#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
COLGALT2	23127	hgsc.bcm.edu	37	1	183944320	183944320	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr1:183944320G>T	ENST00000361927.4	-	3	774	c.403C>A	c.(403-405)Cac>Aac	p.H135N	COLGALT2_ENST00000546159.1_Missense_Mutation_p.H135N	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	135					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)	p.H135N(1)									GTTGGCCAGTGCTTTGGTCCA	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											80.0	76.0	77.0					1																	183944320		2203	4300	6503	182210943	SO:0001583	missense	23127			AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.403C>A	1.37:g.183944320G>T	ENSP00000354960:p.His135Asn	Somatic		WXS	SOLID	Phase_III	182210943	O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	37	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	G	32	5.172796	0.94807	.	.	ENSG00000198756	ENST00000546159;ENST00000361927	T;T	0.21191	2.02;2.02	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.32556	0.0833	L	0.58925	1.835	0.80722	D	1	P;P	0.51653	0.921;0.947	B;P	0.48425	0.359;0.577	T	0.02450	-1.1157	10	0.41790	T	0.15	-11.8449	19.1269	0.93388	0.0:0.0:1.0:0.0	.	135;135	F5H3T5;Q8IYK4	.;GT252_HUMAN	N	135	ENSP00000439112:H135N;ENSP00000354960:H135N	ENSP00000354960:H135N	H	-	1	0	GLT25D2	182210943	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.497000	0.97970	2.583000	0.87209	0.650000	0.86243	CAC		0.428	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
IGSF10	285313	hgsc.bcm.edu	37	3	151163375	151163375	+	Missense_Mutation	SNP	A	A	T			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr3:151163375A>T	ENST00000282466.3	-	4	4393	c.4394T>A	c.(4393-4395)tTc>tAc	p.F1465Y		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1465					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.F1465Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GCTGCTCAAGAATGGTGGTAT	0.468																																																1	Substitution - Missense(1)	ovary(1)	3											149.0	124.0	132.0					3																	151163375		2203	4300	6503	152646065	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.4394T>A	3.37:g.151163375A>T	ENSP00000282466:p.Phe1465Tyr	Somatic		WXS	SOLID	Phase_III	152646065	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	A	14.03	2.413440	0.42817	.	.	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.68181	-0.31	5.72	3.36	0.38483	.	1.444780	0.04643	N	0.405713	T	0.42314	0.1197	N	0.08118	0	0.09310	N	1	P	0.49961	0.93	B	0.34722	0.188	T	0.34700	-0.9818	10	0.27082	T	0.32	.	7.0725	0.25187	0.6972:0.0:0.3028:0.0	.	1465	Q6WRI0	IGS10_HUMAN	Y	1465;92	ENSP00000282466:F1465Y	ENSP00000282466:F1465Y	F	-	2	0	IGSF10	152646065	0.000000	0.05858	0.101000	0.21167	0.140000	0.21249	-0.094000	0.11094	0.460000	0.27045	0.454000	0.30748	TTC		0.468	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
RPTOR	57521	hgsc.bcm.edu	37	17	78727815	78727816	+	Frame_Shift_Ins	INS	-	-	G			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr17:78727815_78727816insG	ENST00000306801.3	+	6	1022_1023	c.660_661insG	c.(661-663)gcafs	p.A221fs	RPTOR_ENST00000537330.1_Frame_Shift_Ins_p.A36fs|RPTOR_ENST00000544334.2_Frame_Shift_Ins_p.A221fs|RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000570891.1_Frame_Shift_Ins_p.A221fs	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	221					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.A221fs*41(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						TTCAGGTAGCTGCAATCAACCC	0.505																																																1	Insertion - Frameshift(1)	ovary(1)	17																																								76342411	SO:0001589	frameshift_variant	57521				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.661dupG	17.37:g.78727816_78727816dupG	ENSP00000307272:p.Ala221fs	Somatic		WXS	SOLID	Phase_III	76342410	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Frame_Shift_Ins	INS	ENST00000306801.3	37	CCDS11773.1																																																																																				0.505	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
TMEM135	65084	hgsc.bcm.edu	37	11	86778793	86778793	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr11:86778793G>C	ENST00000305494.5	+	2	238	c.199G>C	c.(199-201)Gag>Cag	p.E67Q	TMEM135_ENST00000355734.4_Missense_Mutation_p.E67Q|TMEM135_ENST00000340353.7_Missense_Mutation_p.E67Q|TMEM135_ENST00000532959.1_Intron|TMEM135_ENST00000535167.1_5'UTR	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	67					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)		p.E67Q(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				ACTACTCCCTGAGATCCTACA	0.363																																																1	Substitution - Missense(1)	ovary(1)	11											125.0	121.0	122.0					11																	86778793		2201	4299	6500	86456441	SO:0001583	missense	65084			BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.199G>C	11.37:g.86778793G>C	ENSP00000306344:p.Glu67Gln	Somatic		WXS	SOLID	Phase_III	86456441	Q6AW91|Q8ND01|Q9H6M3	Missense_Mutation	SNP	ENST00000305494.5	37	CCDS8280.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139549	0.77775	.	.	ENSG00000166575	ENST00000340353;ENST00000526733;ENST00000525018;ENST00000355734;ENST00000305494	T;T;T	0.48836	0.88;0.8;0.92	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.65481	0.2695	L	0.58101	1.795	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.999	P;D;D	0.74348	0.905;0.983;0.966	T	0.63377	-0.6651	9	.	.	.	-9.7214	17.9762	0.89128	0.0:0.0:1.0:0.0	.	67;67;67	Q86UB9-2;Q86UB9;Q8N605	.;TM135_HUMAN;.	Q	67	ENSP00000345513:E67Q;ENSP00000433927:E67Q;ENSP00000306344:E67Q	.	E	+	1	0	TMEM135	86456441	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	8.800000	0.91900	2.497000	0.84241	0.563000	0.77884	GAG		0.363	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393875.1	NM_022918	
TNFAIP3	7128	hgsc.bcm.edu	37	6	138192422	138192422	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr6:138192422A>C	ENST00000237289.4	+	2	124	c.58A>C	c.(58-60)Aag>Cag	p.K20Q		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	20					apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.K20Q(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		GAAAGCTGTGAAGATACGGGA	0.403			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""						OREG0031869	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)																									GBM(130;153 1739 22295 28918 47987)		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	26	Whole gene deletion(25)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(25)|ovary(1)	6											102.0	106.0	105.0					6																	138192422		2203	4300	6503	138234115	SO:0001583	missense	7128			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.58A>C	6.37:g.138192422A>C	ENSP00000237289:p.Lys20Gln	Somatic	1639	WXS	SOLID	Phase_III	138234115	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	CCDS5187.1	.	.	.	.	.	.	.	.	.	.	A	18.55	3.648589	0.67358	.	.	ENSG00000118503	ENST00000421450;ENST00000420009;ENST00000237289;ENST00000433680;ENST00000535574;ENST00000535332;ENST00000539356;ENST00000544646;ENST00000536070	T;T	0.36699	1.24;1.54	5.98	5.98	0.97165	.	0.096141	0.64402	D	0.000001	T	0.12987	0.0315	L	0.34521	1.04	0.52099	D	0.999941	D	0.55800	0.973	B	0.34346	0.18	T	0.06356	-1.0831	10	0.59425	D	0.04	-5.8807	10.9517	0.47334	0.9276:0.0:0.0724:0.0	.	20	P21580	TNAP3_HUMAN	Q	20	ENSP00000401562:K20Q;ENSP00000237289:K20Q	ENSP00000237289:K20Q	K	+	1	0	TNFAIP3	138234115	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.837000	0.75354	2.285000	0.76669	0.533000	0.62120	AAG		0.403	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
TOMM40	10452	hgsc.bcm.edu	37	19	45397256	45397256	+	Silent	SNP	G	G	C			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr19:45397256G>C	ENST00000426677.2	+	5	756	c.576G>C	c.(574-576)ggG>ggC	p.G192G	TOMM40_ENST00000252487.5_Silent_p.G192G|TOMM40_ENST00000405636.2_Silent_p.G192G|TOMM40_ENST00000592434.1_Silent_p.G192G	NM_001128917.1	NP_001122389.1	O96008	TOM40_HUMAN	translocase of outer mitochondrial membrane 40 homolog (yeast)	192					cellular protein metabolic process (GO:0044267)|ion transport (GO:0006811)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial outer membrane translocase complex (GO:0005742)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein transmembrane transporter activity (GO:0008320)	p.G192G(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(1)	5	Lung NSC(12;0.0018)|all_lung(12;0.00481)			OV - Ovarian serous cystadenocarcinoma(262;0.0033)|Epithelial(262;0.176)		AGGTGGACGGGGAGTATCGGG	0.647																																																1	Substitution - coding silent(1)	ovary(1)	19											47.0	46.0	46.0					19																	45397256		2203	4300	6503	50089096	SO:0001819	synonymous_variant	10452			AF043250	CCDS12646.1	19q13	2008-07-04				ENSG00000130204			18001	protein-coding gene	gene with protein product		608061				10980201, 15644312	Standard	NM_006114		Approved	PEREC1, D19S1177E, C19orf1, TOM40, PER-EC1	uc002paa.4	O96008		ENST00000426677.2:c.576G>C	19.37:g.45397256G>C		Somatic		WXS	SOLID	Phase_III	50089096	Q86VW4|Q8WY09|Q8WY10|Q8WY11|Q9BR95	Silent	SNP	ENST00000426677.2	37	CCDS12646.1																																																																																				0.647	TOMM40-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453241.1		
APOBEC3H	164668	hgsc.bcm.edu	37	22	39497388	39497388	+	Silent	SNP	C	C	T			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr22:39497388C>T	ENST00000401756.1	+	3	373	c.297C>T	c.(295-297)caC>caT	p.H99H	APOBEC3H_ENST00000442487.3_Silent_p.H99H|APOBEC3H_ENST00000348946.4_Silent_p.H99H|APOBEC3H_ENST00000421988.2_Silent_p.H99H	NM_001166003.1	NP_001159475.1	Q6NTF7	ABC3H_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H	99					cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral process (GO:0048525)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|zinc ion binding (GO:0008270)	p.H99H(1)		central_nervous_system(1)|kidney(8)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15	Melanoma(58;0.04)					TCAAGGCTCACGACCATCTGA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	22											115.0	81.0	93.0					22																	39497388		2203	4300	6503	37827334	SO:0001819	synonymous_variant	164668			BC069023	CCDS13985.1, CCDS54530.1, CCDS54531.1, CCDS54532.1	22q13.1	2007-02-01			ENSG00000100298	ENSG00000100298		"""Apolipoprotein B mRNA editing enzymes"""	24100	protein-coding gene	gene with protein product		610976				16571802	Standard	NM_001166003		Approved	ARP10	uc021wpt.1	Q6NTF7	OTTHUMG00000151082	ENST00000401756.1:c.297C>T	22.37:g.39497388C>T		Somatic		WXS	SOLID	Phase_III	37827334	B0QYP0|B0QYP1|B7TQM5|E9PF38|Q5JYL9|Q6IC87	Silent	SNP	ENST00000401756.1	37	CCDS54530.1																																																																																				0.612	APOBEC3H-002	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000321230.1	NM_181773	
BOC	91653	hgsc.bcm.edu	37	3	113002346	113002346	+	Silent	SNP	G	G	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr3:113002346G>A	ENST00000495514.1	+	16	3224	c.2520G>A	c.(2518-2520)ccG>ccA	p.P840P	BOC_ENST00000273395.4_Silent_p.P841P|BOC_ENST00000355385.3_Silent_p.P840P			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	840					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.P840P(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			TAGAGCGGCCGGTGGGCACTG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	3											82.0	91.0	88.0					3																	113002346		2203	4300	6503	114485036	SO:0001819	synonymous_variant	91653			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.2520G>A	3.37:g.113002346G>A		Somatic		WXS	SOLID	Phase_III	114485036	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Silent	SNP	ENST00000495514.1	37	CCDS2971.1																																																																																				0.627	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
CCDC186	55088	hgsc.bcm.edu	37	10	115894803	115894803	+	Silent	SNP	T	T	G			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr10:115894803T>G	ENST00000369287.3	-	10	1790	c.1524A>C	c.(1522-1524)ctA>ctC	p.L508L	C10orf118_ENST00000543782.1_Silent_p.L106L	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		508								p.L508L(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		GTTCATCTTCTAGACATTTCA	0.274																																																1	Substitution - coding silent(1)	ovary(1)	10											84.0	83.0	83.0					10																	115894803		2203	4298	6501	115884793	SO:0001819	synonymous_variant	55088																														ENST00000369287.3:c.1524A>C	10.37:g.115894803T>G		Somatic		WXS	SOLID	Phase_III	115884793	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Silent	SNP	ENST00000369287.3	37	CCDS7587.1																																																																																				0.274	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050455.1		
CDH22	64405	hgsc.bcm.edu	37	20	44869781	44869781	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr20:44869781C>T	ENST00000372262.3	-	2	771	c.371G>A	c.(370-372)cGc>cAc	p.R124H	CDH22_ENST00000537909.1_Missense_Mutation_p.R124H	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	124	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R124H(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GCGGTCCAGGCGCTCCATGGC	0.622																																																1	Substitution - Missense(1)	ovary(1)	20											80.0	67.0	71.0					20																	44869781		2203	4300	6503	44303188	SO:0001583	missense	64405			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.371G>A	20.37:g.44869781C>T	ENSP00000361336:p.Arg124His	Somatic		WXS	SOLID	Phase_III	44303188	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.544710	0.86022	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.53640	0.61;0.61	4.21	4.21	0.49690	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.70859	0.3272	M	0.82433	2.59	0.49915	D	0.999834	D	0.89917	1.0	D	0.85130	0.997	T	0.76788	-0.2830	10	0.72032	D	0.01	.	16.127	0.81402	0.0:1.0:0.0:0.0	.	124	Q9UJ99	CAD22_HUMAN	H	124	ENSP00000361336:R124H;ENSP00000437790:R124H	ENSP00000361336:R124H	R	-	2	0	CDH22	44303188	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.539000	0.67199	2.364000	0.80123	0.455000	0.32223	CGC		0.622	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
CHRNA1	1134	hgsc.bcm.edu	37	2	175618346	175618346	+	Silent	SNP	G	G	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr2:175618346G>A	ENST00000261007.5	-	7	804	c.738C>T	c.(736-738)atC>atT	p.I246I	AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Silent_p.I139I|CHRNA1_ENST00000409323.1_Silent_p.I221I|CHRNA1_ENST00000409219.1_Silent_p.I221I|CHRNA1_ENST00000348749.5_Silent_p.I221I	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	246					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)	p.I246I(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	AGTGGTAGGTGATGTCCAGGT	0.582																																																1	Substitution - coding silent(1)	ovary(1)	2											176.0	163.0	167.0					2																	175618346		2203	4300	6503	175326592	SO:0001819	synonymous_variant	1134			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.738C>T	2.37:g.175618346G>A		Somatic		WXS	SOLID	Phase_III	175326592	B4DRV6|D3DPE8	Silent	SNP	ENST00000261007.5	37	CCDS33331.1																																																																																				0.582	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1		
CRTC3	64784	hgsc.bcm.edu	37	15	91147677	91147677	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr15:91147677C>G	ENST00000268184.6	+	5	478	c.474C>G	c.(472-474)aaC>aaG	p.N158K	CRTC3_ENST00000558619.1_3'UTR|CTD-3065B20.3_ENST00000559839.1_RNA|CRTC3_ENST00000420329.2_Missense_Mutation_p.N158K			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	158					energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)	p.N158K(1)	CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			CTGCACTTAACAGGTACATGG	0.393			T	MAML2	salivary gland mucoepidermoid																																		Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	1	Substitution - Missense(1)	ovary(1)	15											115.0	111.0	112.0					15																	91147677		2198	4298	6496	88948681	SO:0001583	missense	64784				CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.474C>G	15.37:g.91147677C>G	ENSP00000268184:p.Asn158Lys	Somatic		WXS	SOLID	Phase_III	88948681	Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Missense_Mutation	SNP	ENST00000268184.6	37	CCDS32331.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987753	0.53934	.	.	ENSG00000140577	ENST00000437186;ENST00000268184;ENST00000420329	T;T	0.12465	2.68;2.68	6.03	5.11	0.69529	.	0.130222	0.48767	D	0.000171	T	0.13243	0.0321	L	0.50333	1.59	0.44780	D	0.997785	B;B	0.33637	0.296;0.42	B;B	0.29176	0.046;0.099	T	0.03662	-1.1015	10	0.45353	T	0.12	-22.7053	10.9987	0.47591	0.0:0.9153:0.0:0.0847	.	158;158	Q6UUV7;Q6UUV7-3	CRTC3_HUMAN;.	K	122;158;158	ENSP00000268184:N158K;ENSP00000416573:N158K	ENSP00000268184:N158K	N	+	3	2	CRTC3	88948681	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.133000	0.42093	1.551000	0.49450	0.655000	0.94253	AAC		0.393	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417716.2	NM_022769	
DNAH5	1767	hgsc.bcm.edu	37	5	13754367	13754367	+	Silent	SNP	T	T	C			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr5:13754367T>C	ENST00000265104.4	-	62	10604	c.10500A>G	c.(10498-10500)aaA>aaG	p.K3500K		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3500					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K3500K(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCCATCTTTCTTTTTCACCTG	0.413									Kartagener syndrome																																							1	Substitution - coding silent(1)	ovary(1)	5											119.0	116.0	117.0					5																	13754367		2203	4300	6503	13807367	SO:0001819	synonymous_variant	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.10500A>G	5.37:g.13754367T>C		Somatic		WXS	SOLID	Phase_III	13807367	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1																																																																																				0.413	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
EFEMP1	2202	hgsc.bcm.edu	37	2	56104917	56104917	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr2:56104917C>G	ENST00000394555.2	-	6	1159	c.724G>C	c.(724-726)Ggg>Cgg	p.G242R	EFEMP1_ENST00000355426.3_Missense_Mutation_p.G242R|EFEMP1_ENST00000394554.1_Missense_Mutation_p.G242R|EFEMP1_ENST00000424836.2_Intron	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	242	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)	p.G242R(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AATTGAAACCCAGGACTGCAC	0.448																																					GBM(92;934 1319 7714 28760 40110)											1	Substitution - Missense(1)	ovary(1)	2											176.0	161.0	166.0					2																	56104917		2203	4300	6503	55958421	SO:0001583	missense	2202			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.724G>C	2.37:g.56104917C>G	ENSP00000378058:p.Gly242Arg	Somatic		WXS	SOLID	Phase_III	55958421	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	ENST00000394555.2	37	CCDS1857.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259590	0.80246	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000405693;ENST00000355426	D;D;D	0.92752	-3.1;-3.1;-3.1	5.65	5.65	0.86999	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000004	D	0.98429	0.9477	H	0.99884	4.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99501	1.0953	10	0.87932	D	0	.	19.7347	0.96198	0.0:1.0:0.0:0.0	.	242	Q12805	FBLN3_HUMAN	R	242;242;98;242	ENSP00000378058:G242R;ENSP00000378057:G242R;ENSP00000347596:G242R	ENSP00000347596:G242R	G	-	1	0	EFEMP1	55958421	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.659000	0.83766	2.672000	0.90937	0.655000	0.94253	GGG		0.448	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2		
ELAVL3	1995	hgsc.bcm.edu	37	19	11569363	11569363	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr19:11569363G>A	ENST00000359227.3	-	4	821	c.397C>T	c.(397-399)Ccc>Tcc	p.P133S	ELAVL3_ENST00000438662.2_Missense_Mutation_p.P133S	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	133	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)	p.P133S(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						ATGGTCTTGGGGAGCCCGCTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											134.0	118.0	124.0					19																	11569363		2203	4300	6503	11430363	SO:0001583	missense	1995				CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.397C>T	19.37:g.11569363G>A	ENSP00000352162:p.Pro133Ser	Somatic		WXS	SOLID	Phase_III	11430363	Q16135|Q96CL8|Q96QS9	Missense_Mutation	SNP	ENST00000359227.3	37	CCDS32912.1	.	.	.	.	.	.	.	.	.	.	G	33	5.263436	0.95399	.	.	ENSG00000196361	ENST00000359227;ENST00000438662	T;T	0.22134	3.05;1.97	4.96	4.96	0.65561	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.39682	0.1087	L	0.45422	1.42	0.80722	D	1	D;D	0.71674	0.998;0.998	D;P	0.73380	0.98;0.84	T	0.21586	-1.0241	10	0.72032	D	0.01	.	16.9656	0.86285	0.0:0.0:1.0:0.0	.	133;133	Q14576;Q14576-2	ELAV3_HUMAN;.	S	133	ENSP00000352162:P133S;ENSP00000390878:P133S	ENSP00000352162:P133S	P	-	1	0	ELAVL3	11430363	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.719000	0.98760	2.311000	0.77944	0.491000	0.48974	CCC		0.602	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458827.2	NM_001420	
FAM163A	148753	hgsc.bcm.edu	37	1	179783001	179783001	+	Missense_Mutation	SNP	A	A	T			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr1:179783001A>T	ENST00000341785.4	+	5	577	c.181A>T	c.(181-183)Acc>Tcc	p.T61S	RP11-12M5.3_ENST00000415218.1_RNA|RP11-12M5.3_ENST00000453051.1_RNA	NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	61						integral component of membrane (GO:0016021)		p.T61S(1)		endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						CAGAGGCCCCACCTGCAATGC	0.672																																																1	Substitution - Missense(1)	ovary(1)	1											52.0	46.0	48.0					1																	179783001		2203	4299	6502	178049624	SO:0001583	missense	148753			BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.181A>T	1.37:g.179783001A>T	ENSP00000354891:p.Thr61Ser	Somatic		WXS	SOLID	Phase_III	178049624	A8K8R7	Missense_Mutation	SNP	ENST00000341785.4	37	CCDS1333.1	.	.	.	.	.	.	.	.	.	.	A	7.141	0.581894	0.13749	.	.	ENSG00000143340	ENST00000341785	.	.	.	4.63	-1.03	0.10102	.	0.559453	0.19372	N	0.115885	T	0.25121	0.0610	L	0.44542	1.39	0.19575	N	0.999965	B	0.02656	0.0	B	0.04013	0.001	T	0.28170	-1.0052	9	0.10111	T	0.7	-0.4107	5.3848	0.16213	0.4943:0.2811:0.2247:0.0	.	61	Q96GL9	F163A_HUMAN	S	61	.	ENSP00000354891:T61S	T	+	1	0	FAM163A	178049624	0.373000	0.25073	0.980000	0.43619	0.565000	0.35776	0.751000	0.26348	-0.395000	0.07715	0.379000	0.24179	ACC		0.672	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085300.1	NM_173509	
FAM186B	84070	hgsc.bcm.edu	37	12	49997067	49997067	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr12:49997067T>C	ENST00000257894.2	-	3	567	c.406A>G	c.(406-408)Aaa>Gaa	p.K136E	FAM186B_ENST00000551047.1_Missense_Mutation_p.K136E|FAM186B_ENST00000544141.1_Missense_Mutation_p.K46E|PRPF40B_ENST00000508736.1_Intron	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	136						protein complex (GO:0043234)		p.K136E(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GGTAACACTTTCTCCGTCACT	0.512																																																1	Substitution - Missense(1)	ovary(1)	12											242.0	167.0	193.0					12																	49997067		2203	4300	6503	48283334	SO:0001583	missense	84070			AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.406A>G	12.37:g.49997067T>C	ENSP00000257894:p.Lys136Glu	Somatic		WXS	SOLID	Phase_III	48283334	B4DZ15|Q8TCP7|Q9H0L3	Missense_Mutation	SNP	ENST00000257894.2	37	CCDS8788.1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.157146	0.38119	.	.	ENSG00000135436	ENST00000544141;ENST00000551047;ENST00000257894	T;T;T	0.51817	2.41;0.69;2.69	4.74	3.59	0.41128	.	0.311596	0.23171	N	0.051121	T	0.38081	0.1027	L	0.60455	1.87	0.27011	N	0.964683	P;P	0.40107	0.703;0.703	B;B	0.34873	0.191;0.191	T	0.27706	-1.0066	9	.	.	.	-10.1694	7.2663	0.26232	0.0:0.1032:0.0:0.8968	.	46;136	B4DZ15;Q8IYM0	.;F186B_HUMAN	E	46;136;136	ENSP00000438569:K46E;ENSP00000448656:K136E;ENSP00000257894:K136E	.	K	-	1	0	FAM186B	48283334	0.987000	0.35691	0.931000	0.37212	0.039000	0.13416	2.144000	0.42197	0.767000	0.33267	0.533000	0.62120	AAA		0.512	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394583.2	NM_032130	
ERVFRD-1	405754	hgsc.bcm.edu	37	6	11105009	11105009	+	Missense_Mutation	SNP	T	T	G			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr6:11105009T>G	ENST00000472091.1	-	2	910	c.535A>C	c.(535-537)Act>Cct	p.T179P	SMIM13_ENST00000416247.2_Intron|ERVFRD-1_ENST00000542862.1_Missense_Mutation_p.T179P	NM_207582.2	NP_997465.1	P60508	SYCY2_HUMAN	endogenous retrovirus group FRD, member 1	179					syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)		p.T179P(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(4)|stomach(1)	15						TGAGGAAAAGTAATATTTGGA	0.448																																																1	Substitution - Missense(1)	ovary(1)	6											140.0	154.0	149.0					6																	11105009		2202	4300	6502	11212995	SO:0001583	missense	405754			AK075092, AK123938, AY358244	CCDS4519.1	6p24.2	2014-05-02			ENSG00000244476	ENSG00000244476			33823	other	endogenous retrovirus		610524				12970426, 14557543, 15476554, 21542922	Standard	NM_207582		Approved	HERV-W/FRD, HERV-FRD, envFRD, ERVFRDE1, syncytin-2	uc003mzt.3	P60508	OTTHUMG00000159193	ENST00000472091.1:c.535A>C	6.37:g.11105009T>G	ENSP00000420174:p.Thr179Pro	Somatic		WXS	SOLID	Phase_III	11212995		Missense_Mutation	SNP	ENST00000472091.1	37	CCDS4519.1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.157720	0.38119	.	.	ENSG00000244476	ENST00000472091;ENST00000542862	T;T	0.15487	2.42;2.42	0.235	0.235	0.15431	.	.	.	.	.	T	0.06416	0.0165	N	0.24115	0.695	0.21256	N	0.999744	D	0.54964	0.969	P	0.50590	0.645	T	0.22382	-1.0218	8	0.52906	T	0.07	.	.	.	.	.	179	P60508	EFRD1_HUMAN	P	179	ENSP00000420174:T179P;ENSP00000444461:T179P	ENSP00000420174:T179P	T	-	1	0	ERVFRD-1	11212995	0.787000	0.28750	0.814000	0.32528	0.815000	0.46073	0.310000	0.19356	0.263000	0.21812	0.260000	0.18958	ACT		0.448	ERVFRD-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353776.1	NM_207582	
HIRA	7290	hgsc.bcm.edu	37	22	19373104	19373104	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr22:19373104C>G	ENST00000263208.5	-	12	1525	c.1269G>C	c.(1267-1269)atG>atC	p.M423I	HIRA_ENST00000541063.1_Missense_Mutation_p.M379I|HIRA_ENST00000546308.1_Missense_Mutation_p.M379I|HIRA_ENST00000340170.4_Missense_Mutation_p.M423I	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	423	Interaction with ASF1A.|Interaction with CCNA1.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.M423I(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					TGGCTGAGCCCATCTCCCTGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	22											92.0	80.0	84.0					22																	19373104		2203	4300	6503	17753104	SO:0001583	missense	7290			X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.1269G>C	22.37:g.19373104C>G	ENSP00000263208:p.Met423Ile	Somatic		WXS	SOLID	Phase_III	17753104	Q05BU9|Q8IXN2	Missense_Mutation	SNP	ENST00000263208.5	37	CCDS13759.1	.	.	.	.	.	.	.	.	.	.	C	9.853	1.194284	0.22037	.	.	ENSG00000100084	ENST00000340170;ENST00000263208;ENST00000541063;ENST00000546308	T;T;T;T	0.70869	-0.29;-0.52;-0.36;-0.31	5.44	-10.9	0.00192	.	0.598307	0.17529	N	0.170941	T	0.37404	0.1002	N	0.08118	0	0.19300	N	0.99998	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.09377	0.001;0.004;0.0	T	0.14811	-1.0459	10	0.38643	T	0.18	-1.233	7.0802	0.25227	0.1642:0.5044:0.1316:0.1997	.	379;423;423	F5H4M2;P54198-2;P54198	.;.;HIRA_HUMAN	I	423;423;379;379	ENSP00000345350:M423I;ENSP00000263208:M423I;ENSP00000446073:M379I;ENSP00000441870:M379I	ENSP00000263208:M423I	M	-	3	0	HIRA	17753104	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-1.854000	0.01664	-3.487000	0.00154	-0.290000	0.09829	ATG		0.572	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	NM_003325	
HMCN1	83872	hgsc.bcm.edu	37	1	186039781	186039781	+	Silent	SNP	A	A	G			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr1:186039781A>G	ENST00000271588.4	+	52	8260	c.8031A>G	c.(8029-8031)ccA>ccG	p.P2677P	HMCN1_ENST00000367492.2_Silent_p.P2677P	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2677	Ig-like C2-type 25.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.P2677P(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTTGGGGGCCAGGTCTTTCCC	0.408																																																1	Substitution - coding silent(1)	ovary(1)	1											102.0	106.0	105.0					1																	186039781		2203	4300	6503	184306404	SO:0001819	synonymous_variant	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.8031A>G	1.37:g.186039781A>G		Somatic		WXS	SOLID	Phase_III	184306404	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																				0.408	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HSP90B1	7184	hgsc.bcm.edu	37	12	104324315	104324315	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr12:104324315G>C	ENST00000299767.5	+	1	204	c.22G>C	c.(22-24)Ggc>Cgc	p.G8R	RP11-642P15.1_ENST00000548897.1_RNA|MIR3652_ENST00000579335.1_RNA	NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	8					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)	p.G8R(1)		central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	GTGGGTGCTGGGCCTCTGCTG	0.677																																																1	Substitution - Missense(1)	ovary(1)	12											31.0	28.0	29.0					12																	104324315		2203	4299	6502	102848445	SO:0001583	missense	7184			AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.22G>C	12.37:g.104324315G>C	ENSP00000299767:p.Gly8Arg	Somatic		WXS	SOLID	Phase_III	102848445	Q96A97	Missense_Mutation	SNP	ENST00000299767.5	37	CCDS9094.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592102	0.86953	.	.	ENSG00000166598	ENST00000299767;ENST00000421266;ENST00000537375	T	0.19105	2.17	5.38	5.38	0.77491	.	0.049241	0.85682	D	0.000000	T	0.44871	0.1314	M	0.75447	2.3	0.80722	D	1	D;P	0.58268	0.982;0.89	P;P	0.58172	0.834;0.642	T	0.35076	-0.9803	10	0.59425	D	0.04	.	19.3294	0.94280	0.0:0.0:1.0:0.0	.	34;8	Q59FC6;P14625	.;ENPL_HUMAN	R	8	ENSP00000299767:G8R	ENSP00000299767:G8R	G	+	1	0	HSP90B1	102848445	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	8.267000	0.89874	2.804000	0.96469	0.462000	0.41574	GGC		0.677	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407349.1	NM_003299	
KCTD1	284252	hgsc.bcm.edu	37	18	24039732	24039732	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr18:24039732G>A	ENST00000408011.3	-	4	1026	c.467C>T	c.(466-468)aCg>aTg	p.T156M	KCTD1_ENST00000580059.1_Missense_Mutation_p.T156M|KCTD1_ENST00000417602.1_Missense_Mutation_p.T764M|KCTD1_ENST00000579973.1_Missense_Mutation_p.T156M|KCTD1_ENST00000317932.7_Missense_Mutation_p.T156M	NM_001136205.2	NP_001129677.1	Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1	156					negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.T156M(1)		endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			ACCGCTTAGCGTGATCCTTTC	0.522																																																1	Substitution - Missense(1)	ovary(1)	18											129.0	109.0	115.0					18																	24039732		2203	4300	6503	22293730	SO:0001583	missense	284252			AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000408011.3:c.467C>T	18.37:g.24039732G>A	ENSP00000384367:p.Thr156Met	Somatic		WXS	SOLID	Phase_III	22293730	A8K1F5	Missense_Mutation	SNP	ENST00000408011.3	37	CCDS11888.1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.861542	0.32884	.	.	ENSG00000134504	ENST00000317932;ENST00000417602;ENST00000408011	T;T;T	0.77358	-0.71;-1.09;-0.71	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.59528	0.2200	N	0.04508	-0.205	0.58432	D	0.999999	B	0.17038	0.02	B	0.10450	0.005	T	0.56068	-0.8040	10	0.15952	T	0.53	.	19.1034	0.93283	0.0:0.0:1.0:0.0	.	156	Q719H9	KCTD1_HUMAN	M	156;764;156	ENSP00000314831:T156M;ENSP00000408405:T764M;ENSP00000384367:T156M	ENSP00000314831:T156M	T	-	2	0	KCTD1	22293730	1.000000	0.71417	0.993000	0.49108	0.977000	0.68977	5.108000	0.64609	2.517000	0.84864	0.655000	0.94253	ACG		0.522	KCTD1-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000446265.1	XM_209091	
NOX3	50508	hgsc.bcm.edu	37	6	155761198	155761198	+	Missense_Mutation	SNP	A	A	T	rs199815687		TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr6:155761198A>T	ENST00000159060.2	-	6	662	c.560T>A	c.(559-561)aTc>aAc	p.I187N		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	187	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)	p.I187N(1)		cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		CGAGGTCATGATCAAGACTAA	0.438																																																1	Substitution - Missense(1)	ovary(1)	6											147.0	136.0	140.0					6																	155761198		2203	4300	6503	155802890	SO:0001583	missense	50508			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.560T>A	6.37:g.155761198A>T	ENSP00000159060:p.Ile187Asn	Somatic		WXS	SOLID	Phase_III	155802890	Q9HBJ9	Missense_Mutation	SNP	ENST00000159060.2	37	CCDS5250.1	.	.	.	.	.	.	.	.	.	.	A	19.93	3.918994	0.73098	.	.	ENSG00000074771	ENST00000159060	D	0.91740	-2.9	5.83	5.83	0.93111	Flavoprotein transmembrane component (1);	0.090412	0.48286	D	0.000189	D	0.95626	0.8578	M	0.83483	2.645	0.58432	D	0.999992	D	0.67145	0.996	D	0.70016	0.967	D	0.96266	0.9195	10	0.87932	D	0	-16.1799	16.1946	0.82018	1.0:0.0:0.0:0.0	.	187	Q9HBY0	NOX3_HUMAN	N	187	ENSP00000159060:I187N	ENSP00000159060:I187N	I	-	2	0	NOX3	155802890	1.000000	0.71417	0.997000	0.53966	0.337000	0.28794	6.901000	0.75693	2.228000	0.72767	0.528000	0.53228	ATC		0.438	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		
NRG2	9542	hgsc.bcm.edu	37	5	139245143	139245143	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr5:139245143G>T	ENST00000361474.1	-	5	1404	c.1180C>A	c.(1180-1182)Cct>Act	p.P394T	NRG2_ENST00000394770.1_Missense_Mutation_p.P394T|NRG2_ENST00000289409.4_Intron|NRG2_ENST00000289422.7_Missense_Mutation_p.P394T|NRG2_ENST00000358522.3_Intron|NRG2_ENST00000545385.1_Intron|NRG2_ENST00000340391.3_Missense_Mutation_p.P191T|NRG2_ENST00000541337.1_Intron	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	394					embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.P394T(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTGCTTAGGATCTGGCATG	0.468																																																1	Substitution - Missense(1)	ovary(1)	5											106.0	102.0	103.0					5																	139245143		2203	4300	6503	139225327	SO:0001583	missense	9542				CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.1180C>A	5.37:g.139245143G>T	ENSP00000354910:p.Pro394Thr	Somatic		WXS	SOLID	Phase_III	139225327		Missense_Mutation	SNP	ENST00000361474.1	37	CCDS4217.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.570947	0.45798	.	.	ENSG00000158458	ENST00000289422;ENST00000361474;ENST00000446269;ENST00000394770;ENST00000340391;ENST00000544729;ENST00000378238	T;T;T;T;T	0.73363	-0.73;-0.56;-0.74;-0.4;-0.74	5.92	5.92	0.95590	.	0.422970	0.23108	N	0.051837	T	0.81187	0.4770	L	0.42245	1.32	0.58432	D	0.999998	B;D	0.89917	0.062;1.0	B;D	0.87578	0.021;0.998	T	0.73613	-0.3927	10	0.12103	T	0.63	-8.6388	18.5018	0.90884	0.0:0.0:1.0:0.0	.	394;394	O14511;O14511-3	NRG2_HUMAN;.	T	394;394;394;394;191;302;394	ENSP00000289422:P394T;ENSP00000354910:P394T;ENSP00000378251:P394T;ENSP00000342660:P191T;ENSP00000367483:P394T	ENSP00000289422:P394T	P	-	1	0	NRG2	139225327	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.430000	0.90283	2.810000	0.96702	0.650000	0.86243	CCT		0.468	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982	
PARS2	25973	hgsc.bcm.edu	37	1	55223917	55223917	+	Silent	SNP	C	C	T			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr1:55223917C>T	ENST00000371279.3	-	2	1000	c.918G>A	c.(916-918)gaG>gaA	p.E306E		NM_152268.3	NP_689481.2	Q7L3T8	SYPM_HUMAN	prolyl-tRNA synthetase 2, mitochondrial (putative)	306					gene expression (GO:0010467)|prolyl-tRNA aminoacylation (GO:0006433)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|proline-tRNA ligase activity (GO:0004827)	p.E306E(1)		breast(1)|endometrium(3)|kidney(2)|lung(4)|ovary(2)|prostate(2)|skin(1)	15					L-Proline(DB00172)	TGTGCCCCACCTCAATGCCTT	0.507																																																1	Substitution - coding silent(1)	ovary(1)	1											128.0	121.0	123.0					1																	55223917		2203	4300	6503	54996505	SO:0001819	synonymous_variant	25973			AK025585	CCDS597.1	1p32.2	2011-07-01	2007-02-23		ENSG00000162396	ENSG00000162396	6.1.1.15	"""Aminoacyl tRNA synthetases / Class II"""	30563	protein-coding gene	gene with protein product	"""proline tRNA ligase 2, mitochondrial (putative)"""	612036				15779907	Standard	NM_152268		Approved	DKFZp727A071	uc001cxy.3	Q7L3T8	OTTHUMG00000009915	ENST00000371279.3:c.918G>A	1.37:g.55223917C>T		Somatic		WXS	SOLID	Phase_III	54996505	A8K0W4|Q9H6S5|Q9UFT1	Silent	SNP	ENST00000371279.3	37	CCDS597.1																																																																																				0.507	PARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027436.1	NM_152268	
PRICKLE2	166336	hgsc.bcm.edu	37	3	64084736	64084736	+	Silent	SNP	G	G	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr3:64084736G>A	ENST00000295902.6	-	8	3111	c.2526C>T	c.(2524-2526)atC>atT	p.I842I	PRICKLE2-AS1_ENST00000476308.1_RNA|PRICKLE2-AS1_ENST00000460946.1_RNA|RP11-129B22.1_ENST00000482609.1_RNA|PRICKLE2_ENST00000564377.1_Silent_p.I898I	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	842					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.I842I(1)		breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		ATTAAGAAATGATACAGTTTT	0.433																																																1	Substitution - coding silent(1)	ovary(1)	3											99.0	101.0	101.0					3																	64084736		2203	4300	6503	64059776	SO:0001819	synonymous_variant	166336			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.2526C>T	3.37:g.64084736G>A		Somatic		WXS	SOLID	Phase_III	64059776	Q0VF44	Silent	SNP	ENST00000295902.6	37	CCDS2902.1																																																																																				0.433	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
SALL4	57167	hgsc.bcm.edu	37	20	50406888	50406888	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr20:50406888G>A	ENST00000217086.4	-	2	2245	c.2134C>T	c.(2134-2136)Ctt>Ttt	p.L712F	SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Intron|SALL4_ENST00000395997.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	712					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L712F(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ATGCTGGGAAGAGGCGTGGGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	20											40.0	38.0	39.0					20																	50406888		2203	4300	6503	49840295	SO:0001583	missense	57167			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2134C>T	20.37:g.50406888G>A	ENSP00000217086:p.Leu712Phe	Somatic		WXS	SOLID	Phase_III	49840295	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	G	0.070	-1.204892	0.01568	.	.	ENSG00000101115	ENST00000217086	T	0.09350	2.99	5.47	1.95	0.26073	.	0.382752	0.19354	N	0.116306	T	0.07143	0.0181	L	0.41415	1.275	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.41088	-0.9528	10	0.11485	T	0.65	-10.0869	5.4989	0.16817	0.147:0.3991:0.4538:0.0	.	712	Q9UJQ4	SALL4_HUMAN	F	712	ENSP00000217086:L712F	ENSP00000217086:L712F	L	-	1	0	SALL4	49840295	0.005000	0.15991	0.014000	0.15608	0.002000	0.02628	1.647000	0.37260	0.621000	0.30232	-0.304000	0.09214	CTT		0.587	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
SART1	9092	hgsc.bcm.edu	37	11	65745239	65745239	+	Missense_Mutation	SNP	A	A	G			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr11:65745239A>G	ENST00000312397.5	+	17	2133	c.2041A>G	c.(2041-2043)Atc>Gtc	p.I681V		NM_005146.4	NP_005137.1	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T cells	681					cell cycle arrest (GO:0007050)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.I681V(1)		endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GGCCAGGGCCATCGATGACAA	0.602																																																1	Substitution - Missense(1)	ovary(1)	11											80.0	74.0	76.0					11																	65745239		2201	4296	6497	65501815	SO:0001583	missense	9092			AB006198	CCDS31611.1	11q13.1	2009-01-06	2006-12-07		ENSG00000175467	ENSG00000175467			10538	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 110kDa (U4/U6.U5)"""	605941	"""squamous cell carcinoma antigen recognised by T cells"""			9449708	Standard	NM_005146		Approved	Ara1, Snu66, SNRNP110	uc001ogl.3	O43290	OTTHUMG00000166771	ENST00000312397.5:c.2041A>G	11.37:g.65745239A>G	ENSP00000310448:p.Ile681Val	Somatic		WXS	SOLID	Phase_III	65501815	A6NDN1|Q53GB5	Missense_Mutation	SNP	ENST00000312397.5	37	CCDS31611.1	.	.	.	.	.	.	.	.	.	.	A	11.88	1.771719	0.31320	.	.	ENSG00000175467	ENST00000312397;ENST00000542816	T	0.22336	1.96	4.32	4.32	0.51571	.	0.065161	0.56097	D	0.000026	T	0.19446	0.0467	L	0.41356	1.27	0.42524	D	0.993011	B	0.29988	0.264	B	0.32022	0.139	T	0.06826	-1.0805	10	0.87932	D	0	-7.8253	11.463	0.50221	1.0:0.0:0.0:0.0	.	681	O43290	SNUT1_HUMAN	V	681;523	ENSP00000310448:I681V	ENSP00000310448:I681V	I	+	1	0	SART1	65501815	1.000000	0.71417	0.998000	0.56505	0.319000	0.28217	6.260000	0.72502	1.815000	0.52974	0.402000	0.26972	ATC		0.602	SART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391409.1		
SLC16A14	151473	hgsc.bcm.edu	37	2	230911026	230911026	+	Silent	SNP	C	C	T			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr2:230911026C>T	ENST00000295190.4	-	4	1274	c.816G>A	c.(814-816)ggG>ggA	p.G272G		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.G272G(1)		NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		TCTTCCTGTGCCCGGCCTGAT	0.587																																																1	Substitution - coding silent(1)	ovary(1)	2											89.0	90.0	90.0					2																	230911026		2203	4300	6503	230619270	SO:0001819	synonymous_variant	151473			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.816G>A	2.37:g.230911026C>T		Somatic		WXS	SOLID	Phase_III	230619270	A8KA08|Q53R92|Q96NI7	Silent	SNP	ENST00000295190.4	37	CCDS2473.1																																																																																				0.587	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527	
SLC4A4	8671	hgsc.bcm.edu	37	4	72420864	72420864	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr4:72420864C>A	ENST00000264485.5	+	21	2819	c.2702C>A	c.(2701-2703)cCc>cAc	p.P901H	SLC4A4_ENST00000425175.1_Missense_Mutation_p.P901H|SLC4A4_ENST00000340595.3_Missense_Mutation_p.P857H|SLC4A4_ENST00000351898.6_Missense_Mutation_p.P817H	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	901					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.P857H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TAGTTTATACCCATGCCTGTA	0.328																																																1	Substitution - Missense(1)	ovary(1)	4											257.0	257.0	257.0					4																	72420864		2203	4300	6503	72639728	SO:0001583	missense	8671			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2702C>A	4.37:g.72420864C>A	ENSP00000264485:p.Pro901His	Somatic		WXS	SOLID	Phase_III	72639728	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	37	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.871250	0.91587	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000340595	D;D;T;D	0.89123	-2.47;-2.47;-1.49;-2.47	5.75	5.75	0.90469	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96694	0.8921	H	0.96333	3.805	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.997;0.998	D	0.97178	0.9849	10	0.87932	D	0	.	20.3046	0.98621	0.0:1.0:0.0:0.0	.	901;817;857;901	A5JJ20;Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1	.;.;.;S4A4_HUMAN	H	901;901;817;857	ENSP00000264485:P901H;ENSP00000393557:P901H;ENSP00000307349:P817H;ENSP00000344272:P857H	ENSP00000264485:P901H	P	+	2	0	SLC4A4	72639728	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.016000	0.70798	2.878000	0.98634	0.650000	0.86243	CCC		0.328	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
TBC1D22A	25771	hgsc.bcm.edu	37	22	47433033	47433033	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr22:47433033A>C	ENST00000337137.4	+	11	1434	c.1268A>C	c.(1267-1269)aAc>aCc	p.N423T	TBC1D22A_ENST00000407381.3_Missense_Mutation_p.N364T|TBC1D22A_ENST00000355704.3_Missense_Mutation_p.N345T|TBC1D22A_ENST00000406733.1_Missense_Mutation_p.N376T	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	423	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)	p.N423T(1)		breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		CGCTGGATGAACAACCTGCTG	0.597																																																1	Substitution - Missense(1)	ovary(1)	22											125.0	100.0	108.0					22																	47433033		2203	4300	6503	45811697	SO:0001583	missense	25771			AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.1268A>C	22.37:g.47433033A>C	ENSP00000336724:p.Asn423Thr	Somatic		WXS	SOLID	Phase_III	45811697	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	ENST00000337137.4	37	CCDS14078.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.250837	0.80135	.	.	ENSG00000054611	ENST00000337137;ENST00000407381;ENST00000355704;ENST00000406733	T;T;T;T	0.10668	2.85;2.85;2.85;2.85	4.59	4.59	0.56863	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.29423	0.0733	M	0.67953	2.075	0.80722	D	1	D;D;D;D	0.89917	0.995;1.0;1.0;0.995	D;D;D;D	0.91635	0.947;0.997;0.999;0.947	T	0.01330	-1.1383	10	0.41790	T	0.15	.	12.943	0.58357	1.0:0.0:0.0:0.0	.	423;345;364;423	B9A6M3;Q8WUA7-2;B0QYI1;Q8WUA7	.;.;.;TB22A_HUMAN	T	423;364;345;376	ENSP00000336724:N423T;ENSP00000384036:N364T;ENSP00000347932:N345T;ENSP00000385634:N376T	ENSP00000336724:N423T	N	+	2	0	TBC1D22A	45811697	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.295000	0.89937	1.912000	0.55364	0.379000	0.24179	AAC		0.597	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317600.3	NM_014346	
TEKT3	64518	hgsc.bcm.edu	37	17	15234458	15234458	+	Missense_Mutation	SNP	G	G	A	rs200458813		TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr17:15234458G>A	ENST00000395930.1	-	3	631	c.445C>T	c.(445-447)Cgt>Tgt	p.R149C	TEKT3_ENST00000338696.2_Missense_Mutation_p.R149C	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	149					cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.R149C(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		TCATTGACACGTTCTCCCAGA	0.383													G|||	1	0.000199681	0.0	0.0	5008	,	,		19464	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	17						G	CYS/ARG	0,4406		0,0,2203	229.0	209.0	216.0		445	4.6	1.0	17		216	1,8599	1.2+/-3.3	0,1,4299	no	missense	TEKT3	NM_031898.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	149/491	15234458	1,13005	2203	4300	6503	15175183	SO:0001583	missense	64518			AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.445C>T	17.37:g.15234458G>A	ENSP00000379263:p.Arg149Cys	Somatic		WXS	SOLID	Phase_III	15175183	B2RAS7|D3DTT0|Q8N5R5|Q96M48	Missense_Mutation	SNP	ENST00000395930.1	37	CCDS11169.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328142	0.81690	0.0	1.16E-4	ENSG00000125409	ENST00000395930;ENST00000338696	T;T	0.10288	2.89;2.89	5.61	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.46229	0.1382	H	0.95745	3.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61710	-0.7007	10	0.87932	D	0	-0.5367	16.4838	0.84179	0.0:0.0:0.8688:0.1312	.	149	Q9BXF9	TEKT3_HUMAN	C	149	ENSP00000379263:R149C;ENSP00000343995:R149C	ENSP00000343995:R149C	R	-	1	0	TEKT3	15175183	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.058000	0.57463	2.808000	0.96608	0.655000	0.94253	CGT		0.383	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130385.2	NM_031898	
TMEM8B	51754	hgsc.bcm.edu	37	9	35842574	35842574	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr9:35842574G>A	ENST00000377991.4	+	7	1154	c.139G>A	c.(139-141)Gac>Aac	p.D47N	TMEM8B_ENST00000377996.1_Missense_Mutation_p.D47N|TMEM8B_ENST00000473947.1_Intron|TMEM8B_ENST00000377988.2_Missense_Mutation_p.D47N|TMEM8B_ENST00000439587.2_Missense_Mutation_p.D47N	NM_001042589.2	NP_001036054.1	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B	47					cell-matrix adhesion (GO:0007160)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle (GO:0007346)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.D47N(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	7						CAACGAGCTGGACACCTTCTC	0.652																																																1	Substitution - Missense(1)	ovary(1)	9											94.0	74.0	81.0					9																	35842574		2203	4300	6503	35832574	SO:0001583	missense	51754			BC043384	CCDS6595.1, CCDS43800.1	9p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000137103	ENSG00000137103			21427	protein-coding gene	gene with protein product	"""nasopharyngeal carcinoma expressed 6"""		"""chromosome 9 open reading frame 127"""	C9orf127		12918109, 8619474	Standard	NM_016446		Approved	NAG-5, NGX6	uc003zym.4	A6NDV4	OTTHUMG00000019885	ENST00000377991.4:c.139G>A	9.37:g.35842574G>A	ENSP00000367230:p.Asp47Asn	Somatic		WXS	SOLID	Phase_III	35832574	B3KQF3|O75539|Q49AB1|Q4KMX5|Q5TCW5|Q9HBY2|Q9P0U7	Missense_Mutation	SNP	ENST00000377991.4	37	CCDS43800.1	.	.	.	.	.	.	.	.	.	.	G	35	5.419241	0.96092	.	.	ENSG00000137103	ENST00000377996;ENST00000439587;ENST00000377991;ENST00000377988	T;T;T;T	0.67698	-0.28;-0.28;-0.07;-0.07	5.54	5.54	0.83059	.	0.045965	0.85682	D	0.000000	T	0.81054	0.4743	M	0.69358	2.11	0.48762	D	0.999704	D;P	0.63880	0.993;0.911	D;P	0.72338	0.977;0.479	T	0.81904	-0.0719	10	0.72032	D	0.01	-11.2432	18.424	0.90602	0.0:0.0:1.0:0.0	.	47;411	A6NDV4;Q5TCW0	TMM8B_HUMAN;.	N	47	ENSP00000367235:D47N;ENSP00000395810:D47N;ENSP00000367230:D47N;ENSP00000367227:D47N	ENSP00000367227:D47N	D	+	1	0	TMEM8B	35832574	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.643000	0.83403	2.769000	0.95229	0.563000	0.77884	GAC		0.652	TMEM8B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052388.2	NM_016446	
ZNF555	148254	hgsc.bcm.edu	37	19	2853696	2853696	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr19:2853696T>C	ENST00000334241.4	+	4	1771	c.1633T>C	c.(1633-1635)Ttc>Ctc	p.F545L	AC006130.3_ENST00000589365.1_RNA|ZNF555_ENST00000591539.1_Missense_Mutation_p.F544L	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	545					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F545L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGAAGGTCTTCAAATGGCC	0.428																																																1	Substitution - Missense(1)	ovary(1)	19											144.0	118.0	127.0					19																	2853696		2203	4300	6503	2804696	SO:0001583	missense	148254			AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300		"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product						12477932	Standard	NM_152791		Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000334241.4:c.1633T>C	19.37:g.2853696T>C	ENSP00000334853:p.Phe545Leu	Somatic		WXS	SOLID	Phase_III	2804696	A8KA89|K7EQM2|Q8NA46|Q96MP1	Missense_Mutation	SNP	ENST00000334241.4	37	CCDS12096.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.064782	0.76187	.	.	ENSG00000186300	ENST00000334241;ENST00000382127	T	0.46063	0.88	2.93	2.93	0.34026	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.54983	0.1892	L	0.52011	1.625	0.32652	N	0.5192	D;D	0.89917	0.999;1.0	D;D	0.87578	0.925;0.998	T	0.63377	-0.6651	9	0.87932	D	0	.	9.242	0.37502	0.0:0.0:0.0:1.0	.	545;544	Q8NEP9;A8KA89	ZN555_HUMAN;.	L	545;460	ENSP00000334853:F545L	ENSP00000334853:F545L	F	+	1	0	ZNF555	2804696	1.000000	0.71417	0.511000	0.27724	0.943000	0.58893	7.073000	0.76784	1.346000	0.45694	0.379000	0.24179	TTC		0.428	ZNF555-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451637.3	NM_152791	
ZNF559	84527	hgsc.bcm.edu	37	19	9452608	9452608	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr19:9452608C>A	ENST00000393883.2	+	6	1129	c.481C>A	c.(481-483)Cat>Aat	p.H161N	ZNF559_ENST00000592896.1_3'UTR|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000538743.1_Missense_Mutation_p.H81N|ZNF559_ENST00000603380.1_Missense_Mutation_p.H161N|ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000585352.1_3'UTR|ZNF559_ENST00000587557.1_Missense_Mutation_p.H225N|CTC-325H20.2_ENST00000592371.1_lincRNA|ZNF559_ENST00000317221.7_3'UTR|ZNF559_ENST00000586255.1_Intron|ZNF559_ENST00000592504.1_3'UTR|ZNF177_ENST00000602856.1_Intron|ZNF177_ENST00000446085.4_Intron	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	161					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H161N(1)		endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						CCAACATCTACATCTTGTTTG	0.368																																																1	Substitution - Missense(1)	ovary(1)	19											112.0	113.0	113.0					19																	9452608		2203	4300	6503	9313608	SO:0001583	missense	84527			AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.481C>A	19.37:g.9452608C>A	ENSP00000377461:p.His161Asn	Somatic		WXS	SOLID	Phase_III	9313608	K7EMG6	Missense_Mutation	SNP	ENST00000393883.2	37	CCDS12211.1	.	.	.	.	.	.	.	.	.	.	C	0.032	-1.327153	0.01309	.	.	ENSG00000188321	ENST00000317221;ENST00000538743;ENST00000393883	T;T	0.59364	0.27;3.42	0.961	-1.92	0.07618	.	.	.	.	.	T	0.33904	0.0879	N	0.16862	0.45	0.09310	N	1	B;B;P	0.39094	0.002;0.014;0.659	B;B;B	0.42959	0.002;0.002;0.403	T	0.21930	-1.0231	9	0.11182	T	0.66	.	1.6711	0.02812	0.3517:0.3404:0.0:0.3079	.	161;161;81	B3KPL8;Q9BR84;B4DP29	.;ZN559_HUMAN;.	N	161;81;161	ENSP00000442832:H81N;ENSP00000377461:H161N	ENSP00000325393:H161N	H	+	1	0	ZNF559	9313608	0.000000	0.05858	0.000000	0.03702	0.148000	0.21650	-2.538000	0.00938	-0.808000	0.04387	0.393000	0.25936	CAT		0.368	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
ABCA5	23461	hgsc.bcm.edu	37	17	67255915	67255915	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr17:67255915C>A	ENST00000392676.3	-	28	3727	c.3663G>T	c.(3661-3663)tgG>tgT	p.W1221C	ABCA5_ENST00000588877.1_Missense_Mutation_p.W1221C|ABCA5_ENST00000392677.2_Missense_Mutation_p.W1222C			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	1221					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.W1221C(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	AGAGGAAAATCCACAGTACAC	0.323																																																1	Substitution - Missense(1)	ovary(1)	17											61.0	59.0	59.0					17																	67255915		2203	4299	6502	64767510	SO:0001583	missense	23461			U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.3663G>T	17.37:g.67255915C>A	ENSP00000376443:p.Trp1221Cys	Somatic		WXS	SOLID	Phase_III	64767510	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	37	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.915953	0.73098	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	D;D	0.87179	-2.22;-2.22	5.85	5.85	0.93711	.	0.000000	0.51477	D	0.000081	D	0.91737	0.7387	M	0.65975	2.015	0.80722	D	1	D	0.71674	0.998	D	0.64144	0.922	D	0.90896	0.4765	9	.	.	.	.	15.6152	0.76760	0.0:0.8632:0.1368:0.0	.	1221	Q8WWZ7	ABCA5_HUMAN	C	1222;1221	ENSP00000376444:W1222C;ENSP00000376443:W1221C	.	W	-	3	0	ABCA5	64767510	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.870000	0.63035	2.767000	0.95098	0.563000	0.77884	TGG		0.323	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
ADAMTS2	9509	hgsc.bcm.edu	37	5	178541232	178541232	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr5:178541232T>C	ENST00000251582.7	-	22	3373	c.3272A>G	c.(3271-3273)aAg>aGg	p.K1091R		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1091	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.K1091R(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GTTACAGGACTTGCAGCACAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	5											118.0	91.0	100.0					5																	178541232		2203	4300	6503	178473838	SO:0001583	missense	9509			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3272A>G	5.37:g.178541232T>C	ENSP00000251582:p.Lys1091Arg	Somatic		WXS	SOLID	Phase_III	178473838		Missense_Mutation	SNP	ENST00000251582.7	37	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.997007	0.74818	.	.	ENSG00000087116	ENST00000251582	T	0.60299	0.2	5.39	2.99	0.34606	PLAC (1);	0.098661	0.43919	D	0.000511	T	0.56992	0.2023	L	0.56769	1.78	0.80722	D	1	D	0.58268	0.982	P	0.48738	0.588	T	0.55023	-0.8205	10	0.48119	T	0.1	.	9.0249	0.36222	0.0:0.151:0.0:0.849	.	1091	O95450	ATS2_HUMAN	R	1091	ENSP00000251582:K1091R	ENSP00000251582:K1091R	K	-	2	0	ADAMTS2	178473838	1.000000	0.71417	0.920000	0.36463	0.972000	0.66771	4.155000	0.58131	0.445000	0.26639	0.459000	0.35465	AAG		0.532	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
BAI3	577	hgsc.bcm.edu	37	6	69703742	69703742	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr6:69703742C>A	ENST00000370598.1	+	11	2638	c.1817C>A	c.(1816-1818)aCt>aAt	p.T606N		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	606					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T606N(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TTGGATTTAACTCAGAGAAAA	0.443																																																1	Substitution - Missense(1)	ovary(1)	6											172.0	181.0	178.0					6																	69703742		2203	4300	6503	69760463	SO:0001583	missense	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1817C>A	6.37:g.69703742C>A	ENSP00000359630:p.Thr606Asn	Somatic		WXS	SOLID	Phase_III	69760463	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.004820	0.93287	.	.	ENSG00000135298	ENST00000370598	T	0.18338	2.22	6.05	6.05	0.98169	Domain of unknown function DUF3497 (1);	0.056343	0.64402	D	0.000001	T	0.26412	0.0645	L	0.50333	1.59	0.80722	D	1	D	0.60160	0.987	P	0.57204	0.815	T	0.00392	-1.1768	10	0.72032	D	0.01	.	20.6013	0.99457	0.0:1.0:0.0:0.0	.	606	O60242	BAI3_HUMAN	N	606	ENSP00000359630:T606N	ENSP00000359630:T606N	T	+	2	0	BAI3	69760463	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.052000	0.71080	2.878000	0.98634	0.650000	0.86243	ACT		0.443	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
C9orf72	203228	hgsc.bcm.edu	37	9	27558578	27558578	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr9:27558578T>C	ENST00000380003.3	-	7	829	c.766A>G	c.(766-768)Act>Gct	p.T256A	C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	256					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)	p.T256A(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		TCTGCTGGAGTCAGAAAAAGG	0.338																																																1	Substitution - Missense(1)	ovary(1)	9											61.0	61.0	61.0					9																	27558578		2202	4298	6500	27548578	SO:0001583	missense	203228			AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.766A>G	9.37:g.27558578T>C	ENSP00000369339:p.Thr256Ala	Somatic		WXS	SOLID	Phase_III	27548578	A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Missense_Mutation	SNP	ENST00000380003.3	37	CCDS6522.1	.	.	.	.	.	.	.	.	.	.	T	16.29	3.082292	0.55861	.	.	ENSG00000147894	ENST00000380003	T	0.44482	0.92	5.93	5.93	0.95920	.	0.046386	0.85682	D	0.000000	T	0.35422	0.0931	L	0.39898	1.24	0.80722	D	1	B	0.26147	0.143	B	0.30572	0.117	T	0.15321	-1.0441	9	.	.	.	.	11.4643	0.50230	0.1342:0.0:0.0:0.8658	.	256	Q96LT7	CI072_HUMAN	A	256	ENSP00000369339:T256A	.	T	-	1	0	C9orf72	27548578	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.583000	0.67484	2.258000	0.74832	0.533000	0.62120	ACT		0.338	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	NM_018325	
DLC1	10395	hgsc.bcm.edu	37	8	12947955	12947955	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr8:12947955G>A	ENST00000276297.4	-	15	4289	c.3880C>T	c.(3880-3882)Cgt>Tgt	p.R1294C	DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000520226.1_Missense_Mutation_p.R783C|DLC1_ENST00000358919.2_Missense_Mutation_p.R857C|DLC1_ENST00000512044.2_Missense_Mutation_p.R891C	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1294					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.R1294C(2)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TAGGAATTACGACATCGGCTC	0.512																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	8											96.0	85.0	89.0					8																	12947955		2203	4300	6503	12992326	SO:0001583	missense	10395			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3880C>T	8.37:g.12947955G>A	ENSP00000276297:p.Arg1294Cys	Somatic		WXS	SOLID	Phase_III	12992326	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041115	0.55003	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.07216	3.46;3.22;3.22;3.21	5.32	3.5	0.40072	.	0.000000	0.85682	D	0.000000	T	0.21841	0.0526	L	0.57536	1.79	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.87578	0.893;0.985;0.998	T	0.00366	-1.1786	10	0.42905	T	0.14	.	10.499	0.44794	0.069:0.0:0.7972:0.1337	.	1294;891;857	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	C	1294;857;233;891;783	ENSP00000276297:R1294C;ENSP00000351797:R857C;ENSP00000422595:R891C;ENSP00000428028:R783C	ENSP00000276297:R1294C	R	-	1	0	DLC1	12992326	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	4.784000	0.62411	0.906000	0.36621	0.655000	0.94253	CGT		0.512	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
ENPP3	5169	hgsc.bcm.edu	37	6	132047342	132047342	+	Splice_Site	SNP	T	T	C			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr6:132047342T>C	ENST00000414305.1	+	21	2281		c.e21+2		ENPP3_ENST00000358229.5_Splice_Site|ENPP3_ENST00000357639.3_Splice_Site			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3						immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.?(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		CCCCAGTTGGTAAGTTCCTGA	0.423																																																1	Unknown(1)	ovary(1)	6											144.0	137.0	139.0					6																	132047342		2203	4300	6503	132089035	SO:0001630	splice_region_variant	5169			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1953+2T>C	6.37:g.132047342T>C		Somatic		WXS	SOLID	Phase_III	132089035	Q5JTL3	Splice_Site	SNP	ENST00000414305.1	37	CCDS5148.1	.	.	.	.	.	.	.	.	.	.	T	9.501	1.103168	0.20632	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000358229	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.6684	0.39998	0.0:0.0785:0.0:0.9215	.	.	.	.	.	-1	.	.	.	+	.	.	ENPP3	132089035	1.000000	0.71417	0.694000	0.30210	0.043000	0.13939	4.691000	0.61738	2.039000	0.60335	0.460000	0.39030	.		0.423	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2		Intron
KIF2B	84643	hgsc.bcm.edu	37	17	51902168	51902168	+	Nonsense_Mutation	SNP	C	C	T			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr17:51902168C>T	ENST00000268919.4	+	1	1930	c.1774C>T	c.(1774-1776)Cag>Tag	p.Q592*		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	592					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q592*(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GAGTGAGGAGCAGAAAGAGAT	0.413																																																1	Substitution - Nonsense(1)	ovary(1)	17											124.0	123.0	123.0					17																	51902168		2203	4300	6503	49257167	SO:0001587	stop_gained	84643			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1774C>T	17.37:g.51902168C>T	ENSP00000268919:p.Gln592*	Somatic		WXS	SOLID	Phase_III	49257167	Q96MA2|Q9BXG6	Nonsense_Mutation	SNP	ENST00000268919.4	37	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.427549	0.62733	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	.	.	.	5.51	4.54	0.55810	.	0.551367	0.13206	U	0.405576	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	13.5857	0.61928	0.0:0.1637:0.8363:0.0	.	.	.	.	X	592;480	.	ENSP00000268919:Q592X	Q	+	1	0	KIF2B	49257167	0.000000	0.05858	0.031000	0.17742	0.001000	0.01503	0.061000	0.14366	1.449000	0.47699	-0.165000	0.13383	CAG		0.413	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559	
KTN1	3895	hgsc.bcm.edu	37	14	56119763	56119763	+	Missense_Mutation	SNP	A	A	G			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr14:56119763A>G	ENST00000395314.3	+	27	2791	c.2723A>G	c.(2722-2724)aAa>aGa	p.K908R	KTN1_ENST00000438792.2_Missense_Mutation_p.K908R|KTN1_ENST00000554507.1_Missense_Mutation_p.K203R|KTN1_ENST00000395308.1_Missense_Mutation_p.K885R|KTN1_ENST00000416613.1_Missense_Mutation_p.K908R|KTN1_ENST00000395309.3_Missense_Mutation_p.K908R|KTN1_ENST00000413890.2_Missense_Mutation_p.K885R|Y_RNA_ENST00000363872.1_RNA|KTN1_ENST00000395311.1_Missense_Mutation_p.K885R	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	908					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.K908R(1)		breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						GAATCTTTAAAAGCACATGTT	0.264			T	RET	papillary thryoid																																		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	1	Substitution - Missense(1)	ovary(1)	14											337.0	363.0	354.0					14																	56119763		2201	4294	6495	55189516	SO:0001583	missense	3895				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.2723A>G	14.37:g.56119763A>G	ENSP00000378725:p.Lys908Arg	Somatic		WXS	SOLID	Phase_III	55189516	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	ENST00000395314.3	37	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	A	12.79	2.043825	0.36085	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613;ENST00000554507	T;T;T;T;T;T;T;T	0.52983	1.55;1.44;1.36;1.44;1.55;1.55;1.44;0.64	5.42	5.42	0.78866	.	0.148866	0.31566	N	0.007438	T	0.52933	0.1765	L	0.46157	1.445	0.24444	N	0.994516	P;D;P;P;P	0.62365	0.763;0.991;0.884;0.804;0.763	B;P;P;B;B	0.57324	0.288;0.818;0.559;0.36;0.288	T	0.46610	-0.9179	10	0.19590	T	0.45	-15.8496	12.2458	0.54571	0.8483:0.1517:0.0:0.0	.	908;203;908;885;908	B4DZ88;G3V4Y7;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;.;KTN1_HUMAN	R	885;908;908;908;885;885;908;203	ENSP00000394992:K885R;ENSP00000378720:K908R;ENSP00000391964:K908R;ENSP00000378725:K908R;ENSP00000378719:K885R;ENSP00000378722:K885R;ENSP00000388807:K908R;ENSP00000452073:K203R	ENSP00000378719:K885R	K	+	2	0	KTN1	55189516	0.542000	0.26426	0.838000	0.33150	0.637000	0.38172	1.212000	0.32394	2.044000	0.60594	0.477000	0.44152	AAA		0.264	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
MCHR2	84539	hgsc.bcm.edu	37	6	100390994	100390994	+	Nonsense_Mutation	SNP	G	G	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr6:100390994G>A	ENST00000281806.2	-	4	732	c.418C>T	c.(418-420)Cga>Tga	p.R140*	MCHR2_ENST00000369212.2_Nonsense_Mutation_p.R140*	NM_001040179.1	NP_001035269.1	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R140*(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	39		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CGTGTCAGTCGAAATGGTTGG	0.478																																																1	Substitution - Nonsense(1)	ovary(1)	6											115.0	107.0	110.0					6																	100390994		2203	4300	6503	100497715	SO:0001587	stop_gained	84539			AF347063	CCDS5044.1	6q16	2012-08-08	2006-02-15	2006-02-15	ENSG00000152034	ENSG00000152034		"""GPCR / Class A : MCH receptors"""	20867	protein-coding gene	gene with protein product		606111	"""G protein-coupled receptor 145"""	GPR145		11355873, 11274220	Standard	NM_032503		Approved	SLT, MCH2, MCH2R	uc003pqi.1	Q969V1	OTTHUMG00000015270	ENST00000281806.2:c.418C>T	6.37:g.100390994G>A	ENSP00000281806:p.Arg140*	Somatic		WXS	SOLID	Phase_III	100497715	B3KVW4|E1P5D7|Q5VTV7|Q6Q377|Q9BXA8	Nonsense_Mutation	SNP	ENST00000281806.2	37	CCDS5044.1	.	.	.	.	.	.	.	.	.	.	G	34	5.363835	0.95877	.	.	ENSG00000152034	ENST00000445970;ENST00000281806;ENST00000369212	.	.	.	4.95	1.81	0.25067	.	0.361362	0.19944	N	0.102600	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	5.2519	0.15527	0.1773:0.0:0.4882:0.3345	.	.	.	.	X	140	.	ENSP00000281806:R140X	R	-	1	2	MCHR2	100497715	0.989000	0.36119	0.922000	0.36590	0.983000	0.72400	1.684000	0.37649	0.505000	0.28104	0.655000	0.94253	CGA		0.478	MCHR2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041620.2	NM_032503	
MYH9	4627	hgsc.bcm.edu	37	22	36712628	36712628	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr22:36712628G>T	ENST00000216181.5	-	12	1544	c.1314C>A	c.(1312-1314)gaC>gaA	p.D438E	RN7SL349P_ENST00000582364.1_RNA	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	438	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.D438E(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TCTTGGTCTTGTCCAGAGCCT	0.607			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	1	Substitution - Missense(1)	ovary(1)	22											91.0	87.0	89.0					22																	36712628		2203	4300	6503	35042574	SO:0001583	missense	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.1314C>A	22.37:g.36712628G>T	ENSP00000216181:p.Asp438Glu	Somatic		WXS	SOLID	Phase_III	35042574	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580289	0.86645	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	D	0.87103	-2.21	5.1	4.07	0.47477	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	T	0.82051	0.4953	L	0.56199	1.76	0.80722	D	1	P	0.38597	0.639	B	0.37239	0.244	T	0.81324	-0.0984	10	0.45353	T	0.12	.	8.5592	0.33501	0.1807:0.0:0.8193:0.0	.	438	P35579	MYH9_HUMAN	E	302;438	ENSP00000216181:D438E	ENSP00000216181:D438E	D	-	3	2	MYH9	35042574	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.263000	0.51546	2.538000	0.85594	0.585000	0.79938	GAC		0.607	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
SLC4A5	57835	hgsc.bcm.edu	37	2	74458386	74458386	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr2:74458386C>G	ENST00000377634.4	-	25	3223	c.2824G>C	c.(2824-2826)Gtc>Ctc	p.V942L	SLC4A5_ENST00000357822.5_Missense_Mutation_p.V942L|SLC4A5_ENST00000359484.4_Missense_Mutation_p.V840L|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000358683.4_Missense_Mutation_p.V840L|SLC4A5_ENST00000377632.1_Missense_Mutation_p.V942L|SLC4A5_ENST00000423644.1_Missense_Mutation_p.C882S|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000394019.2_Missense_Mutation_p.V942L|SLC4A5_ENST00000346834.4_Missense_Mutation_p.V942L					solute carrier family 4 (sodium bicarbonate cotransporter), member 5									p.V942L(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						GCCAGGAAGACAGAGATTCCC	0.567																																																1	Substitution - Missense(1)	ovary(1)	2											182.0	149.0	160.0					2																	74458386		2203	4300	6503	74311894	SO:0001583	missense	57835			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.2824G>C	2.37:g.74458386C>G	ENSP00000366861:p.Val942Leu	Somatic		WXS	SOLID	Phase_III	74311894		Missense_Mutation	SNP	ENST00000377634.4	37	CCDS1936.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.79|19.79	3.892501|3.892501	0.72524|0.72524	.|.	.|.	ENSG00000188687|ENSG00000188687	ENST00000423644;ENST00000425249|ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634	T;T|D;D;T;T;D;D;D	0.70164|0.82344	-0.46;-0.14|-1.6;-1.6;-1.14;-1.14;-1.6;-1.6;-1.6	4.47|4.47	4.47|4.47	0.54385|0.54385	.|Bicarbonate transporter, C-terminal (1);	.|0.243433	.|0.41001	.|D	.|0.000964	D|D	0.87410|0.87410	0.6170|0.6170	L|L	0.52905|0.52905	1.665|1.665	0.26197|0.26197	N|N	0.979505|0.979505	B|P;P;P;D	0.02656|0.54772	0.0|0.832;0.659;0.603;0.968	B|P;P;P;P	0.04013|0.61328	0.001|0.495;0.477;0.513;0.887	T|T	0.81362|0.81362	-0.0967|-0.0967	9|10	0.21540|0.72032	T|D	0.41|0.01	.|.	14.6661|14.6661	0.68910|0.68910	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	844|942;840;942;942	E7EQT3|Q9BY07-4;Q9BY07-7;Q9BY07;Q9BY07-3	.|.;.;S4A5_HUMAN;.	S|L	882;844|942;942;942;840;840;942;942;942	ENSP00000395804:C882S;ENSP00000405678:C844S|ENSP00000377587:V942L;ENSP00000251768:V942L;ENSP00000352461:V840L;ENSP00000351513:V840L;ENSP00000350475:V942L;ENSP00000366859:V942L;ENSP00000366861:V942L	ENSP00000395804:C882S|ENSP00000251768:V942L	C|V	-|-	2|1	0|0	SLC4A5|SLC4A5	74311894|74311894	0.975000|0.975000	0.34042|0.34042	0.973000|0.973000	0.42090|0.42090	0.987000|0.987000	0.75469|0.75469	2.335000|2.335000	0.43929|0.43929	2.309000|2.309000	0.77851|0.77851	0.561000|0.561000	0.74099|0.74099	TGT|GTC		0.567	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3		
SPTB	6710	hgsc.bcm.edu	37	14	65262267	65262267	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr14:65262267C>G	ENST00000389721.5	-	11	1464	c.1432G>C	c.(1432-1434)Gtg>Ctg	p.V478L	SPTB_ENST00000389720.3_Missense_Mutation_p.V478L|SPTB_ENST00000556626.1_Missense_Mutation_p.V478L|SPTB_ENST00000542895.1_Missense_Mutation_p.V478L|SPTB_ENST00000389722.3_Missense_Mutation_p.V478L	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	478					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.V478L(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		AGGGCTCTCACCCGCTCCTCG	0.597																																																1	Substitution - Missense(1)	ovary(1)	14											90.0	84.0	86.0					14																	65262267		2203	4300	6503	64332020	SO:0001583	missense	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.1432G>C	14.37:g.65262267C>G	ENSP00000374371:p.Val478Leu	Somatic		WXS	SOLID	Phase_III	64332020	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	C	36	5.613693	0.96637	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.74854	0.3771	M	0.90542	3.125	0.80722	D	1	D;D	0.67145	0.996;0.995	D;D	0.68039	0.941;0.955	T	0.78633	-0.2128	10	0.59425	D	0.04	.	18.9672	0.92701	0.0:1.0:0.0:0.0	.	478;482	P11277;Q59FP5	SPTB1_HUMAN;.	L	482;478;478;478;478;478	ENSP00000374372:V478L;ENSP00000451752:V478L;ENSP00000374371:V478L;ENSP00000443882:V478L;ENSP00000374370:V478L	ENSP00000374370:V478L	V	-	1	0	SPTB	64332020	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.815000	0.86186	2.780000	0.95670	0.655000	0.94253	GTG		0.597	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
TEK	7010	hgsc.bcm.edu	37	9	27169607	27169607	+	Missense_Mutation	SNP	T	T	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr9:27169607T>A	ENST00000380036.4	+	4	1050	c.608T>A	c.(607-609)tTc>tAc	p.F203Y	TEK_ENST00000519097.1_Missense_Mutation_p.F99Y|TEK_ENST00000406359.4_Missense_Mutation_p.F203Y	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	203					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.F203Y(1)		breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	ACCTCGGCCTTCACCAGGCTG	0.473																																																1	Substitution - Missense(1)	ovary(1)	9											104.0	96.0	99.0					9																	27169607		2203	4300	6503	27159607	SO:0001583	missense	7010			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.608T>A	9.37:g.27169607T>A	ENSP00000369375:p.Phe203Tyr	Somatic		WXS	SOLID	Phase_III	27159607	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	T	14.92	2.679915	0.47886	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000346448;ENST00000406359;ENST00000519080	T;T;T;T	0.74315	-0.78;-0.8;-0.83;2.87	5.48	5.48	0.80851	Immunoglobulin-like fold (1);	0.123114	0.37348	N	0.002137	T	0.61476	0.2350	L	0.28115	0.83	0.35413	D	0.792585	B;B;B;B;B;B	0.17852	0.005;0.013;0.015;0.024;0.014;0.006	B;B;B;B;B;B	0.22152	0.003;0.038;0.014;0.008;0.008;0.008	T	0.64419	-0.6412	10	0.32370	T	0.25	.	10.6149	0.45445	0.1791:0.0:0.0:0.8209	.	99;236;203;56;203;203	E7EWI2;Q59HG2;B5A953;E5RIV9;B4DHD3;Q02763	.;.;.;.;.;TIE2_HUMAN	Y	99;203;203;203;56	ENSP00000430686:F99Y;ENSP00000369375:F203Y;ENSP00000383977:F203Y;ENSP00000428337:F56Y	ENSP00000343716:F203Y	F	+	2	0	TEK	27159607	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.954000	0.56708	2.211000	0.71520	0.459000	0.35465	TTC		0.473	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
TP53	7157	hgsc.bcm.edu	37	17	7576852	7576852	+	Splice_Site	SNP	C	C	T	rs11575997		TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr17:7576852C>T	ENST00000269305.4	-	9	1183		c.e9+1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(24)|p.0?(8)|p.I332fs*49(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGACTTAGTACCTGAAGGGTG	0.458		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	33	Unknown(24)|Whole gene deletion(8)|Insertion - Frameshift(1)	ovary(8)|lung(4)|breast(4)|bone(4)|stomach(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|NS(2)|pancreas(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|skin(1)	17	GRCh37	CD002536	TP53	D	rs11575997						115.0	108.0	111.0					17																	7576852		2203	4300	6503	7517577	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.993+1G>A	17.37:g.7576852C>T		Somatic		WXS	SOLID	Phase_III	7517577	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361474	0.41801	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000419024	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6932	0.56988	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517577	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	2.315000	0.43752	2.462000	0.83206	0.561000	0.74099	.		0.458	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron
UBE4A	9354	hgsc.bcm.edu	37	11	118260580	118260580	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1669-01A-01W-0615-10	TCGA-09-1669-10A-01W-0616-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	3842cd55-d850-42b0-a79b-dc8f21688744	1cadae9b-cb52-4ba8-90e0-1e9078d6f279	g.chr11:118260580C>A	ENST00000431736.2	+	17	2821	c.2749C>A	c.(2749-2751)Cag>Aag	p.Q917K	UBE4A_ENST00000545354.1_Missense_Mutation_p.Q382K|UBE4A_ENST00000252108.3_Missense_Mutation_p.Q910K					ubiquitination factor E4A									p.Q917K(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CAAACCCCAGCAGCTTGTATC	0.438																																																1	Substitution - Missense(1)	ovary(1)	11											107.0	102.0	104.0					11																	118260580		2200	4296	6496	117765790	SO:0001583	missense	9354			D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.2749C>A	11.37:g.118260580C>A	ENSP00000387362:p.Gln917Lys	Somatic		WXS	SOLID	Phase_III	117765790		Missense_Mutation	SNP	ENST00000431736.2	37	CCDS8396.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.413582	0.83449	.	.	ENSG00000110344	ENST00000252108;ENST00000431736;ENST00000545354	T;T;T	0.66815	-0.23;-0.23;0.91	5.72	5.72	0.89469	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.71426	0.3338	L	0.55481	1.735	0.80722	D	1	P;D	0.57899	0.692;0.981	P;P	0.53593	0.57;0.73	T	0.65034	-0.6266	10	0.08381	T	0.77	-9.0578	19.8868	0.96915	0.0:1.0:0.0:0.0	.	910;917	Q14139;Q14139-2	UBE4A_HUMAN;.	K	910;917;382	ENSP00000252108:Q910K;ENSP00000387362:Q917K;ENSP00000438918:Q382K	ENSP00000252108:Q910K	Q	+	1	0	UBE4A	117765790	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.689000	0.91719	0.650000	0.86243	CAG		0.438	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788	
