#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF3	401940	hgsc.bcm.edu	37	1	13330767	13330767	+	Silent	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:13330767G>C	ENST00000353410.5	-	2	539	c.513C>G	c.(511-513)gtC>gtG	p.V171V	PRAMEF3_ENST00000376173.3_Silent_p.V173V			Q5TYW8	PRAM3_HUMAN	PRAME family member 3	171					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.V171V(1)		ovary(1)	1	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTCTGTGCTGGACCCACCCAG	0.438																																																1	Substitution - coding silent(1)	ovary(1)	1											6.0	5.0	6.0					1																	13330767		992	966	1958	13203354	SO:0001819	synonymous_variant	401940					1p36.21	2013-01-17			ENSG00000204503			"""-"""	14087	protein-coding gene	gene with protein product							Standard			Approved		uc001aut.1	Q5TYW8	OTTHUMG00000009404	ENST00000353410.5:c.513C>G	1.37:g.13330767G>C		Somatic		WXS	SOLID	Phase_IV	13203354		Silent	SNP	ENST00000353410.5	37																																																																																					0.438	PRAMEF3-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000026088.1	NM_001013692	
AHNAK2	113146	hgsc.bcm.edu	37	14	105404929	105404930	+	Frame_Shift_Ins	INS	-	-	G	rs372736452		TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr14:105404929_105404930insG	ENST00000333244.5	-	7	16977_16978	c.16858_16859insC	c.(16858-16860)caafs	p.Q5620fs	AHNAK2_ENST00000557457.1_Frame_Shift_Ins_p.Q618fs	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5620						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.Q590fs*10(1)|p.Q5620fs*10(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGTTGCCTCTTGGCTATCATCA	0.485																																																2	Insertion - Frameshift(2)	ovary(2)	14																																								104475975	SO:0001589	frameshift_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.16859dupC	14.37:g.105404931_105404931dupG	ENSP00000353114:p.Gln5620fs	Somatic		WXS	SOLID	Phase_IV	104475974	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Frame_Shift_Ins	INS	ENST00000333244.5	37	CCDS45177.1																																																																																				0.485	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ANKRD17	26057	hgsc.bcm.edu	37	4	73951137	73951137	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr4:73951137C>T	ENST00000358602.4	-	30	7104	c.6988G>A	c.(6988-6990)Ggt>Agt	p.G2330S	ANKRD17_ENST00000330838.6_Missense_Mutation_p.G2079S|ANKRD17_ENST00000509867.2_Missense_Mutation_p.G2217S	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	2330					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G2330S(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GTTACAGAACCATATGGCGAG	0.403																																																1	Substitution - Missense(1)	ovary(1)	4											81.0	81.0	81.0					4																	73951137		2203	4300	6503	74170001	SO:0001583	missense	26057			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.6988G>A	4.37:g.73951137C>T	ENSP00000351416:p.Gly2330Ser	Somatic		WXS	SOLID	Phase_IV	74170001	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	C	9.000	0.979793	0.18812	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.64438	-0.02;0.02;-0.1	5.81	4.97	0.65823	.	0.169262	0.40554	N	0.001062	T	0.37758	0.1015	N	0.08118	0	0.25861	N	0.983825	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.003;0.001;0.0	T	0.15235	-1.0444	10	0.10902	T	0.67	.	11.2501	0.49020	0.0:0.8604:0.0:0.1396	.	2329;2079;2330;2217	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	S	2330;1737;2079;2217;714	ENSP00000351416:G2330S;ENSP00000332265:G2079S;ENSP00000427151:G2217S	ENSP00000332265:G2079S	G	-	1	0	ANKRD17	74170001	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	2.741000	0.47426	1.605000	0.50152	-0.136000	0.14681	GGT		0.403	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
ATP13A2	23400	hgsc.bcm.edu	37	1	17319010	17319010	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:17319010G>C	ENST00000326735.8	-	17	1849	c.1816C>G	c.(1816-1818)Cca>Gca	p.P606A	ATP13A2_ENST00000452699.1_Missense_Mutation_p.P601A|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000341676.5_Missense_Mutation_p.P601A			Q9NQ11	AT132_HUMAN	ATPase type 13A2	606					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.P606A(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		TCCCAAAGTGGGGGTCTCATC	0.652																																																1	Substitution - Missense(1)	ovary(1)	1											87.0	90.0	89.0					1																	17319010		2203	4300	6503	17191597	SO:0001583	missense	23400			AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.1816C>G	1.37:g.17319010G>C	ENSP00000327214:p.Pro606Ala	Somatic		WXS	SOLID	Phase_IV	17191597	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	37	CCDS175.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899312	0.33535	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000503552	D;D;D;T	0.93307	-2.96;-3.2;-2.96;0.29	5.63	5.63	0.86233	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.211190	0.49305	D	0.000143	D	0.93341	0.7877	M	0.68593	2.085	0.47441	D	0.999421	B;P;B	0.35872	0.002;0.525;0.025	B;B;B	0.39562	0.017;0.303;0.057	D	0.93150	0.6549	10	0.56958	D	0.05	-18.6195	18.2178	0.89892	0.0:0.0:1.0:0.0	.	601;601;606	Q5JXY1;Q6S9Z9;Q9NQ11	.;.;AT132_HUMAN	A	606;601;601;96	ENSP00000327214:P606A;ENSP00000341115:P601A;ENSP00000413307:P601A;ENSP00000421126:P96A	ENSP00000327214:P606A	P	-	1	0	ATP13A2	17191597	1.000000	0.71417	0.996000	0.52242	0.381000	0.30169	4.403000	0.59729	2.656000	0.90262	0.491000	0.48974	CCA		0.652	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089	
BPIFB3	359710	hgsc.bcm.edu	37	20	31656703	31656703	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr20:31656703T>A	ENST00000375494.3	+	10	1073	c.1073T>A	c.(1072-1074)gTc>gAc	p.V358D		NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	358					innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.V358D(1)									AAGGCCTTGGTCTCCCTCCCA	0.602																																																1	Substitution - Missense(1)	ovary(1)	20											135.0	97.0	110.0					20																	31656703		2203	4300	6503	31120364	SO:0001583	missense	359710			AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.1073T>A	20.37:g.31656703T>A	ENSP00000364643:p.Val358Asp	Somatic		WXS	SOLID	Phase_IV	31120364	Q5TDX7	Missense_Mutation	SNP	ENST00000375494.3	37	CCDS13212.1	.	.	.	.	.	.	.	.	.	.	T	13.45	2.239931	0.39598	.	.	ENSG00000186190	ENST00000375494	T	0.12039	2.72	4.25	4.25	0.50352	.	0.727247	0.11826	N	0.525686	T	0.29093	0.0723	M	0.63843	1.955	0.53688	D	0.999973	P	0.51791	0.948	P	0.57846	0.828	T	0.01635	-1.1307	10	0.87932	D	0	-15.4807	9.9298	0.41514	0.0:0.0:0.0:1.0	.	358	P59826	BPIB3_HUMAN	D	358	ENSP00000364643:V358D	ENSP00000364643:V358D	V	+	2	0	BPIFB3	31120364	0.907000	0.30839	0.894000	0.35097	0.050000	0.14768	3.346000	0.52190	1.918000	0.55548	0.482000	0.46254	GTC		0.602	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658	
ATP9A	10079	hgsc.bcm.edu	37	20	50255883	50255883	+	Splice_Site	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr20:50255883C>T	ENST00000338821.5	-	15	1931	c.1667G>A	c.(1666-1668)cGg>cAg	p.R556Q	ATP9A_ENST00000311637.5_Splice_Site_p.R420Q|ATP9A_ENST00000402822.1_Splice_Site_p.R435Q	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	556					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R556Q(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ACGACTCACCCGCACGATGAT	0.498											OREG0026043	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	20											190.0	155.0	166.0					20																	50255883		2203	4300	6503	49689290	SO:0001630	splice_region_variant	10079			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1668+1G>A	20.37:g.50255883C>T		Somatic	968	WXS	SOLID	Phase_IV	49689290	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965202	0.74131	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	T;T;T	0.70399	-0.48;-0.48;-0.48	5.36	4.42	0.53409	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.78861	0.4350	L	0.54908	1.71	0.80722	D	1	D;P	0.69078	0.997;0.941	D;P	0.69479	0.964;0.655	T	0.76708	-0.2860	10	0.31617	T	0.26	-32.4413	14.0462	0.64706	0.0:0.9272:0.0:0.0728	.	435;556	O75110-2;O75110	.;ATP9A_HUMAN	Q	420;556;435	ENSP00000309086:R420Q;ENSP00000342481:R556Q;ENSP00000385875:R435Q	ENSP00000309086:R420Q	R	-	2	0	ATP9A	49689290	1.000000	0.71417	0.987000	0.45799	0.821000	0.46438	5.972000	0.70448	1.259000	0.44117	0.655000	0.94253	CGG		0.498	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	Missense_Mutation
SLC35F6	54978	hgsc.bcm.edu	37	2	26999335	26999335	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr2:26999335G>T	ENST00000344420.5	+	5	693	c.631G>T	c.(631-633)Gca>Tca	p.A211S	CENPA_ENST00000475662.1_Intron|SLC35F6_ENST00000482746.1_Intron|SLC35F6_ENST00000416475.2_Missense_Mutation_p.A128S	NM_017877.3	NP_060347.2	Q8N357	S35F6_HUMAN	solute carrier family 35, member F6	211					negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)		p.A211S(1)									CCCACTGCGGGCAGTTGGCAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	2											97.0	78.0	85.0					2																	26999335		2203	4300	6503	26852839	SO:0001583	missense	54978			AK075164	CCDS1728.1	2p24.1	2012-12-13	2012-12-07	2012-12-07	ENSG00000213699	ENSG00000213699			26055	protein-coding gene	gene with protein product	"""ANT2-binding protein"", ""transport and golgi organization 9 homolog (Drosophila)"""		"""chromosome 2 open reading frame 18"""	C2orf18		15911612, 19154410	Standard	NM_017877		Approved	FLJ20555, ANT2BP, TANGO9	uc002rhp.1	Q8N357	OTTHUMG00000128407	ENST00000344420.5:c.631G>T	2.37:g.26999335G>T	ENSP00000345528:p.Ala211Ser	Somatic		WXS	SOLID	Phase_IV	26852839	D6W543|Q53GK2|Q8NBX6|Q9NWX0	Missense_Mutation	SNP	ENST00000344420.5	37	CCDS1728.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226020	0.79576	.	.	ENSG00000213699	ENST00000344420;ENST00000416475	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.85221	0.5647	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.99;0.993	D	0.87339	0.2330	9	0.46703	T	0.11	.	17.1547	0.86788	0.0:0.0:1.0:0.0	.	128;211	B4DLH2;Q8N357	.;CB018_HUMAN	S	211;128	.	ENSP00000345528:A211S	A	+	1	0	C2orf18	26852839	1.000000	0.71417	1.000000	0.80357	0.476000	0.33039	8.830000	0.92063	2.395000	0.81488	0.561000	0.74099	GCA		0.582	SLC35F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250187.2	NM_017877	
CABLES1	91768	hgsc.bcm.edu	37	18	20833760	20833760	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr18:20833760G>A	ENST00000256925.7	+	9	1621	c.1621G>A	c.(1621-1623)Gcc>Acc	p.A541T	CABLES1_ENST00000420687.2_Missense_Mutation_p.A276T|CABLES1_ENST00000585061.1_Intron|TMEM241_ENST00000450466.2_Intron|CABLES1_ENST00000400473.2_Missense_Mutation_p.A214T	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	541					blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)	p.A541T(1)		breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GGTGGCCATGGCCTTCGTCTA	0.547																																																1	Substitution - Missense(1)	ovary(1)	18											52.0	55.0	54.0					18																	20833760		1993	4172	6165	19087758	SO:0001583	missense	91768			BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.1621G>A	18.37:g.20833760G>A	ENSP00000256925:p.Ala541Thr	Somatic		WXS	SOLID	Phase_IV	19087758	B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	Missense_Mutation	SNP	ENST00000256925.7	37	CCDS42417.1	.	.	.	.	.	.	.	.	.	.	G	34	5.398697	0.96030	.	.	ENSG00000134508	ENST00000400473;ENST00000256925;ENST00000420687	T;T;T	0.43294	0.95;0.95;0.95	4.93	4.93	0.64822	Cyclin, N-terminal (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.68924	0.3054	M	0.83312	2.635	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.91635	0.987;0.999	T	0.73802	-0.3868	10	0.87932	D	0	-8.7419	18.7053	0.91635	0.0:0.0:1.0:0.0	.	276;541	Q8TDN4-2;Q8TDN4	.;CABL1_HUMAN	T	214;541;276	ENSP00000383321:A214T;ENSP00000256925:A541T;ENSP00000413851:A276T	ENSP00000256925:A541T	A	+	1	0	CABLES1	19087758	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.601000	0.98297	2.728000	0.93425	0.655000	0.94253	GCC		0.547	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445198.2	NM_138375	
CELA1	1990	hgsc.bcm.edu	37	12	51723598	51723599	+	Frame_Shift_Ins	INS	-	-	G	rs398102298|rs76813052|rs17860363|rs75442020	byFrequency	TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr12:51723598_51723599insG	ENST00000293636.1	-	7	668_669	c.628_629insC	c.(628-630)ctcfs	p.L210fs		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	210	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.L210fs*24(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						CAAGCAATGGAGGGGGCCCCCA	0.564													GGGGG|GGGGG|GGGGGG|insertion	729	0.145567	0.084	0.1772	5008	,	,		16900	0.0407		0.2863	False		,,,				2504	0.1697															1	Insertion - Frameshift(1)	ovary(1)	12								562,3700		35,492,1604						5.4	0.2		dbSNP_123	63	2566,5688		406,1754,1967	no	frameshift	CELA1	NM_001971.5		441,2246,3571	A1A1,A1R,RR		31.088,13.1863,24.992				3128,9388				50009866	SO:0001589	frameshift_variant	1990				CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.629dupC	12.37:g.51723603_51723603dupG	ENSP00000293636:p.Leu210fs	Somatic		WXS	SOLID	Phase_IV	50009865	Q5MLF0|Q6DJT0|Q6ISM6	Frame_Shift_Ins	INS	ENST00000293636.1	37	CCDS8812.1																																																																																				0.564	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394901.1	NM_001971	
COL14A1	7373	hgsc.bcm.edu	37	8	121259876	121259876	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr8:121259876T>C	ENST00000297848.3	+	21	2774	c.2504T>C	c.(2503-2505)tTg>tCg	p.L835S	COL14A1_ENST00000247781.3_Missense_Mutation_p.L740S|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.L835S	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.L835S(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CCCCAGAACTTGCGGGTGTCC	0.478																																																1	Substitution - Missense(1)	ovary(1)	8											70.0	63.0	66.0					8																	121259876		2203	4300	6503	121329057	SO:0001583	missense	7373				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2504T>C	8.37:g.121259876T>C	ENSP00000297848:p.Leu835Ser	Somatic		WXS	SOLID	Phase_IV	121329057		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	T	17.15	3.317235	0.60524	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.2	5.2	0.72013	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.155057	0.43110	D	0.000614	T	0.81202	0.4773	M	0.87617	2.895	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.74023	0.932;0.982	D	0.83744	0.0205	10	0.51188	T	0.08	.	15.7793	0.78246	0.0:0.0:0.0:1.0	.	835;835	Q05707-2;Q05707	.;COEA1_HUMAN	S	835;835;740;648	ENSP00000311809:L835S;ENSP00000297848:L835S;ENSP00000247781:L740S;ENSP00000409461:L648S	ENSP00000247781:L740S	L	+	2	0	COL14A1	121329057	1.000000	0.71417	0.168000	0.22838	0.372000	0.29890	7.436000	0.80404	2.270000	0.75569	0.460000	0.39030	TTG		0.478	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
CSNK1A1L	122011	hgsc.bcm.edu	37	13	37679077	37679077	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr13:37679077C>T	ENST00000379800.3	-	1	726	c.317G>A	c.(316-318)aGa>aAa	p.R106K		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	106	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R106K(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		GGTGAACCTTCTTGAACAGAA	0.428																																																1	Substitution - Missense(1)	ovary(1)	13											125.0	119.0	121.0					13																	37679077		2203	4300	6503	36577077	SO:0001583	missense	122011			BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.317G>A	13.37:g.37679077C>T	ENSP00000369126:p.Arg106Lys	Somatic		WXS	SOLID	Phase_IV	36577077	Q5T2N2	Missense_Mutation	SNP	ENST00000379800.3	37	CCDS9363.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.449492	0.63178	.	.	ENSG00000180138	ENST00000379800	T	0.63580	-0.05	1.01	1.01	0.19927	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69106	0.3074	L	0.57536	1.79	0.41499	D	0.988276	D	0.58970	0.984	D	0.66084	0.941	T	0.69731	-0.5066	10	0.87932	D	0	.	7.8591	0.29499	0.0:1.0:0.0:0.0	.	106	Q8N752	KC1AL_HUMAN	K	106	ENSP00000369126:R106K	ENSP00000369126:R106K	R	-	2	0	CSNK1A1L	36577077	1.000000	0.71417	0.138000	0.22173	0.906000	0.53458	5.366000	0.66122	0.825000	0.34637	0.561000	0.74099	AGA		0.428	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203	
DHX8	1659	hgsc.bcm.edu	37	17	41571123	41571123	+	Nonsense_Mutation	SNP	G	G	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr17:41571123G>T	ENST00000262415.3	+	8	1153	c.1081G>T	c.(1081-1083)Gag>Tag	p.E361*	DHX8_ENST00000540306.1_Nonsense_Mutation_p.E361*	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	361					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.E361*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		GACCAATGAGGAGACCTCAAT	0.507																																					NSCLC(56;1548 1661 49258 49987)											1	Substitution - Nonsense(1)	ovary(1)	17											185.0	190.0	189.0					17																	41571123		2203	4300	6503	38926649	SO:0001587	stop_gained	1659			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.1081G>T	17.37:g.41571123G>T	ENSP00000262415:p.Glu361*	Somatic		WXS	SOLID	Phase_IV	38926649		Nonsense_Mutation	SNP	ENST00000262415.3	37	CCDS11464.1	.	.	.	.	.	.	.	.	.	.	G	38	7.062617	0.98036	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	.	.	.	5.89	5.89	0.94794	.	0.047811	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	.	19.2448	0.93898	0.0:0.0:1.0:0.0	.	.	.	.	X	361	.	ENSP00000262415:E361X	E	+	1	0	DHX8	38926649	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.431000	0.97494	2.793000	0.96121	0.561000	0.74099	GAG		0.507	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1		
DNMT3B	1789	hgsc.bcm.edu	37	20	31376728	31376728	+	Silent	SNP	C	C	G			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr20:31376728C>G	ENST00000328111.2	+	7	1044	c.723C>G	c.(721-723)gcC>gcG	p.A241A	DNMT3B_ENST00000456297.2_Silent_p.A165A|DNMT3B_ENST00000375623.4_Silent_p.A199A|DNMT3B_ENST00000443239.3_Silent_p.A199A|DNMT3B_ENST00000344505.4_Silent_p.A241A|DNMT3B_ENST00000201963.3_Silent_p.A253A|DNMT3B_ENST00000348286.2_Silent_p.A241A|DNMT3B_ENST00000353855.2_Silent_p.A241A	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	241	Interaction with DNMT1 and DNMT3A.|PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)	p.A241A(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGTGGCCCGCCATGGTGGTGT	0.572																																																1	Substitution - coding silent(1)	ovary(1)	20											87.0	83.0	84.0					20																	31376728		2203	4300	6503	30840389	SO:0001819	synonymous_variant	1789				CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.723C>G	20.37:g.31376728C>G		Somatic		WXS	SOLID	Phase_IV	30840389	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Silent	SNP	ENST00000328111.2	37	CCDS13205.1																																																																																				0.572	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
FABP3	2170	hgsc.bcm.edu	37	1	31845809	31845809	+	Missense_Mutation	SNP	T	T	A	rs534545556		TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:31845809T>A	ENST00000373713.2	-	1	114	c.53A>T	c.(52-54)gAt>gTt	p.D18V		NM_004102.3	NP_004093.1	P05413	FABPH_HUMAN	fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)	18					cholesterol homeostasis (GO:0042632)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid import (GO:0044539)|negative regulation of cell proliferation (GO:0008285)|phospholipid homeostasis (GO:0055091)|positive regulation of phospholipid biosynthetic process (GO:0071073)|regulation of fatty acid oxidation (GO:0046320)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to insulin (GO:0032868)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasm (GO:0016528)	cytoskeletal protein binding (GO:0008092)|icosatetraenoic acid binding (GO:0050543)|long-chain fatty acid binding (GO:0036041)|long-chain fatty acid transporter activity (GO:0005324)|oleic acid binding (GO:0070538)	p.D18V(1)		large_intestine(1)|lung(2)|ovary(2)	5		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0185)|READ - Rectum adenocarcinoma(331;0.149)		CATGTAGTCATCGAAATTCTT	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											101.0	86.0	91.0					1																	31845809		2203	4300	6503	31618396	SO:0001583	missense	2170			U57623	CCDS342.1	1p33-p32	2013-03-01	2003-09-10		ENSG00000121769	ENSG00000121769		"""Fatty acid binding protein family"""	3557	protein-coding gene	gene with protein product		134651	"""fatty acid binding protein 11"""	MDGI, FABP11		8661024	Standard	NM_004102		Approved	H-FABP, O-FABP	uc001bss.1	P05413	OTTHUMG00000003797	ENST00000373713.2:c.53A>T	1.37:g.31845809T>A	ENSP00000362817:p.Asp18Val	Somatic		WXS	SOLID	Phase_IV	31618396	B2RAB6|Q5VV93|Q99957	Missense_Mutation	SNP	ENST00000373713.2	37	CCDS342.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.784045	0.90282	.	.	ENSG00000121769	ENST00000373713	T	0.58506	0.33	4.85	4.85	0.62838	Calycin-like (1);Cytosolic fatty-acid binding (2);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.000000	0.85682	D	0.000000	T	0.78375	0.4273	M	0.88377	2.95	0.80722	D	1	D	0.67145	0.996	D	0.76071	0.987	T	0.82719	-0.0318	10	0.87932	D	0	.	12.7565	0.57339	0.0:0.0:0.0:1.0	.	18	P05413	FABPH_HUMAN	V	18	ENSP00000362817:D18V	ENSP00000362817:D18V	D	-	2	0	FABP3	31618396	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.684000	0.84104	2.184000	0.69523	0.529000	0.55759	GAT		0.597	FABP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010683.1	NM_004102	
FLVCR2	55640	hgsc.bcm.edu	37	14	76107536	76107536	+	Silent	SNP	C	C	A	rs143830535		TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr14:76107536C>A	ENST00000238667.4	+	8	1709	c.1353C>A	c.(1351-1353)atC>atA	p.I451I	FLVCR2_ENST00000555027.1_Silent_p.I166I|FLVCR2_ENST00000553587.1_Intron|FLVCR2_ENST00000556241.1_Intron|FLVCR2_ENST00000556856.1_Intron|FLVCR2_ENST00000539311.1_Silent_p.I246I	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	451					heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)	p.I451I(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		TATTTGGGATCATCTTTACCA	0.478													C|||	1	0.000199681	0.0	0.0	5008	,	,		22166	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	14											151.0	127.0	135.0					14																	76107536		2203	4300	6503	75177289	SO:0001819	synonymous_variant	55640			AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.1353C>A	14.37:g.76107536C>A		Somatic		WXS	SOLID	Phase_IV	75177289	B7Z485|Q53ZT9|Q96JY3|Q9NX90	Silent	SNP	ENST00000238667.4	37	CCDS9844.1																																																																																				0.478	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413672.1	NM_017791	
FMN1	342184	hgsc.bcm.edu	37	15	33091129	33091129	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr15:33091129C>T	ENST00000559047.1	-	16	4005	c.4006G>A	c.(4006-4008)Ggg>Agg	p.G1336R	FMN1_ENST00000561249.1_Missense_Mutation_p.G1238R|FMN1_ENST00000334528.9_Missense_Mutation_p.G1113R			Q68DA7	FMN1_HUMAN	formin 1	1336	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G1336R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GGCTTCATCCCAAAATATCGT	0.448																																																1	Substitution - Missense(1)	ovary(1)	15											79.0	70.0	73.0					15																	33091129		1877	4123	6000	30878421	SO:0001583	missense	342184			AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.4006G>A	15.37:g.33091129C>T	ENSP00000454047:p.Gly1336Arg	Somatic		WXS	SOLID	Phase_IV	30878421	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	37		.	.	.	.	.	.	.	.	.	.	C	22.9	4.345387	0.82022	.	.	ENSG00000248905	ENST00000334528	T	0.69806	-0.43	5.86	5.86	0.93980	.	0.096844	0.64402	D	0.000001	T	0.81786	0.4896	M	0.73217	2.22	.	.	.	D	0.76494	0.999	D	0.76575	0.988	T	0.78836	-0.2047	9	0.37606	T	0.19	.	20.1785	0.98192	0.0:1.0:0.0:0.0	.	1113	Q68DA7-5	.	R	1113	ENSP00000333950:G1113R	ENSP00000333950:G1113R	G	-	1	0	FMN1	30878421	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.722000	0.68485	2.773000	0.95371	0.655000	0.94253	GGG		0.448	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
FOXP3	50943	hgsc.bcm.edu	37	X	49113978	49113978	+	Silent	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chrX:49113978C>T	ENST00000376207.4	-	4	547	c.360G>A	c.(358-360)gtG>gtA	p.V120V	FOXP3_ENST00000376199.2_Silent_p.V85V|FOXP3_ENST00000455775.2_Silent_p.V120V|FOXP3_ENST00000518685.1_Silent_p.V85V|FOXP3_ENST00000376197.1_Silent_p.V70V|FOXP3_ENST00000557224.1_Silent_p.V85V	NM_014009.3	NP_054728.2	Q9BZS1	FOXP3_HUMAN	forkhead box P3	120					B cell homeostasis (GO:0001782)|CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|chromatin remodeling (GO:0006338)|cytokine production (GO:0001816)|myeloid cell homeostasis (GO:0002262)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of immune response (GO:0050777)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0032831)|positive regulation of histone acetylation (GO:0035066)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of peripheral T cell tolerance induction (GO:0002851)|positive regulation of T cell anergy (GO:0002669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell activation (GO:0042110)|T cell homeostasis (GO:0043029)|T cell mediated immunity (GO:0002456)|T cell receptor signaling pathway (GO:0050852)|tolerance induction to self antigen (GO:0002513)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|NFAT protein binding (GO:0051525)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.V120V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)	10	Ovarian(276;0.236)					CCAGGGGGTGCACCTGCAGCA	0.677																																					GBM(182;1432 2112 16160 23073 31774)											1	Substitution - coding silent(1)	ovary(1)	X											53.0	46.0	49.0					X																	49113978		2200	4299	6499	49000922	SO:0001819	synonymous_variant	50943				CCDS14323.1, CCDS48109.1	Xp11.23	2014-09-17		2002-09-20	ENSG00000049768	ENSG00000049768		"""Forkhead boxes"""	6106	protein-coding gene	gene with protein product		300292	"""immune dysregulation, polyendocrinopathy, enteropathy, X-linked"""	IPEX		10677306, 11138001	Standard	NM_014009		Approved	JM2, XPID, AIID, PIDX, DIETER, SCURFIN	uc004dnf.4	Q9BZS1	OTTHUMG00000024135	ENST00000376207.4:c.360G>A	X.37:g.49113978C>T		Somatic		WXS	SOLID	Phase_IV	49000922	A5HJT1|B7ZLG0|B9UN80|O60827|Q14DD8|Q4ZH51	Silent	SNP	ENST00000376207.4	37	CCDS14323.1																																																																																				0.677	FOXP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060814.1	NM_014009	
GRIK3	2899	hgsc.bcm.edu	37	1	37271784	37271784	+	Silent	SNP	G	G	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:37271784G>A	ENST00000373091.3	-	14	2251	c.2235C>T	c.(2233-2235)taC>taT	p.Y745Y	GRIK3_ENST00000373093.4_Silent_p.Y745Y	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	745					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.Y745Y(2)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				TCTGCGTGACGTACTCGATGG	0.642																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	1											195.0	138.0	157.0					1																	37271784		2203	4300	6503	37044371	SO:0001819	synonymous_variant	2899			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2235C>T	1.37:g.37271784G>A		Somatic		WXS	SOLID	Phase_IV	37044371	A9Z1Z8|B1AMS6|Q13004|Q16136	Silent	SNP	ENST00000373091.3	37	CCDS416.1																																																																																				0.642	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
IDI2	91734	hgsc.bcm.edu	37	10	1066735	1066735	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr10:1066735T>G	ENST00000277517.1	-	4	402	c.338A>C	c.(337-339)cAa>cCa	p.Q113P	IDI2-AS1_ENST00000420381.1_RNA|IDI2-AS1_ENST00000428780.2_RNA|IDI2-AS1_ENST00000437374.1_RNA|IDI2-AS1_ENST00000536039.1_RNA|IDI2-AS1_ENST00000434470.1_RNA	NM_033261.2	NP_150286.1	Q9BXS1	IDI2_HUMAN	isopentenyl-diphosphate delta isomerase 2	113	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isopentenyl diphosphate metabolic process (GO:0046490)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|metal ion binding (GO:0046872)	p.Q113P(1)		kidney(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9		Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.143)	Epithelial(11;0.067)|OV - Ovarian serous cystadenocarcinoma(14;0.169)|all cancers(11;0.192)		CAGCTCTGCTTGCAGACGCCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	10											98.0	84.0	88.0					10																	1066735		2203	4300	6503	1056735	SO:0001583	missense	91734			AF271725	CCDS7055.1	10p15.3	2003-11-19			ENSG00000148377	ENSG00000148377			23487	protein-coding gene	gene with protein product		615389				12477932	Standard	NM_033261		Approved	IPPI2	uc001ifv.1	Q9BXS1	OTTHUMG00000017537	ENST00000277517.1:c.338A>C	10.37:g.1066735T>G	ENSP00000277517:p.Gln113Pro	Somatic		WXS	SOLID	Phase_IV	1056735		Missense_Mutation	SNP	ENST00000277517.1	37	CCDS7055.1	.	.	.	.	.	.	.	.	.	.	T	14.49	2.550780	0.45383	.	.	ENSG00000148377	ENST00000277517	T	0.08370	3.1	4.09	4.09	0.47781	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.472749	0.23402	U	0.048569	T	0.14313	0.0346	M	0.66506	2.035	0.34737	D	0.730342	P	0.37083	0.581	B	0.42593	0.392	T	0.17471	-1.0368	10	0.33141	T	0.24	-24.96	12.9989	0.58664	0.0:0.0:0.0:1.0	.	113	Q9BXS1	IDI2_HUMAN	P	113	ENSP00000277517:Q113P	ENSP00000277517:Q113P	Q	-	2	0	IDI2	1056735	0.932000	0.31603	0.031000	0.17742	0.005000	0.04900	2.658000	0.46733	1.615000	0.50252	0.346000	0.21813	CAA		0.557	IDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046411.1	NM_033261	
KIAA2018	205717	hgsc.bcm.edu	37	3	113377826	113377826	+	Silent	SNP	A	A	G			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr3:113377826A>G	ENST00000478658.1	-	5	2720	c.2703T>C	c.(2701-2703)caT>caC	p.H901H	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.H901H			Q68DE3	K2018_HUMAN	KIAA2018	901						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.H901H(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CCATTGCAAAATGTTCACTTG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	3											168.0	154.0	158.0					3																	113377826		1873	4106	5979	114860516	SO:0001819	synonymous_variant	205717			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.2703T>C	3.37:g.113377826A>G		Somatic		WXS	SOLID	Phase_IV	114860516	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1																																																																																				0.413	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
MAGEB1	4112	hgsc.bcm.edu	37	X	30268730	30268730	+	Silent	SNP	C	C	G	rs199978505		TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chrX:30268730C>G	ENST00000378981.3	+	4	441	c.120C>G	c.(118-120)tcC>tcG	p.S40S	MAGEB1_ENST00000397548.2_Silent_p.S40S|MAGEB1_ENST00000397550.1_Silent_p.S40S	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	40								p.S40S(1)		NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						AGTGCCCCTCCTCCTCTCCTG	0.617													C|||	2	0.000529801	0.0	0.0014	3775	,	,		13991	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	X											42.0	32.0	35.0					X																	30268730		2202	4299	6501	30178651	SO:0001819	synonymous_variant	4112				CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.120C>G	X.37:g.30268730C>G		Somatic		WXS	SOLID	Phase_IV	30178651	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Silent	SNP	ENST00000378981.3	37	CCDS14222.1																																																																																				0.617	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056160.1	NM_002363	
MAOA	4128	hgsc.bcm.edu	37	X	43603056	43603061	+	In_Frame_Del	DEL	CGTGGG	CGTGGG	-			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	CGTGGG	CGTGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chrX:43603056_43603061delCGTGGG	ENST00000338702.3	+	13	1401_1406	c.1278_1283delCGTGGG	c.(1276-1284)cccgtgggc>ccc	p.VG427del	MAOA_ENST00000542639.1_In_Frame_Del_p.VG294del	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	427					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)	p.V427_G428delVG(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	TTCGTCAACCCGTGGGCAGGATTTTC	0.544																																																1	Deletion - In frame(1)	ovary(1)	X																																								43488005	SO:0001651	inframe_deletion	4128				CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.1278_1283delCGTGGG	X.37:g.43603056_43603061delCGTGGG	ENSP00000340684:p.Val427_Gly428del	Somatic		WXS	SOLID	Phase_IV	43488000	B4DF46|Q16426	In_Frame_Del	DEL	ENST00000338702.3	37	CCDS14260.1																																																																																				0.544	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1	NM_000240	
MAPRE3	22924	hgsc.bcm.edu	37	2	27248516	27248517	+	Frame_Shift_Ins	INS	-	-	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr2:27248516_27248517insC	ENST00000233121.2	+	5	733_734	c.535_536insC	c.(535-537)gccfs	p.A179fs	MAPRE3_ENST00000402218.1_Frame_Shift_Ins_p.A164fs|MAPRE3_ENST00000405074.3_Frame_Shift_Ins_p.A164fs			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3	179					mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)	p.C182fs*16(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGCAATGTGGCCCCCCCCTGC	0.564																																																2	Insertion - Frameshift(2)	ovary(1)|large_intestine(1)	2								39,4227		0,39,2094						4.4	1.0			60	29,8225		0,29,4098	no	frameshift	MAPRE3	NM_012326.2		0,68,6192	A1A1,A1R,RR		0.3513,0.9142,0.5431				68,12452				27102021	SO:0001589	frameshift_variant	22924			Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.543dupC	2.37:g.27248524_27248524dupC	ENSP00000233121:p.Ala179fs	Somatic		WXS	SOLID	Phase_IV	27102020	B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	Frame_Shift_Ins	INS	ENST00000233121.2	37	CCDS1731.1																																																																																				0.564	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214183.1	NM_012326	
MEF2C	4208	hgsc.bcm.edu	37	5	88018549	88018549	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr5:88018549C>A	ENST00000437473.2	-	11	1711	c.1294G>T	c.(1294-1296)Gac>Tac	p.D432Y	MEF2C_ENST00000504921.2_Missense_Mutation_p.D432Y|MEF2C_ENST00000340208.5_Missense_Mutation_p.D442Y|MEF2C_ENST00000514015.1_Missense_Mutation_p.D400Y|CTC-467M3.1_ENST00000510274.1_RNA|MEF2C_ENST00000508569.1_Missense_Mutation_p.D392Y|MEF2C_ENST00000424173.2_Missense_Mutation_p.D422Y|MEF2C_ENST00000506554.1_3'UTR|MEF2C_ENST00000539796.1_Missense_Mutation_p.D376Y|MEF2C_ENST00000510942.1_Missense_Mutation_p.D424Y|MEF2C_ENST00000514028.1_Missense_Mutation_p.D432Y	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	432		Cleavage. {ECO:0000305}.			apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.D432Y(1)		breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		TCGCTCCCGTCGTACGAACTG	0.587										HNSCC(66;0.2)																																						1	Substitution - Missense(1)	ovary(1)	5											130.0	136.0	134.0					5																	88018549		2032	4197	6229	88054305	SO:0001583	missense	4208			AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.1294G>T	5.37:g.88018549C>A	ENSP00000396219:p.Asp432Tyr	Somatic		WXS	SOLID	Phase_IV	88054305	C9JMZ0|D7F7N5|F8W7V7	Missense_Mutation	SNP	ENST00000437473.2	37	CCDS47245.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537076	0.65085	.	.	ENSG00000081189	ENST00000340208;ENST00000424173;ENST00000504921;ENST00000514028;ENST00000437473;ENST00000510942;ENST00000508569;ENST00000514015;ENST00000539796	T;T;T;T;T;T;T;T;T	0.71103	-0.01;0.01;-0.02;0.02;0.02;0.01;-0.44;-0.54;0.46	5.69	5.69	0.88448	.	0.043855	0.85682	D	0.000000	T	0.79845	0.4516	L	0.42245	1.32	0.58432	D	0.999999	B;D;D;D	0.69078	0.047;0.997;0.995;0.997	B;D;P;D	0.65010	0.116;0.931;0.813;0.921	T	0.80529	-0.1342	10	0.87932	D	0	-8.4576	19.7914	0.96458	0.0:1.0:0.0:0.0	.	422;442;432;424	C9JMZ0;F8W7V7;Q06413;Q06413-2	.;.;MEF2C_HUMAN;.	Y	442;422;432;432;432;424;392;400;376	ENSP00000340874:D442Y;ENSP00000389610:D422Y;ENSP00000421925:D432Y;ENSP00000426665:D432Y;ENSP00000396219:D432Y;ENSP00000422390:D424Y;ENSP00000423597:D392Y;ENSP00000424606:D400Y;ENSP00000441153:D376Y	ENSP00000340874:D442Y	D	-	1	0	MEF2C	88054305	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.840000	0.97914	0.655000	0.94253	GAC		0.587	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	NM_002397	
OLFM3	118427	hgsc.bcm.edu	37	1	102302461	102302461	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:102302461T>A	ENST00000338858.5	-	2	249	c.250A>T	c.(250-252)Agg>Tgg	p.R84W	OLFM3_ENST00000359814.3_Missense_Mutation_p.R84W|OLFM3_ENST00000536598.1_5'UTR|OLFM3_ENST00000370103.4_Missense_Mutation_p.R64W|OLFM3_ENST00000462354.1_5'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	84					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)		p.R64W(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		CGAAGTTGCCTGCTTTTGGCA	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											127.0	118.0	121.0					1																	102302461		2203	4300	6503	102075049	SO:0001583	missense	118427			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.250A>T	1.37:g.102302461T>A	ENSP00000345192:p.Arg84Trp	Somatic		WXS	SOLID	Phase_IV	102075049	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	ENST00000338858.5	37		.	.	.	.	.	.	.	.	.	.	T	22.4	4.280792	0.80692	.	.	ENSG00000118733	ENST00000370103;ENST00000338858;ENST00000359814	D;D;T	0.90261	-2.64;-2.64;0.7	5.62	3.25	0.37280	.	0.163884	0.50627	D	0.000117	D	0.90872	0.7132	L	0.55481	1.735	0.80722	D	1	D;D	0.59767	0.986;0.975	D;P	0.67103	0.949;0.817	D	0.90823	0.4710	10	0.72032	D	0.01	.	12.3364	0.55069	0.0:0.0:0.2677:0.7323	.	64;84	Q5T3V6;Q96PB7	.;NOE3_HUMAN	W	64;84;84	ENSP00000359121:R64W;ENSP00000345192:R84W;ENSP00000352867:R84W	ENSP00000345192:R84W	R	-	1	2	OLFM3	102075049	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.781000	0.47750	0.384000	0.24942	0.477000	0.44152	AGG		0.483	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
NAV1	89796	hgsc.bcm.edu	37	1	201779701	201779701	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:201779701A>G	ENST00000367296.4	+	24	5032	c.4612A>G	c.(4612-4614)Aag>Gag	p.K1538E	NAV1_ENST00000295624.6_Missense_Mutation_p.K1535E|NAV1_ENST00000367297.4_Missense_Mutation_p.K1530E|NAV1_ENST00000367295.1_Missense_Mutation_p.K1144E|NAV1_ENST00000367300.3_Missense_Mutation_p.K1478E|MIR1231_ENST00000408101.1_RNA|NAV1_ENST00000367302.1_Missense_Mutation_p.K1491E|IPO9-AS1_ENST00000413035.1_RNA	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1538					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.K1535E(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						GCTGATCCCCAAGCCGATGAT	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											43.0	39.0	41.0					1																	201779701		2203	4300	6503	200046324	SO:0001583	missense	89796			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.4612A>G	1.37:g.201779701A>G	ENSP00000356265:p.Lys1538Glu	Somatic		WXS	SOLID	Phase_IV	200046324	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	A	29.3	4.997693	0.93227	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295	D;D;D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24;-2.24;-2.24	4.85	4.85	0.62838	.	0.055379	0.64402	D	0.000001	D	0.89399	0.6704	M	0.78049	2.395	0.58432	D	0.999996	D;D	0.55385	0.971;0.971	P;P	0.48270	0.453;0.572	D	0.91112	0.4923	10	0.87932	D	0	-25.8572	14.2681	0.66135	1.0:0.0:0.0:0.0	.	1144;1535	Q8NEY1-5;Q8NEY1-3	.;.	E	1491;1538;1535;1530;1478;1144	ENSP00000356271:K1491E;ENSP00000356265:K1538E;ENSP00000295624:K1535E;ENSP00000356266:K1530E;ENSP00000356269:K1478E;ENSP00000356264:K1144E	ENSP00000295624:K1535E	K	+	1	0	NAV1	200046324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.064000	0.93933	2.025000	0.59659	0.477000	0.44152	AAG		0.587	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
PTPDC1	138639	hgsc.bcm.edu	37	9	96859668	96859668	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr9:96859668G>C	ENST00000375360.3	+	7	998	c.658G>C	c.(658-660)Gtg>Ctg	p.V220L	PTPDC1_ENST00000288976.3_Missense_Mutation_p.V272L	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	220	Tyrosine-protein phosphatase.				cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.V272L(1)		endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						AATTATATTTGTGCGGGCAAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	9											71.0	69.0	69.0					9																	96859668		2203	4300	6503	95899489	SO:0001583	missense	138639			BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.658G>C	9.37:g.96859668G>C	ENSP00000364509:p.Val220Leu	Somatic		WXS	SOLID	Phase_IV	95899489	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	ENST00000375360.3	37	CCDS6707.1	.	.	.	.	.	.	.	.	.	.	.	25.5	4.641500	0.87859	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	D;D	0.85629	-2.01;-2.01	5.55	5.55	0.83447	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.89553	0.6748	L	0.43598	1.365	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	D;D;D;D	0.76071	0.983;0.97;0.987;0.983	D	0.87772	0.2606	10	0.33940	T	0.23	-18.9387	18.4793	0.90806	0.0:0.0:1.0:0.0	.	274;272;274;220	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	L	220;272	ENSP00000364509:V220L;ENSP00000288976:V272L	ENSP00000288976:V272L	V	+	1	0	PTPDC1	95899489	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.160000	0.71862	2.610000	0.88304	0.591000	0.81541	GTG		0.408	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	NM_177995, NM_152422	
RBBP6	5930	hgsc.bcm.edu	37	16	24578678	24578678	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr16:24578678C>T	ENST00000319715.4	+	15	2236	c.1804C>T	c.(1804-1806)Cca>Tca	p.P602S	RBBP6_ENST00000348022.2_Missense_Mutation_p.P602S|RBBP6_ENST00000381039.3_Intron	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	602					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P602S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		TGTCCCTCCTCCAGGGTTTCC	0.542																																																1	Substitution - Missense(1)	ovary(1)	16											211.0	217.0	215.0					16																	24578678		2197	4300	6497	24486179	SO:0001583	missense	5930				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.1804C>T	16.37:g.24578678C>T	ENSP00000317872:p.Pro602Ser	Somatic		WXS	SOLID	Phase_IV	24486179	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	37	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.039771	0.55003	.	.	ENSG00000122257	ENST00000319715;ENST00000348022	T;T	0.19394	2.15;2.55	5.9	5.9	0.94986	.	0.072077	0.52532	D	0.000074	T	0.39759	0.1090	L	0.32530	0.975	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.08249	-1.0731	10	0.62326	D	0.03	-13.7204	20.2723	0.98479	0.0:1.0:0.0:0.0	.	602;602	Q7Z6E9-2;Q7Z6E9	.;RBBP6_HUMAN	S	602	ENSP00000317872:P602S;ENSP00000316291:P602S	ENSP00000317872:P602S	P	+	1	0	RBBP6	24486179	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.500000	0.60387	2.793000	0.96121	0.563000	0.77884	CCA		0.542	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
RBM20	282996	hgsc.bcm.edu	37	10	112581637	112581638	+	Frame_Shift_Ins	INS	-	-	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr10:112581637_112581638insC	ENST00000369519.3	+	11	3318_3319	c.3260_3261insC	c.(3259-3264)agccccfs	p.SP1087fs		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	1087					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.I1090fs*4(1)		autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						GAGAAAGCCAGCCCCCCCATCG	0.594																																																1	Insertion - Frameshift(1)	ovary(1)	10								7,2173		1,5,1084						4.1	0.9			41	4,4226		1,2,2112	no	frameshift	RBM20	NM_001134363.1		2,7,3196	A1A1,A1R,RR		0.0946,0.3211,0.1716				11,6399				112571628	SO:0001589	frameshift_variant	282996			BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.3267dupC	10.37:g.112581644_112581644dupC	ENSP00000358532:p.Ser1087fs	Somatic		WXS	SOLID	Phase_IV	112571627	A6NIP5|B5A868|Q5JVI1	Frame_Shift_Ins	INS	ENST00000369519.3	37	CCDS44477.1																																																																																				0.594	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
SCUBE1	80274	hgsc.bcm.edu	37	22	43604161	43604161	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr22:43604161C>T	ENST00000360835.4	-	20	2777	c.2651G>A	c.(2650-2652)cGc>cAc	p.R884H		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	884	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)	p.R884H(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				CTTGCGGGAGCGGGAGGTGAA	0.562																																																1	Substitution - Missense(1)	ovary(1)	22											246.0	209.0	222.0					22																	43604161		2203	4300	6503	41934105	SO:0001583	missense	80274				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.2651G>A	22.37:g.43604161C>T	ENSP00000354080:p.Arg884His	Somatic		WXS	SOLID	Phase_IV	41934105	Q5R336	Missense_Mutation	SNP	ENST00000360835.4	37	CCDS14048.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798975	0.90538	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	T	0.18338	2.22	3.76	3.76	0.43208	CUB (5);	0.000000	0.85682	D	0.000000	T	0.33323	0.0859	L	0.41906	1.305	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.18023	-1.0350	10	0.87932	D	0	.	16.1153	0.81302	0.0:1.0:0.0:0.0	.	884	Q8IWY4	SCUB1_HUMAN	H	884;514	ENSP00000354080:R884H	ENSP00000354080:R884H	R	-	2	0	SCUBE1	41934105	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.553000	0.82203	2.102000	0.63906	0.313000	0.20887	CGC		0.562	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050	
SCYL1	57410	hgsc.bcm.edu	37	11	65303522	65303522	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr11:65303522C>G	ENST00000270176.5	+	11	1562	c.1485C>G	c.(1483-1485)caC>caG	p.H495Q	SCYL1_ENST00000527009.1_Missense_Mutation_p.H352Q|SCYL1_ENST00000525364.1_Missense_Mutation_p.H495Q|SCYL1_ENST00000279270.6_Missense_Mutation_p.H495Q|SCYL1_ENST00000524944.1_Missense_Mutation_p.H495Q|SCYL1_ENST00000533862.1_Missense_Mutation_p.H495Q|SCYL1_ENST00000420247.2_Missense_Mutation_p.H495Q	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	495			H -> Y (in a metastatic melanoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)	p.H495Q(2)		ovary(1)|skin(1)	2						CTGCCACCCACAACCTCTACT	0.592																																																2	Substitution - Missense(2)	ovary(2)	11											90.0	92.0	91.0					11																	65303522		1981	4155	6136	65060098	SO:0001583	missense	57410			AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.1485C>G	11.37:g.65303522C>G	ENSP00000270176:p.His495Gln	Somatic		WXS	SOLID	Phase_IV	65060098	A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Missense_Mutation	SNP	ENST00000270176.5	37	CCDS41672.1	.	.	.	.	.	.	.	.	.	.	C	12.46	1.944623	0.34283	.	.	ENSG00000142186	ENST00000270176;ENST00000525364;ENST00000420247;ENST00000533862;ENST00000527630;ENST00000349495;ENST00000279270;ENST00000524944;ENST00000527009	T;T;T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47;1.47;1.47	5.46	5.46	0.80206	Armadillo-like helical (1);Armadillo-type fold (1);	0.104625	0.64402	D	0.000005	T	0.18718	0.0449	N	0.16656	0.425	0.58432	D	0.999997	B;B;B;B;B	0.20052	0.005;0.041;0.041;0.041;0.011	B;B;B;B;B	0.20955	0.014;0.032;0.032;0.032;0.006	T	0.05257	-1.0896	10	0.02654	T	1	-11.242	16.7806	0.85562	0.0:1.0:0.0:0.0	.	495;495;495;495;495	E9PS17;Q96KG9-4;Q96KG9-6;Q96KG9-2;Q96KG9	.;.;.;.;NTKL_HUMAN	Q	495;495;495;495;495;495;495;495;352	ENSP00000270176:H495Q;ENSP00000431635:H495Q;ENSP00000408192:H495Q;ENSP00000437254:H495Q;ENSP00000433450:H495Q;ENSP00000279270:H495Q;ENSP00000432175:H495Q;ENSP00000436993:H352Q	ENSP00000270176:H495Q	H	+	3	2	SCYL1	65060098	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.894000	0.56250	2.577000	0.86979	0.462000	0.41574	CAC		0.592	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	NM_020680	
SIRPD	128646	hgsc.bcm.edu	37	20	1532543	1532543	+	Missense_Mutation	SNP	C	C	T	rs139039354	byFrequency	TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr20:1532543C>T	ENST00000381623.3	-	2	1404	c.215G>A	c.(214-216)cGg>cAg	p.R72Q	SIRPD_ENST00000381621.1_Missense_Mutation_p.R72Q			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	72	Ig-like V-type.					extracellular region (GO:0005576)		p.R72Q(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						GATTAATTTCCGGTTTGGCCC	0.463																																																1	Substitution - Missense(1)	ovary(1)	20						C	GLN/ARG	0,4406		0,0,2203	144.0	142.0	143.0		215	-0.3	0.0	20	dbSNP_134	143	2,8598		0,2,4298	no	missense	SIRPD	NM_178460.2	43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	72/198	1532543	2,13004	2203	4300	6503	1480543	SO:0001583	missense	128646			AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.215G>A	20.37:g.1532543C>T	ENSP00000371036:p.Arg72Gln	Somatic		WXS	SOLID	Phase_IV	1480543	B3KS88|Q5TFQ6	Missense_Mutation	SNP	ENST00000381623.3	37	CCDS13018.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	24.4|24.4	4.522730|4.522730	0.85600|0.85600	0.0|0.0	2.33E-4|2.33E-4	ENSG00000125900|ENSG00000125900	ENST00000429387|ENST00000381623;ENST00000381621	.|T;T	.|0.42900	.|4.36;0.96	4.03|4.03	-0.332|-0.332	0.12675|0.12675	.|Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|1.160920	.|0.06782	.|N	.|0.785533	T|T	0.30039|0.30039	0.0752|0.0752	M|M	0.66378|0.66378	2.025|2.025	0.09310|0.09310	N|N	1|1	.|P	.|0.46578	.|0.88	.|B	.|0.25140	.|0.058	T|T	0.33929|0.33929	-0.9849|-0.9849	5|10	.|0.54805	.|T	.|0.06	.|.	3.9226|3.9226	0.09250|0.09250	0.0:0.5036:0.1791:0.3173|0.0:0.5036:0.1791:0.3173	.|.	.|72	.|Q9H106	.|SIRPD_HUMAN	R|Q	15|72	.|ENSP00000371036:R72Q;ENSP00000371034:R72Q	.|ENSP00000371034:R72Q	G|R	-|-	1|2	0|0	SIRPD|SIRPD	1480543|1480543	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.765000|0.765000	0.43378|0.43378	-0.086000|-0.086000	0.11233|0.11233	-0.108000|-0.108000	0.12066|0.12066	0.558000|0.558000	0.71614|0.71614	GGA|CGG		0.463	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460	
SLC16A9	220963	hgsc.bcm.edu	37	10	61413432	61413432	+	Splice_Site	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr10:61413432C>T	ENST00000395348.3	-	5	1988		c.e5+1		SLC16A9_ENST00000395347.1_Splice_Site	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9						urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.?(1)		kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						AAATATCTTACCAACGATGGG	0.383																																																1	Unknown(1)	ovary(1)	10											63.0	62.0	63.0					10																	61413432		2203	4300	6503	61083438	SO:0001630	splice_region_variant	220963			AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.1351+1G>A	10.37:g.61413432C>T		Somatic		WXS	SOLID	Phase_IV	61083438	Q6ZMI2|Q9UFH8	Splice_Site	SNP	ENST00000395348.3	37	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169760	0.78452	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7057	0.91637	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC16A9	61083438	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.434000	0.80377	2.498000	0.84270	0.591000	0.81541	.		0.383	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	Intron
SLC25A44	9673	hgsc.bcm.edu	37	1	156177778	156177778	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:156177778A>T	ENST00000359511.4	+	3	899	c.727A>T	c.(727-729)Atg>Ttg	p.M243L	SLC25A44_ENST00000423538.2_Missense_Mutation_p.M220L|SLC25A44_ENST00000469537.1_3'UTR	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44	243					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.M243L(1)		breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					CACCAATCCCATGGATGTCAT	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											104.0	88.0	93.0					1																	156177778		2203	4300	6503	154444402	SO:0001583	missense	9673			AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.727A>T	1.37:g.156177778A>T	ENSP00000352497:p.Met243Leu	Somatic		WXS	SOLID	Phase_IV	154444402	O75034	Missense_Mutation	SNP	ENST00000359511.4	37	CCDS1133.1	.	.	.	.	.	.	.	.	.	.	A	9.064	0.995316	0.19043	.	.	ENSG00000160785	ENST00000359511;ENST00000423538	T;T	0.74002	-0.8;-0.8	4.89	4.89	0.63831	Mitochondrial carrier domain (2);	0.088632	0.85682	D	0.000000	T	0.27063	0.0663	N	0.01751	-0.74	0.80722	D	1	B;B;B	0.19445	0.017;0.036;0.036	B;B;B	0.29663	0.006;0.105;0.071	T	0.38023	-0.9680	10	0.02654	T	1	1.8056	12.5436	0.56186	1.0:0.0:0.0:0.0	.	220;220;243	E9PGQ0;B4DGC4;Q96H78	.;.;S2544_HUMAN	L	243;220	ENSP00000352497:M243L;ENSP00000407560:M220L	ENSP00000352497:M243L	M	+	1	0	SLC25A44	154444402	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.881000	0.92415	2.053000	0.61076	0.519000	0.50382	ATG		0.562	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040856.1	NM_014655	
SLC26A7	115111	hgsc.bcm.edu	37	8	92355655	92355655	+	Silent	SNP	A	A	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr8:92355655A>T	ENST00000276609.3	+	9	1340	c.1101A>T	c.(1099-1101)ggA>ggT	p.G367G	SLC26A7_ENST00000309536.2_Silent_p.G367G|SLC26A7_ENST00000520249.1_3'UTR|SLC26A7_ENST00000523719.1_Silent_p.G367G	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7									p.G367G(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			CTGCCATGGGAAGGACGGCTG	0.478																																																1	Substitution - coding silent(1)	ovary(1)	8											82.0	79.0	80.0					8																	92355655		2203	4300	6503	92424831	SO:0001819	synonymous_variant	115111			AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.1101A>T	8.37:g.92355655A>T		Somatic		WXS	SOLID	Phase_IV	92424831		Silent	SNP	ENST00000276609.3	37	CCDS6254.1																																																																																				0.478	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1		
SLC9A5	6553	hgsc.bcm.edu	37	16	67288982	67288982	+	Silent	SNP	G	G	A	rs374255508		TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr16:67288982G>A	ENST00000299798.11	+	3	614	c.549G>A	c.(547-549)gcG>gcA	p.A183A	SLC9A5_ENST00000561472.2_3'UTR	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	183					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.A183A(1)		breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		TCATCTCGGCGGTGGACCCCG	0.557																																																1	Substitution - coding silent(1)	ovary(1)	16						G		0,4292		0,0,2146	81.0	88.0	86.0		549	-11.9	0.7	16		86	1,8543		0,1,4271	no	coding-synonymous	SLC9A5	NM_004594.2		0,1,6417	AA,AG,GG		0.0117,0.0,0.0078		183/897	67288982	1,12835	2146	4272	6418	65846483	SO:0001819	synonymous_variant	6553				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.549G>A	16.37:g.67288982G>A		Somatic		WXS	SOLID	Phase_IV	65846483	A5PKY7|Q9Y626	Silent	SNP	ENST00000299798.11	37	CCDS42178.1																																																																																				0.557	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421386.1		
SORT1	6272	hgsc.bcm.edu	37	1	109857366	109857366	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:109857366G>C	ENST00000256637.6	-	18	2343	c.2285C>G	c.(2284-2286)gCc>gGc	p.A762G	SORT1_ENST00000538502.1_Missense_Mutation_p.A625G	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	762					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)	p.A762G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		TCCCACGATGGCCAGGATAAT	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											103.0	95.0	98.0					1																	109857366		2203	4300	6503	109658889	SO:0001583	missense	6272			BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.2285C>G	1.37:g.109857366G>C	ENSP00000256637:p.Ala762Gly	Somatic		WXS	SOLID	Phase_IV	109658889	B4DWI3|C0JYZ0|Q8IZ49	Missense_Mutation	SNP	ENST00000256637.6	37	CCDS798.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505824	0.44558	.	.	ENSG00000134243	ENST00000256637;ENST00000538502	T;T	0.16196	2.36;2.39	5.63	5.63	0.86233	.	0.326103	0.33691	N	0.004644	T	0.04861	0.0131	N	0.08118	0	0.37313	D	0.909213	B;B	0.09022	0.001;0.002	B;B	0.06405	0.002;0.002	T	0.31024	-0.9958	10	0.29301	T	0.29	-18.5992	18.452	0.90707	0.0:0.0:1.0:0.0	.	625;762	B4DWI3;Q99523	.;SORT_HUMAN	G	762;625	ENSP00000256637:A762G;ENSP00000438597:A625G	ENSP00000256637:A762G	A	-	2	0	SORT1	109658889	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.198000	0.65147	2.670000	0.90874	0.655000	0.94253	GCC		0.428	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033179.1	NM_002959	
TIMELESS	8914	hgsc.bcm.edu	37	12	56815921	56815921	+	Silent	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr12:56815921C>T	ENST00000553532.1	-	20	2643	c.2493G>A	c.(2491-2493)cgG>cgA	p.R831R	TIMELESS_ENST00000229201.4_Silent_p.R830R|TIMELESS_ENST00000554616.1_Intron					timeless circadian clock									p.R831R(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						GGTACAGCTCCCGAAGATGAG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	12											106.0	98.0	101.0					12																	56815921		2203	4300	6503	55102188	SO:0001819	synonymous_variant	8914			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2493G>A	12.37:g.56815921C>T		Somatic		WXS	SOLID	Phase_IV	55102188		Silent	SNP	ENST00000553532.1	37	CCDS8918.1																																																																																				0.537	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
TIPRL	261726	hgsc.bcm.edu	37	1	168160704	168160704	+	Frame_Shift_Del	DEL	A	A	-			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:168160704delA	ENST00000367833.2	+	4	627	c.482delA	c.(481-483)catfs	p.H161fs	TIPRL_ENST00000367830.3_Frame_Shift_Del_p.H161fs	NM_152902.3	NP_690866.1	O75663	TIPRL_HUMAN	TOR signaling pathway regulator	161					DNA damage checkpoint (GO:0000077)|negative regulation of protein phosphatase type 2A activity (GO:0034048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.H161fs*8(1)		breast(1)|kidney(1)|large_intestine(1)|ovary(2)|skin(1)	6	all_hematologic(923;0.215)					GATGAACTTCATGATCATGGA	0.303																																																1	Deletion - Frameshift(1)	ovary(1)	1											62.0	70.0	67.0					1																	168160704		2203	4300	6503	166427328	SO:0001589	frameshift_variant	261726			AB097034	CCDS1270.1, CCDS30935.1	1q23.2	2014-03-07	2014-03-07		ENSG00000143155	ENSG00000143155			30231	protein-coding gene	gene with protein product		611807	"""TIP41, TOR signaling pathway regulator-like (S. cerevisiae)"""			12761501	Standard	NM_001031800		Approved	MGC3794, dJ69E11.3, TIP41	uc001gfg.3	O75663	OTTHUMG00000034646	ENST00000367833.2:c.482delA	1.37:g.168160704delA	ENSP00000356807:p.His161fs	Somatic		WXS	SOLID	Phase_IV	166427328	B2R8V3|Q5HYB2|Q8IZ86	Frame_Shift_Del	DEL	ENST00000367833.2	37	CCDS1270.1																																																																																				0.303	TIPRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083822.1	NM_152902	
UQCRC1	7384	hgsc.bcm.edu	37	3	48638211	48638211	+	Silent	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr3:48638211G>C	ENST00000203407.5	-	9	1445	c.1029C>G	c.(1027-1029)acC>acG	p.T343T		NM_003365.2	NP_003356.2	P31930	QCR1_HUMAN	ubiquinol-cytochrome c reductase core protein I	343					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)|response to alkaloid (GO:0043279)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)	p.T343T(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		AGATGCTGAAGGTCTGGAAAC	0.557																																					NSCLC(81;1112 1427 27031 32409 45529)											1	Substitution - coding silent(1)	ovary(1)	3											82.0	76.0	78.0					3																	48638211		2203	4300	6503	48613215	SO:0001819	synonymous_variant	7384			BC009586	CCDS2774.1	3p21	2011-07-04			ENSG00000010256	ENSG00000010256	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12585	protein-coding gene	gene with protein product		191328				8407948	Standard	NM_003365		Approved	D3S3191, QCR1, UQCR1	uc003cub.1	P31930	OTTHUMG00000133539	ENST00000203407.5:c.1029C>G	3.37:g.48638211G>C		Somatic		WXS	SOLID	Phase_IV	48613215	B2R7R8|Q96DD2	Silent	SNP	ENST00000203407.5	37	CCDS2774.1																																																																																				0.557	UQCRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257517.1	NM_003365	
TMEM39A	55254	hgsc.bcm.edu	37	3	119151002	119151002	+	Silent	SNP	G	G	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr3:119151002G>A	ENST00000319172.5	-	9	1713	c.1293C>T	c.(1291-1293)gtC>gtT	p.V431V		NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	431						integral component of membrane (GO:0016021)		p.V431V(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		GATAGAAGACGACACTGCCCT	0.383																																																1	Substitution - coding silent(1)	ovary(1)	3											73.0	67.0	69.0					3																	119151002		2203	4300	6503	120633692	SO:0001819	synonymous_variant	55254			BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.1293C>T	3.37:g.119151002G>A		Somatic		WXS	SOLID	Phase_IV	120633692	D3DN80|Q53FN4|Q53GI1|Q6PKB5	Silent	SNP	ENST00000319172.5	37	CCDS2987.1																																																																																				0.383	TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354941.3	NM_018266	
XPNPEP3	63929	hgsc.bcm.edu	37	22	41322426	41322426	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr22:41322426G>C	ENST00000357137.4	+	10	1595	c.1511G>C	c.(1510-1512)aGc>aCc	p.S504T	XPNPEP3_ENST00000544094.1_Missense_Mutation_p.S481T	NM_022098.3	NP_071381.1	Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3, putative	504					glomerular filtration (GO:0003094)|protein processing (GO:0016485)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metallopeptidase activity (GO:0008237)	p.S504T(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	17						CAGATATGCAGCCAGGCTTCT	0.507																																					Ovarian(145;306 1841 7037 21878 30110)											1	Substitution - Missense(1)	ovary(1)	22											166.0	157.0	160.0					22																	41322426		2203	4300	6503	39652372	SO:0001583	missense	63929				CCDS14007.1, CCDS74869.1	22q13.2	2010-07-20			ENSG00000196236	ENSG00000196236			28052	protein-coding gene	gene with protein product		613553				15708373, 20179356	Standard	NM_022098		Approved	APP3, NPHPL1	uc003azh.3	Q9NQH7	OTTHUMG00000151312	ENST00000357137.4:c.1511G>C	22.37:g.41322426G>C	ENSP00000349658:p.Ser504Thr	Somatic		WXS	SOLID	Phase_IV	39652372	B2R9G1|B7Z790|B7Z7B2|Q6I9V9|Q8NDA6|Q9BV27|Q9BVH0	Missense_Mutation	SNP	ENST00000357137.4	37	CCDS14007.1	.	.	.	.	.	.	.	.	.	.	G	4.092	0.015109	0.07959	.	.	ENSG00000196236	ENST00000357137;ENST00000544094;ENST00000465561	T;T	0.79247	-1.25;-1.24	5.47	0.481	0.16809	.	0.353194	0.35838	N	0.002953	T	0.66790	0.2825	L	0.39633	1.23	0.25771	N	0.984832	B	0.12630	0.006	B	0.14023	0.01	T	0.58869	-0.7560	10	0.44086	T	0.13	-6.6776	11.7212	0.51683	0.2832:0.0:0.7168:0.0	.	504	Q9NQH7	XPP3_HUMAN	T	504;481;25	ENSP00000349658:S504T;ENSP00000441942:S481T	ENSP00000349658:S504T	S	+	2	0	XPNPEP3	39652372	1.000000	0.71417	0.747000	0.31113	0.090000	0.18270	2.058000	0.41374	0.289000	0.22422	-0.253000	0.11424	AGC		0.507	XPNPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322201.2	NM_022098	
WBP2NL	164684	hgsc.bcm.edu	37	22	42423015	42423015	+	Missense_Mutation	SNP	G	G	A	rs140763493		TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr22:42423015G>A	ENST00000328823.9	+	6	791	c.760G>A	c.(760-762)Gcc>Acc	p.A254T	WBP2NL_ENST00000543212.1_Missense_Mutation_p.A180T	NM_152613.2	NP_689826.2	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like	254	10 X 7 AA tandem repeat of Y-G-X-P-P-X-G.|Gly-rich.				egg activation (GO:0007343)|male pronucleus assembly (GO:0035039)|meiotic nuclear division (GO:0007126)	perinuclear theca (GO:0033011)	WW domain binding (GO:0050699)	p.A254T(1)		breast(2)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)	14						CGGATATGGAGCCCCACCTCT	0.602																																																1	Substitution - Missense(1)	ovary(1)	22											135.0	155.0	148.0					22																	42423015		2203	4300	6503	40752961	SO:0001583	missense	164684			BC022546	CCDS14029.1	22q13.2	2007-07-18			ENSG00000183066	ENSG00000183066			28389	protein-coding gene	gene with protein product	"""postacrosomal sheath WW domain-binding protein"""	610981				17289678	Standard	NM_152613		Approved	FLJ26145, MGC26816, PAWP	uc003bbt.3	Q6ICG8	OTTHUMG00000151270	ENST00000328823.9:c.760G>A	22.37:g.42423015G>A	ENSP00000332983:p.Ala254Thr	Somatic		WXS	SOLID	Phase_IV	40752961	A3KFF7|A8MSG5|B3KXX4|Q8TBF0|Q8TBF3	Missense_Mutation	SNP	ENST00000328823.9	37	CCDS14029.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.538778	0.65085	.	.	ENSG00000183066	ENST00000328823;ENST00000543212	T;T	0.25250	2.11;1.81	3.96	-4.41	0.03590	WW-domain-binding protein (1);	.	.	.	.	T	0.15089	0.0364	L	0.52905	1.665	0.09310	N	1	B	0.21520	0.057	B	0.15052	0.012	T	0.41052	-0.9530	9	0.09338	T	0.73	.	2.0752	0.03623	0.2389:0.3427:0.2959:0.1225	.	254	Q6ICG8	WBP2L_HUMAN	T	254;180	ENSP00000332983:A254T;ENSP00000442447:A180T	ENSP00000332983:A254T	A	+	1	0	WBP2NL	40752961	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.081000	0.11321	-0.870000	0.04047	-0.145000	0.13849	GCC		0.602	WBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322037.1	NM_152613	
ZMYND12	84217	hgsc.bcm.edu	37	1	42921578	42921578	+	Frame_Shift_Del	DEL	A	A	-			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:42921578delA	ENST00000372565.3	-	1	360	c.91delT	c.(91-93)tgcfs	p.C31fs	PPCS_ENST00000372560.3_5'Flank|PPCS_ENST00000372561.3_5'Flank|PPCS_ENST00000455780.1_5'Flank|PPCS_ENST00000372556.3_5'Flank|PPCS_ENST00000372562.1_5'Flank|ZMYND12_ENST00000433602.2_5'UTR	NM_032257.4	NP_115633.3	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12	31						intracellular (GO:0005622)	metal ion binding (GO:0046872)	p.C31fs*27(1)		NS(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|skin(2)	17	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GTGACTGTGCAGGCCGCGCAC	0.617																																																1	Deletion - Frameshift(1)	ovary(1)	1											41.0	42.0	42.0					1																	42921578		2203	4300	6503	42694165	SO:0001589	frameshift_variant	84217			AK057384	CCDS467.1	1p34.1	2008-02-05			ENSG00000066185	ENSG00000066185		"""Zinc fingers, MYND-type"""	21192	protein-coding gene	gene with protein product						11230166	Standard	NM_032257		Approved	DKFZp434N2435	uc001chj.3	Q9H0C1	OTTHUMG00000007333	ENST00000372565.3:c.91delT	1.37:g.42921578delA	ENSP00000361646:p.Cys31fs	Somatic		WXS	SOLID	Phase_IV	42694165	Q5VUS6|Q8TC87|Q96M51	Frame_Shift_Del	DEL	ENST00000372565.3	37	CCDS467.1																																																																																				0.617	ZMYND12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019170.1	NM_032257	
FER1L6	654463	hgsc.bcm.edu	37	8	125047661	125047661	+	Silent	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr8:125047661C>T	ENST00000522917.1	+	19	2636	c.2430C>T	c.(2428-2430)ggC>ggT	p.G810G	RP11-959I15.4_ENST00000522005.1_RNA|FER1L6-AS1_ENST00000518567.1_RNA|FER1L6_ENST00000399018.1_Silent_p.G810G	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	810						integral component of membrane (GO:0016021)		p.G810G(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AAGGGGCTGGCACCAATCACC	0.532																																																1	Substitution - coding silent(1)	ovary(1)	8											60.0	59.0	59.0					8																	125047661		1939	4141	6080	125116842	SO:0001819	synonymous_variant	654463			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2430C>T	8.37:g.125047661C>T		Somatic		WXS	SOLID	Phase_IV	125116842		Silent	SNP	ENST00000522917.1	37	CCDS43767.1																																																																																				0.532	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
GTF3C3	9330	hgsc.bcm.edu	37	2	197639868	197639868	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr2:197639868G>C	ENST00000263956.3	-	13	1892	c.1803C>G	c.(1801-1803)gaC>gaG	p.D601E		NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	601					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.D601E(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						CTGACTCTTGGTCATTGCTGT	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											120.0	111.0	114.0					2																	197639868		2203	4300	6503	197348113	SO:0001583	missense	9330			AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.1803C>G	2.37:g.197639868G>C	ENSP00000263956:p.Asp601Glu	Somatic		WXS	SOLID	Phase_IV	197348113	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	37	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059369	0.36373	.	.	ENSG00000119041	ENST00000263956;ENST00000435252	T	0.44881	0.91	5.2	2.37	0.29283	.	0.175991	0.49305	N	0.000157	T	0.20455	0.0492	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17715	-1.0360	10	0.02654	T	1	-14.2552	7.6705	0.28455	0.1418:0.2631:0.5952:0.0	.	601	Q9Y5Q9	TF3C3_HUMAN	E	601;124	ENSP00000263956:D601E	ENSP00000263956:D601E	D	-	3	2	GTF3C3	197348113	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	0.938000	0.28965	0.322000	0.23283	-0.176000	0.13171	GAC		0.348	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
KMT2E	55904	hgsc.bcm.edu	37	7	104752614	104752614	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr7:104752614T>A	ENST00000311117.3	+	27	4956	c.4411T>A	c.(4411-4413)Tca>Aca	p.S1471T	KMT2E_ENST00000334877.4_Missense_Mutation_p.S1429T|KMT2E_ENST00000257745.4_Missense_Mutation_p.S1471T|KMT2E_ENST00000334914.7_Missense_Mutation_p.S526T|SRPK2_ENST00000493638.1_Intron	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1471	Pro-rich. {ECO:0000255}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.S1471T(1)									AAAGCCTCCTTCACAGCAGTT	0.483																																																1	Substitution - Missense(1)	ovary(1)	7											123.0	113.0	116.0					7																	104752614		2203	4300	6503	104539850	SO:0001583	missense	55904			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.4411T>A	7.37:g.104752614T>A	ENSP00000312379:p.Ser1471Thr	Somatic		WXS	SOLID	Phase_IV	104539850	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.153201	0.38021	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914	D;D;D;T	0.93019	-3.15;-3.02;-3.15;0.59	4.16	-5.04	0.02964	.	0.742253	0.11527	N	0.555092	D	0.83096	0.5180	N	0.17082	0.46	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.0	T	0.60167	-0.7316	10	0.41790	T	0.15	.	7.0473	0.25052	0.2313:0.0:0.3525:0.4162	.	1391;1471	F8W6H1;Q8IZD2	.;MLL5_HUMAN	T	1471;1471;1429;1391;1471;526	ENSP00000312379:S1471T;ENSP00000335599:S1429T;ENSP00000257745:S1471T;ENSP00000333986:S526T	ENSP00000257745:S1471T	S	+	1	0	MLL5	104539850	0.583000	0.26757	0.927000	0.36925	0.999000	0.98932	0.320000	0.19540	-0.589000	0.05874	0.528000	0.53228	TCA		0.483	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
MUC16	94025	hgsc.bcm.edu	37	19	9087711	9087711	+	Silent	SNP	A	A	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr19:9087711A>T	ENST00000397910.4	-	1	4307	c.4104T>A	c.(4102-4104)ccT>ccA	p.P1368P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1368	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P1368P(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTGAGATTTTAGGACTTCCAG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	19											172.0	177.0	175.0					19																	9087711		2195	4298	6493	8948711	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4104T>A	19.37:g.9087711A>T		Somatic		WXS	SOLID	Phase_IV	8948711	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
NOL8	55035	hgsc.bcm.edu	37	9	95077666	95077666	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr9:95077666T>G	ENST00000535387.1	-	6	1240	c.1241A>C	c.(1240-1242)aAt>aCt	p.N414T	NOL8_ENST00000542053.1_Missense_Mutation_p.N346T|NOL8_ENST00000442668.2_Missense_Mutation_p.N414T|NOL8_ENST00000358855.4_Missense_Mutation_p.N346T|NOL8_ENST00000545558.1_Missense_Mutation_p.N414T					nucleolar protein 8									p.N416T(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						GTTTTCTCTATTTTTGAAAGA	0.313																																																1	Substitution - Missense(1)	ovary(1)	9											25.0	21.0	22.0					9																	95077666		1802	4054	5856	94117487	SO:0001583	missense	55035			AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000535387.1:c.1241A>C	9.37:g.95077666T>G	ENSP00000441300:p.Asn414Thr	Somatic		WXS	SOLID	Phase_IV	94117487		Missense_Mutation	SNP	ENST00000535387.1	37	CCDS47993.1	.	.	.	.	.	.	.	.	.	.	T	0.944	-0.708627	0.03230	.	.	ENSG00000198000	ENST00000442668;ENST00000375594;ENST00000358855;ENST00000545558;ENST00000535387;ENST00000542053;ENST00000432670	T;T;T;T;T;T	0.17854	2.52;2.52;2.52;2.74;2.52;2.25	5.69	-1.34	0.09143	.	1.056050	0.07388	N	0.888603	T	0.09468	0.0233	N	0.14661	0.345	0.09310	N	1	B	0.14805	0.011	B	0.08055	0.003	T	0.36866	-0.9730	10	0.45353	T	0.12	-2.8735	6.4006	0.21636	0.0:0.3115:0.2223:0.4663	.	414	Q76FK4	NOL8_HUMAN	T	414;416;346;414;414;346;414	ENSP00000401177:N414T;ENSP00000351723:N346T;ENSP00000441140:N414T;ENSP00000441300:N414T;ENSP00000440709:N346T;ENSP00000414112:N414T	ENSP00000351723:N346T	N	-	2	0	NOL8	94117487	0.208000	0.23494	0.011000	0.14972	0.105000	0.19272	0.225000	0.17757	-0.139000	0.11414	0.533000	0.62120	AAT		0.313	NOL8-010	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053082.2	NM_017948	
OR7D2	162998	hgsc.bcm.edu	37	19	9297069	9297069	+	Silent	SNP	T	T	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr19:9297069T>A	ENST00000344248.2	+	1	791	c.612T>A	c.(610-612)ggT>ggA	p.G204G		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	204					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G204G(1)		breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						TTATGACGGGTGTGCTGGGCG	0.443																																																1	Substitution - coding silent(1)	ovary(1)	19											145.0	136.0	139.0					19																	9297069		2203	4300	6503	9158069	SO:0001819	synonymous_variant	162998			AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.612T>A	19.37:g.9297069T>A		Somatic		WXS	SOLID	Phase_IV	9158069	Q6IFJ7|Q8N133	Silent	SNP	ENST00000344248.2	37	CCDS32900.1																																																																																				0.443	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449002.1		
RNASE11	122651	hgsc.bcm.edu	37	14	21052068	21052068	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr14:21052068A>C	ENST00000610205.1	-	3	749	c.566T>G	c.(565-567)cTg>cGg	p.L189R	RNASE11_ENST00000398009.2_Missense_Mutation_p.L189R|RNASE11_ENST00000432835.2_Missense_Mutation_p.L189R|RNASE11_ENST00000553849.1_Missense_Mutation_p.L189R|RNASE11_ENST00000398008.2_Missense_Mutation_p.L189R|RNASE11_ENST00000555841.1_Missense_Mutation_p.L189R	NM_145250.3	NP_660293.1	Q8TAA1	RNS11_HUMAN	ribonuclease, RNase A family, 11 (non-active)	189						extracellular region (GO:0005576)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)	p.L189R(1)		endometrium(1)|large_intestine(6)|lung(7)|ovary(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	21	all_cancers(95;0.00238)	all_lung(585;0.235)	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.0139)		CCAGCTCATCAGAGAATGACC	0.423																																																1	Substitution - Missense(1)	ovary(1)	14											85.0	73.0	77.0					14																	21052068		2203	4300	6503	20121908	SO:0001583	missense	122651			BC025410	CCDS9553.1	14q11.1	2013-08-05	2004-11-18	2004-11-18	ENSG00000173464	ENSG00000173464		"""Ribonucleases, RNase A"""	19269	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 6"""	C14orf6			Standard	NM_145250		Approved		uc001vxs.3	Q8TAA1	OTTHUMG00000170990	ENST00000610205.1:c.566T>G	14.37:g.21052068A>C	ENSP00000476537:p.Leu189Arg	Somatic		WXS	SOLID	Phase_IV	20121908		Missense_Mutation	SNP	ENST00000610205.1	37	CCDS9553.1	.	.	.	.	.	.	.	.	.	.	A	17.03	3.284797	0.59867	.	.	ENSG00000173464	ENST00000335950;ENST00000553849;ENST00000555841;ENST00000398009;ENST00000398008;ENST00000432835	T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83	3.88	2.74	0.32292	Ribonuclease A, domain (1);	0.453245	0.17844	N	0.160085	T	0.49847	0.1581	L	0.27053	0.805	0.30897	N	0.729683	D	0.89917	1.0	D	0.81914	0.995	T	0.51196	-0.8736	10	0.87932	D	0	-22.9072	5.9833	0.19419	0.8824:0.0:0.1176:0.0	.	189	Q8TAA1	RNS11_HUMAN	R	189	ENSP00000338288:L189R;ENSP00000451318:L189R;ENSP00000451563:L189R;ENSP00000381093:L189R;ENSP00000381092:L189R;ENSP00000395210:L189R	ENSP00000338288:L189R	L	-	2	0	RNASE11	20121908	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.979000	0.40608	0.850000	0.35239	0.418000	0.28097	CTG		0.423	RNASE11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073662.3	NM_145250	
TBC1D21	161514	hgsc.bcm.edu	37	15	74178503	74178503	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr15:74178503G>C	ENST00000300504.2	+	7	747	c.664G>C	c.(664-666)Gct>Cct	p.A222P	TBC1D21_ENST00000562056.1_Missense_Mutation_p.A185P|TBC1D21_ENST00000535547.2_Missense_Mutation_p.A186P	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	222	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.A222P(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						CCCCGTGTTTGCTGAGCACCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	15											186.0	128.0	148.0					15																	74178503		2198	4297	6495	71965556	SO:0001583	missense	161514			BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.664G>C	15.37:g.74178503G>C	ENSP00000300504:p.Ala222Pro	Somatic		WXS	SOLID	Phase_IV	71965556	B9A6M2	Missense_Mutation	SNP	ENST00000300504.2	37	CCDS10252.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558468	0.65538	.	.	ENSG00000167139	ENST00000300504;ENST00000535547	T;T	0.23348	1.91;1.91	4.78	4.78	0.61160	Rab-GAP/TBC domain (5);	0.000000	0.52532	D	0.000078	T	0.31544	0.0800	L	0.29908	0.895	0.42212	D	0.991815	P;P	0.51537	0.946;0.497	P;P	0.56127	0.792;0.611	T	0.02150	-1.1205	10	0.37606	T	0.19	.	13.6457	0.62279	0.0:0.0:1.0:0.0	.	186;222	B9A6M2;Q8IYX1	.;TBC21_HUMAN	P	222;186	ENSP00000300504:A222P;ENSP00000439325:A186P	ENSP00000300504:A222P	A	+	1	0	TBC1D21	71965556	1.000000	0.71417	0.987000	0.45799	0.820000	0.46376	1.798000	0.38814	2.371000	0.80710	0.536000	0.68110	GCT		0.592	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268994.1	NM_153356	
TP53	7157	hgsc.bcm.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	17	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	7517845	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His	Somatic		WXS	SOLID	Phase_IV	7517845	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
WDR75	84128	hgsc.bcm.edu	37	2	190340030	190340030	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr2:190340030G>C	ENST00000314761.4	+	21	2440	c.2380G>C	c.(2380-2382)Gat>Cat	p.D794H		NM_032168.1	NP_115544.1	Q8IWA0	WDR75_HUMAN	WD repeat domain 75	794						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.D794H(1)		breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)			AAAAGTCCAGGATACAAGTAA	0.323																																																1	Substitution - Missense(1)	ovary(1)	2											59.0	61.0	60.0					2																	190340030		2203	4300	6503	190048275	SO:0001583	missense	84128			AK091546	CCDS2298.1	2q32.2	2013-01-09			ENSG00000115368	ENSG00000115368		"""WD repeat domain containing"""	25725	protein-coding gene	gene with protein product	"""UTP17, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_032168		Approved	FLJ12519, NET16, UTP17	uc002uql.1	Q8IWA0	OTTHUMG00000132660	ENST00000314761.4:c.2380G>C	2.37:g.190340030G>C	ENSP00000314193:p.Asp794His	Somatic		WXS	SOLID	Phase_IV	190048275	Q96J10|Q9H8U8|Q9H9U5|Q9H9V8|Q9UIX2	Missense_Mutation	SNP	ENST00000314761.4	37	CCDS2298.1	.	.	.	.	.	.	.	.	.	.	G	8.613	0.889529	0.17540	.	.	ENSG00000115368	ENST00000314761	T	0.61627	0.09	5.01	2.22	0.28083	.	0.421858	0.24891	N	0.034763	T	0.39860	0.1094	L	0.40543	1.245	0.09310	N	1	P;B	0.38642	0.641;0.343	B;B	0.32289	0.143;0.125	T	0.25433	-1.0132	10	0.44086	T	0.13	-2.3289	6.424	0.21760	0.2172:0.1386:0.6442:0.0	.	794;794	A8K330;Q8IWA0	.;WDR75_HUMAN	H	794	ENSP00000314193:D794H	ENSP00000314193:D794H	D	+	1	0	WDR75	190048275	0.883000	0.30277	0.003000	0.11579	0.578000	0.36192	1.220000	0.32491	0.808000	0.34231	0.591000	0.81541	GAT		0.323	WDR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255913.1	NM_032168	
DNAH8	1769	hgsc.bcm.edu	37	6	38851758	38851758	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr6:38851758A>T	ENST00000359357.3	+	54	7846	c.7592A>T	c.(7591-7593)aAt>aTt	p.N2531I	DNAH8_ENST00000441566.1_Missense_Mutation_p.N2495I|DNAH8_ENST00000449981.2_Missense_Mutation_p.N2748I			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2531	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.N2531I(1)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CCTGTGATTAATGAGTGGGGA	0.318																																																1	Substitution - Missense(1)	ovary(1)	6											99.0	102.0	101.0					6																	38851758		2203	4300	6503	38959736	SO:0001583	missense	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7592A>T	6.37:g.38851758A>T	ENSP00000352312:p.Asn2531Ile	Somatic		WXS	SOLID	Phase_III	38959736	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	A	22.8	4.337733	0.81911	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.17528	2.27;2.27;2.27	5.07	5.07	0.68467	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.47525	0.1450	H	0.95224	3.64	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65533	-0.6145	10	0.87932	D	0	.	15.1103	0.72351	1.0:0.0:0.0:0.0	.	2531	Q96JB1	DYH8_HUMAN	I	2736;2736;2531;2495	ENSP00000333363:N2736I;ENSP00000352312:N2531I;ENSP00000402294:N2495I	ENSP00000333363:N2736I	N	+	2	0	DNAH8	38959736	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.277000	0.95755	2.030000	0.59900	0.454000	0.30748	AAT		0.318	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
ZNF292	23036	hgsc.bcm.edu	37	6	87968048	87968048	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr6:87968048G>T	ENST00000369577.3	+	8	4744	c.4701G>T	c.(4699-4701)ttG>ttT	p.L1567F	ZNF292_ENST00000339907.4_Missense_Mutation_p.L1562F	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1567						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.L1422F(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GTAGCAGCTTGCCTGTTTTTC	0.433																																																1	Substitution - Missense(1)	ovary(1)	6											77.0	75.0	75.0					6																	87968048		1961	4150	6111	88024767	SO:0001583	missense	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.4701G>T	6.37:g.87968048G>T	ENSP00000358590:p.Leu1567Phe	Somatic		WXS	SOLID	Phase_IV	88024767	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	G	6.673	0.492773	0.12702	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.10477	2.87;2.88	6.07	3.33	0.38152	.	0.209202	0.30714	N	0.009035	T	0.02380	0.0073	N	0.24115	0.695	0.34375	D	0.692506	B	0.20887	0.049	B	0.19666	0.026	T	0.33214	-0.9877	10	0.44086	T	0.13	.	5.9805	0.19405	0.3164:0.0:0.5646:0.119	.	1567	O60281	ZN292_HUMAN	F	1567;1562	ENSP00000358590:L1567F;ENSP00000342847:L1562F	ENSP00000342847:L1562F	L	+	3	2	ZNF292	88024767	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	0.955000	0.29188	0.905000	0.36596	0.655000	0.94253	TTG		0.433	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
FBXW2	26190	hgsc.bcm.edu	37	9	123538409	123538409	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr9:123538409G>C	ENST00000608872.1	-	5	968	c.781C>G	c.(781-783)Ctg>Gtg	p.L261V	FBXW2_ENST00000493559.1_5'UTR|FBXW2_ENST00000340778.5_Missense_Mutation_p.L196V	NM_012164.3	NP_036296.2	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2	261					cellular protein modification process (GO:0006464)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)	p.L261V(1)		ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	4						AGTGTGTTCAGGCATGTCCCA	0.502																																																1	Substitution - Missense(1)	ovary(1)	9											142.0	145.0	144.0					9																	123538409		2043	4191	6234	122578230	SO:0001583	missense	26190			AF129531	CCDS43872.1	9q34	2013-01-09	2007-02-08		ENSG00000119402	ENSG00000119402		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13608	protein-coding gene	gene with protein product		609071	"""F-box and WD-40 domain protein 2"""			10531035, 10828603	Standard	NM_012164		Approved	FBW2, Md6, Fwd2	uc004bkm.1	Q9UKT8	OTTHUMG00000020576	ENST00000608872.1:c.781C>G	9.37:g.123538409G>C	ENSP00000476369:p.Leu261Val	Somatic		WXS	SOLID	Phase_III	122578230	B3KRL8|Q4VXH2|Q7Z4V6|Q8WV51|Q9HA09|Q9UKA3	Missense_Mutation	SNP	ENST00000608872.1	37	CCDS43872.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948853	0.53186	.	.	ENSG00000119402	ENST00000373926;ENST00000340778;ENST00000444833;ENST00000453291	T;T;T	0.18657	2.21;2.2;2.21	5.18	4.27	0.50696	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.150434	0.45126	N	0.000387	T	0.13970	0.0338	L	0.33485	1.01	0.50171	D	0.999855	B;B;B	0.11235	0.004;0.0;0.001	B;B;B	0.12156	0.007;0.001;0.002	T	0.09885	-1.0654	10	0.19147	T	0.46	-2.6315	7.447	0.27217	0.0893:0.1709:0.7397:0.0	.	196;261;261	Q9UKT8-2;B2RAW3;Q9UKT8	.;.;FBXW2_HUMAN	V	261;196;261;132	ENSP00000363036:L261V;ENSP00000341161:L196V;ENSP00000398662:L132V	ENSP00000341161:L196V	L	-	1	2	FBXW2	122578230	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.609000	0.74173	1.270000	0.44297	0.563000	0.77884	CTG		0.502	FBXW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053834.2		
SLC2A3	6515	hgsc.bcm.edu	37	12	8075601	8075601	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr12:8075601C>T	ENST00000075120.7	-	9	1328	c.1088G>A	c.(1087-1089)aGc>aAc	p.S363N		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	363					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)	p.S363N(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		ACAGACAAAGCTCATCCCATT	0.433																																					Colon(96;424 1461 14416 20933 23688)											1	Substitution - Missense(1)	ovary(1)	12											38.0	38.0	38.0					12																	8075601		2203	4300	6503	7966868	SO:0001583	missense	6515			M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.1088G>A	12.37:g.8075601C>T	ENSP00000075120:p.Ser363Asn	Somatic		WXS	SOLID	Phase_III	7966868	B2R606|D3DUU6|Q6I9U2|Q9UG15	Missense_Mutation	SNP	ENST00000075120.7	37	CCDS8586.1	.	.	.	.	.	.	.	.	.	.	C	9.554	1.116646	0.20795	.	.	ENSG00000059804	ENST00000075120;ENST00000540978	D	0.81908	-1.55	4.34	3.43	0.39272	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.131649	0.64402	D	0.000001	D	0.84515	0.5489	M	0.66506	2.035	0.41203	D	0.986381	B	0.26902	0.163	B	0.40477	0.33	D	0.84046	0.0367	10	0.56958	D	0.05	.	12.2557	0.54623	0.0:0.8272:0.1728:0.0	.	363	P11169	GTR3_HUMAN	N	363;289	ENSP00000075120:S363N	ENSP00000075120:S363N	S	-	2	0	SLC2A3	7966868	0.998000	0.40836	0.978000	0.43139	0.078000	0.17371	2.623000	0.46435	1.151000	0.42436	0.655000	0.94253	AGC		0.433	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257914.1	NM_006931	
ZDHHC23	254887	hgsc.bcm.edu	37	3	113672987	113672987	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr3:113672987G>T	ENST00000330212.3	+	3	901	c.602G>T	c.(601-603)gGt>gTt	p.G201V	ZDHHC23_ENST00000498275.1_Missense_Mutation_p.G195V	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23	201					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.G201V(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						CCAGCAAGCGGTGACAGATCT	0.552																																																1	Substitution - Missense(1)	ovary(1)	3											107.0	113.0	111.0					3																	113672987		2203	4300	6503	115155677	SO:0001583	missense	254887			AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.602G>T	3.37:g.113672987G>T	ENSP00000330485:p.Gly201Val	Somatic		WXS	SOLID	Phase_III	115155677	D3DN76	Missense_Mutation	SNP	ENST00000330212.3	37	CCDS33827.1	.	.	.	.	.	.	.	.	.	.	G	1.062	-0.672714	0.03403	.	.	ENSG00000184307	ENST00000330212;ENST00000498275	T;T	0.43294	0.95;0.95	5.26	-4.78	0.03209	.	2.047310	0.01699	N	0.027111	T	0.17916	0.0430	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.09037	-1.0693	10	0.26408	T	0.33	2.4072	4.0555	0.09814	0.2265:0.2194:0.4464:0.1078	.	201	Q8IYP9	ZDH23_HUMAN	V	201;195	ENSP00000330485:G201V;ENSP00000417840:G195V	ENSP00000330485:G201V	G	+	2	0	ZDHHC23	115155677	0.000000	0.05858	0.000000	0.03702	0.112000	0.19704	-0.094000	0.11094	-1.054000	0.03214	0.561000	0.74099	GGT		0.552	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354702.1	NM_173570	
ARL8A	127829	hgsc.bcm.edu	37	1	202104655	202104655	+	Splice_Site	SNP	C	C	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:202104655C>A	ENST00000272217.2	-	5	541		c.e5-1		ARL8A_ENST00000486225.1_5'UTR	NM_001256129.1|NM_138795.3	NP_001243058.1|NP_620150.1	Q96BM9	ARL8A_HUMAN	ADP-ribosylation factor-like 8A						chromosome segregation (GO:0007059)|GTP catabolic process (GO:0006184)|mitotic nuclear division (GO:0007067)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|midbody (GO:0030496)|spindle midzone (GO:0051233)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.?(1)		large_intestine(1)|lung(2)|ovary(2)|skin(1)	6						GGACTAAGACCTACGGAGAAG	0.557											OREG0012976	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Unknown(1)	ovary(1)	1											115.0	116.0	116.0					1																	202104655		2203	4300	6503	200371278	SO:0001630	splice_region_variant	127829			BC015408	CCDS1421.1, CCDS73004.1	1q32.1	2014-05-09	2005-11-03	2005-11-03	ENSG00000143862	ENSG00000143862		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25192	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10B"""	ARL10B		8889548	Standard	NM_001256129		Approved	FLJ45195, Gie2	uc001gxk.2	Q96BM9	OTTHUMG00000035923	ENST00000272217.2:c.373-1G>T	1.37:g.202104655C>A		Somatic	2126	WXS	SOLID	Phase_IV	200371278	B3KXD0	Splice_Site	SNP	ENST00000272217.2	37	CCDS1421.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.368069	0.61513	.	.	ENSG00000143862	ENST00000272217	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4214	0.90591	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARL8A	200371278	1.000000	0.71417	0.993000	0.49108	0.570000	0.35934	7.606000	0.82863	2.334000	0.79466	0.305000	0.20034	.		0.557	ARL8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087493.1	NM_138795	Intron
CYP26A1	1592	hgsc.bcm.edu	37	10	94835617	94835617	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr10:94835617G>C	ENST00000224356.4	+	5	944	c.899G>C	c.(898-900)gGa>gCa	p.G300A	CYP26A1_ENST00000394139.1_Missense_Mutation_p.G231A|CYP26A1_ENST00000371531.1_Missense_Mutation_p.G231A	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	300					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)	p.G231A(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	CTCCTCTTTGGAGGACACGAA	0.493																																																1	Substitution - Missense(1)	ovary(1)	10											82.0	78.0	79.0					10																	94835617		2203	4300	6503	94825607	SO:0001583	missense	1592			AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.899G>C	10.37:g.94835617G>C	ENSP00000224356:p.Gly300Ala	Somatic		WXS	SOLID	Phase_IV	94825607	B3KNI4|Q5VXH9|Q5VXI0	Missense_Mutation	SNP	ENST00000224356.4	37	CCDS7426.1	.	.	.	.	.	.	.	.	.	.	G	9.473	1.096054	0.20552	.	.	ENSG00000095596	ENST00000371531;ENST00000224356;ENST00000394139	T;T;T	0.58060	0.36;0.36;0.36	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.33673	0.0871	N	0.11698	0.16	0.80722	D	1	B;B	0.13145	0.007;0.007	B;B	0.14578	0.011;0.002	T	0.25847	-1.0120	10	0.02654	T	1	-9.8409	19.0472	0.93027	0.0:0.0:1.0:0.0	.	231;300	B3KNI4;O43174	.;CP26A_HUMAN	A	231;300;231	ENSP00000360586:G231A;ENSP00000224356:G300A;ENSP00000377695:G231A	ENSP00000224356:G300A	G	+	2	0	CYP26A1	94825607	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.986000	0.93492	2.749000	0.94314	0.655000	0.94253	GGA		0.493	CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049408.3		
DOPEY2	9980	hgsc.bcm.edu	37	21	37609580	37609580	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr21:37609580G>C	ENST00000399151.3	+	16	2728	c.2643G>C	c.(2641-2643)tgG>tgC	p.W881C		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	881					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.W881C(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GTGTGCTTTGGAATCAGCTGA	0.587																																																1	Substitution - Missense(1)	ovary(1)	21											103.0	88.0	93.0					21																	37609580		2203	4300	6503	36531450	SO:0001583	missense	9980			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.2643G>C	21.37:g.37609580G>C	ENSP00000382104:p.Trp881Cys	Somatic		WXS	SOLID	Phase_IV	36531450	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	37	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362226	0.82353	.	.	ENSG00000142197	ENST00000399151	T	0.66280	-0.2	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.81740	0.4886	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84481	0.0605	10	0.87932	D	0	-2.9886	18.9768	0.92740	0.0:0.0:1.0:0.0	.	881	Q9Y3R5	DOP2_HUMAN	C	881	ENSP00000382104:W881C	ENSP00000382104:W881C	W	+	3	0	DOPEY2	36531450	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.259000	0.95561	2.489000	0.83994	0.591000	0.81541	TGG		0.587	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
FKBP9	11328	hgsc.bcm.edu	37	7	33016064	33016064	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr7:33016064G>A	ENST00000242209.4	+	4	825	c.656G>A	c.(655-657)cGc>cAc	p.R219H	FKBP9_ENST00000489038.1_3'UTR|FKBP9_ENST00000538336.1_Missense_Mutation_p.R272H|FKBP9_ENST00000538443.1_Missense_Mutation_p.R81H|AVL9_ENST00000404479.1_Intron	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	219	PPIase FKBP-type 2. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.R219H(1)		central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			GGTGAGAAGCGCATCATCACC	0.478																																																1	Substitution - Missense(1)	ovary(1)	7											161.0	140.0	147.0					7																	33016064		2202	4286	6488	32982589	SO:0001583	missense	11328			AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.656G>A	7.37:g.33016064G>A	ENSP00000242209:p.Arg219His	Somatic		WXS	SOLID	Phase_IV	32982589	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Missense_Mutation	SNP	ENST00000242209.4	37	CCDS5439.1	.	.	.	.	.	.	.	.	.	.	G	33	5.222651	0.95139	.	.	ENSG00000122642	ENST00000242209;ENST00000538336;ENST00000538443	D;D;D	0.87966	-2.32;-2.32;-2.32	4.73	4.73	0.59995	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	0.000000	0.85682	D	0.000000	D	0.96097	0.8728	H	0.97564	4.03	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97871	1.0286	10	0.87932	D	0	-14.008	18.074	0.89422	0.0:0.0:1.0:0.0	.	272;219;219	B7Z6H3;O95302;B3KQQ0	.;FKBP9_HUMAN;.	H	219;272;81	ENSP00000242209:R219H;ENSP00000439250:R272H;ENSP00000437504:R81H	ENSP00000242209:R219H	R	+	2	0	FKBP9	32982589	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	9.777000	0.99008	2.341000	0.79615	0.455000	0.32223	CGC		0.478	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
MORN1	79906	hgsc.bcm.edu	37	1	2317304	2317304	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:2317304C>T	ENST00000378531.3	-	5	564	c.391G>A	c.(391-393)Gtg>Atg	p.V131M	MORN1_ENST00000378529.3_Missense_Mutation_p.V131M|MORN1_ENST00000606372.1_5'UTR	NM_024848.1	NP_079124.1	Q5T089	MORN1_HUMAN	MORN repeat containing 1	131								p.V131M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(1)|ovary(2)	9	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		CCCTGGTACACTTGTCCATCC	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											164.0	150.0	154.0					1																	2317304		2203	4300	6503	2307164	SO:0001583	missense	79906			AK024003	CCDS40.1, CCDS72688.1	1p36.33-p36.32	2008-02-05			ENSG00000116151	ENSG00000116151			25852	protein-coding gene	gene with protein product						12477932	Standard	XM_005244798		Approved	FLJ13941	uc001ajb.1	Q5T089	OTTHUMG00000001402	ENST00000378531.3:c.391G>A	1.37:g.2317304C>T	ENSP00000367792:p.Val131Met	Somatic		WXS	SOLID	Phase_IV	2307164	A6NKZ6|Q8WW30|Q9H852	Missense_Mutation	SNP	ENST00000378531.3	37	CCDS40.1	.	.	.	.	.	.	.	.	.	.	C	9.935	1.215968	0.22373	.	.	ENSG00000116151	ENST00000378531;ENST00000378529;ENST00000378525	T;T;T	0.47528	0.86;0.86;0.84	4.41	1.44	0.22558	.	1.370220	0.04834	N	0.439334	T	0.59197	0.2176	L	0.50847	1.595	0.09310	N	1	D;D;D	0.71674	0.998;0.98;0.984	D;P;P	0.68353	0.957;0.847;0.905	T	0.42447	-0.9451	10	0.30854	T	0.27	.	6.504	0.22184	0.0:0.5875:0.0:0.4125	.	107;131;131	B4DRE3;Q5T089-2;Q5T089	.;.;MORN1_HUMAN	M	131;131;107	ENSP00000367792:V131M;ENSP00000367790:V131M;ENSP00000367786:V107M	ENSP00000367786:V107M	V	-	1	0	MORN1	2307164	0.003000	0.15002	0.002000	0.10522	0.010000	0.07245	0.842000	0.27627	0.497000	0.27926	0.460000	0.39030	GTG		0.567	MORN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004055.1	NM_024848	
SETD4	54093	hgsc.bcm.edu	37	21	37420633	37420633	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr21:37420633C>T	ENST00000399215.1	-	4	1641	c.269G>A	c.(268-270)cGa>cAa	p.R90Q	SETD4_ENST00000399212.1_Missense_Mutation_p.R66Q|SETD4_ENST00000481477.1_Intron|SETD4_ENST00000332131.4_Missense_Mutation_p.R90Q|SETD4_ENST00000399201.1_Missense_Mutation_p.R66Q|SETD4_ENST00000399205.1_Missense_Mutation_p.R66Q|SETD4_ENST00000399208.2_Missense_Mutation_p.R90Q|SETD4_ENST00000399207.1_Missense_Mutation_p.R90Q			Q9NVD3	SETD4_HUMAN	SET domain containing 4	90	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						methyltransferase activity (GO:0008168)	p.R90Q(2)		autonomic_ganglia(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	15						TAAGTAGCTTCGAATCACTGT	0.463																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	21											386.0	318.0	341.0					21																	37420633		2203	4300	6503	36342503	SO:0001583	missense	54093			AK001660	CCDS13640.1, CCDS42923.1, CCDS74791.1, CCDS74792.1	21q22.13	2006-02-15	2006-02-15	2006-02-15	ENSG00000185917	ENSG00000185917			1258	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 27"", ""chromosome 21 open reading frame 18"""	C21orf27, C21orf18			Standard	XM_005261000		Approved		uc021wiy.1	Q9NVD3	OTTHUMG00000086483	ENST00000399215.1:c.269G>A	21.37:g.37420633C>T	ENSP00000382163:p.Arg90Gln	Somatic		WXS	SOLID	Phase_IV	36342503	B4DT14|D3DSG2|D3DSG4|Q8NE19|Q9BU46	Missense_Mutation	SNP	ENST00000399215.1	37	CCDS13640.1	.	.	.	.	.	.	.	.	.	.	C	5.507	0.278582	0.10403	.	.	ENSG00000185917	ENST00000399215;ENST00000399212;ENST00000332131;ENST00000399205;ENST00000399208;ENST00000399201;ENST00000399207;ENST00000424303;ENST00000429161;ENST00000446166;ENST00000442559	D;D;D;D;D;D;D;T;T;T;T	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;2.57;2.57;2.57;2.57	5.25	-0.836	0.10770	SET domain (1);	0.397866	0.27664	N	0.018362	T	0.59376	0.2189	N	0.12961	0.28	0.09310	N	1	B;B;B;B	0.21753	0.06;0.029;0.048;0.0	B;B;B;B	0.16289	0.015;0.004;0.009;0.002	T	0.43782	-0.9370	10	0.13108	T	0.6	8.0285	11.2508	0.49024	0.0:0.4034:0.0:0.5966	.	66;90;66;90	A8MTS1;C9JWV5;Q9NVD3-3;Q9NVD3	.;.;.;SETD4_HUMAN	Q	90;66;90;66;90;66;90;90;90;66;66	ENSP00000382163:R90Q;ENSP00000382161:R66Q;ENSP00000329189:R90Q;ENSP00000382156:R66Q;ENSP00000382159:R90Q;ENSP00000382152:R66Q;ENSP00000382158:R90Q;ENSP00000399998:R90Q;ENSP00000396837:R90Q;ENSP00000413318:R66Q;ENSP00000394822:R66Q	ENSP00000329189:R90Q	R	-	2	0	SETD4	36342503	0.000000	0.05858	0.057000	0.19452	0.487000	0.33371	-0.245000	0.08890	0.002000	0.14630	-1.012000	0.02466	CGA		0.463	SETD4-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194456.1	NM_017438	
SMARCAL1	50485	hgsc.bcm.edu	37	2	217280023	217280023	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr2:217280023C>G	ENST00000357276.4	+	3	926	c.596C>G	c.(595-597)cCt>cGt	p.P199R	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.P199R|AC098820.2_ENST00000457694.1_RNA	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	199					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)	p.P199R(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		AAAGCCTCCCCTTCGGGGCAG	0.522									Schimke Immuno-Osseous Dysplasia																																							1	Substitution - Missense(1)	ovary(1)	2											75.0	75.0	75.0					2																	217280023		2203	4300	6503	216988268	SO:0001583	missense	50485	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.596C>G	2.37:g.217280023C>G	ENSP00000349823:p.Pro199Arg	Somatic		WXS	SOLID	Phase_IV	216988268	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.733407	0.30684	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000427645;ENST00000392128	D;D;T;D	0.85411	-1.93;-1.93;1.58;-1.98	5.44	4.54	0.55810	.	0.625395	0.16340	N	0.218711	T	0.69797	0.3151	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.56080	-0.8038	10	0.33141	T	0.24	-4.5175	10.3516	0.43939	0.0:0.9096:0.0:0.0904	.	199	Q9NZC9	SMAL1_HUMAN	R	199;199;98;63	ENSP00000349823:P199R;ENSP00000350940:P199R;ENSP00000392997:P98R;ENSP00000375974:P63R	ENSP00000349823:P199R	P	+	2	0	SMARCAL1	216988268	0.083000	0.21467	0.008000	0.14137	0.001000	0.01503	2.311000	0.43717	2.832000	0.97577	0.655000	0.94253	CCT		0.522	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
SPINT4	391253	hgsc.bcm.edu	37	20	44351107	44351107	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr20:44351107G>A	ENST00000279058.3	+	1	118	c.101G>A	c.(100-102)tGt>tAt	p.C34Y		NM_178455.1	NP_848550.1	Q6UDR6	SPIT4_HUMAN	serine peptidase inhibitor, Kunitz type 4	34						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.C34Y(1)		lung(6)|ovary(1)|skin(1)	8		Myeloproliferative disorder(115;0.028)				GAGAAGATATGTGGAGACCTC	0.383																																																1	Substitution - Missense(1)	ovary(1)	20											133.0	125.0	128.0					20																	44351107		2203	4300	6503	43784521	SO:0001583	missense	391253			AY372174	CCDS33477.1	20q13.12	2012-08-20	2005-10-18	2005-10-25	ENSG00000149651	ENSG00000149651			16130	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 137"", ""serine peptidase inhibitor, Kunitz type 4"""	C20orf137		21988899	Standard	NM_178455		Approved	dJ601O1.1	uc002xpe.1	Q6UDR6	OTTHUMG00000130153	ENST00000279058.3:c.101G>A	20.37:g.44351107G>A	ENSP00000279058:p.Cys34Tyr	Somatic		WXS	SOLID	Phase_IV	43784521	Q9BQN3	Missense_Mutation	SNP	ENST00000279058.3	37	CCDS33477.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371145	0.42003	.	.	ENSG00000149651	ENST00000279058	T	0.58210	0.35	3.97	3.97	0.46021	Proteinase inhibitor I2, Kunitz metazoa (1);	0.000000	0.49305	D	0.000141	T	0.68559	0.3014	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.59595	-0.7425	9	0.72032	D	0.01	-23.8837	11.848	0.52395	0.0:0.0:1.0:0.0	.	34	Q6UDR6	SPIT4_HUMAN	Y	34	ENSP00000279058:C34Y	ENSP00000279058:C34Y	C	+	2	0	SPINT4	43784521	0.616000	0.27035	0.056000	0.19401	0.004000	0.04260	2.436000	0.44819	2.507000	0.84556	0.650000	0.86243	TGT		0.383	SPINT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252463.2	XM_372869	
TFRC	7037	hgsc.bcm.edu	37	3	195782162	195782162	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr3:195782162T>C	ENST00000360110.4	-	17	1857	c.1688A>G	c.(1687-1689)tAt>tGt	p.Y563C	TFRC_ENST00000392396.3_Missense_Mutation_p.Y563C|TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000465288.1_5'Flank|TFRC_ENST00000420415.1_Missense_Mutation_p.Y482C|TFRC_ENST00000535031.1_Missense_Mutation_p.Y281C	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	563					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)	p.Y563C(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	CAAATAAGGATAATCTGTGTC	0.502			T	BCL6	NHL																																		Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	1	Substitution - Missense(1)	ovary(1)	3											87.0	79.0	82.0					3																	195782162		2203	4300	6503	197266559	SO:0001583	missense	7037			X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.1688A>G	3.37:g.195782162T>C	ENSP00000353224:p.Tyr563Cys	Somatic		WXS	SOLID	Phase_IV	197266559	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Missense_Mutation	SNP	ENST00000360110.4	37	CCDS3312.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.594533	0.46214	.	.	ENSG00000072274	ENST00000360110;ENST00000420415;ENST00000392396;ENST00000535031	T;T;T;T	0.74002	1.0;1.0;1.0;-0.8	5.34	5.34	0.76211	Peptidase M28 (1);	0.000000	0.85682	D	0.000000	D	0.88952	0.6577	M	0.92691	3.335	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91178	0.4974	10	0.59425	D	0.04	-19.5216	14.4823	0.67592	0.0:0.0:0.0:1.0	.	563	P02786	TFR1_HUMAN	C	563;482;563;281	ENSP00000353224:Y563C;ENSP00000390133:Y482C;ENSP00000376197:Y563C;ENSP00000437753:Y281C	ENSP00000353224:Y563C	Y	-	2	0	TFRC	197266559	1.000000	0.71417	0.424000	0.26647	0.212000	0.24457	5.993000	0.70616	2.014000	0.59158	0.260000	0.18958	TAT		0.502	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341346.1		
PARP1	142	hgsc.bcm.edu	37	1	226564905	226564905	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr1:226564905C>T	ENST00000366794.5	-	13	1988	c.1845G>A	c.(1843-1845)atG>atA	p.M615I		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	615					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.M615I(1)		breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		CATATAATTTCATGAAGTGCT	0.473								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																								1	Substitution - Missense(1)	ovary(1)	1											212.0	224.0	220.0					1																	226564905		2203	4300	6503	224631528	SO:0001583	missense	142			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.1845G>A	1.37:g.226564905C>T	ENSP00000355759:p.Met615Ile	Somatic		WXS	SOLID	Phase_III	224631528	B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	ENST00000366794.5	37	CCDS1554.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.565679	0.27915	.	.	ENSG00000143799	ENST00000366794	T	0.15718	2.4	5.31	3.33	0.38152	WGR domain (4);	0.252983	0.47455	D	0.000238	T	0.09069	0.0224	N	0.24115	0.695	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.19353	-1.0308	10	0.21540	T	0.41	.	4.628	0.12488	0.1235:0.6149:0.1202:0.1414	.	615	P09874	PARP1_HUMAN	I	615	ENSP00000355759:M615I	ENSP00000355759:M615I	M	-	3	0	PARP1	224631528	0.970000	0.33590	1.000000	0.80357	0.992000	0.81027	0.128000	0.15810	1.380000	0.46344	0.650000	0.86243	ATG		0.473	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
GRIN3A	116443	hgsc.bcm.edu	37	9	104356948	104356948	+	Intron	SNP	C	C	A			TCGA-04-1530-01A-02W-0552-10	TCGA-04-1530-10A-01W-0552-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f5637a61-4fb7-4401-aecf-02f196d197f0	19f5c528-089f-4983-aee5-e995e51d2cf9	g.chr9:104356948C>A	ENST00000361820.3	-	7	3367				PPP3R2_ENST00000374806.1_Missense_Mutation_p.G89C	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A						calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.G89C(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TCCTCGTCGCCCTTGACGCTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	9											125.0	119.0	121.0					9																	104356948		2203	4300	6503	103396769	SO:0001627	intron_variant	5535				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2767-15306G>T	9.37:g.104356948C>A		Somatic		WXS	SOLID	Phase_III	103396769	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144706	0.37825	.	.	ENSG00000188386	ENST00000374806;ENST00000541976	T	0.34275	1.37	3.97	3.08	0.35506	EF-hand-like domain (1);	0.000000	0.41712	D	0.000829	T	0.50274	0.1606	M	0.89353	3.025	0.46954	D	0.999267	D	0.55605	0.972	P	0.48704	0.587	T	0.61272	-0.7096	10	0.87932	D	0	-17.6975	10.1727	0.42920	0.0:0.8999:0.0:0.1001	.	86	Q96LZ3	CANB2_HUMAN	C	89	ENSP00000363939:G89C	ENSP00000363939:G89C	G	-	1	0	PPP3R2	103396769	0.995000	0.38212	0.064000	0.19789	0.118000	0.20060	3.608000	0.54109	1.264000	0.44198	-0.244000	0.11960	GGC		0.537	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
