#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ASMTL	8623	genome.wustl.edu	37	X	1535433	1535433	+	Intron	SNP	C	C	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chrX:1535433C>T	ENST00000381317.3	-	11	1555				ASMTL_ENST00000534940.1_Intron|ASMTL-AS1_ENST00000419737.2_RNA|ASMTL-AS1_ENST00000602357.1_RNA|ASMTL-AS1_ENST00000425740.2_RNA|ASMTL_ENST00000416733.2_Intron|ASMTL_ENST00000381333.4_Intron	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like							cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ggcacacgcacggacacacaG	0.517																																																0			X																																								1495433	SO:0001627	intron_variant	0			Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1522+1432G>A	X.37:g.1535433C>T		Somatic		Capture	Illumina GAIIx	4	1495433	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Missense_Mutation	SNP	NULL	p.R652H	ENST00000381317.3	37	c.1955	CCDS43917.1	X																																																																																			-	NULL		0.517	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100130224	protein_coding	OTTHUMT00000055595.1	C	NM_004192		1495433	-1	no_start_codon:pseudogene:no_stop_codon	XM_001713700	genbank	human	model	54_36p	missense	SNP	0.000	T
DCP1B	196513	genome.wustl.edu	37	12	2061828	2061828	+	Silent	SNP	C	C	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr12:2061828C>T	ENST00000280665.6	-	7	1357	c.1278G>A	c.(1276-1278)caG>caA	p.Q426Q	DCP1B_ENST00000541700.1_5'Flank|DCP1B_ENST00000397173.4_Silent_p.Q324Q|DCP1B_ENST00000540622.1_Silent_p.Q300Q	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	426				Q -> R (in Ref. 2; BAB71118). {ECO:0000305}.	exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			GGAGTGTGGACTGTTCTCTTC	0.527																																																0			12											177.0	166.0	169.0					12																	2061828		2203	4300	6503	1932089	SO:0001819	synonymous_variant	196513			AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.1278G>A	12.37:g.2061828C>T		Somatic		Capture	Illumina GAIIx	4	1932089	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Silent	SNP	HMMPfam_DCP1,superfamily_PH domain-like	p.Q426	ENST00000280665.6	37	c.1278	CCDS31727.1	12																																																																																			-	NULL		0.527	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCP1B	protein_coding	OTTHUMT00000398244.1	C	NM_152640		1932089	-1	no_errors	NM_152640	genbank	human	validated	54_36p	silent	SNP	0.274	T
OR2D3	120775	genome.wustl.edu	37	11	6943157	6943157	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr11:6943157A>G	ENST00000317834.3	+	1	953	c.925A>G	c.(925-927)Agg>Ggg	p.R309G		NM_001004684.1	NP_001004684.1	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D, member 3	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|prostate(3)|skin(1)|stomach(1)	27		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTATAGCTTGAGGAACAAAGA	0.428																																																0			11											72.0	75.0	74.0					11																	6943157		2201	4296	6497	6899733	SO:0001583	missense	120775			BK004294	CCDS31417.1	11p15.4	2012-08-09			ENSG00000178358	ENSG00000178358		"""GPCR / Class A : Olfactory receptors"""	15146	protein-coding gene	gene with protein product							Standard	NM_001004684		Approved		uc010rav.2	Q8NGH3	OTTHUMG00000165742	ENST00000317834.3:c.925A>G	11.37:g.6943157A>G	ENSP00000320560:p.Arg309Gly	Somatic		Capture	Illumina GAIIx	4	6899733	B2RP06|Q6IFG8|Q96R51	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R309G	ENST00000317834.3	37	c.925	CCDS31417.1	11	.	.	.	.	.	.	.	.	.	.	A	12.53	1.965901	0.34659	.	.	ENSG00000178358	ENST00000317834	T	0.40476	1.03	5.17	2.75	0.32379	.	0.275476	0.25948	N	0.027280	T	0.78767	0.4335	H	0.99859	4.855	0.09310	N	0.999999	P	0.50156	0.932	D	0.70487	0.969	T	0.73452	-0.3978	10	0.87932	D	0	-41.3536	10.7931	0.46445	0.6984:0.3016:0.0:0.0	.	309	Q8NGH3	OR2D3_HUMAN	G	309	ENSP00000320560:R309G	ENSP00000320560:R309G	R	+	1	2	OR2D3	6899733	0.012000	0.17670	0.920000	0.36463	0.344000	0.29017	0.474000	0.22148	0.472000	0.27344	0.533000	0.62120	AGG	-	superfamily_SSF81321		0.428	OR2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2D3	protein_coding	OTTHUMT00000385987.1	A	NM_001004684		6899733	+1	no_errors	NM_001004684	genbank	human	provisional	54_36p	missense	SNP	0.995	G
TP53	7157	genome.wustl.edu	37	17	7577058	7577058	+	Nonsense_Mutation	SNP	C	C	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr17:7577058C>A	ENST00000269305.4	-	8	1069	c.880G>T	c.(880-882)Gag>Tag	p.E294*	TP53_ENST00000420246.2_Nonsense_Mutation_p.E294*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E294*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E294*|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.E294*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	294	Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E294*(46)|p.E294fs*51(9)|p.K291fs*48(8)|p.0?(8)|p.E294K(3)|p.E294fs*12(3)|p.?(2)|p.E294Q(2)|p.L265_K305del41(1)|p.E294>*(1)|p.G293fs*1(1)|p.R290fs*50(1)|p.R290_P295>X(1)|p.E294fs*11(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTGAGGCTCCCCTTTCTTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	87	Substitution - Nonsense(46)|Deletion - Frameshift(20)|Whole gene deletion(8)|Substitution - Missense(5)|Insertion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Complex - deletion inframe(1)|Complex - compound substitution(1)	upper_aerodigestive_tract(17)|lung(14)|large_intestine(10)|breast(7)|urinary_tract(6)|oesophagus(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|bone(4)|stomach(3)|central_nervous_system(2)|skin(2)|salivary_gland(1)|vulva(1)|soft_tissue(1)|endometrium(1)	17											109.0	95.0	100.0					17																	7577058		2203	4300	6503	7517783	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.880G>T	17.37:g.7577058C>A	ENSP00000269305:p.Glu294*	Somatic		Capture	Illumina GAIIx	4	7517783	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.E294*	ENST00000269305.4	37	c.880	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.130179	0.94473	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	4.29	0.51040	.	0.702099	0.13430	N	0.388474	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-17.6918	13.5106	0.61511	0.0:0.8337:0.1663:0.0	.	.	.	.	X	294;294;294;294;294;283;162	.	ENSP00000269305:E294X	E	-	1	0	TP53	7517783	0.019000	0.18553	0.006000	0.13384	0.253000	0.25986	1.700000	0.37815	1.441000	0.47550	0.561000	0.74099	GAG	-	NULL		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7517783	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	0.009	A
Unknown	0	genome.wustl.edu	37	4	9704743	9704743	+	IGR	SNP	A	A	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr4:9704743A>C								AC097493.1 (102692 upstream) : DRD5 (78514 downstream)																							TAATTTCCAAATCAGGAACCA	0.423																																																0			4																																								9313841	SO:0001628	intergenic_variant	644517																															4.37:g.9704743A>C		Somatic		Capture	Illumina GAIIx	4	9313841		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.423					LOC644517			A			9313841	+1	pseudogene	XR_042369	genbank	human	model	54_36p	rna	SNP	0.029	C
ALG1L3P	100132066	genome.wustl.edu	37	4	9705413	9705413	+	IGR	SNP	C	C	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr4:9705413C>T								AC097493.1 (103362 upstream) : DRD5 (77844 downstream)																							GCACCCAGCTCTCATCCCATC	0.547																																																0			4																																								9314511	SO:0001628	intergenic_variant	0																															4.37:g.9705413C>T		Somatic		Capture	Illumina GAIIx	4	9314511		Silent	SNP	HMMPfam_Glycos_transf_1,superfamily_UDP-Glycosyltransferase/glycogen phosphorylase	p.E243		37	c.729		4																																																																																			-	superfamily_UDP-Glycosyltransferase/glycogen phosphorylase	0	0.547					LOC100132066			C			9314511	-1	pseudogene	XM_001720916	genbank	human	model	54_36p	silent	SNP	1.000	T
MYH4	4622	genome.wustl.edu	37	17	10367839	10367839	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr17:10367839C>A	ENST00000255381.2	-	7	708	c.598G>T	c.(598-600)Gca>Tca	p.A200S	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	200	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CCAGTAACTGCAATTGTTGCA	0.408																																																0			17											95.0	91.0	93.0					17																	10367839		2203	4300	6503	10308564	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.598G>T	17.37:g.10367839C>A	ENSP00000255381:p.Ala200Ser	Somatic		Capture	Illumina GAIIx	4	10308564		Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_Myosin_tail_1	p.A200S	ENST00000255381.2	37	c.598	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627886	0.87560	.	.	ENSG00000141048	ENST00000255381	D	0.86769	-2.17	5.12	5.12	0.69794	Myosin head, motor domain (2);	0.000000	0.37136	U	0.002229	D	0.89812	0.6823	L	0.48174	1.505	0.53005	D	0.999968	B	0.15719	0.014	B	0.43413	0.419	D	0.87634	0.2518	10	0.66056	D	0.02	.	18.9057	0.92460	0.0:1.0:0.0:0.0	.	200	Q9Y623	MYH4_HUMAN	S	200	ENSP00000255381:A200S	ENSP00000255381:A200S	A	-	1	0	MYH4	10308564	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.781000	0.62389	2.527000	0.85204	0.650000	0.86243	GCA	-	superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head		0.408	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	protein_coding	OTTHUMT00000252731.1	C	NM_017533		10308564	-1	no_errors	NM_017533	genbank	human	validated	54_36p	missense	SNP	1.000	A
ARHGAP6	395	genome.wustl.edu	37	X	11160360	11160360	+	Silent	SNP	T	T	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chrX:11160360T>A	ENST00000337414.4	-	12	3122	c.2250A>T	c.(2248-2250)ggA>ggT	p.G750G	ARHGAP6_ENST00000380736.1_Silent_p.G547G|ARHGAP6_ENST00000303025.6_Silent_p.G547G|ARHGAP6_ENST00000534860.1_Silent_p.G575G	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	750					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CACCTGTCATTCCTGGGTCTT	0.313																																																0			X											105.0	101.0	102.0					X																	11160360		2203	4300	6503	11070281	SO:0001819	synonymous_variant	395			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.2250A>T	X.37:g.11160360T>A		Somatic		Capture	Illumina GAIIx	4	11070281	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Silent	SNP	superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.G750	ENST00000337414.4	37	c.2250	CCDS14140.1	X																																																																																			-	NULL		0.313	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	protein_coding	OTTHUMT00000055760.2	T	NM_013427		11070281	-1	no_errors	NM_013427	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
LRP6	4040	genome.wustl.edu	37	12	12397428	12397428	+	Nonsense_Mutation	SNP	C	C	A	rs201813872		TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr12:12397428C>A	ENST00000261349.4	-	2	293	c.217G>T	c.(217-219)Gaa>Taa	p.E73*	LRP6_ENST00000543091.1_Nonsense_Mutation_p.E73*	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	73	Beta-propeller 1.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TTAATGGCTTCTTCGCTGACA	0.453																																																0			12											116.0	99.0	105.0					12																	12397428		2203	4300	6503	12288695	SO:0001587	stop_gained	4040			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.217G>T	12.37:g.12397428C>A	ENSP00000261349:p.Glu73*	Somatic		Capture	Illumina GAIIx	4	12288695	Q17RZ2	Nonsense_Mutation	SNP	superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_2,superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1	p.E73*	ENST00000261349.4	37	c.217	CCDS8647.1	12	.	.	.	.	.	.	.	.	.	.	C	38	6.790901	0.97841	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	.	.	.	5.04	5.04	0.67666	.	0.000000	0.53938	U	0.000052	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	18.59	0.91206	0.0:1.0:0.0:0.0	.	.	.	.	X	73	.	ENSP00000261349:E73X	E	-	1	0	LRP6	12288695	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.651000	0.83577	2.627000	0.88993	0.460000	0.39030	GAA	-	superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b		0.453	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP6	protein_coding	OTTHUMT00000400137.1	C			12288695	-1	no_errors	NM_002336	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
PODNL1	79883	genome.wustl.edu	37	19	14045201	14045201	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr19:14045201G>T	ENST00000339560.5	-	6	811	c.538C>A	c.(538-540)Cag>Aag	p.Q180K	PODNL1_ENST00000538371.2_Missense_Mutation_p.Q178K|PODNL1_ENST00000254320.3_Missense_Mutation_p.Q98K|PODNL1_ENST00000538517.2_Intron	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	180	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			TTGCTCAGCTGGTTGTTGTGG	0.692																																																0			19											22.0	21.0	22.0					19																	14045201		2181	4276	6457	13906201	SO:0001583	missense	79883			AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.538C>A	19.37:g.14045201G>T	ENSP00000345175:p.Gln180Lys	Somatic		Capture	Illumina GAIIx	4	13906201	B7Z564|Q9H5G9	Missense_Mutation	SNP	superfamily_RNI-like,HMMSmart_SM00364,HMMPfam_LRR_1,HMMSmart_SM00369,HMMSmart_SM00365,superfamily_L domain-like	p.Q180K	ENST00000339560.5	37	c.538	CCDS12300.1	19	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635217	0.29068	.	.	ENSG00000132000	ENST00000538371;ENST00000339560;ENST00000254320	T;T;T	0.23754	1.89;5.55;1.89	5.05	3.99	0.46301	.	0.378830	0.19415	N	0.114851	T	0.12008	0.0292	N	0.10809	0.05	0.22521	N	0.999029	B;B;B	0.29988	0.264;0.215;0.004	B;B;B	0.29353	0.052;0.101;0.003	T	0.22452	-1.0216	10	0.06236	T	0.91	.	11.9432	0.52913	0.0:0.0:0.8189:0.1811	.	178;98;180	F5H7F9;B7Z3M0;Q6PEZ8	.;.;PONL1_HUMAN	K	178;180;98	ENSP00000442553:Q178K;ENSP00000345175:Q180K;ENSP00000254320:Q98K	ENSP00000254320:Q98K	Q	-	1	0	PODNL1	13906201	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.269000	0.33074	1.185000	0.42971	0.585000	0.79938	CAG	-	superfamily_RNI-like,HMMSmart_SM00369,HMMPfam_LRR_1		0.692	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	PODNL1	protein_coding	OTTHUMT00000457967.1	G	NM_024825		13906201	-1	no_errors	NM_024825	genbank	human	provisional	54_36p	missense	SNP	1.000	T
COPB1	1315	genome.wustl.edu	37	11	14515232	14515232	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr11:14515232G>C	ENST00000249923.3	-	4	747	c.447C>G	c.(445-447)agC>agG	p.S149R	COPB1_ENST00000439561.2_Missense_Mutation_p.S149R	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	149					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TTCTAACATAGCTGTGTCGAT	0.378																																																0			11											143.0	134.0	137.0					11																	14515232		2200	4294	6494	14471808	SO:0001583	missense	1315			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.447C>G	11.37:g.14515232G>C	ENSP00000249923:p.Ser149Arg	Somatic		Capture	Illumina GAIIx	4	14471808	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	HMMPfam_Adaptin_N,superfamily_ARM-type_fold,HMMPfam_Coatamer_beta_C	p.S149R	ENST00000249923.3	37	c.447	CCDS7815.1	11	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192487	0.78902	.	.	ENSG00000129083	ENST00000249923;ENST00000439561;ENST00000534234	T;T;T	0.29397	1.57;1.57;1.57	5.3	5.3	0.74995	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64649	0.2617	M	0.91920	3.255	0.80722	D	1	D	0.67145	0.996	D	0.65573	0.936	T	0.73196	-0.4059	10	0.72032	D	0.01	.	19.3218	0.94245	0.0:0.0:1.0:0.0	.	149	P53618	COPB_HUMAN	R	149	ENSP00000249923:S149R;ENSP00000397873:S149R;ENSP00000436383:S149R	ENSP00000249923:S149R	S	-	3	2	COPB1	14471808	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.217000	0.65252	2.647000	0.89833	0.455000	0.32223	AGC	-	HMMPfam_Adaptin_N,superfamily_ARM-type_fold		0.378	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB1	protein_coding	OTTHUMT00000386410.1	G	NM_016451		14471808	-1	no_errors	NM_016451	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CROCC	9696	genome.wustl.edu	37	1	17274958	17274958	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr1:17274958G>C	ENST00000375541.5	+	18	2716	c.2647G>C	c.(2647-2649)Gtg>Ctg	p.V883L	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TGGCCTGGCTGTGCAGCTGGT	0.721																																																0			1											11.0	11.0	11.0					1																	17274958		2135	4189	6324	17147545	SO:0001583	missense	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2647G>C	1.37:g.17274958G>C	ENSP00000364691:p.Val883Leu	Somatic		Capture	Illumina GAIIx	4	17147545		Missense_Mutation	SNP	superfamily_Prefoldin	p.V883L	ENST00000375541.5	37	c.2647	CCDS30616.1	1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388525	0.61956	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.29397	1.57	4.21	4.21	0.49690	.	.	.	.	.	T	0.53142	0.1778	M	0.80616	2.505	0.50313	D	0.999867	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	T	0.53373	-0.8448	9	0.11794	T	0.64	.	14.9241	0.70862	0.0:0.0:1.0:0.0	.	186;883	Q5TZA2-2;Q5TZA2	.;CROCC_HUMAN	L	883;764	ENSP00000364691:V883L	ENSP00000364691:V883L	V	+	1	0	CROCC	17147545	1.000000	0.71417	0.934000	0.37439	0.583000	0.36354	8.941000	0.92964	2.300000	0.77407	0.449000	0.29647	GTG	-	NULL		0.721	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	protein_coding	OTTHUMT00000006249.2	G	NM_014675		17147545	+1	no_errors	NM_014675	genbank	human	validated	54_36p	missense	SNP	0.996	C
KLHL22	84861	genome.wustl.edu	37	22	20819202	20819202	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr22:20819202T>A	ENST00000328879.4	-	4	1211	c.1055A>T	c.(1054-1056)tAc>tTc	p.Y352F	KLHL22_ENST00000440659.2_Missense_Mutation_p.Y209F	NM_032775.3	NP_116164.2	Q53GT1	KLH22_HUMAN	kelch-like family member 22	352				Y -> H (in Ref. 3; BAD96570). {ECO:0000305}.	cell division (GO:0051301)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein monoubiquitination (GO:0006513)	centrosome (GO:0005813)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|polar microtubule (GO:0005827)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	20	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TCCAATCAAGTATACGAAGTT	0.542																																																0			22											100.0	90.0	93.0					22																	20819202		2203	4300	6503	19149202	SO:0001583	missense	84861				CCDS13780.1	22q11.21	2013-01-30	2013-01-30		ENSG00000099910	ENSG00000099910		"""Kelch-like"", ""BTB/POZ domain containing"""	25888	protein-coding gene	gene with protein product			"""kelch-like 22 (Drosophila)"""			12477932	Standard	NM_032775		Approved	FLJ14360, KELCHL	uc002zsl.2	Q53GT1	OTTHUMG00000150778	ENST00000328879.4:c.1055A>T	22.37:g.20819202T>A	ENSP00000331682:p.Tyr352Phe	Somatic		Capture	Illumina GAIIx	4	19149202	A8K3Q4|A8MTV3|B7Z2G1|D3DX30|Q96B68|Q96KC6	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,HMMPfam_BACK,superfamily_Galactose oxidase central domain,HMMSmart_SM00612,HMMPfam_Kelch_1	p.Y352F	ENST00000328879.4	37	c.1055	CCDS13780.1	22	.	.	.	.	.	.	.	.	.	.	T	14.65	2.597879	0.46318	.	.	ENSG00000099910	ENST00000328879;ENST00000440659	T;T	0.73575	-0.76;-0.76	5.42	4.32	0.51571	Kelch-type beta propeller (1);	0.059231	0.64402	D	0.000001	T	0.65004	0.2650	L	0.41079	1.255	0.51233	D	0.999915	B;B	0.28998	0.23;0.051	B;B	0.31812	0.136;0.048	T	0.64647	-0.6358	10	0.44086	T	0.13	.	9.4579	0.38767	0.1588:0.0:0.0:0.8412	.	209;352	B7Z2G1;Q53GT1	.;KLH22_HUMAN	F	352;209	ENSP00000331682:Y352F;ENSP00000405521:Y209F	ENSP00000331682:Y352F	Y	-	2	0	KLHL22	19149202	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.674000	0.61612	2.046000	0.60703	0.533000	0.62120	TAC	-	superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612		0.542	KLHL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL22	protein_coding	OTTHUMT00000320045.2	T	NM_032775		19149202	-1	no_errors	NM_032775	genbank	human	validated	54_36p	missense	SNP	1.000	A
SLC47A1	55244	genome.wustl.edu	37	17	19454777	19454777	+	Missense_Mutation	SNP	A	A	T	rs139970097		TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr17:19454777A>T	ENST00000270570.4	+	6	625	c.539A>T	c.(538-540)aAc>aTc	p.N180I	SLC47A1_ENST00000436810.2_Missense_Mutation_p.N157I|SLC47A1_ENST00000542886.1_Missense_Mutation_p.N180I|SLC47A1_ENST00000575023.1_Intron|SLC47A1_ENST00000584348.1_3'UTR|SLC47A1_ENST00000571335.1_Missense_Mutation_p.T32S|SLC47A1_ENST00000395585.1_Missense_Mutation_p.N180I|SLC47A1_ENST00000457293.1_Missense_Mutation_p.N180I	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	180					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	TATTTGCTCAACCAGGTAATA	0.443																																																0			17											156.0	145.0	149.0					17																	19454777		2203	4300	6503	19395369	SO:0001583	missense	55244				CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.539A>T	17.37:g.19454777A>T	ENSP00000270570:p.Asn180Ile	Somatic		Capture	Illumina GAIIx	4	19395369	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	HMMPfam_MatE	p.N180I	ENST00000270570.4	37	c.539	CCDS11209.1	17	.	.	.	.	.	.	.	.	.	.	A	18.39	3.613506	0.66672	.	.	ENSG00000142494	ENST00000436810;ENST00000270570;ENST00000457293;ENST00000542886;ENST00000395585	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.15	4.05	0.47172	.	0.041420	0.85682	D	0.000000	T	0.55970	0.1954	M	0.89287	3.02	0.44207	D	0.997034	D;P;D	0.67145	0.996;0.954;0.961	D;D;P	0.72338	0.977;0.934;0.706	T	0.57808	-0.7747	10	0.72032	D	0.01	-11.8508	6.547	0.22412	0.7584:0.1585:0.0831:0.0	.	157;180;180	E7EX57;Q96FL8;Q96FL8-3	.;S47A1_HUMAN;.	I	157;180;180;180;180	ENSP00000407155:N157I;ENSP00000270570:N180I;ENSP00000415586:N180I;ENSP00000378951:N180I	ENSP00000270570:N180I	N	+	2	0	SLC47A1	19395369	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.095000	0.30964	0.777000	0.33496	0.459000	0.35465	AAC	-	HMMPfam_MatE		0.443	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC47A1	protein_coding	OTTHUMT00000132250.1	A	NM_018242		19395369	+1	no_errors	NM_018242	genbank	human	validated	54_36p	missense	SNP	1.000	T
PLK1	5347	genome.wustl.edu	37	16	23700856	23700856	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr16:23700856C>G	ENST00000300093.4	+	9	1578	c.1467C>G	c.(1465-1467)caC>caG	p.H489Q	CTD-2196E14.5_ENST00000566143.1_RNA	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	489					activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		TGAGCGAGCACTTGCTGAAGG	0.562																																					Colon(12;240 564 27038 33155)											0			16											57.0	58.0	58.0					16																	23700856		2197	4300	6497	23608357	SO:0001583	missense	5347				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.1467C>G	16.37:g.23700856C>G	ENSP00000300093:p.His489Gln	Somatic		Capture	Illumina GAIIx	4	23608357	Q15153|Q99746	Missense_Mutation	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,superfamily_SSF82615,HMMPfam_POLO_box	p.H489Q	ENST00000300093.4	37	c.1467	CCDS10616.1	16	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150411	0.37923	.	.	ENSG00000166851	ENST00000300093;ENST00000425844	T	0.15256	2.44	5.45	3.46	0.39613	.	0.000000	0.85682	D	0.000000	T	0.44705	0.1306	M	0.86420	2.815	0.80722	D	1	D	0.69078	0.997	D	0.67382	0.951	T	0.52902	-0.8513	10	0.87932	D	0	-32.9103	13.4089	0.60931	0.0:0.8497:0.0:0.1503	.	489	P53350	PLK1_HUMAN	Q	489;392	ENSP00000300093:H489Q	ENSP00000300093:H489Q	H	+	3	2	PLK1	23608357	1.000000	0.71417	0.513000	0.27749	0.167000	0.22549	2.896000	0.48656	0.691000	0.31592	-1.151000	0.01829	CAC	-	superfamily_SSF82615		0.562	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK1	protein_coding	OTTHUMT00000214057.2	C	NM_005030		23608357	+1	no_errors	NM_005030	genbank	human	provisional	54_36p	missense	SNP	0.997	G
UNC119	9094	genome.wustl.edu	37	17	26875116	26875116	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr17:26875116C>A	ENST00000335765.4	-	3	448	c.338G>T	c.(337-339)cGg>cTg	p.R113L	UNC119_ENST00000470125.1_Missense_Mutation_p.R18L|UNC119_ENST00000301032.4_Missense_Mutation_p.R113L|UNC119_ENST00000484980.1_Missense_Mutation_p.R18L	NM_005148.3	NP_005139.1	Q13432	U119A_HUMAN	unc-119 homolog (C. elegans)	113					cytokinesis, completion of separation (GO:0007109)|endocytosis (GO:0006897)|lipoprotein transport (GO:0042953)|negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of clathrin-mediated endocytosis (GO:1900186)|phototransduction (GO:0007602)|positive regulation of protein tyrosine kinase activity (GO:0061098)|synaptic transmission (GO:0007268)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	lipid binding (GO:0008289)			breast(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	7	Lung NSC(42;0.00431)					GATGGGCAACCGTTCTGCAAT	0.612											OREG0024277	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			17											29.0	28.0	28.0					17																	26875116		2203	4300	6503	23899243	SO:0001583	missense	9094			U40998	CCDS11233.1, CCDS11234.1	17q11.2	2014-09-17	2001-11-28		ENSG00000109103	ENSG00000109103			12565	protein-coding gene	gene with protein product	"""POC7 centriolar protein homolog A (Chlamydomonas)"""	604011	"""unc119 (C.elegans) homolog"""			8576185, 9538874	Standard	NM_005148		Approved	HRG4, POC7, POC7A	uc002hbk.2	Q13432	OTTHUMG00000132606	ENST00000335765.4:c.338G>T	17.37:g.26875116C>A	ENSP00000337040:p.Arg113Leu	Somatic	790	Capture	Illumina GAIIx	4	23899243	A8K8G4|F1T095|O95126	Missense_Mutation	SNP	superfamily_E set domains,HMMPfam_GMP_PDE_delta	p.R113L	ENST00000335765.4	37	c.338	CCDS11233.1	17	.	.	.	.	.	.	.	.	.	.	C	16.44	3.124508	0.56613	.	.	ENSG00000109103	ENST00000335765;ENST00000301032;ENST00000444148	T;T;T	0.77358	-1.07;-1.09;-1.09	5.81	5.81	0.92471	Immunoglobulin E-set (1);	0.388228	0.30076	N	0.010461	T	0.76371	0.3978	L	0.38531	1.155	0.58432	D	0.999999	P;B	0.46220	0.874;0.005	P;B	0.48304	0.573;0.017	T	0.72500	-0.4274	10	0.26408	T	0.33	-18.9581	18.2592	0.90028	0.0:1.0:0.0:0.0	.	113;113	F1T095;Q13432	.;U119A_HUMAN	L	113;113;106	ENSP00000337040:R113L;ENSP00000301032:R113L;ENSP00000414639:R106L	ENSP00000301032:R113L	R	-	2	0	UNC119	23899243	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.734000	0.55037	2.757000	0.94681	0.462000	0.41574	CGG	-	superfamily_E set domains,HMMPfam_GMP_PDE_delta		0.612	UNC119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC119	protein_coding	OTTHUMT00000255842.2	C			23899243	-1	no_errors	NM_005148	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZKSCAN2	342357	genome.wustl.edu	37	16	25264268	25264268	+	Splice_Site	SNP	T	T	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr16:25264268T>C	ENST00000328086.7	-	3	1480	c.677A>G	c.(676-678)cAg>cGg	p.Q226R		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	226					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		ACAATGTACCTGGGACCCAGC	0.507																																																0			16											146.0	144.0	144.0					16																	25264268		2197	4300	6497	25171769	SO:0001630	splice_region_variant	342357			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.678+1A>G	16.37:g.25264268T>C		Somatic		Capture	Illumina GAIIx	4	25171769	A1L3B4|Q6ZN77	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.Q226R	ENST00000328086.7	37	c.677	CCDS32410.1	16	.	.	.	.	.	.	.	.	.	.	T	14.27	2.484683	0.44147	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	T	0.00995	5.46	5.99	5.99	0.97316	Krueppel-associated box (1);	0.142496	0.32769	N	0.005675	T	0.05640	0.0148	M	0.80028	2.48	0.37922	D	0.931716	D;D	0.71674	0.998;0.993	D;D	0.72982	0.953;0.979	T	0.04053	-1.0981	10	0.87932	D	0	-20.1764	12.8861	0.58045	0.0:0.0:0.0:1.0	.	226;226	Q63HK3-2;Q63HK3	.;ZKSC2_HUMAN	R	226	ENSP00000331626:Q226R	ENSP00000331626:Q226R	Q	-	2	0	ZKSCAN2	25171769	1.000000	0.71417	0.998000	0.56505	0.306000	0.27790	3.562000	0.53777	2.291000	0.77112	0.533000	0.62120	CAG	-	superfamily_KRAB domain (Kruppel-associated box Pfam 01352)		0.507	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN2	protein_coding	OTTHUMT00000435739.1	T	NM_001012981	Missense_Mutation	25171769	-1	no_errors	NM_001012981	genbank	human	validated	54_36p	missense	SNP	0.993	C
PDCD6IPP2	646278	genome.wustl.edu	37	15	29052085	29052085	+	RNA	SNP	G	G	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr15:29052085G>T	ENST00000562423.1	+	0	568																											TCCTTTTAAAGTCATTAAGGT	0.318																																																0			15																																								26851126			646278																															15.37:g.29052085G>T		Somatic		Capture	Illumina GAIIx	4	26851126		Splice_Site	SNP	-	NULL	ENST00000562423.1	37	c.NULL		15																																																																																			-	-		0.318	RP11-578F21.12-004	PUTATIVE	basic	processed_transcript	LOC646278	pseudogene	OTTHUMT00000431789.1	G			26851126	+1	pseudogene	XR_042308	genbank	human	model	54_36p	splice_site	SNP	0.997	T
HOXA1	3198	genome.wustl.edu	37	7	27135101	27135101	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr7:27135101T>A	ENST00000343060.4	-	1	492	c.431A>T	c.(430-432)cAc>cTc	p.H144L	HOTAIRM1_ENST00000495032.1_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOXA1_ENST00000355633.5_Intron|HOTAIRM1_ENST00000425358.2_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	144	Poly-His.				abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CTGGTGGTGGTGGTGATGCTG	0.562																																																0			7											67.0	69.0	68.0					7																	27135101		2203	4300	6503	27101626	SO:0001583	missense	3198				CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.431A>T	7.37:g.27135101T>A	ENSP00000343246:p.His144Leu	Somatic		Capture	Illumina GAIIx	4	27101626	A4D184|B2R8U7|O43363	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.H144L	ENST00000343060.4	37	c.431	CCDS5401.1	7	.	.	.	.	.	.	.	.	.	.	T	8.859	0.946373	0.18356	.	.	ENSG00000105991	ENST00000343060	T	0.28666	1.6	4.88	4.88	0.63580	.	0.222920	0.37906	N	0.001887	T	0.36580	0.0972	L	0.40543	1.245	0.80722	D	1	P	0.50156	0.932	P	0.58520	0.84	T	0.07539	-1.0767	10	0.07990	T	0.79	.	12.4806	0.55839	0.0:0.0:0.0:1.0	.	144	P49639	HXA1_HUMAN	L	144	ENSP00000343246:H144L	ENSP00000343246:H144L	H	-	2	0	HOXA1	27101626	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.216000	0.42871	2.056000	0.61249	0.379000	0.24179	CAC	-	NULL		0.562	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HOXA1	protein_coding	OTTHUMT00000358454.1	T			27101626	-1	no_errors	NM_005522	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CAD	790	genome.wustl.edu	37	2	27465202	27465202	+	Silent	SNP	C	C	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr2:27465202C>T	ENST00000403525.1	+	39	6084	c.5940C>T	c.(5938-5940)atC>atT	p.I1980I	CAD_ENST00000264705.4_Silent_p.I2043I			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCCAGTGATCAATGCTGGGG	0.607																																																0			2											33.0	35.0	35.0					2																	27465202		2203	4300	6503	27318706	SO:0001819	synonymous_variant	790			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.5940C>T	2.37:g.27465202C>T		Somatic		Capture	Illumina GAIIx	4	27318706	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Silent	SNP	superfamily_CP_synthsmall,HMMPfam_CPSase_sm_chain,superfamily_SSF52317,HMMPfam_GATase,superfamily_PreATP-grasp-like,HMMPfam_CPSase_L_chain,HMMPfam_CPSase_L_D2,superfamily_SSF56059,PatternScan_CPSASE_1,PatternScan_CPSASE_2,superfamily_CarbamoylP_synth_lsu_oligo,HMMPfam_CPSase_L_D3,superfamily_SSF52335,HMMPfam_MGS,HMMPfam_Amidohydro_1,superfamily_SSF51556,PatternScan_DIHYDROOROTASE_1,PatternScan_DIHYDROOROTASE_2,superfamily_Metalo_hydrolase,superfamily_Asp/Orn_carbamoyltranf,HMMPfam_OTCace_N,PatternScan_CARBAMOYLTRANSFERASE,HMMPfam_OTCace	p.I2043	ENST00000403525.1	37	c.6129		2	.	.	.	.	.	.	.	.	.	.	C	9.990	1.230679	0.22542	.	.	ENSG00000084774	ENST00000428460	.	.	.	4.88	3.97	0.46021	.	.	.	.	.	T	0.62159	0.2405	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59402	-0.7461	4	.	.	.	-5.0256	11.1056	0.48201	0.336:0.664:0.0:0.0	.	.	.	.	L	79	.	.	S	+	2	0	CAD	27318706	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	1.295000	0.33377	0.993000	0.38866	0.491000	0.48974	TCA	-	superfamily_Asp/Orn_carbamoyltranf,HMMPfam_OTCace_N		0.607	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	protein_coding	OTTHUMT00000324970.1	C			27318706	+1	no_errors	NM_004341	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
PPFIBP1	8496	genome.wustl.edu	37	12	27807738	27807738	+	Silent	SNP	A	A	G			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr12:27807738A>G	ENST00000318304.8	+	8	970	c.687A>G	c.(685-687)aaA>aaG	p.K229K	PPFIBP1_ENST00000228425.6_Silent_p.K229K|PPFIBP1_ENST00000537927.1_Silent_p.K76K|PPFIBP1_ENST00000542629.1_Silent_p.K229K	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	229					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)			PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					AAAAGCTTAAATCAACCAAAG	0.323																																																0			12											69.0	67.0	68.0					12																	27807738		2203	4299	6502	27699005	SO:0001819	synonymous_variant	8496			AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.687A>G	12.37:g.27807738A>G		Somatic		Capture	Illumina GAIIx	4	27699005	O75336|Q86X70|Q9NY03|Q9ULJ0	Silent	SNP	HMMPfam_Integrase_DNA,superfamily_SAM_homology,HMMSmart_SAM,HMMPfam_SAM_1,HMMPfam_SAM_2	p.K229	ENST00000318304.8	37	c.687	CCDS55812.1	12																																																																																			-	HMMPfam_Integrase_DNA		0.323	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	PPFIBP1	protein_coding	OTTHUMT00000402877.1	A	NM_003622		27699005	+1	no_errors	NM_003622	genbank	human	reviewed	54_36p	silent	SNP	0.994	G
SKIV2L	6499	genome.wustl.edu	37	6	31928034	31928034	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr6:31928034G>T	ENST00000375394.2	+	4	387	c.274G>T	c.(274-276)Gct>Tct	p.A92S	SKIV2L_ENST00000544581.1_Intron|NELFE_ENST00000444811.2_5'Flank|SKIV2L_ENST00000488648.1_3'UTR|NELFE_ENST00000375425.5_5'Flank|NELFE_ENST00000375429.3_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	92					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						GTCTCTTTTGGCTGTCCTGGG	0.522																																																0			6											144.0	177.0	165.0					6																	31928034		1511	2709	4220	32036013	SO:0001583	missense	6499				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.274G>T	6.37:g.31928034G>T	ENSP00000364543:p.Ala92Ser	Somatic		Capture	Illumina GAIIx	4	32036013	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_DEAD,HMMSmart_HELICc,HMMPfam_Helicase_C,HMMPfam_DSHCT	p.A92S	ENST00000375394.2	37	c.274	CCDS4731.1	6	.	.	.	.	.	.	.	.	.	.	G	0.105	-1.145878	0.01714	.	.	ENSG00000204351	ENST00000375394	T	0.41065	1.01	4.61	-0.44	0.12261	.	0.896569	0.09693	N	0.768046	T	0.05364	0.0142	N	0.11427	0.14	0.20074	N	0.999935	B	0.06786	0.001	B	0.09377	0.004	T	0.39663	-0.9603	10	0.11182	T	0.66	-0.9941	3.5588	0.07874	0.3193:0.0:0.3882:0.2926	.	92	Q15477	SKIV2_HUMAN	S	92	ENSP00000364543:A92S	ENSP00000364543:A92S	A	+	1	0	SKIV2L	32036013	0.044000	0.20184	0.032000	0.17829	0.181000	0.23173	0.252000	0.18278	-0.313000	0.08728	0.655000	0.94253	GCT	-	NULL		0.522	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L	protein_coding	OTTHUMT00000076264.3	G			32036013	+1	no_errors	NM_006929	genbank	human	reviewed	54_36p	missense	SNP	0.039	T
ADAMTS12	81792	genome.wustl.edu	37	5	33577049	33577049	+	Missense_Mutation	SNP	T	T	C	rs200132406		TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr5:33577049T>C	ENST00000504830.1	-	19	3417	c.3082A>G	c.(3082-3084)Agg>Ggg	p.R1028G	ADAMTS12_ENST00000504582.1_5'Flank|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.R943G	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1028	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						ATTCTGGGCCTGGATGTAGGT	0.527										HNSCC(64;0.19)			T|||	1	0.000199681	0.0	0.0	5008	,	,		21571	0.001		0.0	False		,,,				2504	0.0															0			5											141.0	134.0	137.0					5																	33577049		2203	4300	6503	33612806	SO:0001583	missense	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3082A>G	5.37:g.33577049T>C	ENSP00000422554:p.Arg1028Gly	Somatic		Capture	Illumina GAIIx	4	33612806	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1"	p.R1028G	ENST00000504830.1	37	c.3082	CCDS34140.1	5	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	T	0.686	-0.796495	0.02862	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.59502	0.27;0.26	5.3	-1.38	0.09027	.	0.881988	0.10529	N	0.664033	T	0.35770	0.0943	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.17349	-1.0372	10	0.22706	T	0.39	.	5.5417	0.17041	0.0:0.2868:0.1346:0.5786	.	943;1028	P58397-3;P58397	.;ATS12_HUMAN	G	1028;943	ENSP00000422554:R1028G;ENSP00000344847:R943G	ENSP00000344847:R943G	R	-	1	2	ADAMTS12	33612806	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.293000	0.19029	-0.357000	0.08175	-0.899000	0.02877	AGG	-	NULL		0.527	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	protein_coding	OTTHUMT00000367164.2	T	NM_030955		33612806	-1	no_errors	NM_030955	genbank	human	reviewed	54_36p	missense	SNP	0.001	C
SLC1A3	6507	genome.wustl.edu	37	5	36629575	36629575	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr5:36629575C>T	ENST00000265113.4	+	3	681	c.205C>T	c.(205-207)Cga>Tga	p.R69*	SLC1A3_ENST00000381918.3_Nonsense_Mutation_p.R69*	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	69					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATTTACCCTCCGACCATACAG	0.393																																																0			5											145.0	130.0	135.0					5																	36629575		2203	4300	6503	36665332	SO:0001587	stop_gained	6507				CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.205C>T	5.37:g.36629575C>T	ENSP00000265113:p.Arg69*	Somatic		Capture	Illumina GAIIx	4	36665332	B2R5T3|Q4JCQ8	Nonsense_Mutation	SNP	HMMPfam_SDF,PatternScan_NA_DICARBOXYL_SYMP_1,PatternScan_NA_DICARBOXYL_SYMP_2	p.R69*	ENST00000265113.4	37	c.205	CCDS3919.1	5	.	.	.	.	.	.	.	.	.	.	C	39	7.424625	0.98275	.	.	ENSG00000079215	ENST00000265113;ENST00000513903;ENST00000505202;ENST00000513646;ENST00000381918	.	.	.	5.95	4.1	0.47936	.	0.064020	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.4246	15.1983	0.73112	0.2571:0.7429:0.0:0.0	.	.	.	.	X	69	.	ENSP00000265113:R69X	R	+	1	2	SLC1A3	36665332	0.998000	0.40836	0.986000	0.45419	0.991000	0.79684	2.143000	0.42187	0.771000	0.33359	0.655000	0.94253	CGA	-	HMMPfam_SDF		0.393	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC1A3	protein_coding	OTTHUMT00000207579.2	C	NM_004172		36665332	+1	no_errors	NM_004172	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
JUP	3728	genome.wustl.edu	37	17	39915076	39915076	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr17:39915076T>G	ENST00000393931.3	-	9	1662	c.1544A>C	c.(1543-1545)cAt>cCt	p.H515P	JUP_ENST00000540235.1_Intron|JUP_ENST00000393930.1_Missense_Mutation_p.H515P|JUP_ENST00000310706.5_Missense_Mutation_p.H515P	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	515					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		CAGCGGGGCATGGTTGGCTGG	0.622																																					Colon(16;42 520 6044 17852 28530)											0			17											28.0	28.0	28.0					17																	39915076		2202	4300	6502	37168602	SO:0001583	missense	3728			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.1544A>C	17.37:g.39915076T>G	ENSP00000377508:p.His515Pro	Somatic		Capture	Illumina GAIIx	4	37168602	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMSmart_ARM,HMMPfam_HEAT,HMMPfam_Arm	p.H515P	ENST00000393931.3	37	c.1544	CCDS11407.1	17	.	.	.	.	.	.	.	.	.	.	t	20.5	3.996402	0.74818	.	.	ENSG00000173801	ENST00000393930;ENST00000310706;ENST00000393931	T;T;T	0.64803	-0.12;-0.12;-0.12	5.12	3.99	0.46301	Armadillo-like helical (1);Armadillo-type fold (1);	0.050166	0.85682	D	0.000000	T	0.70979	0.3286	M	0.62088	1.915	0.80722	D	1	P	0.35363	0.497	P	0.51355	0.667	T	0.74093	-0.3776	10	0.66056	D	0.02	-20.2124	11.5685	0.50820	0.0:0.0:0.1485:0.8515	.	515	P14923	PLAK_HUMAN	P	515	ENSP00000377507:H515P;ENSP00000311113:H515P;ENSP00000377508:H515P	ENSP00000311113:H515P	H	-	2	0	JUP	37168602	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	7.695000	0.84257	2.151000	0.67156	0.454000	0.30748	CAT	-	superfamily_ARM-type_fold,HMMSmart_ARM		0.622	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	protein_coding	OTTHUMT00000257406.1	T			37168602	-1	no_errors	NM_002230	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
EGFLAM	133584	genome.wustl.edu	37	5	38337712	38337712	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr5:38337712G>C	ENST00000354891.3	+	2	534	c.188G>C	c.(187-189)aGt>aCt	p.S63T	EGFLAM_ENST00000322350.5_Missense_Mutation_p.S63T	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	63	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CATCCTGGAAGTCCCATCCTT	0.522																																					Colon(62;485 1295 3347 17454)											0			5											93.0	68.0	76.0					5																	38337712		2203	4299	6502	38373469	SO:0001583	missense	133584			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.188G>C	5.37:g.38337712G>C	ENSP00000346964:p.Ser63Thr	Somatic		Capture	Illumina GAIIx	4	38373469	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3,HMMSmart_EGF,superfamily_ConA_like_lec_gl,PatternScan_EGF_1,HMMSmart_LamG,HMMPfam_Laminin_G_1,HMMPfam_EGF,PatternScan_EGF_2,HMMPfam_Laminin_G_2	p.S63T	ENST00000354891.3	37	c.188	CCDS56363.1	5	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974212	0.34848	.	.	ENSG00000164318	ENST00000354891;ENST00000322350	T;T	0.55413	0.52;0.52	5.71	1.7	0.24286	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.090770	0.85682	D	0.000000	T	0.54191	0.1843	M	0.71036	2.16	0.09310	N	0.999999	P;P	0.42161	0.772;0.554	P;B	0.45660	0.489;0.282	T	0.50030	-0.8875	10	0.56958	D	0.05	-5.8552	9.3701	0.38248	0.3214:0.0:0.6786:0.0	.	63;63	Q63HQ2;Q63HQ2-2	EGFLA_HUMAN;.	T	63	ENSP00000346964:S63T;ENSP00000313084:S63T	ENSP00000313084:S63T	S	+	2	0	EGFLAM	38373469	0.200000	0.23398	0.003000	0.11579	0.457000	0.32468	1.567000	0.36407	0.660000	0.30964	0.655000	0.94253	AGT	-	superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3		0.522	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	protein_coding	OTTHUMT00000367323.1	G	NM_152403		38373469	+1	no_errors	NM_152403	genbank	human	validated	54_36p	missense	SNP	0.003	C
Unknown	0	genome.wustl.edu	37	22	41470531	41470531	+	IGR	SNP	C	C	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr22:41470531C>A								Y_RNA (8881 upstream) : EP300 (17258 downstream)																							GGCAGTGGAACCGCTCGTTGC	0.582																																																0			22																																								39800477	SO:0001628	intergenic_variant	391334																															22.37:g.41470531C>A		Somatic		Capture	Illumina GAIIx	4	39800477		RNA	SNP	-	NULL		37	NULL		22																																																																																			-	-	0	0.582					LOC391334			C			39800477	-1	pseudogene	XR_017601	genbank	human	model	54_36p	rna	SNP	1.000	A
C1QL1	10882	genome.wustl.edu	37	17	43037583	43037583	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr17:43037583G>C	ENST00000253407.3	-	2	772	c.750C>G	c.(748-750)ttC>ttG	p.F250L		NM_006688.3	NP_006679.1	O75973	C1QRF_HUMAN	complement component 1, q subcomponent-like 1	250	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				locomotory behavior (GO:0007626)	collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)				lung(1)|prostate(1)	2		Prostate(33;0.155)				TGAAGCCAGAGAACGTGCTGT	0.632																																																0			17											305.0	246.0	266.0					17																	43037583		2203	4300	6503	40393109	SO:0001583	missense	10882			AF410771	CCDS11492.1	17q21	2010-08-18			ENSG00000131094	ENSG00000131094			24182	protein-coding gene	gene with protein product		611586				9878755	Standard	NM_006688		Approved	CRF, C1QRF, C1QTNF14	uc002ihv.3	O75973	OTTHUMG00000162944	ENST00000253407.3:c.750C>G	17.37:g.43037583G>C	ENSP00000253407:p.Phe250Leu	Somatic		Capture	Illumina GAIIx	4	40393109		Missense_Mutation	SNP	HMMPfam_Collagen,HMMSmart_C1Q,superfamily_TNF_like,HMMPfam_C1q	p.F250L	ENST00000253407.3	37	c.750	CCDS11492.1	17	.	.	.	.	.	.	.	.	.	.	G	23.4	4.413464	0.83449	.	.	ENSG00000131094	ENST00000253407	D	0.92911	-3.13	4.4	2.42	0.29668	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.96367	0.8815	H	0.94925	3.6	0.51233	D	0.999918	D	0.76494	0.999	D	0.85130	0.997	D	0.94932	0.8083	10	0.87932	D	0	.	7.7959	0.29148	0.2783:0.0:0.7217:0.0	.	250	O75973	C1QRF_HUMAN	L	250	ENSP00000253407:F250L	ENSP00000253407:F250L	F	-	3	2	C1QL1	40393109	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.301000	0.43628	0.498000	0.27948	0.555000	0.69702	TTC	-	HMMSmart_C1Q,superfamily_TNF_like,HMMPfam_C1q		0.632	C1QL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QL1	protein_coding	OTTHUMT00000371119.3	G	NM_006688		40393109	-1	no_errors	NM_006688	genbank	human	provisional	54_36p	missense	SNP	1.000	C
COL9A2	1298	genome.wustl.edu	37	1	40777216	40777216	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr1:40777216G>A	ENST00000372748.3	-	10	571	c.475C>T	c.(475-477)Cgc>Tgc	p.R159C		NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	159	Triple-helical region 4 (COL4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			GTTCCCGGGCGACCCTGAGAG	0.632																																																0			1											77.0	79.0	79.0					1																	40777216		2203	4300	6503	40549803	SO:0001583	missense	1298			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.475C>T	1.37:g.40777216G>A	ENSP00000361834:p.Arg159Cys	Somatic		Capture	Illumina GAIIx	4	40549803	B2RMP9	Missense_Mutation	SNP	HMMPfam_Collagen	p.R159C	ENST00000372748.3	37	c.475	CCDS450.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	17.96|17.96	3.516716|3.516716	0.64634|0.64634	.|.	.|.	ENSG00000049089|ENSG00000049089	ENST00000372748|ENST00000417105	D|.	0.94330|.	-3.4|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	0.131843|.	0.56097|.	D|.	0.000040|.	T|T	0.59824|0.59824	0.2222|0.2222	L|L	0.41415|0.41415	1.275|1.275	0.47905|0.47905	D|D	0.99954|0.99954	D|.	0.89917|.	1.0|.	D|.	0.78314|.	0.991|.	T|T	0.55095|0.55095	-0.8194|-0.8194	10|5	0.56958|.	D|.	0.05|.	.|.	15.02|15.02	0.71624|0.71624	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	159|.	Q14055|.	CO9A2_HUMAN|.	C|L	159|147	ENSP00000361834:R159C|.	ENSP00000361834:R159C|.	R|S	-|-	1|2	0|0	COL9A2|COL9A2	40549803|40549803	1.000000|1.000000	0.71417|0.71417	0.979000|0.979000	0.43373|0.43373	0.827000|0.827000	0.46813|0.46813	5.178000|5.178000	0.65037|0.65037	2.607000|2.607000	0.88179|0.88179	0.563000|0.563000	0.77884|0.77884	CGC|TCG	-	HMMPfam_Collagen		0.632	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A2	protein_coding	OTTHUMT00000015764.3	G	NM_001852		40549803	-1	no_errors	NM_001852	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
FGF10	2255	genome.wustl.edu	37	5	44305163	44305163	+	Silent	SNP	C	C	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr5:44305163C>T	ENST00000264664.4	-	3	675	c.561G>A	c.(559-561)agG>agA	p.R187R		NM_004465.1	NP_004456.1	O15520	FGF10_HUMAN	fibroblast growth factor 10	187					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching morphogenesis of an epithelial tube (GO:0048754)|bronchiole morphogenesis (GO:0060436)|bud elongation involved in lung branching (GO:0060449)|bud outgrowth involved in lung branching (GO:0060447)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell migration (GO:0010631)|epithelial cell proliferation (GO:0050673)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|ERK1 and ERK2 cascade (GO:0070371)|establishment of mitotic spindle orientation (GO:0000132)|Fc-epsilon receptor signaling pathway (GO:0038095)|female genitalia morphogenesis (GO:0048807)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|hair follicle morphogenesis (GO:0031069)|Harderian gland development (GO:0070384)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte proliferation (GO:0043616)|lacrimal gland development (GO:0032808)|limb bud formation (GO:0060174)|lung epithelium development (GO:0060428)|lung proximal/distal axis specification (GO:0061115)|lung saccule development (GO:0060430)|male genitalia morphogenesis (GO:0048808)|mammary gland bud formation (GO:0060615)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal-epithelial cell signaling involved in lung development (GO:0060496)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|metanephros morphogenesis (GO:0003338)|muscle cell fate commitment (GO:0042693)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|pancreas development (GO:0031016)|phosphatidylinositol-mediated signaling (GO:0048015)|pituitary gland development (GO:0021983)|positive chemotaxis (GO:0050918)|positive regulation of ATPase activity (GO:0032781)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of hair follicle cell proliferation (GO:0071338)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urothelial cell proliferation (GO:0050677)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of white fat cell proliferation (GO:0070352)|prostatic bud formation (GO:0060513)|protein localization to cell surface (GO:0034394)|radial glial cell differentiation (GO:0060019)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of saliva secretion (GO:0046877)|regulation of smoothened signaling pathway (GO:0008589)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|salivary gland development (GO:0007431)|secretion by lung epithelial cell involved in lung growth (GO:0061033)|semicircular canal fusion (GO:0060879)|smooth muscle cell differentiation (GO:0051145)|somatic stem cell maintenance (GO:0035019)|spleen development (GO:0048536)|submandibular salivary gland formation (GO:0060661)|tear secretion (GO:0070075)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tissue regeneration (GO:0042246)|Type II pneumocyte differentiation (GO:0060510)|urothelial cell proliferation (GO:0050674)|white fat cell differentiation (GO:0050872)|wound healing (GO:0042060)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chemoattractant activity (GO:0042056)|fibroblast growth factor receptor binding (GO:0005104)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|type 2 fibroblast growth factor receptor binding (GO:0005111)			haematopoietic_and_lymphoid_tissue(1)|lung(11)|skin(1)	13	Lung NSC(6;1.12e-06)					TCTGTCCTCTCCTTGGAGCTC	0.433																																																0			5											297.0	254.0	268.0					5																	44305163		2203	4300	6503	44340920	SO:0001819	synonymous_variant	2255				CCDS3950.1	5p13-p12	2008-02-05			ENSG00000070193	ENSG00000070193			3666	protein-coding gene	gene with protein product		602115				9287324	Standard	NM_004465		Approved		uc003jog.1	O15520	OTTHUMG00000131153	ENST00000264664.4:c.561G>A	5.37:g.44305163C>T		Somatic		Capture	Illumina GAIIx	4	44340920	C7FDY0|Q6FHR3|Q6FHT6|Q96P59	Silent	SNP	superfamily_Cytok_IL1_like,HMMSmart_FGF,HMMPfam_FGF,PatternScan_HBGF_FGF	p.R187	ENST00000264664.4	37	c.561	CCDS3950.1	5																																																																																			-	superfamily_Cytok_IL1_like,HMMSmart_FGF,HMMPfam_FGF		0.433	FGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF10	protein_coding	OTTHUMT00000253845.2	C	NM_004465		44340920	-1	no_errors	NM_004465	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
ZNFX1	57169	genome.wustl.edu	37	20	47887087	47887087	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr20:47887087C>T	ENST00000396105.1	-	3	1508	c.1262G>A	c.(1261-1263)tGt>tAt	p.C421Y	ZNFX1_ENST00000371752.1_Missense_Mutation_p.C421Y|ZNFX1_ENST00000371754.4_Missense_Mutation_p.C421Y	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	421							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TGATGATGAACACATGGGGGT	0.438																																																0			20											177.0	172.0	174.0					20																	47887087		2203	4300	6503	47320494	SO:0001583	missense	57169			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.1262G>A	20.37:g.47887087C>T	ENSP00000379412:p.Cys421Tyr	Somatic		Capture	Illumina GAIIx	4	47320494	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_zf-NF-X1,HMMSmart_SM00438	p.C421Y	ENST00000396105.1	37	c.1262	CCDS13417.1	20	.	.	.	.	.	.	.	.	.	.	C	12.96	2.095160	0.36952	.	.	ENSG00000124201	ENST00000396106;ENST00000371754;ENST00000371752;ENST00000396105;ENST00000371744;ENST00000455070	D;D;D;T;D	0.87103	-1.95;-2.21;-2.21;-0.9;-1.62	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.87665	0.6234	M	0.61703	1.905	0.80722	D	1	D	0.54772	0.968	P	0.48627	0.584	D	0.84184	0.0441	10	0.09084	T	0.74	-11.0925	18.7272	0.91718	0.0:1.0:0.0:0.0	.	421	Q9P2E3	ZNFX1_HUMAN	Y	421;421;421;421;421;225	ENSP00000360819:C421Y;ENSP00000360817:C421Y;ENSP00000379412:C421Y;ENSP00000360809:C421Y;ENSP00000413800:C225Y	ENSP00000360809:C421Y	C	-	2	0	ZNFX1	47320494	1.000000	0.71417	0.995000	0.50966	0.962000	0.63368	7.773000	0.85462	2.773000	0.95371	0.655000	0.94253	TGT	-	NULL		0.438	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNFX1	protein_coding	OTTHUMT00000079647.2	C	NM_021035		47320494	-1	no_errors	NM_021035	genbank	human	validated	54_36p	missense	SNP	1.000	T
NEK4	6787	genome.wustl.edu	37	3	52771610	52771610	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr3:52771610C>T	ENST00000233027.5	-	15	2627	c.2425G>A	c.(2425-2427)Gat>Aat	p.D809N	NEK4_ENST00000535191.1_Missense_Mutation_p.D720N|NEK4_ENST00000383721.4_Missense_Mutation_p.D763N	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	809					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		ACCTCTCTATCAAATTCATCC	0.363																																																0			3											139.0	126.0	131.0					3																	52771610		2203	4300	6503	52746650	SO:0001583	missense	6787			L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.2425G>A	3.37:g.52771610C>T	ENSP00000233027:p.Asp809Asn	Somatic		Capture	Illumina GAIIx	4	52746650	A5YM70|B2R633|B7Z200|Q6P576	Missense_Mutation	SNP	HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,superfamily_Protein kinase-like (PK-like),PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.D809N	ENST00000233027.5	37	c.2425	CCDS2863.1	3	.	.	.	.	.	.	.	.	.	.	C	11.05	1.524054	0.27299	.	.	ENSG00000114904	ENST00000233027;ENST00000535191;ENST00000383721;ENST00000461689	T;T;T;T	0.72505	-0.59;-0.66;-0.62;-0.63	5.73	-2.55	0.06288	.	0.613865	0.15797	N	0.244161	T	0.46541	0.1398	N	0.14661	0.345	0.09310	N	1	B;B;B	0.23540	0.087;0.066;0.062	B;B;B	0.23716	0.048;0.019;0.03	T	0.35025	-0.9805	10	0.62326	D	0.03	.	5.6861	0.17803	0.0:0.2169:0.4026:0.3805	.	720;763;809	B7Z200;P51957-2;P51957	.;.;NEK4_HUMAN	N	809;720;763;720	ENSP00000233027:D809N;ENSP00000437703:D720N;ENSP00000373227:D763N;ENSP00000419666:D720N	ENSP00000233027:D809N	D	-	1	0	NEK4	52746650	0.044000	0.20184	0.020000	0.16555	0.235000	0.25334	0.238000	0.18004	-0.311000	0.08754	-0.882000	0.02950	GAT	-	NULL		0.363	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEK4	protein_coding	OTTHUMT00000352386.2	C	NM_003157		52746650	-1	no_errors	NM_003157	genbank	human	validated	54_36p	missense	SNP	0.663	T
OR5D18	219438	genome.wustl.edu	37	11	55587539	55587539	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr11:55587539T>C	ENST00000333976.4	+	1	454	c.434T>C	c.(433-435)cTg>cCg	p.L145P		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				TGCGTGCTGCTGGTTGTGGGA	0.463																																																0			11											187.0	177.0	180.0					11																	55587539		2200	4296	6496	55344115	SO:0001583	missense	219438			AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.434T>C	11.37:g.55587539T>C	ENSP00000335025:p.Leu145Pro	Somatic		Capture	Illumina GAIIx	4	55344115	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L145P	ENST00000333976.4	37	c.434	CCDS31510.1	11	.	.	.	.	.	.	.	.	.	.	.	11.34	1.608878	0.28623	.	.	ENSG00000186119	ENST00000333976	T	0.45276	0.9	4.66	4.66	0.58398	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30989	N	0.008475	T	0.73024	0.3534	H	0.97265	3.97	0.21627	N	0.999614	D	0.89917	1.0	D	0.81914	0.995	T	0.70182	-0.4942	10	0.87932	D	0	-9.4669	8.1827	0.31319	0.0:0.092:0.0:0.908	.	145	Q8NGL1	OR5DI_HUMAN	P	145	ENSP00000335025:L145P	ENSP00000335025:L145P	L	+	2	0	OR5D18	55344115	0.928000	0.31464	0.008000	0.14137	0.022000	0.10575	5.738000	0.68613	1.912000	0.55364	0.462000	0.41574	CTG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.463	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D18	protein_coding	OTTHUMT00000391515.1	T	NM_001001952		55344115	+1	no_errors	NM_001001952	genbank	human	provisional	54_36p	missense	SNP	0.013	C
RPL37P23	648217	genome.wustl.edu	37	19	52646387	52646387	+	RNA	SNP	A	A	T	rs574180919		TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr19:52646387A>T	ENST00000594362.1	-	0	554				CTC-471J1.9_ENST00000597886.1_lincRNA																							CACCTTCAGAAGTCGACCTGT	0.512																																																0			19																																								57338199			648217																															19.37:g.52646387A>T		Somatic		Capture	Illumina GAIIx	4	57338199		Missense_Mutation	SNP	superfamily_Zn-binding ribosomal proteins,HMMPfam_Ribosomal_L37e	p.K31M	ENST00000594362.1	37	c.92		19																																																																																			-	superfamily_Zn-binding ribosomal proteins,HMMPfam_Ribosomal_L37e		0.512	CTC-471J1.8-002	KNOWN	NMD_likely_if_extended|basic|readthrough_transcript	processed_transcript	LOC648217	processed_transcript	OTTHUMT00000462533.1	A			57338199	+1	pseudogene	XM_496319	genbank	human	model	54_36p	missense	SNP	1.000	T
POLRMTP1	284167	genome.wustl.edu	37	17	60214717	60214717	+	IGR	SNP	T	T	C	rs535533338		TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr17:60214717T>C								Y_RNA (14935 upstream) : TBC1D3P2 (127348 downstream)																							ATGTCTCCGTTGTGGGTGTAG	0.577																																																0			17																																								57569499	SO:0001628	intergenic_variant	284167																															17.37:g.60214717T>C		Somatic		Capture	Illumina GAIIx	4	57569499		RNA	SNP	-	NULL		37	NULL		17																																																																																			-	-	0	0.577					LOC284167			T			57569499	-1	pseudogene	XR_017049	genbank	human	model	54_36p	rna	SNP	0.300	C
SLCO4A1	28231	genome.wustl.edu	37	20	61299422	61299422	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr20:61299422C>G	ENST00000370507.1	+	8	1793	c.1697C>G	c.(1696-1698)aCt>aGt	p.T566S	RP11-93B14.5_ENST00000433126.1_RNA|SLCO4A1_ENST00000470412.1_3'UTR|RP11-93B14.5_ENST00000411824.1_RNA|RP11-93B14.5_ENST00000451648.1_RNA|SLCO4A1_ENST00000217159.1_Missense_Mutation_p.T566S			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	566					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GGCCATGCCACTGCAGGGAAA	0.473											OREG0026115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(168;741 2006 10379 40139 45334)											0			20											186.0	177.0	180.0					20																	61299422		2203	4300	6503	60769867	SO:0001583	missense	28231			AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1697C>G	20.37:g.61299422C>G	ENSP00000359538:p.Thr566Ser	Somatic	1052	Capture	Illumina GAIIx	4	60769867	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Missense_Mutation	SNP	HMMPfam_OATP,superfamily_MFS general substrate transporter,superfamily_Kazal-type serine protease inhibitors,HMMPfam_Kazal_2	p.T566S	ENST00000370507.1	37	c.1697	CCDS13501.1	20	.	.	.	.	.	.	.	.	.	.	C	11.15	1.554851	0.27739	.	.	ENSG00000101187	ENST00000217159;ENST00000370512;ENST00000370507;ENST00000342674	T;T	0.38401	1.14;1.14	4.97	4.97	0.65823	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.430781	0.24594	N	0.037181	T	0.30854	0.0778	L	0.56769	1.78	0.09310	N	1	B	0.21071	0.051	B	0.25759	0.063	T	0.21621	-1.0240	10	0.12766	T	0.61	.	7.8798	0.29616	0.1724:0.7432:0.0:0.0844	.	566	Q96BD0	SO4A1_HUMAN	S	566;566;566;418	ENSP00000217159:T566S;ENSP00000359538:T566S	ENSP00000217159:T566S	T	+	2	0	SLCO4A1	60769867	0.010000	0.17322	0.881000	0.34555	0.910000	0.53928	0.926000	0.28804	2.283000	0.76528	0.591000	0.81541	ACT	-	HMMPfam_OATP,superfamily_MFS general substrate transporter		0.473	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4A1	protein_coding	OTTHUMT00000080048.2	C	NM_016354		60769867	+1	no_errors	NM_016354	genbank	human	validated	54_36p	missense	SNP	0.110	G
HELZ2	85441	genome.wustl.edu	37	20	62190635	62190635	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr20:62190635C>A	ENST00000467148.1	-	19	7983	c.7914G>T	c.(7912-7914)caG>caT	p.Q2638H	HELZ2_ENST00000427522.2_Missense_Mutation_p.Q2069H	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2638	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										AGACGCGCACCTGGCCGGCAG	0.672																																																0			20											16.0	14.0	15.0					20																	62190635		2188	4292	6480	61661079	SO:0001583	missense	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7914G>T	20.37:g.62190635C>A	ENSP00000417401:p.Gln2638His	Somatic		Capture	Illumina GAIIx	4	61661079	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	PatternScan_ZINC_FINGER_C2H2_1,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_RNB,PatternScan_RIBONUCLEASE_II	p.Q2638H	ENST00000467148.1	37	c.7914	CCDS33508.1	20	.	.	.	.	.	.	.	.	.	.	C	9.841	1.191126	0.21954	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.80033	-1.33;-1.23	3.5	2.44	0.29823	.	0.947197	0.08728	N	0.902537	T	0.68504	0.3008	L	0.33485	1.01	0.19300	N	0.999972	B;B	0.13594	0.008;0.002	B;B	0.13407	0.009;0.004	T	0.54827	-0.8235	10	0.33940	T	0.23	.	5.0429	0.14467	0.0:0.8249:0.0:0.1751	.	2638;2069	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	H	2069;2638	ENSP00000393257:Q2069H;ENSP00000417401:Q2638H	ENSP00000393257:Q2069H	Q	-	3	2	RP4-697K14.7	61661079	0.544000	0.26441	0.287000	0.24848	0.043000	0.13939	0.467000	0.22035	1.816000	0.52996	0.462000	0.41574	CAG	-	NULL		0.672	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIC285	protein_coding	OTTHUMT00000354127.1	C	NM_001037335		61661079	-1	no_errors	NM_001037335	genbank	human	reviewed	54_36p	missense	SNP	0.008	A
ABCA6	23460	genome.wustl.edu	37	17	67133497	67133497	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr17:67133497G>T	ENST00000284425.2	-	3	415	c.241C>A	c.(241-243)Cca>Aca	p.P81T	ABCA6_ENST00000590645.1_Missense_Mutation_p.P81T	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	81					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TTAGATATTGGTGTATACACA	0.373																																																0			17											103.0	109.0	107.0					17																	67133497		2203	4300	6503	64645092	SO:0001583	missense	23460			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.241C>A	17.37:g.67133497G>T	ENSP00000284425:p.Pro81Thr	Somatic		Capture	Illumina GAIIx	4	64645092	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran	p.P81T	ENST00000284425.2	37	c.241	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	g	14.96	2.689885	0.48097	.	.	ENSG00000154262	ENST00000284425	D	0.89343	-2.5	4.81	4.81	0.61882	.	0.000000	0.41294	D	0.000914	D	0.94466	0.8219	M	0.85197	2.74	0.38275	D	0.942271	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.95632	0.8690	10	0.87932	D	0	.	13.5788	0.61890	0.0:0.0:1.0:0.0	.	81;81	Q8N139-3;Q8N139	.;ABCA6_HUMAN	T	81	ENSP00000284425:P81T	ENSP00000284425:P81T	P	-	1	0	ABCA6	64645092	1.000000	0.71417	0.566000	0.28421	0.386000	0.30323	4.570000	0.60872	2.671000	0.90904	0.651000	0.88453	CCA	-	NULL		0.373	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	protein_coding	OTTHUMT00000450463.1	G	NM_080284		64645092	-1	no_errors	NM_080284	genbank	human	reviewed	54_36p	missense	SNP	0.444	T
ARMC1	55156	genome.wustl.edu	37	8	66525611	66525611	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr8:66525611C>A	ENST00000276569.3	-	4	577	c.333G>T	c.(331-333)caG>caT	p.Q111H	ARMC1_ENST00000458464.2_Intron|ARMC1_ENST00000523384.1_5'UTR	NM_018120.4	NP_060590.1	Q9NVT9	ARMC1_HUMAN	armadillo repeat containing 1	111					metal ion transport (GO:0030001)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(1)|lung(8)|skin(1)	14			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			TATTGGAGGACTGAAGAATGT	0.368																																																0			8											137.0	131.0	133.0					8																	66525611		2203	4300	6503	66688165	SO:0001583	missense	55156			BC011607	CCDS6181.1, CCDS69490.1	8q12.3	2013-02-14			ENSG00000104442	ENSG00000104442		"""Armadillo repeat containing"""	17684	protein-coding gene	gene with protein product							Standard	XM_005251264		Approved	FLJ10511, Arcp	uc003xvl.3	Q9NVT9	OTTHUMG00000164374	ENST00000276569.3:c.333G>T	8.37:g.66525611C>A	ENSP00000276569:p.Gln111His	Somatic		Capture	Illumina GAIIx	4	66688165	B4E2W7|Q9H018|Q9H820	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_Arm,superfamily_HeavyMe_transpt	p.Q111H	ENST00000276569.3	37	c.333	CCDS6181.1	8	.	.	.	.	.	.	.	.	.	.	C	15.57	2.871475	0.51695	.	.	ENSG00000104442	ENST00000276569;ENST00000518908;ENST00000519352	T;T;T	0.46819	0.86;0.86;0.86	6.02	-2.44	0.06502	.	0.000000	0.85682	D	0.000000	T	0.43700	0.1259	M	0.70595	2.14	0.80722	D	1	P	0.45283	0.855	B	0.41510	0.359	T	0.42699	-0.9436	10	0.45353	T	0.12	.	11.9025	0.52692	0.0:0.5156:0.0:0.4844	.	111	Q9NVT9	ARMC1_HUMAN	H	111	ENSP00000276569:Q111H;ENSP00000429191:Q111H;ENSP00000429715:Q111H	ENSP00000276569:Q111H	Q	-	3	2	ARMC1	66688165	0.983000	0.35010	0.784000	0.31847	0.994000	0.84299	0.271000	0.18626	-0.896000	0.03915	-0.136000	0.14681	CAG	-	superfamily_ARM-type_fold		0.368	ARMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC1	protein_coding	OTTHUMT00000378480.1	C	NM_018120		66688165	-1	no_errors	NM_018120	genbank	human	provisional	54_36p	missense	SNP	0.996	A
NETO1	81832	genome.wustl.edu	37	18	70417456	70417456	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr18:70417456T>A	ENST00000327305.6	-	9	2039	c.1382A>T	c.(1381-1383)cAg>cTg	p.Q461L	NETO1_ENST00000583169.1_Missense_Mutation_p.Q461L|NETO1_ENST00000299430.2_Missense_Mutation_p.Q460L|RNA5SP460_ENST00000516789.1_RNA	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	461					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.Q461L(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		TTTTCCTGGCTGTGTGGGCAT	0.483																																																1	Substitution - Missense(1)	lung(1)	18											208.0	184.0	192.0					18																	70417456		2203	4300	6503	68568436	SO:0001583	missense	81832			AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1382A>T	18.37:g.70417456T>A	ENSP00000313088:p.Gln461Leu	Somatic		Capture	Illumina GAIIx	4	68568436	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_LDL receptor-like module,HMMSmart_SM00192,PatternScan_LDLRA_1	p.Q461L	ENST00000327305.6	37	c.1382	CCDS12000.1	18	.	.	.	.	.	.	.	.	.	.	T	13.21	2.167794	0.38315	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.22743	1.94;1.94	5.76	1.88	0.25563	.	0.000000	0.56097	D	0.000024	T	0.16300	0.0392	L	0.44542	1.39	0.80722	D	1	B;B	0.15473	0.013;0.008	B;B	0.19391	0.025;0.011	T	0.06734	-1.0810	10	0.30078	T	0.28	-34.0953	8.4958	0.33127	0.0:0.0644:0.2428:0.6928	.	460;461	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	L	461;460	ENSP00000313088:Q461L;ENSP00000299430:Q460L	ENSP00000299430:Q460L	Q	-	2	0	NETO1	68568436	1.000000	0.71417	0.842000	0.33263	0.892000	0.51952	2.564000	0.45931	0.412000	0.25729	0.377000	0.23210	CAG	-	NULL		0.483	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NETO1	protein_coding	OTTHUMT00000256301.2	T	NM_138999		68568436	-1	no_errors	NM_138966	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DNAJB13	374407	genome.wustl.edu	37	11	73679409	73679409	+	Missense_Mutation	SNP	C	C	T	rs555430903	byFrequency	TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr11:73679409C>T	ENST00000339764.1	+	6	1377	c.626C>T	c.(625-627)gCa>gTa	p.A209V	RP11-167N4.2_ENST00000537019.1_RNA|DNAJB13_ENST00000537753.1_Missense_Mutation_p.A34V|DNAJB13_ENST00000543947.1_Missense_Mutation_p.A34V	NM_153614.2	NP_705842.2	P59910	DJB13_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 13	209					protein folding (GO:0006457)					large_intestine(3)|lung(2)	5	Breast(11;7.42e-05)					ATCATCCCAGCAGACATCATT	0.542																																																0			11											165.0	120.0	135.0					11																	73679409		2200	4293	6493	73357057	SO:0001583	missense	374407			AF516185	CCDS8227.1	11q13.3	2011-09-02	2010-04-21		ENSG00000187726	ENSG00000187726		"""Heat shock proteins / DNAJ (HSP40)"""	30718	protein-coding gene	gene with protein product	"""radial spoke 16 homolog A (Chlamydomonas)"""	610263	"""DnaJ (Hsp40) related, subfamily B, member 13"""				Standard	NM_153614		Approved	TSARG6, RSPH16A	uc001ouo.3	P59910	OTTHUMG00000168093	ENST00000339764.1:c.626C>T	11.37:g.73679409C>T	ENSP00000344431:p.Ala209Val	Somatic		Capture	Illumina GAIIx	4	73357057	B3LEP4|Q8IZW5	Missense_Mutation	SNP	superfamily_Chaperone J-domain,HMMSmart_SM00271,HMMPfam_DnaJ,PatternScan_DNAJ_1,superfamily_HSP40/DnaJ peptide-binding domain,HMMPfam_DnaJ_C	p.A209V	ENST00000339764.1	37	c.626	CCDS8227.1	11	.	.	.	.	.	.	.	.	.	.	c	33	5.284316	0.95517	.	.	ENSG00000187726	ENST00000339764;ENST00000537753;ENST00000543947	T;T;T	0.47869	0.91;0.83;0.83	5.23	5.23	0.72850	HSP40/DnaJ peptide-binding (1);	0.047454	0.85682	D	0.000000	T	0.77191	0.4094	H	0.97783	4.075	0.53688	D	0.999973	D	0.52996	0.957	P	0.55545	0.778	D	0.86575	0.1850	10	0.87932	D	0	.	17.4282	0.87532	0.0:1.0:0.0:0.0	.	209	P59910	DJB13_HUMAN	V	209;34;34	ENSP00000344431:A209V;ENSP00000439711:A34V;ENSP00000438576:A34V	ENSP00000344431:A209V	A	+	2	0	DNAJB13	73357057	1.000000	0.71417	0.969000	0.41365	0.973000	0.67179	5.003000	0.63959	2.452000	0.82932	0.437000	0.28790	GCA	-	superfamily_HSP40/DnaJ peptide-binding domain,HMMPfam_DnaJ_C		0.542	DNAJB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB13	protein_coding	OTTHUMT00000398100.1	C	NM_153614		73357057	+1	no_errors	NM_153614	genbank	human	provisional	54_36p	missense	SNP	0.996	T
KCNC2	3747	genome.wustl.edu	37	12	75436917	75436917	+	Missense_Mutation	SNP	G	G	A	rs200051664		TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr12:75436917G>A	ENST00000549446.1	-	5	2565	c.1885C>T	c.(1885-1887)Cgc>Tgc	p.R629C	KCNC2_ENST00000540018.1_Missense_Mutation_p.R574C|RP11-81K13.1_ENST00000547040.1_RNA|KCNC2_ENST00000548513.1_Intron|RP11-81K13.1_ENST00000549762.1_RNA|KCNC2_ENST00000298972.1_Intron|KCNC2_ENST00000350228.2_Intron|RP11-81K13.1_ENST00000550049.1_RNA|KCNC2_ENST00000550433.1_Intron|KCNC2_ENST00000341669.3_Intron	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	629					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	GATCGAGAGCGCCTCAGAGGA	0.458																																																0			12											154.0	137.0	143.0					12																	75436917		2203	4300	6503	73723184	SO:0001583	missense	3747			AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.1885C>T	12.37:g.75436917G>A	ENSP00000449253:p.Arg629Cys	Somatic		Capture	Illumina GAIIx	4	73723184	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	superfamily_POZ domain,HMMSmart_SM00225,HMMPfam_K_tetra,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.R629C	ENST00000549446.1	37	c.1885	CCDS9007.1	12	.	.	.	.	.	.	.	.	.	.	G	20.8	4.050581	0.75960	.	.	ENSG00000166006	ENST00000549446;ENST00000540018	D;D	0.98192	-4.61;-4.78	6.17	5.28	0.74379	.	0.283728	0.23491	N	0.047601	D	0.97256	0.9103	L	0.38175	1.15	0.80722	D	1	B;D	0.89917	0.054;1.0	B;P	0.53689	0.017;0.732	D	0.96557	0.9412	10	0.48119	T	0.1	.	15.01	0.71542	0.0673:0.0:0.9327:0.0	.	574;629	F5H030;Q96PR1	.;KCNC2_HUMAN	C	629;574	ENSP00000449253:R629C;ENSP00000438423:R574C	ENSP00000438423:R574C	R	-	1	0	KCNC2	73723184	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	8.022000	0.88759	2.941000	0.99782	0.655000	0.94253	CGC	-	NULL		0.458	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNC2	protein_coding	OTTHUMT00000405581.2	G	NM_153748		73723184	-1	no_errors	NM_139137	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SLCO2B1	11309	genome.wustl.edu	37	11	74907586	74907586	+	Silent	SNP	A	A	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr11:74907586A>T	ENST00000289575.5	+	10	1856	c.1461A>T	c.(1459-1461)ccA>ccT	p.P487P	SLCO2B1_ENST00000531756.1_Silent_p.P232P|SLCO2B1_ENST00000532236.1_Silent_p.P371P|SLCO2B1_ENST00000341411.4_Silent_p.P260P|SLCO2B1_ENST00000454962.2_Silent_p.P260P|SLCO2B1_ENST00000525650.1_Silent_p.P343P|SLCO2B1_ENST00000428359.2_Silent_p.P465P	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	487	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	AGCTGTCTCCAAGCTGCATGG	0.632																																																0			11											59.0	52.0	54.0					11																	74907586		2200	4293	6493	74585234	SO:0001819	synonymous_variant	11309			AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.1461A>T	11.37:g.74907586A>T		Somatic		Capture	Illumina GAIIx	4	74585234	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Silent	SNP	superfamily_MFS general substrate transporter,HMMPfam_OATP	p.P487	ENST00000289575.5	37	c.1461	CCDS8235.1	11																																																																																			-	superfamily_MFS general substrate transporter,HMMPfam_OATP		0.632	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLCO2B1	protein_coding	OTTHUMT00000383933.1	A	NM_007256		74585234	+1	no_errors	NM_007256	genbank	human	validated	54_36p	silent	SNP	0.077	T
HSPB1	3315	genome.wustl.edu	37	7	75932058	75932058	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr7:75932058T>A	ENST00000248553.6	+	1	198	c.29T>A	c.(28-30)cTc>cAc	p.L10H	HSPB1_ENST00000429938.1_5'Flank	NM_001540.3	NP_001531.1	P04792	HSPB1_HUMAN	heat shock 27kDa protein 1	10				L -> I (in Ref. 13; AA sequence). {ECO:0000305}.	cell death (GO:0008219)|cellular component movement (GO:0006928)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of protein kinase activity (GO:0006469)|platelet aggregation (GO:0070527)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of translational initiation (GO:0006446)|response to unfolded protein (GO:0006986)|response to virus (GO:0009615)|retina homeostasis (GO:0001895)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)|ubiquitin binding (GO:0043130)			large_intestine(1)|lung(3)	4						CCCTTCTCGCTCCTGCGGGGC	0.692																																																0			7											9.0	13.0	12.0					7																	75932058		2116	4207	6323	75769994	SO:0001583	missense	3315			X54079	CCDS5583.1	7q11.23	2014-09-17	2002-08-29		ENSG00000106211	ENSG00000106211		"""Heat shock proteins / HSPB"""	5246	protein-coding gene	gene with protein product		602195	"""heat shock 27kD protein 1"""			2243808, 9344682	Standard	NM_001540		Approved	HSP27, HSP28, Hs.76067, Hsp25	uc003uew.3	P04792	OTTHUMG00000023228	ENST00000248553.6:c.29T>A	7.37:g.75932058T>A	ENSP00000248553:p.Leu10His	Somatic		Capture	Illumina GAIIx	4	75769994	B2R4N8|Q6FI47|Q96C20|Q96EI7|Q9UC31|Q9UC34|Q9UC35|Q9UC36	Missense_Mutation	SNP	superfamily_HSP20-like chaperones,HMMPfam_HSP20	p.L10H	ENST00000248553.6	37	c.29	CCDS5583.1	7	.	.	.	.	.	.	.	.	.	.	T	29.3	4.992977	0.93167	.	.	ENSG00000106211	ENST00000248553;ENST00000432276	D	0.90069	-2.61	4.88	4.88	0.63580	.	0.269200	0.36628	N	0.002490	D	0.92344	0.7571	M	0.63843	1.955	0.80722	D	1	D	0.71674	0.998	P	0.62740	0.906	D	0.93077	0.6488	10	0.72032	D	0.01	-38.5058	13.8593	0.63550	0.0:0.0:0.0:1.0	.	10	P04792	HSPB1_HUMAN	H	10	ENSP00000248553:L10H	ENSP00000248553:L10H	L	+	2	0	HSPB1	75769994	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.446000	0.60014	2.057000	0.61298	0.459000	0.35465	CTC	-	superfamily_HSP20-like chaperones		0.692	HSPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPB1	protein_coding	OTTHUMT00000252958.1	T			75769994	+1	no_errors	NM_001540	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	15	84722438	84722438	+	IGR	SNP	G	G	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr15:84722438G>T								ADAMTSL3 (13844 upstream) : EFTUD1P1 (26481 downstream)																							CGAGCATTCTGGGTCACTCTG	0.478																																																0			15																																								82513442	SO:0001628	intergenic_variant	642677																															15.37:g.84722438G>T		Somatic		Capture	Illumina GAIIx	4	82513442		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.478					LOC642677			G			82513442	-1	pseudogene	XR_036878	genbank	human	model	54_36p	rna	SNP	0.087	T
ANKRD1	27063	genome.wustl.edu	37	10	92679963	92679963	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr10:92679963T>A	ENST00000371697.3	-	2	418	c.170A>T	c.(169-171)gAg>gTg	p.E57V	RNU6-740P_ENST00000364734.1_RNA	NM_014391.2	NP_055206.2	Q15327	ANKR1_HUMAN	ankyrin repeat domain 1 (cardiac muscle)	57					cardiac muscle tissue morphogenesis (GO:0055008)|cellular lipid metabolic process (GO:0044255)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muscle stretch (GO:0035994)|sarcomere organization (GO:0045214)|skeletal muscle cell differentiation (GO:0035914)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I band (GO:0031674)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|p53 binding (GO:0002039)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|titin binding (GO:0031432)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|prostate(3)|skin(1)	27		Colorectal(252;0.0475)				CCACTGTTGCTCCCCCAGGGT	0.512																																																0			10											207.0	194.0	198.0					10																	92679963		2203	4300	6503	92669943	SO:0001583	missense	27063			X83703	CCDS7412.1	10q23.33	2014-09-17			ENSG00000148677	ENSG00000148677		"""Ankyrin repeat domain containing"""	15819	protein-coding gene	gene with protein product		609599				7730328	Standard	NM_014391		Approved	C-193, ALRP, CARP, CVARP, MCARP	uc001khe.1	Q15327	OTTHUMG00000018734	ENST00000371697.3:c.170A>T	10.37:g.92679963T>A	ENSP00000360762:p.Glu57Val	Somatic		Capture	Illumina GAIIx	4	92669943	Q96LE7	Missense_Mutation	SNP	superfamily_ANK,HMMPfam_Ank,HMMSmart_ANK	p.E57V	ENST00000371697.3	37	c.170	CCDS7412.1	10	.	.	.	.	.	.	.	.	.	.	T	13.36	2.213419	0.39102	.	.	ENSG00000148677	ENST00000371697	T	0.68765	-0.35	5.76	5.76	0.90799	.	0.425745	0.25442	N	0.030659	T	0.55386	0.1917	L	0.29908	0.895	0.35988	D	0.83648	B	0.31125	0.309	B	0.24701	0.055	T	0.62642	-0.6811	10	0.41790	T	0.15	.	16.3668	0.83335	0.0:0.0:0.0:1.0	.	57	Q15327	ANKR1_HUMAN	V	57	ENSP00000360762:E57V	ENSP00000360762:E57V	E	-	2	0	ANKRD1	92669943	0.162000	0.22906	0.933000	0.37362	0.247000	0.25773	1.580000	0.36547	2.322000	0.78497	0.528000	0.53228	GAG	-	superfamily_ANK		0.512	ANKRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD1	protein_coding	OTTHUMT00000049357.1	T	NM_014391		92669943	-1	no_errors	NM_014391	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
ADAMTS17	170691	genome.wustl.edu	37	15	100537756	100537756	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr15:100537756C>A	ENST00000268070.4	-	19	2735	c.2630G>T	c.(2629-2631)tGt>tTt	p.C877F		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	877	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GCCTTTCTCACAGGTCGCCGA	0.692																																																0			15											31.0	32.0	32.0					15																	100537756		2203	4300	6503	98355279	SO:0001583	missense	170691			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.2630G>T	15.37:g.100537756C>A	ENSP00000268070:p.Cys877Phe	Somatic		Capture	Illumina GAIIx	4	98355279	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMSmart_SM00608,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_PLAC"	p.C877F	ENST00000268070.4	37	c.2630	CCDS10383.1	15	.	.	.	.	.	.	.	.	.	.	C	24.5	4.542445	0.85917	.	.	ENSG00000140470	ENST00000268070	D	0.96491	-4.03	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.99093	0.9688	H	0.99169	4.455	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.98959	1.0797	10	0.66056	D	0.02	.	18.639	0.91389	0.0:1.0:0.0:0.0	.	877	Q8TE56	ATS17_HUMAN	F	877	ENSP00000268070:C877F	ENSP00000268070:C877F	C	-	2	0	ADAMTS17	98355279	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	6.975000	0.76128	2.385000	0.81259	0.563000	0.77884	TGT	-	superfamily_TSP-1 type 1 repeat,HMMPfam_TSP_1,HMMSmart_SM00209		0.692	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS17	protein_coding	OTTHUMT00000313595.1	C	NM_139057		98355279	-1	no_errors	NM_139057	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DYNC1H1	1778	genome.wustl.edu	37	14	102483485	102483485	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr14:102483485C>G	ENST00000360184.4	+	39	8073	c.7909C>G	c.(7909-7911)Cac>Gac	p.H2637D		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2637	AAA 3. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GACTTTTGATCACTACTGCGA	0.488																																																0			14											147.0	138.0	141.0					14																	102483485		2203	4300	6503	101553238	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.7909C>G	14.37:g.102483485C>G	ENSP00000348965:p.His2637Asp	Somatic		Capture	Illumina GAIIx	4	101553238	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.H2637D	ENST00000360184.4	37	c.7909	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606517	0.87157	.	.	ENSG00000197102	ENST00000360184	T	0.20881	2.04	5.06	5.06	0.68205	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.44138	0.1279	M	0.65975	2.015	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.15578	-1.0432	10	0.18710	T	0.47	.	18.7865	0.91957	0.0:1.0:0.0:0.0	.	2637	Q14204	DYHC1_HUMAN	D	2637	ENSP00000348965:H2637D	ENSP00000348965:H2637D	H	+	1	0	DYNC1H1	101553238	1.000000	0.71417	0.994000	0.49952	0.801000	0.45260	7.634000	0.83273	2.520000	0.84964	0.561000	0.74099	CAC	-	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA_5		0.488	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	C	NM_001376		101553238	+1	no_errors	NM_001376	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PPRC1	23082	genome.wustl.edu	37	10	103899798	103899798	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr10:103899798G>T	ENST00000278070.2	+	5	1572	c.1533G>T	c.(1531-1533)gaG>gaT	p.E511D	PPRC1_ENST00000413464.2_Missense_Mutation_p.E511D|PPRC1_ENST00000370012.1_5'Flank	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TTCAAAAAGAGTCTGGGCCTC	0.557																																																0			10											63.0	72.0	69.0					10																	103899798		2203	4300	6503	103889788	SO:0001583	missense	23082			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.1533G>T	10.37:g.103899798G>T	ENSP00000278070:p.Glu511Asp	Somatic		Capture	Illumina GAIIx	4	103889788	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.E511D	ENST00000278070.2	37	c.1533	CCDS7529.1	10	.	.	.	.	.	.	.	.	.	.	G	7.098	0.573509	0.13623	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.56941	0.43;0.43	6.03	2.0	0.26442	.	0.216428	0.32952	N	0.005457	T	0.36386	0.0965	L	0.32530	0.975	0.09310	N	1	B;B;B	0.14438	0.006;0.01;0.006	B;B;B	0.09377	0.003;0.004;0.003	T	0.30416	-0.9979	10	0.72032	D	0.01	.	5.8131	0.18477	0.1439:0.0:0.5846:0.2716	.	511;391;511	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	D	511	ENSP00000278070:E511D;ENSP00000399743:E511D	ENSP00000278070:E511D	E	+	3	2	PPRC1	103889788	0.037000	0.19845	0.041000	0.18516	0.064000	0.16182	0.413000	0.21148	0.446000	0.26666	-0.266000	0.10368	GAG	-	NULL		0.557	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	protein_coding	OTTHUMT00000050021.1	G	NM_015062		103889788	+1	no_errors	NM_015062	genbank	human	reviewed	54_36p	missense	SNP	0.039	T
CYLC2	1539	genome.wustl.edu	37	9	105767956	105767956	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr9:105767956A>T	ENST00000374798.3	+	5	1113	c.1043A>T	c.(1042-1044)aAg>aTg	p.K348M	CYLC2_ENST00000487798.1_Missense_Mutation_p.K348M	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	348					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				aagaagggcaagtaggCCTTG	0.363																																																0			9											54.0	58.0	57.0					9																	105767956		2202	4298	6500	104807777	SO:0001583	missense	1539			Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.1043A>T	9.37:g.105767956A>T	ENSP00000420256:p.Lys348Met	Somatic		Capture	Illumina GAIIx	4	104807777	B2R8F4|Q5VVJ9	Missense_Mutation	SNP	NULL	p.K348M	ENST00000374798.3	37	c.1043	CCDS35085.1	9	.	.	.	.	.	.	.	.	.	.	A	11.62	1.693663	0.30052	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.17213	2.29;2.29	4.39	3.15	0.36227	.	.	.	.	.	T	0.15176	0.0366	N	0.08118	0	0.09310	N	1	D	0.56035	0.974	P	0.56612	0.802	T	0.08597	-1.0714	9	0.62326	D	0.03	.	6.7342	0.23401	0.7906:0.0:0.0:0.2094	.	348	Q14093	CYLC2_HUMAN	M	348	ENSP00000420256:K348M;ENSP00000417674:K348M	ENSP00000420256:K348M	K	+	2	0	CYLC2	104807777	1.000000	0.71417	0.296000	0.24974	0.064000	0.16182	2.694000	0.47035	1.963000	0.57068	0.477000	0.44152	AAG	-	NULL		0.363	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	protein_coding	OTTHUMT00000053463.3	A	NM_001340		104807777	+1	no_errors	NM_001340	genbank	human	reviewed	54_36p	missense	SNP	0.031	T
LRP12	29967	genome.wustl.edu	37	8	105511658	105511658	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr8:105511658G>T	ENST00000276654.5	-	4	470	c.362C>A	c.(361-363)gCt>gAt	p.A121D	LRP12_ENST00000424843.2_Missense_Mutation_p.A102D	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	121	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GGAACCACAAGCTCTGTAACT	0.378																																																0			8											161.0	155.0	157.0					8																	105511658		2203	4300	6503	105580834	SO:0001583	missense	29967			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.362C>A	8.37:g.105511658G>T	ENSP00000276654:p.Ala121Asp	Somatic		Capture	Illumina GAIIx	4	105580834	A8K137|B4DRQ2	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1	p.A121D	ENST00000276654.5	37	c.362	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	G	19.25	3.791744	0.70452	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000523830	T;T	0.18502	2.21;2.21	5.81	5.81	0.92471	CUB (5);	0.100219	0.64402	D	0.000002	T	0.33585	0.0868	M	0.62723	1.935	0.80722	D	1	D;D	0.56287	0.969;0.975	P;P	0.62298	0.839;0.9	T	0.01879	-1.1255	10	0.15499	T	0.54	-25.6189	14.2655	0.66116	0.0708:0.0:0.9292:0.0	.	102;121	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	D	102;121;121	ENSP00000399148:A102D;ENSP00000276654:A121D	ENSP00000276654:A121D	A	-	2	0	LRP12	105580834	0.970000	0.33590	1.000000	0.80357	0.998000	0.95712	1.713000	0.37951	2.752000	0.94435	0.557000	0.71058	GCT	-	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042		0.378	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	protein_coding	OTTHUMT00000380821.1	G	NM_013437		105580834	-1	no_errors	NM_013437	genbank	human	reviewed	54_36p	missense	SNP	0.881	T
BBX	56987	genome.wustl.edu	37	3	107435527	107435527	+	Missense_Mutation	SNP	G	G	A	rs76764171	byFrequency	TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr3:107435527G>A	ENST00000325805.8	+	5	523	c.236G>A	c.(235-237)cGa>cAa	p.R79Q	BBX_ENST00000402543.1_Missense_Mutation_p.R79Q|BBX_ENST00000415149.2_Missense_Mutation_p.R79Q|BBX_ENST00000416476.2_Missense_Mutation_p.R79Q|BBX_ENST00000406780.1_Missense_Mutation_p.R79Q			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	79					bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			CCAGAGCAGCGAGCCCGGAGA	0.478													G|||	2	0.000399361	0.0	0.0	5008	,	,		17738	0.0		0.002	False		,,,				2504	0.0															0			3						G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	127.0	117.0	120.0		236,236	4.2	1.0	3	dbSNP_131	120	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	BBX	NM_001142568.1,NM_020235.5	43,43	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging	79/942,79/912	107435527	3,13003	2203	4300	6503	108918217	SO:0001583	missense	56987			AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.236G>A	3.37:g.107435527G>A	ENSP00000319974:p.Arg79Gln	Somatic		Capture	Illumina GAIIx	4	108918217	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	superfamily_HMG-box,HMMSmart_HMG,HMMPfam_HMG_box,HMMPfam_DUF2028	p.R79Q	ENST00000325805.8	37	c.236	CCDS46881.1	3	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	29.4	5.004671	0.93287	0.0	3.49E-4	ENSG00000114439	ENST00000415149;ENST00000402543;ENST00000325805;ENST00000427402;ENST00000416476;ENST00000431630;ENST00000449335;ENST00000458458;ENST00000437908;ENST00000456419;ENST00000402163;ENST00000406780;ENST00000413213;ENST00000449271;ENST00000449213;ENST00000457496;ENST00000429270	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98792	-4.73;-4.74;-4.74;-5.05;-5.09;-3.36;-3.36;-5.05;-5.14;-4.73;-3.36;-3.36;-4.62;-4.63	5.06	4.17	0.49024	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (1);	0.062516	0.64402	D	0.000004	D	0.98333	0.9447	L	0.32530	0.975	0.48571	D	0.999679	D;D;D;D	0.89917	1.0;1.0;0.958;0.999	D;D;P;D	0.85130	0.996;0.997;0.653;0.988	D	0.99874	1.1101	10	0.87932	D	0	-1.1778	15.7402	0.77887	0.0:0.1371:0.8629:0.0	.	79;79;79;79	C9JA69;Q8WY36;A2RRM7;Q8WY36-2	.;BBX_HUMAN;.;.	Q	79;79;79;79;79;109;79;79;79;79;79;79;79;79;79;79;79	ENSP00000408358:R79Q;ENSP00000385317:R79Q;ENSP00000319974:R79Q;ENSP00000413320:R79Q;ENSP00000403860:R79Q;ENSP00000408297:R79Q;ENSP00000404654:R79Q;ENSP00000413274:R79Q;ENSP00000385518:R79Q;ENSP00000385530:R79Q;ENSP00000403806:R79Q;ENSP00000406554:R79Q;ENSP00000407662:R79Q;ENSP00000414673:R79Q	ENSP00000319974:R79Q	R	+	2	0	BBX	108918217	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.378000	0.97191	1.235000	0.43724	0.460000	0.39030	CGA	-	superfamily_HMG-box,HMMSmart_HMG		0.478	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBX	protein_coding	OTTHUMT00000317820.1	G	NM_020235		108918217	+1	no_errors	NM_020235	genbank	human	validated	54_36p	missense	SNP	1.000	A
SORT1	6272	genome.wustl.edu	37	1	109884644	109884644	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr1:109884644T>C	ENST00000256637.6	-	9	1158	c.1100A>G	c.(1099-1101)gAa>gGa	p.E367G	SORT1_ENST00000538502.1_Missense_Mutation_p.E230G	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	367					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		ACCTCCAGGTTCATCTACATG	0.453																																																0			1											139.0	130.0	133.0					1																	109884644		2203	4300	6503	109686167	SO:0001583	missense	6272			BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.1100A>G	1.37:g.109884644T>C	ENSP00000256637:p.Glu367Gly	Somatic		Capture	Illumina GAIIx	4	109686167	B4DWI3|C0JYZ0|Q8IZ49	Missense_Mutation	SNP	superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase,HMMSmart_SM00602,PatternScan_HEMOCYANIN_2	p.E367G	ENST00000256637.6	37	c.1100	CCDS798.1	1	.	.	.	.	.	.	.	.	.	.	t	15.48	2.847232	0.51164	.	.	ENSG00000134243	ENST00000256637;ENST00000538502	T;T	0.37235	1.21;1.21	5.88	4.73	0.59995	VPS10 (1);	0.258206	0.43747	D	0.000529	T	0.16599	0.0399	L	0.50333	1.59	0.58432	D	0.999995	B;P	0.43431	0.429;0.807	B;B	0.36134	0.108;0.218	T	0.02104	-1.1213	10	0.34782	T	0.22	-22.4955	12.1996	0.54317	0.0:0.0:0.1429:0.8571	.	230;367	B4DWI3;Q99523	.;SORT_HUMAN	G	367;230	ENSP00000256637:E367G;ENSP00000438597:E230G	ENSP00000256637:E367G	E	-	2	0	SORT1	109686167	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.287000	0.59001	1.024000	0.39682	0.370000	0.22315	GAA	-	superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase,HMMSmart_SM00602		0.453	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORT1	protein_coding	OTTHUMT00000033179.1	T	NM_002959		109686167	-1	no_errors	NM_002959	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
RPL7AP30	441034	genome.wustl.edu	37	4	113709801	113709801	+	IGR	SNP	A	A	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr4:113709801A>T								Y_RNA (32728 upstream) : ANK2 (29463 downstream)																							GGTTAATCGCAGGAGGCACTT	0.542																																																0			4																																								113929250	SO:0001628	intergenic_variant	441034																															4.37:g.113709801A>T		Somatic		Capture	Illumina GAIIx	4	113929250		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.542					LOC441034			A			113929250	-1	pseudogene	XR_016809	genbank	human	model	54_36p	rna	SNP	1.000	T
FOXP2	93986	genome.wustl.edu	37	7	114282559	114282559	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr7:114282559C>A	ENST00000393494.2	+	7	1149	c.870C>A	c.(868-870)gaC>gaA	p.D290E	FOXP2_ENST00000393498.2_Missense_Mutation_p.D269E|FOXP2_ENST00000408937.3_Missense_Mutation_p.D315E|FOXP2_ENST00000393489.3_Missense_Mutation_p.D198E|FOXP2_ENST00000360232.4_Missense_Mutation_p.D290E|FOXP2_ENST00000393500.3_Missense_Mutation_p.D215E|FOXP2_ENST00000393491.3_Missense_Mutation_p.D198E|FOXP2_ENST00000378237.3_Missense_Mutation_p.D290E|FOXP2_ENST00000350908.4_Missense_Mutation_p.D290E|FOXP2_ENST00000390668.3_Missense_Mutation_p.D314E|FOXP2_ENST00000403559.4_Missense_Mutation_p.D307E			O15409	FOXP2_HUMAN	forkhead box P2	290				DLTTNNSSSTTSSNT -> EEFPVQGPAAVCAGL (in Ref. 10; AAB91439). {ECO:0000305}.	camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						GAGGGCTAGACCTCACTACTA	0.438																																																0			7											236.0	206.0	216.0					7																	114282559		2203	4300	6503	114069795	SO:0001583	missense	93986			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.870C>A	7.37:g.114282559C>A	ENSP00000377132:p.Asp290Glu	Somatic		Capture	Illumina GAIIx	4	114069795	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_FH,superfamily_SSF46785,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2	p.D315E	ENST00000393494.2	37	c.945	CCDS5760.1	7	.	.	.	.	.	.	.	.	.	.	C	29.2	4.986948	0.93106	.	.	ENSG00000128573	ENST00000393500;ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000378237;ENST00000393489;ENST00000360232;ENST00000393495;ENST00000390668;ENST00000393491	T;T;T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	4.86	4.86	0.63082	.	0.085675	0.85682	D	0.000000	T	0.65626	0.2709	M	0.73962	2.25	0.80722	D	1	D;D;P;D;D;D;D	0.61697	0.984;0.984;0.953;0.975;0.99;0.984;0.99	D;D;D;P;D;D;D	0.70935	0.935;0.935;0.935;0.714;0.971;0.935;0.971	T	0.70208	-0.4935	10	0.72032	D	0.01	.	18.3604	0.90372	0.0:1.0:0.0:0.0	.	289;307;198;290;314;290;315	B7ZLK5;B4DLD9;Q0PRL4;O15409-6;Q8N6B5;O15409;O15409-4	.;.;.;.;.;FOXP2_HUMAN;.	E	215;290;315;307;290;267;290;198;290;147;314;198	ENSP00000377137:D215E;ENSP00000377132:D290E;ENSP00000386200:D315E;ENSP00000385069:D307E;ENSP00000265436:D290E;ENSP00000367482:D290E;ENSP00000377129:D198E;ENSP00000353367:D290E;ENSP00000375084:D314E;ENSP00000377130:D198E	ENSP00000265436:D290E	D	+	3	2	FOXP2	114069795	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.442000	0.80503	2.410000	0.81850	0.460000	0.39030	GAC	-	NULL		0.438	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	FOXP2	protein_coding	OTTHUMT00000317366.1	C	NM_014491		114069795	+1	no_errors	NM_148898	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
FEM1C	56929	genome.wustl.edu	37	5	114860860	114860860	+	Silent	SNP	A	A	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr5:114860860A>T	ENST00000274457.3	-	3	1560	c.999T>A	c.(997-999)tcT>tcA	p.S333S		NM_020177.2	NP_064562.1	Q96JP0	FEM1C_HUMAN	fem-1 homolog c (C. elegans)	333					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(5)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	18		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		TATCAGGATGAGAAGGACCAA	0.408																																																0			5											126.0	128.0	127.0					5																	114860860		2202	4300	6502	114888759	SO:0001819	synonymous_variant	56929				CCDS4118.1	5q22	2013-01-10	2006-11-08		ENSG00000145780	ENSG00000145780		"""Ankyrin repeat domain containing"""	16933	protein-coding gene	gene with protein product		608767				14527725, 11733146	Standard	NM_020177		Approved	KIAA1785, EUROIMAGE686608, EUROIMAGE783647, FEM1A	uc003krb.1	Q96JP0	OTTHUMG00000128895	ENST00000274457.3:c.999T>A	5.37:g.114860860A>T		Somatic		Capture	Illumina GAIIx	4	114888759	B2RE47|Q8N3V8|Q9H704|Q9NPL6|Q9NPL9	Silent	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.S333	ENST00000274457.3	37	c.999	CCDS4118.1	5																																																																																			-	superfamily_ANK		0.408	FEM1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEM1C	protein_coding	OTTHUMT00000250857.3	A	NM_020177		114888759	-1	no_errors	NM_020177	genbank	human	validated	54_36p	silent	SNP	1.000	T
GOLGB1	2804	genome.wustl.edu	37	3	121448761	121448761	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr3:121448761A>G	ENST00000340645.5	-	3	325	c.200T>C	c.(199-201)aTt>aCt	p.I67T	GOLGB1_ENST00000393667.3_Missense_Mutation_p.I67T|GOLGB1_ENST00000472829.1_5'UTR	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	67					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CTGTCTAATAATATCTTTTAG	0.383																																																0			3											164.0	153.0	157.0					3																	121448761		2203	4300	6503	122931451	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.200T>C	3.37:g.121448761A>G	ENSP00000341848:p.Ile67Thr	Somatic		Capture	Illumina GAIIx	4	122931451	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Spectrin repeat,superfamily_Prefoldin,HMMSmart_SM00340	p.I67T	ENST00000340645.5	37	c.200	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	A	6.554	0.470411	0.12461	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517	T;T;T	0.24723	2.47;2.47;1.84	5.25	2.81	0.32909	.	1.316990	0.04944	N	0.459067	T	0.24547	0.0595	L	0.57536	1.79	0.09310	N	1	P;P;P;P;P	0.35272	0.493;0.493;0.493;0.493;0.493	B;B;B;B;B	0.34242	0.053;0.178;0.053;0.053;0.053	T	0.26087	-1.0113	10	0.13853	T	0.58	.	5.4821	0.16729	0.7341:0.175:0.0908:0.0	.	28;67;67;67;67	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	T	67	ENSP00000341848:I67T;ENSP00000377275:I67T;ENSP00000418231:I67T	ENSP00000341848:I67T	I	-	2	0	GOLGB1	122931451	0.151000	0.22747	0.005000	0.12908	0.790000	0.44656	3.130000	0.50508	0.383000	0.24910	0.477000	0.44152	ATT	-	NULL		0.383	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	protein_coding	OTTHUMT00000355159.1	A	NM_004487		122931451	-1	no_errors	NM_004487	genbank	human	validated	54_36p	missense	SNP	0.007	G
BUB3	9184	genome.wustl.edu	37	10	124922347	124922347	+	Intron	SNP	G	G	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr10:124922347G>A	ENST00000368865.4	+	7	1180				BUB3_ENST00000368858.5_Intron|BUB3_ENST00000481952.1_3'UTR|BUB3_ENST00000368859.2_Intron|BUB3_ENST00000538238.1_Intron	NM_004725.3	NP_004716.1	O43684	BUB3_HUMAN	BUB3 mitotic checkpoint protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|regulation of chromosome segregation (GO:0051983)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly checkpoint (GO:0071173)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	9		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)				AAACCCAAGTGAGTATGCTTC	0.373																																					GBM(161;1111 1985 17553 20049 26037)											0			10											89.0	83.0	85.0					10																	124922347		2203	4300	6503	124912337	SO:0001627	intron_variant	9184			AF053304	CCDS7635.1, CCDS31306.1	10q24	2013-01-17	2013-01-17		ENSG00000154473	ENSG00000154473		"""WD repeat domain containing"""	1151	protein-coding gene	gene with protein product		603719	"""BUB3 (budding uninhibited by benzimidazoles 3, yeast) homolog"", ""budding uninhibited by benzimidazoles 3 homolog (yeast)"""			9660858	Standard	NM_004725		Approved	BUB3L	uc001lhe.2	O43684	OTTHUMG00000019197	ENST00000368865.4:c.971+3G>A	10.37:g.124922347G>A		Somatic		Capture	Illumina GAIIx	4	124912337	A6NJ42|B2R6E7|D3DRE9|O43685	Silent	SNP	HMMSmart_WD40,superfamily_WD40_like,HMMPfam_WD40	p.*325	ENST00000368865.4	37	c.974	CCDS7635.1	10																																																																																			-	NULL		0.373	BUB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BUB3	protein_coding	OTTHUMT00000050835.1	G			124912337	+1	no_errors	ENST00000407911	ensembl	human	known	54_36p	silent	SNP	1.000	A
SLC25A25	114789	genome.wustl.edu	37	9	130860913	130860913	+	Missense_Mutation	SNP	C	C	G	rs377289085		TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr9:130860913C>G	ENST00000373064.5	+	1	331	c.68C>G	c.(67-69)tCg>tGg	p.S23W	SLC25A25_ENST00000432073.2_Intron|SLC25A25_ENST00000433501.1_5'UTR|SLC25A25_ENST00000373066.5_Intron|SLC25A25_ENST00000373068.2_Intron|SLC25A25_ENST00000373069.5_Intron	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25	23					adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						TACTTTGAGTCGAAGGGGCTC	0.592																																																0			9											111.0	100.0	104.0					9																	130860913		2203	4300	6503	129900734	SO:0001583	missense	114789			AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736	ENST00000373064.5:c.68C>G	9.37:g.130860913C>G	ENSP00000362155:p.Ser23Trp	Somatic		Capture	Illumina GAIIx	4	129900734	Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,superfamily_Mitochondrial carrier,HMMPfam_Mito_carr	p.S23W	ENST00000373064.5	37	c.68	CCDS6890.1	9	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617461	0.87359	.	.	ENSG00000148339	ENST00000373064	T	0.78595	-1.19	5.37	5.37	0.77165	.	.	.	.	.	T	0.71350	0.3329	N	0.19112	0.55	0.80722	D	1	P	0.46987	0.888	P	0.44990	0.466	T	0.76217	-0.3040	9	0.66056	D	0.02	.	18.458	0.90728	0.0:1.0:0.0:0.0	.	23	Q6KCM7	SCMC2_HUMAN	W	23	ENSP00000362155:S23W	ENSP00000362155:S23W	S	+	2	0	SLC25A25	129900734	1.000000	0.71417	1.000000	0.80357	0.609000	0.37215	7.587000	0.82613	2.665000	0.90641	0.467000	0.42956	TCG	-	superfamily_EF-hand		0.592	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A25	protein_coding	OTTHUMT00000054407.1	C	NM_052901		129900734	+1	no_errors	NM_052901	genbank	human	validated	54_36p	missense	SNP	1.000	G
PRRX2	51450	genome.wustl.edu	37	9	132482984	132482984	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr9:132482984A>C	ENST00000372469.4	+	3	784	c.557A>C	c.(556-558)cAg>cCg	p.Q186P	RP11-483H20.6_ENST00000440413.1_RNA	NM_016307.3	NP_057391.1	Q99811	PRRX2_HUMAN	paired related homeobox 2	186					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(2)|pancreas(1)	3		Ovarian(14;0.00556)				GCCATCGAGCAGCCCGTGGCT	0.657																																																0			9											46.0	49.0	48.0					9																	132482984		2203	4300	6503	131522805	SO:0001583	missense	51450			AF061970	CCDS6926.1	9q34.11	2011-06-20			ENSG00000167157	ENSG00000167157		"""Homeoboxes / PRD class"""	21338	protein-coding gene	gene with protein product		604675				11063257	Standard	NM_016307		Approved	PRX2, PMX2	uc004byh.3	Q99811	OTTHUMG00000020790	ENST00000372469.4:c.557A>C	9.37:g.132482984A>C	ENSP00000361547:p.Gln186Pro	Somatic		Capture	Illumina GAIIx	4	131522805	Q5SZB5|Q9UIB3	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1,HMMPfam_OAR	p.Q186P	ENST00000372469.4	37	c.557	CCDS6926.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.57|13.57	2.276371|2.276371	0.40294|0.40294	.|.	.|.	ENSG00000167157|ENSG00000167157	ENST00000372469|ENST00000557730	D|.	0.89617|.	-2.54|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.060915|.	0.64402|.	D|.	0.000002|.	T|T	0.63954|0.63954	0.2555|0.2555	L|L	0.52573|0.52573	1.65|1.65	0.53688|0.53688	D|D	0.999973|0.999973	D|.	0.67145|.	0.996|.	D|.	0.65010|.	0.931|.	T|T	0.61821|0.61821	-0.6984|-0.6984	10|5	0.29301|.	T|.	0.29|.	.|.	14.934|14.934	0.70938|0.70938	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	186|.	Q99811|.	PRRX2_HUMAN|.	P|R	186|101	ENSP00000361547:Q186P|.	ENSP00000361547:Q186P|.	Q|S	+|+	2|1	0|0	PRRX2|PRRX2	131522805|131522805	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	6.895000|6.895000	0.75660|0.75660	2.187000|2.187000	0.69744|0.69744	0.459000|0.459000	0.35465|0.35465	CAG|AGC	-	NULL		0.657	PRRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX2	protein_coding	OTTHUMT00000054598.2	A	NM_016307		131522805	+1	no_errors	NM_016307	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ACAD11	84129	genome.wustl.edu	37	3	132350184	132350184	+	Splice_Site	SNP	C	C	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr3:132350184C>T	ENST00000264990.6	-	6	1813		c.e6+1		ACAD11_ENST00000355458.3_Splice_Site|ACAD11_ENST00000489991.1_Intron|ACAD11_ENST00000481970.2_Splice_Site|ACAD11_ENST00000545291.1_Splice_Site	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11						fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)			breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						TGTTTTTATACCTGAGTTTTC	0.274																																																0			3											47.0	50.0	49.0					3																	132350184		2203	4300	6503	133832874	SO:0001630	splice_region_variant	84129			BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.841+1G>A	3.37:g.132350184C>T		Somatic		Capture	Illumina GAIIx	4	133832874	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Splice_Site	SNP	-	e6+1	ENST00000264990.6	37	c.841+1	CCDS3074.1	3	.	.	.	.	.	.	.	.	.	.	C	11.05	1.523396	0.27299	.	.	ENSG00000240303	ENST00000355458;ENST00000264990;ENST00000481970	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4893	0.90841	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ACAD11	133832874	1.000000	0.71417	0.983000	0.44433	0.074000	0.17049	5.590000	0.67530	2.608000	0.88229	0.591000	0.81541	.	-	-		0.274	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD11	protein_coding	OTTHUMT00000357279.2	C	NM_032169	Intron	133832874	-1	no_errors	NM_032169	genbank	human	validated	54_36p	splice_site	SNP	0.861	T
XRN1	54464	genome.wustl.edu	37	3	142099015	142099015	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr3:142099015T>A	ENST00000264951.4	-	23	2741	c.2624A>T	c.(2623-2625)gAt>gTt	p.D875V	XRN1_ENST00000392981.2_Missense_Mutation_p.D875V	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	875					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						ATCACCTGAATCCTGAACCTT	0.323																																																0			3											86.0	78.0	81.0					3																	142099015		2203	4300	6503	143581705	SO:0001583	missense	54464			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.2624A>T	3.37:g.142099015T>A	ENSP00000264951:p.Asp875Val	Somatic		Capture	Illumina GAIIx	4	143581705	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	HMMPfam_XRN_N,superfamily_dsRNA-binding domain-like	p.D875V	ENST00000264951.4	37	c.2624	CCDS3123.1	3	.	.	.	.	.	.	.	.	.	.	T	14.86	2.662802	0.47572	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.32515	1.45;1.45	5.37	4.18	0.49190	.	0.109600	0.64402	N	0.000010	T	0.36826	0.0981	M	0.79693	2.465	0.80722	D	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.12156	0.007;0.007;0.005	T	0.20907	-1.0261	10	0.54805	T	0.06	-6.5816	11.4739	0.50286	0.1349:0.0:0.0:0.8651	.	736;875;875	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	V	875	ENSP00000264951:D875V;ENSP00000376707:D875V	ENSP00000264951:D875V	D	-	2	0	XRN1	143581705	1.000000	0.71417	0.991000	0.47740	0.803000	0.45373	6.162000	0.71874	0.843000	0.35070	0.477000	0.44152	GAT	-	NULL		0.323	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	protein_coding	OTTHUMT00000354087.2	T	NM_019001		143581705	-1	no_errors	NM_019001	genbank	human	validated	54_36p	missense	SNP	1.000	A
ARC	23237	genome.wustl.edu	37	8	143694873	143694873	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr8:143694873A>T	ENST00000356613.2	-	1	1960	c.760T>A	c.(760-762)Tgg>Agg	p.W254R	ARC_ENST00000581404.1_5'Flank	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				TTGAACTCCCACCACTTCTTG	0.607																																																0			8											41.0	43.0	42.0					8																	143694873		2201	4300	6501	143691875	SO:0001583	missense	23237			AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.760T>A	8.37:g.143694873A>T	ENSP00000349022:p.Trp254Arg	Somatic		Capture	Illumina GAIIx	4	143691875	B4DFL0|O60937	Missense_Mutation	SNP	NULL	p.W254R	ENST00000356613.2	37	c.760	CCDS34950.1	8	.	.	.	.	.	.	.	.	.	.	A	18.90	3.721534	0.68959	.	.	ENSG00000198576	ENST00000356613	.	.	.	4.92	4.92	0.64577	.	0.000000	0.53938	U	0.000055	T	0.63212	0.2492	N	0.24115	0.695	0.45354	D	0.998349	D	0.71674	0.998	D	0.81914	0.995	T	0.68330	-0.5437	9	0.87932	D	0	.	13.7151	0.62691	1.0:0.0:0.0:0.0	.	254	Q7LC44	ARC_HUMAN	R	254	.	ENSP00000349022:W254R	W	-	1	0	ARC	143691875	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.871000	0.39539	1.840000	0.53500	0.379000	0.24179	TGG	-	NULL		0.607	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ARC	protein_coding	OTTHUMT00000259274.2	A			143691875	-1	no_errors	NM_015193	genbank	human	validated	54_36p	missense	SNP	1.000	T
ZNF212	7988	genome.wustl.edu	37	7	148950948	148950948	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr7:148950948G>C	ENST00000335870.2	+	5	1058	c.930G>C	c.(928-930)aaG>aaC	p.K310N		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			AGCTGAAAAAGGACACTTCCC	0.567																																																0			7											51.0	52.0	52.0					7																	148950948		2203	4300	6503	148581881	SO:0001583	missense	7988			U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.930G>C	7.37:g.148950948G>C	ENSP00000338572:p.Lys310Asn	Somatic		Capture	Illumina GAIIx	4	148581881	B2RCF4|Q13396|Q8N664	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMSmart_SM00349,HMMPfam_KRAB,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.K310N	ENST00000335870.2	37	c.930	CCDS5896.1	7	.	.	.	.	.	.	.	.	.	.	G	7.700	0.692935	0.15039	.	.	ENSG00000170260	ENST00000335870	T	0.07327	3.2	5.31	4.44	0.53790	.	0.432627	0.22233	N	0.062796	T	0.04272	0.0118	N	0.08118	0	0.09310	N	1	B	0.23735	0.09	B	0.24155	0.051	T	0.42447	-0.9451	10	0.23302	T	0.38	-12.7408	8.1638	0.31215	0.1794:0.0:0.8206:0.0	.	310	Q9UDV6	ZN212_HUMAN	N	310	ENSP00000338572:K310N	ENSP00000338572:K310N	K	+	3	2	ZNF212	148581881	0.019000	0.18553	0.175000	0.22980	0.460000	0.32559	1.960000	0.40422	1.245000	0.43885	0.655000	0.94253	AAG	-	NULL		0.567	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF212	protein_coding	OTTHUMT00000352710.1	G	NM_012256		148581881	+1	no_errors	NM_012256	genbank	human	reviewed	54_36p	missense	SNP	0.446	C
CPA3	1359	genome.wustl.edu	37	3	148614446	148614446	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr3:148614446G>A	ENST00000296046.3	+	11	1258	c.1206G>A	c.(1204-1206)atG>atA	p.M402I	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	402					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			GAGAGACCATGCTAGCTGTCA	0.418																																																0			3											112.0	115.0	114.0					3																	148614446		2203	4300	6503	150097136	SO:0001583	missense	1359				CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.1206G>A	3.37:g.148614446G>A	ENSP00000296046:p.Met402Ile	Somatic		Capture	Illumina GAIIx	4	150097136	Q96E94	Missense_Mutation	SNP	superfamily_Protease propeptides/inhibitors,HMMPfam_Propep_M14,superfamily_Zn-dependent exopeptidases,HMMSmart_SM00631,HMMPfam_Peptidase_M14,PatternScan_CARBOXYPEPT_ZN_2	p.M402I	ENST00000296046.3	37	c.1206	CCDS3138.1	3	.	.	.	.	.	.	.	.	.	.	G	17.03	3.285230	0.59867	.	.	ENSG00000163751	ENST00000296046	T	0.10668	2.85	5.37	5.37	0.77165	Peptidase M14, carboxypeptidase A (1);	0.088046	0.85682	D	0.000000	T	0.18676	0.0448	M	0.70275	2.135	0.54753	D	0.99998	B	0.21452	0.056	B	0.34873	0.191	T	0.01829	-1.1265	10	0.41790	T	0.15	.	12.9155	0.58203	0.0:0.0:0.8374:0.1626	.	402	P15088	CBPA3_HUMAN	I	402	ENSP00000296046:M402I	ENSP00000296046:M402I	M	+	3	0	CPA3	150097136	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	2.743000	0.47442	2.528000	0.85240	0.591000	0.81541	ATG	-	superfamily_Zn-dependent exopeptidases,HMMPfam_Peptidase_M14		0.418	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA3	protein_coding	OTTHUMT00000355974.1	G	NM_001870		150097136	+1	no_errors	NM_001870	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MED12L	116931	genome.wustl.edu	37	3	150911398	150911398	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr3:150911398C>G	ENST00000474524.1	+	14	2128	c.2090C>G	c.(2089-2091)tCt>tGt	p.S697C	MED12L_ENST00000422248.2_Missense_Mutation_p.S697C|MED12L_ENST00000309237.4_Missense_Mutation_p.S732C|MED12L_ENST00000273432.4_Missense_Mutation_p.S557C	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	697						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ATTTTTCCATCTAATTATGAC	0.378																																																0			3											135.0	135.0	135.0					3																	150911398		2203	4300	6503	152394088	SO:0001583	missense	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.2090C>G	3.37:g.150911398C>G	ENSP00000417235:p.Ser697Cys	Somatic		Capture	Illumina GAIIx	4	152394088	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	HMMPfam_Med12	p.S697C	ENST00000474524.1	37	c.2090	CCDS33876.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.0|21.0	4.075591|4.075591	0.76415|0.76415	.|.	.|.	ENSG00000144893|ENSG00000144893	ENST00000480026|ENST00000422248;ENST00000309237;ENST00000474524;ENST00000273432	.|T;T;T;T	.|0.33216	.|1.42;1.42;1.42;1.42	5.3|5.3	5.3|5.3	0.74995|0.74995	.|Mediator complex, subunit Med12, LCEWAV-domain (1);	.|0.323795	.|0.32473	.|N	.|0.006050	T|T	0.54095|0.54095	0.1837|0.1837	L|L	0.58101|0.58101	1.795|1.795	0.52501|0.52501	D|D	0.999957|0.999957	.|P;D;D;D	.|0.76494	.|0.931;0.999;0.999;0.988	.|P;D;D;P	.|0.83275	.|0.77;0.996;0.995;0.708	T|T	0.52003|0.52003	-0.8633|-0.8633	5|10	.|0.52906	.|T	.|0.07	-7.2714|-7.2714	18.9155|18.9155	0.92505|0.92505	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|557;697;697;732	.|F8WAE6;Q86YW9;Q86YW9-2;Q86YW9-3	.|.;MD12L_HUMAN;.;.	M|C	46|697;732;697;557	.|ENSP00000403308:S697C;ENSP00000310760:S732C;ENSP00000417235:S697C;ENSP00000273432:S557C	.|ENSP00000273432:S557C	I|S	+|+	3|2	3|0	MED12L|MED12L	152394088|152394088	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	3.227000|3.227000	0.51262|0.51262	2.615000|2.615000	0.88500|0.88500	0.609000|0.609000	0.83330|0.83330	ATC|TCT	-	NULL		0.378	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	protein_coding	OTTHUMT00000357707.2	C	NM_053002		152394088	+1	no_errors	NM_053002	genbank	human	validated	54_36p	missense	SNP	0.999	G
TMEM154	201799	genome.wustl.edu	37	4	153601074	153601074	+	Silent	SNP	G	G	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr4:153601074G>C	ENST00000304385.3	-	1	243	c.12C>G	c.(10-12)ccC>ccG	p.P4P	TMEM154_ENST00000504064.1_Silent_p.P4P	NM_152680.2	NP_689893.1	Q6P9G4	TM154_HUMAN	transmembrane protein 154	4						integral component of membrane (GO:0016021)				kidney(2)|large_intestine(1)	3	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				GGGCTGCGCGGGGAGCCTGCA	0.637																																																0			4											11.0	15.0	13.0					4																	153601074		2190	4286	6476	153820524	SO:0001819	synonymous_variant	201799			AK056590	CCDS3779.1	4q31.3	2008-02-05			ENSG00000170006	ENSG00000170006			26489	protein-coding gene	gene with protein product						12477932	Standard	NM_152680		Approved	FLJ32028	uc003imw.2	Q6P9G4	OTTHUMG00000161463	ENST00000304385.3:c.12C>G	4.37:g.153601074G>C		Somatic		Capture	Illumina GAIIx	4	153820524	Q8WUT7|Q96MQ8	Silent	SNP	NULL	p.P4	ENST00000304385.3	37	c.12	CCDS3779.1	4																																																																																			-	NULL		0.637	TMEM154-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM154	protein_coding	OTTHUMT00000365024.1	G	NM_152680		153820524	-1	no_errors	NM_152680	genbank	human	provisional	54_36p	silent	SNP	0.000	C
MME	4311	genome.wustl.edu	37	3	154834774	154834774	+	Splice_Site	SNP	A	A	C	rs142506311		TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr3:154834774A>C	ENST00000460393.1	+	7	773	c.653A>C	c.(652-654)cAt>cCt	p.H218P	MME_ENST00000462745.1_Splice_Site_p.H218P|MME_ENST00000492661.1_Splice_Site_p.H218P|MME_ENST00000493237.1_Splice_Site_p.H218P|MME_ENST00000360490.2_Splice_Site_p.H218P	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	218					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	CATGTAATTCATGTAAGTTTG	0.264																																																0			3											49.0	51.0	50.0					3																	154834774		2201	4295	6496	156317468	SO:0001630	splice_region_variant	4311				CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.654+1A>C	3.37:g.154834774A>C		Somatic		Capture	Illumina GAIIx	4	156317468	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	"superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Peptidase_M13_N,HMMPfam_Peptidase_M13"	p.H218P	ENST00000460393.1	37	c.653	CCDS3172.1	3	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220059	0.79464	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000481828;ENST00000462745;ENST00000493237;ENST00000360490	T;T;T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77;-0.77;-0.77	6.08	6.08	0.98989	Peptidase M13 (1);	0.000000	0.85682	D	0.000000	D	0.84556	0.5498	M	0.63843	1.955	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.84747	0.0754	10	0.51188	T	0.08	-37.1974	16.6512	0.85203	1.0:0.0:0.0:0.0	.	218	P08473	NEP_HUMAN	P	218	ENSP00000420389:H218P;ENSP00000418525:H218P;ENSP00000420101:H218P;ENSP00000419653:H218P;ENSP00000417079:H218P;ENSP00000353679:H218P	ENSP00000353679:H218P	H	+	2	0	MME	156317468	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	8.548000	0.90669	2.333000	0.79357	0.482000	0.46254	CAT	-	"superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Peptidase_M13_N"		0.264	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MME	protein_coding	OTTHUMT00000351076.1	A	NM_000902	Missense_Mutation	156317468	+1	no_errors	NM_000902	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CSRNP3	80034	genome.wustl.edu	37	2	166532870	166532870	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr2:166532870C>A	ENST00000342316.4	+	4	729	c.457C>A	c.(457-459)Ctg>Atg	p.L153M	CSRNP3_ENST00000314499.7_Missense_Mutation_p.L153M|CSRNP3_ENST00000409420.1_Missense_Mutation_p.L185M	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	153					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						CACTCTTACACTGGATGACAT	0.408																																																0			2											206.0	211.0	209.0					2																	166532870		2203	4300	6503	166241116	SO:0001583	missense	80034			AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.457C>A	2.37:g.166532870C>A	ENSP00000344042:p.Leu153Met	Somatic		Capture	Illumina GAIIx	4	166241116	B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	NULL	p.L153M	ENST00000342316.4	37	c.457	CCDS2225.1	2	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703606	0.48412	.	.	ENSG00000178662	ENST00000421875;ENST00000431452;ENST00000314499;ENST00000342316;ENST00000409420	T;T;T;T	0.20069	2.1;2.1;2.1;2.1	5.77	2.86	0.33363	.	0.279990	0.35646	N	0.003068	T	0.25121	0.0610	M	0.63428	1.95	0.32593	N	0.526959	B	0.25441	0.126	B	0.34779	0.189	T	0.33111	-0.9881	10	0.49607	T	0.09	-10.1871	10.3115	0.43712	0.0:0.4873:0.3923:0.1203	.	153	Q8WYN3	CSRN3_HUMAN	M	153;160;153;153;185	ENSP00000412081:L153M;ENSP00000318258:L153M;ENSP00000344042:L153M;ENSP00000387195:L185M	ENSP00000318258:L153M	L	+	1	2	CSRNP3	166241116	0.978000	0.34361	0.986000	0.45419	0.966000	0.64601	1.856000	0.39389	1.575000	0.49775	-0.165000	0.13383	CTG	-	NULL		0.408	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP3	protein_coding	OTTHUMT00000255191.2	C	NM_024969		166241116	+1	no_errors	NM_024969	genbank	human	provisional	54_36p	missense	SNP	0.805	A
PHYKPL	85007	genome.wustl.edu	37	5	177658437	177658437	+	Silent	SNP	T	T	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr5:177658437T>C	ENST00000308158.5	-	2	381	c.147A>G	c.(145-147)gaA>gaG	p.E49E	PHYKPL_ENST00000481811.1_5'Flank|PHYKPL_ENST00000476170.2_Silent_p.E49E	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	49						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	AATCGATGTATTCTGCCCCCT	0.557																																																0			5											267.0	209.0	229.0					5																	177658437		2203	4300	6503	177591043	SO:0001819	synonymous_variant	85007			BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.147A>G	5.37:g.177658437T>C		Somatic		Capture	Illumina GAIIx	4	177591043	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Silent	SNP	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_3,PatternScan_AA_TRANSFER_CLASS_3	p.E49	ENST00000308158.5	37	c.147	CCDS4434.1	5																																																																																			-	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_3		0.557	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2L2	protein_coding	OTTHUMT00000253477.1	T	NM_032921		177591043	-1	no_errors	NM_153373	genbank	human	validated	54_36p	silent	SNP	0.383	C
CCDC141	285025	genome.wustl.edu	37	2	179732906	179732906	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr2:179732906C>G	ENST00000420890.2	-	16	2538	c.2421G>C	c.(2419-2421)gaG>gaC	p.E807D	CCDC141_ENST00000295723.5_Missense_Mutation_p.E232D	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	807								p.E232D(1)|p.E807D(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CAAACTCCAGCTCTCTTGATT	0.433																																																2	Substitution - Missense(2)	lung(2)	2											103.0	94.0	97.0					2																	179732906		2203	4300	6503	179441151	SO:0001583	missense	285025			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2421G>C	2.37:g.179732906C>G	ENSP00000395995:p.Glu807Asp	Somatic		Capture	Illumina GAIIx	4	179441151	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	HMMPfam_I-set	p.E232D	ENST00000420890.2	37	c.696		2	.	.	.	.	.	.	.	.	.	.	C	8.539	0.872730	0.17322	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758	T;T;T;T	0.52057	0.68;1.28;1.28;1.26	5.5	-0.405	0.12392	.	0.310590	0.27253	N	0.020207	T	0.27063	0.0663	L	0.29908	0.895	0.22185	N	0.999302	B	0.13594	0.008	B	0.17433	0.018	T	0.08911	-1.0699	10	0.41790	T	0.15	-2.538	1.8641	0.03195	0.132:0.1525:0.1372:0.5783	.	232	Q6ZP82	CC141_HUMAN	D	807;251;232;807	ENSP00000395995:E807D;ENSP00000344627:E251D;ENSP00000295723:E232D;ENSP00000390190:E807D	ENSP00000295723:E232D	E	-	3	2	CCDC141	179441151	0.998000	0.40836	0.022000	0.16811	0.483000	0.33249	1.075000	0.30716	-0.158000	0.11040	-1.402000	0.01139	GAG	-	NULL		0.433	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	protein_coding		C	NM_173648		179441151	-1	no_errors	NM_173648	genbank	human	provisional	54_36p	missense	SNP	0.926	G
EIF2B5	8893	genome.wustl.edu	37	3	183858305	183858305	+	Missense_Mutation	SNP	C	C	T	rs113994063		TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr3:183858305C>T	ENST00000273783.3	+	7	1065	c.943C>T	c.(943-945)Cgc>Tgc	p.R315C	EIF2B5_ENST00000444495.1_Missense_Mutation_p.R315C	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	315			R -> C (in VWM). {ECO:0000269|PubMed:19158808}.|R -> G (in VWM). {ECO:0000269|PubMed:11704758}.|R -> H (in VWM). {ECO:0000269|PubMed:11704758}.		astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)	p.R315S(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			TGACGTCATCCGCCGATGGGT	0.562																																																1	Substitution - Missense(1)	lung(1)	3	GRCh37	CM013536|CM041320	EIF2B5	M	rs113994063						242.0	228.0	233.0					3																	183858305		2203	4300	6503	185340999	SO:0001583	missense	8893			U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.943C>T	3.37:g.183858305C>T	ENSP00000273783:p.Arg315Cys	Somatic		Capture	Illumina GAIIx	4	185340999	Q541Z1|Q96D04	Missense_Mutation	SNP	superfamily_SSF53448,superfamily_Trimer_LpxA_like,HMMPfam_Hexapep,superfamily_ARM-type_fold,HMMSmart_eIF5C,HMMPfam_W2	p.R315C	ENST00000273783.3	37	c.943	CCDS3252.1	3	.	.	.	.	.	.	.	.	.	.	c	28.2	4.898222	0.91962	.	.	ENSG00000145191	ENST00000273783;ENST00000444495;ENST00000544027	D;D	0.96136	-3.92;-3.92	5.8	5.8	0.92144	Trimeric LpxA-like (1);	0.000000	0.85682	D	0.000000	D	0.96448	0.8841	M	0.79475	2.455	0.80722	D	1	D;D	0.69078	0.997;0.997	P;P	0.51657	0.676;0.642	D	0.96473	0.9350	10	0.62326	D	0.03	.	16.3538	0.83227	0.1324:0.8676:0.0:0.0	.	315;315	E9PC74;Q13144	.;EI2BE_HUMAN	C	315;315;71	ENSP00000273783:R315C;ENSP00000409142:R315C	ENSP00000273783:R315C	R	+	1	0	EIF2B5	185340999	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.897000	0.63231	2.746000	0.94184	0.563000	0.77884	CGC	-	superfamily_SSF53448		0.562	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B5	protein_coding	OTTHUMT00000346168.1	C			185340999	+1	no_errors	NM_003907	genbank	human	validated	54_36p	missense	SNP	1.000	T
BRINP3	339479	genome.wustl.edu	37	1	190067300	190067300	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr1:190067300C>T	ENST00000367462.3	-	8	2380	c.2149G>A	c.(2149-2151)Ggt>Agt	p.G717S	BRINP3_ENST00000534846.1_Missense_Mutation_p.G615S	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	717					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											CGACGCTGACCAGGTGGGGAG	0.478																																																0			1											104.0	100.0	102.0					1																	190067300		2203	4300	6503	188333923	SO:0001583	missense	339479			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2149G>A	1.37:g.190067300C>T	ENSP00000356432:p.Gly717Ser	Somatic		Capture	Illumina GAIIx	4	188333923	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	HMMPfam_MACPF,HMMSmart_SM00457	p.G717S	ENST00000367462.3	37	c.2149	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419231	0.83559	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.21031	2.27;2.03	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.45617	0.1351	M	0.72894	2.215	0.80722	D	1	D;D	0.71674	0.998;0.996	D;P	0.63957	0.92;0.834	T	0.36890	-0.9729	10	0.72032	D	0.01	.	17.3704	0.87376	0.0:1.0:0.0:0.0	.	615;717	B7Z260;Q76B58	.;FAM5C_HUMAN	S	717;615	ENSP00000356432:G717S;ENSP00000438022:G615S	ENSP00000356432:G717S	G	-	1	0	FAM5C	188333923	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	7.734000	0.84928	2.695000	0.91970	0.650000	0.86243	GGT	-	NULL		0.478	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	protein_coding	OTTHUMT00000086278.1	C	NM_199051		188333923	-1	no_errors	NM_199051	genbank	human	provisional	54_36p	missense	SNP	1.000	T
STK36	27148	genome.wustl.edu	37	2	219549830	219549830	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1516-01A-01D-1526-09	TCGA-04-1516-11B-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4e700ddb-522d-4bb6-808c-dae3296a813a	d8159f60-4e36-4ac8-ab39-557cf0d41775	g.chr2:219549830G>C	ENST00000295709.3	+	11	1538	c.1259G>C	c.(1258-1260)tGg>tCg	p.W420S	STK36_ENST00000440309.1_Missense_Mutation_p.W420S|STK36_ENST00000392105.3_Missense_Mutation_p.W420S|STK36_ENST00000392106.2_Missense_Mutation_p.W420S	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		GACAATGAGTGGCAGCACCTG	0.527																																																0			2											108.0	90.0	96.0					2																	219549830		2203	4300	6503	219258074	SO:0001583	missense	27148			AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.1259G>C	2.37:g.219549830G>C	ENSP00000295709:p.Trp420Ser	Somatic		Capture	Illumina GAIIx	4	219258074		Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,superfamily_ARM repeat,HMMPfam_HEAT	p.W420S	ENST00000295709.3	37	c.1259	CCDS2421.1	2	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188454	0.57909	.	.	ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	T;T;T;T	0.75589	-0.32;-0.32;-0.95;-0.32	5.02	5.02	0.67125	.	0.000000	0.39544	N	0.001321	T	0.80177	0.4575	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82010	-0.0669	10	0.62326	D	0.03	-8.7512	17.5159	0.87773	0.0:0.0:1.0:0.0	.	420;420	Q9NRP7-2;Q9NRP7	.;STK36_HUMAN	S	420	ENSP00000295709:W420S;ENSP00000375955:W420S;ENSP00000375954:W420S;ENSP00000394095:W420S	ENSP00000295709:W420S	W	+	2	0	STK36	219258074	1.000000	0.71417	1.000000	0.80357	0.357000	0.29423	6.700000	0.74619	2.608000	0.88229	0.650000	0.86243	TGG	-	NULL		0.527	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK36	protein_coding	OTTHUMT00000256723.2	G			219258074	+1	no_errors	NM_015690	genbank	human	validated	54_36p	missense	SNP	1.000	C
