#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CSMD1	64478	genome.wustl.edu	37	8	2832112	2832112	+	Silent	SNP	G	G	A	rs368720706		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr8:2832112G>A	ENST00000520002.1	-	57	9159	c.8604C>T	c.(8602-8604)aaC>aaT	p.N2868N	CSMD1_ENST00000537824.1_Silent_p.N2867N|CSMD1_ENST00000602723.1_Silent_p.N2810N|CSMD1_ENST00000542608.1_Silent_p.N2809N|CSMD1_ENST00000400186.3_Silent_p.N2810N|CSMD1_ENST00000602557.1_Silent_p.N2868N			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2868	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.N2596N(1)|p.N2867N(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGAGGACGGCGTTGGCAGGGA	0.507																																																2	Substitution - coding silent(2)	large_intestine(2)	8						G		0,3942		0,0,1971	37.0	40.0	39.0		8601	-7.7	0.3	8		39	1,8281		0,1,4140	no	coding-synonymous	CSMD1	NM_033225.5		0,1,6111	AA,AG,GG		0.0121,0.0,0.0082		2867/3565	2832112	1,12223	1971	4141	6112	2819519	SO:0001819	synonymous_variant	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8604C>T	8.37:g.2832112G>A		Somatic		Capture	Illumina GAIIx	4	2819519	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.R2869C	ENST00000520002.1	37	c.8605		8	.	.	.	.	.	.	.	.	.	.	G	0.864	-0.734195	0.03111	0.0	1.21E-4	ENSG00000183117	ENST00000335551	.	.	.	5.81	-7.67	0.01272	.	.	.	.	.	T	0.48502	0.1503	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54781	-0.8242	4	.	.	.	.	9.1371	0.36881	0.4365:0.0:0.4628:0.1006	.	.	.	.	C	2285	.	.	R	-	1	0	CSMD1	2819519	0.999000	0.42202	0.322000	0.25334	0.010000	0.07245	0.897000	0.28390	-1.197000	0.02673	-1.021000	0.02439	CGC	-	NULL		0.507	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	G	NM_033225		2819519	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_033225	genbank	human	validated	54_36p	missense	SNP	1.000	A
ANO2	57101	genome.wustl.edu	37	12	5687611	5687611	+	Silent	SNP	G	G	A	rs377226128		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr12:5687611G>A	ENST00000356134.5	-	23	2381	c.2310C>T	c.(2308-2310)aaC>aaT	p.N770N	ANO2_ENST00000546188.1_Silent_p.N770N|ANO2_ENST00000327087.8_Silent_p.N769N	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	774					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CTTCAATGACGTTGTTGAGGA	0.532													A|||	1	0.000199681	0.0008	0.0	5008	,	,		20942	0.0		0.0	False		,,,				2504	0.0															0			12						A		1,4061		0,1,2030	74.0	79.0	77.0		2307	-0.4	1.0	12		77	0,8364		0,0,4182	no	coding-synonymous	ANO2	NM_020373.2		0,1,6212	AA,AG,GG		0.0,0.0246,0.0080		769/999	5687611	1,12425	2031	4182	6213	5557872	SO:0001819	synonymous_variant	57101			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2310C>T	12.37:g.5687611G>A		Somatic		Capture	Illumina GAIIx	4	5557872	C4N787|Q9H847	Silent	SNP	HMMPfam_DUF590	p.N770	ENST00000356134.5	37	c.2310		12																																																																																			-	HMMPfam_DUF590		0.532	ANO2-001	KNOWN	basic	protein_coding	ANO2	protein_coding	OTTHUMT00000399019.4	G	NM_020373		5557872	-1	no_errors	NM_020373	genbank	human	validated	54_36p	silent	SNP	0.995	A
TP53	7157	genome.wustl.edu	37	17	7578404	7578404	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr17:7578404A>C	ENST00000269305.4	-	5	715	c.526T>G	c.(526-528)Tgc>Ggc	p.C176G	TP53_ENST00000445888.2_Missense_Mutation_p.C176G|TP53_ENST00000420246.2_Missense_Mutation_p.C176G|TP53_ENST00000413465.2_Missense_Mutation_p.C176G|TP53_ENST00000455263.2_Missense_Mutation_p.C176G|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.C176G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176S(10)|p.C176R(8)|p.0?(8)|p.C176fs*71(7)|p.C176G(6)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C176fs*5(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.C44G(1)|p.R42fs*24(1)|p.C176fs*72(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.C83G(1)|p.C176fs*6(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTGGGGGCAGCGCCTCACA	0.647		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	80	Substitution - Missense(26)|Deletion - Frameshift(25)|Deletion - In frame(13)|Whole gene deletion(8)|Insertion - Frameshift(5)|Complex - deletion inframe(3)	breast(18)|haematopoietic_and_lymphoid_tissue(13)|oesophagus(10)|upper_aerodigestive_tract(8)|large_intestine(8)|stomach(4)|lung(4)|liver(4)|bone(4)|central_nervous_system(3)|ovary(2)|biliary_tract(1)|prostate(1)	17											49.0	49.0	49.0					17																	7578404		2203	4300	6503	7519129	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.526T>G	17.37:g.7578404A>C	ENSP00000269305:p.Cys176Gly	Somatic		Capture	Illumina GAIIx	4	7519129	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.C176G	ENST00000269305.4	37	c.526	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	26.3	4.725152	0.89298	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.71674	0.998;0.971;0.983;0.996;0.995;0.977;0.994	D;D;D;D;D;D;D	0.87578	0.998;0.977;0.982;0.998;0.988;0.973;0.996	D	0.96412	0.9305	10	0.87932	D	0	-18.1821	14.037	0.64651	1.0:0.0:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176G;ENSP00000352610:C176G;ENSP00000269305:C176G;ENSP00000398846:C176G;ENSP00000391127:C176G;ENSP00000391478:C176G;ENSP00000425104:C44G;ENSP00000423862:C83G	ENSP00000269305:C176G	C	-	1	0	TP53	7519129	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	9.287000	0.95975	2.263000	0.75096	0.533000	0.62120	TGC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.647	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546		7519129	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
XAB2	56949	genome.wustl.edu	37	19	7688131	7688131	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr19:7688131G>C	ENST00000358368.4	-	9	1201	c.1164C>G	c.(1162-1164)ttC>ttG	p.F388L	XAB2_ENST00000534844.1_Missense_Mutation_p.F385L	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	388					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						CTGTGGCCTTGAAGGGGTCCA	0.582								Direct reversal of damage;Nucleotide excision repair (NER)																																								0			19											150.0	119.0	129.0					19																	7688131		2203	4300	6503	7594131	SO:0001583	missense	56949			AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.1164C>G	19.37:g.7688131G>C	ENSP00000351137:p.Phe388Leu	Somatic		Capture	Illumina GAIIx	4	7594131	Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	HMMSmart_HAT,superfamily_SSF48452	p.F388L	ENST00000358368.4	37	c.1164	CCDS32892.1	19	.	.	.	.	.	.	.	.	.	.	G	14.33	2.502376	0.44455	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.03441	3.93;3.93	4.57	4.57	0.56435	Tetratricopeptide-like helical (1);	0.256440	0.34338	N	0.004049	T	0.02156	0.0067	N	0.11201	0.11	0.34404	D	0.695569	B	0.06786	0.001	B	0.09377	0.004	T	0.36986	-0.9725	10	0.34782	T	0.22	-31.6173	6.2205	0.20679	0.0962:0.0:0.7173:0.1865	.	388	Q9HCS7	SYF1_HUMAN	L	388;385	ENSP00000351137:F388L;ENSP00000438225:F385L	ENSP00000351137:F388L	F	-	3	2	XAB2	7594131	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.831000	0.48144	2.263000	0.75096	0.643000	0.83706	TTC	-	superfamily_SSF48452		0.582	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XAB2	protein_coding	OTTHUMT00000461021.1	G	NM_020196		7594131	-1	no_errors	NM_020196	genbank	human	validated	54_36p	missense	SNP	1.000	C
MUC16	94025	genome.wustl.edu	37	19	9087849	9087849	+	Silent	SNP	G	G	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr19:9087849G>T	ENST00000397910.4	-	1	4169	c.3966C>A	c.(3964-3966)acC>acA	p.T1322T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1322	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGATGTAGGTGGTGGGGTCCC	0.493																																																0			19											137.0	136.0	137.0					19																	9087849		2122	4243	6365	8948849	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.3966C>A	19.37:g.9087849G>T		Somatic		Capture	Illumina GAIIx	4	8948849	Q6ZQW5|Q96RK2	Silent	SNP	PatternScan_ATPASE_ALPHA_BETA,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.T1322	ENST00000397910.4	37	c.3966	CCDS54212.1	19																																																																																			-	NULL		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690		8948849	-1	no_errors	NM_024690	genbank	human	validated	54_36p	silent	SNP	0.000	T
GRIN2A	2903	genome.wustl.edu	37	16	10206341	10206341	+	Intron	SNP	G	G	A	rs573365058	byFrequency	TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr16:10206341G>A	ENST00000396573.2	-	3	724				GRIN2A_ENST00000404927.2_Intron|GRIN2A_ENST00000330684.3_Intron|GRIN2A_ENST00000396575.2_Intron|GRIN2A_ENST00000562109.1_Intron	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A						directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CATCCAGACCGTGGGGCACGT	0.627													G|||	2	0.000399361	0.0	0.0	5008	,	,		22153	0.002		0.0	False		,,,				2504	0.0															0			16																																								10113842	SO:0001627	intron_variant	727833				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.414+67513C>T	16.37:g.10206341G>A		Somatic		Capture	Illumina GAIIx	4	10113842	O00669|Q17RZ6	RNA	SNP	-	NULL	ENST00000396573.2	37	NULL	CCDS10539.1	16																																																																																			-	-		0.627	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC727833	protein_coding	OTTHUMT00000251930.3	G			10113842	+1	pseudogene	XR_015181	genbank	human	model	54_36p	rna	SNP	1.000	A
MYH1	4619	genome.wustl.edu	37	17	10401190	10401190	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr17:10401190T>C	ENST00000226207.5	-	31	4320	c.4226A>G	c.(4225-4227)gAa>gGa	p.E1409G	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1409					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						ATTCACAGCTTCTACATGTTC	0.458																																																0			17											104.0	93.0	97.0					17																	10401190		2203	4300	6503	10341915	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.4226A>G	17.37:g.10401190T>C	ENSP00000226207:p.Glu1409Gly	Somatic		Capture	Illumina GAIIx	4	10341915	Q14CA4|Q9Y622	Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_IQ,HMMPfam_Myosin_tail_1	p.E1409G	ENST00000226207.5	37	c.4226	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	T	22.8	4.339731	0.81911	.	.	ENSG00000109061	ENST00000226207;ENST00000379814	D	0.82167	-1.58	5.65	5.65	0.86999	Myosin tail (1);	0.000000	0.44483	U	0.000453	D	0.92028	0.7474	M	0.88310	2.945	0.80722	D	1	D	0.63046	0.992	D	0.70487	0.969	D	0.92344	0.5884	10	0.44086	T	0.13	.	16.1566	0.81673	0.0:0.0:0.0:1.0	.	1409	P12882	MYH1_HUMAN	G	1409;498	ENSP00000226207:E1409G	ENSP00000226207:E1409G	E	-	2	0	MYH1	10341915	1.000000	0.71417	0.987000	0.45799	0.996000	0.88848	7.993000	0.88291	2.268000	0.75426	0.533000	0.62120	GAA	-	HMMPfam_Myosin_tail_1		0.458	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	T	NM_005963		10341915	-1	no_errors	NM_005963	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TLR7	51284	genome.wustl.edu	37	X	12905367	12905367	+	Silent	SNP	T	T	C			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chrX:12905367T>C	ENST00000380659.3	+	3	1879	c.1740T>C	c.(1738-1740)ttT>ttC	p.F580F		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	580					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	GCCATTATTTTCAATCAGAAG	0.393																																																0			X											111.0	119.0	117.0					X																	12905367		2203	4300	6503	12815288	SO:0001819	synonymous_variant	51284			AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.1740T>C	X.37:g.12905367T>C		Somatic		Capture	Illumina GAIIx	4	12815288	D1CS69|Q9NR98	Silent	SNP	superfamily_L domain-like,HMMSmart_SM00365,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRCT,superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR	p.F580	ENST00000380659.3	37	c.1740	CCDS14151.1	X																																																																																			-	superfamily_L domain-like		0.393	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR7	protein_coding	OTTHUMT00000055769.1	T	NM_016562		12815288	+1	no_errors	NM_016562	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
FREM1	158326	genome.wustl.edu	37	9	14770702	14770702	+	Missense_Mutation	SNP	G	G	A	rs373186602		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr9:14770702G>A	ENST00000380880.3	-	26	5743	c.4960C>T	c.(4960-4962)Cgc>Tgc	p.R1654C	FREM1_ENST00000380881.4_Missense_Mutation_p.R1655C|FREM1_ENST00000380894.1_Missense_Mutation_p.R190C|FREM1_ENST00000422223.2_Missense_Mutation_p.R1654C|FREM1_ENST00000486223.1_5'UTR			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1654					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.R67S(1)|p.R1655S(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TTCAACACGCGGGAAGTGATG	0.473																																																2	Substitution - Missense(2)	lung(2)	9						G	CYS/ARG,CYS/ARG	1,3921		0,1,1960	134.0	128.0	130.0		568,4960	5.8	1.0	9		130	0,8300		0,0,4150	no	missense,missense	FREM1	NM_001177704.1,NM_144966.5	180,180	0,1,6110	AA,AG,GG		0.0,0.0255,0.0082	possibly-damaging,possibly-damaging	190/716,1654/2180	14770702	1,12221	1961	4150	6111	14760702	SO:0001583	missense	158326			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.4960C>T	9.37:g.14770702G>A	ENSP00000370262:p.Arg1654Cys	Somatic		Capture	Illumina GAIIx	4	14760702	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	superfamily_Cadherin-like,PatternScan_SPASE_I_1,superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C	p.R1654C	ENST00000380880.3	37	c.4960	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346122	0.61073	2.55E-4	0.0	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380894;ENST00000380880;ENST00000380892	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.8	5.8	0.92144	.	0.290106	0.35936	N	0.002900	T	0.60881	0.2303	M	0.66939	2.045	0.48040	D	0.999579	D;D	0.71674	0.978;0.998	P;P	0.56514	0.726;0.8	T	0.62709	-0.6797	10	0.59425	D	0.04	-0.1397	13.9587	0.64166	0.0:0.0:0.7474:0.2526	.	1654;190	Q5H8C1;B7ZBX4	FREM1_HUMAN;.	C	1655;1654;190;1654;67	ENSP00000370263:R1655C;ENSP00000412940:R1654C;ENSP00000370278:R190C;ENSP00000370262:R1654C	ENSP00000370262:R1654C	R	-	1	0	FREM1	14760702	0.998000	0.40836	0.952000	0.39060	0.514000	0.34195	2.849000	0.48286	2.743000	0.94032	0.650000	0.86243	CGC	-	NULL		0.473	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	protein_coding	OTTHUMT00000339474.2	G	NM_144966		14760702	-1	no_errors	NM_144966	genbank	human	validated	54_36p	missense	SNP	0.744	A
Unknown	0	genome.wustl.edu	37	18	19812319	19812319	+	IGR	SNP	C	C	A	rs372062872		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr18:19812319C>A								RP11-627G18.4 (4327 upstream) : snoU13 (28219 downstream)																							atacatacatccatacataca	0.388																																																0			18																																								18066317	SO:0001628	intergenic_variant	0																															18.37:g.19812319C>A		Somatic		Capture	Illumina GAIIx	4	18066317		Missense_Mutation	SNP	NULL	p.P155T		37	c.463		18																																																																																			-	NULL	0	0.388					LOC100131966			C			18066317	+1	no_errors	XM_001714344	genbank	human	model	54_36p	missense	SNP	0.000	A
NHLRC1	378884	genome.wustl.edu	37	6	18121872	18121872	+	Silent	SNP	G	G	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr6:18121872G>T	ENST00000340650.3	-	1	979	c.966C>A	c.(964-966)gcC>gcA	p.A322A		NM_198586.2	NP_940988.2	Q6VVB1	NHLC1_HUMAN	NHL repeat containing E3 ubiquitin protein ligase 1	322					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|positive regulation of protein ubiquitination (GO:0031398)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(2)	11	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)			TCACAGCGGAGGCAGTTATTT	0.483																																																0			6											92.0	86.0	88.0					6																	18121872		2203	4300	6503	18229851	SO:0001819	synonymous_variant	378884			AY324849	CCDS4542.1	6p22.3	2014-01-28	2013-12-12		ENSG00000187566	ENSG00000187566			21576	protein-coding gene	gene with protein product	"""epilepsy, progressive myoclonus type 2B"""	608072	"""NHL repeat containing 1"""			12958597	Standard	NM_198586		Approved	bA204B7.2, EPM2B, malin	uc003ncl.1	Q6VVB1	OTTHUMG00000014315	ENST00000340650.3:c.966C>A	6.37:g.18121872G>T		Somatic		Capture	Illumina GAIIx	4	18229851	Q3SYB1|Q5VUK7|Q6IMH1	Silent	SNP	superfamily_SSF57850,HMMSmart_RING,PatternScan_ZF_RING_1,superfamily_SSF101898,HMMPfam_NHL	p.A322	ENST00000340650.3	37	c.966	CCDS4542.1	6																																																																																			-	superfamily_SSF101898		0.483	NHLRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC1	protein_coding	OTTHUMT00000039958.1	G			18229851	-1	no_errors	NM_198586	genbank	human	provisional	54_36p	silent	SNP	0.859	T
TUBA3C	7278	genome.wustl.edu	37	13	19752479	19752479	+	Silent	SNP	G	G	A	rs144672090		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr13:19752479G>A	ENST00000400113.3	-	3	386	c.282C>T	c.(280-282)acC>acT	p.T94T		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	94					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CTTCCTTCCCGGTGATCAGCT	0.512													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20810	0.0		0.0	False		,,,				2504	0.0															0			13						G		4,4402	8.1+/-20.4	0,4,2199	166.0	141.0	150.0		282	-0.6	1.0	13	dbSNP_134	150	0,8600		0,0,4300	no	coding-synonymous	TUBA3C	NM_006001.2		0,4,6499	AA,AG,GG		0.0,0.0908,0.0308		94/451	19752479	4,13002	2203	4300	6503	18650479	SO:0001819	synonymous_variant	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.282C>T	13.37:g.19752479G>A		Somatic		Capture	Illumina GAIIx	4	18650479	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	superfamily_Tubulin nucleotide-binding domain-like,HMMPfam_Tubulin,PatternScan_TUBULIN,superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C	p.T94	ENST00000400113.3	37	c.282	CCDS9284.1	13																																																																																			-	superfamily_Tubulin nucleotide-binding domain-like,HMMPfam_Tubulin		0.512	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	protein_coding	OTTHUMT00000044007.2	G	NM_006001		18650479	-1	no_errors	NM_006001	genbank	human	reviewed	54_36p	silent	SNP	0.988	A
Unknown	0	genome.wustl.edu	37	17	20493408	20493408	+	IGR	SNP	T	T	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr17:20493408T>A								CDRT15L2 (9184 upstream) : AC087499.10 (22816 downstream)																							TTCCAGCACCTCTGGCACCCG	0.577																																																0			17																																								20434000	SO:0001628	intergenic_variant	0																															17.37:g.20493408T>A		Somatic		Capture	Illumina GAIIx	4	20434000		Missense_Mutation	SNP	PatternScan_HOMEOBOX_1,superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox	p.L268H		37	c.803		17																																																																																			-	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox	0	0.577					MEIS3P2			T			20434000	+1	no_errors	ENST00000340731	ensembl	human	known	54_36p	missense	SNP	1.000	A
IFNA21	3452	genome.wustl.edu	37	9	21166467	21166467	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr9:21166467G>C	ENST00000380225.1	-	1	192	c.145C>G	c.(145-147)Cct>Gct	p.P49A		NM_002175.2	NP_002166.2	P01568	IFN21_HUMAN	interferon, alpha 21	49					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(3)	14				GBM - Glioblastoma multiforme(5;1.93e-187)|Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CAGGAGAAAGGAGAGATTCTT	0.517																																																0			9											106.0	109.0	108.0					9																	21166467		2203	4300	6503	21156467	SO:0001583	missense	3452				CCDS6497.1	9p22	2010-12-10			ENSG00000137080	ENSG00000137080		"""Interferons"""	5424	protein-coding gene	gene with protein product	"""leukocyte interferon protein"""	147584				1385305	Standard	NM_002175		Approved	IFN-alphaI	uc003zom.2	P01568	OTTHUMG00000019653	ENST00000380225.1:c.145C>G	9.37:g.21166467G>C	ENSP00000369574:p.Pro49Ala	Somatic		Capture	Illumina GAIIx	4	21156467	Q14608|Q5VWD1|Q7M4Q4	Missense_Mutation	SNP	HMMPfam_Interferon,superfamily_4_helix_cytokine,HMMSmart_IFabd,PatternScan_INTERFERON_A_B_D	p.P49A	ENST00000380225.1	37	c.145	CCDS6497.1	9	.	.	.	.	.	.	.	.	.	.	N	11.92	1.781462	0.31502	.	.	ENSG00000137080	ENST00000380225	T	0.03413	3.94	4.02	-0.225	0.13111	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.348813	0.29846	N	0.011045	T	0.04861	0.0131	M	0.78456	2.415	0.09310	N	1	P	0.42375	0.778	B	0.40506	0.331	T	0.27606	-1.0069	10	0.39692	T	0.17	.	2.1113	0.03703	0.1045:0.1791:0.4107:0.3057	.	49	P01568	IFN21_HUMAN	A	49	ENSP00000369574:P49A	ENSP00000369574:P49A	P	-	1	0	IFNA21	21156467	0.000000	0.05858	0.001000	0.08648	0.865000	0.49528	0.333000	0.19768	-0.250000	0.09555	0.644000	0.83932	CCT	-	HMMPfam_Interferon,superfamily_4_helix_cytokine		0.517	IFNA21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA21	protein_coding	OTTHUMT00000051882.1	G	NM_002175		21156467	-1	no_errors	NM_002175	genbank	human	validated	54_36p	missense	SNP	0.002	C
DNAH11	8701	genome.wustl.edu	37	7	21784163	21784163	+	Silent	SNP	A	A	G			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr7:21784163A>G	ENST00000409508.3	+	50	8293	c.8262A>G	c.(8260-8262)aaA>aaG	p.K2754K	DNAH11_ENST00000328843.6_Silent_p.K2761K	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2761					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TAGACAAAAAAGATTGTGATT	0.363									Kartagener syndrome																																							0			7											127.0	123.0	125.0					7																	21784163		1840	4099	5939	21750688	SO:0001819	synonymous_variant	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8262A>G	7.37:g.21784163A>G		Somatic		Capture	Illumina GAIIx	4	21750688	Q9UJ82	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2	p.R2762G	ENST00000409508.3	37	c.8284		7																																																																																			-	NULL		0.363	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	protein_coding	OTTHUMT00000326582.6	A	NM_003777		21750688	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_003777	genbank	human	reviewed	54_36p	missense	SNP	0.996	G
SNHG14	104472715	genome.wustl.edu	37	15	25302080	25302080	+	RNA	SNP	G	G	A	rs568283973		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr15:25302080G>A	ENST00000549804.2	+	0	98				SNHG14_ENST00000384733.1_RNA|SNORD116-2_ENST00000384274.1_RNA|SNORD116-3_ENST00000384287.1_RNA|SNHG14_ENST00000547292.1_RNA					small nucleolar RNA host gene 14 (non-protein coding)																		TCATACCGTCGTTCTCATCGG	0.507													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19698	0.0		0.0	False		,,,				2504	0.0															0			15											166.0	153.0	157.0					15																	25302080		876	1991	2867	22853173			0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25302080G>A		Somatic		Capture	Illumina GAIIx	4	22853173		RNA	SNP	-	NULL	ENST00000549804.2	37	NULL		15																																																																																			-	-		0.507	SNHG14-012	KNOWN	non_canonical_other|basic	antisense	SNORD116-3	processed_transcript	OTTHUMT00000408278.2	G			22853173	+1	no_errors	NR_003318	genbank	human	provisional	54_36p	rna	SNP	0.840	A
PPARGC1A	10891	genome.wustl.edu	37	4	23816029	23816029	+	Silent	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr4:23816029G>A	ENST00000264867.2	-	8	1196	c.1077C>T	c.(1075-1077)agC>agT	p.S359S	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	359	Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				CTGAGGACTTGCTGAGTTGTG	0.512																																					Esophageal Squamous(29;694 744 13796 34866 44181)											0			4											119.0	122.0	121.0					4																	23816029		2203	4300	6503	23425127	SO:0001819	synonymous_variant	10891			AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1077C>T	4.37:g.23816029G>A		Somatic		Capture	Illumina GAIIx	4	23425127	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Silent	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.S359	ENST00000264867.2	37	c.1077	CCDS3429.1	4																																																																																			-	NULL		0.512	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARGC1A	protein_coding	OTTHUMT00000214976.1	G	NM_013261		23425127	-1	no_errors	NM_013261	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
CDH9	1007	genome.wustl.edu	37	5	26881572	26881572	+	Silent	SNP	C	C	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr5:26881572C>T	ENST00000231021.4	-	12	2215	c.2043G>A	c.(2041-2043)gaG>gaA	p.E681E		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	681					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CTTCTCTTGCCTCTGGATTCC	0.438																																					Melanoma(8;187 585 15745 40864 52829)											0			5											195.0	189.0	191.0					5																	26881572		2203	4300	6503	26917329	SO:0001819	synonymous_variant	1007			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2043G>A	5.37:g.26881572C>T		Somatic		Capture	Illumina GAIIx	4	26917329	Q3B7I5	Silent	SNP	superfamily_Cadherin,HMMSmart_CA,HMMPfam_Cadherin,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.E681	ENST00000231021.4	37	c.2043	CCDS3893.1	5																																																																																			-	HMMPfam_Cadherin_C		0.438	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	protein_coding	OTTHUMT00000207352.1	C	NM_016279		26917329	-1	no_errors	NM_016279	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
ADAMTS5	11096	genome.wustl.edu	37	21	28305355	28305355	+	Silent	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr21:28305355G>A	ENST00000284987.5	-	5	1819	c.1698C>T	c.(1696-1698)agC>agT	p.S566S	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	566	Disintegrin.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						AGTTGCCATGGCTTGACGTCT	0.443																																					Esophageal Squamous(53;683 1080 10100 14424 45938)											0			21											69.0	59.0	62.0					21																	28305355		2203	4300	6503	27227226	SO:0001819	synonymous_variant	11096			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1698C>T	21.37:g.28305355G>A		Somatic		Capture	Illumina GAIIx	4	27227226	Q52LV4|Q9UKP2	Silent	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMSmart_SM00608,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1"	p.S566	ENST00000284987.5	37	c.1698	CCDS13579.1	21																																																																																			-	superfamily_TSP-1 type 1 repeat		0.443	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS5	protein_coding	OTTHUMT00000171648.1	G			27227226	-1	no_errors	NM_007038	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
OR11A1	26531	genome.wustl.edu	37	6	29394497	29394497	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr6:29394497T>C	ENST00000377149.1	-	5	1394	c.922A>G	c.(922-924)Atc>Gtc	p.I308V	OR11A1_ENST00000377148.1_Missense_Mutation_p.I308V|OR11A1_ENST00000377147.2_Missense_Mutation_p.I308V|OR5V1_ENST00000377154.1_Intron			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						GTTTGTTTGATACAGAGAATC	0.473																																																0			6											88.0	89.0	89.0					6																	29394497		1510	2708	4218	29502476	SO:0001583	missense	26531				CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.922A>G	6.37:g.29394497T>C	ENSP00000366354:p.Ile308Val	Somatic		Capture	Illumina GAIIx	4	29502476	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.I308V	ENST00000377149.1	37	c.922	CCDS34363.1	6	.	.	.	.	.	.	.	.	.	.	T	3.308	-0.141350	0.06669	.	.	ENSG00000204694	ENST00000377148;ENST00000377149;ENST00000377147	T;T;T	0.36878	1.23;1.23;1.23	3.34	-3.38	0.04883	.	5.700120	0.00496	N	0.000148	T	0.05273	0.0140	N	0.11845	0.185	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11717	-1.0576	10	0.32370	T	0.25	6.6602	0.812	0.01095	0.3944:0.1081:0.1533:0.3442	.	308	Q9GZK7	O11A1_HUMAN	V	308	ENSP00000366353:I308V;ENSP00000366354:I308V;ENSP00000366352:I308V	ENSP00000366352:I308V	I	-	1	0	OR11A1	29502476	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.019000	0.12546	-1.006000	0.03412	0.338000	0.21704	ATC	-	superfamily_Family A G protein-coupled receptor-like		0.473	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR11A1	protein_coding	OTTHUMT00000193778.1	T			29502476	-1	no_errors	NM_013937	genbank	human	provisional	54_36p	missense	SNP	0.000	C
NEUROD6	63974	genome.wustl.edu	37	7	31378576	31378576	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr7:31378576C>T	ENST00000297142.3	-	2	629	c.307G>A	c.(307-309)Gag>Aag	p.E103K		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	103	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						CTGTTCCTCTCGCGCGCGTTC	0.473																																																0			7											217.0	213.0	214.0					7																	31378576		2203	4300	6503	31345101	SO:0001583	missense	63974			AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.307G>A	7.37:g.31378576C>T	ENSP00000297142:p.Glu103Lys	Somatic		Capture	Illumina GAIIx	4	31345101	Q548T9|Q9H3H6	Missense_Mutation	SNP	superfamily_HLH helix-loop-helix DNA-binding domain,HMMPfam_HLH,HMMSmart_SM00353	p.E103K	ENST00000297142.3	37	c.307	CCDS5434.1	7	.	.	.	.	.	.	.	.	.	.	C	25.7	4.664406	0.88251	.	.	ENSG00000164600	ENST00000297142	D	0.99730	-6.56	5.46	5.46	0.80206	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	H	0.97340	3.985	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.96669	0.9495	10	0.87932	D	0	-7.743	19.3174	0.94220	0.0:1.0:0.0:0.0	.	103	Q96NK8	NDF6_HUMAN	K	103	ENSP00000297142:E103K	ENSP00000297142:E103K	E	-	1	0	NEUROD6	31345101	1.000000	0.71417	0.953000	0.39169	0.953000	0.61014	7.770000	0.85390	2.569000	0.86673	0.650000	0.86243	GAG	-	superfamily_HLH helix-loop-helix DNA-binding domain,HMMPfam_HLH,HMMSmart_SM00353		0.473	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD6	protein_coding	OTTHUMT00000215050.1	C	NM_022728		31345101	-1	no_errors	NM_022728	genbank	human	provisional	54_36p	missense	SNP	0.995	T
PDE1C	5137	genome.wustl.edu	37	7	31918700	31918700	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr7:31918700G>A	ENST00000396191.1	-	4	789	c.334C>T	c.(334-336)Cgg>Tgg	p.R112W	PDE1C_ENST00000396193.1_Missense_Mutation_p.R172W|PDE1C_ENST00000321453.7_Missense_Mutation_p.R112W|PDE1C_ENST00000396182.2_Missense_Mutation_p.R112W|PDE1C_ENST00000396184.3_Missense_Mutation_p.R112W	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	112					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	CCCATCTGCCGCGTGAAGGTG	0.557																																																0			7											103.0	92.0	96.0					7																	31918700		2203	4300	6503	31885225	SO:0001583	missense	5137			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.334C>T	7.37:g.31918700G>A	ENSP00000379494:p.Arg112Trp	Somatic		Capture	Illumina GAIIx	4	31885225	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	HMMPfam_PDEase_I_N,superfamily_SSF109604,HMMSmart_HDc,HMMPfam_PDEase_I,PatternScan_PDEASE_I	p.R112W	ENST00000396191.1	37	c.334	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	G	20.9	4.060875	0.76074	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.76316	-0.99;-1.01;-1.01;-0.96;-0.96	5.72	1.46	0.22682	-cyclic nucleotide phosphodiesterase N-terminal (1);5&apos (1);3&apos (1);	0.063961	0.64402	D	0.000006	D	0.87366	0.6159	M	0.82056	2.57	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.996	D	0.88426	0.3032	10	0.87932	D	0	.	15.0182	0.71605	0.0:0.0:0.4909:0.5091	.	112;172;112	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	W	172;112;112;112;112	ENSP00000379496:R172W;ENSP00000379494:R112W;ENSP00000318105:R112W;ENSP00000379487:R112W;ENSP00000379485:R112W	ENSP00000318105:R112W	R	-	1	2	PDE1C	31885225	0.728000	0.28080	0.367000	0.25926	0.870000	0.49936	0.908000	0.28545	0.260000	0.21731	0.655000	0.94253	CGG	-	HMMPfam_PDEase_I_N		0.557	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	protein_coding	OTTHUMT00000328458.1	G			31885225	-1	no_errors	NM_005020	genbank	human	provisional	54_36p	missense	SNP	0.806	A
COL16A1	1307	genome.wustl.edu	37	1	32149596	32149596	+	Silent	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr1:32149596G>A	ENST00000373672.3	-	33	2808	c.2292C>T	c.(2290-2292)ccC>ccT	p.P764P	COL16A1_ENST00000373668.3_Silent_p.P764P|COL16A1_ENST00000271069.6_Silent_p.P763P	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	764	Triple-helical region 5 (COL5) with 3 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CTGGTAGACCGGGTTGGCCCT	0.642																																					Colon(143;498 1786 21362 25193 36625)											0			1											47.0	52.0	51.0					1																	32149596		1962	4126	6088	31922183	SO:0001819	synonymous_variant	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2292C>T	1.37:g.32149596G>A		Somatic		Capture	Illumina GAIIx	4	31922183	Q16593|Q59F89|Q71RG9	Silent	SNP	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Collagen	p.P764	ENST00000373672.3	37	c.2292	CCDS41297.1	1																																																																																			-	NULL		0.642	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	protein_coding	OTTHUMT00000011057.2	G	NM_001856		31922183	-1	no_errors	NM_001856	genbank	human	reviewed	54_36p	silent	SNP	0.608	A
Unknown	0	genome.wustl.edu	37	16	32442092	32442092	+	IGR	SNP	C	C	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr16:32442092C>T								RP11-17M15.2 (120216 upstream) : RP11-626K17.3 (23840 downstream)																							TCTGTTTCATCGCTTGAATCA	0.244																																																0			16																																								32349593	SO:0001628	intergenic_variant	647157																															16.37:g.32442092C>T		Somatic		Capture	Illumina GAIIx	4	32349593		RNA	SNP	-	NULL		37	NULL		16																																																																																			-	-	0	0.244					LOC647157			C			32349593	+1	pseudogene	XR_017478	genbank	human	model	54_36p	rna	SNP	0.936	T
HIPK3	10114	genome.wustl.edu	37	11	33309012	33309012	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr11:33309012T>C	ENST00000303296.4	+	2	1357	c.1052T>C	c.(1051-1053)gTa>gCa	p.V351A	HIPK3_ENST00000525975.1_Missense_Mutation_p.V351A|HIPK3_ENST00000456517.1_Missense_Mutation_p.V351A|HIPK3_ENST00000379016.3_Missense_Mutation_p.V351A	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	351	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						GCCAGTCATGTATCAAAGACT	0.378																																																0			11											101.0	104.0	103.0					11																	33309012		2202	4298	6500	33265588	SO:0001583	missense	10114			AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.1052T>C	11.37:g.33309012T>C	ENSP00000304226:p.Val351Ala	Somatic		Capture	Illumina GAIIx	4	33265588	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.V351A	ENST00000303296.4	37	c.1052	CCDS7884.1	11	.	.	.	.	.	.	.	.	.	.	T	21.3	4.135674	0.77662	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.20463	2.07;2.07;2.07;2.07	5.52	5.52	0.82312	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000029	T	0.32376	0.0827	L	0.31207	0.915	0.80722	D	1	P;P	0.42375	0.503;0.778	B;P	0.56474	0.302;0.799	T	0.06373	-1.0830	10	0.87932	D	0	.	15.651	0.77091	0.0:0.0:0.0:1.0	.	351;351	Q9H422-2;Q9H422	.;HIPK3_HUMAN	A	351	ENSP00000431710:V351A;ENSP00000304226:V351A;ENSP00000368301:V351A;ENSP00000398241:V351A	ENSP00000304226:V351A	V	+	2	0	HIPK3	33265588	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.040000	0.89188	2.101000	0.63845	0.460000	0.39030	GTA	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.378	HIPK3-001	KNOWN	basic|CCDS	protein_coding	HIPK3	protein_coding	OTTHUMT00000255358.1	T	NM_005734		33265588	+1	no_errors	NM_005734	genbank	human	validated	54_36p	missense	SNP	1.000	C
ANKRD18B	441459	genome.wustl.edu	37	9	33529063	33529063	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr9:33529063T>G	ENST00000290943.6	+	3	483	c.387T>G	c.(385-387)atT>atG	p.I129M		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	129										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						ATCCAAACATTAAGGATATCT	0.428																																																0			9																																								33519063	SO:0001583	missense	441459					9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.387T>G	9.37:g.33529063T>G	ENSP00000290943:p.Ile129Met	Somatic		Capture	Illumina GAIIx	4	33519063		Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.I129M	ENST00000290943.6	37	c.387		9	.	.	.	.	.	.	.	.	.	.	t	9.826	1.187224	0.21870	.	.	ENSG00000230453	ENST00000290943	T	0.64618	-0.11	1.5	-3.0	0.05480	.	.	.	.	.	T	0.51312	0.1667	.	.	.	0.22693	N	0.998845	.	.	.	.	.	.	T	0.52653	-0.8547	5	0.59425	D	0.04	.	3.0302	0.06104	0.0:0.3886:0.2612:0.3502	.	.	.	.	M	129	ENSP00000290943:I129M	ENSP00000290943:I129M	I	+	3	3	ANKRD18B	33519063	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-1.564000	0.02152	-0.958000	0.03622	0.254000	0.18369	ATT	-	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank		0.428	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	ANKRD18B	protein_coding	OTTHUMT00000313729.2	T	XM_001718334		33519063	+1	no_errors	ENST00000290943	ensembl	human	known	54_36p	missense	SNP	0.029	G
CSNK1E	1454	genome.wustl.edu	37	22	38696913	38696913	+	Silent	SNP	C	C	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr22:38696913C>A	ENST00000396832.1	-	5	641	c.381G>T	c.(379-381)cgG>cgT	p.R127R	CSNK1E_ENST00000403904.1_Silent_p.R127R|CSNK1E_ENST00000359867.3_Silent_p.R127R|CSNK1E_ENST00000405675.3_Silent_p.R127R|CSNK1E_ENST00000498529.1_5'Flank|CSNK1E_ENST00000400206.2_Silent_p.R127R|CSNK1E_ENST00000413574.2_Silent_p.R127R	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	127	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					GCTTGACGTCCCGGTGGATGA	0.597																																					Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)											0			22											171.0	145.0	154.0					22																	38696913		2203	4300	6503	37026859	SO:0001819	synonymous_variant	1454				CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.381G>T	22.37:g.38696913C>A		Somatic		Capture	Illumina GAIIx	4	37026859		Silent	SNP	superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.R127	ENST00000396832.1	37	c.381	CCDS13970.1	22	.	.	.	.	.	.	.	.	.	.	C	10.76	1.441611	0.25900	.	.	ENSG00000213923	ENST00000451964	.	.	.	5.44	-1.89	0.07689	.	.	.	.	.	T	0.50069	0.1594	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40384	-0.9566	4	.	.	.	.	5.9875	0.19442	0.0:0.3356:0.3405:0.3239	.	.	.	.	V	65	.	.	G	-	2	0	CSNK1E	37026859	0.085000	0.21516	0.715000	0.30552	0.990000	0.78478	-0.563000	0.05943	-0.366000	0.08064	0.561000	0.74099	GGG	-	superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ST		0.597	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1E	protein_coding	OTTHUMT00000321462.1	C	NM_001894		37026859	-1	no_errors	NM_001894	genbank	human	reviewed	54_36p	silent	SNP	0.996	A
PTPRT	11122	genome.wustl.edu	37	20	40980843	40980843	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr20:40980843T>C	ENST00000373187.1	-	10	1642	c.1643A>G	c.(1642-1644)gAa>gGa	p.E548G	PTPRT_ENST00000373198.4_Missense_Mutation_p.E548G|PTPRT_ENST00000373184.1_Missense_Mutation_p.E548G|PTPRT_ENST00000356100.2_Missense_Mutation_p.E548G|PTPRT_ENST00000373201.1_Missense_Mutation_p.E548G|PTPRT_ENST00000373193.3_Missense_Mutation_p.E548G|PTPRT_ENST00000373190.1_Missense_Mutation_p.E548G			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	548	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GTGGTGGGTTTCATTCCGGAG	0.577																																																0			20											86.0	92.0	90.0					20																	40980843		1962	4139	6101	40414257	SO:0001583	missense	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1643A>G	20.37:g.40980843T>C	ENSP00000362283:p.Glu548Gly	Somatic		Capture	Illumina GAIIx	4	40414257	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	HMMSmart_SM00137,HMMPfam_MAM,PatternScan_MAM_1,superfamily_Immunoglobulin,HMMSmart_SM00060,superfamily_Fibronectin type III,HMMPfam_fn3,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.E548G	ENST00000373187.1	37	c.1643	CCDS42874.1	20	.	.	.	.	.	.	.	.	.	.	T	29.8	5.040802	0.93685	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4;0.4	6.03	6.03	0.97812	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.110113	0.64402	D	0.000007	T	0.71804	0.3383	M	0.72353	2.195	0.80722	D	1	D;D	0.67145	0.995;0.996	D;D	0.70487	0.947;0.969	T	0.74318	-0.3704	10	0.66056	D	0.02	.	16.5549	0.84482	0.0:0.0:0.0:1.0	.	548;548	O14522-1;O14522	.;PTPRT_HUMAN	G	548	ENSP00000362286:E548G;ENSP00000362283:E548G;ENSP00000362289:E548G;ENSP00000348408:E548G;ENSP00000362294:E548G;ENSP00000362280:E548G;ENSP00000362297:E548G	ENSP00000348408:E548G	E	-	2	0	PTPRT	40414257	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.310000	0.77875	0.450000	0.29827	GAA	-	superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3		0.577	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	protein_coding	OTTHUMT00000080315.1	T			40414257	-1	no_errors	NM_133170	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
KLHL40	131377	genome.wustl.edu	37	3	42729685	42729685	+	Missense_Mutation	SNP	C	C	T	rs149076152		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr3:42729685C>T	ENST00000287777.4	+	2	1304	c.1204C>T	c.(1204-1206)Cgc>Tgc	p.R402C		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	402					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											GCCCTCGCCCCGCTGCCTCTT	0.642																																																0			3						C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	49.0	49.0	49.0		1204	5.0	1.0	3	dbSNP_134	49	0,8600		0,0,4300	no	missense	KBTBD5	NM_152393.2	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	402/622	42729685	1,13005	2203	4300	6503	42704689	SO:0001583	missense	131377			AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.1204C>T	3.37:g.42729685C>T	ENSP00000287777:p.Arg402Cys	Somatic		Capture	Illumina GAIIx	4	42704689	Q86SI1|Q96MR2	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,PatternScan_MGMT,HMMPfam_BACK,superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612	p.R402C	ENST00000287777.4	37	c.1204	CCDS2703.1	3	.	.	.	.	.	.	.	.	.	.	C	25.6	4.652963	0.88056	2.27E-4	0.0	ENSG00000157119	ENST00000287777;ENST00000452129	T	0.79554	-1.28	4.98	4.98	0.66077	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.90480	0.7018	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.92056	0.5652	10	0.87932	D	0	.	18.2333	0.89941	0.0:1.0:0.0:0.0	.	402	Q2TBA0	KBTB5_HUMAN	C	402;147	ENSP00000287777:R402C	ENSP00000287777:R402C	R	+	1	0	KBTBD5	42704689	1.000000	0.71417	0.994000	0.49952	0.745000	0.42441	4.780000	0.62382	2.296000	0.77279	0.455000	0.32223	CGC	-	superfamily_Galactose oxidase central domain,HMMSmart_SM00612,HMMPfam_Kelch_1		0.642	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD5	protein_coding	OTTHUMT00000256651.1	C	NM_152393		42704689	+1	no_errors	NM_152393	genbank	human	validated	54_36p	missense	SNP	0.995	T
DLK2	65989	genome.wustl.edu	37	6	43418508	43418508	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr6:43418508C>A	ENST00000357338.3	-	6	1621	c.921G>T	c.(919-921)ttG>ttT	p.L307F	DLK2_ENST00000414245.1_Missense_Mutation_p.L301F|DLK2_ENST00000372488.3_Missense_Mutation_p.L307F|DLK2_ENST00000372485.1_Missense_Mutation_p.L301F	NM_206539.1	NP_996262.1	Q6UY11	DLK2_HUMAN	delta-like 2 homolog (Drosophila)	307					negative regulation of Notch signaling pathway (GO:0045746)|regulation of fat cell differentiation (GO:0045598)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CCAGGGCCACCAAGCTAGGCT	0.687																																																0			6											78.0	77.0	77.0					6																	43418508		2203	4300	6503	43526486	SO:0001583	missense	65989			AK055380	CCDS4897.1, CCDS75461.1	6p21.1	2008-02-05	2007-07-05	2007-07-05	ENSG00000171462	ENSG00000171462			21113	protein-coding gene	gene with protein product			"""EGF-like-domain, multiple 9"""	EGFL9			Standard	NM_001286656		Approved	MGC2487	uc003ovb.3	Q6UY11	OTTHUMG00000014735	ENST00000357338.3:c.921G>T	6.37:g.43418508C>A	ENSP00000349893:p.Leu307Phe	Somatic		Capture	Illumina GAIIx	4	43526486	B3KNZ7|Q5T3T8|Q9BQ54	Missense_Mutation	SNP	PatternScan_ZF_RING_1,HMMSmart_SM00181,superfamily_Concanavalin A-like lectins/glucanases,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_EGF/Laminin,HMMPfam_EGF,HMMSmart_SM00179,PatternScan_EGF_CA,PatternScan_ASX_HYDROXYL	p.L307F	ENST00000357338.3	37	c.921	CCDS4897.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.12|13.12	2.143192|2.143192	0.37825|0.37825	.|.	.|.	ENSG00000171462|ENSG00000171462	ENST00000372485;ENST00000372488;ENST00000357338;ENST00000414245|ENST00000430324	D;D;D;D|.	0.91295|.	-2.82;-2.79;-2.79;-2.82|.	5.09|5.09	4.23|4.23	0.50019|0.50019	.|.	0.000000|.	0.64402|.	D|.	0.000006|.	T|T	0.39937|0.39937	0.1097|0.1097	L|L	0.29908|0.29908	0.895|0.895	0.39826|0.39826	D|D	0.972906|0.972906	P|.	0.43938|.	0.822|.	B|.	0.36464|.	0.225|.	T|T	0.32771|0.32771	-0.9894|-0.9894	10|5	0.56958|.	D|.	0.05|.	.|.	15.071|15.071	0.72037|0.72037	0.1434:0.8566:0.0:0.0|0.1434:0.8566:0.0:0.0	.|.	307|.	Q6UY11|.	DLK2_HUMAN|.	F|L	301;307;307;301|213	ENSP00000361563:L301F;ENSP00000361566:L307F;ENSP00000349893:L307F;ENSP00000398906:L301F|.	ENSP00000349893:L307F|.	L|W	-|-	3|2	2|0	DLK2|DLK2	43526486|43526486	0.999000|0.999000	0.42202|0.42202	0.997000|0.997000	0.53966|0.53966	0.328000|0.328000	0.28507|0.28507	0.562000|0.562000	0.23531|0.23531	1.163000|1.163000	0.42636|0.42636	-0.360000|-0.360000	0.07572|0.07572	TTG|TGG	-	NULL		0.687	DLK2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	DLK2	protein_coding	OTTHUMT00000040618.1	C	NM_023932		43526486	-1	no_errors	NM_023932	genbank	human	validated	54_36p	missense	SNP	0.944	A
ANKRD20A7P	653436	genome.wustl.edu	37	9	44097368	44097368	+	IGR	SNP	C	C	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr9:44097368C>A								CNTNAP3B (173319 upstream) : RNU6-599P (10444 downstream)																							CCGATGCAGGCAATGAATCCA	0.328																																																0			9																																								44037364	SO:0001628	intergenic_variant	653436																															9.37:g.44097368C>A		Somatic		Capture	Illumina GAIIx	4	44037364		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.328					LOC653436			C			44037364	-1	pseudogene	XR_042306	genbank	human	model	54_36p	rna	SNP	0.526	A
ANKRD20A7P	653436	genome.wustl.edu	37	9	44118385	44118385	+	IGR	SNP	G	G	A	rs568613107		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr9:44118385G>A								RNU6-599P (10466 upstream) : RP11-175I6.5 (138194 downstream)																							CCGTGTAGACGTGGTCTATGG	0.622													g|||	1	0.000199681	0.0008	0.0	5008	,	,		11258	0.0		0.0	False		,,,				2504	0.0															0			9																																								44058381	SO:0001628	intergenic_variant	653436																															9.37:g.44118385G>A		Somatic		Capture	Illumina GAIIx	4	44058381		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.622					LOC653436			G			44058381	-1	pseudogene	XR_042306	genbank	human	model	54_36p	rna	SNP	0.017	A
ALOX5	240	genome.wustl.edu	37	10	45907646	45907646	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr10:45907646G>A	ENST00000374391.2	+	4	492	c.439G>A	c.(439-441)Gag>Aag	p.E147K	ALOX5_ENST00000542434.1_Missense_Mutation_p.E147K	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	147	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	CAGATGGATGGAGTGGAACCC	0.498																																																0			10											120.0	116.0	118.0					10																	45907646		2203	4300	6503	45227652	SO:0001583	missense	240			J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.439G>A	10.37:g.45907646G>A	ENSP00000363512:p.Glu147Lys	Somatic		Capture	Illumina GAIIx	4	45227652	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	superfamily_Lipase_LipOase,HMMPfam_PLAT,HMMSmart_LH2,superfamily_Lipoxygenase,HMMPfam_Lipoxygenase,PatternScan_LIPOXYGENASE_1,PatternScan_LIPOXYGENASE_2	p.E147K	ENST00000374391.2	37	c.439	CCDS7212.1	10	.	.	.	.	.	.	.	.	.	.	G	16.67	3.187565	0.57909	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	D;D	0.89617	-2.54;-2.54	5.16	5.16	0.70880	Lipoxygenase, C-terminal (2);	0.119289	0.56097	D	0.000036	D	0.90789	0.7108	M	0.64997	1.995	0.58432	D	0.999992	D;D;D	0.60160	0.985;0.987;0.985	P;P;P	0.54401	0.709;0.751;0.709	D	0.88642	0.3176	10	0.21540	T	0.41	-39.4822	16.15	0.81611	0.0:0.0:1.0:0.0	.	147;147;147	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	K	147	ENSP00000437634:E147K;ENSP00000363512:E147K	ENSP00000363512:E147K	E	+	1	0	ALOX5	45227652	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.537000	0.98070	2.393000	0.81446	0.655000	0.94253	GAG	-	superfamily_Lipoxygenase,HMMPfam_Lipoxygenase		0.498	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX5	protein_coding	OTTHUMT00000047780.1	G			45227652	+1	no_errors	NM_000698	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
XCR1	2829	genome.wustl.edu	37	3	46063343	46063343	+	Missense_Mutation	SNP	C	C	T	rs140218706		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr3:46063343C>T	ENST00000309285.3	-	2	453	c.97G>A	c.(97-99)Gcc>Acc	p.A33T	XCR1_ENST00000542109.1_Missense_Mutation_p.A33T	NM_001024644.1	NP_001019815.1	P46094	XCR1_HUMAN	chemokine (C motif) receptor 1	33					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol (GO:0051209)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		ACAGTGGTGGCGAGGGTAGCA	0.567																																																0			3						C	THR/ALA,THR/ALA	0,4406		0,0,2203	104.0	100.0	102.0		97,97	-5.3	0.0	3	dbSNP_134	102	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	XCR1	NM_001024644.1,NM_005283.2	58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	33/334,33/334	46063343	1,13005	2203	4300	6503	46038347	SO:0001583	missense	2829				CCDS2736.1	3p21.3-p21.1	2012-11-19	2006-01-13	2002-08-23	ENSG00000173578	ENSG00000173578		"""GPCR / Class A : Chemokine receptors : X-C motif"""	1625	protein-coding gene	gene with protein product		600552	"""chemokine (C motif) XC receptor 1"""	GPR5, CCXCR1		7832990, 10400311	Standard	NM_005283		Approved		uc003cpf.3	P46094	OTTHUMG00000133449	ENST00000309285.3:c.97G>A	3.37:g.46063343C>T	ENSP00000310405:p.Ala33Thr	Somatic		Capture	Illumina GAIIx	4	46038347		Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A33T	ENST00000309285.3	37	c.97	CCDS2736.1	3	.	.	.	.	.	.	.	.	.	.	C	1.726	-0.495405	0.04291	0.0	1.16E-4	ENSG00000173578	ENST00000309285;ENST00000542109;ENST00000395946	T;T	0.37584	1.19;1.19	5.03	-5.27	0.02763	.	1.580970	0.03170	N	0.170630	T	0.15696	0.0378	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.08055	0.003	T	0.14420	-1.0473	10	0.59425	D	0.04	.	1.1447	0.01772	0.4247:0.1473:0.1295:0.2985	.	33	P46094	XCR1_HUMAN	T	33	ENSP00000310405:A33T;ENSP00000438119:A33T	ENSP00000310405:A33T	A	-	1	0	XCR1	46038347	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.002000	0.13061	-0.746000	0.04766	-1.128000	0.01989	GCC	-	superfamily_SSF81321		0.567	XCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XCR1	protein_coding	OTTHUMT00000257322.2	C			46038347	-1	no_errors	NM_001024644	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
LRRC2	79442	genome.wustl.edu	37	3	46571464	46571464	+	Missense_Mutation	SNP	C	C	T	rs148660546		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr3:46571464C>T	ENST00000395905.3	-	6	1096	c.704G>A	c.(703-705)cGg>cAg	p.R235Q	LRRC2_ENST00000296144.3_Missense_Mutation_p.R235Q	NM_024512.4	NP_078788.2	Q9BYS8	LRRC2_HUMAN	leucine rich repeat containing 2	235										breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	17		Ovarian(412;0.0563)		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)		ATTCGACATCCGCAGGACACA	0.403																																																0			3						C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	102.0	93.0	96.0		704	5.3	1.0	3	dbSNP_134	96	0,8600		0,0,4300	no	missense	LRRC2	NM_024512.4	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	235/372	46571464	1,13005	2203	4300	6503	46546468	SO:0001583	missense	79442			AJ308569	CCDS2741.1	3p21.3	2014-07-30	2003-11-19		ENSG00000163827	ENSG00000163827			14676	protein-coding gene	gene with protein product		607180	"""leucine-rich repeat-containing 2"""			11896456	Standard	NM_024512		Approved		uc010hji.3	Q9BYS8	OTTHUMG00000133479	ENST00000395905.3:c.704G>A	3.37:g.46571464C>T	ENSP00000379241:p.Arg235Gln	Somatic		Capture	Illumina GAIIx	4	46546468	B2RDQ7|Q96LT5	Missense_Mutation	SNP	superfamily_SSF52058,HMMSmart_LRR_TYP,HMMPfam_LRR_1	p.R235Q	ENST00000395905.3	37	c.704	CCDS2741.1	3	.	.	.	.	.	.	.	.	.	.	C	31	5.058481	0.93846	2.27E-4	0.0	ENSG00000163827	ENST00000395905;ENST00000296144	T;T	0.56941	0.43;0.43	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000005	T	0.59404	0.2191	L	0.37750	1.13	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	T	0.50145	-0.8862	10	0.06236	T	0.91	.	16.8744	0.86047	0.0:1.0:0.0:0.0	.	235	Q9BYS8	LRRC2_HUMAN	Q	235	ENSP00000379241:R235Q;ENSP00000296144:R235Q	ENSP00000296144:R235Q	R	-	2	0	LRRC2	46546468	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.115000	0.77110	2.653000	0.90120	0.655000	0.94253	CGG	-	superfamily_SSF52058		0.403	LRRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC2	protein_coding	OTTHUMT00000257375.2	C			46546468	-1	no_errors	NM_024512	genbank	human	validated	54_36p	missense	SNP	1.000	T
FAM21A	387680	genome.wustl.edu	37	10	47911507	47911507	+	Silent	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr10:47911507G>A	ENST00000358474.5	+	13	984	c.984G>A	c.(982-984)acG>acA	p.T328T		NM_018232.1	NP_060702.1	Q5SNT6	FA21B_HUMAN		328					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10						CAGGAGACACGGATGTGTTTG	0.537																																																0			10											23.0	24.0	24.0					10																	47911507		1743	3496	5239	47431513	SO:0001819	synonymous_variant	55747																														ENST00000358474.5:c.984G>A	10.37:g.47911507G>A		Somatic		Capture	Illumina GAIIx	4	47431513		Silent	SNP	NULL	p.T328	ENST00000358474.5	37	c.984	CCDS44379.1	10																																																																																			-	NULL		0.537	FAM21B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM21B	protein_coding	OTTHUMT00000047871.2	G			47431513	+1	no_errors	NM_018232	genbank	human	validated	54_36p	silent	SNP	0.607	A
CCDC51	79714	genome.wustl.edu	37	3	48476261	48476261	+	Missense_Mutation	SNP	T	T	C	rs113958192		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr3:48476261T>C	ENST00000395694.2	-	2	363	c.278A>G	c.(277-279)aAc>aGc	p.N93S	CCDC51_ENST00000442740.1_5'UTR|CCDC51_ENST00000447018.1_5'UTR|CCDC51_ENST00000395696.1_Missense_Mutation_p.N93S|CCDC51_ENST00000412398.2_5'UTR	NM_001256964.1	NP_001243893.1	Q96ER9	CCD51_HUMAN	coiled-coil domain containing 51	93						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				endometrium(4)|kidney(4)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TCGAACCTCGTTGAGTCCAAC	0.597																																																0			3						T	SER/ASN	0,4002		0,0,2001	78.0	82.0	81.0		278	-5.7	0.6	3	dbSNP_132	81	12,8336		0,12,4162	yes	missense	CCDC51	NM_024661.3	46	0,12,6163	CC,CT,TT		0.1437,0.0,0.0972	benign	93/412	48476261	12,12338	2001	4174	6175	48451265	SO:0001583	missense	79714			AK022498	CCDS2766.2, CCDS58830.1	3p21.31	2005-12-30			ENSG00000164051	ENSG00000164051			25714	protein-coding gene	gene with protein product						12477932	Standard	NM_001256964		Approved	FLJ12436	uc003ctc.3	Q96ER9	OTTHUMG00000133534	ENST00000395694.2:c.278A>G	3.37:g.48476261T>C	ENSP00000379047:p.Asn93Ser	Somatic		Capture	Illumina GAIIx	4	48451265	Q9HA01	Missense_Mutation	SNP	NULL	p.N93S	ENST00000395694.2	37	c.278	CCDS2766.2	3	.	.	.	.	.	.	.	.	.	.	T	9.017	0.983845	0.18889	0.0	0.001437	ENSG00000164051	ENST00000395694;ENST00000395696;ENST00000446140	T;T;T	0.28895	1.59;1.59;1.59	4.91	-5.68	0.02436	.	0.380247	0.30791	N	0.008863	T	0.13543	0.0328	L	0.33189	0.99	0.31065	N	0.713632	B	0.06786	0.001	B	0.09377	0.004	T	0.33929	-0.9849	10	0.11794	T	0.64	1.1593	5.1219	0.14865	0.2291:0.3731:0.0:0.3978	.	93	Q96ER9	CCD51_HUMAN	S	93	ENSP00000379047:N93S;ENSP00000379049:N93S;ENSP00000409494:N93S	ENSP00000379047:N93S	N	-	2	0	CCDC51	48451265	0.436000	0.25586	0.582000	0.28627	0.934000	0.57294	-0.114000	0.10757	-1.212000	0.02620	-0.558000	0.04189	AAC	-	NULL		0.597	CCDC51-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC51	protein_coding	OTTHUMT00000344599.2	T	NM_024661		48451265	-1	no_errors	NM_024661	genbank	human	validated	54_36p	missense	SNP	0.891	C
OR4C12	283093	genome.wustl.edu	37	11	50003836	50003836	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr11:50003836C>A	ENST00000335238.4	-	1	235	c.202G>T	c.(202-204)Gac>Tac	p.D68Y		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						TAAACTGTGTCTATCAAAGAA	0.443																																																0			11											64.0	67.0	66.0					11																	50003836		2201	4295	6496	49960412	SO:0001583	missense	283093			BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.202G>T	11.37:g.50003836C>A	ENSP00000334418:p.Asp68Tyr	Somatic		Capture	Illumina GAIIx	4	49960412	B2RNF0|Q6IF49	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.D68Y	ENST00000335238.4	37	c.202	CCDS31496.1	11	.	.	.	.	.	.	.	.	.	.	.	18.22	3.574899	0.65878	.	.	ENSG00000221954	ENST00000335238	T	0.01185	5.21	3.31	3.31	0.37934	GPCR, rhodopsin-like superfamily (1);	0.153463	0.28952	U	0.013607	T	0.11623	0.0283	H	0.97516	4.02	0.46317	D	0.998981	D	0.89917	1.0	D	0.80764	0.994	T	0.03945	-1.0990	10	0.87932	D	0	.	12.6176	0.56586	0.0:1.0:0.0:0.0	.	68	Q96R67	OR4CC_HUMAN	Y	68	ENSP00000334418:D68Y	ENSP00000334418:D68Y	D	-	1	0	OR4C12	49960412	1.000000	0.71417	0.409000	0.26459	0.984000	0.73092	7.130000	0.77235	1.878000	0.54408	0.398000	0.26397	GAC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.443	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C12	protein_coding	OTTHUMT00000391104.1	C	NM_001005270		49960412	-1	no_errors	NM_001005270	genbank	human	provisional	54_36p	missense	SNP	0.998	A
CCNB3	85417	genome.wustl.edu	37	X	50053116	50053116	+	Silent	SNP	G	G	A	rs201598054		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chrX:50053116G>A	ENST00000376042.1	+	6	2245	c.1947G>A	c.(1945-1947)ttG>ttA	p.L649L	CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Silent_p.L649L			Q8WWL7	CCNB3_HUMAN	cyclin B3	649					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					ATACCACCTTGCAGGAAGTGT	0.428																																																0			X											51.0	44.0	46.0					X																	50053116		2203	4300	6503	50069856	SO:0001819	synonymous_variant	85417			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.1947G>A	X.37:g.50053116G>A		Somatic		Capture	Illumina GAIIx	4	50069856	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Silent	SNP	superfamily_Cyclin-like,HMMPfam_Cyclin_N,HMMSmart_SM00385,HMMPfam_Cyclin_C	p.L649	ENST00000376042.1	37	c.1947	CCDS14331.1	X																																																																																			-	NULL		0.428	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	protein_coding	OTTHUMT00000056558.1	G			50069856	+1	no_errors	NM_033031	genbank	human	reviewed	54_36p	silent	SNP	0.000	A
NUTM2HP	729023	genome.wustl.edu	37	10	52443367	52443367	+	IGR	SNP	C	C	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr10:52443367C>T								RP11-564C4.6 (23339 upstream) : ASAH2B (55710 downstream)																							TGGCCACCACCCCGGCCCCAC	0.701																																																0			10																																								52113373	SO:0001628	intergenic_variant	729023																															10.37:g.52443367C>T		Somatic		Capture	Illumina GAIIx	4	52113373		RNA	SNP	-	NULL		37	NULL		10																																																																																			-	-	0	0.701					LOC729023			C			52113373	+1	pseudogene	XR_038278	genbank	human	model	54_36p	rna	SNP	0.002	T
DST	667	genome.wustl.edu	37	6	56504791	56504791	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr6:56504791T>A	ENST00000361203.3	-	15	1929	c.1922A>T	c.(1921-1923)cAt>cTt	p.H641L	DST_ENST00000446842.2_Missense_Mutation_p.H315L|DST_ENST00000370765.6_Missense_Mutation_p.H315L|DST_ENST00000370754.5_Missense_Mutation_p.H819L|DST_ENST00000312431.6_Missense_Mutation_p.H641L|DST_ENST00000244364.6_Missense_Mutation_p.H315L|DST_ENST00000370769.4_Missense_Mutation_p.H641L|DST_ENST00000370788.2_Missense_Mutation_p.H641L|DST_ENST00000518935.1_Missense_Mutation_p.H315L|DST_ENST00000421834.2_Missense_Mutation_p.H641L			Q03001	DYST_HUMAN	dystonin	641					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AACATTTTTATGATTTTCTAA	0.308																																																0			6											56.0	62.0	60.0					6																	56504791		2202	4300	6502	56612750	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.1922A>T	6.37:g.56504791T>A	ENSP00000354508:p.His641Leu	Somatic		Capture	Illumina GAIIx	4	56612750	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMSmart_SM00150,HMMPfam_Spectrin,superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1,HMMPfam_GAS2,HMMSmart_SM00243	p.H641L	ENST00000361203.3	37	c.1922		6	.	.	.	.	.	.	.	.	.	.	T	25.2	4.615200	0.87359	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	D;D;D;D;D;D;D;D;D;D;D;D	0.92858	-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12	5.45	5.45	0.79879	.	0.000000	0.51477	D	0.000096	D	0.95046	0.8396	M	0.75615	2.305	0.35442	D	0.794972	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.989;1.0;0.994;1.0;1.0;0.999;1.0;0.994;0.991	D;P;D;P;D;D;D;D;P;D	0.97110	0.999;0.838;0.999;0.838;0.989;0.996;0.99;1.0;0.885;0.976	D	0.95226	0.8338	9	0.56958	D	0.05	.	15.6785	0.77349	0.0:0.0:0.0:1.0	.	670;641;641;819;757;315;315;315;641;315	B4DGY0;Q5TBT1;E7ERU2;E9PEB9;Q03001-13;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;.;.;DYST_HUMAN;.	L	315;819;641;641;315;641;641;641;315;681;315;315	ENSP00000244364:H315L;ENSP00000359790:H819L;ENSP00000359805:H641L;ENSP00000400883:H641L;ENSP00000393645:H315L;ENSP00000307959:H641L;ENSP00000359824:H641L;ENSP00000354508:H641L;ENSP00000404924:H315L;ENSP00000431030:H681L;ENSP00000359801:H315L;ENSP00000431003:H315L	ENSP00000244364:H315L	H	-	2	0	DST	56612750	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.868000	0.87116	2.288000	0.76882	0.533000	0.62120	CAT	-	HMMSmart_SM00150,superfamily_Spectrin repeat		0.308	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	T	NM_001723		56612750	-1	no_errors	NM_183380	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
RPS9	6203	genome.wustl.edu	37	19	54711303	54711303	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr19:54711303G>A	ENST00000302907.4	+	5	617	c.445G>A	c.(445-447)Gtc>Atc	p.V149I	RPS9_ENST00000391751.3_3'UTR|RPS9_ENST00000402367.1_3'UTR|RPS9_ENST00000391752.1_Missense_Mutation_p.V149I|RPS9_ENST00000391753.2_Missense_Mutation_p.V149I|RPS9_ENST00000441429.1_3'UTR	NM_001013.3	NP_001004.2	P46781	RS9_HUMAN	ribosomal protein S9	149	S4 RNA-binding. {ECO:0000255|PROSITE- ProRule:PRU00182}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of cell proliferation (GO:0008284)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)|translation regulator activity (GO:0045182)			NS(1)|breast(1)|kidney(11)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	20	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.18)		GTCCTTCATTGTCCGCCTGGA	0.612																																																0			19											86.0	65.0	72.0					19																	54711303		2203	4300	6503	59403115	SO:0001583	missense	6203			U14971	CCDS12884.1	19q13.4	2011-04-05			ENSG00000170889	ENSG00000170889		"""S ribosomal proteins"""	10442	protein-coding gene	gene with protein product	"""40S ribosomal protein S9"""	603631				7772601, 9582194	Standard	XM_005259135		Approved	S9	uc002qdx.3	P46781	OTTHUMG00000066618	ENST00000302907.4:c.445G>A	19.37:g.54711303G>A	ENSP00000302896:p.Val149Ile	Somatic		Capture	Illumina GAIIx	4	59403115	A9C4C1|Q4QRK7|Q9BVZ0	Missense_Mutation	SNP	HMMPfam_Ribosomal_S4,superfamily_Alpha-L RNA-binding motif,PatternScan_RIBOSOMAL_S4,HMMPfam_S4,HMMSmart_SM00363	p.V149I	ENST00000302907.4	37	c.445	CCDS12884.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.638085	0.96693	.	.	ENSG00000170889	ENST00000302907;ENST00000391752;ENST00000391753	T;T;T	0.60424	0.19;0.19;0.19	4.86	4.86	0.63082	RNA-binding S4 (4);	0.000000	0.85682	D	0.000000	T	0.77805	0.4185	M	0.90082	3.085	0.80722	D	1	D	0.55800	0.973	P	0.59761	0.863	T	0.82859	-0.0249	10	0.87932	D	0	-36.5195	15.8659	0.79063	0.0:0.0:1.0:0.0	.	149	P46781	RS9_HUMAN	I	149	ENSP00000302896:V149I;ENSP00000375632:V149I;ENSP00000375633:V149I	ENSP00000302896:V149I	V	+	1	0	RPS9	59403115	1.000000	0.71417	0.976000	0.42696	0.992000	0.81027	8.640000	0.91028	2.692000	0.91855	0.655000	0.94253	GTC	-	superfamily_Alpha-L RNA-binding motif,HMMPfam_S4,HMMSmart_SM00363		0.612	RPS9-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS9	protein_coding	OTTHUMT00000142834.3	G	NM_001013		59403115	+1	no_errors	NM_001013	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SYNE2	23224	genome.wustl.edu	37	14	64444671	64444671	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr14:64444671G>A	ENST00000344113.4	+	13	1554	c.1342G>A	c.(1342-1344)Gaa>Aaa	p.E448K	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.E448K|SYNE2_ENST00000358025.3_Missense_Mutation_p.E448K	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	448					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CCTTACCTTTGAAAATAAGGA	0.378																																																0			14											128.0	111.0	116.0					14																	64444671		1874	4116	5990	63514424	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.1342G>A	14.37:g.64444671G>A	ENSP00000341781:p.Glu448Lys	Somatic		Capture	Illumina GAIIx	4	63514424	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	superfamily_Calponin-homology,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_CH,PatternScan_ACTININ_2,superfamily_Spectrin,HMMSmart_SPEC,HMMPfam_Spectrin,superfamily_4_helix_cytokine,HMMPfam_KASH	p.E448K	ENST00000344113.4	37	c.1342	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514614	0.44763	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.56776	0.8;0.8;0.44	6.07	4.25	0.50352	.	0.000000	0.56097	D	0.000034	T	0.42517	0.1206	L	0.49350	1.555	0.80722	D	1	B;B	0.26081	0.087;0.141	B;B	0.22753	0.018;0.041	T	0.27938	-1.0059	10	0.36615	T	0.2	.	6.8764	0.24149	0.1533:0.1448:0.7019:0.0	.	448;448	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	K	448	ENSP00000350719:E448K;ENSP00000341781:E448K;ENSP00000452570:E448K	ENSP00000261678:E448K	E	+	1	0	SYNE2	63514424	1.000000	0.71417	0.998000	0.56505	0.435000	0.31806	2.874000	0.48483	0.884000	0.36064	0.655000	0.94253	GAA	-	superfamily_Spectrin		0.378	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	protein_coding	OTTHUMT00000276994.2	G	NM_182914		63514424	+1	no_errors	NM_182914	genbank	human	validated	54_36p	missense	SNP	0.993	A
RGS7BP	401190	genome.wustl.edu	37	5	63802571	63802571	+	Silent	SNP	C	C	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr5:63802571C>T	ENST00000334025.2	+	1	446	c.120C>T	c.(118-120)tcC>tcT	p.S40S	RGS7BP_ENST00000508162.1_3'UTR	NM_001029875.1|NM_001271890.1|NM_001271891.1	NP_001025046.1|NP_001258819.1|NP_001258820.1	Q6MZT1	R7BP_HUMAN	regulator of G-protein signaling 7 binding protein	40					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|stomach(1)	11		Lung NSC(810;0.000518)|Prostate(74;0.0435)|Ovarian(174;0.186)		Lung(70;0.147)		GCAGCGGCTCCGAGAGCGCCC	0.607																																																0			5											34.0	48.0	43.0					5																	63802571		2203	4300	6503	63838327	SO:0001819	synonymous_variant	401190			BX640900	CCDS34170.1	5q12.3	2008-02-05	2007-08-14		ENSG00000186479	ENSG00000186479			23271	protein-coding gene	gene with protein product		610890	"""regulator of G-protein signalling 7 binding protein"""			15632198	Standard	NM_001271890		Approved	R7BP	uc003jtj.4	Q6MZT1	OTTHUMG00000162293	ENST00000334025.2:c.120C>T	5.37:g.63802571C>T		Somatic		Capture	Illumina GAIIx	4	63838327	B7Z3X1	Silent	SNP	NULL	p.S40	ENST00000334025.2	37	c.120	CCDS34170.1	5																																																																																			-	NULL		0.607	RGS7BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS7BP	protein_coding	OTTHUMT00000368464.1	C	NM_001029875		63838327	+1	no_errors	NM_001029875	genbank	human	provisional	54_36p	silent	SNP	1.000	T
HEPH	9843	genome.wustl.edu	37	X	65412030	65412030	+	Silent	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chrX:65412030G>A	ENST00000343002.2	+	6	1786	c.1122G>A	c.(1120-1122)ctG>ctA	p.L374L	HEPH_ENST00000419594.1_Silent_p.L377L|HEPH_ENST00000441993.2_Silent_p.L377L|HEPH_ENST00000519389.1_Silent_p.L428L|HEPH_ENST00000374727.3_Silent_p.L377L|HEPH_ENST00000336279.5_Silent_p.L107L			Q9BQS7	HEPH_HUMAN	hephaestin	374					cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CTGTGGACCTGCTCACAGGCA	0.507																																																0			X											116.0	91.0	100.0					X																	65412030		2203	4300	6503	65328755	SO:0001819	synonymous_variant	9843			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.1122G>A	X.37:g.65412030G>A		Somatic		Capture	Illumina GAIIx	4	65328755	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Silent	SNP	superfamily_Cupredoxin,PatternScan_MULTICOPPER_OXIDASE1,HMMPfam_Cu-oxidase_3,HMMPfam_Cu-oxidase_2,PatternScan_MULTICOPPER_OXIDASE2	p.L107	ENST00000343002.2	37	c.321		X																																																																																			-	superfamily_Cupredoxin		0.507	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	protein_coding	OTTHUMT00000056995.1	G	NM_138737		65328755	+1	no_errors	NM_014799	genbank	human	reviewed	54_36p	silent	SNP	0.000	A
TSGA10IP	254187	genome.wustl.edu	37	11	65714718	65714718	+	RNA	SNP	T	T	C			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr11:65714718T>C	ENST00000532620.1	+	0	653				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein											endometrium(2)|kidney(3)|lung(9)	14						CCCTCCTCGTTCTCCCAGCGT	0.647																																																0			11											17.0	19.0	18.0					11																	65714718		2119	4228	6347	65471294			254187			AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65714718T>C		Somatic		Capture	Illumina GAIIx	4	65471294	Q3SXZ9|Q3SY01|Q96M26	Missense_Mutation	SNP	NULL	p.F141S	ENST00000532620.1	37	c.422		11																																																																																			-	NULL		0.647	TSGA10IP-001	KNOWN	basic	processed_transcript	TSGA10IP	polymorphic_pseudogene	OTTHUMT00000391373.2	T	NM_152762		65471294	+1	pseudogene	NM_152762	genbank	human	validated	54_36p	missense	SNP	0.000	C
CYP7B1	9420	genome.wustl.edu	37	8	65537058	65537058	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr8:65537058G>T	ENST00000310193.3	-	2	334	c.161C>A	c.(160-162)cCt>cAt	p.P54H		NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	54					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TCCAAGATAAGGAAGCCAACC	0.373																																																0			8											132.0	129.0	130.0					8																	65537058		2203	4300	6503	65699612	SO:0001583	missense	9420			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.161C>A	8.37:g.65537058G>T	ENSP00000310721:p.Pro54His	Somatic		Capture	Illumina GAIIx	4	65699612	B2RN07|Q9UNF5	Missense_Mutation	SNP	superfamily_Cytochrome P450,HMMPfam_p450	p.P54H	ENST00000310193.3	37	c.161	CCDS6180.1	8	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736814	0.89482	.	.	ENSG00000172817	ENST00000310193	T	0.74209	-0.82	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.88764	0.6525	M	0.86502	2.82	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.90045	0.4145	10	0.87932	D	0	-33.5436	19.678	0.95945	0.0:0.0:1.0:0.0	.	54	O75881	CP7B1_HUMAN	H	54	ENSP00000310721:P54H	ENSP00000310721:P54H	P	-	2	0	CYP7B1	65699612	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.544000	0.82117	2.653000	0.90120	0.591000	0.81541	CCT	-	superfamily_Cytochrome P450		0.373	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7B1	protein_coding	OTTHUMT00000378550.1	G			65699612	-1	no_errors	NM_004820	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CTNNA3	29119	genome.wustl.edu	37	10	68381522	68381522	+	Silent	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr10:68381522G>A	ENST00000433211.2	-	10	1476	c.1302C>T	c.(1300-1302)tcC>tcT	p.S434S	CTNNA3_ENST00000373744.4_Silent_p.S434S	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TTGTTGACATGGAACAAGCAA	0.333																																																0			10											84.0	79.0	81.0					10																	68381522		2203	4299	6502	68051528	SO:0001819	synonymous_variant	29119			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1302C>T	10.37:g.68381522G>A		Somatic		Capture	Illumina GAIIx	4	68051528		Silent	SNP	HMMPfam_Vinculin,superfamily_alpha-catenin/vinculin	p.S434	ENST00000433211.2	37	c.1302	CCDS7269.1	10																																																																																			-	HMMPfam_Vinculin,superfamily_alpha-catenin/vinculin		0.333	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	protein_coding	OTTHUMT00000048282.2	G	NM_013266		68051528	-1	no_errors	NM_013266	genbank	human	validated	54_36p	silent	SNP	0.999	A
MYO6	4646	genome.wustl.edu	37	6	76599898	76599898	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr6:76599898G>A	ENST00000369977.3	+	26	2922	c.2783G>A	c.(2782-2784)cGt>cAt	p.R928H	MYO6_ENST00000369985.4_Missense_Mutation_p.R928H|MYO6_ENST00000369981.3_Missense_Mutation_p.R928H|MYO6_ENST00000369975.1_Missense_Mutation_p.R928H	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	928	Glu-rich.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		AGGCTGAGGCGTATTCAAGAA	0.408																																																0			6											95.0	105.0	102.0					6																	76599898		2203	4300	6503	76656618	SO:0001583	missense	4646			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2783G>A	6.37:g.76599898G>A	ENSP00000358994:p.Arg928His	Somatic		Capture	Illumina GAIIx	4	76656618	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMPfam_IQ	p.R928H	ENST00000369977.3	37	c.2783	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742839	0.49151	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	T;T;T;T	0.18657	2.2;2.52;2.52;2.2	5.98	3.9	0.45041	.	0.261207	0.38492	N	0.001678	T	0.05593	0.0147	N	0.13043	0.29	0.36381	D	0.861931	B;B	0.10296	0.001;0.003	B;B	0.04013	0.001;0.001	T	0.09530	-1.0670	10	0.62326	D	0.03	.	11.0654	0.47972	0.2172:0.0:0.7828:0.0	.	928;928	Q9UM54-2;Q9UM54-1	.;.	H	928	ENSP00000358998:R928H;ENSP00000359002:R928H;ENSP00000358994:R928H;ENSP00000358992:R928H	ENSP00000358992:R928H	R	+	2	0	MYO6	76656618	0.985000	0.35326	0.978000	0.43139	0.910000	0.53928	2.033000	0.41136	1.550000	0.49438	0.591000	0.81541	CGT	-	NULL		0.408	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	protein_coding	OTTHUMT00000041279.2	G	NM_004999		76656618	+1	no_errors	NM_004999	genbank	human	reviewed	54_36p	missense	SNP	0.414	A
CEP131	22994	genome.wustl.edu	37	17	79180660	79180660	+	Silent	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr17:79180660G>A	ENST00000269392.4	-	5	646	c.399C>T	c.(397-399)ccC>ccT	p.P133P	AZI1_ENST00000575907.1_Silent_p.P133P|AZI1_ENST00000450824.2_Silent_p.P133P|AZI1_ENST00000570482.2_5'Flank|AZI1_ENST00000374782.3_Silent_p.P133P	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		133					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TGAAGCCCCGGGGCTGGTCAT	0.657																																																0			17											53.0	61.0	58.0					17																	79180660		2203	4300	6503	76795255	SO:0001819	synonymous_variant	22994																														ENST00000269392.4:c.399C>T	17.37:g.79180660G>A		Somatic		Capture	Illumina GAIIx	4	76795255	A6NHI8|B2RN11|Q96F50	Silent	SNP	NULL	p.P133	ENST00000269392.4	37	c.399		17																																																																																			-	NULL		0.657	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	AZI1	protein_coding	OTTHUMT00000256070.1	G			76795255	-1	no_errors	NM_014984	genbank	human	validated	54_36p	silent	SNP	0.711	A
ANKRD34B	340120	genome.wustl.edu	37	5	79855106	79855106	+	Missense_Mutation	SNP	C	C	T	rs376632230		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr5:79855106C>T	ENST00000338682.3	-	5	1405	c.733G>A	c.(733-735)Gct>Act	p.A245T		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	245						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		CAGGGTGGAGCGTGGGGGAGC	0.527																																																0			5						C	THR/ALA	1,4405		0,1,2202	41.0	46.0	44.0		733	4.7	0.2	5		44	0,8598		0,0,4299	no	missense	ANKRD34B	NM_001004441.2	58	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	245/515	79855106	1,13003	2203	4299	6502	79890862	SO:0001583	missense	340120				CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.733G>A	5.37:g.79855106C>T	ENSP00000339802:p.Ala245Thr	Somatic		Capture	Illumina GAIIx	4	79890862	B2RPH1|Q68D79	Missense_Mutation	SNP	HMMSmart_SM00248,superfamily_Ankyrin repeat,HMMPfam_Ank	p.A245T	ENST00000338682.3	37	c.733	CCDS34194.1	5	.	.	.	.	.	.	.	.	.	.	C	8.465	0.856298	0.17106	2.27E-4	0.0	ENSG00000189127	ENST00000338682	T	0.19938	2.11	5.6	4.7	0.59300	.	0.184455	0.34802	U	0.003667	T	0.18130	0.0435	L	0.51422	1.61	0.27961	N	0.936774	P	0.41710	0.76	B	0.28553	0.091	T	0.10636	-1.0621	10	0.72032	D	0.01	-8.3964	14.8838	0.70553	0.0:0.8556:0.1444:0.0	.	245	A5PLL1	AN34B_HUMAN	T	245	ENSP00000339802:A245T	ENSP00000339802:A245T	A	-	1	0	ANKRD34B	79890862	0.010000	0.17322	0.208000	0.23602	0.044000	0.14063	0.378000	0.20569	1.291000	0.44653	0.655000	0.94253	GCT	-	NULL		0.527	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD34B	protein_coding	OTTHUMT00000369475.1	C	NM_001004441		79890862	-1	no_errors	NM_001004441	genbank	human	provisional	54_36p	missense	SNP	0.737	T
Unknown	0	genome.wustl.edu	37	8	86816069	86816069	+	IGR	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr8:86816069G>A								REXO1L10P (57324 upstream) : CTA-392E5.1 (35864 downstream)																							CCACGGGAGCGTTGGCTGCTG	0.617																																																0			8																																								86909738	SO:0001628	intergenic_variant	441363																															8.37:g.86816069G>A		Somatic		Capture	Illumina GAIIx	4	86909738		RNA	SNP	-	NULL		37	NULL		8																																																																																			-	-	0	0.617					REXO1L7P			G			86909738	-1	pseudogene	XR_041982	genbank	human	model	54_36p	rna	SNP	0.001	A
PTPN21	11099	genome.wustl.edu	37	14	88940127	88940127	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr14:88940127A>G	ENST00000556564.1	-	14	2815	c.2531T>C	c.(2530-2532)gTa>gCa	p.V844A	PTPN21_ENST00000328736.3_Missense_Mutation_p.V844A	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	844					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TTTTGCATCTACTCGAGTCTT	0.398																																																0			14											159.0	152.0	155.0					14																	88940127		2203	4300	6503	88009880	SO:0001583	missense	11099			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.2531T>C	14.37:g.88940127A>G	ENSP00000452414:p.Val844Ala	Somatic		Capture	Illumina GAIIx	4	88009880		Missense_Mutation	SNP	HMMSmart_SM00295,superfamily_Ubiquitin-like,HMMPfam_FERM_N,PatternScan_FERM_1,superfamily_Second domain of FERM,HMMPfam_FERM_M,PatternScan_FERM_2,superfamily_PH domain-like,HMMPfam_FERM_C,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.V844A	ENST00000556564.1	37	c.2531	CCDS9884.1	14	.	.	.	.	.	.	.	.	.	.	A	3.689	-0.064005	0.07273	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	T;T	0.71817	-0.6;-0.6	5.43	-1.23	0.09465	.	0.689240	0.14831	N	0.295845	T	0.30727	0.0774	N	0.02011	-0.69	0.22305	N	0.999215	B	0.02656	0.0	B	0.01281	0.0	T	0.33471	-0.9867	10	0.02654	T	1	.	3.1775	0.06573	0.2292:0.4407:0.225:0.1052	.	844	Q16825	PTN21_HUMAN	A	844	ENSP00000330276:V844A;ENSP00000452414:V844A	ENSP00000330276:V844A	V	-	2	0	PTPN21	88009880	0.935000	0.31712	0.961000	0.40146	0.990000	0.78478	0.381000	0.20619	-0.151000	0.11176	0.533000	0.62120	GTA	-	NULL		0.398	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN21	protein_coding	OTTHUMT00000410303.1	A			88009880	-1	no_errors	NM_007039	genbank	human	reviewed	54_36p	missense	SNP	0.594	G
SLCO3A1	28232	genome.wustl.edu	37	15	92647654	92647654	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr15:92647654G>A	ENST00000318445.6	+	4	1105	c.891G>A	c.(889-891)atG>atA	p.M297I	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.M297I|SLCO3A1_ENST00000555549.1_3'UTR	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	297					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	AGCCCGCCATGGAAAGCGAGC	0.607																																																0			15											105.0	91.0	96.0					15																	92647654		2198	4298	6496	90448658	SO:0001583	missense	28232			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.891G>A	15.37:g.92647654G>A	ENSP00000320634:p.Met297Ile	Somatic		Capture	Illumina GAIIx	4	90448658	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	superfamily_MFS general substrate transporter,HMMPfam_OATP,superfamily_Kazal-type serine protease inhibitors,HMMPfam_Kazal_2	p.M297I	ENST00000318445.6	37	c.891	CCDS10371.1	15	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304941	0.40795	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000556649;ENST00000555549	T;T	0.80566	-1.39;-1.39	5.31	5.31	0.75309	Major facilitator superfamily domain, general substrate transporter (1);	0.737577	0.13343	N	0.394996	T	0.64681	0.2620	N	0.04880	-0.145	0.38946	D	0.958249	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.0;0.002;0.001	T	0.60850	-0.7181	10	0.39692	T	0.17	.	13.2872	0.60249	0.0764:0.0:0.9236:0.0	.	239;297;297	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	I	297;297;90;16	ENSP00000320634:M297I;ENSP00000387846:M297I	ENSP00000320634:M297I	M	+	3	0	SLCO3A1	90448658	0.994000	0.37717	1.000000	0.80357	0.989000	0.77384	1.977000	0.40589	2.456000	0.83038	0.655000	0.94253	ATG	-	superfamily_MFS general substrate transporter,HMMPfam_OATP		0.607	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO3A1	protein_coding	OTTHUMT00000313529.1	G	NM_013272		90448658	+1	no_errors	NM_013272	genbank	human	validated	54_36p	missense	SNP	0.997	A
ZCWPW1	55063	genome.wustl.edu	37	7	100013927	100013927	+	Splice_Site	SNP	C	C	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr7:100013927C>T	ENST00000398027.2	-	7	879		c.e7+1		ZCWPW1_ENST00000324725.6_Splice_Site|ZCWPW1_ENST00000490721.1_Splice_Site|ZCWPW1_ENST00000360951.4_Splice_Site	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1								zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACTGTACTTACGAGCTTCCTT	0.463																																																0			7											128.0	120.0	123.0					7																	100013927		1863	4100	5963	99851863	SO:0001630	splice_region_variant	55063			AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.631+1G>A	7.37:g.100013927C>T		Somatic		Capture	Illumina GAIIx	4	99851863	A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Splice_Site	SNP	-	e5+1	ENST00000398027.2	37	c.631+1	CCDS43623.1	7	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929897	0.52759	.	.	ENSG00000078487	ENST00000398027;ENST00000490721;ENST00000360951;ENST00000324725;ENST00000379559	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7428	0.69469	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZCWPW1	99851863	0.995000	0.38212	0.991000	0.47740	0.605000	0.37080	3.705000	0.54823	2.603000	0.88011	0.655000	0.94253	.	-	-		0.463	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZCWPW1	protein_coding	OTTHUMT00000356083.1	C	NM_017984	Intron	99851863	-1	no_errors	NM_017984	genbank	human	validated	54_36p	splice_site	SNP	0.865	T
TMEM119	338773	genome.wustl.edu	37	12	108986031	108986031	+	Silent	SNP	C	C	T	rs74504010	byFrequency	TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr12:108986031C>T	ENST00000392806.3	-	2	297	c.129G>A	c.(127-129)gaG>gaA	p.E43E		NM_181724.2	NP_859075.2	Q4V9L6	TM119_HUMAN	transmembrane protein 119	43					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(3)|ovary(1)|skin(1)	7						AGCCCTCGGCCTCCCCACTAC	0.706													C|||	832	0.166134	0.0053	0.1297	5008	,	,		11135	0.3145		0.164	False		,,,				2504	0.2587															0			12						C		156,4214		6,144,2035	8.0	11.0	10.0		129	0.4	1.0	12	dbSNP_131	10	1399,7135		129,1141,2997	no	coding-synonymous	TMEM119	NM_181724.2		135,1285,5032	TT,TC,CC		16.3933,3.5698,12.0505		43/284	108986031	1555,11349	2185	4267	6452	107510160	SO:0001819	synonymous_variant	338773			AK075501	CCDS9119.1	12q23.3	2014-02-12				ENSG00000183160			27884	protein-coding gene	gene with protein product						12975309	Standard	NM_181724		Approved		uc001tng.3	Q4V9L6		ENST00000392806.3:c.129G>A	12.37:g.108986031C>T		Somatic		Capture	Illumina GAIIx	4	107510160	Q6UXE5|Q8N2F5	Silent	SNP	NULL	p.E43	ENST00000392806.3	37	c.129	CCDS9119.1	12																																																																																			-	NULL		0.706	TMEM119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM119	protein_coding	OTTHUMT00000403900.1	C	NM_181724		107510160	-1	no_errors	NM_181724	genbank	human	validated	54_36p	silent	SNP	0.995	T
SLC5A7	60482	genome.wustl.edu	37	2	108626706	108626706	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr2:108626706G>A	ENST00000264047.2	+	9	1408	c.1132G>A	c.(1132-1134)Gtt>Att	p.V378I	SLC5A7_ENST00000409059.1_Missense_Mutation_p.V378I|SLC5A7_ENST00000540517.1_Missense_Mutation_p.V273I	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	378					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)	p.V378I(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	CAAAGAAATCGTTTGGGTTAT	0.443																																																2	Substitution - Missense(2)	ovary(1)|pancreas(1)	2											148.0	120.0	129.0					2																	108626706		2203	4300	6503	107993138	SO:0001583	missense	60482			AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.1132G>A	2.37:g.108626706G>A	ENSP00000264047:p.Val378Ile	Somatic		Capture	Illumina GAIIx	4	107993138	Q53TF2	Missense_Mutation	SNP	PatternScan_NA_SOLUT_SYMP_1,PatternScan_NA_SOLUT_SYMP_2,HMMPfam_SSF	p.V378I	ENST00000264047.2	37	c.1132	CCDS2074.1	2	.	.	.	.	.	.	.	.	.	.	G	8.887	0.953064	0.18431	.	.	ENSG00000115665	ENST00000409059;ENST00000540517;ENST00000264047	D;D;D	0.89050	-2.46;-2.46;-2.46	5.85	2.92	0.33932	.	0.168277	0.51477	N	0.000083	T	0.79724	0.4495	N	0.25647	0.755	0.49915	D	0.999832	B	0.06786	0.001	B	0.10450	0.005	T	0.70360	-0.4893	10	0.31617	T	0.26	-25.0208	8.2684	0.31829	0.1388:0.0:0.7353:0.1259	.	378	Q9GZV3	SC5A7_HUMAN	I	378;273;378	ENSP00000387346:V378I;ENSP00000445351:V273I;ENSP00000264047:V378I	ENSP00000264047:V378I	V	+	1	0	SLC5A7	107993138	1.000000	0.71417	0.256000	0.24389	0.798000	0.45092	4.104000	0.57790	0.773000	0.33404	-0.143000	0.13931	GTT	-	HMMPfam_SSF		0.443	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A7	protein_coding	OTTHUMT00000253562.1	G			107993138	+1	no_errors	NM_021815	genbank	human	provisional	54_36p	missense	SNP	0.918	A
ZC3H12C	85463	genome.wustl.edu	37	11	110030125	110030125	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr11:110030125A>G	ENST00000278590.3	+	4	1109	c.1058A>G	c.(1057-1059)aAt>aGt	p.N353S	ZC3H12C_ENST00000453089.2_Missense_Mutation_p.N322S|ZC3H12C_ENST00000528673.1_Missense_Mutation_p.N354S	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	353							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		ATTGTGTCCAATGATAACTAC	0.443																																																0			11											61.0	64.0	63.0					11																	110030125		2126	4280	6406	109535335	SO:0001583	missense	85463				CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1058A>G	11.37:g.110030125A>G	ENSP00000278590:p.Asn353Ser	Somatic		Capture	Illumina GAIIx	4	109535335	B4DI65|B4DR47	Missense_Mutation	SNP	NULL	p.N353S	ENST00000278590.3	37	c.1058	CCDS44727.1	11	.	.	.	.	.	.	.	.	.	.	A	26.8	4.774711	0.90108	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.59083	0.29;0.29;0.29	5.55	5.55	0.83447	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.80701	0.4673	M	0.90650	3.135	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.992;0.996	D	0.85054	0.0930	10	0.87932	D	0	-34.1864	15.9917	0.80211	1.0:0.0:0.0:0.0	.	354;353;353	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	S	353;354;322	ENSP00000278590:N353S;ENSP00000431821:N354S;ENSP00000413094:N322S	ENSP00000278590:N353S	N	+	2	0	ZC3H12C	109535335	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.339000	0.96797	2.222000	0.72286	0.533000	0.62120	AAT	-	NULL		0.443	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	ZC3H12C	protein_coding	OTTHUMT00000390491.1	A	NM_033390		109535335	+1	no_errors	NM_033390	genbank	human	validated	54_36p	missense	SNP	1.000	G
CHIA	27159	genome.wustl.edu	37	1	111861831	111861831	+	Silent	SNP	C	C	G			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr1:111861831C>G	ENST00000369740.1	+	10	1108	c.1005C>G	c.(1003-1005)ggC>ggG	p.G335G	CHIA_ENST00000343320.6_Silent_p.G335G|CHIA_ENST00000451398.2_Silent_p.G174G|CHIA_ENST00000483391.1_Silent_p.G174G|CHIA_ENST00000430615.1_Silent_p.G227G|RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000353665.6_Silent_p.G174G	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	335					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TGTGGGTTGGCTATGACAACA	0.473																																																0			1											140.0	130.0	134.0					1																	111861831		2203	4300	6503	111663354	SO:0001819	synonymous_variant	27159			AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.1005C>G	1.37:g.111861831C>G		Somatic		Capture	Illumina GAIIx	4	111663354	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Silent	SNP	HMMPfam_Glyco_hydro_18,HMMSmart_SM00636,superfamily_(Trans)glycosidases,PatternScan_CHITINASE_18,superfamily_Chitinase insertion domain,HMMSmart_SM00494,superfamily_Invertebrate chitin-binding proteins,HMMPfam_CBM_14	p.G335	ENST00000369740.1	37	c.1005	CCDS41368.1	1																																																																																			-	HMMPfam_Glyco_hydro_18,HMMSmart_SM00636,superfamily_(Trans)glycosidases,superfamily_Chitinase insertion domain		0.473	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIA	protein_coding	OTTHUMT00000030710.1	C			111663354	+1	no_errors	NM_201653	genbank	human	validated	54_36p	silent	SNP	0.994	G
SIDT2	51092	genome.wustl.edu	37	11	117062657	117062657	+	Missense_Mutation	SNP	C	C	T	rs139484942		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr11:117062657C>T	ENST00000324225.4	+	19	2330	c.1799C>T	c.(1798-1800)cCg>cTg	p.P600L	SIDT2_ENST00000532062.1_5'Flank|SIDT2_ENST00000431081.2_Missense_Mutation_p.P597L	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	600					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		AAGCGGCACCCGGACATCAAC	0.587																																																0			11						C	LEU/PRO	1,4401	2.1+/-5.4	0,1,2200	196.0	175.0	182.0		1799	4.9	1.0	11	dbSNP_134	182	1,8591	1.2+/-3.3	0,1,4295	no	missense	SIDT2	NM_001040455.1	98	0,2,6495	TT,TC,CC		0.0116,0.0227,0.0154	possibly-damaging	600/833	117062657	2,12992	2201	4296	6497	116567867	SO:0001583	missense	51092			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1799C>T	11.37:g.117062657C>T	ENSP00000314023:p.Pro600Leu	Somatic		Capture	Illumina GAIIx	4	116567867	Q8NBY7|Q9Y357	Missense_Mutation	SNP	NULL	p.P600L	ENST00000324225.4	37	c.1799	CCDS31682.1	11	.	.	.	.	.	.	.	.	.	.	C	28.8	4.950619	0.92660	2.27E-4	1.16E-4	ENSG00000149577	ENST00000324225;ENST00000278951;ENST00000431081	T;T;T	0.30714	1.52;1.52;1.52	4.91	4.91	0.64330	.	0.052843	0.85682	D	0.000000	T	0.57021	0.2025	M	0.83384	2.64	0.80722	D	1	D;D;D;D	0.64830	0.992;0.972;0.994;0.994	P;B;P;P	0.60068	0.792;0.286;0.868;0.868	T	0.64305	-0.6439	10	0.72032	D	0.01	-13.6396	18.2914	0.90131	0.0:1.0:0.0:0.0	.	621;597;600;621	Q8NBJ9-2;F5H8L4;Q8NBJ9;C9JBG5	.;.;SIDT2_HUMAN;.	L	600;621;597	ENSP00000314023:P600L;ENSP00000278951:P621L;ENSP00000399635:P597L	ENSP00000278951:P621L	P	+	2	0	SIDT2	116567867	1.000000	0.71417	0.954000	0.39281	0.822000	0.46500	7.566000	0.82347	2.573000	0.86826	0.655000	0.94253	CCG	-	NULL		0.587	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT2	protein_coding	OTTHUMT00000392836.1	C	NM_015996		116567867	+1	no_errors	NM_001040455	genbank	human	validated	54_36p	missense	SNP	0.992	T
POU2F3	25833	genome.wustl.edu	37	11	120170353	120170353	+	Silent	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr11:120170353G>A	ENST00000543440.2	+	5	429	c.279G>A	c.(277-279)ccG>ccA	p.P93P	POU2F3_ENST00000260264.4_Silent_p.P95P	NM_014352.3	NP_055167.2	Q9UKI9	PO2F3_HUMAN	POU class 2 homeobox 3	93					epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|negative regulation by host of viral transcription (GO:0043922)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)	17		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		CCCTCCATCCGCTCCAGCAGC	0.567											OREG0021419	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			11											124.0	101.0	109.0					11																	120170353		2203	4300	6503	119675563	SO:0001819	synonymous_variant	25833			AF133895	CCDS8431.1, CCDS58190.1	11q23.3	2011-06-20	2007-07-13		ENSG00000137709	ENSG00000137709		"""Homeoboxes / POU class"""	19864	protein-coding gene	gene with protein product		607394	"""POU domain class 2, transcription factor 3"""			10473598	Standard	NM_014352		Approved	OCT11, PLA-1, Skn-1a, Epoc-1	uc021qrk.1	Q9UKI9	OTTHUMG00000166140	ENST00000543440.2:c.279G>A	11.37:g.120170353G>A		Somatic	1501	Capture	Illumina GAIIx	4	119675563	A8K7H8|B4DY07|F5GWW6|Q3MIY3|Q9UKR7|Q9Y504	Silent	SNP	HMMPfam_Pou,HMMSmart_SM00352,superfamily_lambda repressor-like DNA-binding domains,PatternScan_POU_1,PatternScan_POU_2,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.P93	ENST00000543440.2	37	c.279	CCDS8431.1	11	.	.	.	.	.	.	.	.	.	.	G	10.25	1.297563	0.23650	.	.	ENSG00000137709	ENST00000533620	D	0.84070	-1.8	4.58	-9.16	0.00694	.	.	.	.	.	T	0.63022	0.2476	.	.	.	0.53688	D	0.999972	B	0.06786	0.001	B	0.04013	0.001	T	0.29549	-1.0008	8	0.23302	T	0.38	.	3.623	0.08103	0.1132:0.0844:0.4236:0.3788	.	32	E9PIN6	.	T	32	ENSP00000435738:A32T	ENSP00000435738:A32T	A	+	1	0	POU2F3	119675563	0.000000	0.05858	0.239000	0.24122	0.997000	0.91878	-4.769000	0.00188	-3.285000	0.00196	0.563000	0.77884	GCT	-	NULL		0.567	POU2F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU2F3	protein_coding	OTTHUMT00000388039.2	G			119675563	+1	no_errors	NM_014352	genbank	human	validated	54_36p	silent	SNP	0.698	A
HAO2	51179	genome.wustl.edu	37	1	119936413	119936413	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr1:119936413C>T	ENST00000325945.3	+	8	1079	c.1006C>T	c.(1006-1008)Cgg>Tgg	p.R336W	HAO2_ENST00000482991.1_3'UTR|HAO2_ENST00000361035.4_Missense_Mutation_p.R349W	NM_001005783.1|NM_016527.2	NP_001005783.1|NP_057611.1	Q9NYQ3	HAOX2_HUMAN	hydroxyacid oxidase 2 (long chain)	336	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				fatty acid oxidation (GO:0019395)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)	p.R336W(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)		TTTAGGCTGCCGGTCGGTCGC	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											213.0	194.0	200.0					1																	119936413		2203	4300	6503	119737936	SO:0001583	missense	51179			AF231917	CCDS901.1	1p13.3-p13.1	2008-07-18			ENSG00000116882	ENSG00000116882	1.1.3.15		4810	protein-coding gene	gene with protein product	"""(S)-2-hydroxy-acid oxidase"", ""glycolate oxidase"", ""long-chain L-2-hydroxy acid oxidase"", ""growth-inhibiting protein 16"""	605176				10777549	Standard	XM_005270913		Approved	HAOX2, GIG16	uc001ehr.1	Q9NYQ3	OTTHUMG00000012410	ENST00000325945.3:c.1006C>T	1.37:g.119936413C>T	ENSP00000316339:p.Arg336Trp	Somatic		Capture	Illumina GAIIx	4	119737936	Q2TU86|Q5QP00|Q9UJS6	Missense_Mutation	SNP	superfamily_FMN-linked oxidoreductases,HMMPfam_FMN_dh,PatternScan_FMN_HYDROXY_ACID_DH_1	p.R336W	ENST00000325945.3	37	c.1006	CCDS901.1	1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.187497	0.38609	.	.	ENSG00000116882	ENST00000361035;ENST00000325945	T;T	0.33216	1.42;1.42	4.66	2.71	0.32032	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.384931	0.26673	N	0.023082	T	0.22475	0.0542	M	0.87547	2.89	0.49483	D	0.999795	P	0.35793	0.521	B	0.33254	0.16	T	0.06972	-1.0797	9	.	.	.	-9.7153	11.4768	0.50302	0.3256:0.6744:0.0:0.0	.	336	Q9NYQ3	HAOX2_HUMAN	W	349;336	ENSP00000354314:R349W;ENSP00000316339:R336W	.	R	+	1	2	HAO2	119737936	1.000000	0.71417	0.971000	0.41717	0.715000	0.41141	1.776000	0.38594	0.647000	0.30713	0.563000	0.77884	CGG	-	superfamily_FMN-linked oxidoreductases,HMMPfam_FMN_dh		0.483	HAO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HAO2	protein_coding	OTTHUMT00000034984.1	C	NM_001005783		119737936	+1	no_errors	NM_001005783	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
PTPRZ1	5803	genome.wustl.edu	37	7	121651696	121651696	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr7:121651696G>T	ENST00000393386.2	+	12	3007	c.2596G>T	c.(2596-2598)Gat>Tat	p.D866Y	PTPRZ1_ENST00000449182.1_Intron|PTPRZ1_ENST00000483028.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	866					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GGCTGGGGGTGATTTGCTATT	0.488																																																0			7											79.0	77.0	78.0					7																	121651696		2203	4300	6503	121438932	SO:0001583	missense	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.2596G>T	7.37:g.121651696G>T	ENSP00000377047:p.Asp866Tyr	Somatic		Capture	Illumina GAIIx	4	121438932	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	superfamily_Carbonic anhydrase,HMMPfam_Carb_anhydrase,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.D866Y	ENST00000393386.2	37	c.2596	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	G	12.50	1.956510	0.34565	.	.	ENSG00000106278	ENST00000393386	T	0.54479	0.57	5.71	4.82	0.62117	.	0.217021	0.40908	D	0.000994	T	0.54143	0.1840	M	0.67953	2.075	0.80722	D	1	P	0.45986	0.87	P	0.44732	0.459	T	0.59563	-0.7431	10	0.87932	D	0	.	10.134	0.42695	0.0711:0.138:0.7909:0.0	.	866	P23471	PTPRZ_HUMAN	Y	866	ENSP00000377047:D866Y	ENSP00000377047:D866Y	D	+	1	0	PTPRZ1	121438932	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	4.369000	0.59511	1.383000	0.46405	0.650000	0.86243	GAT	-	NULL		0.488	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	protein_coding	OTTHUMT00000347288.1	G	NM_002851		121438932	+1	no_errors	NM_002851	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
THOC2	57187	genome.wustl.edu	37	X	122866861	122866861	+	Silent	SNP	C	C	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chrX:122866861C>T	ENST00000245838.8	-	1	43	c.12G>A	c.(10-12)gcG>gcA	p.A4A	THOC2_ENST00000355725.4_Silent_p.A4A	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	4					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						CCACCACAGCCGCGGCCGCCA	0.637											OREG0003978|OREG0003979	type=REGULATORY REGION|Gene=BC041435|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=THOC2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			X											57.0	62.0	60.0					X																	122866861		1964	4133	6097	122694542	SO:0001819	synonymous_variant	57187			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.12G>A	X.37:g.122866861C>T		Somatic	1522	Capture	Illumina GAIIx	4	122694542	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Silent	SNP	NULL	p.A4	ENST00000245838.8	37	c.12	CCDS43988.1	X																																																																																			-	NULL		0.637	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	protein_coding	OTTHUMT00000058153.3	C			122694542	-1	no_errors	NM_001081550	genbank	human	validated	54_36p	silent	SNP	0.860	T
DTX3L	151636	genome.wustl.edu	37	3	122288593	122288593	+	Silent	SNP	C	C	T	rs201919153		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr3:122288593C>T	ENST00000296161.4	+	3	1846	c.1657C>T	c.(1657-1659)Ctg>Ttg	p.L553L	DTX3L_ENST00000383661.3_Intron	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	553					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		GGCCTCAGAACTGGACAAGAA	0.463																																																0			3											75.0	77.0	77.0					3																	122288593		2203	4300	6503	123771283	SO:0001819	synonymous_variant	151636				CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.1657C>T	3.37:g.122288593C>T		Somatic		Capture	Illumina GAIIx	4	123771283	B3KWH6|Q53ZZ3|Q5MJP7	Silent	SNP	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1	p.L553	ENST00000296161.4	37	c.1657	CCDS3015.1	3																																																																																			-	superfamily_SSF57850		0.463	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX3L	protein_coding	OTTHUMT00000355966.1	C	NM_138287		123771283	+1	no_errors	NM_138287	genbank	human	validated	54_36p	silent	SNP	0.000	T
TACC2	10579	genome.wustl.edu	37	10	123843832	123843832	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr10:123843832G>A	ENST00000369005.1	+	4	2157	c.1817G>A	c.(1816-1818)cGt>cAt	p.R606H	TACC2_ENST00000513429.1_Intron|TACC2_ENST00000515603.1_Missense_Mutation_p.R606H|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515273.1_Missense_Mutation_p.R606H|TACC2_ENST00000453444.2_Missense_Mutation_p.R606H|TACC2_ENST00000334433.3_Missense_Mutation_p.R606H	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	606					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				AGCAGCAAGCGTGATCCAGAA	0.572																																																0			10											70.0	66.0	67.0					10																	123843832		2203	4300	6503	123833822	SO:0001583	missense	10579			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.1817G>A	10.37:g.123843832G>A	ENSP00000358001:p.Arg606His	Somatic		Capture	Illumina GAIIx	4	123833822	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	HMMPfam_TACC	p.R606H	ENST00000369005.1	37	c.1817	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	G	11.52	1.662280	0.29515	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.03035	4.08;4.07;4.07;4.08;4.07	5.29	3.31	0.37934	.	0.733388	0.11267	N	0.581933	T	0.02533	0.0077	N	0.14661	0.345	0.09310	N	1	P;P;P	0.36616	0.561;0.561;0.561	B;B;B	0.24974	0.057;0.057;0.057	T	0.45862	-0.9232	10	0.72032	D	0.01	-0.3458	11.3784	0.49741	0.0:0.6235:0.3765:0.0	.	606;606;606	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	H	606;606;606;606;606;596	ENSP00000358001:R606H;ENSP00000424467:R606H;ENSP00000427618:R606H;ENSP00000334280:R606H;ENSP00000395048:R606H	ENSP00000334280:R606H	R	+	2	0	TACC2	123833822	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.150000	0.10189	1.233000	0.43693	-0.311000	0.09066	CGT	-	NULL		0.572	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	protein_coding	OTTHUMT00000090004.1	G			123833822	+1	no_errors	NM_206862	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
PSTK	118672	genome.wustl.edu	37	10	124740041	124740041	+	Silent	SNP	C	C	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr10:124740041C>A	ENST00000368887.3	+	1	486	c.46C>A	c.(46-48)Cgg>Agg	p.R16R	PSTK_ENST00000405485.1_Silent_p.R16R	NM_153336.2	NP_699167.2	Q8IV42	PSTK_HUMAN	phosphoseryl-tRNA kinase	16					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|tRNA binding (GO:0000049)			endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|skin(1)|stomach(2)	13		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)		CGACGGGCCGCGGAAACGAGG	0.692											OREG0020597	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			10											16.0	19.0	18.0					10																	124740041		2183	4275	6458	124730031	SO:0001819	synonymous_variant	118672			AK127173	CCDS7633.1	10q26.13	2007-04-17	2007-04-17	2007-04-17	ENSG00000179988	ENSG00000179988			28578	protein-coding gene	gene with protein product		611310	"""chromosome 10 open reading frame 89"""	C10orf89		15317934	Standard	NM_153336		Approved	MGC35392	uc001lgy.1	Q8IV42	OTTHUMG00000019191	ENST00000368887.3:c.46C>A	10.37:g.124740041C>A		Somatic	1536	Capture	Illumina GAIIx	4	124730031	Q6ZSS9	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_KTI12	p.R16	ENST00000368887.3	37	c.46	CCDS7633.1	10																																																																																			-	NULL		0.692	PSTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSTK	protein_coding	OTTHUMT00000050811.1	C	NM_153336		124730031	+1	no_errors	NM_153336	genbank	human	validated	54_36p	silent	SNP	0.000	A
PCDHB12	56124	genome.wustl.edu	37	5	140589344	140589344	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr5:140589344C>T	ENST00000239450.2	+	1	1054	c.865C>T	c.(865-867)Cgc>Tgc	p.R289C	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	289	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGAAGATATTCGCAAGACATT	0.408																																																0			5											92.0	99.0	96.0					5																	140589344		2203	4300	6503	140569528	SO:0001583	missense	56124			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.865C>T	5.37:g.140589344C>T	ENSP00000239450:p.Arg289Cys	Somatic		Capture	Illumina GAIIx	4	140569528	B4DDU1	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.R289C	ENST00000239450.2	37	c.865	CCDS4254.1	5	.	.	.	.	.	.	.	.	.	.	C	4.335	0.061489	0.08339	.	.	ENSG00000120328	ENST00000239450	T	0.01767	4.65	4.06	0.839	0.18907	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.03095	0.0091	M	0.79614	2.46	0.09310	N	1	B	0.14012	0.009	B	0.17979	0.02	T	0.32903	-0.9889	9	0.51188	T	0.08	.	5.5555	0.17113	0.1424:0.6354:0.1383:0.084	.	289	Q9Y5F1	PCDBC_HUMAN	C	289	ENSP00000239450:R289C	ENSP00000239450:R289C	R	+	1	0	PCDHB12	140569528	0.000000	0.05858	0.866000	0.34008	0.396000	0.30629	-2.117000	0.01326	0.283000	0.22279	0.491000	0.48974	CGC	-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.408	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	protein_coding	OTTHUMT00000251815.2	C	NM_018932		140569528	+1	no_errors	NM_018932	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
PCDHGB2	56103	genome.wustl.edu	37	5	140740782	140740782	+	Silent	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr5:140740782G>A	ENST00000522605.1	+	1	1080	c.1080G>A	c.(1078-1080)tcG>tcA	p.S360S	PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	360	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGAGGATTCGCCACCAGGAA	0.443																																																0			5											76.0	79.0	78.0					5																	140740782		2124	4257	6381	140720966	SO:0001819	synonymous_variant	56103			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1080G>A	5.37:g.140740782G>A		Somatic		Capture	Illumina GAIIx	4	140720966	Q3MIJ3|Q9UN65	Silent	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.S360	ENST00000522605.1	37	c.1080	CCDS54924.1	5																																																																																			-	superfamily_Cadherin-like,HMMPfam_Cadherin		0.443	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	protein_coding	OTTHUMT00000374741.1	G	NM_018923		140720966	+1	no_errors	NM_018923	genbank	human	reviewed	54_36p	silent	SNP	0.000	A
LRP1B	53353	genome.wustl.edu	37	2	141200193	141200193	+	Splice_Site	SNP	C	C	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr2:141200193C>T	ENST00000389484.3	-	66	11266		c.e66-1			NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B						protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGTTTTCAGCTTAGAAAGAA	0.358										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											0			2											82.0	84.0	84.0					2																	141200193		2203	4300	6503	140916663	SO:0001630	splice_region_variant	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10295-1G>A	2.37:g.141200193C>T		Somatic		Capture	Illumina GAIIx	4	140916663	Q8WY29|Q8WY30|Q8WY31	Splice_Site	SNP	-	e66-1	ENST00000389484.3	37	c.10295-1	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	28.0	4.886153	0.91814	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3366	0.94322	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP1B	140916663	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.463000	0.73530	2.551000	0.86045	0.650000	0.86243	.	-	-		0.358	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	C	NM_018557	Intron	140916663	-1	no_errors	NM_018557	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	C	C	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chrUnknown:0C>A								None (None upstream) : None (None downstream)																								0.0																																																0			X																																								148576986	SO:0001628	intergenic_variant	4110																															Unknown.37:g.0C>A		Somatic		Capture	Illumina GAIIx	4	148576986		Missense_Mutation	SNP	HMMPfam_MAGE	p.W91C		37	c.273		X																																																																																			-	NULL	0	0					MAGEA11			C			148576986	-1	no_errors	NM_005366	genbank	human	reviewed	54_36p	missense	SNP	0.008	A
NMUR2	56923	genome.wustl.edu	37	5	151784307	151784307	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr5:151784307G>A	ENST00000255262.3	-	1	533	c.368C>T	c.(367-369)aCg>aTg	p.T123M	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	123					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			AAAGAGGGCCGTCTTGAAGTA	0.602																																																0			5											73.0	77.0	75.0					5																	151784307		2203	4300	6503	151764500	SO:0001583	missense	56923			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.368C>T	5.37:g.151784307G>A	ENSP00000255262:p.Thr123Met	Somatic		Capture	Illumina GAIIx	4	151764500	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T123M	ENST00000255262.3	37	c.368	CCDS4321.1	5	.	.	.	.	.	.	.	.	.	.	G	25.6	4.654628	0.88056	.	.	ENSG00000132911	ENST00000255262	T	0.36340	1.26	5.54	5.54	0.83059	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.59797	0.2220	M	0.65320	2	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60281	-0.7294	10	0.62326	D	0.03	-14.1383	18.4906	0.90846	0.0:0.0:1.0:0.0	.	123	Q9GZQ4	NMUR2_HUMAN	M	123	ENSP00000255262:T123M	ENSP00000255262:T123M	T	-	2	0	NMUR2	151764500	1.000000	0.71417	0.956000	0.39512	0.968000	0.65278	9.507000	0.97996	2.607000	0.88179	0.655000	0.94253	ACG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.602	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR2	protein_coding	OTTHUMT00000252439.1	G	NM_020167		151764500	-1	no_errors	NM_020167	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
DPP6	1804	genome.wustl.edu	37	7	154561239	154561239	+	Silent	SNP	C	C	T	rs371237236		TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr7:154561239C>T	ENST00000377770.3	+	9	1137	c.996C>T	c.(994-996)acC>acT	p.T332T	DPP6_ENST00000332007.3_Silent_p.T270T|DPP6_ENST00000404039.1_Silent_p.T268T|DPP6_ENST00000427557.1_Silent_p.T225T			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	332					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CAACTTACACCGGCTCCATCT	0.547																																					NSCLC(125;1384 1783 2490 7422 34254)											0			7						C	,,	0,3976		0,0,1988	51.0	51.0	51.0		450,369,369	-10.6	0.1	7		51	1,8299		0,1,4149	no	coding-synonymous,coding-synonymous,coding-synonymous	DPP6	NM_001039350.1,NM_001936.3,NM_130797.2	,,	0,1,6137	TT,TC,CC		0.012,0.0,0.0081	,,	150/684,123/657,123/657	154561239	1,12275	1988	4150	6138	154192172	SO:0001819	synonymous_variant	1804			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.996C>T	7.37:g.154561239C>T		Somatic		Capture	Illumina GAIIx	4	154192172		Silent	SNP	superfamily_Dipeptidyl peptidase IV/CD26 N-terminal domain,HMMPfam_DPPIV_N,superfamily_alpha/beta-Hydrolases,HMMPfam_Peptidase_S9	p.T332	ENST00000377770.3	37	c.996		7																																																																																			-	superfamily_Dipeptidyl peptidase IV/CD26 N-terminal domain,HMMPfam_DPPIV_N		0.547	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	protein_coding	OTTHUMT00000322932.1	C	NM_130797		154192172	+1	no_errors	ENST00000252510	ensembl	human	known	54_36p	silent	SNP	0.667	T
NES	10763	genome.wustl.edu	37	1	156641684	156641684	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr1:156641684G>A	ENST00000368223.3	-	4	2428	c.2296C>T	c.(2296-2298)Cgg>Tgg	p.R766W		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	766	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGAGACCTCCGTCGCTGTTGA	0.448																																																0			1											85.0	86.0	86.0					1																	156641684		2203	4300	6503	154908308	SO:0001583	missense	10763			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.2296C>T	1.37:g.156641684G>A	ENSP00000357206:p.Arg766Trp	Somatic		Capture	Illumina GAIIx	4	154908308	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	HMMPfam_Filament,PatternScan_IF	p.R766W	ENST00000368223.3	37	c.2296	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.519812	0.27211	.	.	ENSG00000132688	ENST00000368223	D	0.85339	-1.97	4.85	-0.342	0.12635	.	.	.	.	.	T	0.45756	0.1358	N	0.08118	0	0.09310	N	1	P	0.39116	0.66	B	0.32805	0.153	T	0.44421	-0.9329	9	0.87932	D	0	.	4.528	0.11990	0.4513:0.164:0.3847:0.0	.	766	P48681	NEST_HUMAN	W	766	ENSP00000357206:R766W	ENSP00000357206:R766W	R	-	1	2	NES	154908308	0.000000	0.05858	0.001000	0.08648	0.181000	0.23173	-0.151000	0.10175	-0.029000	0.13827	0.563000	0.77884	CGG	-	NULL		0.448	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	protein_coding	OTTHUMT00000082844.2	G	NM_006617		154908308	-1	no_errors	NM_006617	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
SCAF8	22828	genome.wustl.edu	37	6	155145432	155145432	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr6:155145432C>G	ENST00000367178.3	+	17	2567	c.1991C>G	c.(1990-1992)cCg>cGg	p.P664R	SCAF8_ENST00000367186.4_Missense_Mutation_p.P730R|RNU6-824P_ENST00000363724.1_RNA|SCAF8_ENST00000417268.1_Missense_Mutation_p.P664R	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	664	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						GTGTCGATGCCGGTTCCTCCT	0.453																																																0			6											195.0	191.0	192.0					6																	155145432		2203	4300	6503	155187124	SO:0001583	missense	22828			AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.1991C>G	6.37:g.155145432C>G	ENSP00000356146:p.Pro664Arg	Somatic		Capture	Illumina GAIIx	4	155187124	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	superfamily_ENTH_VHS,HMMSmart_RPR,HMMPfam_DUF618,superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1	p.P664R	ENST00000367178.3	37	c.1991	CCDS5247.1	6	.	.	.	.	.	.	.	.	.	.	C	20.9	4.059155	0.76074	.	.	ENSG00000213079	ENST00000367178;ENST00000417268;ENST00000367186	T;T;T	0.53640	0.64;0.64;0.61	5.27	5.27	0.74061	.	0.379178	0.24917	U	0.034574	T	0.26521	0.0648	N	0.08118	0	0.36123	D	0.845599	B;D;D;D	0.60160	0.389;0.961;0.987;0.961	B;P;P;P	0.52424	0.084;0.579;0.698;0.579	T	0.08576	-1.0715	10	0.15066	T	0.55	.	18.8836	0.92367	0.0:1.0:0.0:0.0	.	709;730;742;664	B7Z876;B7Z888;B7Z3A4;Q9UPN6	.;.;.;SCAF8_HUMAN	R	664;664;730	ENSP00000356146:P664R;ENSP00000413098:P664R;ENSP00000356154:P730R	ENSP00000356146:P664R	P	+	2	0	SCAF8	155187124	1.000000	0.71417	0.941000	0.38009	0.964000	0.63967	5.660000	0.68018	2.454000	0.82982	0.650000	0.86243	CCG	-	NULL		0.453	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM16	protein_coding	OTTHUMT00000042798.1	C	NM_014892		155187124	+1	no_errors	NM_014892	genbank	human	validated	54_36p	missense	SNP	0.967	G
SCN3A	6328	genome.wustl.edu	37	2	166011145	166011145	+	Silent	SNP	T	T	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr2:166011145T>A	ENST00000360093.3	-	11	1688	c.1197A>T	c.(1195-1197)acA>acT	p.T399T	SCN3A_ENST00000283254.7_Silent_p.T399T|SCN3A_ENST00000409101.3_Silent_p.T399T	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	399					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATATCATGTATGTTTTCCCAG	0.403																																																0			2											62.0	62.0	62.0					2																	166011145		2203	4300	6503	165719391	SO:0001819	synonymous_variant	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1197A>T	2.37:g.166011145T>A		Somatic		Capture	Illumina GAIIx	4	165719391	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,HMMSmart_IQ,HMMPfam_IQ	p.T399	ENST00000360093.3	37	c.1197		2																																																																																			-	superfamily_SSF81324,HMMPfam_Ion_trans		0.403	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	protein_coding		T	NM_006922		165719391	-1	no_errors	NM_006922	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
TTLL2	83887	genome.wustl.edu	37	6	167753659	167753659	+	Missense_Mutation	SNP	G	G	A	rs140657695	byFrequency	TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr6:167753659G>A	ENST00000239587.5	+	3	359	c.271G>A	c.(271-273)Gtt>Att	p.V91I		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	91	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)	p.V91I(2)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GGTTTTTCGCGTTGACGAGAC	0.512													G|||	3	0.000599042	0.0023	0.0	5008	,	,		19944	0.0		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	large_intestine(1)|lung(1)	6						G	ILE/VAL	3,4403	6.2+/-15.9	0,3,2200	53.0	54.0	53.0		271	1.5	0.0	6	dbSNP_134	53	0,8600		0,0,4300	yes	missense	TTLL2	NM_031949.4	29	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	91/593	167753659	3,13003	2203	4300	6503	167673649	SO:0001583	missense	83887			AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.271G>A	6.37:g.167753659G>A	ENSP00000239587:p.Val91Ile	Somatic		Capture	Illumina GAIIx	4	167673649	B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	HMMPfam_TTL,superfamily_Glutathione synthetase ATP-binding domain-like	p.V91I	ENST00000239587.5	37	c.271	CCDS5301.1	6	.	.	.	.	.	.	.	.	.	.	G	4.623	0.115827	0.08831	6.81E-4	0.0	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.02472	4.28	3.37	1.46	0.22682	.	0.760646	0.11193	N	0.589623	T	0.00608	0.0020	L	0.41415	1.275	0.09310	N	1	P	0.40107	0.703	B	0.23716	0.048	T	0.48927	-0.8991	10	0.33940	T	0.23	.	2.4826	0.04591	0.1111:0.3068:0.4117:0.1704	.	91	Q9BWV7	TTLL2_HUMAN	I	91;18	ENSP00000239587:V91I	ENSP00000239587:V91I	V	+	1	0	TTLL2	167673649	0.046000	0.20272	0.000000	0.03702	0.006000	0.05464	1.637000	0.37155	0.218000	0.20820	0.484000	0.47621	GTT	-	NULL		0.512	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL2	protein_coding	OTTHUMT00000043127.3	G	NM_031949		167673649	+1	no_errors	NM_031949	genbank	human	validated	54_36p	missense	SNP	0.002	A
ADAMTS2	9509	genome.wustl.edu	37	5	178579154	178579154	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr5:178579154C>A	ENST00000251582.7	-	10	1719	c.1618G>T	c.(1618-1620)Gca>Tca	p.A540S	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.A540S	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	540	Disintegrin.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TTGCCAGGTGCACACATAGTC	0.612																																																0			5											57.0	53.0	54.0					5																	178579154		2203	4300	6503	178511760	SO:0001583	missense	9509			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1618G>T	5.37:g.178579154C>A	ENSP00000251582:p.Ala540Ser	Somatic		Capture	Illumina GAIIx	4	178511760		Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1"	p.A540S	ENST00000251582.7	37	c.1618	CCDS4444.1	5	.	.	.	.	.	.	.	.	.	.	C	9.842	1.191377	0.21954	.	.	ENSG00000087116	ENST00000251582;ENST00000274609	T;T	0.59772	0.27;0.24	5.35	4.47	0.54385	.	0.000000	0.56097	D	0.000031	T	0.43010	0.1228	L	0.28458	0.855	0.37204	D	0.9045	P;B	0.36683	0.565;0.163	B;B	0.34385	0.181;0.069	T	0.50808	-0.8784	10	0.45353	T	0.12	.	10.3029	0.43663	0.1527:0.7001:0.1471:0.0	.	540;540	O95450-2;O95450	.;ATS2_HUMAN	S	540	ENSP00000251582:A540S;ENSP00000274609:A540S	ENSP00000251582:A540S	A	-	1	0	ADAMTS2	178511760	1.000000	0.71417	0.996000	0.52242	0.005000	0.04900	2.460000	0.45031	1.244000	0.43870	-0.314000	0.08810	GCA	-	NULL		0.612	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	protein_coding	OTTHUMT00000253507.1	C	NM_014244		178511760	-1	no_errors	NM_014244	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
MUC20	200958	genome.wustl.edu	37	3	195453036	195453036	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr3:195453036C>T	ENST00000447234.2	+	2	1688	c.1562C>T	c.(1561-1563)gCt>gTt	p.A521V	MUC20_ENST00000445522.2_Missense_Mutation_p.A486V|MUC20_ENST00000436408.1_Missense_Mutation_p.A521V|MUC20_ENST00000320736.6_Missense_Mutation_p.A350V	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	521	Involved in oligomerization.		Missing. {ECO:0000269|PubMed:14702039}.		activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CTCAGTGGAGCTCTGGTCACA	0.572																																																0			3											58.0	57.0	57.0					3																	195453036		2105	4209	6314	196938707	SO:0001583	missense	200958			AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1562C>T	3.37:g.195453036C>T	ENSP00000414350:p.Ala521Val	Somatic		Capture	Illumina GAIIx	4	196938707	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	NULL	p.A350V	ENST00000447234.2	37	c.1049		3	.	.	.	.	.	.	.	.	.	.	C	13.54	2.266659	0.40095	.	.	ENSG00000176945	ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	T;T;T;T	0.14893	2.89;2.89;3.06;2.47	3.97	-0.0788	0.13713	.	0.452872	0.18875	N	0.128738	T	0.06416	0.0165	N	0.08118	0	0.09310	N	1	B	0.24426	0.103	B	0.25140	0.058	T	0.29852	-0.9998	10	0.29301	T	0.29	3.025	2.8327	0.05505	0.2223:0.5111:0.1661:0.1005	.	350	E9PH32	.	V	521;350;521;486	ENSP00000414350:A521V;ENSP00000325431:A350V;ENSP00000396774:A521V;ENSP00000405629:A486V	ENSP00000325431:A350V	A	+	2	0	MUC20	196938707	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.053000	0.11846	-0.136000	0.11475	-0.346000	0.07831	GCT	-	NULL		0.572	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	MUC20	protein_coding	OTTHUMT00000341835.1	C	NM_152673		196938707	+1	no_errors	NM_152673	genbank	human	reviewed	54_36p	missense	SNP	0.001	T
TRAK2	66008	genome.wustl.edu	37	2	202262943	202262943	+	Silent	SNP	T	T	C			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr2:202262943T>C	ENST00000332624.3	-	6	1043	c.615A>G	c.(613-615)caA>caG	p.Q205Q	TRAK2_ENST00000430254.1_Silent_p.Q205Q	NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	205	HAP1 N-terminal.				protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						GCAGCAACCCTTGAGATAAGC	0.423																																																0			2											125.0	124.0	124.0					2																	202262943		2203	4300	6503	201971188	SO:0001819	synonymous_variant	66008			AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.615A>G	2.37:g.202262943T>C		Somatic		Capture	Illumina GAIIx	4	201971188	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Silent	SNP	HMMPfam_HAP1_N	p.Q205	ENST00000332624.3	37	c.615	CCDS2347.1	2																																																																																			-	HMMPfam_HAP1_N		0.423	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAK2	protein_coding	OTTHUMT00000256284.3	T	NM_015049		201971188	-1	no_errors	NM_015049	genbank	human	validated	54_36p	silent	SNP	0.987	C
OR2L5	81466	genome.wustl.edu	37	1	248185582	248185582	+	Silent	SNP	G	G	A	rs150668862	byFrequency	TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr1:248185582G>A	ENST00000355281.1	+	1	333	c.333G>A	c.(331-333)gcG>gcA	p.A111A	OR2L13_ENST00000366478.2_Intron	NM_001258284.1	NP_001245213.1	Q8NG80	OR2L5_HUMAN	olfactory receptor, family 2, subfamily L, member 5	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										GTGCAGAAGCGCTGCTCCTGA	0.433													g|||	8	0.00159744	0.0061	0.0	5008	,	,		22268	0.0		0.0	False		,,,				2504	0.0															0			1																																								246252205	SO:0001819	synonymous_variant	0				CCDS58068.1	1q44	2012-08-09		2004-03-10	ENSG00000197454	ENSG00000197454		"""GPCR / Class A : Olfactory receptors"""	15011	protein-coding gene	gene with protein product				OR2L11, OR2L5P			Standard	NM_001258284		Approved		uc031psy.1	Q8NG80	OTTHUMG00000040194	ENST00000355281.1:c.333G>A	1.37:g.248185582G>A		Somatic		Capture	Illumina GAIIx	4	246252205	Q6IF04	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A111	ENST00000355281.1	37	c.333	CCDS58068.1	1																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1		0.433	OR2L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L5	protein_coding	OTTHUMT00000096851.1	G			246252205	+1	no_errors	ENST00000355281	ensembl	human	known	54_36p	silent	SNP	0.000	A
FAT3	120114	genome.wustl.edu	37	11	92534605	92534607	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	ACA	ACA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr11:92534605_92534607delACA	ENST00000298047.6	+	9	8443_8445	c.8426_8428delACA	c.(8425-8430)gacaac>gac	p.N2810del	FAT3_ENST00000409404.2_In_Frame_Del_p.N2810del|FAT3_ENST00000525166.1_In_Frame_Del_p.N2660del			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2810	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GATTTGAATGACAACAAGCCAGT	0.419										TCGA Ovarian(4;0.039)																																						0			11																																								92174255	SO:0001651	inframe_deletion	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8426_8428delACA	11.37:g.92534608_92534610delACA	ENSP00000298047:p.Asn2810del	Somatic		Capture	Illumina GAIIx	4	92174253	B5MDB0|Q96AU6	In_Frame_Del	DEL	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Concanavalin A-like lectins/glucanases,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00179,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2	p.N2810in_frame_del	ENST00000298047.6	37	c.8426_8428		11																																																																																			(deletion:cds_exon[92170650,92174723])	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Cadherin-like		0.419	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		ACA	NM_001008781		92174255	+1	no_errors	NM_001008781	genbank	human	validated	54_36p	in_frame_del	DEL	1.000:1.000:1.000	-
CCDC67	159989	genome.wustl.edu	37	11	93127699	93127699	+	Frame_Shift_Del	DEL	C	C	-			TCGA-04-1652-01A-01W-0639-09	TCGA-04-1652-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8edb3a01-22e3-4671-8685-75f08d7af0d5	1bfaaa95-191e-4fa6-ae9f-1e11b4285f5c	g.chr11:93127699delC	ENST00000298050.3	+	10	1216	c.1116delC	c.(1114-1116)gacfs	p.D372fs	CCDC67_ENST00000525646.1_Frame_Shift_Del_p.D114fs	NM_181645.3	NP_857596.2	Q05D60	DEUP1_HUMAN	coiled-coil domain containing 67	372					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)	cytoplasm (GO:0005737)|deuterosome (GO:0098536)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				AAATCTCTGACCTAACAGAAG	0.393																																																0			11											71.0	64.0	66.0					11																	93127699		1870	4090	5960	92767347	SO:0001589	frameshift_variant	159989			AK058122	CCDS44707.1	11q21	2014-02-20				ENSG00000165325			26344	protein-coding gene	gene with protein product						24240477	Standard	NM_181645		Approved	FLJ25393	uc001pdq.3	Q05D60		ENST00000298050.3:c.1116delC	11.37:g.93127699delC	ENSP00000298050:p.Asp372fs	Somatic		Capture	Illumina GAIIx	4	92767347	Q8NEF1|Q96LL7	Frame_Shift_Del	DEL	NULL	p.L373fs	ENST00000298050.3	37	c.1116	CCDS44707.1	11																																																																																			(deletion:cds_exon[92767273,92767470])	NULL		0.393	CCDC67-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC67	protein_coding		C	NM_181645		92767347	+1	no_errors	NM_181645	genbank	human	validated	54_36p	frame_shift_del	DEL	0.999	-
