#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PRAMEF4	400735	genome.wustl.edu	37	1	12942207	12942207	+	Missense_Mutation	SNP	A	A	G			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr1:12942207A>G	ENST00000235349.5	-	3	413	c.343T>C	c.(343-345)Tgg>Cgg	p.W115R		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	115					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.W115R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CAAACCATCCAGAAGTTCTCA	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											19.0	25.0	23.0					1																	12942207		1277	2427	3704	12864794	SO:0001583	missense	400735				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.343T>C	1.37:g.12942207A>G	ENSP00000235349:p.Trp115Arg	Somatic		Capture	Illumina GAIIx	4	12864794	Q5LJB5	Missense_Mutation	SNP	-	p.W115R	ENST00000235349.5	37	c.343	CCDS30592.1	1	.	.	.	.	.	.	.	.	.	.	a	11.91	1.781073	0.31502	.	.	ENSG00000243073	ENST00000235349	T	0.04862	3.54	1.48	1.48	0.22813	.	0.155196	0.45606	D	0.000357	T	0.21550	0.0519	M	0.87900	2.915	0.22728	N	0.998806	D	0.76494	0.999	D	0.72075	0.976	T	0.01858	-1.1259	10	0.66056	D	0.02	.	5.1316	0.14913	1.0:0.0:0.0:0.0	.	115	O60810	PRAM4_HUMAN	R	115	ENSP00000235349:W115R	ENSP00000235349:W115R	W	-	1	0	PRAMEF4	12864794	0.184000	0.23200	0.520000	0.27837	0.065000	0.16274	0.382000	0.20635	0.939000	0.37446	0.329000	0.21502	TGG	-	NULL		0.478	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	protein_coding	OTTHUMT00000005518.1	A	NM_001009611		12864794	-1	no_errors	NM_001009611	genbank	human	validated	54_36p	missense	SNP	0.09	G
APH1A	51107	genome.wustl.edu	37	1	150240405	150240405	+	Missense_Mutation	SNP	G	G	C			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr1:150240405G>C	ENST00000369109.3	-	2	424	c.236C>G	c.(235-237)tCt>tGt	p.S79C	APH1A_ENST00000461320.1_Intron|APH1A_ENST00000414276.2_Intron|C1orf54_ENST00000369102.1_5'Flank|APH1A_ENST00000360244.4_Missense_Mutation_p.S79C	NM_001077628.2	NP_001071096.1	Q96BI3	APH1A_HUMAN	APH1A gamma secretase subunit	79					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|metanephros development (GO:0001656)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)	p.S79C(1)		breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TAGAAGGACAGAGACAGCAGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											92.0	99.0	96.0					1																	150240405		1980	4156	6136	148507029	SO:0001583	missense	51107			AF151835	CCDS41390.1, CCDS41391.1, CCDS58025.1	1q21.2	2013-05-01	2013-05-01		ENSG00000117362	ENSG00000117362			29509	protein-coding gene	gene with protein product		607629	"""anterior pharynx defective 1 homolog A (C. elegans)"""			10810093, 12110170	Standard	NM_001077628		Approved	APH-1A, CGI-78	uc001ety.2	Q96BI3	OTTHUMG00000012545	ENST00000369109.3:c.236C>G	1.37:g.150240405G>C	ENSP00000358105:p.Ser79Cys	Somatic		Capture	Illumina GAIIx	4	148507029	B4DQK0|Q5TB22|Q5TB23|Q969R6|Q9BVG0|Q9Y386	Missense_Mutation	SNP	-	p.S79C	ENST00000369109.3	37	c.236	CCDS41390.1	1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315611	0.81469	.	.	ENSG00000117362	ENST00000369109;ENST00000360244	T;T	0.56275	0.47;0.47	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.64649	0.2617	M	0.66297	2.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.992;0.995;0.998	T	0.64905	-0.6297	10	0.49607	T	0.09	-7.0833	15.8372	0.78808	0.0:0.0:1.0:0.0	.	79;79;79	Q96BI3-2;Q5TB22;Q96BI3	.;.;APH1A_HUMAN	C	79	ENSP00000358105:S79C;ENSP00000353380:S79C	ENSP00000353380:S79C	S	-	2	0	APH1A	148507029	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.540000	0.98080	2.586000	0.87340	0.591000	0.81541	TCT	-	NULL		0.557	APH1A-002	KNOWN	basic|CCDS	protein_coding	APH1A	protein_coding	OTTHUMT00000035048.1	G	NM_016022		148507029	-1	no_errors	NM_001077628	genbank	human	validated	54_36p	missense	SNP	1	C
ENO1	2023	genome.wustl.edu	37	1	8924018	8924018	+	Silent	SNP	G	G	A	rs146867004		TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr1:8924018G>A	ENST00000234590.4	-	9	1118	c.999C>T	c.(997-999)aaC>aaT	p.N333N		NM_001428.3	NP_001419.1	P06733	ENOA_HUMAN	enolase 1, (alpha)	333					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.N333N(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	10	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.42e-07)|COAD - Colon adenocarcinoma(227;2.78e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		AGGACTTCTCGTTCACGGCCT	0.567																																					Esophageal Squamous(21;302 608 19946 22210 33560)											1	Substitution - coding silent(1)	ovary(1)	1						G	,	0,4406		0,0,2203	281.0	254.0	263.0		720,999	-11.0	0.0	1	dbSNP_134	263	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ENO1	NM_001201483.1,NM_001428.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	240/342,333/435	8924018	1,13005	2203	4300	6503	8846605	SO:0001819	synonymous_variant	2023			BC022545	CCDS97.1	1p36.2	2010-03-11			ENSG00000074800	ENSG00000074800	4.2.1.11		3350	protein-coding gene	gene with protein product		172430		ENO1L1, MPB1		9653645, 9691177	Standard	NM_001428		Approved	PPH, MBP-1	uc001apj.2	P06733	OTTHUMG00000001773	ENST00000234590.4:c.999C>T	1.37:g.8924018G>A		Somatic		Capture	Illumina GAIIx	4	8846605	B2RD59|P22712|Q16704|Q4TUS4|Q53FT9|Q53HR3|Q658M5|Q6GMP2|Q71V37|Q7Z3V6|Q8WU71|Q96GV1|Q9BT62|Q9UCH6|Q9UM55	Silent	SNP	HMMPfam_Enolase_C;HMMPfam_Enolase_N;superfamily_Enolase C-terminal domain-like;superfamily_Enolase N-terminal domain-like	p.N333	ENST00000234590.4	37	c.999	CCDS97.1	1																																																																																			-	HMMPfam_Enolase_C		0.567	ENO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO1	protein_coding	OTTHUMT00000004945.1	G	NM_001428		8846605	-1	no_errors	NM_001428	genbank	human	reviewed	54_36p	silent	SNP		A
SZT2	23334	genome.wustl.edu	37	1	43891607	43891607	+	Silent	SNP	G	G	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr1:43891607G>A	ENST00000562955.1	+	20	2916	c.2916G>A	c.(2914-2916)ccG>ccA	p.P972P	SZT2_ENST00000372442.1_Silent_p.P130P	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	972					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)		p.P130P(2)		NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CCCCAGAGCCGAGGGTCTCTG	0.602																																																2	Substitution - coding silent(2)	ovary(2)	1											64.0	65.0	64.0					1																	43891607		2203	4300	6503	43664194	SO:0001819	synonymous_variant	23334			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.2916G>A	1.37:g.43891607G>A		Somatic		Capture	Illumina GAIIx	4	43664194	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Silent	SNP	-	p.P130	ENST00000562955.1	37	c.390	CCDS30694.2	1																																																																																			-	NULL		0.602	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0467	protein_coding	OTTHUMT00000019517.3	G	NM_015284		43664194	1	no_errors	NM_015284	genbank	human	predicted	54_36p	silent	SNP		A
ZFYVE9	9372	genome.wustl.edu	37	1	52811830	52811830	+	Missense_Mutation	SNP	C	C	G			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr1:52811830C>G	ENST00000371591.1	+	18	4346	c.4215C>G	c.(4213-4215)tgC>tgG	p.C1405W	ZFYVE9_ENST00000357206.2_Missense_Mutation_p.C1346W|ZFYVE9_ENST00000287727.3_Missense_Mutation_p.C1405W	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	1405					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)	p.C1405W(1)|p.C1405C(1)		breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						GAGGGGCCTGCCAGCTTAGTG	0.493																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|endometrium(1)	1											84.0	83.0	83.0					1																	52811830		2203	4300	6503	52584418	SO:0001583	missense	9372			AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.4215C>G	1.37:g.52811830C>G	ENSP00000360647:p.Cys1405Trp	Somatic		Capture	Illumina GAIIx	4	52584418	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	HMMPfam_FYVE;superfamily_FYVE/PHD zinc finger	p.C1405W	ENST00000371591.1	37	c.4215	CCDS563.1	1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.085453	0.55861	.	.	ENSG00000157077	ENST00000357206;ENST00000287727;ENST00000371591	T;T;T	0.39787	1.13;1.06;1.06	4.78	2.87	0.33458	.	0.047227	0.85682	D	0.000000	T	0.53077	0.1774	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.78314	0.991;0.981	T	0.54583	-0.8272	10	0.72032	D	0.01	.	9.8336	0.40956	0.0:0.7603:0.0:0.2397	.	1346;1405	O95405-2;O95405	.;ZFYV9_HUMAN	W	1346;1405;1405	ENSP00000349737:C1346W;ENSP00000287727:C1405W;ENSP00000360647:C1405W	ENSP00000287727:C1405W	C	+	3	2	ZFYVE9	52584418	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.865000	0.39479	1.235000	0.43724	0.655000	0.94253	TGC	-	NULL		0.493	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE9	protein_coding	OTTHUMT00000022083.1	C	NM_007324		52584418	1	no_errors	NM_004799	genbank	human	reviewed	54_36p	missense	SNP	1	G
HRNR	388697	genome.wustl.edu	37	1	152186837	152186837	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr1:152186837C>T	ENST00000368801.2	-	3	7343	c.7268G>A	c.(7267-7269)cGa>cAa	p.R2423Q	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2423					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R2423Q(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGACCCATGTCGGCCACGGCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											1.0	1.0	1.0					1																	152186837		251	755	1006	150453461	SO:0001583	missense	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.7268G>A	1.37:g.152186837C>T	ENSP00000357791:p.Arg2423Gln	Somatic		Capture	Illumina GAIIx	4	150453461	Q5DT20|Q5U1F4	Missense_Mutation	SNP	-	p.R2423Q	ENST00000368801.2	37	c.7268	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	-	6.285	0.420671	0.11928	.	.	ENSG00000197915	ENST00000368801	T	0.02974	4.09	2.94	-5.88	0.02290	.	.	.	.	.	T	0.00328	0.0010	N	0.03115	-0.41	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.45293	-0.9271	9	0.10636	T	0.68	.	7.9897	0.30233	0.1213:0.2056:0.0:0.673	.	2423	Q86YZ3	HORN_HUMAN	Q	2423	ENSP00000357791:R2423Q	ENSP00000357791:R2423Q	R	-	2	0	HRNR	150453461	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.624000	0.02038	-2.325000	0.00638	-0.762000	0.03455	CGA	-	NULL		0.612	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	protein_coding	OTTHUMT00000034016.1	C	XM_373868		150453461	-1	no_errors	NM_001009931	genbank	human	validated	54_36p	missense	SNP	0	T
LGI1	9211	genome.wustl.edu	37	10	95553059	95553059	+	Missense_Mutation	SNP	G	G	C			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr10:95553059G>C	ENST00000371418.4	+	7	1050	c.790G>C	c.(790-792)Gaa>Caa	p.E264Q	LGI1_ENST00000542308.1_Missense_Mutation_p.E216Q|LGI1_ENST00000371413.3_Missense_Mutation_p.E264Q	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	264					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)	p.E264Q(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				CATTTTCCTTGAATGGGACCA	0.368																																																1	Substitution - Missense(1)	ovary(1)	10											131.0	123.0	126.0					10																	95553059		2203	4300	6503	95543049	SO:0001583	missense	9211			AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.790G>C	10.37:g.95553059G>C	ENSP00000360472:p.Glu264Gln	Somatic		Capture	Illumina GAIIx	4	95543049	A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	HMMPfam_LRRCT;HMMPfam_LRR_1;HMMPfam_EPTP;superfamily_L domain-like	p.E264Q	ENST00000371418.4	37	c.790	CCDS7431.1	10	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845838	0.51164	.	.	ENSG00000108231	ENST00000542308;ENST00000371418;ENST00000371413	T;T;T	0.79749	-1.3;-1.3;-1.3	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.75027	0.3794	L	0.52011	1.625	0.80722	D	1	P;B;B	0.35628	0.513;0.138;0.167	B;B;B	0.32533	0.147;0.049;0.117	T	0.72693	-0.4216	10	0.28530	T	0.3	-16.0368	15.8221	0.78662	0.0:0.1357:0.8643:0.0	.	216;264;264	O95970-3;O95970-2;O95970	.;.;LGI1_HUMAN	Q	216;264;264	ENSP00000440763:E216Q;ENSP00000360472:E264Q;ENSP00000360467:E264Q	ENSP00000360467:E264Q	E	+	1	0	LGI1	95543049	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.723000	0.84788	2.835000	0.97688	0.650000	0.86243	GAA	-	HMMPfam_EPTP		0.368	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI1	protein_coding	OTTHUMT00000049445.1	G	NM_005097		95543049	1	no_errors	NM_005097	genbank	human	reviewed	54_36p	missense	SNP	1	C
MYO7A	4647	genome.wustl.edu	37	11	76870560	76870560	+	Silent	SNP	C	C	G			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr11:76870560C>G	ENST00000409709.3	+	10	1343	c.1071C>G	c.(1069-1071)tcC>tcG	p.S357S	MYO7A_ENST00000409619.2_Silent_p.S346S|MYO7A_ENST00000458637.2_Silent_p.S357S|MYO7A_ENST00000409893.1_Silent_p.S357S	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	357	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)	p.S357S(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CAGCTGCATCCCTGCTTGAGG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	11											85.0	88.0	87.0					11																	76870560		2033	4202	6235	76548208	SO:0001819	synonymous_variant	4647			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.1071C>G	11.37:g.76870560C>G		Somatic		Capture	Illumina GAIIx	4	76548208	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	-	p.S357	ENST00000409709.3	37	c.1071	CCDS53683.1	11																																																																																			-	NULL		0.567	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	protein_coding	OTTHUMT00000328133.1	C	NM_000260		76548208	1	no_errors	NM_000260	genbank	human	reviewed	54_36p	silent	SNP	0.3	G
ADAMTS20	80070	genome.wustl.edu	37	12	43817683	43817683	+	Missense_Mutation	SNP	C	C	G			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr12:43817683C>G	ENST00000553158.1	-	29	4328	c.4329G>C	c.(4327-4329)ttG>ttC	p.L1443F	ADAMTS20_ENST00000395541.2_Missense_Mutation_p.L561F|ADAMTS20_ENST00000389420.3_Intron			P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	0	TSP type-1 11. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TTAGTTCCCACAAGATGATGG	0.338																																																0			12											11.0	11.0	11.0					12																	43817683		872	1984	2856	42103950	SO:0001583	missense	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000553158.1:c.4329G>C	12.37:g.43817683C>G	ENSP00000448341:p.Leu1443Phe	Somatic		Capture	Illumina GAIIx	4	42103950	A6NNC9|J3QT00	Missense_Mutation	SNP	-	p.L1444F	ENST00000553158.1	37	c.4332		12	.	.	.	.	.	.	.	.	.	.	C	10.13	1.264766	0.23136	.	.	ENSG00000173157	ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T	0.62498	0.03;0.02;0.02	4.5	-3.81	0.04294	.	.	.	.	.	T	0.39886	0.1095	.	.	.	0.09310	N	1	B	0.28178	0.202	B	0.24848	0.056	T	0.20107	-1.0285	8	0.41790	T	0.15	.	1.8853	0.03237	0.1381:0.2653:0.3675:0.2291	.	561	E9PBD5	.	F	573;561;1443;1443	ENSP00000447427:L573F;ENSP00000378911:L561F;ENSP00000448341:L1443F	ENSP00000374068:L1443F	L	-	3	2	ADAMTS20	42103950	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.592000	0.05747	-0.964000	0.03595	0.591000	0.81541	TTG	-	NULL		0.338	ADAMTS20-002	KNOWN	basic	protein_coding	ADAMTS20	protein_coding	OTTHUMT00000403645.1	C	NM_025003		42103950	-1	no_errors	ENST00000389417	ensembl	human	known	54_36p	missense	SNP		G
PABPN1	8106	genome.wustl.edu	37	14	23791502	23791502	+	Missense_Mutation	SNP	A	A	G			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr14:23791502A>G	ENST00000216727.4	+	2	645	c.464A>G	c.(463-465)aAt>aGt	p.N155S	PABPN1_ENST00000397276.2_Missense_Mutation_p.N155S|PABPN1_ENST00000557702.1_Missense_Mutation_p.N27S|PABPN1_ENST00000556821.1_Missense_Mutation_p.N27S|AL049829.1_ENST00000594872.1_5'Flank|BCL2L2-PABPN1_ENST00000553781.1_Missense_Mutation_p.N182S|BCL2L2-PABPN1_ENST00000557008.1_Missense_Mutation_p.N182S	NM_004643.3	NP_004634.1	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	155	Necessary for homooligomerization.				gene expression (GO:0010467)|modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|muscle contraction (GO:0006936)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.N155S(1)		large_intestine(1)|lung(1)|ovary(2)	4	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)		CCTCCAGGCAATGGTGAGTAA	0.552																																																1	Substitution - Missense(1)	ovary(1)	14											47.0	39.0	42.0					14																	23791502		2203	4300	6503	22861342	SO:0001583	missense	8106			AF026029	CCDS9592.1	14q11.2	2013-02-12	2001-11-28		ENSG00000100836	ENSG00000100836		"""RNA binding motif (RRM) containing"""	8565	protein-coding gene	gene with protein product		602279	"""poly(A)-binding protein, nuclear 1"""	OPMD, PABP2		7795598	Standard	NM_004643		Approved	PAB2		Q86U42	OTTHUMG00000028739	ENST00000216727.4:c.464A>G	14.37:g.23791502A>G	ENSP00000216727:p.Asn155Ser	Somatic		Capture	Illumina GAIIx	4	22861342	D3DS49|O43484	Missense_Mutation	SNP	-	p.N155S	ENST00000216727.4	37	c.464	CCDS9592.1	14	.	.	.	.	.	.	.	.	.	.	A	7.684	0.689606	0.14973	.	.	ENSG00000258643;ENSG00000258643;ENSG00000100836;ENSG00000100836;ENSG00000100836;ENSG00000100836	ENST00000553781;ENST00000557008;ENST00000216727;ENST00000397276;ENST00000556821;ENST00000557702	T;T;T;T;T;T	0.54479	2.98;2.98;0.57;0.99;2.31;2.32	5.2	5.2	0.72013	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.64402	D	0.000006	T	0.28699	0.0711	N	0.10972	0.075	0.40485	D	0.980481	B;B;P	0.34743	0.021;0.012;0.466	B;B;B	0.29353	0.009;0.02;0.101	T	0.23048	-1.0199	10	0.07482	T	0.82	-10.3516	14.3316	0.66561	1.0:0.0:0.0:0.0	.	155;155;182	Q86U42;Q86U42-2;G3V5R7	PABP2_HUMAN;.;.	S	182;182;155;155;27;27	ENSP00000451320:N182S;ENSP00000452479:N182S;ENSP00000216727:N155S;ENSP00000380446:N155S;ENSP00000451970:N27S;ENSP00000450724:N27S	ENSP00000216727:N155S	N	+	2	0	PABPN1;RP11-124D2.2	22861342	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.493000	0.66899	2.084000	0.62774	0.459000	0.35465	AAT	-	NULL		0.552	PABPN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PABPN1	protein_coding	OTTHUMT00000071767.4	A	NM_004643		22861342	1	no_errors	NM_004643	genbank	human	reviewed	54_36p	missense	SNP	1	G
CPSF2	53981	genome.wustl.edu	37	14	92628044	92628044	+	Missense_Mutation	SNP	T	T	G			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr14:92628044T>G	ENST00000298875.4	+	16	2590	c.2305T>G	c.(2305-2307)Tat>Gat	p.Y769D		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	769					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)	p.Y769D(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		TCAAGATTTTTATAGGATAAG	0.313																																					Ovarian(78;28 1788 18702 44111)											1	Substitution - Missense(1)	ovary(1)	14											72.0	70.0	71.0					14																	92628044		2203	4298	6501	91697797	SO:0001583	missense	53981			AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.2305T>G	14.37:g.92628044T>G	ENSP00000298875:p.Tyr769Asp	Somatic		Capture	Illumina GAIIx	4	91697797	B3KME1|Q6NSJ1|Q9H3W7	Missense_Mutation	SNP	-	p.Y769D	ENST00000298875.4	37	c.2305	CCDS9902.1	14	.	.	.	.	.	.	.	.	.	.	T	23.5	4.418428	0.83559	.	.	ENSG00000165934	ENST00000298875	T	0.61859	0.07	5.7	5.7	0.88788	.	0.059083	0.64402	D	0.000001	T	0.77471	0.4135	M	0.81112	2.525	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.80961	-0.1148	10	0.87932	D	0	.	15.9745	0.80049	0.0:0.0:0.0:1.0	.	769	Q9P2I0	CPSF2_HUMAN	D	769	ENSP00000298875:Y769D	ENSP00000298875:Y769D	Y	+	1	0	CPSF2	91697797	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.208000	0.77907	2.168000	0.68352	0.533000	0.62120	TAT	-	NULL		0.313	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF2	protein_coding	OTTHUMT00000412123.1	T			91697797	1	no_errors	NM_017437	genbank	human	validated	54_36p	missense	SNP	1	G
NDUFAF1	51103	genome.wustl.edu	37	15	41687146	41687146	+	Missense_Mutation	SNP	T	T	G			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr15:41687146T>G	ENST00000260361.4	-	3	1051	c.670A>C	c.(670-672)Aag>Cag	p.K224Q		NM_016013.3	NP_057097.2	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 1	224					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|mitochondrial respiratory chain complex I (GO:0005747)	unfolded protein binding (GO:0051082)	p.K224Q(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	12		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		GTGTCCTCCTTGATATTCACC	0.488																																																1	Substitution - Missense(1)	ovary(1)	15											121.0	100.0	107.0					15																	41687146		2203	4300	6503	39474438	SO:0001583	missense	51103			AF151823	CCDS10075.1	15q11.2-q21.3	2012-10-12	2012-05-08		ENSG00000137806	ENSG00000137806		"""Mitochondrial respiratory chain complex assembly factors"""	18828	protein-coding gene	gene with protein product		606934				11935339, 10810093	Standard	NM_016013		Approved	CIA30, CGI-65	uc001znx.3	Q9Y375	OTTHUMG00000130340	ENST00000260361.4:c.670A>C	15.37:g.41687146T>G	ENSP00000260361:p.Lys224Gln	Somatic		Capture	Illumina GAIIx	4	39474438	Q9BVZ5	Missense_Mutation	SNP	HMMPfam_CIA30	p.K224Q	ENST00000260361.4	37	c.670	CCDS10075.1	15	.	.	.	.	.	.	.	.	.	.	T	8.253	0.809415	0.16537	.	.	ENSG00000137806	ENST00000260361	T	0.78003	-1.14	5.63	1.82	0.25136	NADH:ubiquinone oxidoreductase intermediate-associated protein 30 (1);Galactose-binding domain-like (1);	1.105750	0.06535	N	0.742217	T	0.52289	0.1725	N	0.03071	-0.42	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.36986	-0.9725	10	0.09084	T	0.74	-15.7331	7.6878	0.28550	0.1588:0.0:0.328:0.5132	.	224	Q9Y375	CIA30_HUMAN	Q	224	ENSP00000260361:K224Q	ENSP00000260361:K224Q	K	-	1	0	NDUFAF1	39474438	0.004000	0.15560	0.056000	0.19401	0.917000	0.54804	0.484000	0.22308	0.106000	0.17784	0.451000	0.29950	AAG	-	HMMPfam_CIA30		0.488	NDUFAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFAF1	protein_coding	OTTHUMT00000252692.2	T	NM_016013		39474438	-1	no_errors	NM_016013	genbank	human	validated	54_36p	missense	SNP	0.01	G
LIPC	3990	genome.wustl.edu	37	15	58830576	58830576	+	Silent	SNP	C	C	T	rs374220111		TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr15:58830576C>T	ENST00000356113.6	+	4	748	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	LIPC_ENST00000414170.3_Silent_p.L45L|LIPC_ENST00000299022.5_Silent_p.L45L|LIPC_ENST00000433326.2_Silent_p.L45L			P11150	LIPC_HUMAN	lipase, hepatic	45					cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|fatty acid biosynthetic process (GO:0006633)|high-density lipoprotein particle remodeling (GO:0034375)|intermediate-density lipoprotein particle remodeling (GO:0034373)|low-density lipoprotein particle remodeling (GO:0034374)|phosphatidylcholine catabolic process (GO:0034638)|reverse cholesterol transport (GO:0043691)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|low-density lipoprotein particle binding (GO:0030169)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)	p.L45L(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		AAACAAAACGCTGCATGAGAT	0.478																																																1	Substitution - coding silent(1)	ovary(1)	15						C		1,4383	2.1+/-5.4	0,1,2191	168.0	166.0	167.0		133	-3.7	0.0	15		167	0,8584		0,0,4292	no	coding-synonymous	LIPC	NM_000236.2		0,1,6483	TT,TC,CC		0.0,0.0228,0.0077		45/500	58830576	1,12967	2192	4292	6484	56617868	SO:0001819	synonymous_variant	3990				CCDS10166.1	15q21-q23	2012-10-02			ENSG00000166035	ENSG00000166035	3.1.1.3		6619	protein-coding gene	gene with protein product		151670					Standard	NM_000236		Approved	HL, HTGL	uc002afa.2	P11150	OTTHUMG00000132632	ENST00000356113.6:c.133C>T	15.37:g.58830576C>T		Somatic		Capture	Illumina GAIIx	4	56617868	A2RUB4|A8K9B6|O43571|P78529|Q99465	Silent	SNP	HMMPfam_PLAT;HMMPfam_Lipase;superfamily_Lipase/lipooxygenase domain (PLAT/LH2 domain);superfamily_alpha/beta-Hydrolases	p.L45	ENST00000356113.6	37	c.133	CCDS10166.1	15																																																																																			-	HMMPfam_Lipase		0.478	LIPC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LIPC	protein_coding	OTTHUMT00000416209.1	C			56617868	1	no_errors	NM_000236	genbank	human	reviewed	54_36p	silent	SNP		T
LRRC49	54839	genome.wustl.edu	37	15	71229155	71229155	+	Missense_Mutation	SNP	T	T	G			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr15:71229155T>G	ENST00000260382.5	+	8	1027	c.767T>G	c.(766-768)aTa>aGa	p.I256R	LRRC49_ENST00000443425.2_Missense_Mutation_p.I212R|LRRC49_ENST00000560158.2_De_novo_Start_OutOfFrame|LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000544974.2_Missense_Mutation_p.I246R|LRRC49_ENST00000560691.1_De_novo_Start_InFrame|LRRC49_ENST00000560369.1_Missense_Mutation_p.I261R	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	256						cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.I256R(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						TTTAACAATATATCTAGGTAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	15											68.0	69.0	69.0					15																	71229155		2199	4297	6496	69016209	SO:0001583	missense	54839				CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.767T>G	15.37:g.71229155T>G	ENSP00000260382:p.Ile256Arg	Somatic		Capture	Illumina GAIIx	4	69016209	B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Missense_Mutation	SNP	-	p.I256R	ENST00000260382.5	37	c.767	CCDS32282.1	15	.	.	.	.	.	.	.	.	.	.	T	19.02	3.745652	0.69418	.	.	ENSG00000137821	ENST00000544974;ENST00000260382;ENST00000443425;ENST00000436542	T;T;T	0.30714	1.54;1.52;1.52	5.62	5.62	0.85841	.	0.062166	0.64402	D	0.000005	T	0.69548	0.3123	H	0.97240	3.965	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.85130	0.997;0.994;0.991;0.997;0.996	T	0.80933	-0.1161	10	0.87932	D	0	-22.0752	13.7591	0.62954	0.0:0.0:0.0:1.0	.	261;228;212;256;246	B7Z366;G5E9Q1;G5E9T5;Q8IUZ0;F5H1J4	.;.;.;LRC49_HUMAN;.	R	246;256;212;228	ENSP00000439600:I246R;ENSP00000260382:I256R;ENSP00000414065:I212R	ENSP00000260382:I256R	I	+	2	0	LRRC49	69016209	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.409000	0.66374	2.133000	0.65898	0.482000	0.46254	ATA	-	NULL		0.333	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRC49	protein_coding	OTTHUMT00000417209.3	T	NM_017691		69016209	1	no_errors	NM_017691	genbank	human	validated	54_36p	missense	SNP	1	G
ADAMTS17	170691	genome.wustl.edu	37	15	100695449	100695449	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr15:100695449C>T	ENST00000268070.4	-	9	1363	c.1258G>A	c.(1258-1260)Ggc>Agc	p.G420S		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	420	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G420S(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GGGTTCCGGCCTTTCACCCAC	0.517																																																1	Substitution - Missense(1)	ovary(1)	15											99.0	90.0	93.0					15																	100695449		2203	4300	6503	98512972	SO:0001583	missense	170691			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.1258G>A	15.37:g.100695449C>T	ENSP00000268070:p.Gly420Ser	Somatic		Capture	Illumina GAIIx	4	98512972	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	"HMMPfam_TSP_1,HMMPfam_Reprolysin,HMMPfam_Pep_M12B_propep,HMMPfam_ADAM_spacer1,HMMPfam_PLAC,superfamily_Metalloproteases (""zincins"") catalytic domain,superfamily_TSP-1 type 1 repeat"	p.G420S	ENST00000268070.4	37	c.1258	CCDS10383.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.488333	0.96323	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	D	0.86956	-2.19	5.38	5.38	0.77491	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.87204	0.6119	N	0.11255	0.115	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.74348	0.977;0.983	D	0.87693	0.2555	10	0.33940	T	0.23	.	19.1285	0.93396	0.0:1.0:0.0:0.0	.	177;420	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	S	420;177	ENSP00000268070:G420S	ENSP00000268070:G420S	G	-	1	0	ADAMTS17	98512972	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.003000	0.76310	2.489000	0.83994	0.655000	0.94253	GGC	-	HMMPfam_Reprolysin		0.517	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS17	protein_coding	OTTHUMT00000313595.1	C	NM_139057		98512972	-1	no_errors	NM_139057	genbank	human	reviewed	54_36p	missense	SNP	1	T
HS3ST2	9956	genome.wustl.edu	37	16	22926412	22926412	+	Silent	SNP	C	C	T			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr16:22926412C>T	ENST00000261374.3	+	2	1067	c.633C>T	c.(631-633)gcC>gcT	p.A211A		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	211					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)	p.A211A(1)		breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		TGACCCGTGCCATCTCTGATT	0.587																																																1	Substitution - coding silent(1)	ovary(1)	16											134.0	117.0	122.0					16																	22926412		2197	4300	6497	22833913	SO:0001819	synonymous_variant	9956			AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.633C>T	16.37:g.22926412C>T		Somatic		Capture	Illumina GAIIx	4	22833913	Q52LZ1	Silent	SNP	HMMPfam_Sulfotransfer_1;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.A211	ENST00000261374.3	37	c.633	CCDS10606.1	16																																																																																			-	HMMPfam_Sulfotransfer_1		0.587	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST2	protein_coding	OTTHUMT00000211598.1	C	NM_006043		22833913	1	no_errors	NM_006043	genbank	human	reviewed	54_36p	silent	SNP	1	T
CDH3	1001	genome.wustl.edu	37	16	68718540	68718540	+	Missense_Mutation	SNP	G	G	A	rs369109043		TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr16:68718540G>A	ENST00000264012.4	+	10	1781	c.1237G>A	c.(1237-1239)Gag>Aag	p.E413K	CDH3_ENST00000429102.2_Missense_Mutation_p.E413K|CDH3_ENST00000581171.1_Missense_Mutation_p.E358K	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	413	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)|p.E413K(1)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		AGTGACCAACGAGGCCCCTTT	0.527																																																3	Unknown(2)|Substitution - Missense(1)	breast(2)|ovary(1)	16						G	LYS/GLU	0,4396		0,0,2198	185.0	193.0	190.0		1237	5.3	0.5	16		190	1,8599	1.2+/-3.3	0,1,4299	no	missense	CDH3	NM_001793.4	56	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	413/830	68718540	1,12995	2198	4300	6498	67276041	SO:0001583	missense	1001			X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.1237G>A	16.37:g.68718540G>A	ENSP00000264012:p.Glu413Lys	Somatic		Capture	Illumina GAIIx	4	67276041	B2R6F4|Q05DI6	Missense_Mutation	SNP	HMMPfam_Cadherin;superfamily_Cadherin-like;HMMPfam_Cadherin_C	p.E413K	ENST00000264012.4	37	c.1237	CCDS10868.1	16	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845400	0.51164	0.0	1.16E-4	ENSG00000062038	ENST00000429102;ENST00000264012;ENST00000542274	T;T	0.52057	0.68;0.68	5.28	5.28	0.74379	Cadherin (4);Cadherin-like (1);	0.000000	0.39834	N	0.001242	T	0.34366	0.0895	N	0.21508	0.67	0.58432	D	0.999993	P	0.38565	0.637	B	0.33799	0.17	T	0.20273	-1.0280	10	0.41790	T	0.15	.	16.3954	0.83604	0.0:0.0:1.0:0.0	.	413	P22223	CADH3_HUMAN	K	413;413;358	ENSP00000398485:E413K;ENSP00000264012:E413K	ENSP00000264012:E413K	E	+	1	0	CDH3	67276041	1.000000	0.71417	0.493000	0.27502	0.369000	0.29798	5.413000	0.66399	2.474000	0.83562	0.561000	0.74099	GAG	-	HMMPfam_Cadherin		0.527	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH3	protein_coding	OTTHUMT00000268896.2	G	NM_001793		67276041	1	no_errors	NM_001793	genbank	human	reviewed	54_36p	missense	SNP	1	A
SPACA3	124912	genome.wustl.edu	37	17	31322540	31322540	+	Missense_Mutation	SNP	G	G	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr17:31322540G>A	ENST00000269053.3	+	2	218	c.148G>A	c.(148-150)Gcc>Acc	p.A50T	SPACA3_ENST00000394637.2_3'UTR|SPACA3_ENST00000580599.1_5'UTR|SPACA3_ENST00000394638.1_Intron	NM_173847.3	NP_776246.1	Q8IXA5	SACA3_HUMAN	sperm acrosome associated 3	50					cell wall macromolecule catabolic process (GO:0016998)|defense response to Gram-positive bacterium (GO:0050830)|monocyte activation (GO:0042117)|peptidoglycan catabolic process (GO:0009253)|positive regulation of macrophage activation (GO:0043032)|positive regulation of phagocytosis (GO:0050766)|response to virus (GO:0009615)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|secretory granule (GO:0030141)	lysozyme activity (GO:0003796)	p.A50T(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(9;0.193)			CTCCACCTCTGCCGCCGGCAT	0.617																																																1	Substitution - Missense(1)	ovary(1)	17											61.0	56.0	58.0					17																	31322540		2203	4300	6503	28346653	SO:0001583	missense	124912			AF216311, AF099029	CCDS11275.1	17q12	2014-07-23			ENSG00000141316	ENSG00000141316			16260	protein-coding gene	gene with protein product	"""cancer/testis antigen 54"", ""sperm lyzozyme-like acrosomal protein 1"""	612749				12606493	Standard	NM_173847		Approved	ALLP17, SLLP1, LYC3, LYZL3, CT54	uc002hhs.1	Q8IXA5	OTTHUMG00000132886	ENST00000269053.3:c.148G>A	17.37:g.31322540G>A	ENSP00000269053:p.Ala50Thr	Somatic		Capture	Illumina GAIIx	4	28346653	Q7Z4Y5	Missense_Mutation	SNP	-	p.A50T	ENST00000269053.3	37	c.148	CCDS11275.1	17	.	.	.	.	.	.	.	.	.	.	g	10.00	1.233324	0.22626	.	.	ENSG00000141316	ENST00000269053;ENST00000394637	T	0.70164	-0.46	3.16	-0.00996	0.13998	.	3.167960	0.01388	N	0.013172	T	0.49389	0.1554	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.19549	-1.0302	10	0.25751	T	0.34	-8.5885	4.3368	0.11090	0.1752:0.0:0.635:0.1898	.	50	Q8IXA5	SACA3_HUMAN	T	50;51	ENSP00000269053:A50T	ENSP00000269053:A50T	A	+	1	0	SPACA3	28346653	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.647000	0.05397	-0.009000	0.14296	-0.516000	0.04426	GCC	-	NULL		0.617	SPACA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPACA3	protein_coding	OTTHUMT00000256380.1	G	NM_173847		28346653	1	no_errors	NM_173847	genbank	human	provisional	54_36p	missense	SNP	0.01	A
LRRC46	90506	genome.wustl.edu	37	17	45912765	45912765	+	Splice_Site	SNP	G	G	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr17:45912765G>A	ENST00000269025.4	+	4	635	c.272G>A	c.(271-273)cGc>cAc	p.R91H		NM_033413.3	NP_219481.1	Q96FV0	LRC46_HUMAN	leucine rich repeat containing 46	91								p.R91H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	9						CCCTCCTTGCGGTATGTGGTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	17											113.0	109.0	110.0					17																	45912765		2203	4300	6503	43267764	SO:0001630	splice_region_variant	90506				CCDS11518.1	17q21.32	2005-08-09				ENSG00000141294			25047	protein-coding gene	gene with protein product						12477932	Standard	NM_033413		Approved	MGC16309	uc002ima.3	Q96FV0		ENST00000269025.4:c.272+1G>A	17.37:g.45912765G>A		Somatic		Capture	Illumina GAIIx	4	43267764	A8K9Q0	Missense_Mutation	SNP	-	p.R91H	ENST00000269025.4	37	c.272	CCDS11518.1	17	.	.	.	.	.	.	.	.	.	.	G	22.8	4.332759	0.81801	.	.	ENSG00000141294	ENST00000269025	T	0.61158	0.13	5.39	5.39	0.77823	.	0.102516	0.45361	D	0.000366	T	0.65217	0.2670	L	0.39147	1.195	0.39381	D	0.966257	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.973	T	0.68265	-0.5454	10	0.66056	D	0.02	-17.1036	10.2653	0.43452	0.0904:0.0:0.9096:0.0	.	91;91	A8K9Q0;Q96FV0	.;LRC46_HUMAN	H	91	ENSP00000269025:R91H	ENSP00000269025:R91H	R	+	2	0	LRRC46	43267764	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	2.271000	0.43364	2.549000	0.85964	0.644000	0.83932	CGC	-	NULL		0.537	LRRC46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC46	protein_coding	OTTHUMT00000441377.1	G	NM_033413	Missense_Mutation	43267764	1	no_errors	NM_033413	genbank	human	provisional	54_36p	missense	SNP	1	A
TP53	7157	genome.wustl.edu	37	17	7578534	7578534	+	Missense_Mutation	SNP	C	C	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr17:7578534C>A	ENST00000269305.4	-	5	585	c.396G>T	c.(394-396)aaG>aaT	p.K132N	TP53_ENST00000420246.2_Missense_Mutation_p.K132N|TP53_ENST00000445888.2_Missense_Mutation_p.K132N|TP53_ENST00000359597.4_Missense_Mutation_p.K132N|TP53_ENST00000455263.2_Missense_Mutation_p.K132N|TP53_ENST00000413465.2_Missense_Mutation_p.K132N|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	132	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in LFS; germline mutation and in sporadic cancers; somatic mutation).|K -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).|K -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|KM -> NL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132N(49)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.K39N(2)|p.N131fs*27(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.K132K(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.M133fs*37(1)|p.M133fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAAAACATCTTGTTGAGGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	77	Substitution - Missense(51)|Deletion - In frame(10)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(1)|Substitution - coding silent(1)	urinary_tract(13)|breast(10)|ovary(10)|lung(9)|large_intestine(8)|haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(4)|bone(4)|adrenal_gland(3)|upper_aerodigestive_tract(2)|skin(2)|liver(2)|stomach(1)|penis(1)|oesophagus(1)|pancreas(1)	17											47.0	48.0	48.0					17																	7578534		2203	4300	6503	7519259	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.396G>T	17.37:g.7578534C>A	ENSP00000269305:p.Lys132Asn	Somatic		Capture	Illumina GAIIx	4	7519259	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.K132N	ENST00000269305.4	37	c.396	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186174	0.78789	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99859	-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23	5.48	3.5	0.40072	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99857	0.9933	M	0.91768	3.24	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.998;0.993;0.996;0.999;0.998;1.0	D	0.97328	0.9948	10	0.87932	D	0	-14.0777	10.5581	0.45129	0.0:0.841:0.0:0.159	.	93;132;132;39;132;132;132	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	132;132;132;132;132;132;121;39;39;132	ENSP00000410739:K132N;ENSP00000352610:K132N;ENSP00000269305:K132N;ENSP00000398846:K132N;ENSP00000391127:K132N;ENSP00000391478:K132N;ENSP00000423862:K39N;ENSP00000424104:K132N	ENSP00000269305:K132N	K	-	3	2	TP53	7519259	1.000000	0.71417	0.994000	0.49952	0.784000	0.44337	1.646000	0.37249	0.804000	0.34136	0.655000	0.94253	AAG	-	HMMPfam_P53		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7519259	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	A
GPRC5C	55890	genome.wustl.edu	37	17	72436456	72436456	+	Missense_Mutation	SNP	C	C	T	rs374834578		TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr17:72436456C>T	ENST00000392627.1	+	2	1802	c.676C>T	c.(676-678)Cgg>Tgg	p.R226W	GPRC5C_ENST00000392629.2_Missense_Mutation_p.R193W|GPRC5C_ENST00000342648.5_Intron|GPRC5C_ENST00000481232.1_Intron	NM_022036.2	NP_071319.2	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	181					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)	p.R226W(1)		central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						CACCCTGGTTCGGGGCAGTGG	0.632																																																1	Substitution - Missense(1)	ovary(1)	17						C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	49.0	50.0	50.0		577,676	4.7	0.7	17		50	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GPRC5C	NM_018653.3,NM_022036.2	101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	193/454,226/487	72436456	1,13005	2203	4300	6503	69948051	SO:0001583	missense	55890			AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	ENST00000392627.1:c.676C>T	17.37:g.72436456C>T	ENSP00000376403:p.Arg226Trp	Somatic		Capture	Illumina GAIIx	4	69948051	B5BUN4|Q2NL85|Q9NZG5	Missense_Mutation	SNP	-	p.R226W	ENST00000392627.1	37	c.676	CCDS11699.1	17	.	.	.	.	.	.	.	.	.	.	C	14.17	2.456445	0.43634	0.0	1.16E-4	ENSG00000170412	ENST00000392627;ENST00000342648;ENST00000392629;ENST00000392628	D	0.88975	-2.45	5.79	4.74	0.60224	GPCR, family 3, C-terminal (2);	0.055445	0.64402	D	0.000001	D	0.94830	0.8330	M	0.86502	2.82	0.51012	D	0.999904	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.95256	0.8364	10	0.87932	D	0	-6.8953	15.0481	0.71844	0.1511:0.8489:0.0:0.0	.	181;181;193	A8MXZ4;Q9NQ84;Q9NQ84-2	.;GPC5C_HUMAN;.	W	181;226;193;181	ENSP00000376405:R193W	ENSP00000340595:R226W	R	+	1	2	GPRC5C	69948051	0.881000	0.30235	0.714000	0.30535	0.129000	0.20672	1.781000	0.38644	2.735000	0.93741	0.561000	0.74099	CGG	-	NULL		0.632	GPRC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5C	protein_coding	OTTHUMT00000145094.2	C			69948051	1	no_errors	NM_022036	genbank	human	reviewed	54_36p	missense	SNP	0.94	T
HRH4	59340	genome.wustl.edu	37	18	22057170	22057170	+	Missense_Mutation	SNP	G	G	T			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr18:22057170G>T	ENST00000256906.4	+	3	917	c.817G>T	c.(817-819)Gct>Tct	p.A273S	HRH4_ENST00000426880.2_Missense_Mutation_p.A185S	NM_001160166.1|NM_021624.3	NP_001153638.1|NP_067637.2	Q9H3N8	HRH4_HUMAN	histamine receptor H4	273					inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of MAPK cascade (GO:0043408)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)	p.A273S(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Amitriptyline(DB00321)|Amoxapine(DB00543)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Mianserin(DB06148)|Olanzapine(DB00334)	CAATACAATTGCTTCCAAAAT	0.438																																																1	Substitution - Missense(1)	ovary(1)	18											126.0	127.0	126.0					18																	22057170		2203	4300	6503	20311168	SO:0001583	missense	59340			AF312230	CCDS11887.1, CCDS45841.1	18q11.2	2012-08-08			ENSG00000134489	ENSG00000134489		"""GPCR / Class A : Histamine receptors"""	17383	protein-coding gene	gene with protein product		606792				11118334, 10973974	Standard	NM_021624		Approved	H4R, HH4R, AXOR35, GPCR105, GPRv53	uc002kvi.3	Q9H3N8	OTTHUMG00000131945	ENST00000256906.4:c.817G>T	18.37:g.22057170G>T	ENSP00000256906:p.Ala273Ser	Somatic		Capture	Illumina GAIIx	4	20311168	B0YJ19|B2KJ48|Q4G0I6|Q9GZQ0	Missense_Mutation	SNP	-	p.A273S	ENST00000256906.4	37	c.817	CCDS11887.1	18	.	.	.	.	.	.	.	.	.	.	G	9.714	1.157929	0.21454	.	.	ENSG00000134489	ENST00000256906;ENST00000426880	T;T	0.69175	-0.38;-0.24	5.26	-1.21	0.09524	GPCR, rhodopsin-like superfamily (1);	0.516748	0.19552	N	0.111552	T	0.43700	0.1259	L	0.37850	1.14	0.09310	N	1	B;B	0.29612	0.251;0.1	B;B	0.28305	0.067;0.088	T	0.30909	-0.9962	10	0.07990	T	0.79	-2.3389	4.5768	0.12238	0.4295:0.0:0.3403:0.2301	.	185;273	B2KJ48;Q9H3N8	.;HRH4_HUMAN	S	273;185	ENSP00000256906:A273S;ENSP00000402526:A185S	ENSP00000256906:A273S	A	+	1	0	HRH4	20311168	0.000000	0.05858	0.033000	0.17914	0.193000	0.23685	-0.349000	0.07731	-0.088000	0.12506	0.650000	0.86243	GCT	-	NULL		0.438	HRH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH4	protein_coding	OTTHUMT00000254904.1	G			20311168	1	no_errors	NM_021624	genbank	human	reviewed	54_36p	missense	SNP		T
MAST3	23031	genome.wustl.edu	37	19	18254610	18254610	+	Missense_Mutation	SNP	T	T	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr19:18254610T>A	ENST00000262811.6	+	21	2290	c.2290T>A	c.(2290-2292)Tca>Aca	p.S764T	AC007192.6_ENST00000600364.2_RNA	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	764	Poly-Ser.						ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.S786T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						CTCCTGTCAGTCATCTTCGTC	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											34.0	37.0	36.0					19																	18254610		2043	4191	6234	18115610	SO:0001583	missense	23031			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.2290T>A	19.37:g.18254610T>A	ENSP00000262811:p.Ser764Thr	Somatic		Capture	Illumina GAIIx	4	18115610	Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	-	p.S764T	ENST00000262811.6	37	c.2290	CCDS46014.1	19	.	.	.	.	.	.	.	.	.	.	T	8.580	0.882018	0.17467	.	.	ENSG00000099308	ENST00000262811	T	0.67865	-0.29	3.51	2.48	0.30137	.	0.297248	0.32231	N	0.006398	T	0.60051	0.2239	M	0.74467	2.265	0.09310	N	1	B	0.13594	0.008	B	0.12837	0.008	T	0.51100	-0.8748	10	0.33141	T	0.24	-3.159	5.6107	0.17404	0.0:0.2737:0.0:0.7263	.	764	O60307	MAST3_HUMAN	T	764	ENSP00000262811:S764T	ENSP00000262811:S764T	S	+	1	0	MAST3	18115610	0.017000	0.18338	0.218000	0.23776	0.718000	0.41266	0.768000	0.26590	0.460000	0.27045	0.402000	0.26972	TCA	-	NULL		0.602	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST3	protein_coding	OTTHUMT00000466526.2	T	XM_038150		18115610	1	no_errors	NM_015016	genbank	human	validated	54_36p	missense	SNP	0.01	A
ZNF93	81931	genome.wustl.edu	37	19	20048009	20048009	+	IGR	SNP	G	G	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	A	G	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr19:20048009G>A	ENST00000343769.5	+	0	2648				AC007204.2_ENST00000592245.1_lincRNA|AC007204.1_ENST00000595282.1_Silent_p.V46V	NM_031218.3	NP_112495.2	P35789	ZNF93_HUMAN	zinc finger protein 93						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(2)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	24						CTGGCTTAGAGACAACAATAC	0.393																																																0			19																																								19909009	SO:0001628	intergenic_variant	100128975			M61873	CCDS32973.1	19p12	2014-02-12	2006-05-12		ENSG00000184635	ENSG00000184635		"""Zinc fingers, C2H2-type"", ""-"""	13169	protein-coding gene	gene with protein product		603975	"""zinc finger protein 505"", ""zinc finger protein 93 (HTF34)"""	ZNF505		8467795, 2023909	Standard	NM_031218		Approved	HPF34, TF34, FLJ12488	uc002non.3	P35789	OTTHUMG00000182371		19.37:g.20048009G>A		Somatic		Capture	Illumina GAIIx	Phase_III	19909009	A6NMY2|B9EGT2|Q8N8Q4|Q9H9X5|Q9Y2N8	Silent	SNP	-	p.V93	ENST00000343769.5	37	c.279	CCDS32973.1	19																																																																																			-	NULL		0.393	ZNF93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128975	protein_coding	OTTHUMT00000460808.2	G	NM_031218		19909009	-1	no_errors	XM_001719745	genbank	human	model	54_36p	silent	SNP		A
PSG11	5680	genome.wustl.edu	37	19	43519321	43519321	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr19:43519321C>T	ENST00000401740.1	-	4	1014	c.911G>A	c.(910-912)cGt>cAt	p.R304H	PSG11_ENST00000403486.1_Missense_Mutation_p.R182H|PSG11_ENST00000320078.7_Missense_Mutation_p.R304H|PSG11_ENST00000306322.7_Missense_Mutation_p.R182H|PSG11_ENST00000595312.1_5'Flank			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	313	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				GGCTGAGTTACGAGCAGAGCA	0.453																																																0			19											145.0	140.0	142.0					19																	43519321		2199	4297	6496	48211161	SO:0001583	missense	5680			U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.911G>A	19.37:g.43519321C>T	ENSP00000384995:p.Arg304His	Somatic		Capture	Illumina GAIIx	4	48211161	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	-	p.R304H	ENST00000401740.1	37	c.911	CCDS12614.2	19	.	.	.	.	.	.	.	.	.	.	c	0.004	-2.246828	0.00271	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	0.976	-1.95	0.07548	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.08268	0.0206	L	0.45581	1.43	0.09310	N	1	B;B	0.26876	0.162;0.025	B;B	0.25614	0.062;0.021	T	0.42682	-0.9437	9	0.08837	T	0.75	.	2.1676	0.03841	0.0:0.3412:0.3423:0.3165	.	182;304	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	H	304;182;182;304	ENSP00000319140:R304H;ENSP00000385427:R182H;ENSP00000304913:R182H;ENSP00000384995:R304H	ENSP00000304913:R182H	R	-	2	0	PSG11	48211161	0.000000	0.05858	0.003000	0.11579	0.055000	0.15305	-0.379000	0.07437	-0.424000	0.07382	0.184000	0.17185	CGT	-	NULL		0.453	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG11	protein_coding	OTTHUMT00000323079.1	C	NM_002785		48211161	-1	no_errors	NM_002785	genbank	human	validated	54_36p	missense	SNP	0.26	T
PIKFYVE	200576	genome.wustl.edu	37	2	209138357	209138357	+	Missense_Mutation	SNP	G	G	C			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr2:209138357G>C	ENST00000264380.4	+	3	380	c.222G>C	c.(220-222)tgG>tgC	p.W74C	PIKFYVE_ENST00000392202.3_Missense_Mutation_p.W74C|PIKFYVE_ENST00000407449.1_Missense_Mutation_p.W74C|PIKFYVE_ENST00000308862.6_Missense_Mutation_p.W74C	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	74					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.W74C(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GTGGAAGTTGGACCAGCCCTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	2											97.0	94.0	95.0					2																	209138357		2203	4300	6503	208846602	SO:0001583	missense	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.222G>C	2.37:g.209138357G>C	ENSP00000264380:p.Trp74Cys	Somatic		Capture	Illumina GAIIx	4	208846602	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	"HMMPfam_FYVE;HMMPfam_DEP;HMMPfam_Cpn60_TCP1;HMMPfam_PIP5K;superfamily_FYVE/PHD zinc finger;superfamily_""Winged helix"" DNA-binding domain;superfamily_Spectrin repeat;superfamily_GroEL apical domain-like;superfamily_GroEL-intermediate domain like;superfamily_SAICAR synthase-like"	p.W74C	ENST00000264380.4	37	c.222	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	G	16.27	3.075341	0.55646	.	.	ENSG00000115020	ENST00000392202;ENST00000264380;ENST00000407449;ENST00000308862;ENST00000422495;ENST00000452564	T;T;T;T	0.64260	1.64;-0.09;-0.08;1.8	5.65	4.72	0.59763	.	0.157358	0.45126	D	0.000395	T	0.65678	0.2714	N	0.19112	0.55	0.38953	D	0.958389	D;D;P;P;P	0.76494	0.999;0.975;0.924;0.876;0.924	D;P;P;B;P	0.76071	0.987;0.62;0.521;0.221;0.521	T	0.68872	-0.5294	10	0.52906	T	0.07	-8.9267	14.0965	0.65027	0.0:0.0:0.8501:0.1499	.	74;74;74;74;74	Q9Y2I7;E9PDH4;Q9Y2I7-3;Q08AR7;Q9Y2I7-2	FYV1_HUMAN;.;.;.;.	C	74	ENSP00000264380:W74C;ENSP00000384356:W74C;ENSP00000414477:W74C;ENSP00000405736:W74C	ENSP00000264380:W74C	W	+	3	0	PIKFYVE	208846602	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	4.669000	0.61575	2.824000	0.97209	0.655000	0.94253	TGG	-	NULL		0.507	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP5K3	protein_coding	OTTHUMT00000256477.2	G	NM_015040		208846602	1	no_errors	NM_015040	genbank	human	validated	54_36p	missense	SNP	1	C
DLGAP4	22839	genome.wustl.edu	37	20	35060830	35060830	+	Missense_Mutation	SNP	G	G	T			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr20:35060830G>T	ENST00000373907.2	+	2	909	c.710G>T	c.(709-711)aGc>aTc	p.S237I	DLGAP4_ENST00000401952.2_Missense_Mutation_p.S237I|DLGAP4_ENST00000373913.3_Missense_Mutation_p.S237I|DLGAP4_ENST00000339266.5_Missense_Mutation_p.S237I			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	237					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)		p.S237I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GCAGAACGCAGCCAGCCACGC	0.622																																																1	Substitution - Missense(1)	ovary(1)	20											81.0	77.0	79.0					20																	35060830		2202	4300	6502	34494244	SO:0001583	missense	22839			AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.710G>T	20.37:g.35060830G>T	ENSP00000363014:p.Ser237Ile	Somatic		Capture	Illumina GAIIx	4	34494244	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	-	p.S237I	ENST00000373907.2	37	c.710		20	.	.	.	.	.	.	.	.	.	.	G	12.62	1.991950	0.35131	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266	T;T;T;T	0.12984	2.63;2.63;2.64;2.64	5.24	-1.73	0.08081	.	0.554695	0.20671	N	0.087823	T	0.15869	0.0382	L	0.60455	1.87	0.20196	N	0.999924	B	0.27853	0.191	B	0.32149	0.141	T	0.32693	-0.9897	10	0.56958	D	0.05	.	14.8897	0.70600	0.0:0.5304:0.3788:0.0908	.	237	Q9Y2H0-1	.	I	237	ENSP00000363023:S237I;ENSP00000384954:S237I;ENSP00000363014:S237I;ENSP00000341633:S237I	ENSP00000341633:S237I	S	+	2	0	DLGAP4	34494244	0.993000	0.37304	0.991000	0.47740	0.981000	0.71138	0.756000	0.26419	-0.095000	0.12351	0.462000	0.41574	AGC	-	NULL		0.622	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	protein_coding	OTTHUMT00000079025.2	G	NM_014902		34494244	1	no_errors	NM_014902	genbank	human	reviewed	54_36p	missense	SNP	0.98	T
EIF4ENIF1	56478	genome.wustl.edu	37	22	31836737	31836737	+	Frame_Shift_Del	DEL	C	C	-			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr22:31836737delC	ENST00000397525.1	-	18	2892	c.2669delG	c.(2668-2670)ggafs	p.G890fs	EIF4ENIF1_ENST00000397523.1_Frame_Shift_Del_p.G866fs|EIF4ENIF1_ENST00000441289.1_5'Flank|EIF4ENIF1_ENST00000344710.5_Frame_Shift_Del_p.G716fs|EIF4ENIF1_ENST00000330125.5_Frame_Shift_Del_p.G890fs|EIF4ENIF1_ENST00000382180.2_Frame_Shift_Del_p.G545fs	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	890						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.G890fs*89(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CAGAGGTGTTCCAGGACGAGG	0.517																																																1	Deletion - Frameshift(1)	ovary(1)	22											138.0	125.0	129.0					22																	31836737		2203	4300	6503	30166737	SO:0001589	frameshift_variant	56478			AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.2669delG	22.37:g.31836737delC	ENSP00000380659:p.Gly890fs	Somatic		Capture	Illumina GAIIx	4	30166737	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Frame_Shift_Del	DEL	-	p.G890fs	ENST00000397525.1	37	c.2669	CCDS13898.1	22																																																																																			(deletion:cds_exon[30166690;30166854])	NULL		0.517	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4ENIF1	protein_coding	OTTHUMT00000127926.1	C	NM_019843		30166737	-1	no_errors	NM_019843	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1	-
PLXNB1	5364	genome.wustl.edu	37	3	48454545	48454545	+	Missense_Mutation	SNP	C	C	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr3:48454545C>A	ENST00000358536.4	-	24	4838	c.4569G>T	c.(4567-4569)aaG>aaT	p.K1523N	PLXNB1_ENST00000465117.1_5'Flank|PLXNB1_ENST00000358459.4_Missense_Mutation_p.K1340N|PLXNB1_ENST00000456774.1_Missense_Mutation_p.K1340N|PLXNB1_ENST00000296440.6_Missense_Mutation_p.K1523N|PLXNB1_ENST00000448774.2_Missense_Mutation_p.K134N	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1523					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.K1523N(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TCTGAACCTTCTTATAGTCCC	0.597																																																1	Substitution - Missense(1)	ovary(1)	3											149.0	141.0	144.0					3																	48454545		2203	4300	6503	48429549	SO:0001583	missense	5364			X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.4569G>T	3.37:g.48454545C>A	ENSP00000351338:p.Lys1523Asn	Somatic		Capture	Illumina GAIIx	4	48429549	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	-	p.K1523N	ENST00000358536.4	37	c.4569	CCDS2765.1	3	.	.	.	.	.	.	.	.	.	.	C	23.0	4.360214	0.82353	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000448774;ENST00000456774	T;T;T;T;T	0.14391	3.65;3.69;3.65;2.51;3.69	5.33	4.45	0.53987	.	0.000000	0.85682	D	0.000000	T	0.43077	0.1231	M	0.89353	3.025	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	T	0.50866	-0.8777	10	0.59425	D	0.04	.	13.4555	0.61195	0.0:0.9231:0.0:0.0769	.	1523;1340	O43157;O43157-2	PLXB1_HUMAN;.	N	1523;1340;1523;134;1340	ENSP00000296440:K1523N;ENSP00000351242:K1340N;ENSP00000351338:K1523N;ENSP00000389320:K134N;ENSP00000414199:K1340N	ENSP00000296440:K1523N	K	-	3	2	PLXNB1	48429549	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.021000	0.57196	1.209000	0.43321	0.563000	0.77884	AAG	-	NULL		0.597	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	protein_coding	OTTHUMT00000344454.1	C	NM_002673		48429549	-1	no_errors	NM_002673	genbank	human	validated	54_36p	missense	SNP	1	A
COL7A1	1294	genome.wustl.edu	37	3	48623284	48623284	+	Missense_Mutation	SNP	C	C	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr3:48623284C>A	ENST00000328333.8	-	29	3872	c.3765G>T	c.(3763-3765)caG>caT	p.Q1255H	COL7A1_ENST00000454817.1_Missense_Mutation_p.Q1255H	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1255	Interrupted collagenous region.|Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q1255H(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GTTCCCCCTTCTGGCCCTGGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	3											147.0	156.0	153.0					3																	48623284		2203	4300	6503	48598288	SO:0001583	missense	1294			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.3765G>T	3.37:g.48623284C>A	ENSP00000332371:p.Gln1255His	Somatic		Capture	Illumina GAIIx	4	48598288	Q14054|Q16507	Missense_Mutation	SNP	HMMPfam_VWA;HMMPfam_Kunitz_BPTI;superfamily_BPTI-like;HMMPfam_fn3;HMMPfam_Collagen;superfamily_Fibronectin type III;superfamily_vWA-like	p.Q1255H	ENST00000328333.8	37	c.3765	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	C	11.87	1.766772	0.31320	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.93547	-3.24;-3.24	5.81	4.93	0.64822	.	0.347799	0.20708	N	0.087160	D	0.90397	0.6994	N	0.25245	0.725	0.36668	D	0.878323	P	0.47484	0.896	P	0.48524	0.58	D	0.91894	0.5526	10	0.48119	T	0.1	.	13.0501	0.58950	0.0:0.9258:0.0:0.0742	.	1255	Q02388	CO7A1_HUMAN	H	1255	ENSP00000332371:Q1255H;ENSP00000412569:Q1255H	ENSP00000332371:Q1255H	Q	-	3	2	COL7A1	48598288	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.111000	0.50360	1.453000	0.47775	0.563000	0.77884	CAG	-	NULL		0.582	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	protein_coding	OTTHUMT00000257519.1	C	NM_000094		48598288	-1	no_errors	NM_000094	genbank	human	reviewed	54_36p	missense	SNP	1	A
COL7A1	1294	genome.wustl.edu	37	3	48629185	48629185	+	Silent	SNP	C	C	T	rs138330564		TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr3:48629185C>T	ENST00000328333.8	-	11	1535	c.1428G>A	c.(1426-1428)ccG>ccA	p.P476P	COL7A1_ENST00000454817.1_Silent_p.P476P	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	476	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P476P(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACTCAGTGCCCGGCTGCAGCC	0.632													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19701	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	3						C		1,4405	2.1+/-5.4	0,1,2202	58.0	60.0	59.0		1428	-6.1	0.9	3	dbSNP_134	59	0,8598		0,0,4299	no	coding-synonymous	COL7A1	NM_000094.3		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		476/2945	48629185	1,13003	2203	4299	6502	48604189	SO:0001819	synonymous_variant	1294			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.1428G>A	3.37:g.48629185C>T		Somatic		Capture	Illumina GAIIx	4	48604189	Q14054|Q16507	Silent	SNP	HMMPfam_VWA,HMMPfam_Kunitz_BPTI,superfamily_BPTI-like,HMMPfam_fn3,HMMPfam_Collagen,superfamily_Fibronectin type III,superfamily_vWA-like	p.P476	ENST00000328333.8	37	c.1428	CCDS2773.1	3																																																																																			-	HMMPfam_fn3		0.632	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	protein_coding	OTTHUMT00000257519.1	C	NM_000094		48604189	-1	no_errors	NM_000094	genbank	human	reviewed	54_36p	silent	SNP	0.954	T
GPR149	344758	genome.wustl.edu	37	3	154055525	154055525	+	Missense_Mutation	SNP	G	G	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr3:154055525G>A	ENST00000389740.2	-	4	2258	c.2159C>T	c.(2158-2160)gCt>gTt	p.A720V		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	720					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A720V(1)		autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTTTCTGTAAGCTTTATTTAA	0.433																																																1	Substitution - Missense(1)	ovary(1)	3											315.0	291.0	299.0					3																	154055525		1914	4119	6033	155538219	SO:0001583	missense	344758			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.2159C>T	3.37:g.154055525G>A	ENSP00000374390:p.Ala720Val	Somatic		Capture	Illumina GAIIx	4	155538219		Missense_Mutation	SNP	-	p.A720V	ENST00000389740.2	37	c.2159	CCDS43162.1	3	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468079	0.84533	.	.	ENSG00000174948	ENST00000389740	.	.	.	5.8	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.49029	0.1533	N	0.24115	0.695	0.58432	D	0.999994	D	0.56521	0.976	P	0.50192	0.634	T	0.55412	-0.8145	9	0.87932	D	0	-11.7316	14.7238	0.69329	0.0692:0.0:0.9308:0.0	.	720	Q86SP6	GP149_HUMAN	V	720	.	ENSP00000374390:A720V	A	-	2	0	GPR149	155538219	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.433000	0.66520	1.456000	0.47831	0.650000	0.86243	GCT	-	NULL		0.433	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	protein_coding	OTTHUMT00000353430.1	G	XM_293580		155538219	-1	no_errors	NM_001038705	genbank	human	provisional	54_36p	missense	SNP	1	A
SLC2A9	56606	genome.wustl.edu	37	4	9987354	9987354	+	Silent	SNP	C	C	T	rs559926779		TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr4:9987354C>T	ENST00000264784.3	-	4	527	c.474G>A	c.(472-474)tcG>tcA	p.S158S	SLC2A9_ENST00000309065.3_Silent_p.S129S|SLC2A9_ENST00000506583.1_Silent_p.S129S	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	158					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)	p.S129S(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	CTGCCTGGAGCGAGCAGGCCA	0.488													C|||	1	0.000199681	0.0	0.0014	5008	,	,		24229	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	4											90.0	87.0	88.0					4																	9987354		2203	4300	6503	9596452	SO:0001819	synonymous_variant	56606			AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.474G>A	4.37:g.9987354C>T		Somatic		Capture	Illumina GAIIx	4	9596452	Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Silent	SNP	-	p.S158	ENST00000264784.3	37	c.474	CCDS3407.1	4																																																																																			-	NULL		0.488	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC2A9	protein_coding	OTTHUMT00000207055.1	C			9596452	-1	no_errors	NM_020041	genbank	human	reviewed	54_36p	silent	SNP		T
SIM1	6492	genome.wustl.edu	37	6	100896081	100896081	+	Missense_Mutation	SNP	G	G	T			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr6:100896081G>T	ENST00000369208.3	-	8	1573	c.791C>A	c.(790-792)aCt>aAt	p.T264N	SIM1_ENST00000262901.4_Missense_Mutation_p.T264N			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	264	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.T264N(1)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		GTGGTACAGAGTCTTCTCAAT	0.637																																																1	Substitution - Missense(1)	ovary(1)	6											132.0	95.0	107.0					6																	100896081		2203	4300	6503	101002802	SO:0001583	missense	6492			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.791C>A	6.37:g.100896081G>T	ENSP00000358210:p.Thr264Asn	Somatic		Capture	Illumina GAIIx	Phase_III	101002802	Q5TDP7	Missense_Mutation	SNP	HMMPfam_HLH,HMMPfam_SIM_C,superfamily_HLH helix-loop-helix DNA-binding domain,HMMPfam_PAS_3,HMMPfam_PAS,superfamily_PYP-like sensor domain (PAS domain)	p.T264N	ENST00000369208.3	37	c.791	CCDS5045.1	6	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640731	0.67244	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.16324	2.35;2.35	5.16	5.16	0.70880	PAS fold-3 (1);PAS (2);	0.045348	0.85682	D	0.000000	T	0.31670	0.0804	L	0.57130	1.785	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.03739	-1.1008	10	0.56958	D	0.05	.	18.669	0.91504	0.0:0.0:1.0:0.0	.	264	P81133	SIM1_HUMAN	N	264	ENSP00000358210:T264N;ENSP00000262901:T264N	ENSP00000262901:T264N	T	-	2	0	SIM1	101002802	1.000000	0.71417	0.943000	0.38184	0.084000	0.17831	9.476000	0.97823	2.404000	0.81709	0.561000	0.74099	ACT	-	HMMPfam_PAS_3		0.637	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	protein_coding	OTTHUMT00000041628.3	G	NM_005068		101002802	-1	no_errors	NM_005068	genbank	human	reviewed	54_36p	missense	SNP	1	T
UTRN	7402	genome.wustl.edu	37	6	144806600	144806600	+	Missense_Mutation	SNP	T	T	G			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr6:144806600T>G	ENST00000367545.3	+	27	3767	c.3767T>G	c.(3766-3768)aTg>aGg	p.M1256R		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1256					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.M1256R(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GAAGAGCGGATGAAGAGCACA	0.463																																																1	Substitution - Missense(1)	ovary(1)	6											212.0	204.0	207.0					6																	144806600		2203	4300	6503	144848293	SO:0001583	missense	7402			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.3767T>G	6.37:g.144806600T>G	ENSP00000356515:p.Met1256Arg	Somatic		Capture	Illumina GAIIx	4	144848293	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	-	p.M1256R	ENST00000367545.3	37	c.3767	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	T	14.83	2.651687	0.47362	.	.	ENSG00000152818	ENST00000367545	T	0.35236	1.32	5.12	3.97	0.46021	.	0.249624	0.28198	N	0.016237	T	0.09335	0.0230	N	0.08118	0	0.80722	D	1	B	0.25609	0.13	B	0.24541	0.054	T	0.07462	-1.0771	10	0.87932	D	0	.	10.6037	0.45381	0.0:0.0755:0.0:0.9245	.	1256	P46939	UTRO_HUMAN	R	1256	ENSP00000356515:M1256R	ENSP00000356515:M1256R	M	+	2	0	UTRN	144848293	0.997000	0.39634	0.030000	0.17652	0.987000	0.75469	6.210000	0.72176	0.913000	0.36797	0.533000	0.62120	ATG	-	NULL		0.463	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	protein_coding	OTTHUMT00000042551.1	T			144848293	1	no_errors	NM_007124	genbank	human	reviewed	54_36p	missense	SNP	0.06	G
THSD7A	221981	genome.wustl.edu	37	7	11675821	11675821	+	Nonsense_Mutation	SNP	G	G	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr7:11675821G>A	ENST00000423059.4	-	2	1209	c.958C>T	c.(958-960)Cag>Tag	p.Q320*	THSD7A_ENST00000480061.1_5'Flank	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	320					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q320*(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TATCCAATCTGGATGTCCCAA	0.413										HNSCC(18;0.044)																																						1	Substitution - Nonsense(1)	ovary(1)	7											160.0	157.0	158.0					7																	11675821		1890	4112	6002	11642346	SO:0001587	stop_gained	221981				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.958C>T	7.37:g.11675821G>A	ENSP00000406482:p.Gln320*	Somatic		Capture	Illumina GAIIx	4	11642346		Nonsense_Mutation	SNP	-	p.Q320*	ENST00000423059.4	37	c.958	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	G	38	7.259692	0.98171	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	.	.	.	5.62	5.62	0.85841	.	0.050105	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	20.0333	0.97547	0.0:0.0:1.0:0.0	.	.	.	.	X	320	.	ENSP00000262042:Q320X	Q	-	1	0	THSD7A	11642346	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.850000	0.86915	2.810000	0.96702	0.585000	0.79938	CAG	-	NULL		0.413	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	protein_coding	OTTHUMT00000325944.4	G	XM_928187.2		11642346	-1	no_errors	NM_015204	genbank	human	validated	54_36p	nonsense	SNP	1	A
PPP1R3A	5506	genome.wustl.edu	37	7	113558949	113558949	+	Missense_Mutation	SNP	G	G	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr7:113558949G>A	ENST00000284601.3	-	1	171	c.103C>T	c.(103-105)Cct>Tct	p.P35S		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	35					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.P35S(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GAGAAACCAGGTTGGAAAGTA	0.393																																																1	Substitution - Missense(1)	ovary(1)	7											78.0	81.0	80.0					7																	113558949		2203	4300	6503	113346185	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.103C>T	7.37:g.113558949G>A	ENSP00000284601:p.Pro35Ser	Somatic		Capture	Illumina GAIIx	4	113346185	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	HMMPfam_CBM_21	p.P35S	ENST00000284601.3	37	c.103	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	G	21.5	4.151505	0.78001	.	.	ENSG00000154415	ENST00000284601	T	0.19669	2.13	6.17	6.17	0.99709	.	0.183813	0.48286	D	0.000194	T	0.49660	0.1570	M	0.74881	2.28	0.58432	D	0.999996	D	0.89917	1.0	D	0.68765	0.96	T	0.29488	-1.0010	10	0.49607	T	0.09	-0.1205	20.8794	0.99867	0.0:0.0:1.0:0.0	.	35	Q16821	PPR3A_HUMAN	S	35	ENSP00000284601:P35S	ENSP00000284601:P35S	P	-	1	0	PPP1R3A	113346185	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	6.133000	0.71682	2.941000	0.99782	0.655000	0.94253	CCT	-	NULL		0.393	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	protein_coding	OTTHUMT00000346724.1	G	NM_002711		113346185	-1	no_errors	NM_002711	genbank	human	reviewed	54_36p	missense	SNP	1	A
EPDR1	54749	genome.wustl.edu	37	7	37960263	37960275	+	5'UTR	DEL	AGGCAGTGGCAGC	AGGCAGTGGCAGC	-	rs201513905|rs62443108|rs200181352|rs76859517	byFrequency	TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	AGGCAGTGGCAGC	AGGCAGTGGCAGC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr7:37960263_37960275delAGGCAGTGGCAGC	ENST00000199448.4	+	0	101_113				EPDR1_ENST00000423717.1_5'UTR|EPDR1_ENST00000559325.1_Frame_Shift_Del_p.RQWQQ28fs|EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000476620.1_Intron	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1						cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)	p.A36fs*79(3)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						AAGCGGCAGAAGGCAGTGGCAGCAGGCAGTGGC	0.634														805	0.160743	0.059	0.2104	5008	,	,		17289	0.1389		0.3052	False		,,,				2504	0.137															3	Deletion - Frameshift(3)	urinary_tract(1)|ovary(1)|breast(1)	7								445,3795		57,331,1732						-0.3	0.2			25	2789,5371		581,1627,1872	no	frameshift	EPDR1	NM_017549.4		638,1958,3604	A1A1,A1R,RR		34.1789,10.4953,26.0806				3234,9166				37926800	SO:0001623	5_prime_UTR_variant	54749			BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.-267AGGCAGTGGCAGC>-	7.37:g.37960263_37960275delAGGCAGTGGCAGC		Somatic		Capture	Illumina GAIIx	4	37926788	A8K4C0|C9JYS3|Q06BL0|Q99M77	Frame_Shift_Del	DEL	-	p.Q31fs	ENST00000199448.4	37	c.82_94	CCDS5454.2	7																																																																																			(deletion:cds_exon[37926707;37927335])	NULL		0.634	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	EPDR1	protein_coding	OTTHUMT00000220037.3	AGGCAGTGGCAGC	NM_017549		37926800	1	no_errors	NM_017549	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.083:0.084:0.084:0.084:0.084:0.084:0.083:0.082:0.080:0.077:0.074:0.070:0.065	-
ADCY1	107	genome.wustl.edu	37	7	45717574	45717574	+	Missense_Mutation	SNP	G	G	A			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr7:45717574G>A	ENST00000297323.7	+	9	1734	c.1712G>A	c.(1711-1713)cGc>cAc	p.R571H		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	571					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.R571H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TACATCAGCCGCCTCTTAGAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	7											75.0	83.0	80.0					7																	45717574		2203	4300	6503	45684099	SO:0001583	missense	107			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1712G>A	7.37:g.45717574G>A	ENSP00000297323:p.Arg571His	Somatic		Capture	Illumina GAIIx	4	45684099	A4D2L8|Q75MI1	Missense_Mutation	SNP	HMMPfam_Guanylate_cyc;superfamily_Adenylyl and guanylyl cyclase catalytic domain;superfamily_Voltage-gated potassium channels	p.R571H	ENST00000297323.7	37	c.1712	CCDS34631.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.239186	0.95240	.	.	ENSG00000164742	ENST00000297323;ENST00000545300	T	0.80994	-1.44	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.73048	0.3537	L	0.56769	1.78	0.80722	D	1	P	0.42871	0.792	B	0.28232	0.087	T	0.74780	-0.3549	10	0.30078	T	0.28	.	16.3318	0.83023	0.0:0.0:1.0:0.0	.	571	Q08828	ADCY1_HUMAN	H	571	ENSP00000297323:R571H	ENSP00000297323:R571H	R	+	2	0	ADCY1	45684099	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.260000	0.95568	2.445000	0.82738	0.655000	0.94253	CGC	-	NULL		0.507	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY1	protein_coding	OTTHUMT00000340055.2	G	NM_021116		45684099	1	no_errors	NM_021116	genbank	human	reviewed	54_36p	missense	SNP	1	A
HIPK2	28996	genome.wustl.edu	37	7	139416581	139416581	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr7:139416581C>T	ENST00000406875.3	-	2	347	c.253G>A	c.(253-255)Gtc>Atc	p.V85I	HIPK2_ENST00000428878.2_Missense_Mutation_p.V85I|HIPK2_ENST00000342645.6_Missense_Mutation_p.V85I	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	85					adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)	p.V85I(1)		breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					CCTGGGAAGACGATGGTCTGC	0.602																																																1	Substitution - Missense(1)	ovary(1)	7											109.0	101.0	104.0					7																	139416581		1568	3582	5150	139063067	SO:0001583	missense	653052			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.253G>A	7.37:g.139416581C>T	ENSP00000385571:p.Val85Ile	Somatic		Capture	Illumina GAIIx	4	139063067	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	-	p.V85I	ENST00000406875.3	37	c.253		7	.	.	.	.	.	.	.	.	.	.	T	5.337	0.247425	0.10130	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.50813	0.73;0.73;0.73	5.28	2.67	0.31697	.	.	.	.	.	T	0.27594	0.0678	.	.	.	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23762	-1.0179	8	0.16420	T	0.52	.	7.4495	0.27229	0.0:0.0709:0.269:0.6601	.	85;85	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	I	85	ENSP00000385571:V85I;ENSP00000413724:V85I;ENSP00000343108:V85I	ENSP00000343108:V85I	V	-	1	0	HIPK2	139063067	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.704000	0.37857	0.297000	0.22615	-0.360000	0.07572	GTC	-	NULL		0.602	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	LOC653052	protein_coding	OTTHUMT00000349430.3	C	NM_022740		139063067	-1	no_errors	XM_925800	genbank	human	model	54_36p	missense	SNP	1	T
CYP11B1	1584	genome.wustl.edu	37	8	143960891	143960891	+	Intron	SNP	C	C	T	rs199825110		TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr8:143960891C>T	ENST00000292427.4	-	1	272				CYP11B1_ENST00000377675.3_Missense_Mutation_p.R82Q|CYP11B1_ENST00000517471.1_Intron	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1						aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	TGCAGAGTGCCGGGACCTGCT	0.657									Familial Hyperaldosteronism type I																																							0			8						C	,	0,1752		0,0,876	58.0	59.0	59.0		,	-5.4	0.0	8		59	5,3977		0,5,1986	no	intron,intron	CYP11B1	NM_000497.3,NM_001026213.1	,	0,5,2862	TT,TC,CC		0.1256,0.0,0.0872	,	,	143960891	5,5729	876	1991	2867	143957893	SO:0001627	intron_variant	1584	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.239+99G>A	8.37:g.143960891C>T		Somatic		Capture	Illumina GAIIx	4	143957893	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	HMMPfam_p450;superfamily_Cytochrome_P450	p.R82Q	ENST00000292427.4	37	c.245	CCDS6392.1	8	.	.	.	.	.	.	.	.	.	.	C	8.981	0.975313	0.18736	0.0	0.001256	ENSG00000160882	ENST00000377675	T	0.75154	-0.91	2.68	-5.36	0.02689	.	.	.	.	.	T	0.51941	0.1704	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25257	-1.0137	8	0.29301	T	0.29	.	3.1786	0.06577	0.1718:0.161:0.5194:0.1478	.	82	Q4VAR0	.	Q	82	ENSP00000366903:R82Q	ENSP00000366903:R82Q	R	-	2	0	CYP11B1	143957893	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.668000	0.05268	-1.703000	0.01409	-0.516000	0.04426	CGG	-	NULL		0.657	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B1	protein_coding	OTTHUMT00000379475.2	C			143957893	-1	no_errors	ENST00000377675	ensembl	human	known	54_36p	missense	SNP		T
Unknown	0	genome.wustl.edu	37	X	89294635	89294635	+	IGR	SNP	A	A	G			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chrX:89294635A>G								TGIF2LX (116753 upstream) : RNU6-555P (557598 downstream)																							ACCAAGTTGTAATAGCATTGC	0.393																																																0			X																																								89181291	SO:0001628	intergenic_variant	100130134																															X.37:g.89294635A>G		Somatic		Capture	Illumina GAIIx	4	89181291		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.393					LOC100130134			A			89181291	-1	pseudogene	XR_037810	genbank	human	model	54_36p	rna	SNP	0.01	G
NTRK2	4915	genome.wustl.edu	37	9	87570331	87570331	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chr9:87570331C>T	ENST00000323115.4	+	15	2376	c.2023C>T	c.(2023-2025)Cgc>Tgc	p.R675C	NTRK2_ENST00000376214.1_Missense_Mutation_p.R691C|NTRK2_ENST00000277120.3_Missense_Mutation_p.R691C|NTRK2_ENST00000376213.1_Missense_Mutation_p.R675C			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	675	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)	p.R691C(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	CTTCGTGCACCGCGATTTGGC	0.612										TSP Lung(25;0.17)																																						1	Substitution - Missense(1)	ovary(1)	9											59.0	57.0	57.0					9																	87570331		2203	4300	6503	86760151	SO:0001583	missense	4915			AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.2023C>T	9.37:g.87570331C>T	ENSP00000314586:p.Arg675Cys	Somatic		Capture	Illumina GAIIx	4	86760151	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	LRRNT;HMMPfam_LRRNT;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;LRR_1;HMMPfam_LRR_1;Protein kinase-like (PK-like);superfamily_Protein kinase-like (PK-like);I-set;HMMPfam_I-set;Immunoglobulin;superfamily_Immunoglobulin;L domain-like;superfamily_L domain-like	p.R691C	ENST00000323115.4	37	c.2071	CCDS35050.1	9	.	.	.	.	.	.	.	.	.	.	C	24.0	4.481454	0.84747	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000277120;ENST00000323115	D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43	4.98	4.98	0.66077	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95601	0.8570	M	0.90145	3.09	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	D	0.96530	0.9392	10	0.87932	D	0	.	18.2752	0.90080	0.0:1.0:0.0:0.0	.	675;691;721	Q16620;Q16620-4;Q59GJ1	NTRK2_HUMAN;.;.	C	691;675;691;675	ENSP00000365387:R691C;ENSP00000365386:R675C;ENSP00000277120:R691C;ENSP00000314586:R675C	ENSP00000277120:R691C	R	+	1	0	NTRK2	86760151	1.000000	0.71417	0.999000	0.59377	0.892000	0.51952	4.936000	0.63506	2.320000	0.78422	0.655000	0.94253	CGC	-	HMMPfam_Pkinase_Tyr		0.612	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	protein_coding	OTTHUMT00000052882.1	C			86760151	1	no_errors	NM_006180	genbank	human	reviewed	54_36p	missense	SNP	1	T
MBTPS2	51360	genome.wustl.edu	37	X	21861408	21861408	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chrX:21861408C>T	ENST00000379484.5	+	2	295	c.196C>T	c.(196-198)Cgg>Tgg	p.R66W	MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000365779.2_Missense_Mutation_p.R66W	NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	66					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.R66W(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						CAGTTGGGGACGGCGGAAAGC	0.408																																																1	Substitution - Missense(1)	ovary(1)	X											195.0	194.0	194.0					X																	21861408		2203	4300	6503	21771329	SO:0001583	missense	51360			AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.196C>T	X.37:g.21861408C>T	ENSP00000368798:p.Arg66Trp	Somatic		Capture	Illumina GAIIx	4	21771329	Q9UM70|Q9UMD3	Missense_Mutation	SNP	superfamily_PDZ domain-like;HMMPfam_Peptidase_M50	p.R66W	ENST00000379484.5	37	c.196	CCDS14201.1	X	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046546	0.75846	.	.	ENSG00000012174	ENST00000379484;ENST00000365779	D;D	0.94280	-3.39;-2.25	4.95	4.95	0.65309	.	0.114641	0.64402	D	0.000015	D	0.95522	0.8545	M	0.72894	2.215	0.54753	D	0.999981	D;D;D	0.89917	1.0;1.0;1.0	D;D;P	0.65573	0.936;0.936;0.854	D	0.95461	0.8543	10	0.62326	D	0.03	-5.3103	12.0663	0.53590	0.2266:0.7734:0.0:0.0	.	66;66;66	A8KA68;O43462;B9ZVQ3	.;MBTP2_HUMAN;.	W	66	ENSP00000368798:R66W;ENSP00000368796:R66W	ENSP00000368796:R66W	R	+	1	2	MBTPS2	21771329	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	1.994000	0.40757	2.301000	0.77427	0.538000	0.68166	CGG	-	NULL		0.408	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS2	protein_coding	OTTHUMT00000056026.1	C			21771329	1	no_errors	NM_015884	genbank	human	validated	54_36p	missense	SNP	1	T
ARR3	407	genome.wustl.edu	37	X	69496551	69496551	+	Silent	SNP	C	C	T			TCGA-09-0366-01A-01W-0372-09	TCGA-09-0366-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	62269d21-50dc-42b0-b1e4-75ed8010080a	79fa14ed-bc6b-444f-a2d0-b69ec117defd	g.chrX:69496551C>T	ENST00000307959.8	+	8	489	c.438C>T	c.(436-438)ttC>ttT	p.F146F	ARR3_ENST00000374495.3_Silent_p.F146F	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)	146					endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)		p.F146F(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						TGAAGAGTTTCTGTGCTGAAA	0.507																																																1	Substitution - coding silent(1)	ovary(1)	X											110.0	96.0	101.0					X																	69496551		2203	4300	6503	69413276	SO:0001819	synonymous_variant	407				CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768	ENST00000307959.8:c.438C>T	X.37:g.69496551C>T		Somatic		Capture	Illumina GAIIx	4	69413276	B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Silent	SNP	-	p.F146	ENST00000307959.8	37	c.438	CCDS14399.1	X																																																																																			-	NULL		0.507	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARR3	protein_coding	OTTHUMT00000057055.2	C	NM_004312		69413276	1	no_errors	NM_004312	genbank	human	validated	54_36p	silent	SNP	1	T
