#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
MUC6	4588	genome.wustl.edu	37	11	1016919	1016919	+	Missense_Mutation	SNP	C	C	T	rs536595477	byFrequency	TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr11:1016919C>T	ENST00000421673.2	-	31	5932	c.5882G>A	c.(5881-5883)aGg>aAg	p.R1961K		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1961	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGTGGGTAGCCTGCTGCTGCT	0.587													C|||	4	0.000798722	0.0	0.0	5008	,	,		24077	0.004		0.0	False		,,,				2504	0.0															0			11											694.0	713.0	707.0					11																	1016919		2203	4295	6498	1006919	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5882G>A	11.37:g.1016919C>T	ENSP00000406861:p.Arg1961Lys	Somatic		Capture	Illumina GAIIx	4	1006919	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,HMMPfam_TIL,HMMSmart_SM00215,HMMSmart_SM00041	p.R1961K	ENST00000421673.2	37	c.5882	CCDS44513.1	11	.	.	.	.	.	.	.	.	.	.	C	0.232	-1.020016	0.02078	.	.	ENSG00000184956	ENST00000421673	T	0.17854	2.25	3.12	-4.2	0.03823	.	.	.	.	.	T	0.06917	0.0176	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41106	-0.9527	9	0.16896	T	0.51	.	5.8138	0.18481	0.0:0.5175:0.1322:0.3502	.	1961	Q6W4X9	MUC6_HUMAN	K	1961	ENSP00000406861:R1961K	ENSP00000406861:R1961K	R	-	2	0	MUC6	1006919	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.310000	0.00517	-1.090000	0.03069	-1.305000	0.01319	AGG	-	NULL		0.587	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	protein_coding	OTTHUMT00000382120.2	C	XM_290540		1006919	-1	no_errors	NM_005961	genbank	human	validated	54_36p	missense	SNP	0.002	T
MUC2	4583	genome.wustl.edu	37	11	1093430	1093430	+	Missense_Mutation	SNP	C	C	A	rs199573018	byFrequency	TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr11:1093430C>A	ENST00000441003.2	+	30	5276	c.5249C>A	c.(5248-5250)aCc>aAc	p.T1750N	MUC2_ENST00000333592.6_Missense_Mutation_p.T38N|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1717N	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1750N(2)|p.T1717N(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	atcaccaccaccaccacggtg	0.642													c|||	1883	0.375998	0.3865	0.3401	5008	,	,		24527	0.3621		0.3549	False		,,,				2504	0.4233															4	Substitution - Missense(4)	large_intestine(2)|prostate(2)	11											201.0	230.0	220.0					11																	1093430		2046	4004	6050	1083430	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5249C>A	11.37:g.1093430C>A	ENSP00000415183:p.Thr1750Asn	Somatic		Capture	Illumina GAIIx	4	1083430	Q14878	Missense_Mutation	SNP	HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,HMMSmart_SM00215,superfamily_PMP inhibitors	p.T1717N	ENST00000441003.2	37	c.5150		11	.	.	.	.	.	.	.	.	.	.	C	3.281	-0.147066	0.06627	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.11169	2.86;2.8;2.81	1.81	-3.61	0.04556	.	2587.460000	0.00766	U	0.001164	T	0.08313	0.0207	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.38607	-0.9653	9	0.49607	T	0.09	.	6.4546	0.21922	0.1652:0.6018:0.2329:0.0	.	1750	E7EUV1	.	N	1750;1717;38	ENSP00000415183:T1750N;ENSP00000351956:T1717N;ENSP00000331373:T38N	ENSP00000331373:T38N	T	+	2	0	MUC2	1083430	0.004000	0.15560	0.002000	0.10522	0.003000	0.03518	2.066000	0.41452	-0.510000	0.06523	0.195000	0.17529	ACC	-	NULL		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	protein_coding	OTTHUMT00000345894.2	C	NM_002457		1083430	+1	no_stop_codon	ENST00000359061	ensembl	human	known	54_36p	missense	SNP	0.088	A
SIRPB1	10326	genome.wustl.edu	37	20	1551655	1551655	+	Missense_Mutation	SNP	G	G	A	rs143614046		TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr20:1551655G>A	ENST00000381605.4	-	4	944	c.880C>T	c.(880-882)Cgg>Tgg	p.R294W	SIRPB1_ENST00000262929.5_Intron|RP4-576H24.4_ENST00000564763.1_Intron|SIRPB1_ENST00000381603.3_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	294	Ig-like C1-type 2.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						GTTTCTGTCCGGGACACATTT	0.562																																																0			20						G	,TRP/ARG	1,4405		0,1,2202	191.0	172.0	178.0		,880	1.2	0.0	20	dbSNP_134	178	0,8600		0,0,4300	no	intron,missense	SIRPB1	NM_001083910.2,NM_006065.3	,101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,probably-damaging	,294/399	1551655	1,13005	2203	4300	6503	1499655	SO:0001583	missense	10326			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.880C>T	20.37:g.1551655G>A	ENSP00000371018:p.Arg294Trp	Somatic		Capture	Illumina GAIIx	4	1499655	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_C1-set,HMMSmart_SM00407	p.R294W	ENST00000381605.4	37	c.880	CCDS13019.1	20	.	.	.	.	.	.	.	.	.	.	.	9.453	1.091080	0.20471	2.27E-4	0.0	ENSG00000101307	ENST00000381605	T	0.03035	4.07	2.39	1.25	0.21368	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.935929	0.08842	N	0.885763	T	0.07548	0.0190	M	0.90082	3.085	0.09310	N	1	P	0.37688	0.605	B	0.30943	0.122	T	0.28996	-1.0026	10	0.62326	D	0.03	.	6.2433	0.20803	0.0:0.3186:0.6814:0.0	.	294	O00241	SIRB1_HUMAN	W	294	ENSP00000371018:R294W	ENSP00000371018:R294W	R	-	1	2	SIRPB1	1499655	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-0.086000	0.11233	1.330000	0.45394	0.313000	0.20887	CGG	-	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_C1-set,HMMSmart_SM00407		0.562	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIRPB1	protein_coding	OTTHUMT00000077555.2	G	NM_006065		1499655	-1	no_errors	NM_006065	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
SERPINB6	5269	genome.wustl.edu	37	6	2959420	2959420	+	Silent	SNP	G	G	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr6:2959420G>A	ENST00000380520.1	-	1	2141	c.147C>T	c.(145-147)acC>acT	p.T49T	SERPINB6_ENST00000380529.1_Silent_p.T49T|SERPINB6_ENST00000335686.5_Silent_p.T49T|SERPINB6_ENST00000380524.1_Silent_p.T49T|SERPINB6_ENST00000380546.3_Silent_p.T49T|SERPINB6_ENST00000380539.1_Silent_p.T49T			P35237	SPB6_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 6	49					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|stomach(1)|upper_aerodigestive_tract(2)	17	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	TCTGTGCAGCGGTGTTTCCCT	0.517																																																0			6											110.0	96.0	100.0					6																	2959420		2203	4300	6503	2904419	SO:0001819	synonymous_variant	5269			Z22658	CCDS4479.1, CCDS75386.1, CCDS75387.1	6p25.2	2014-02-18	2005-08-18		ENSG00000124570	ENSG00000124570		"""Serine (or cysteine) peptidase inhibitors"""	8950	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase"""	173321	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6"", ""deafness, autosomal recessive 91"""	PI6, DFNB91		8415716, 9858835, 20451170, 24172014	Standard	NM_004568		Approved	PTI, CAP	uc031smo.1	P35237	OTTHUMG00000016170	ENST00000380520.1:c.147C>T	6.37:g.2959420G>A		Somatic		Capture	Illumina GAIIx	4	2904419	B2RBA8|Q59F97|Q5TD06|Q7Z2Y7|Q96J44|Q9UDI7	Silent	SNP	HMMPfam_Serpin,superfamily_Prot_inh_serpin,HMMSmart_SERPIN,PatternScan_SERPIN	p.T49	ENST00000380520.1	37	c.147	CCDS4479.1	6	.	.	.	.	.	.	.	.	.	.	G	8.222	0.802642	0.16397	.	.	ENSG00000124570	ENST00000380500	.	.	.	5.11	-6.22	0.02058	.	.	.	.	.	T	0.28665	0.0710	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42207	-0.9465	4	.	.	.	.	5.8759	0.18828	0.6075:0.0982:0.1951:0.0991	.	.	.	.	L	38	.	.	P	-	2	0	SERPINB6	2904419	0.000000	0.05858	0.025000	0.17156	0.888000	0.51559	-2.431000	0.01023	-1.518000	0.01778	-0.469000	0.05056	CCG	-	HMMPfam_Serpin,superfamily_Prot_inh_serpin,HMMSmart_SERPIN		0.517	SERPINB6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB6	protein_coding	OTTHUMT00000043422.1	G			2904419	-1	no_errors	NM_004568	genbank	human	validated	54_36p	silent	SNP	0.993	A
TP53	7157	genome.wustl.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000413465.2_Missense_Mutation_p.H193R|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000455263.2_Missense_Mutation_p.H193R|TP53_ENST00000445888.2_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	17	GRCh37	CM083194|CM951225	TP53	M							97.0	87.0	90.0					17																	7578271		2203	4300	6503	7518996	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	17.37:g.7578271T>C	ENSP00000269305:p.His193Arg	Somatic		Capture	Illumina GAIIx	4	7518996	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.H193R	ENST00000269305.4	37	c.578	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546		7518996	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ADCY2	108	genome.wustl.edu	37	5	7804770	7804770	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr5:7804770G>T	ENST00000338316.4	+	22	2937	c.2848G>T	c.(2848-2850)Ggt>Tgt	p.G950C	ADCY2_ENST00000537121.1_Missense_Mutation_p.G770C	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	950					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GGCAGCAACAGGTCTGAGCGC	0.527																																																0			5											81.0	74.0	76.0					5																	7804770		2203	4300	6503	7857770	SO:0001583	missense	108			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2848G>T	5.37:g.7804770G>T	ENSP00000342952:p.Gly950Cys	Somatic		Capture	Illumina GAIIx	4	7857770	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	HMMSmart_CYCc,superfamily_A/G_cyclase,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1,HMMPfam_DUF1053	p.G950C	ENST00000338316.4	37	c.2848	CCDS3872.2	5	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658956	0.88154	.	.	ENSG00000078295	ENST00000338316;ENST00000382532;ENST00000541993;ENST00000537121	T;T	0.46451	0.87;0.87	4.72	4.72	0.59763	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.80248	0.4588	H	0.99238	4.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89507	0.3768	10	0.87932	D	0	.	18.0341	0.89293	0.0:0.0:1.0:0.0	.	770;950	B7Z2C1;Q08462	.;ADCY2_HUMAN	C	950;103;783;770	ENSP00000342952:G950C;ENSP00000444803:G770C	ENSP00000342952:G950C	G	+	1	0	ADCY2	7857770	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	9.451000	0.97610	2.336000	0.79503	0.491000	0.48974	GGT	-	HMMSmart_CYCc,HMMPfam_Guanylate_cyc,superfamily_A/G_cyclase		0.527	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	protein_coding	OTTHUMT00000206930.2	G	NM_020546		7857770	+1	no_errors	NM_020546	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MFN2	9927	genome.wustl.edu	37	1	12064078	12064078	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr1:12064078G>A	ENST00000235329.5	+	12	1512	c.1190G>A	c.(1189-1191)cGg>cAg	p.R397Q	MFN2_ENST00000444836.1_Missense_Mutation_p.R397Q	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	397					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		CGTGAAGAGCGGCAAGACCGA	0.493																																																0			1											75.0	76.0	76.0					1																	12064078		2203	4300	6503	11986665	SO:0001583	missense	9927			AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.1190G>A	1.37:g.12064078G>A	ENSP00000235329:p.Arg397Gln	Somatic		Capture	Illumina GAIIx	4	11986665	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Dynamin_N,HMMPfam_Fzo_mitofusin	p.R397Q	ENST00000235329.5	37	c.1190	CCDS30587.1	1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304043	0.40795	.	.	ENSG00000116688	ENST00000444836;ENST00000235329;ENST00000376337	D;D	0.92099	-2.97;-2.97	5.66	5.66	0.87406	.	0.205050	0.43260	D	0.000585	T	0.81688	0.4875	N	0.04335	-0.225	0.41637	D	0.989054	B	0.09022	0.002	B	0.08055	0.003	T	0.76751	-0.2844	10	0.22706	T	0.39	-24.8032	13.7384	0.62833	0.0:0.0:0.8464:0.1536	.	397	O95140	MFN2_HUMAN	Q	397;397;95	ENSP00000416338:R397Q;ENSP00000235329:R397Q	ENSP00000235329:R397Q	R	+	2	0	MFN2	11986665	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	4.428000	0.59894	2.688000	0.91661	0.650000	0.86243	CGG	-	NULL		0.493	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN2	protein_coding	OTTHUMT00000006859.2	G	NM_014874		11986665	+1	no_errors	NM_014874	genbank	human	reviewed	54_36p	missense	SNP	0.969	A
KLF2	10365	genome.wustl.edu	37	19	16437789	16437789	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr19:16437789C>T	ENST00000248071.5	+	3	1122	c.1015C>T	c.(1015-1017)Cgt>Tgt	p.R339C	CTD-2562J15.6_ENST00000588799.1_RNA|KLF2_ENST00000592003.1_Silent_p.I66I	NM_016270.2	NP_057354.1	Q9Y5W3	KLF2_HUMAN	Kruppel-like factor 2	339					cell morphogenesis (GO:0000902)|cellular response to cycloheximide (GO:0071409)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|cellular response to tumor necrosis factor (GO:0071356)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(3)|lung(1)|skin(1)	5						TCTGTGCGATCGTGCCTTCTC	0.692																																																0			19											48.0	37.0	41.0					19																	16437789		2203	4300	6503	16298789	SO:0001583	missense	10365			AF123344	CCDS12343.1	19p13.11	2013-10-15	2013-10-15		ENSG00000127528	ENSG00000127528		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6347	protein-coding gene	gene with protein product		602016	"""Kruppel-like factor 2 (lung)"""			10217429, 10458913	Standard	NM_016270		Approved	LKLF	uc002ndw.3	Q9Y5W3	OTTHUMG00000182330	ENST00000248071.5:c.1015C>T	19.37:g.16437789C>T	ENSP00000248071:p.Arg339Cys	Somatic		Capture	Illumina GAIIx	4	16298789	Q6IPC4|Q9UJS5|Q9UKR6	Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.R339C	ENST00000248071.5	37	c.1015	CCDS12343.1	19	.	.	.	.	.	.	.	.	.	.	C	16.26	3.074267	0.55646	.	.	ENSG00000127528	ENST00000248071	T	0.21361	2.01	4.43	4.43	0.53597	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46619	0.1402	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.50939	-0.8768	9	0.87932	D	0	.	13.0961	0.59192	0.1608:0.8392:0.0:0.0	.	339	Q9Y5W3	KLF2_HUMAN	C	339	ENSP00000248071:R339C	ENSP00000248071:R339C	R	+	1	0	KLF2	16298789	1.000000	0.71417	0.999000	0.59377	0.014000	0.08584	1.548000	0.36201	2.189000	0.69895	0.467000	0.42956	CGT	-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.692	KLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF2	protein_coding	OTTHUMT00000460562.1	C			16298789	+1	no_errors	NM_016270	genbank	human	validated	54_36p	missense	SNP	1.000	T
U1	0	genome.wustl.edu	37	1	17198737	17198737	+	lincRNA	SNP	C	C	T	rs80108785		TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr1:17198737C>T	ENST00000362684.1	+	0	0																											CTCCGCGCTCCCGCCTCCTCC	0.647																																																0			1																																								17071324			440570																															1.37:g.17198737C>T		Somatic		Capture	Illumina GAIIx	4	17071324		RNA	SNP	-	NULL	ENST00000362684.1	37	NULL		1																																																																																			-	-		0.647	U1.1-201	KNOWN	basic	snRNA	LOC440570	lincRNA		C			17071324	+1	no_errors	XR_041951	genbank	human	model	54_36p	rna	SNP	0.005	T
ABCC8	6833	genome.wustl.edu	37	11	17432122	17432122	+	Missense_Mutation	SNP	C	C	G	rs531684936		TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr11:17432122C>G	ENST00000389817.3	-	22	2703	c.2635G>C	c.(2635-2637)Gac>Cac	p.D879H	ABCC8_ENST00000302539.4_Missense_Mutation_p.D880H			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	879	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GTCCTCTTGTCGTCCCGGAGC	0.582																																																0			11											149.0	130.0	137.0					11																	17432122		2200	4293	6493	17388698	SO:0001583	missense	6833			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.2635G>C	11.37:g.17432122C>G	ENSP00000374467:p.Asp879His	Somatic		Capture	Illumina GAIIx	4	17388698	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.D879H	ENST00000389817.3	37	c.2635	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	C	32	5.142763	0.94560	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.88975	-2.45;-2.45	6.17	6.17	0.99709	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.050131	0.85682	D	0.000000	D	0.87700	0.6243	N	0.04148	-0.265	0.80722	D	1	D	0.71674	0.998	D	0.66084	0.941	D	0.89228	0.3575	10	0.44086	T	0.13	.	19.0599	0.93085	0.0:1.0:0.0:0.0	.	879	Q09428	ABCC8_HUMAN	H	879;880;883	ENSP00000374467:D879H;ENSP00000303960:D880H	ENSP00000303960:D880H	D	-	1	0	ABCC8	17388698	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.506000	0.81665	2.941000	0.99782	0.655000	0.94253	GAC	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran		0.582	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	protein_coding	OTTHUMT00000389093.1	C	NM_000352		17388698	-1	no_errors	NM_000352	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	15	20482286	20482286	+	IGR	SNP	C	C	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr15:20482286C>A								RP11-173D3.1 (129080 upstream) : CHEK2P2 (5710 downstream)																							GCCCAGCTTGCAGTACACCTG	0.577																																																0			15																																								18742300	SO:0001628	intergenic_variant	646090																															15.37:g.20482286C>A		Somatic		Capture	Illumina GAIIx	4	18742300		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.577					LOC646090			C			18742300	-1	pseudogene	XR_017120	genbank	human	model	54_36p	rna	SNP	0.000	A
C16orf62	57020	genome.wustl.edu	37	16	19584459	19584459	+	Missense_Mutation	SNP	C	C	T	rs570834372		TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr16:19584459C>T	ENST00000251143.5	+	4	316	c.304C>T	c.(304-306)Cgt>Tgt	p.R102C	C16orf62_ENST00000438132.3_Missense_Mutation_p.R191C|C16orf62_ENST00000542263.1_Missense_Mutation_p.R191C|C16orf62_ENST00000538853.1_Missense_Mutation_p.R191C|C16orf62_ENST00000417362.2_Missense_Mutation_p.R102C			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	102						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						CAGAAGGAAACGTGATAGAGA	0.403													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16375	0.0		0.0	False		,,,				2504	0.0															0			16											130.0	128.0	129.0					16																	19584459		2197	4300	6497	19491960	SO:0001583	missense	57020				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.304C>T	16.37:g.19584459C>T	ENSP00000251143:p.Arg102Cys	Somatic		Capture	Illumina GAIIx	4	19491960	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	NULL	p.R102C	ENST00000251143.5	37	c.304		16	.	.	.	.	.	.	.	.	.	.	C	15.91	2.971589	0.53614	.	.	ENSG00000103544	ENST00000438132;ENST00000538853;ENST00000542263;ENST00000251143;ENST00000417362	T;T;T;T;T	0.49432	1.47;0.78;1.47;1.47;1.47	5.32	4.36	0.52297	.	0.294944	0.30419	N	0.009667	T	0.48502	0.1503	L	0.46157	1.445	0.80722	D	1	D;D;D	0.69078	0.997;0.987;0.995	P;B;P	0.50896	0.653;0.401;0.648	T	0.49082	-0.8976	10	0.56958	D	0.05	-6.1474	10.1933	0.43039	0.1539:0.6978:0.1483:0.0	.	191;102;191	F5H7K1;Q7Z3J2;E7EWW0	.;CP062_HUMAN;.	C	191;191;191;102;102	ENSP00000400815:R191C;ENSP00000444363:R191C;ENSP00000442468:R191C;ENSP00000251143:R102C;ENSP00000395973:R102C	ENSP00000251143:R102C	R	+	1	0	C16orf62	19491960	1.000000	0.71417	0.975000	0.42487	0.374000	0.29953	2.882000	0.48546	1.212000	0.43366	0.557000	0.71058	CGT	-	NULL		0.403	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	protein_coding		C	NM_020314		19491960	+1	no_errors	NM_020314	genbank	human	predicted	54_36p	missense	SNP	1.000	T
LZTR1	8216	genome.wustl.edu	37	22	21345967	21345967	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr22:21345967C>T	ENST00000215739.8	+	9	1201	c.842C>T	c.(841-843)cCg>cTg	p.P281L	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Missense_Mutation_p.P262L	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	281					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P281L(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CCACCACCCCCGCAGCGGCGC	0.632																																																1	Substitution - Missense(1)	lung(1)	22											30.0	28.0	28.0					22																	21345967		2202	4295	6497	19675967	SO:0001583	missense	8216			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.842C>T	22.37:g.21345967C>T	ENSP00000215739:p.Pro281Leu	Somatic		Capture	Illumina GAIIx	4	19675967	Q14776|Q20WK0	Missense_Mutation	SNP	superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612,HMMPfam_Kelch_2,superfamily_POZ domain,HMMSmart_SM00225,HMMPfam_BTB	p.P281L	ENST00000215739.8	37	c.842	CCDS33606.1	22	.	.	.	.	.	.	.	.	.	.	C	31	5.088414	0.94100	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.70986	-0.53;-0.53	5.18	5.18	0.71444	Kelch-type beta propeller (1);	0.106961	0.64402	D	0.000004	D	0.84079	0.5393	M	0.77820	2.39	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;P	0.78314	0.975;0.991;0.967;0.894	D	0.86279	0.1666	10	0.87932	D	0	-20.5054	16.1666	0.81759	0.0:1.0:0.0:0.0	.	262;240;281;240	B7Z3T9;Q6ZSY0;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	L	240;281;262	ENSP00000215739:P281L;ENSP00000374006:P262L	ENSP00000215739:P281L	P	+	2	0	LZTR1	19675967	1.000000	0.71417	0.938000	0.37757	0.894000	0.52154	7.462000	0.80851	2.409000	0.81822	0.407000	0.27541	CCG	-	superfamily_Galactose oxidase central domain,HMMSmart_SM00612		0.632	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	protein_coding	OTTHUMT00000320387.1	C	NM_006767		19675967	+1	no_errors	NM_006767	genbank	human	reviewed	54_36p	missense	SNP	0.993	T
CYFIP1	23191	genome.wustl.edu	37	15	22958295	22958295	+	Nonsense_Mutation	SNP	G	G	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr15:22958295G>A	ENST00000313077.7	+	17	2063	c.1938G>A	c.(1936-1938)tgG>tgA	p.W646*	CYFIP1_ENST00000435939.2_Nonsense_Mutation_p.W215*|CYFIP1_ENST00000560848.1_Nonsense_Mutation_p.W646*	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		CGATGCCCTGGATCCTGACGG	0.597																																																0			15											129.0	100.0	110.0					15																	22958295		2203	4300	6503	20509736	SO:0001587	stop_gained	23191			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1938G>A	15.37:g.22958295G>A	ENSP00000324549:p.Trp646*	Somatic		Capture	Illumina GAIIx	4	20509736		Nonsense_Mutation	SNP	HMMPfam_FragX_IP	p.W646*	ENST00000313077.7	37	c.1938	CCDS10009.1	15	.	.	.	.	.	.	.	.	.	.	G	38	7.079715	0.98048	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	.	.	.	4.96	4.05	0.47172	.	0.000000	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.4297	13.5526	0.61740	0.0757:0.0:0.9243:0.0	.	.	.	.	X	646;674;215	.	ENSP00000324549:W646X	W	+	3	0	CYFIP1	20509736	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	9.643000	0.98464	1.219000	0.43474	0.555000	0.69702	TGG	-	HMMPfam_FragX_IP		0.597	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	protein_coding	OTTHUMT00000251136.2	G	NM_014608		20509736	+1	no_errors	NM_014608	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
CYFIP1	23191	genome.wustl.edu	37	15	22962259	22962259	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr15:22962259A>T	ENST00000313077.7	+	19	2212	c.2087A>T	c.(2086-2088)aAt>aTt	p.N696I	CYFIP1_ENST00000435939.2_Missense_Mutation_p.N265I|CYFIP1_ENST00000560848.1_Missense_Mutation_p.N696I	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		CTTCAGGTGAATCTATGTTTT	0.358																																																0			15											183.0	171.0	175.0					15																	22962259		2203	4300	6503	20513700	SO:0001583	missense	23191			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.2087A>T	15.37:g.22962259A>T	ENSP00000324549:p.Asn696Ile	Somatic		Capture	Illumina GAIIx	4	20513700		Missense_Mutation	SNP	HMMPfam_FragX_IP	p.N696I	ENST00000313077.7	37	c.2087	CCDS10009.1	15	.	.	.	.	.	.	.	.	.	.	A	25.4	4.631188	0.87660	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.26660	1.72;1.72	5.31	5.31	0.75309	.	0.000000	0.64402	D	0.000003	T	0.58235	0.2108	M	0.89287	3.02	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.67452	-0.5667	10	0.87932	D	0	-27.7404	15.5616	0.76253	1.0:0.0:0.0:0.0	.	724;265;696	E7EQ04;Q7L576-2;Q7L576	.;.;CYFP1_HUMAN	I	696;724;265	ENSP00000324549:N696I;ENSP00000405956:N265I	ENSP00000324549:N696I	N	+	2	0	CYFIP1	20513700	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.127000	0.94417	2.127000	0.65507	0.533000	0.62120	AAT	-	HMMPfam_FragX_IP		0.358	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	protein_coding	OTTHUMT00000251136.2	A	NM_014608		20513700	+1	no_errors	NM_014608	genbank	human	validated	54_36p	missense	SNP	1.000	T
MPP7	143098	genome.wustl.edu	37	10	28378746	28378746	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr10:28378746A>C	ENST00000375732.1	-	12	1236	c.977T>G	c.(976-978)cTt>cGt	p.L326R	MPP7_ENST00000445954.2_Missense_Mutation_p.L201R|MPP7_ENST00000337532.5_Missense_Mutation_p.L326R|MPP7_ENST00000540098.1_Missense_Mutation_p.L326R|MPP7_ENST00000375719.3_Missense_Mutation_p.L326R			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	326					establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						TTTTCTACTAAGACGAAAACT	0.323																																																0			10											134.0	114.0	121.0					10																	28378746		2203	4300	6503	28418752	SO:0001583	missense	143098			BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.977T>G	10.37:g.28378746A>C	ENSP00000364884:p.Leu326Arg	Somatic		Capture	Illumina GAIIx	4	28418752	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Missense_Mutation	SNP	HMMSmart_L27,HMMPfam_L27,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,superfamily_SH3,HMMSmart_SH3,HMMPfam_SH3_2,superfamily_SSF52540,HMMSmart_GuKc,PatternScan_GUANYLATE_KINASE_1,HMMPfam_Guanylate_kin	p.L326R	ENST00000375732.1	37	c.977	CCDS7158.1	10	.	.	.	.	.	.	.	.	.	.	A	22.4	4.289827	0.80914	.	.	ENSG00000150054	ENST00000375732;ENST00000337532;ENST00000540098;ENST00000375719;ENST00000441595;ENST00000445954	D;D;D;D;T;D	0.81659	-1.52;-1.52;-1.52;-1.52;1.42;-1.52	5.79	5.79	0.91817	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	D	0.87593	0.6216	M	0.77103	2.36	0.80722	D	1	D	0.58620	0.983	P	0.59703	0.862	D	0.85847	0.1401	10	0.24483	T	0.36	.	16.1193	0.81336	1.0:0.0:0.0:0.0	.	326	Q5T2T1	MPP7_HUMAN	R	326;326;326;326;87;201	ENSP00000364884:L326R;ENSP00000337907:L326R;ENSP00000438693:L326R;ENSP00000364871:L326R;ENSP00000398319:L87R;ENSP00000405397:L201R	ENSP00000337907:L326R	L	-	2	0	MPP7	28418752	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.954000	0.93051	2.201000	0.70794	0.533000	0.62120	CTT	-	superfamily_SH3		0.323	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP7	protein_coding	OTTHUMT00000047345.1	A	NM_173496		28418752	-1	no_errors	NM_173496	genbank	human	validated	54_36p	missense	SNP	1.000	C
ITGAL	3683	genome.wustl.edu	37	16	30507785	30507785	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr16:30507785G>A	ENST00000356798.6	+	15	1910	c.1730G>A	c.(1729-1731)gGa>gAa	p.G577E	ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000358164.5_Missense_Mutation_p.G494E|RP11-297C4.1_ENST00000563751.1_RNA	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	577					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GTGCTCTCAGGAATTCAGTGG	0.567																																					NSCLC(110;1462 1641 3311 33990 49495)											0			16											147.0	133.0	137.0					16																	30507785		2197	4300	6497	30415286	SO:0001583	missense	3683				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1730G>A	16.37:g.30507785G>A	ENSP00000349252:p.Gly577Glu	Somatic		Capture	Illumina GAIIx	4	30415286	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_Integrin domains,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.G577E	ENST00000356798.6	37	c.1730	CCDS32433.1	16	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007430	0.54361	.	.	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.63744	-0.06;-0.06	5.94	5.94	0.96194	.	0.000000	0.56097	D	0.000027	T	0.65312	0.2679	M	0.62723	1.935	0.80722	D	1	P;P	0.42078	0.717;0.77	P;P	0.44860	0.462;0.462	T	0.60372	-0.7276	10	0.22706	T	0.39	.	17.2761	0.87115	0.0:0.0:1.0:0.0	.	494;577	Q96HB1;P20701	.;ITAL_HUMAN	E	577;494	ENSP00000349252:G577E;ENSP00000350886:G494E	ENSP00000349252:G577E	G	+	2	0	ITGAL	30415286	0.997000	0.39634	0.999000	0.59377	0.911000	0.54048	1.590000	0.36654	2.816000	0.96949	0.563000	0.77884	GGA	-	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191		0.567	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	protein_coding	OTTHUMT00000434508.2	G			30415286	+1	no_errors	NM_002209	genbank	human	reviewed	54_36p	missense	SNP	0.997	A
SKIV2L	6499	genome.wustl.edu	37	6	31931495	31931495	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr6:31931495G>C	ENST00000375394.2	+	15	1745	c.1632G>C	c.(1630-1632)caG>caC	p.Q544H	SKIV2L_ENST00000544581.1_Missense_Mutation_p.Q351H	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	544					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CCACACATCAGGGGGGCCCTG	0.567																																																0			6											34.0	36.0	36.0					6																	31931495		1511	2709	4220	32039474	SO:0001583	missense	6499				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1632G>C	6.37:g.31931495G>C	ENSP00000364543:p.Gln544His	Somatic		Capture	Illumina GAIIx	4	32039474	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_DEAD,HMMSmart_HELICc,HMMPfam_Helicase_C,HMMPfam_DSHCT	p.Q544H	ENST00000375394.2	37	c.1632	CCDS4731.1	6	.	.	.	.	.	.	.	.	.	.	G	5.220	0.226119	0.09916	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.70986	-0.53;-0.53	4.76	1.73	0.24493	.	0.564900	0.20633	N	0.088551	T	0.31040	0.0784	N	0.16656	0.425	0.28887	N	0.894077	B	0.32425	0.371	B	0.33750	0.169	T	0.09228	-1.0684	10	0.42905	T	0.14	-4.2506	6.3271	0.21248	0.1596:0.3695:0.4709:0.0	.	544	Q15477	SKIV2_HUMAN	H	544;386;351	ENSP00000364543:Q544H;ENSP00000442645:Q351H	ENSP00000364543:Q544H	Q	+	3	2	SKIV2L	32039474	0.994000	0.37717	1.000000	0.80357	0.194000	0.23727	1.295000	0.33377	0.603000	0.29913	0.650000	0.86243	CAG	-	superfamily_SSF52540		0.567	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L	protein_coding	OTTHUMT00000076264.3	G			32039474	+1	no_errors	NM_006929	genbank	human	reviewed	54_36p	missense	SNP	0.997	C
CPNE1	8904	genome.wustl.edu	37	20	34219655	34219655	+	Silent	SNP	G	G	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr20:34219655G>A	ENST00000317619.3	-	9	976	c.582C>T	c.(580-582)gtC>gtT	p.V194V	CPNE1_ENST00000397443.1_Silent_p.V194V|CPNE1_ENST00000317677.5_Silent_p.V199V|CPNE1_ENST00000397445.1_Silent_p.V194V|CPNE1_ENST00000352393.4_Silent_p.V194V|CPNE1_ENST00000397446.1_Silent_p.V194V|CPNE1_ENST00000397442.1_Silent_p.V194V			Q99829	CPNE1_HUMAN	copine I	194	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid metabolic process (GO:0006629)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GCTGAACGGGGACTGAGAAAC	0.592																																																0			20											109.0	98.0	101.0					20																	34219655		2203	4300	6503	33683069	SO:0001819	synonymous_variant	8904			U83246	CCDS13260.1, CCDS46595.1	20q11.22	2009-06-01			ENSG00000214078	ENSG00000214078			2314	protein-coding gene	gene with protein product		604205				9430674	Standard	NM_152925		Approved	CPN1	uc002xdm.3	Q99829	OTTHUMG00000032356	ENST00000317619.3:c.582C>T	20.37:g.34219655G>A		Somatic		Capture	Illumina GAIIx	4	33683069	E1P5Q4|Q6IBL3|Q9H243|Q9NTZ7	Silent	SNP	HMMSmart_C2,HMMPfam_C2,superfamily_C2_CaLB,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_Copine	p.V194	ENST00000317619.3	37	c.582	CCDS13260.1	20																																																																																			-	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2		0.592	CPNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE1	protein_coding	OTTHUMT00000078909.3	G	NM_152930		33683069	-1	no_errors	NM_003915	genbank	human	reviewed	54_36p	silent	SNP	0.996	A
ZCCHC7	84186	genome.wustl.edu	37	9	37126555	37126555	+	Missense_Mutation	SNP	G	G	A	rs149802071	byFrequency	TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr9:37126555G>A	ENST00000336755.5	+	2	332	c.226G>A	c.(226-228)Gtc>Atc	p.V76I	ZCCHC7_ENST00000461038.1_3'UTR|ZCCHC7_ENST00000534928.1_Intron|ZCCHC7_ENST00000322831.6_Missense_Mutation_p.V75I	NM_032226.2	NP_115602.2	Q8N3Z6	ZCHC7_HUMAN	zinc finger, CCHC domain containing 7	76						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	30				GBM - Glioblastoma multiforme(29;0.0137)		GAAGCTAATCGTCCTTTCAGA	0.408													G|||	2	0.000399361	0.0	0.0	5008	,	,		23606	0.0		0.0	False		,,,				2504	0.002															0			9						G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	161.0	156.0	158.0		226	2.6	1.0	9	dbSNP_134	158	0,8600		0,0,4300	no	missense	ZCCHC7	NM_032226.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	76/544	37126555	1,13005	2203	4300	6503	37116555	SO:0001583	missense	84186			AK026264	CCDS6608.2	9p13.1	2008-05-02			ENSG00000147905	ENSG00000147905		"""Zinc fingers, CCHC domain containing"""	26209	protein-coding gene	gene with protein product							Standard	NM_032226		Approved	FLJ22611, AIR1	uc003zzq.3	Q8N3Z6	OTTHUMG00000019915	ENST00000336755.5:c.226G>A	9.37:g.37126555G>A	ENSP00000337839:p.Val76Ile	Somatic		Capture	Illumina GAIIx	4	37116555	B2RCI4|D3DRQ0|Q5T0Q8|Q5T0Q9|Q5T0R0|Q8N2M1|Q8N4J2|Q8TBK8|Q9H648|Q9P0F0	Missense_Mutation	SNP	superfamily_Retrovirus zinc finger-like domains,HMMPfam_zf-CCHC,HMMSmart_SM00343	p.V76I	ENST00000336755.5	37	c.226	CCDS6608.2	9	.	.	.	.	.	.	.	.	.	.	G	5.314	0.243271	0.10077	2.27E-4	0.0	ENSG00000147905	ENST00000336755;ENST00000322831	T;T	0.44881	1.49;0.91	5.64	2.61	0.31194	.	0.490152	0.21351	N	0.075969	T	0.26376	0.0644	L	0.29908	0.895	0.80722	D	1	B;B	0.21821	0.061;0.05	B;B	0.14578	0.011;0.011	T	0.04737	-1.0930	10	0.12430	T	0.62	.	10.1219	0.42625	0.2112:0.0:0.7888:0.0	.	76;76	Q8N3Z6-2;Q8N3Z6	.;ZCHC7_HUMAN	I	76;75	ENSP00000337839:V76I;ENSP00000316365:V75I	ENSP00000316365:V75I	V	+	1	0	ZCCHC7	37116555	0.976000	0.34144	1.000000	0.80357	0.175000	0.22909	0.506000	0.22658	0.731000	0.32448	0.637000	0.83480	GTC	-	NULL		0.408	ZCCHC7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC7	protein_coding	OTTHUMT00000052453.2	G	NM_032226		37116555	+1	no_errors	NM_032226	genbank	human	validated	54_36p	missense	SNP	0.998	A
RPGR	6103	genome.wustl.edu	37	X	38135964	38135964	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chrX:38135964G>A	ENST00000339363.3	-	15	2749	c.2582C>T	c.(2581-2583)gCt>gTt	p.A861V	RPGR_ENST00000338898.3_3'UTR|RPGR_ENST00000309513.3_Missense_Mutation_p.A594V|RPGR_ENST00000318842.7_Missense_Mutation_p.A656V|TM4SF2_ENST00000465127.1_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	861	Glu-rich.				cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						CACATTTTCAGCATTAATTTC	0.358																																																0			X											221.0	178.0	192.0					X																	38135964		2201	4300	6501	38020908	SO:0001583	missense	6103			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2582C>T	X.37:g.38135964G>A	ENSP00000343671:p.Ala861Val	Somatic		Capture	Illumina GAIIx	4	38020908	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	superfamily_RCC1/BLIP-II,PatternScan_RCC1_2,HMMPfam_RCC1	p.A656V	ENST00000339363.3	37	c.1967		X	.	.	.	.	.	.	.	.	.	.	G	5.168	0.216536	0.09810	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000318842	T;T;T	0.19105	2.31;3.64;2.17	3.34	-0.955	0.10356	.	.	.	.	.	T	0.05410	0.0143	N	0.01048	-1.04	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.36212	-0.9757	9	0.28530	T	0.3	.	3.3956	0.07304	0.3003:0.0:0.4676:0.2321	.	656	Q92834-2	.	V	861;594;656	ENSP00000343671:A861V;ENSP00000308783:A594V;ENSP00000322219:A656V	ENSP00000308783:A594V	A	-	2	0	RPGR	38020908	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.425000	0.02446	-0.260000	0.09418	-0.195000	0.12781	GCT	-	NULL		0.358	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	protein_coding		G	NM_000328		38020908	-1	no_errors	NM_000328	genbank	human	reviewed	54_36p	missense	SNP	0.037	A
UNC5CL	222643	genome.wustl.edu	37	6	40999454	40999454	+	Missense_Mutation	SNP	T	T	C	rs145811250	byFrequency	TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr6:40999454T>C	ENST00000373164.1	-	5	1145	c.1085A>G	c.(1084-1086)aAt>aGt	p.N362S	UNC5CL_ENST00000244565.3_Missense_Mutation_p.N362S|UNC5CL_ENST00000470102.1_Intron			Q8IV45	UN5CL_HUMAN	unc-5 homolog C (C. elegans)-like	362	Interaction with RELA and NFKB1.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|proteolysis (GO:0006508)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	peptidase activity (GO:0008233)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					AATGATCTCATTGGTTAGTGC	0.547													T|||	47	0.00938498	0.0	0.0029	5008	,	,		21145	0.004		0.004	False		,,,				2504	0.0378															0			6						T	SER/ASN	1,4405	2.1+/-5.4	0,1,2202	196.0	174.0	181.0		1085	3.3	1.0	6	dbSNP_134	181	19,8581	13.3+/-46.6	0,19,4281	yes	missense	UNC5CL	NM_173561.2	46	0,20,6483	CC,CT,TT		0.2209,0.0227,0.1538	benign	362/519	40999454	20,12986	2203	4300	6503	41107432	SO:0001583	missense	222643			BC035284	CCDS4847.1	6p21.1	2013-10-15			ENSG00000124602	ENSG00000124602			21203	protein-coding gene	gene with protein product	"""ZU5 and death domain containing"""					14769797	Standard	NM_173561		Approved	MGC34763, ZUD	uc003opi.3	Q8IV45	OTTHUMG00000014665	ENST00000373164.1:c.1085A>G	6.37:g.40999454T>C	ENSP00000362258:p.Asn362Ser	Somatic		Capture	Illumina GAIIx	4	41107432	Q5TGU1	Missense_Mutation	SNP	HMMPfam_ZU5,superfamily_DEATH_like,HMMSmart_DEATH,HMMPfam_Death	p.N362S	ENST00000373164.1	37	c.1085	CCDS4847.1	6	5	0.0022893772893772895	0	0.0	0	0.0	2	0.0034965034965034965	3	0.00395778364116095	T	4.971	0.180333	0.09443	2.27E-4	0.002209	ENSG00000124602	ENST00000244565;ENST00000373164	T;T	0.14022	2.54;2.54	4.52	3.34	0.38264	.	0.124350	0.36482	N	0.002565	T	0.02533	0.0077	N	0.24115	0.695	0.33255	D	0.558932	B	0.02656	0.0	B	0.04013	0.001	T	0.42666	-0.9438	10	0.21540	T	0.41	-8.9542	6.7625	0.23548	0.0:0.1071:0.0:0.8929	.	362	Q8IV45	UN5CL_HUMAN	S	362	ENSP00000244565:N362S;ENSP00000362258:N362S	ENSP00000244565:N362S	N	-	2	0	UNC5CL	41107432	1.000000	0.71417	0.996000	0.52242	0.944000	0.59088	0.406000	0.21032	0.770000	0.33336	0.383000	0.25322	AAT	-	NULL		0.547	UNC5CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5CL	protein_coding	OTTHUMT00000040491.1	T	NM_173561		41107432	-1	no_errors	NM_173561	genbank	human	provisional	54_36p	missense	SNP	0.996	C
HIVEP3	59269	genome.wustl.edu	37	1	42050016	42050016	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr1:42050016G>C	ENST00000372583.1	-	4	1338	c.453C>G	c.(451-453)atC>atG	p.I151M	HIVEP3_ENST00000372584.1_Missense_Mutation_p.I151M|HIVEP3_ENST00000247584.5_Missense_Mutation_p.I151M|HIVEP3_ENST00000429157.2_Missense_Mutation_p.I151M	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	151					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CGGGGGGAATGATGGAAGCGT	0.602																																																0			1											87.0	93.0	91.0					1																	42050016		2203	4300	6503	41822603	SO:0001583	missense	59269			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.453C>G	1.37:g.42050016G>C	ENSP00000361664:p.Ile151Met	Somatic		Capture	Illumina GAIIx	4	41822603	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	PatternScan_AIPM_HOMOCIT_SYNTH_1,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_C2H2 and C2HC zinc fingers	p.I151M	ENST00000372583.1	37	c.453	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	G	9.241	1.038223	0.19669	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.06068	3.36;3.35;3.35;3.36	5.08	3.21	0.36854	.	0.271361	0.26282	N	0.025270	T	0.11452	0.0279	N	0.22421	0.69	0.24399	N	0.994715	D;D	0.64830	0.994;0.989	D;P	0.66716	0.946;0.885	T	0.08617	-1.0713	10	0.42905	T	0.14	-16.6455	11.1075	0.48212	0.1516:0.0:0.8484:0.0	.	151;151	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	M	151	ENSP00000361665:I151M;ENSP00000361664:I151M;ENSP00000247584:I151M;ENSP00000410828:I151M	ENSP00000247584:I151M	I	-	3	3	HIVEP3	41822603	1.000000	0.71417	0.077000	0.20336	0.298000	0.27526	4.280000	0.58959	0.721000	0.32231	0.563000	0.77884	ATC	-	NULL		0.602	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	protein_coding	OTTHUMT00000016978.1	G	NM_024503		41822603	-1	no_errors	NM_024503	genbank	human	validated	54_36p	missense	SNP	0.699	C
RNU6-29P	0	genome.wustl.edu	37	X	48635351	48635351	+	RNA	SNP	C	C	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chrX:48635351C>T	ENST00000384637.1	-	0	107									RNA, U6 small nuclear 29, pseudogene																		CTTTGGGATTCCCACACGCAA	0.453																																																0			X																																								48520295			648603					Xp11.23	2013-05-01	2013-05-01	2013-05-01	ENSG00000207367	ENSG00000207367			34273	pseudogene	RNA, pseudogene			"""RNA, U6 small nuclear 29"""	RNU6-29			Standard			Approved						X.37:g.48635351C>T		Somatic		Capture	Illumina GAIIx	4	48520295		RNA	SNP	-	NULL	ENST00000384637.1	37	NULL		X																																																																																			-	-		0.453	RNU6-29P-201	KNOWN	basic	snRNA	LOC648603	snRNA		C			48520295	-1	pseudogene	XR_038238	genbank	human	model	54_36p	rna	SNP	0.999	T
PHF8	23133	genome.wustl.edu	37	X	54069219	54069219	+	Silent	SNP	G	G	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chrX:54069219G>A	ENST00000357988.5	-	2	409	c.51C>T	c.(49-51)ccC>ccT	p.P17P	PHF8_ENST00000338946.6_5'UTR|PHF8_ENST00000338154.6_5'UTR|PHF8_ENST00000322659.8_5'UTR|PHF8_ENST00000462182.1_5'Flank	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	17					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						CAAGAGGGGCGGGAGGCGGCA	0.642											OREG0019805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			X																																								54085944	SO:0001819	synonymous_variant	23133			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.51C>T	X.37:g.54069219G>A		Somatic	997	Capture	Illumina GAIIx	4	54085944	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Silent	SNP	superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_EGF_2,PatternScan_ZF_PHD_1,superfamily_Clavaminate synthase-like,HMMSmart_SM00558,HMMPfam_JmjC	p.P17	ENST00000357988.5	37	c.51	CCDS55420.1	X																																																																																			-	NULL		0.642	PHF8-001	KNOWN	basic|CCDS	protein_coding	PHF8	protein_coding	OTTHUMT00000056784.2	G	NM_015107		54085944	-1	no_errors	ENST00000357988	ensembl	human	known	54_36p	silent	SNP	0.000	A
DDX4	54514	genome.wustl.edu	37	5	55059883	55059883	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr5:55059883T>A	ENST00000505374.1	+	6	417	c.325T>A	c.(325-327)Ttc>Atc	p.F109I	SLC38A9_ENST00000504880.1_Intron|DDX4_ENST00000508580.1_3'UTR|DDX4_ENST00000514278.2_Missense_Mutation_p.F109I|DDX4_ENST00000353507.5_Missense_Mutation_p.F109I|DDX4_ENST00000354991.5_Missense_Mutation_p.F109I|DDX4_ENST00000511853.1_5'Flank	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	109	Gly-rich.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				TAGCTCTGGTTTCTGGAGAGG	0.328																																																0			5											161.0	163.0	162.0					5																	55059883		2203	4300	6503	55095640	SO:0001583	missense	54514			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.325T>A	5.37:g.55059883T>A	ENSP00000424838:p.Phe109Ile	Somatic		Capture	Illumina GAIIx	4	55095640	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD,PatternScan_DEAD_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C	p.F109I	ENST00000505374.1	37	c.325	CCDS3969.1	5	.	.	.	.	.	.	.	.	.	.	T	16.26	3.072931	0.55646	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000515709;ENST00000514679;ENST00000354991;ENST00000511491	T;T;T;T;T;T;T;T	0.58358	1.99;1.94;2.04;3.46;0.37;0.35;1.99;0.34	4.82	3.67	0.42095	.	0.128282	0.35466	N	0.003196	T	0.59074	0.2167	L	0.47716	1.5	0.38813	D	0.955451	P;D;D	0.64830	0.913;0.985;0.994	P;P;D	0.74348	0.549;0.805;0.983	T	0.57063	-0.7875	10	0.28530	T	0.3	-22.2408	6.8744	0.24139	0.0:0.1035:0.0:0.8965	.	109;109;109	D6RDK4;Q9NQI0-2;Q9NQI0	.;.;DDX4_HUMAN	I	109;109;109;109;83;109;109;109	ENSP00000334167:F109I;ENSP00000425359:F109I;ENSP00000424838:F109I;ENSP00000427167:F109I;ENSP00000424779:F83I;ENSP00000424112:F109I;ENSP00000347087:F109I;ENSP00000427522:F109I	ENSP00000334167:F109I	F	+	1	0	DDX4	55095640	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.914000	0.39966	0.871000	0.35750	0.482000	0.46254	TTC	-	NULL		0.328	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX4	protein_coding	OTTHUMT00000214147.2	T	NM_024415		55095640	+1	no_errors	NM_024415	genbank	human	validated	54_36p	missense	SNP	0.998	A
Unknown	0	genome.wustl.edu	37	11	56457767	56457767	+	IGR	SNP	C	C	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr11:56457767C>T								OR5AR1 (25604 upstream) : OR9G1 (10096 downstream)																							CAACCCTGGGCGCTGCCAACC	0.632																																																0			11																																								56214343	SO:0001628	intergenic_variant	642975																															11.37:g.56457767C>T		Somatic		Capture	Illumina GAIIx	4	56214343		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.632					LOC642975			C			56214343	+1	pseudogene	XR_016156	genbank	human	model	54_36p	rna	SNP	0.000	T
RTN1	6252	genome.wustl.edu	37	14	60074109	60074109	+	Missense_Mutation	SNP	C	C	T	rs577799438		TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr14:60074109C>T	ENST00000267484.5	-	4	2202	c.1867G>A	c.(1867-1869)Gtc>Atc	p.V623I	RTN1_ENST00000342503.4_Missense_Mutation_p.V55I|RTN1_ENST00000395090.1_Missense_Mutation_p.V40I|RTN1_ENST00000557422.1_5'UTR	NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	623	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TAGGCCACGACGCTCACCACG	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		18474	0.0		0.0	False		,,,				2504	0.001															0			14											74.0	66.0	69.0					14																	60074109		2203	4300	6503	59143862	SO:0001583	missense	6252			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1867G>A	14.37:g.60074109C>T	ENSP00000267484:p.Val623Ile	Somatic		Capture	Illumina GAIIx	4	59143862	Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	HMMPfam_Reticulon,PatternScan_HISTONE_H4	p.V623I	ENST00000267484.5	37	c.1867	CCDS9740.1	14	.	.	.	.	.	.	.	.	.	.	C	32	5.178861	0.94846	.	.	ENSG00000139970	ENST00000432103;ENST00000267484;ENST00000395090;ENST00000342503;ENST00000433623	T;T;T	0.48836	0.8;0.8;0.8	5.99	5.11	0.69529	.	0.052228	0.85682	N	0.000000	T	0.73489	0.3593	M	0.88979	2.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.79841	-0.1633	10	0.87932	D	0	.	15.0202	0.71624	0.0:0.9324:0.0:0.0675	.	40;623;55	A8MT72;Q16799;Q16799-3	.;RTN1_HUMAN;.	I	203;623;40;55;549	ENSP00000267484:V623I;ENSP00000378525:V40I;ENSP00000340716:V55I	ENSP00000267484:V623I	V	-	1	0	RTN1	59143862	1.000000	0.71417	0.974000	0.42286	0.954000	0.61252	6.070000	0.71220	1.544000	0.49359	0.655000	0.94253	GTC	-	HMMPfam_Reticulon		0.562	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	protein_coding	OTTHUMT00000072278.2	C			59143862	-1	no_errors	NM_021136	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
DOCK7	85440	genome.wustl.edu	37	1	62923222	62923222	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr1:62923222C>A	ENST00000340370.5	-	48	6291	c.6274G>T	c.(6274-6276)Gtc>Ttc	p.V2092F	DOCK7_ENST00000251157.5_Missense_Mutation_p.V2112F	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	2123	DHR-2.				activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						TGGCAGGTGACAGGCAATACT	0.408																																																0			1											131.0	125.0	127.0					1																	62923222		2203	4300	6503	62695810	SO:0001583	missense	85440				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.6274G>T	1.37:g.62923222C>A	ENSP00000340742:p.Val2092Phe	Somatic		Capture	Illumina GAIIx	4	62695810	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	HMMPfam_Ded_cyto	p.V2092F	ENST00000340370.5	37	c.6274	CCDS30734.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.88|10.88	1.475119|1.475119	0.26511|0.26511	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000454575|ENST00000371140;ENST00000251157;ENST00000340370	.|T;T	.|0.14766	.|2.48;2.48	5.89|5.89	1.52|1.52	0.23074|0.23074	.|.	.|1.875910	.|0.02287	.|N	.|0.069929	T|T	0.10895|0.10895	0.0266|0.0266	N|N	0.19112|0.19112	0.55|0.55	0.47214|0.47214	D|D	0.999354|0.999354	.|B;B;B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0;0.0;0.0	.|B;B;B;B;B;B	.|0.06405	.|0.002;0.001;0.001;0.001;0.002;0.002	T|T	0.15235|0.15235	-1.0444|-1.0444	5|10	.|0.21540	.|T	.|0.41	.|.	9.6558|9.6558	0.39925|0.39925	0.0:0.6899:0.0:0.3101|0.0:0.6899:0.0:0.3101	.|.	.|2123;2112;2092;2081;2083;2114	.|Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.|DOCK7_HUMAN;.;.;.;.;.	F|F	1285|2123;2112;2092	.|ENSP00000251157:V2112F;ENSP00000340742:V2092F	.|ENSP00000251157:V2112F	C|V	-|-	2|1	0|0	DOCK7|DOCK7	62695810|62695810	0.830000|0.830000	0.29337|0.29337	0.995000|0.995000	0.50966|0.50966	0.993000|0.993000	0.82548|0.82548	1.298000|1.298000	0.33412|0.33412	0.266000|0.266000	0.21894|0.21894	0.655000|0.655000	0.94253|0.94253	TGT|GTC	-	NULL		0.408	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	protein_coding	OTTHUMT00000036806.1	C	NM_033407		62695810	-1	no_errors	NM_033407	genbank	human	validated	54_36p	missense	SNP	1.000	A
PRDX5	25824	genome.wustl.edu	37	11	64085793	64085793	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr11:64085793G>A	ENST00000265462.4	+	1	234	c.106G>A	c.(106-108)Gga>Aga	p.G36R	TRMT112_ENST00000544844.1_5'Flank|PRDX5_ENST00000347941.4_Missense_Mutation_p.G36R|TRMT112_ENST00000535750.1_5'Flank|PRDX5_ENST00000352435.4_Missense_Mutation_p.G36R|TRMT112_ENST00000535126.1_5'Flank|TRMT112_ENST00000308774.2_5'Flank|TRMT112_ENST00000539854.1_5'Flank	NM_012094.4	NP_036226	P30044	PRDX5_HUMAN	peroxiredoxin 5	36					cellular response to reactive oxygen species (GO:0034614)|hydrogen peroxide catabolic process (GO:0042744)|inflammatory response (GO:0006954)|NADPH oxidation (GO:0070995)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|positive regulation of collagen biosynthetic process (GO:0032967)|reactive nitrogen species metabolic process (GO:2001057)|regulation of apoptosis involved in tissue homeostasis (GO:0060785)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	antioxidant activity (GO:0016209)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|peroxidase activity (GO:0004601)|peroxiredoxin activity (GO:0051920)|peroxynitrite reductase activity (GO:0072541)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase III regulatory region DNA binding (GO:0001016)			breast(1)|kidney(1)|lung(1)|skin(1)	4					Auranofin(DB00995)	GTACAGTGAAGGAGAGTGGGC	0.677																																																0			11											33.0	32.0	32.0					11																	64085793		2198	4295	6493	63842369	SO:0001583	missense	25824			AF197952	CCDS8069.1, CCDS8070.1, CCDS8071.1	11q13	2008-07-21			ENSG00000126432	ENSG00000126432			9355	protein-coding gene	gene with protein product	"""antioxidant enzyme B166"", ""thioredoxin peroxidase PMP20"", ""peroxisomal antioxidant enzyme"", ""TPx type VI"", ""liver tissue 2D-page spot 71B"", ""Alu co-repressor 1"""	606583				10514471, 10521424	Standard	NM_012094		Approved	ACR1, AOEB166, MGC142285, PRXV, PMP20, B166, PRDX6, PLP, SBBI10, MGC117264, MGC142283	uc001nzu.3	P30044	OTTHUMG00000168805	ENST00000265462.4:c.106G>A	11.37:g.64085793G>A	ENSP00000265462:p.Gly36Arg	Somatic		Capture	Illumina GAIIx	4	63842369	A6NC19|A6NG06|B7ZLJ4|B7ZVW3|Q14CK0|Q6IAF2|Q9UBU5|Q9UJU4|Q9UKX4	Missense_Mutation	SNP	superfamily_Thioredoxin-like,HMMPfam_Redoxin	p.G36R	ENST00000265462.4	37	c.106	CCDS8069.1	11	.	.	.	.	.	.	.	.	.	.	G	18.89	3.719633	0.68844	.	.	ENSG00000126432	ENST00000265462;ENST00000352435;ENST00000347941	T;T;T	0.58652	0.81;0.73;0.32	3.18	-3.05	0.05396	.	1.056860	0.07622	U	0.927192	T	0.34279	0.0892	N	0.19112	0.55	0.09310	N	1	B;B;P	0.48911	0.002;0.0;0.917	B;B;B	0.40329	0.005;0.001;0.326	T	0.25398	-1.0133	10	0.21540	T	0.41	-1.7108	5.2964	0.15754	0.2729:0.2542:0.4728:0.0	.	36;36;36	A6NC19;A6NG06;P30044	.;.;PRDX5_HUMAN	R	36	ENSP00000265462:G36R;ENSP00000335334:G36R;ENSP00000335363:G36R	ENSP00000265462:G36R	G	+	1	0	PRDX5	63842369	0.000000	0.05858	0.000000	0.03702	0.552000	0.35366	-0.749000	0.04813	-0.616000	0.05671	0.306000	0.20318	GGA	-	NULL		0.677	PRDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX5	protein_coding	OTTHUMT00000401148.1	G	NM_181651		63842369	+1	no_errors	NM_012094	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
VTI1B	10490	genome.wustl.edu	37	14	68126593	68126593	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr14:68126593C>T	ENST00000554659.1	-	3	562	c.221G>A	c.(220-222)cGa>cAa	p.R74Q	RP11-1012A1.4_ENST00000553306.1_3'UTR|RP11-1012A1.4_ENST00000554493.1_5'UTR|5S_rRNA_ENST00000607639.1_RNA	NM_006370.2	NP_006361.1	Q9UEU0	VTI1B_HUMAN	vesicle transport through interaction with t-SNAREs 1B	74					cell proliferation (GO:0008283)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			endometrium(1)|large_intestine(2)|stomach(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.000344)|OV - Ovarian serous cystadenocarcinoma(108;0.00212)|BRCA - Breast invasive adenocarcinoma(234;0.00941)		CATGGGGTTTCGGAAAGACAG	0.532																																																0			14											76.0	66.0	69.0					14																	68126593		2203	4300	6503	67196346	SO:0001583	missense	10490			AF060902	CCDS9786.1	14q23.3	2012-12-10	2012-12-10		ENSG00000100568	ENSG00000100568			17793	protein-coding gene	gene with protein product		603207	"""vesicle transport through interaction with t-SNAREs homolog 1B (yeast)"""			9636656, 9446565	Standard	NM_006370		Approved	VTI2	uc001xjt.3	Q9UEU0	OTTHUMG00000171251	ENST00000554659.1:c.221G>A	14.37:g.68126593C>T	ENSP00000450731:p.Arg74Gln	Somatic		Capture	Illumina GAIIx	4	67196346	O43547|Q96J28	Missense_Mutation	SNP	HMMPfam_V-SNARE,HMMSmart_SM00397	p.R74Q	ENST00000554659.1	37	c.221	CCDS9786.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.656313|5.656313	0.96724|0.96724	.|.	.|.	ENSG00000258466|ENSG00000100568	ENST00000557564|ENST00000554659	.|.	.|.	.|.	5.12|5.12	5.12|5.12	0.69794|0.69794	.|t-SNARE (1);Vesicle transport v-SNARE, N-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.66963|0.66963	0.2843|0.2843	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	.|D;D	.|0.64830	.|0.994;0.994	.|P;P	.|0.55785	.|0.784;0.784	T|T	0.69506|0.69506	-0.5127|-0.5127	5|9	.|0.72032	.|D	.|0.01	.|.	13.4244|13.4244	0.61018|0.61018	0.0:0.9246:0.0:0.0754|0.0:0.9246:0.0:0.0754	.|.	.|74;74	.|A8K6M4;Q9UEU0	.|.;VTI1B_HUMAN	K|Q	88|74	.|.	.|ENSP00000216456:R74Q	E|R	-|-	1|2	0|0	RP11-1012A1.4|VTI1B	67196346|67196346	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	4.374000|4.374000	0.59543|0.59543	2.826000|2.826000	0.97356|0.97356	0.563000|0.563000	0.77884|0.77884	GAA|CGA	-	HMMPfam_V-SNARE		0.532	VTI1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VTI1B	protein_coding	OTTHUMT00000412558.2	C			67196346	-1	no_errors	NM_006370	genbank	human	validated	54_36p	missense	SNP	1.000	T
SLC4A4	8671	genome.wustl.edu	37	4	72423492	72423492	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr4:72423492C>T	ENST00000264485.5	+	22	2944	c.2827C>T	c.(2827-2829)Cgt>Tgt	p.R943C	SLC4A4_ENST00000425175.1_Missense_Mutation_p.R943C|SLC4A4_ENST00000351898.6_Missense_Mutation_p.R859C|SLC4A4_ENST00000340595.3_Missense_Mutation_p.R899C	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	943					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	CATCTACCTGCGTCATGTTCC	0.512																																																0			4											155.0	125.0	135.0					4																	72423492		2203	4300	6503	72642356	SO:0001583	missense	8671			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2827C>T	4.37:g.72423492C>T	ENSP00000264485:p.Arg943Cys	Somatic		Capture	Illumina GAIIx	4	72642356	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	superfamily_Phoshotransferase/anion transport protein,HMMPfam_Band_3_cyto,HMMPfam_HCO3_cotransp	p.R943C	ENST00000264485.5	37	c.2827	CCDS43236.1	4	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867295	0.91511	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000340595	D;D;T;D	0.81739	-1.53;-1.53;-1.09;-1.53	5.95	5.95	0.96441	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93429	0.7904	H	0.95187	3.635	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.983;1.0;1.0	D	0.94427	0.7646	10	0.87932	D	0	.	20.3789	0.98926	0.0:1.0:0.0:0.0	.	943;859;899;943	A5JJ20;Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1	.;.;.;S4A4_HUMAN	C	943;943;859;899	ENSP00000264485:R943C;ENSP00000393557:R943C;ENSP00000307349:R859C;ENSP00000344272:R899C	ENSP00000264485:R943C	R	+	1	0	SLC4A4	72642356	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.862000	0.56009	2.826000	0.97356	0.563000	0.77884	CGT	-	HMMPfam_HCO3_cotransp		0.512	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	protein_coding	OTTHUMT00000362090.1	C	NM_003759		72642356	+1	no_errors	NM_001098484	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MSH3	4437	genome.wustl.edu	37	5	80088623	80088623	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr5:80088623G>T	ENST00000265081.6	+	19	2695	c.2615G>T	c.(2614-2616)gGa>gTa	p.G872V		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	872					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		GTGTTGCTGGGAGAACAGGAT	0.323								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)											0			5											98.0	100.0	99.0					5																	80088623		2203	4298	6501	80124379	SO:0001583	missense	4437			U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.2615G>T	5.37:g.80088623G>T	ENSP00000265081:p.Gly872Val	Somatic		Capture	Illumina GAIIx	4	80124379	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	superfamily_DNA repair protein MutS domain I,HMMPfam_MutS_I,superfamily_DNA repair protein MutS domain II,HMMPfam_MutS_II,HMMPfam_MutS_III,superfamily_DNA repair protein MutS domain III,HMMSmart_SM00533,HMMPfam_MutS_V,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00534,PatternScan_DNA_MISMATCH_REPAIR_2	p.G872V	ENST00000265081.6	37	c.2615	CCDS34195.1	5	.	.	.	.	.	.	.	.	.	.	G	18.81	3.703674	0.68501	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	D	0.88201	-2.35	5.41	4.53	0.55603	DNA mismatch repair protein MutS, C-terminal (1);	0.281902	0.40469	N	0.001085	D	0.89931	0.6858	L	0.39633	1.23	0.58432	D	0.999995	D	0.76494	0.999	D	0.73708	0.981	D	0.87909	0.2696	9	.	.	.	-15.5712	8.8854	0.35400	0.166:0.0:0.834:0.0	.	872	P20585	MSH3_HUMAN	V	872;863	ENSP00000265081:G872V	.	G	+	2	0	MSH3	80124379	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.649000	0.67936	2.520000	0.84964	0.650000	0.86243	GGA	-	HMMPfam_MutS_V,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.323	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	protein_coding	OTTHUMT00000369471.1	G	NM_002439		80124379	+1	no_errors	NM_002439	genbank	human	validated	54_36p	missense	SNP	1.000	T
SH3BGRL	6451	genome.wustl.edu	37	X	80532588	80532588	+	Nonsense_Mutation	SNP	G	G	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chrX:80532588G>T	ENST00000373212.5	+	2	409	c.151G>T	c.(151-153)Gaa>Taa	p.E51*	SH3BGRL_ENST00000481106.1_3'UTR	NM_003022.2	NP_003013.1	O75368	SH3L1_HUMAN	SH3 domain binding glutamate-rich protein like	51					positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|ovary(1)	4		all_lung(315;5.94e-05)				GTGGATGAGAGAAAATGTACC	0.403																																																0			X											71.0	65.0	67.0					X																	80532588		2203	4300	6503	80419244	SO:0001587	stop_gained	6451			AF042081	CCDS14449.1	Xq13.3	2014-02-19	2014-02-19		ENSG00000131171	ENSG00000131171			10823	protein-coding gene	gene with protein product		300190	"""SH3 domain binding glutamic acid-rich protein like"""			9642120	Standard	NM_003022		Approved	MGC117402	uc004eef.3	O75368	OTTHUMG00000021910	ENST00000373212.5:c.151G>T	X.37:g.80532588G>T	ENSP00000362308:p.Glu51*	Somatic		Capture	Illumina GAIIx	4	80419244	Q3SYL1|Q5JT50|Q6FIE8|Q9H0N8	Nonsense_Mutation	SNP	HMMPfam_SH3BGR,superfamily_Thioredoxin-like	p.E51*	ENST00000373212.5	37	c.151	CCDS14449.1	X	.	.	.	.	.	.	.	.	.	.	G	39	7.391922	0.98255	.	.	ENSG00000131171	ENST00000373212	.	.	.	5.7	5.7	0.88788	.	0.047873	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-7.1088	17.6307	0.88106	0.0:0.0:1.0:0.0	.	.	.	.	X	51	.	ENSP00000362308:E51X	E	+	1	0	SH3BGRL	80419244	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.081000	0.94049	2.380000	0.81148	0.600000	0.82982	GAA	-	HMMPfam_SH3BGR,superfamily_Thioredoxin-like		0.403	SH3BGRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BGRL	protein_coding	OTTHUMT00000057350.1	G	NM_003022		80419244	+1	no_errors	NM_003022	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
GLMN	11146	genome.wustl.edu	37	1	92755768	92755768	+	Silent	SNP	C	C	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr1:92755768C>T	ENST00000370360.3	-	5	462	c.381G>A	c.(379-381)caG>caA	p.Q127Q	GLMN_ENST00000534881.1_Silent_p.Q127Q	NM_053274.2	NP_444504.1	Q92990	GLMN_HUMAN	glomulin, FKBP associated protein	127					muscle cell differentiation (GO:0042692)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of T cell proliferation (GO:0042130)|neural tube closure (GO:0001843)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of phosphorylation (GO:0042327)|regulation of gene expression, epigenetic (GO:0040029)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|vasculogenesis (GO:0001570)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul3-RING ubiquitin ligase complex (GO:0031463)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cullin-RING ubiquitin ligase complex (GO:0031461)|intracellular (GO:0005622)	hepatocyte growth factor receptor binding (GO:0005171)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase inhibitor activity (GO:0055105)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)	17		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		TTTGTAATGGCTGAAGCAAAA	0.353									Multiple Glomus Tumors (of the Skin), Familial																																							0			1											100.0	105.0	103.0					1																	92755768		2203	4299	6502	92528356	SO:0001819	synonymous_variant	11146	Familial Cancer Database	Multiple Familial Glomangiomas, Hereditary Multiple Glomus Tumors, Familial Multiple Glomangiomatosis, Inherited Cutaneous Venous Anomalies, incl. Familial Multiple Glomangiomyoma	U73704	CCDS738.1	1p22.1	2008-02-05	2004-07-01		ENSG00000174842	ENSG00000174842			14373	protein-coding gene	gene with protein product		601749	"""venous malformation with glomus cells"""	VMGLOM		8955134	Standard	XM_005270400		Approved	FAP48, GLML, GVM, FKBPAP	uc001dor.3	Q92990	OTTHUMG00000010283	ENST00000370360.3:c.381G>A	1.37:g.92755768C>T		Somatic		Capture	Illumina GAIIx	4	92528356	Q5VVC3|Q9BVE8	Silent	SNP	HMMPfam_FKBP12	p.Q127	ENST00000370360.3	37	c.381	CCDS738.1	1																																																																																			-	HMMPfam_FKBP12		0.353	GLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLMN	protein_coding	OTTHUMT00000028358.1	C	NM_007070		92528356	-1	no_errors	NM_053274	genbank	human	reviewed	54_36p	silent	SNP	0.996	T
UBE3B	89910	genome.wustl.edu	37	12	109940840	109940840	+	Missense_Mutation	SNP	G	G	A	rs141849006		TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr12:109940840G>A	ENST00000342494.3	+	14	1890	c.1295G>A	c.(1294-1296)cGt>cAt	p.R432H	UBE3B_ENST00000280774.5_Missense_Mutation_p.R432H|UBE3B_ENST00000535900.1_3'UTR|UBE3B_ENST00000434735.2_Missense_Mutation_p.R432H	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	432					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						CTCCTAAAGCGTGCTTTTCAA	0.507																																																0			12						G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	131.0	128.0	129.0		1295,1295	5.8	1.0	12	dbSNP_134	129	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	UBE3B	NM_130466.2,NM_183415.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	432/1069,432/1069	109940840	1,13005	2203	4300	6503	108425223	SO:0001583	missense	89910			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.1295G>A	12.37:g.109940840G>A	ENSP00000340596:p.Arg432His	Somatic		Capture	Illumina GAIIx	4	108425223	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	HMMSmart_SM00015,HMMPfam_IQ,superfamily_Hect E3 ligase catalytic domain,HMMSmart_SM00119,HMMPfam_HECT	p.R432H	ENST00000342494.3	37	c.1295	CCDS9129.1	12	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040134	0.93630	0.0	1.16E-4	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000539599;ENST00000342494	T;T;T;T	0.50548	1.07;0.74;1.33;1.07	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.68007	0.2954	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.65443	0.935	T	0.67707	-0.5601	10	0.52906	T	0.07	-24.2758	18.6619	0.91474	0.0:0.0:1.0:0.0	.	432	Q7Z3V4	UBE3B_HUMAN	H	432	ENSP00000391529:R432H;ENSP00000280774:R432H;ENSP00000443131:R432H;ENSP00000340596:R432H	ENSP00000280774:R432H	R	+	2	0	UBE3B	108425223	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	8.952000	0.93031	2.741000	0.93983	0.655000	0.94253	CGT	-	NULL		0.507	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	protein_coding	OTTHUMT00000403119.1	G	NM_183415		108425223	+1	no_errors	NM_130466	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
AMD1	262	genome.wustl.edu	37	6	111196329	111196329	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr6:111196329C>A	ENST00000368885.3	+	1	357	c.21C>A	c.(19-21)ttC>ttA	p.F7L	AMD1_ENST00000368876.1_5'Flank|AMD1_ENST00000451850.2_Missense_Mutation_p.F7L|AMD1_ENST00000368882.3_5'UTR|AMD1_ENST00000368877.5_Missense_Mutation_p.F7L	NM_001634.4	NP_001625.2	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1	7					cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|S-adenosylmethioninamine biosynthetic process (GO:0006557)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)	adenosylmethionine decarboxylase activity (GO:0004014)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	CACATTTTTTCGAAGGGACCG	0.562																																																0			6											56.0	50.0	52.0					6																	111196329		2202	4300	6502	111303022	SO:0001583	missense	262			M88006	CCDS5086.1, CCDS75504.1, CCDS75505.1	6q21	2014-05-13			ENSG00000123505	ENSG00000123505	4.1.1.50		457	protein-coding gene	gene with protein product		180980	"""S-adenosylmethionine decarboxylase 1"""				Standard	NM_001634		Approved	SAMDC	uc003puk.1	P17707	OTTHUMG00000015369	ENST00000368885.3:c.21C>A	6.37:g.111196329C>A	ENSP00000357880:p.Phe7Leu	Somatic		Capture	Illumina GAIIx	4	111303022	E1P5F7|Q5VXN4|Q5VXN6|Q9BWK4	Missense_Mutation	SNP	HMMPfam_SAM_decarbox,superfamily_S-AdenosylMet_decarbase_core,PatternScan_ADOMETDC	p.F7L	ENST00000368885.3	37	c.21	CCDS5086.1	6	.	.	.	.	.	.	.	.	.	.	C	17.39	3.376490	0.61735	.	.	ENSG00000123505	ENST00000368885;ENST00000451850;ENST00000368877	.	.	.	5.08	3.31	0.37934	S-adenosylmethionine decarboxylase, core (2);	0.048649	0.85682	D	0.000000	T	0.81034	0.4739	H	0.95402	3.665	0.80722	D	1	P;D;D	0.89917	0.778;1.0;1.0	B;D;D	0.87578	0.295;0.992;0.998	T	0.83223	-0.0067	9	0.87932	D	0	.	8.7584	0.34658	0.0:0.7698:0.0:0.2302	.	7;7;7	B4DZ60;A6NNH3;P17707	.;.;DCAM_HUMAN	L	7	.	ENSP00000357871:F7L	F	+	3	2	AMD1	111303022	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.534000	0.53568	0.559000	0.29153	0.555000	0.69702	TTC	-	HMMPfam_SAM_decarbox,superfamily_S-AdenosylMet_decarbase_core		0.562	AMD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AMD1	protein_coding	OTTHUMT00000041816.1	C			111303022	+1	no_errors	NM_001634	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TMCC1	23023	genome.wustl.edu	37	3	129389482	129389482	+	Missense_Mutation	SNP	G	G	T	rs376957018		TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr3:129389482G>T	ENST00000393238.3	-	4	1542	c.1202C>A	c.(1201-1203)gCg>gAg	p.A401E	TMCC1_ENST00000329333.5_Missense_Mutation_p.A222E|TMCC1_ENST00000432054.2_Missense_Mutation_p.A77E|TMCC1_ENST00000426664.2_Missense_Mutation_p.A287E	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	401						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						AGCCTTCCCCGCATCATCCAC	0.483																																																0			3											89.0	86.0	87.0					3																	129389482		2203	4300	6503	130872172	SO:0001583	missense	23023			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1202C>A	3.37:g.129389482G>T	ENSP00000376930:p.Ala401Glu	Somatic		Capture	Illumina GAIIx	4	130872172	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	HMMPfam_Tmemb_cc2	p.A401E	ENST00000393238.3	37	c.1202	CCDS33855.1	3	.	.	.	.	.	.	.	.	.	.	G	11.48	1.650245	0.29336	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.21	-1.62	0.08372	.	0.393117	0.30437	N	0.009635	T	0.44726	0.1307	L	0.46157	1.445	0.09310	N	0.999992	B;B	0.31256	0.316;0.009	P;B	0.45310	0.476;0.023	T	0.46843	-0.9162	10	0.06236	T	0.91	-22.9697	21.6548	0.99958	0.0:0.3261:0.6739:0.0	.	222;401	B4DE04;O94876	.;TMCC1_HUMAN	E	77;401;287;222	ENSP00000404711:A77E;ENSP00000376930:A401E;ENSP00000389892:A287E;ENSP00000327349:A222E	ENSP00000327349:A222E	A	-	2	0	TMCC1	130872172	0.001000	0.12720	0.014000	0.15608	0.685000	0.39939	-0.234000	0.09028	-0.591000	0.05859	-0.340000	0.08031	GCG	-	HMMPfam_Tmemb_cc2		0.483	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCC1	protein_coding	OTTHUMT00000356418.2	G	NM_015008		130872172	-1	no_errors	NM_001017395	genbank	human	validated	54_36p	missense	SNP	0.120	T
AKR1B1	231	genome.wustl.edu	37	7	134136399	134136399	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr7:134136399G>A	ENST00000285930.4	-	2	252	c.173C>T	c.(172-174)gCc>gTc	p.A58V	AKR1B1_ENST00000489022.1_5'UTR	NM_001628.2	NP_001619.1	P15121	ALDR_HUMAN	aldo-keto reductase family 1, member B1 (aldose reductase)	58					C21-steroid hormone biosynthetic process (GO:0006700)|carbohydrate metabolic process (GO:0005975)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)|glyceraldehyde oxidoreductase activity (GO:0043795)			kidney(1)|large_intestine(5)|lung(2)|ovary(3)|prostate(1)|skin(2)	14					Sulindac(DB00605)	CTCCTGAATGGCCACCCCCAC	0.612																																																0			7											107.0	84.0	92.0					7																	134136399		2203	4300	6503	133786939	SO:0001583	missense	231			J04795	CCDS5831.1	7q35	2010-04-08			ENSG00000085662	ENSG00000085662	1.1.1.21	"""Aldo-keto reductases"""	381	protein-coding gene	gene with protein product		103880		ALDR1		1901827	Standard	NM_001628		Approved	AR	uc003vrp.1	P15121	OTTHUMG00000155322	ENST00000285930.4:c.173C>T	7.37:g.134136399G>A	ENSP00000285930:p.Ala58Val	Somatic		Capture	Illumina GAIIx	4	133786939	B2R8N3|Q5U031|Q6FGA4|Q6ICP2|Q9BS21|Q9UCI9	Missense_Mutation	SNP	superfamily_NAD(P)-linked oxidoreductase,HMMPfam_Aldo_ket_red,PatternScan_ALDOKETO_REDUCTASE_1,PatternScan_ALDOKETO_REDUCTASE_2,PatternScan_ALDOKETO_REDUCTASE_3	p.A58V	ENST00000285930.4	37	c.173	CCDS5831.1	7	.	.	.	.	.	.	.	.	.	.	G	18.81	3.702087	0.68501	.	.	ENSG00000085662	ENST00000285930	T	0.28666	1.6	5.23	5.23	0.72850	NADP-dependent oxidoreductase domain (3);	0.049589	0.85682	D	0.000000	T	0.34542	0.0901	M	0.62209	1.925	0.44908	D	0.997925	P	0.40000	0.698	B	0.39217	0.294	T	0.25293	-1.0136	10	0.72032	D	0.01	.	14.567	0.68185	0.0:0.1572:0.8428:0.0	.	58	P15121	ALDR_HUMAN	V	58	ENSP00000285930:A58V	ENSP00000285930:A58V	A	-	2	0	AKR1B1	133786939	0.619000	0.27059	0.991000	0.47740	0.828000	0.46876	1.003000	0.29809	2.608000	0.88229	0.561000	0.74099	GCC	-	superfamily_NAD(P)-linked oxidoreductase,HMMPfam_Aldo_ket_red		0.612	AKR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1B1	protein_coding	OTTHUMT00000339448.2	G	NM_001628		133786939	-1	no_errors	NM_001628	genbank	human	reviewed	54_36p	missense	SNP	0.992	A
CTNNA1	1495	genome.wustl.edu	37	5	138145786	138145786	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr5:138145786C>T	ENST00000302763.7	+	4	451	c.361C>T	c.(361-363)Cga>Tga	p.R121*	CTNNA1_ENST00000518825.1_Nonsense_Mutation_p.R121*|CTNNA1_ENST00000355078.5_Nonsense_Mutation_p.R18*	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	121	Interaction with JUP and CTNNB1.|Involved in homodimerization.				adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTCTGTGAAGCGAGGCAACAT	0.468																																																0			5											115.0	111.0	112.0					5																	138145786		2203	4300	6503	138173685	SO:0001587	stop_gained	1495			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.361C>T	5.37:g.138145786C>T	ENSP00000304669:p.Arg121*	Somatic		Capture	Illumina GAIIx	4	138173685	Q12795|Q8N1C0	Nonsense_Mutation	SNP	HMMPfam_Vinculin,superfamily_alpha-catenin/vinculin,PatternScan_VINCULIN_1	p.R121*	ENST00000302763.7	37	c.361	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	C	18.83	3.706917	0.68615	.	.	ENSG00000044115	ENST00000522227;ENST00000523912;ENST00000355078;ENST00000302763;ENST00000518910;ENST00000537034;ENST00000541863;ENST00000518245;ENST00000519113;ENST00000520158;ENST00000518825	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.5035	19.6064	0.95583	0.0:1.0:0.0:0.0	.	.	.	.	X	121;121;18;121;18;121;121;91;121;121;121	.	.	R	+	1	2	CTNNA1	138173685	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.218000	0.51192	2.795000	0.96236	0.655000	0.94253	CGA	-	HMMPfam_Vinculin,superfamily_alpha-catenin/vinculin		0.468	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	protein_coding	OTTHUMT00000373868.1	C	NM_001903		138173685	+1	no_errors	NM_001903	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
PCDHB16	57717	genome.wustl.edu	37	5	140563853	140563853	+	Silent	SNP	T	T	C	rs111302655		TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr5:140563853T>C	ENST00000361016.2	+	1	2874	c.1719T>C	c.(1717-1719)acT>acC	p.T573T		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T573T(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACTGAGCTGGTGC	0.697																																																1	Substitution - coding silent(1)	large_intestine(1)	5											16.0	20.0	19.0					5																	140563853		1987	3954	5941	140544037	SO:0001819	synonymous_variant	57717			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1719T>C	5.37:g.140563853T>C		Somatic		Capture	Illumina GAIIx	4	140544037	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,PatternScan_CADHERIN_1,HMMSmart_CA,HMMPfam_Cadherin	p.T573	ENST00000361016.2	37	c.1719	CCDS4251.1	5																																																																																			-	superfamily_Cadherin		0.697	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB16	protein_coding	OTTHUMT00000251800.1	T	NM_020957		140544037	+1	no_errors	NM_020957	genbank	human	reviewed	54_36p	silent	SNP	0.007	C
PCOLCE2	26577	genome.wustl.edu	37	3	142567221	142567221	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr3:142567221C>A	ENST00000295992.3	-	3	592	c.286G>T	c.(286-288)Ggc>Tgc	p.G96C	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.G96C	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	96	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)			NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						TTGGCATGGCCATTGTACACA	0.517																																																0			3											89.0	85.0	86.0					3																	142567221		2203	4300	6503	144049911	SO:0001583	missense	26577			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.286G>T	3.37:g.142567221C>A	ENSP00000295992:p.Gly96Cys	Somatic		Capture	Illumina GAIIx	4	144049911	B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,PatternScan_ABC_TRANSPORTER_1,superfamily_TIMP-like,HMMSmart_SM00643,HMMPfam_NTR	p.G96C	ENST00000295992.3	37	c.286	CCDS3127.1	3	.	.	.	.	.	.	.	.	.	.	C	24.5	4.543229	0.86022	.	.	ENSG00000163710	ENST00000295992;ENST00000485766	T;T	0.27402	1.67;1.67	5.1	5.1	0.69264	CUB (5);	0.048578	0.85682	D	0.000000	T	0.73094	0.3543	H	0.98507	4.25	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84569	0.0654	10	0.87932	D	0	-14.1669	18.7404	0.91772	0.0:1.0:0.0:0.0	.	96	Q9UKZ9	PCOC2_HUMAN	C	96	ENSP00000295992:G96C;ENSP00000419842:G96C	ENSP00000295992:G96C	G	-	1	0	PCOLCE2	144049911	1.000000	0.71417	0.985000	0.45067	0.986000	0.74619	7.320000	0.79064	2.666000	0.90696	0.644000	0.83932	GGC	-	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042		0.517	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCOLCE2	protein_coding	OTTHUMT00000354509.1	C	NM_013363		144049911	-1	no_errors	NM_013363	genbank	human	provisional	54_36p	missense	SNP	1.000	A
SMC4	10051	genome.wustl.edu	37	3	160141294	160141294	+	Missense_Mutation	SNP	G	G	T	rs539359537		TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr3:160141294G>T	ENST00000357388.3	+	14	2552	c.2101G>T	c.(2101-2103)Gat>Tat	p.D701Y	SMC4_ENST00000360111.2_Missense_Mutation_p.D701Y|SMC4_ENST00000344722.5_Missense_Mutation_p.D701Y|SMC4_ENST00000469762.1_Missense_Mutation_p.D676Y|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000462787.1_Missense_Mutation_p.D701Y	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	701	Flexible hinge.				kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AAAAGTAAAAGATGAGAAAAT	0.338																																																0			3											82.0	93.0	90.0					3																	160141294		2198	4299	6497	161623988	SO:0001583	missense	10051			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.2101G>T	3.37:g.160141294G>T	ENSP00000349961:p.Asp701Tyr	Somatic		Capture	Illumina GAIIx	4	161623988	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_SMC_N,superfamily_Prefoldin,superfamily_Smc hinge domain,HMMPfam_SMC_hinge	p.D701Y	ENST00000357388.3	37	c.2101	CCDS3189.1	3	.	.	.	.	.	.	.	.	.	.	G	23.1	4.375386	0.82682	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000462787;ENST00000344722;ENST00000545277	D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4	5.96	4.16	0.48862	SMCs flexible hinge (3);RecF/RecN/SMC (1);	0.042608	0.85682	D	0.000000	D	0.96097	0.8728	H	0.97465	4.01	0.80722	D	1	D;D;D;D	0.76494	0.995;0.99;0.993;0.999	D;D;P;D	0.71656	0.931;0.971;0.88;0.974	D	0.96234	0.9170	10	0.87932	D	0	-25.75	12.1431	0.54008	0.1398:0.0:0.8602:0.0	.	701;676;676;701	Q9NTJ3-2;B3KXX5;E9PD53;Q9NTJ3	.;.;.;SMC4_HUMAN	Y	701;701;676;701;701;295	ENSP00000349961:D701Y;ENSP00000353225:D701Y;ENSP00000417964:D676Y;ENSP00000420734:D701Y;ENSP00000341382:D701Y	ENSP00000341382:D701Y	D	+	1	0	SMC4	161623988	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	6.409000	0.73289	0.841000	0.35020	0.650000	0.86243	GAT	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_SMC_N,superfamily_Smc hinge domain,HMMPfam_SMC_hinge		0.338	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	protein_coding	OTTHUMT00000352862.1	G			161623988	+1	no_errors	NM_001002800	genbank	human	validated	54_36p	missense	SNP	1.000	T
THBS2	7058	genome.wustl.edu	37	6	169637845	169637845	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr6:169637845T>A	ENST00000366787.3	-	9	1424	c.1175A>T	c.(1174-1176)cAg>cTg	p.Q392L	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	392	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CACGGAGCACTGGGTCCACTC	0.657																																					Esophageal Squamous(91;219 1934 18562 44706)											0			6											86.0	67.0	73.0					6																	169637845		2203	4300	6503	169379770	SO:0001583	missense	7058				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.1175A>T	6.37:g.169637845T>A	ENSP00000355751:p.Gln392Leu	Somatic		Capture	Illumina GAIIx	4	169379770	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	PatternScan_EGF_1,HMMSmart_TSPN,superfamily_ConA_like_lec_gl,HMMPfam_VWC,HMMSmart_VWC,PatternScan_VWFC_1,superfamily_TSP1,HMMSmart_TSP1,HMMPfam_TSP_1,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF_CA,HMMPfam_EGF,PatternScan_EGF_2,superfamily_SSF103647,HMMPfam_TSP_3,HMMPfam_TSP_C	p.Q392L	ENST00000366787.3	37	c.1175	CCDS34574.1	6	.	.	.	.	.	.	.	.	.	.	t	12.87	2.068378	0.36470	.	.	ENSG00000186340	ENST00000366787	T	0.54675	0.56	4.75	3.54	0.40534	.	0.361892	0.19542	U	0.111766	T	0.22126	0.0533	L	0.28458	0.855	0.25993	N	0.982229	B	0.14805	0.011	B	0.23852	0.049	T	0.20472	-1.0274	10	0.44086	T	0.13	-28.8016	11.2686	0.49124	0.0:0.0:0.1535:0.8465	.	392	P35442	TSP2_HUMAN	L	392	ENSP00000355751:Q392L	ENSP00000355751:Q392L	Q	-	2	0	THBS2	169379770	0.998000	0.40836	0.201000	0.23476	0.287000	0.27160	5.790000	0.69038	0.628000	0.30357	0.451000	0.29950	CAG	-	superfamily_TSP1,HMMSmart_TSP1,HMMPfam_TSP_1		0.657	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS2	protein_coding	OTTHUMT00000105439.1	T	NM_003247		169379770	-1	no_errors	NM_003247	genbank	human	reviewed	54_36p	missense	SNP	0.924	A
GRM6	2916	genome.wustl.edu	37	5	178409966	178409966	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr5:178409966A>G	ENST00000517717.1	-	10	2419	c.2381T>C	c.(2380-2382)aTc>aCc	p.I794T	GRM6_ENST00000231188.5_Missense_Mutation_p.I794T|RP11-281O15.4_ENST00000519491.1_RNA			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	794					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		CAGCCAGATGATGCAGGTGGT	0.587																																																0			5											118.0	97.0	104.0					5																	178409966		2203	4300	6503	178342572	SO:0001583	missense	2916			U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.2381T>C	5.37:g.178409966A>G	ENSP00000430767:p.Ile794Thr	Somatic		Capture	Illumina GAIIx	4	178342572		Missense_Mutation	SNP	superfamily_SSF53822,HMMPfam_ANF_receptor,PatternScan_G_PROTEIN_RECEP_F3_1,HMMPfam_NCD3G,PatternScan_G_PROTEIN_RECEP_F3_2,HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_3	p.I794T	ENST00000517717.1	37	c.2381	CCDS4442.1	5	.	.	.	.	.	.	.	.	.	.	A	20.2	3.955908	0.73902	.	.	ENSG00000113262	ENST00000231188;ENST00000517717	D;D	0.89875	-2.58;-2.58	4.79	4.79	0.61399	GPCR, family 3, C-terminal (2);	.	.	.	.	D	0.94046	0.8092	M	0.83483	2.645	0.58432	D	0.999994	D;D	0.76494	0.999;0.987	D;P	0.72625	0.978;0.867	D	0.94629	0.7820	9	0.72032	D	0.01	.	12.5935	0.56454	1.0:0.0:0.0:0.0	.	794;88	O15303;Q5HYM4	GRM6_HUMAN;.	T	794	ENSP00000231188:I794T;ENSP00000430767:I794T	ENSP00000231188:I794T	I	-	2	0	GRM6	178342572	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	9.144000	0.94629	1.934000	0.56057	0.260000	0.18958	ATC	-	HMMPfam_7tm_3		0.587	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM6	protein_coding	OTTHUMT00000253474.2	A			178342572	-1	no_errors	NM_000843	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PNKD	25953	genome.wustl.edu	37	2	219209530	219209530	+	Splice_Site	SNP	G	G	A			TCGA-04-1644-01B-01D-1526-09	TCGA-04-1644-11A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	830f887f-acb6-47a8-a759-eae2b906894b	abb2536d-63bf-4556-951d-c102116dc80f	g.chr2:219209530G>A	ENST00000273077.4	+	10	1035		c.e10-1		PNKD_ENST00000258362.3_Splice_Site|PNKD_ENST00000436005.2_Splice_Site|AC021016.8_ENST00000411433.1_RNA	NM_015488.4	NP_056303.3	Q8N490	PNKD_HUMAN	paroxysmal nonkinesigenic dyskinesia						glutathione biosynthetic process (GO:0006750)|neuromuscular process controlling posture (GO:0050884)|regulation of dopamine metabolic process (GO:0042053)|regulation of synaptic transmission, dopaminergic (GO:0032225)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	10		Renal(207;0.0474)		Epithelial(149;7.33e-07)|all cancers(144;0.000133)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCACCCACAGTGCCCATCTA	0.637																																																0			2											138.0	154.0	148.0					2																	219209530		2203	4300	6503	218917774	SO:0001630	splice_region_variant	25953				CCDS2411.1, CCDS2413.1, CCDS42816.1	2q35	2011-01-21	2007-07-12		ENSG00000127838	ENSG00000127838			9153	protein-coding gene	gene with protein product	"""myofibrillogenesis regulator 1"""	609023	"""paroxysmal nonkinesiogenic dyskinesia"""			8659518	Standard	NM_015488		Approved	DYT8, PDC, DKFZp564N1362, FPD1, MR-1, BRP17, FKSG19, TAHCCP2, KIAA1184, KIPP1184, MGC31943, PKND1	uc002vhn.3	Q8N490	OTTHUMG00000133110	ENST00000273077.4:c.985-1G>A	2.37:g.219209530G>A		Somatic		Capture	Illumina GAIIx	4	218917774	A8K1F2|Q96A48|Q9BU26|Q9NSX4|Q9ULN6|Q9Y4T1	Splice_Site	SNP	-	e10-1	ENST00000273077.4	37	c.985-1	CCDS2411.1	2	.	.	.	.	.	.	.	.	.	.	G	21.2	4.115652	0.77323	.	.	ENSG00000127838	ENST00000273077;ENST00000258362;ENST00000436005	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.645	0.85174	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PNKD	218917774	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	9.699000	0.98703	2.196000	0.70406	0.462000	0.41574	.	-	-		0.637	PNKD-001	KNOWN	basic|CCDS	protein_coding	PNKD	protein_coding	OTTHUMT00000256775.2	G		Intron	218917774	+1	no_errors	NM_015488	genbank	human	validated	54_36p	splice_site	SNP	1.000	A
