#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
MYBPHL	343263	genome.wustl.edu	37	1	109839553	109839553	+	Silent	SNP	C	C	T	rs117363727	byFrequency	TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr1:109839553C>T	ENST00000357155.1	-	5	631	c.582G>A	c.(580-582)acG>acA	p.T194T	MYBPHL_ENST00000477962.1_Intron	NM_001010985.2|NM_001265613.1	NP_001010985.2|NP_001252542.1	A2RUH7	MBPHL_HUMAN	myosin binding protein H-like	194	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.							p.T194T(1)		central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(2)	14		all_lung(203;0.00519)|all_epithelial(167;0.00575)|Lung NSC(277;0.00822)		Colorectal(144;0.0306)|Lung(183;0.0681)|COAD - Colon adenocarcinoma(174;0.117)|Epithelial(280;0.197)|all cancers(265;0.225)		GCTCCAGCACCGTGAACCACA	0.577													C|||	16	0.00319489	0.0008	0.0	5008	,	,		19516	0.0149		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1											119.0	100.0	106.0					1																	109839553		2203	4300	6503	109641076	SO:0001819	synonymous_variant	343263			AK129834	CCDS30793.1	1p13	2013-02-11			ENSG00000221986	ENSG00000221986		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	30434	protein-coding gene	gene with protein product							Standard	NM_001010985		Approved		uc001dxk.1	A2RUH7	OTTHUMG00000012002	ENST00000357155.1:c.582G>A	1.37:g.109839553C>T		Somatic		Capture	Illumina GAIIx	4	109641076	B7ZME5|Q5T2Z7	Silent	SNP	-	p.T194	ENST00000357155.1	37	c.582	CCDS30793.1	1																																																																																			-	NULL		0.577	MYBPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPHL	protein_coding	OTTHUMT00000033197.1	C	NM_001010985		109641076	-1	no_errors	NM_001010985	genbank	human	validated	54_36p	silent	SNP	0.14	T
PTCHD2	57540	genome.wustl.edu	37	1	11595685	11595685	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr1:11595685C>T	ENST00000294484.6	+	20	3938	c.3800C>T	c.(3799-3801)cCc>cTc	p.P1267L	PTCHD2_ENST00000389575.3_Missense_Mutation_p.P1267L|PTCHD2_ENST00000304391.6_Silent_p.A153A	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1267					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)	p.P1484L(1)		NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GAGAACCTGCCCCCCCACCAG	0.657																																																1	Substitution - Missense(1)	ovary(1)	1											53.0	63.0	59.0					1																	11595685		2124	4214	6338	11518272	SO:0001583	missense	57540			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3800C>T	1.37:g.11595685C>T	ENSP00000294484:p.Pro1267Leu	Somatic		Capture	Illumina GAIIx	4	11518272	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	-	p.P1267L	ENST00000294484.6	37	c.3800	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.533523	0.85812	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.90197	-2.62;-2.63	5.55	5.55	0.83447	Membrane transport protein, MMPL type (1);	0.000000	0.85682	D	0.000000	D	0.94305	0.8170	L	0.56769	1.78	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	D	0.94614	0.7807	10	0.87932	D	0	-32.102	18.4775	0.90798	0.0:1.0:0.0:0.0	.	1267	Q9P2K9	PTHD2_HUMAN	L	1267	ENSP00000294484:P1267L;ENSP00000374226:P1267L	ENSP00000294484:P1267L	P	+	2	0	PTCHD2	11518272	1.000000	0.71417	0.995000	0.50966	0.761000	0.43186	3.136000	0.50554	2.606000	0.88127	0.655000	0.94253	CCC	-	NULL		0.657	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	protein_coding	OTTHUMT00000005770.2	C	XM_052561		11518272	1	no_errors	NM_020780	genbank	human	validated	54_36p	missense	SNP	1	T
STRIP1	85369	genome.wustl.edu	37	1	110589333	110589333	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr1:110589333C>T	ENST00000369795.3	+	13	1470	c.1448C>T	c.(1447-1449)gCa>gTa	p.A483V	STRIP1_ENST00000369796.1_Missense_Mutation_p.A388V	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1	483					cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.A483V(1)									GAGGTCCAGGCACAGATGGAG	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											176.0	173.0	174.0					1																	110589333		2203	4300	6503	110390856	SO:0001583	missense	85369			AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.1448C>T	1.37:g.110589333C>T	ENSP00000358810:p.Ala483Val	Somatic		Capture	Illumina GAIIx	4	110390856	Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	Missense_Mutation	SNP	-	p.A483V	ENST00000369795.3	37	c.1448	CCDS30798.1	1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.956716	0.53293	.	.	ENSG00000143093	ENST00000369796;ENST00000369795	T;T	0.39229	1.09;1.09	5.83	4.91	0.64330	.	0.220619	0.47852	N	0.000209	T	0.10252	0.0251	N	0.12182	0.205	0.80722	D	1	B;B	0.10296	0.0;0.003	B;B	0.18871	0.002;0.023	T	0.10965	-1.0607	10	0.25751	T	0.34	-11.5801	7.1994	0.25873	0.0:0.7176:0.0:0.2824	.	388;483	Q5VSL9-2;Q5VSL9	.;FA40A_HUMAN	V	388;483	ENSP00000358811:A388V;ENSP00000358810:A483V	ENSP00000358810:A483V	A	+	2	0	FAM40A	110390856	1.000000	0.71417	0.969000	0.41365	0.827000	0.46813	4.948000	0.63590	1.477000	0.48234	0.650000	0.86243	GCA	-	NULL		0.577	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM40A	protein_coding	OTTHUMT00000032213.1	C	NM_033088		110390856	1	no_errors	NM_033088	genbank	human	validated	54_36p	missense	SNP	0.95	T
PSMB4	5692	genome.wustl.edu	37	1	151372582	151372582	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr1:151372582G>T	ENST00000290541.6	+	2	320	c.266G>T	c.(265-267)cGa>cTa	p.R89L		NM_002796.2	NP_002787.2	P28070	PSB4_HUMAN	proteasome (prosome, macropain) subunit, beta type, 4	89					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	lipopolysaccharide binding (GO:0001530)|threonine-type endopeptidase activity (GO:0004298)	p.R89L(1)		endometrium(1)|lung(9)|ovary(2)|prostate(1)|skin(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CGCATTATGCGAGTCAACAAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											168.0	169.0	169.0					1																	151372582		2203	4300	6503	149639206	SO:0001583	missense	5692			D26600	CCDS996.1	1q21	2008-02-05			ENSG00000159377	ENSG00000159377		"""Proteasome (prosome, macropain) subunits"""	9541	protein-coding gene	gene with protein product		602177				7918633	Standard	NM_002796		Approved	HN3, PROS26	uc001eyc.1	P28070	OTTHUMG00000012494	ENST00000290541.6:c.266G>T	1.37:g.151372582G>T	ENSP00000290541:p.Arg89Leu	Somatic		Capture	Illumina GAIIx	4	149639206	B2R9L3|P31148|Q5SZS5|Q6IBI4|Q969L6	Missense_Mutation	SNP	-	p.R89L	ENST00000290541.6	37	c.266	CCDS996.1	1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654764	0.47467	.	.	ENSG00000159377	ENST00000290541	T	0.23552	1.9	5.34	2.48	0.30137	Proteasome, beta-type subunit, conserved site (1);	0.261003	0.36703	N	0.002445	T	0.09905	0.0243	L	0.37561	1.115	0.40519	D	0.980812	B;B	0.30526	0.283;0.014	B;B	0.35114	0.196;0.021	T	0.06935	-1.0799	10	0.66056	D	0.02	-0.0211	7.6631	0.28415	0.3302:0.0:0.6698:0.0	.	89;89	B4DFL3;P28070	.;PSB4_HUMAN	L	89	ENSP00000290541:R89L	ENSP00000290541:R89L	R	+	2	0	PSMB4	149639206	0.999000	0.42202	0.949000	0.38748	0.619000	0.37552	2.172000	0.42463	0.259000	0.21709	-0.258000	0.10820	CGA	-	NULL		0.537	PSMB4-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	PSMB4	protein_coding	OTTHUMT00000034885.1	G	NM_002796		149639206	1	no_errors	NM_002796	genbank	human	reviewed	54_36p	missense	SNP	0.96	T
KLHDC7A	127707	genome.wustl.edu	37	1	18808184	18808184	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr1:18808184G>A	ENST00000400664.1	+	1	761	c.709G>A	c.(709-711)Ggg>Agg	p.G237R		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	237						integral component of membrane (GO:0016021)		p.G237R(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AGAAGAGGCTGGGGCTCTCGA	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											52.0	53.0	53.0					1																	18808184		2203	4300	6503	18680771	SO:0001583	missense	127707			AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.709G>A	1.37:g.18808184G>A	ENSP00000383505:p.Gly237Arg	Somatic		Capture	Illumina GAIIx	4	18680771	Q8N8W6	Missense_Mutation	SNP	-	p.G237R	ENST00000400664.1	37	c.709	CCDS185.2	1	.	.	.	.	.	.	.	.	.	.	G	7.737	0.700548	0.15106	.	.	ENSG00000179023	ENST00000400664;ENST00000540290	T	0.79247	-1.25	5.27	4.35	0.52113	.	0.392297	0.21411	U	0.074980	T	0.64929	0.2643	L	0.27053	0.805	0.09310	N	1	B;B	0.24882	0.113;0.113	B;B	0.25506	0.031;0.061	T	0.59663	-0.7412	10	0.87932	D	0	.	8.0691	0.30678	0.1841:0.0:0.8159:0.0	.	174;237	A7E2V3;Q5VTJ3	.;KLD7A_HUMAN	R	237;174	ENSP00000383505:G237R	ENSP00000383505:G237R	G	+	1	0	KLHDC7A	18680771	0.002000	0.14202	0.312000	0.25196	0.005000	0.04900	0.722000	0.25925	1.208000	0.43306	0.467000	0.42956	GGG	-	NULL		0.602	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7A	protein_coding	OTTHUMT00000006923.3	G	NM_152375		18680771	1	no_errors	NM_152375	genbank	human	validated	54_36p	missense	SNP	0.01	A
FLG	2312	genome.wustl.edu	37	1	152275687	152275687	+	Missense_Mutation	SNP	C	C	T	rs372348813		TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr1:152275687C>T	ENST00000368799.1	-	3	11710	c.11675G>A	c.(11674-11676)cGg>cAg	p.R3892Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3892	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R3892L(1)|p.R3892Q(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGACTGCTCCCGAGAAGATCC	0.542									Ichthyosis																																							2	Substitution - Missense(2)	ovary(1)|endometrium(1)	1											94.0	98.0	97.0					1																	152275687		2203	4300	6503	150542311	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11675G>A	1.37:g.152275687C>T	ENSP00000357789:p.Arg3892Gln	Somatic		Capture	Illumina GAIIx	4	150542311	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	-	p.R3892Q	ENST00000368799.1	37	c.11675	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	3.552	-0.091506	0.07053	.	.	ENSG00000143631	ENST00000368799	T	0.01685	4.69	2.17	-4.33	0.03677	.	.	.	.	.	T	0.00328	0.0010	N	0.21194	0.64	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.44590	-0.9318	9	0.11485	T	0.65	.	4.368	0.11233	0.0:0.2588:0.323:0.4182	.	3892	P20930	FILA_HUMAN	Q	3892	ENSP00000357789:R3892Q	ENSP00000357789:R3892Q	R	-	2	0	FLG	150542311	0.929000	0.31497	0.000000	0.03702	0.000000	0.00434	-0.243000	0.08915	-1.837000	0.01189	-1.494000	0.00967	CGG	-	NULL		0.542	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	C	NM_002016		150542311	-1	no_errors	NM_002016	genbank	human	provisional	54_36p	missense	SNP		T
CENPF	1063	genome.wustl.edu	37	1	214815522	214815522	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr1:214815522A>G	ENST00000366955.3	+	12	4009	c.3841A>G	c.(3841-3843)Aca>Gca	p.T1281A		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.T1281A(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TGAGTTGTCAACAAGTCAAAA	0.398																																					Colon(80;575 1284 11000 14801 43496)											1	Substitution - Missense(1)	ovary(1)	1											65.0	64.0	64.0					1																	214815522		2203	4300	6503	212882145	SO:0001583	missense	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3841A>G	1.37:g.214815522A>G	ENSP00000355922:p.Thr1281Ala	Somatic		Capture	Illumina GAIIx	4	212882145	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	Spectrin repeat;superfamily_Spectrin repeat;BAG domain;superfamily_BAG domain	p.T1281A	ENST00000366955.3	37	c.3841	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	A	8.998	0.979336	0.18812	.	.	ENSG00000117724	ENST00000366955	T	0.22539	1.95	4.96	-2.4	0.06583	.	0.410430	0.18039	N	0.153662	T	0.06280	0.0162	.	.	.	0.23598	N	0.997326	B	0.22683	0.073	B	0.19946	0.027	T	0.31280	-0.9949	9	0.09590	T	0.72	.	1.1552	0.01794	0.337:0.2719:0.2583:0.1327	.	1281	P49454	CENPF_HUMAN	A	1281	ENSP00000355922:T1281A	ENSP00000355922:T1281A	T	+	1	0	CENPF	212882145	0.000000	0.05858	0.988000	0.46212	0.845000	0.48019	-2.184000	0.01254	-0.059000	0.13154	0.418000	0.28097	ACA	-	NULL		0.398	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	protein_coding	OTTHUMT00000089749.1	A	NM_016343		212882145	1	no_errors	NM_016343	genbank	human	reviewed	54_36p	missense	SNP	0.01	G
PGBD2	267002	genome.wustl.edu	37	1	249211970	249211970	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr1:249211970G>C	ENST00000329291.5	+	3	1334	c.1187G>C	c.(1186-1188)gGt>gCt	p.G396A	PGBD2_ENST00000355360.4_Missense_Mutation_p.G145A|PGBD2_ENST00000539153.1_Missense_Mutation_p.G393A	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	396								p.G145A(1)		NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			ATGAAGAGGGGTTCATTTGAT	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											69.0	71.0	70.0					1																	249211970		2203	4300	6503	247178593	SO:0001583	missense	267002			AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.1187G>C	1.37:g.249211970G>C	ENSP00000331643:p.Gly396Ala	Somatic		Capture	Illumina GAIIx	4	247178593	B3KVR8|Q6MZF8	Missense_Mutation	SNP	-	p.G396A	ENST00000329291.5	37	c.1187	CCDS31128.1	1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.228760	0.39399	.	.	ENSG00000185220	ENST00000355360;ENST00000329291;ENST00000539153	T;T;T	0.25579	1.79;1.79;1.79	3.78	2.87	0.33458	.	0.000000	0.52532	D	0.000077	T	0.47078	0.1426	M	0.79693	2.465	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.987;0.999	T	0.22906	-1.0203	10	0.49607	T	0.09	-44.7477	7.2542	0.26166	0.1236:0.0:0.8764:0.0	.	393;396	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	A	145;396;393	ENSP00000355424:G145A;ENSP00000331643:G396A;ENSP00000439950:G393A	ENSP00000331643:G396A	G	+	2	0	PGBD2	247178593	0.998000	0.40836	0.181000	0.23098	0.920000	0.55202	3.309000	0.51903	0.934000	0.37316	0.467000	0.42956	GGT	-	NULL		0.483	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGBD2	protein_coding	OTTHUMT00000097318.1	G			247178593	1	no_errors	NM_170725	genbank	human	validated	54_36p	missense	SNP	1	C
Unknown	0	genome.wustl.edu	37	10	124489060	124489060	+	IGR	SNP	G	G	A	rs80355071	byFrequency	TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr10:124489060G>A								C10orf120 (29722 upstream) : RP11-318C4.2 (27149 downstream)																							AGAAGGAAGTGCAGGTGGTGT	0.607													G|||	163	0.0325479	0.118	0.0072	5008	,	,		17821	0.0		0.002	False		,,,				2504	0.0															0			10																																								124479050	SO:0001628	intergenic_variant	729794																															10.37:g.124489060G>A		Somatic		Capture	Illumina GAIIx	4	124479050		Silent	SNP	-	p.V93		37	c.279		10																																																																																			-	NULL	0	0.607					LOC729794			G			124479050	1	no_errors	XM_001718748	genbank	human	model	54_36p	silent	SNP	0.02	A
SVILP1	645954	genome.wustl.edu	37	10	30974295	30974295	+	IGR	SNP	C	C	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr10:30974295C>T								RP11-14C22.3 (27831 upstream) : SVILP1 (8295 downstream)																							GAGCGGCCAACGACTCGACCC	0.532																																																0			10																																								31014301	SO:0001628	intergenic_variant	645954																															10.37:g.30974295C>T		Somatic		Capture	Illumina GAIIx	4	31014301		RNA	SNP	-	NULL		37	NULL		10																																																																																			-	-	0	0.532					LOC645954			C			31014301	1	no_errors	XR_017086	genbank	human	model	54_36p	rna	SNP	1	T
CPXM2	119587	genome.wustl.edu	37	10	125506320	125506320	+	Missense_Mutation	SNP	C	C	T	rs149753704	byFrequency	TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr10:125506320C>T	ENST00000241305.3	-	14	2385	c.2231G>A	c.(2230-2232)cGg>cAg	p.R744Q	CPXM2_ENST00000368854.3_Intron	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	744					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R744Q(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CAGCTTCAGCCGCCTGGCTGG	0.577													C|||	2	0.000399361	0.0	0.0	5008	,	,		17511	0.002		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	10											56.0	60.0	59.0					10																	125506320		2203	4300	6503	125496310	SO:0001583	missense	119587			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.2231G>A	10.37:g.125506320C>T	ENSP00000241305:p.Arg744Gln	Somatic		Capture	Illumina GAIIx	4	125496310	B4E3Q2	Missense_Mutation	SNP	-	p.R744Q	ENST00000241305.3	37	c.2231	CCDS7637.1	10	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	14.74	2.626698	0.46840	.	.	ENSG00000121898	ENST00000241305;ENST00000540123;ENST00000418782	D	0.96073	-3.9	4.98	3.14	0.36123	Carboxypeptidase-like, regulatory domain (1);	0.272369	0.35013	N	0.003510	D	0.89691	0.6788	L	0.38175	1.15	0.80722	D	1	B	0.30021	0.265	B	0.21151	0.033	D	0.83724	0.0194	10	0.18276	T	0.48	-32.4176	9.6545	0.39917	0.0:0.8401:0.0:0.1599	.	744	Q8N436	CPXM2_HUMAN	Q	744;577;719	ENSP00000241305:R744Q	ENSP00000241305:R744Q	R	-	2	0	CPXM2	125496310	1.000000	0.71417	0.640000	0.29408	0.971000	0.66376	3.127000	0.50484	0.694000	0.31654	0.655000	0.94253	CGG	-	NULL		0.577	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM2	protein_coding	OTTHUMT00000050853.1	C	NM_198148		125496310	-1	no_errors	NM_198148	genbank	human	validated	54_36p	missense	SNP	0.947	T
RCE1	9986	genome.wustl.edu	37	11	66611281	66611282	+	Frame_Shift_Del	DEL	CA	CA	-	rs71457743	byFrequency	TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	CA	CA	CA	-	CA	CA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr11:66611281_66611282delCA	ENST00000309657.3	+	2	281_282	c.237_238delCA	c.(235-240)tccagtfs	p.SS79fs	RCE1_ENST00000534645.1_3'UTR|RCE1_ENST00000525356.1_5'UTR|RCE1_ENST00000524506.1_Frame_Shift_Del_p.SS79fs	NM_001032279.1|NM_005133.2	NP_001027450.1|NP_005124.1	Q9Y256	FACE2_HUMAN	Ras converting CAAX endopeptidase 1	79					CAAX-box protein processing (GO:0071586)|proteolysis (GO:0006508)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cysteine-type endopeptidase activity (GO:0004197)|metalloendopeptidase activity (GO:0004222)	p.S82fs*59(1)		breast(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10						TGGTGGTGTCCAGTCTCTCACC	0.653																																																1	Deletion - Frameshift(1)	ovary(1)	11																																								66367858	SO:0001589	frameshift_variant	9986			AF121951	CCDS8151.1	11q13	2013-10-18	2013-10-18	2001-06-29	ENSG00000173653	ENSG00000173653			13721	protein-coding gene	gene with protein product	"""farnesylated protein-converting enzyme 2"", ""prenyl protein-specific endoprotease 2"", ""RCE1 homolog, prenyl protein protease"", ""CAAX prenyl protease 2"""	605385	"""RCE1 (S. Cerevisiae) homolog, prenyl protein protease"", ""RCE1 homolog, prenyl protein peptidase (S. cerevisiae)"", ""RCE1 homolog, prenyl protein protease (S. cerevisiae)"""	RCE1A, RCE1B		10085068, 10373325	Standard	NM_005133		Approved	hRCE1, FACE-2, FACE2	uc001ojk.1	Q9Y256	OTTHUMG00000167098	ENST00000309657.3:c.237_238delCA	11.37:g.66611281_66611282delCA	ENSP00000309163:p.Ser79fs	Somatic		Capture	Illumina GAIIx	Phase_III	66367857	Q52LZ9	Frame_Shift_Del	DEL	-	p.S82fs	ENST00000309657.3	37	c.237_238	CCDS8151.1	11																																																																																			(deletion:cds_exon[66367806,66367908])	NULL		0.653	RCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCE1	protein_coding	OTTHUMT00000393105.1	CA	NM_005133		66367858	1	no_errors	NM_005133	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000	-
OVCH1	341350	genome.wustl.edu	37	12	29592274	29592274	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr12:29592274C>A	ENST00000318184.5	-	26	3250	c.3251G>T	c.(3250-3252)tGg>tTg	p.W1084L	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	1084						extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.W1084L(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					tgaattttcccatatatgcat	0.299																																																1	Substitution - Missense(1)	ovary(1)	12											79.0	73.0	75.0					12																	29592274		1806	4069	5875	29483541	SO:0001583	missense	341350			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.3251G>T	12.37:g.29592274C>A	ENSP00000326708:p.Trp1084Leu	Somatic		Capture	Illumina GAIIx	4	29483541		Missense_Mutation	SNP	HMMPfam_CUB;superfamily_Spermadhesin CUB domain;HMMPfam_Trypsin;superfamily_Trypsin-like serine proteases	p.W1084L	ENST00000318184.5	37	c.3251		12	.	.	.	.	.	.	.	.	.	.	C	5.178	0.218371	0.09810	.	.	ENSG00000187950	ENST00000318184	D	0.86694	-2.16	0.427	-0.854	0.10705	.	.	.	.	.	T	0.70090	0.3184	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.56475	-0.7973	8	0.87932	D	0	.	.	.	.	.	1084	Q7RTY7	OVCH1_HUMAN	L	1084	ENSP00000326708:W1084L	ENSP00000326708:W1084L	W	-	2	0	OVCH1	29483541	0.008000	0.16893	0.000000	0.03702	0.000000	0.00434	0.679000	0.25291	-0.696000	0.05098	-0.706000	0.03657	TGG	-	NULL		0.299	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	protein_coding	OTTHUMT00000395997.2	C	NM_183378		29483541	-1	no_errors	NM_183378	genbank	human	validated	54_36p	missense	SNP	0	A
ZFC3H1	196441	genome.wustl.edu	37	12	72036246	72036246	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr12:72036246T>C	ENST00000378743.3	-	6	1955	c.1597A>G	c.(1597-1599)Atg>Gtg	p.M533V	SNORA17_ENST00000391159.1_RNA	NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	533					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.M533V(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TCTGTATCCATAGCAACTTCT	0.373																																																2	Substitution - Missense(2)	ovary(1)|kidney(1)	12											172.0	156.0	161.0					12																	72036246		1852	4096	5948	70322513	SO:0001583	missense	196441			AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.1597A>G	12.37:g.72036246T>C	ENSP00000368017:p.Met533Val	Somatic		Capture	Illumina GAIIx	4	70322513	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	superfamily_Protein prenylyltransferase	p.M533V	ENST00000378743.3	37	c.1597	CCDS41813.1	12	.	.	.	.	.	.	.	.	.	.	T	23.6	4.432938	0.83776	.	.	ENSG00000133858	ENST00000378743	T	0.49720	0.77	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.51550	0.1681	N	0.24115	0.695	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	T	0.46527	-0.9185	10	0.27082	T	0.32	.	15.5877	0.76499	0.0:0.0:0.0:1.0	.	533	O60293	ZC3H1_HUMAN	V	533	ENSP00000368017:M533V	ENSP00000368017:M533V	M	-	1	0	ZFC3H1	70322513	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.116000	0.77119	2.099000	0.63709	0.454000	0.30748	ATG	-	NULL		0.373	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFC3H1	protein_coding	OTTHUMT00000404751.1	T	NM_144982		70322513	-1	no_errors	NM_144982	genbank	human	validated	54_36p	missense	SNP	1	C
DTX1	1840	genome.wustl.edu	37	12	113534673	113534673	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr12:113534673G>A	ENST00000257600.3	+	9	2295	c.1792G>A	c.(1792-1794)Gct>Act	p.A598T	DTX1_ENST00000547974.1_3'UTR	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	598					cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A598T(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CTACCCGGACGCTAGCTACCT	0.637																																																1	Substitution - Missense(1)	ovary(1)	12											71.0	52.0	58.0					12																	113534673		2203	4300	6503	112019056	SO:0001583	missense	1840			AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1792G>A	12.37:g.113534673G>A	ENSP00000257600:p.Ala598Thr	Somatic		Capture	Illumina GAIIx	4	112019056	O60630|Q9BS04	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;HMMPfam_WWE;superfamily_RING/U-box	p.A598T	ENST00000257600.3	37	c.1792	CCDS9164.1	12	.	.	.	.	.	.	.	.	.	.	G	16.67	3.187534	0.57909	.	.	ENSG00000135144	ENST00000257600	T	0.45668	0.89	4.99	4.08	0.47627	.	0.121926	0.56097	D	0.000033	T	0.26376	0.0644	N	0.15975	0.35	0.40040	D	0.975641	B	0.16603	0.018	B	0.10450	0.005	T	0.12604	-1.0541	10	0.62326	D	0.03	-7.7338	11.3517	0.49592	0.0:0.4068:0.5932:0.0	.	598	Q86Y01	DTX1_HUMAN	T	598	ENSP00000257600:A598T	ENSP00000257600:A598T	A	+	1	0	DTX1	112019056	0.998000	0.40836	0.938000	0.37757	0.683000	0.39861	2.012000	0.40932	2.306000	0.77630	0.561000	0.74099	GCT	-	NULL		0.637	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX1	protein_coding	OTTHUMT00000405045.2	G			112019056	1	no_errors	NM_004416	genbank	human	reviewed	54_36p	missense	SNP	1	A
RB1	5925	genome.wustl.edu	37	13	49039374	49039374	+	Nonsense_Mutation	SNP	C	C	T	rs137853293		TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr13:49039374C>T	ENST00000267163.4	+	23	2497	c.2359C>T	c.(2359-2361)Cga>Tga	p.R787*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	787	Domain C; mediates interaction with E4F1.|Interaction with LIMD1.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)|p.R787*(4)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCACATTCCTCGAAGCCCTTA	0.393		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	30	Whole gene deletion(15)|Unknown(11)|Substitution - Nonsense(4)	bone(11)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)|lung(1)|oesophagus(1)|ovary(1)|prostate(1)|liver(1)	13	GRCh37	CM900196	RB1	M	rs137853293						155.0	160.0	158.0					13																	49039374		2203	4300	6503	47937375	SO:0001587	stop_gained	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2359C>T	13.37:g.49039374C>T	ENSP00000267163:p.Arg787*	Somatic		Capture	Illumina GAIIx	4	47937375	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	RB_B;HMMPfam_RB_B;RB_A;HMMPfam_RB_A;Rb_C;HMMPfam_Rb_C	p.R787*	ENST00000267163.4	37	c.2359	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	39	7.630709	0.98399	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.87	5.87	0.94306	.	0.072182	0.56097	D	0.000028	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6067	0.62052	0.271:0.729:0.0:0.0	.	.	.	.	X	766;787	.	ENSP00000267163:R787X	R	+	1	2	RB1	47937375	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.152000	0.42272	2.779000	0.95612	0.591000	0.81541	CGA	-	HMMPfam_Rb_C		0.393	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	C			47937375	1	no_errors	NM_000321	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
PEAK1	79834	genome.wustl.edu	37	15	77425831	77425831	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr15:77425831C>T	ENST00000560626.2	-	6	4068	c.3593G>A	c.(3592-3594)aGt>aAt	p.S1198N	PEAK1_ENST00000312493.4_Missense_Mutation_p.S1198N			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1198					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.S1198N(2)									AGAACCAGCACTGCTGGCATC	0.493																																																2	Substitution - Missense(2)	ovary(2)	15											89.0	93.0	91.0					15																	77425831		1920	4121	6041	75212886	SO:0001583	missense	79834				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.3593G>A	15.37:g.77425831C>T	ENSP00000452796:p.Ser1198Asn	Somatic		Capture	Illumina GAIIx	4	75212886	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	-	p.S1198N	ENST00000560626.2	37	c.3593	CCDS42062.1	15	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795186	0.90453	.	.	ENSG00000173517	ENST00000312493	T	0.70631	-0.5	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.74680	0.3748	L	0.29908	0.895	0.51233	D	0.99991	D	0.76494	0.999	D	0.80764	0.994	T	0.66893	-0.5808	10	0.09590	T	0.72	-4.6532	18.0479	0.89338	0.0:1.0:0.0:0.0	.	1198	Q9H792	PEAK1_HUMAN	N	1198	ENSP00000309230:S1198N	ENSP00000309230:S1198N	S	-	2	0	AC087465.1	75212886	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.123000	0.77176	2.709000	0.92574	0.655000	0.94253	AGT	-	NULL		0.493	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SGK269	protein_coding	OTTHUMT00000419483.3	C			75212886	-1	no_errors	NM_024776	genbank	human	validated	54_36p	missense	SNP	1	T
ABCC12	94160	genome.wustl.edu	37	16	48141235	48141235	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr16:48141235G>A	ENST00000311303.3	-	18	2818	c.2473C>T	c.(2473-2475)Cgg>Tgg	p.R825W	ABCC12_ENST00000448542.1_Missense_Mutation_p.R822W|ABCC12_ENST00000416054.1_3'UTR	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	825	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.R825W(1)		NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				AAACTCACCCGTGAGCCCTTG	0.552																																																1	Substitution - Missense(1)	ovary(1)	16											123.0	119.0	121.0					16																	48141235		2201	4300	6501	46698736	SO:0001583	missense	94160			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.2473C>T	16.37:g.48141235G>A	ENSP00000311030:p.Arg825Trp	Somatic		Capture	Illumina GAIIx	4	46698736	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	HMMPfam_ABC_membrane;HMMPfam_ABC_tran;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain	p.R825W	ENST00000311303.3	37	c.2473	CCDS10730.1	16	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336801	0.60963	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939	T;T	0.48836	0.8;0.8	5.41	2.11	0.27256	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.482208	0.21872	N	0.067872	T	0.30792	0.0776	N	0.24115	0.695	0.80722	D	1	P	0.44816	0.844	B	0.39068	0.289	T	0.09729	-1.0661	10	0.66056	D	0.02	.	9.4648	0.38806	0.0:0.5357:0.339:0.1253	.	825	Q96J65	MRP9_HUMAN	W	825;822;743	ENSP00000311030:R825W;ENSP00000401855:R822W	ENSP00000311030:R825W	R	-	1	2	ABCC12	46698736	0.004000	0.15560	0.358000	0.25811	0.531000	0.34715	0.173000	0.16724	0.571000	0.29365	0.557000	0.71058	CGG	-	HMMPfam_ABC_membrane		0.552	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	protein_coding	OTTHUMT00000256837.1	G	NM_033226		46698736	-1	no_errors	NM_033226	genbank	human	reviewed	54_36p	missense	SNP	0.97	A
CAMTA2	23125	genome.wustl.edu	37	17	4883707	4883707	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr17:4883707G>T	ENST00000348066.3	-	9	1033	c.910C>A	c.(910-912)Ccc>Acc	p.P304T	CAMTA2_ENST00000361571.5_Missense_Mutation_p.P303T|CAMTA2_ENST00000381311.5_Missense_Mutation_p.P306T|CAMTA2_ENST00000358183.4_Missense_Mutation_p.P304T|CAMTA2_ENST00000414043.3_Missense_Mutation_p.P327T|CAMTA2_ENST00000572543.1_Missense_Mutation_p.P309T|CAMTA2_ENST00000571831.1_5'Flank	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	304					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)	p.P304T(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						ATTTCTAGGGGCTCTGCAAAA	0.587											OREG0024111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	17											38.0	42.0	41.0					17																	4883707		2203	4300	6503	4824431	SO:0001583	missense	23125			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.910C>A	17.37:g.4883707G>T	ENSP00000321813:p.Pro304Thr	Somatic	622	Capture	Illumina GAIIx	4	4824431	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Ank;superfamily_Ankyrin repeat;HMMPfam_TIG;HMMPfam_CG-1;superfamily_E set domains;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.P304T	ENST00000348066.3	37	c.910	CCDS11063.1	17	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511452	0.44660	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	4.58	4.58	0.56647	.	0.226294	0.31167	N	0.008134	T	0.50905	0.1643	L	0.27053	0.805	0.31889	N	0.617444	D;D;D;D	0.89917	0.999;1.0;0.999;0.99	D;D;D;D	0.83275	0.991;0.996;0.991;0.935	T	0.57642	-0.7776	10	0.49607	T	0.09	-15.8905	14.9162	0.70798	0.0:0.0:1.0:0.0	.	327;306;304;303	E7EWU5;O94983-3;O94983;O94983-4	.;.;CMTA2_HUMAN;.	T	327;306;303;304;304	ENSP00000412886:P327T;ENSP00000370712:P306T;ENSP00000354828:P303T;ENSP00000350910:P304T;ENSP00000321813:P304T	ENSP00000321813:P304T	P	-	1	0	CAMTA2	4824431	1.000000	0.71417	0.996000	0.52242	0.732000	0.41865	2.824000	0.48088	2.382000	0.81193	0.650000	0.86243	CCC	-	NULL		0.587	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA2	protein_coding	OTTHUMT00000216876.1	G	NM_015099		4824431	-1	no_errors	NM_015099	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
TTYH2	94015	genome.wustl.edu	37	17	72248453	72248453	+	Silent	SNP	C	C	T	rs145446841	byFrequency	TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr17:72248453C>T	ENST00000269346.4	+	11	1271	c.1197C>T	c.(1195-1197)gcC>gcT	p.A399A	TTYH2_ENST00000529107.1_Silent_p.A378A|TTYH2_ENST00000441391.2_Silent_p.A78A	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	399						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.A399A(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						CCTTCCTGGCCGCCCTCGCCT	0.617																																																1	Substitution - coding silent(1)	ovary(1)	17						C	,	11,4395	19.1+/-41.9	0,11,2192	105.0	86.0	92.0		1197,234	-11.6	0.2	17	dbSNP_134	92	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	TTYH2	NM_032646.5,NM_052869.1	,	0,13,6490	TT,TC,CC		0.0233,0.2497,0.1	,	399/535,78/214	72248453	13,12993	2203	4300	6503	69760048	SO:0001819	synonymous_variant	94015				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.1197C>T	17.37:g.72248453C>T		Somatic		Capture	Illumina GAIIx	4	69760048	B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Silent	SNP	HMMPfam_Tweety	p.A399	ENST00000269346.4	37	c.1197	CCDS32717.1	17																																																																																			-	HMMPfam_Tweety		0.617	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TTYH2	protein_coding	OTTHUMT00000387459.1	C			69760048	1	no_errors	NM_032646	genbank	human	reviewed	54_36p	silent	SNP	0.32	T
DYRK1B	9149	genome.wustl.edu	37	19	40321331	40321331	+	Silent	SNP	G	G	A			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr19:40321331G>A	ENST00000593685.1	-	3	624	c.156C>T	c.(154-156)ctC>ctT	p.L52L	DYRK1B_ENST00000323039.5_Silent_p.L52L|DYRK1B_ENST00000348817.3_Silent_p.L52L|DYRK1B_ENST00000430012.2_Silent_p.L52L|DYRK1B_ENST00000601972.1_Silent_p.L52L|DYRK1B_ENST00000597639.1_Silent_p.L52L			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	52					adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)	p.L52L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			AGGTCTTGATGAGGTCCACAG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	19											82.0	76.0	78.0					19																	40321331		2203	4300	6503	45013171	SO:0001819	synonymous_variant	9149			Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.156C>T	19.37:g.40321331G>A		Somatic		Capture	Illumina GAIIx	4	45013171	O75258|O75788|O75789	Silent	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.L52	ENST00000593685.1	37	c.156	CCDS12543.1	19																																																																																			-	NULL		0.627	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DYRK1B	protein_coding	OTTHUMT00000462874.2	G	NM_004714		45013171	-1	no_errors	NM_004714	genbank	human	reviewed	54_36p	silent	SNP	1	A
SAE1	10055	genome.wustl.edu	37	19	47673151	47673151	+	Missense_Mutation	SNP	G	G	A	rs538083905		TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr19:47673151G>A	ENST00000270225.7	+	6	772	c.704G>A	c.(703-705)cGc>cAc	p.R235H	SAE1_ENST00000540850.1_Missense_Mutation_p.R61H|SAE1_ENST00000413379.3_Missense_Mutation_p.R235H|SAE1_ENST00000598840.1_Missense_Mutation_p.R154H|SAE1_ENST00000392776.3_Missense_Mutation_p.R235H	NM_005500.2	NP_005491.1	Q9UBE0	SAE1_HUMAN	SUMO1 activating enzyme subunit 1	235					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitotic cell cycle (GO:0007346)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP-dependent protein binding (GO:0043008)|enzyme activator activity (GO:0008047)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|ubiquitin activating enzyme activity (GO:0004839)	p.R235H(1)		endometrium(3)|large_intestine(5)|lung(4)|ovary(1)	13		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)		GCTCTGAAGCGCACGACCTCC	0.512																																																1	Substitution - Missense(1)	ovary(1)	19											133.0	121.0	125.0					19																	47673151		2203	4300	6503	52364991	SO:0001583	missense	10055			BC018271	CCDS12696.1, CCDS54284.1, CCDS54285.1	19q13.32	2013-09-26				ENSG00000142230		"""Ubiquitin-like modifier activating enzymes"""	30660	protein-coding gene	gene with protein product	"""activator Of sumo 1"""	613294				10187858, 9920803, 10217437	Standard	NM_005500		Approved	AOS1, FLJ3091, Sua1	uc002pgc.3	Q9UBE0		ENST00000270225.7:c.704G>A	19.37:g.47673151G>A	ENSP00000270225:p.Arg235His	Somatic		Capture	Illumina GAIIx	4	52364991	B2RDP5|B3KMQ2|F5GXX7|G3XAK6|O95717|Q9P020	Missense_Mutation	SNP	-	p.R235H	ENST00000270225.7	37	c.704	CCDS12696.1	19	.	.	.	.	.	.	.	.	.	.	G	13.90	2.374010	0.42105	.	.	ENSG00000142230	ENST00000413379;ENST00000270225;ENST00000392776;ENST00000540850;ENST00000414294	T;T;T;T;T	0.75821	-0.85;0.85;-0.88;0.85;-0.97	5.73	5.73	0.89815	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.159126	0.52532	D	0.000079	D	0.85004	0.5598	M	0.84773	2.715	0.54753	D	0.999986	B;D;P;B	0.76494	0.196;0.999;0.774;0.055	B;P;B;B	0.61477	0.068;0.889;0.308;0.022	D	0.85892	0.1429	10	0.54805	T	0.06	.	12.3892	0.55348	0.0781:0.0:0.9219:0.0	.	61;235;235;235	B4DY66;G3XAK6;F5GXX7;Q9UBE0	.;.;.;SAE1_HUMAN	H	235;235;235;61;235	ENSP00000416557:R235H;ENSP00000270225:R235H;ENSP00000440818:R235H;ENSP00000440955:R61H;ENSP00000398818:R235H	ENSP00000270225:R235H	R	+	2	0	SAE1	52364991	1.000000	0.71417	1.000000	0.80357	0.240000	0.25518	4.364000	0.59479	2.868000	0.98415	0.555000	0.69702	CGC	-	NULL		0.512	SAE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAE1	protein_coding	OTTHUMT00000466775.1	G	NM_005500		52364991	1	no_errors	NM_005500	genbank	human	validated	54_36p	missense	SNP	0.99	A
MUC16	94025	genome.wustl.edu	37	19	9073638	9073638	+	Missense_Mutation	SNP	C	C	T	rs201713021	byFrequency	TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr19:9073638C>T	ENST00000397910.4	-	3	14011	c.13808G>A	c.(13807-13809)cGa>cAa	p.R4603Q		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4605	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.R4603Q(3)|p.R236Q(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTTCTCTTTTCGTCCAGCAGT	0.502													C|||	3	0.000599042	0.0023	0.0	5008	,	,		20960	0.0		0.0	False		,,,				2504	0.0															5	Substitution - Missense(5)	lung(3)|ovary(2)	19						C	GLN/ARG	19,3967		1,17,1975	93.0	88.0	90.0		13808	-0.8	0.0	19		90	1,8343		0,1,4171	yes	missense	MUC16	NM_024690.2	43	1,18,6146	TT,TC,CC		0.012,0.4767,0.1622	benign	4603/14508	9073638	20,12310	1993	4172	6165	8934638	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13808G>A	19.37:g.9073638C>T	ENSP00000381008:p.Arg4603Gln	Somatic		Capture	Illumina GAIIx	4	8934638	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	HMMPfam_SEA;superfamily_Immunoglobulin;superfamily_SEA domain	p.R4603Q	ENST00000397910.4	37	c.13808	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	2.656	-0.280750	0.05642	0.004767	1.2E-4	ENSG00000181143	ENST00000397910	T	0.02812	4.15	1.63	-0.829	0.10796	.	.	.	.	.	T	0.01222	0.0040	N	0.02011	-0.69	.	.	.	B	0.06786	0.001	B	0.01281	0.0	T	0.44862	-0.9300	8	0.87932	D	0	.	3.5428	0.07818	0.3197:0.4572:0.0:0.2231	.	4603	B5ME49	.	Q	4603	ENSP00000381008:R4603Q	ENSP00000381008:R4603Q	R	-	2	0	MUC16	8934638	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.445000	0.02401	-0.818000	0.04329	-1.786000	0.00637	CGA	-	NULL		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	C	NM_024690		8934638	-1	no_errors	NM_024690	genbank	human	validated	54_36p	missense	SNP		T
NLRP8	126205	genome.wustl.edu	37	19	56466123	56466123	+	Silent	SNP	C	C	T	rs377108884		TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr19:56466123C>T	ENST00000291971.3	+	3	770	c.699C>T	c.(697-699)taC>taT	p.Y233Y	NLRP8_ENST00000590542.1_Silent_p.Y233Y	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	233	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.Y233Y(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		ACAAGTTCTACGCCCACAAGC	0.527																																																1	Substitution - coding silent(1)	ovary(1)	19						C		0,4406		0,0,2203	104.0	88.0	94.0		699	0.9	0.2	19		94	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NLRP8	NM_176811.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		233/1049	56466123	1,13005	2203	4300	6503	61157935	SO:0001819	synonymous_variant	126205			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.699C>T	19.37:g.56466123C>T		Somatic		Capture	Illumina GAIIx	4	61157935	Q7RTR4	Silent	SNP	-	p.Y233	ENST00000291971.3	37	c.699	CCDS12937.1	19																																																																																			-	NULL		0.527	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	protein_coding	OTTHUMT00000457462.1	C	NM_176811		61157935	1	no_errors	NM_176811	genbank	human	provisional	54_36p	silent	SNP	0.01	T
ZNF512	84450	genome.wustl.edu	37	2	27821040	27821040	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr2:27821040G>T	ENST00000355467.4	+	3	279	c.196G>T	c.(196-198)Gat>Tat	p.D66Y	ZNF512_ENST00000416005.2_Missense_Mutation_p.D65Y|ZNF512_ENST00000494548.1_3'UTR|ZNF512_ENST00000379717.1_Missense_Mutation_p.D65Y|ZNF512_ENST00000413371.2_5'UTR|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000556601.1_5'UTR	NM_001271287.1|NM_001271288.1|NM_001271289.1|NM_001271318.1|NM_032434.3	NP_001258216.1|NP_001258217.1|NP_001258218.1|NP_001258247.1|NP_115810.2	Q96ME7	ZN512_HUMAN	zinc finger protein 512	66					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D66Y(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)					ACCAGTGAGTGATTTTCCAGC	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											164.0	140.0	148.0					2																	27821040		2203	4300	6503	27674544	SO:0001583	missense	84450			AL833748	CCDS1758.1, CCDS59428.1, CCDS59429.1	2p23	2008-02-05			ENSG00000243943	ENSG00000243943		"""Zinc fingers, C2H2-type"""	29380	protein-coding gene	gene with protein product						11347906	Standard	NM_032434		Approved	KIAA1805	uc002rla.4	Q96ME7	OTTHUMG00000097786	ENST00000355467.4:c.196G>T	2.37:g.27821040G>T	ENSP00000347648:p.Asp66Tyr	Somatic		Capture	Illumina GAIIx	4	27674544	B4DSM5|Q53RZ7|Q86XK6|Q96JM0	Missense_Mutation	SNP	-	p.D66Y	ENST00000355467.4	37	c.196	CCDS1758.1	2	.	.	.	.	.	.	.	.	.	.	G	15.55	2.866464	0.51588	.	.	ENSG00000243943	ENST00000379717;ENST00000355467;ENST00000416005	.	.	.	5.82	4.95	0.65309	.	0.365154	0.26734	N	0.022774	T	0.39708	0.1088	N	0.22421	0.69	0.80722	D	1	P;P	0.38922	0.524;0.651	B;B	0.38803	0.282;0.121	T	0.38243	-0.9670	9	0.59425	D	0.04	-8.7417	10.9043	0.47071	0.0861:0.0:0.9139:0.0	.	65;66	B4DSM5;Q96ME7	.;ZN512_HUMAN	Y	65;66;65	.	ENSP00000347648:D66Y	D	+	1	0	ZNF512	27674544	1.000000	0.71417	0.968000	0.41197	0.872000	0.50106	3.193000	0.50997	1.476000	0.48215	-0.140000	0.14226	GAT	-	NULL		0.428	ZNF512-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF512	protein_coding	OTTHUMT00000215029.2	G	NM_032434		27674544	1	no_errors	NM_032434	genbank	human	validated	54_36p	missense	SNP	0.72	T
COL6A3	1293	genome.wustl.edu	37	2	238285464	238285464	+	Silent	SNP	T	T	C	rs201085369		TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr2:238285464T>C	ENST00000295550.4	-	7	3473	c.3021A>G	c.(3019-3021)ccA>ccG	p.P1007P	COL6A3_ENST00000353578.4_Silent_p.P801P|COL6A3_ENST00000392004.3_Silent_p.P801P|COL6A3_ENST00000346358.4_Silent_p.P807P|COL6A3_ENST00000472056.1_Silent_p.P400P|COL6A3_ENST00000347401.3_Silent_p.P806P|COL6A3_ENST00000409809.1_Silent_p.P801P|COL6A3_ENST00000392003.2_Silent_p.P600P	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1007	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P1007P(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TCACTATCTGTGGATGAAGAT	0.488																																																1	Substitution - coding silent(1)	ovary(1)	2											224.0	224.0	224.0					2																	238285464		2203	4300	6503	237950203	SO:0001819	synonymous_variant	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3021A>G	2.37:g.238285464T>C		Somatic		Capture	Illumina GAIIx	4	237950203	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	VWA;HMMPfam_VWA;Kunitz_BPTI;HMMPfam_Kunitz_BPTI;Collagen;HMMPfam_Collagen	p.P1007	ENST00000295550.4	37	c.3021	CCDS33412.1	2																																																																																			-	HMMPfam_VWA		0.488	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	protein_coding	OTTHUMT00000315790.2	T	NM_004369		237950203	-1	no_errors	NM_004369	genbank	human	reviewed	54_36p	silent	SNP	0.12	C
VPS16	64601	genome.wustl.edu	37	20	2847206	2847206	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr20:2847206G>A	ENST00000380445.3	+	24	2578	c.2506G>A	c.(2506-2508)Gcc>Acc	p.A836T	VPS16_ENST00000380443.3_Missense_Mutation_p.A522T|VPS16_ENST00000380469.3_Missense_Mutation_p.A692T|PTPRA_ENST00000380393.3_Intron	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	836					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)		p.A836T(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						CAGGGCACAAGCCCAGAAGAA	0.587																																																1	Substitution - Missense(1)	ovary(1)	20											111.0	108.0	109.0					20																	2847206		2203	4300	6503	2795206	SO:0001583	missense	64601			AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.2506G>A	20.37:g.2847206G>A	ENSP00000369810:p.Ala836Thr	Somatic		Capture	Illumina GAIIx	4	2795206	Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Missense_Mutation	SNP	HMMPfam_Vps16_C;HMMPfam_Vps16_N	p.A836T	ENST00000380445.3	37	c.2506	CCDS13036.1	20	.	.	.	.	.	.	.	.	.	.	G	15.64	2.892599	0.52121	.	.	ENSG00000215305	ENST00000380445;ENST00000380469;ENST00000380443	T;T;T	0.44482	0.93;0.93;0.92	5.22	4.28	0.50868	.	0.429955	0.26812	N	0.022361	T	0.21267	0.0512	N	0.08118	0	0.80722	D	1	B;B;B;B	0.26363	0.004;0.147;0.058;0.004	B;B;B;B	0.17433	0.001;0.018;0.015;0.001	T	0.07121	-1.0789	10	0.66056	D	0.02	-8.4563	7.7885	0.29106	0.1815:0.0:0.8185:0.0	.	312;522;692;836	A1A4H0;Q5JUA8;Q9H269-2;Q9H269	.;.;.;VPS16_HUMAN	T	836;692;522	ENSP00000369810:A836T;ENSP00000369836:A692T;ENSP00000369808:A522T	ENSP00000369808:A522T	A	+	1	0	VPS16	2795206	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.606000	0.24194	1.432000	0.47375	0.561000	0.74099	GCC	-	NULL		0.587	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS16	protein_coding	OTTHUMT00000077658.2	G	NM_022575		2795206	1	no_errors	NM_022575	genbank	human	reviewed	54_36p	missense	SNP	1	A
CCM2L	140706	genome.wustl.edu	37	20	30610463	30610463	+	Splice_Site	SNP	G	G	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr20:30610463G>T	ENST00000300415.8	+	6	947	c.934G>T	c.(934-936)Gac>Tac	p.D312Y	CCM2L_ENST00000262659.8_Splice_Site_p.D312Y			Q9NUG4	CCM2L_HUMAN	cerebral cavernous malformation 2-like	312								p.D312Y(1)									CCTGGGCCAGGACGCTGCAGA	0.547																																																1	Substitution - Missense(1)	ovary(1)	20											140.0	131.0	134.0					20																	30610463		2203	4300	6503	30074124	SO:0001630	splice_region_variant	140706			AL031658	CCDS13195.1	20q11.21	2012-10-30	2012-10-30	2012-10-30	ENSG00000101331	ENSG00000101331			16153	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 160"""	C20orf160			Standard	NM_080625		Approved	dJ310O13.5	uc002wxf.2	Q9NUG4	OTTHUMG00000032197	ENST00000300415.8:c.934-1G>T	20.37:g.30610463G>T		Somatic		Capture	Illumina GAIIx	4	30074124	Q5JYR9|Q8N5F1|Q8N6G8|Q96MD5	Missense_Mutation	SNP	-	p.D312Y	ENST00000300415.8	37	c.934		20	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966525	0.74131	.	.	ENSG00000101331	ENST00000300415;ENST00000262659;ENST00000452892	T;T;T	0.51325	1.58;0.71;1.58	5.41	5.41	0.78517	.	0.101878	0.64402	D	0.000004	T	0.67192	0.2867	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.66011	-0.6029	9	.	.	.	-26.3884	17.7483	0.88427	0.0:0.0:1.0:0.0	.	312	Q9NUG4-2	.	Y	312;312;65	ENSP00000300415:D312Y;ENSP00000262659:D312Y;ENSP00000392448:D65Y	.	D	+	1	0	C20orf160	30074124	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	9.299000	0.96137	2.536000	0.85505	0.462000	0.41574	GAC	-	NULL		0.547	CCM2L-201	KNOWN	basic|appris_candidate_longest	protein_coding	C20orf160	protein_coding		G	NM_080625	Missense_Mutation	30074124	1	no_errors	NM_080625	genbank	human	validated	54_36p	missense	SNP	1	T
ATP9A	10079	genome.wustl.edu	37	20	50292692	50292692	+	Missense_Mutation	SNP	A	A	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr20:50292692A>T	ENST00000338821.5	-	10	1119	c.855T>A	c.(853-855)aaT>aaA	p.N285K	ATP9A_ENST00000402822.1_Missense_Mutation_p.N164K|ATP9A_ENST00000311637.5_Missense_Mutation_p.N149K	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	285					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.N285K(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GATTTGAGGTATTCATGACAC	0.408																																																1	Substitution - Missense(1)	ovary(1)	20											95.0	86.0	89.0					20																	50292692		2203	4300	6503	49726099	SO:0001583	missense	10079			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.855T>A	20.37:g.50292692A>T	ENSP00000342481:p.Asn285Lys	Somatic		Capture	Illumina GAIIx	4	49726099	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	-	p.N285K	ENST00000338821.5	37	c.855	CCDS33489.1	20	.	.	.	.	.	.	.	.	.	.	A	21.3	4.126588	0.77549	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	T;D;T	0.90197	-1.43;-2.63;-1.44	5.61	-4.7	0.03288	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.95101	0.8413	M	0.92784	3.345	0.80722	D	1	P;D	0.60575	0.566;0.988	B;D	0.67382	0.175;0.951	D	0.94329	0.7560	10	0.87932	D	0	-28.9316	15.4263	0.75055	0.3846:0.0:0.6154:0.0	.	164;285	O75110-2;O75110	.;ATP9A_HUMAN	K	149;285;164	ENSP00000309086:N149K;ENSP00000342481:N285K;ENSP00000385875:N164K	ENSP00000309086:N149K	N	-	3	2	ATP9A	49726099	0.066000	0.20996	0.545000	0.28153	0.905000	0.53344	-0.608000	0.05641	-1.029000	0.03317	-0.256000	0.11100	AAT	-	NULL		0.408	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP9A	protein_coding	OTTHUMT00000106494.1	A	NM_006045		49726099	-1	no_errors	NM_006045	genbank	human	validated	54_36p	missense	SNP	1	T
RHOA	387	genome.wustl.edu	37	3	49405912	49405912	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr3:49405912C>T	ENST00000418115.1	-	3	610	c.226G>A	c.(226-228)Gat>Aat	p.D76N	RHOA_ENST00000454011.2_Intron|RHOA_ENST00000422781.1_Missense_Mutation_p.D76N|RHOA-IT1_ENST00000428083.1_RNA	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	76					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.D76N(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		ACATCGGTATCTGGGTAGGAG	0.493																																																1	Substitution - Missense(1)	ovary(1)	3											153.0	145.0	148.0					3																	49405912		2203	4300	6503	49380916	SO:0001583	missense	387			BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.226G>A	3.37:g.49405912C>T	ENSP00000400175:p.Asp76Asn	Somatic		Capture	Illumina GAIIx	4	49380916	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	HMMPfam_Ras;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.D76N	ENST00000418115.1	37	c.226	CCDS2795.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.502925	0.96371	.	.	ENSG00000067560	ENST00000418115;ENST00000422781;ENST00000445425	T;T;T	0.76968	-1.06;-1.06;-1.06	5.78	5.78	0.91487	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84352	0.5453	N	0.17082	0.46	0.80722	D	1	B	0.28233	0.204	P	0.62813	0.907	D	0.84334	0.0523	10	0.87932	D	0	.	18.6067	0.91268	0.0:1.0:0.0:0.0	.	76	P61586	RHOA_HUMAN	N	76	ENSP00000400175:D76N;ENSP00000413587:D76N;ENSP00000408402:D76N	ENSP00000400175:D76N	D	-	1	0	RHOA	49380916	1.000000	0.71417	0.999000	0.59377	0.941000	0.58515	7.675000	0.84002	2.749000	0.94314	0.551000	0.68910	GAT	-	HMMPfam_Ras		0.493	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOA	protein_coding	OTTHUMT00000346157.3	C	NM_001664		49380916	-1	no_errors	NM_001664	genbank	human	validated	54_36p	missense	SNP	1	T
PTPRG	5793	genome.wustl.edu	37	3	61734583	61734583	+	Silent	SNP	C	C	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr3:61734583C>T	ENST00000474889.1	+	2	494	c.117C>T	c.(115-117)caC>caT	p.H39H	PTPRG_ENST00000495879.1_3'UTR|PTPRG_ENST00000295874.10_Silent_p.H39H	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	39					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.H39H(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		GGGCCCTGCACGAGAATAGAC	0.557																																																1	Substitution - coding silent(1)	ovary(1)	3											112.0	104.0	107.0					3																	61734583		2203	4300	6503	61709623	SO:0001819	synonymous_variant	5793			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.117C>T	3.37:g.61734583C>T		Somatic		Capture	Illumina GAIIx	4	61709623	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Silent	SNP	Y_phosphatase;HMMPfam_Y_phosphatase;Carb_anhydrase;HMMPfam_Carb_anhydrase;fn3;HMMPfam_fn3	p.H39	ENST00000474889.1	37	c.117	CCDS2895.1	3																																																																																			-	NULL		0.557	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRG	protein_coding	OTTHUMT00000351674.1	C	NM_002841		61709623	1	no_errors	NM_002841	genbank	human	reviewed	54_36p	silent	SNP	0.91	T
Unknown	0	genome.wustl.edu	37	1	39176218	39176218	+	IGR	SNP	G	G	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr1:39176218G>T								RP11-329N22.1 (234062 upstream) : RRAGC (127651 downstream)																							GATATTGAAAGGATGGTTAAT	0.388																																																0			1																																								38948805	SO:0001628	intergenic_variant	400750																															1.37:g.39176218G>T		Somatic		Capture	Illumina GAIIx	4	38948805		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.388					LOC400750			G			38948805	1	pseudogene	XR_039444	genbank	human	model	54_36p	rna	SNP	1	T
UGT8	7368	genome.wustl.edu	37	4	115544519	115544519	+	Silent	SNP	C	C	T	rs368584974		TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr4:115544519C>T	ENST00000310836.6	+	2	1005	c.483C>T	c.(481-483)ggC>ggT	p.G161G	UGT8_ENST00000394511.3_Silent_p.G161G	NM_001128174.1	NP_001121646	Q16880	CGT_HUMAN	UDP glycosyltransferase 8	161					axon cargo transport (GO:0008088)|central nervous system development (GO:0007417)|cytoskeleton organization (GO:0007010)|galactosylceramide biosynthetic process (GO:0006682)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to paranode region of axon (GO:0002175)	integral component of membrane (GO:0016021)	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity (GO:0003851)|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity (GO:0008489)	p.G161G(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		TTTCAACTGGCCTTTGGTATC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	4											137.0	133.0	134.0					4																	115544519		2203	4300	6503	115763968	SO:0001819	synonymous_variant	7368			AK127970	CCDS3705.1	4q26	2013-02-21	2008-07-31	2005-07-20	ENSG00000174607	ENSG00000174607	2.4.1.45	"""UDP glucuronosyltransferases"""	12555	protein-coding gene	gene with protein product	"""2-hydroxyacylsphingosine 1-beta-galactosyltransferase"""	601291	"""UDP-galactose ceramide galactosyltransferase"""	CGT		8661025	Standard	NM_003360		Approved		uc003ibs.2	Q16880	OTTHUMG00000132915	ENST00000310836.6:c.483C>T	4.37:g.115544519C>T		Somatic		Capture	Illumina GAIIx	4	115763968	B3KXU7|O00196	Silent	SNP	HMMPfam_UDPGT;superfamily_UDP-Glycosyltransferase/glycogen phosphorylase	p.G161	ENST00000310836.6	37	c.483	CCDS3705.1	4																																																																																			-	HMMPfam_UDPGT		0.443	UGT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT8	protein_coding	OTTHUMT00000256426.2	C	NM_003360		115763968	1	no_errors	NM_003360	genbank	human	validated	54_36p	silent	SNP	1	T
HHIP	64399	genome.wustl.edu	37	4	145633225	145633225	+	Splice_Site	SNP	T	T	C			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr4:145633225T>C	ENST00000296575.3	+	8	2078		c.e8+2			NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein						carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)	p.?(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		AAGATTATGGTATGTAGAGCA	0.318																																																1	Unknown(1)	ovary(1)	4											110.0	111.0	110.0					4																	145633225		2203	4300	6503	145852675	SO:0001630	splice_region_variant	64399			AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.1423+2T>C	4.37:g.145633225T>C		Somatic		Capture	Illumina GAIIx	4	145852675	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Splice_Site	SNP	-	e8+2	ENST00000296575.3	37	c.1423+2	CCDS3762.1	4	.	.	.	.	.	.	.	.	.	.	T	20.6	4.017083	0.75161	.	.	ENSG00000164161	ENST00000296575	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0467	0.80725	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HHIP	145852675	1.000000	0.71417	0.996000	0.52242	0.921000	0.55340	7.513000	0.81739	2.182000	0.69389	0.533000	0.62120	.	-	-		0.318	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIP	protein_coding	OTTHUMT00000364887.2	T		Intron	145852675	1	no_errors	NM_022475	genbank	human	reviewed	54_36p	splice_site	SNP	1	C
CENPQ	55166	genome.wustl.edu	37	6	49439884	49439884	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr6:49439884A>G	ENST00000335783.3	+	4	360	c.266A>G	c.(265-267)gAa>gGa	p.E89G		NM_018132.3	NP_060602.2	Q7L2Z9	CENPQ_HUMAN	centromere protein Q	89					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.E89G(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(4)|ovary(2)|prostate(1)	11	Lung NSC(77;0.0128)					ACTATGATGGAATCAGTAATA	0.353																																																1	Substitution - Missense(1)	ovary(1)	6											139.0	138.0	138.0					6																	49439884		2203	4300	6503	49547843	SO:0001583	missense	55166			AK001407	CCDS4925.1	6p12.3	2013-11-05	2006-06-15	2006-06-15	ENSG00000031691	ENSG00000031691			21347	protein-coding gene	gene with protein product		611506	"""chromosome 6 open reading frame 139"""	C6orf139		16622420, 16622419	Standard	NM_018132		Approved	FLJ10545, CENP-Q	uc003ozh.1	Q7L2Z9	OTTHUMG00000014815	ENST00000335783.3:c.266A>G	6.37:g.49439884A>G	ENSP00000337289:p.Glu89Gly	Somatic		Capture	Illumina GAIIx	4	49547843	A8KAF1|Q6IN61|Q9NVS5	Missense_Mutation	SNP	-	p.E89G	ENST00000335783.3	37	c.266	CCDS4925.1	6	.	.	.	.	.	.	.	.	.	.	A	16.86	3.238850	0.58995	.	.	ENSG00000031691	ENST00000335783;ENST00000371200	T	0.37915	1.17	5.0	5.0	0.66597	.	0.116367	0.56097	D	0.000029	T	0.26991	0.0661	L	0.56769	1.78	0.33312	D	0.566227	D	0.54047	0.964	P	0.47981	0.563	T	0.10382	-1.0632	10	0.29301	T	0.29	-12.2972	12.5096	0.55999	1.0:0.0:0.0:0.0	.	89	Q7L2Z9	CENPQ_HUMAN	G	89	ENSP00000337289:E89G	ENSP00000337289:E89G	E	+	2	0	CENPQ	49547843	0.994000	0.37717	0.986000	0.45419	0.899000	0.52679	4.246000	0.58740	2.226000	0.72624	0.472000	0.43445	GAA	-	NULL		0.353	CENPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPQ	protein_coding	OTTHUMT00000040855.2	A	NM_018132		49547843	1	no_errors	NM_018132	genbank	human	validated	54_36p	missense	SNP	0.98	G
AK9	221264	genome.wustl.edu	37	6	109995410	109995410	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr6:109995410G>T	ENST00000424296.2	-	3	248	c.172C>A	c.(172-174)Cgt>Agt	p.R58S	AK9_ENST00000285397.5_Missense_Mutation_p.R58S|AK9_ENST00000368948.2_Missense_Mutation_p.R58S|AK9_ENST00000341338.6_5'UTR	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	58	Adenylate kinase 1.				ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)	p.R58S(1)									CCTTCAACACGAATACATTTC	0.289																																																1	Substitution - Missense(1)	ovary(1)	6											49.0	45.0	46.0					6																	109995410		2203	4296	6499	110102103	SO:0001583	missense	221264			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.172C>A	6.37:g.109995410G>T	ENSP00000410186:p.Arg58Ser	Somatic		Capture	Illumina GAIIx	Phase_III	110102103	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	-	p.R58S	ENST00000424296.2	37	c.172	CCDS55048.1	6	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111389	0.77210	.	.	ENSG00000155085	ENST00000424296;ENST00000368948;ENST00000285397;ENST00000532976	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.66	4.78	0.61160	ATPase, AAA+ type, core (1);	0.418399	0.27164	N	0.020637	T	0.65460	0.2693	N	0.24115	0.695	0.80722	D	1	P;D	0.57571	0.934;0.98	B;P	0.57846	0.433;0.828	T	0.66015	-0.6028	9	.	.	.	-3.373	7.6807	0.28511	0.1728:0.0:0.8272:0.0	.	58;58	Q5TCS8-2;Q5TCS8	.;AKD1_HUMAN	S	58	ENSP00000410186:R58S;ENSP00000357944:R58S;ENSP00000285397:R58S;ENSP00000436325:R58S	.	R	-	1	0	AKD1	110102103	0.993000	0.37304	0.997000	0.53966	0.998000	0.95712	1.941000	0.40233	2.666000	0.90696	0.650000	0.86243	CGT	-	NULL		0.289	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AKD2	protein_coding		G	NM_001145128		110102103	-1	no_errors	NM_145025	genbank	human	validated	54_36p	missense	SNP	0.989	T
ZFAND2A	90637	genome.wustl.edu	37	7	1192813	1192813	+	Frame_Shift_Del	DEL	C	C	-			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr7:1192813delC	ENST00000316495.3	-	5	589	c.330delG	c.(328-330)atgfs	p.M110fs	ZFAND2A_ENST00000401903.1_Frame_Shift_Del_p.M110fs	NM_182491.2	NP_872297.2	Q8N6M9	ZFN2A_HUMAN	zinc finger, AN1-type domain 2A	110					cellular response to arsenic-containing substance (GO:0071243)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	zinc ion binding (GO:0008270)	p.M110fs>36(1)		lung(2)|ovary(1)	3		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.82e-15)		CCATCTGCAGCATCTCTTTCT	0.478																																																1	Deletion - Frameshift(1)	ovary(1)	7											164.0	127.0	139.0					7																	1192813		2203	4300	6503	1159339	SO:0001589	frameshift_variant	90637			BC029558	CCDS5323.1	7p22.3	2010-04-23			ENSG00000178381	ENSG00000178381		"""Zinc fingers, AN1-type domain containing"""	28073	protein-coding gene	gene with protein product	"""arsenite inducible RNA associated protein"""	610699				20185824	Standard	NM_182491		Approved	AIRAP	uc003skc.3	Q8N6M9	OTTHUMG00000119019	ENST00000316495.3:c.330delG	7.37:g.1192813delC	ENSP00000314619:p.Met110fs	Somatic		Capture	Illumina GAIIx	Phase_III	1159339	A4D220	Frame_Shift_Del	DEL	HMMPfam_zf-AN1	p.M110fs	ENST00000316495.3	37	c.330	CCDS5323.1	7																																																																																			(deletion:cds_exon[1159231,1159386])	HMMPfam_zf-AN1		0.478	ZFAND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND2A	protein_coding	OTTHUMT00000239220.2	C	NM_182491		1159339	-1	no_errors	NM_182491	genbank	human	provisional	54_36p	frame_shift_del	DEL	1	-
CLK2P1	1197	genome.wustl.edu	37	7	23624707	23624707	+	IGR	SNP	C	C	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr7:23624707C>T								TRA2A (53047 upstream) : CCDC126 (12290 downstream)																							TGACTGGAGTCCCACAACTTG	0.537																																																0			7																																								23591232	SO:0001628	intergenic_variant	1197																															7.37:g.23624707C>T		Somatic		Capture	Illumina GAIIx	4	23591232		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.537					CLK2P			C			23591232	-1	pseudogene	NR_002711	genbank	human	validated	54_36p	rna	SNP	1	T
SPATA31D5P	347127	genome.wustl.edu	37	9	84532488	84532488	+	RNA	SNP	C	C	G			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr9:84532488C>G	ENST00000527857.1	+	0	2510					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		GAGACTAGGTCAGAAACAACT	0.453																																																0			9																																								83722308			0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84532488C>G		Somatic		Capture	Illumina GAIIx	4	83722308		Missense_Mutation	SNP	-	p.Q61E	ENST00000527857.1	37	c.181		9																																																																																			-	NULL		0.453	SPATA31D5P-002	KNOWN	basic	processed_transcript	ENSG00000204562	pseudogene	OTTHUMT00000052810.2	C	NR_026851		83722308	1	no_errors	ENST00000376459	ensembl	human	known	54_36p	missense	SNP		G
BNC2	54796	genome.wustl.edu	37	9	16437049	16437049	+	Silent	SNP	T	T	C			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr9:16437049T>C	ENST00000380672.4	-	6	1200	c.1143A>G	c.(1141-1143)acA>acG	p.T381T	BNC2_ENST00000545497.1_Silent_p.T286T|BNC2_ENST00000380667.2_Silent_p.T314T|BNC2_ENST00000380666.2_Silent_p.T381T	NM_017637.5	NP_060107.3			basonuclin 2									p.T381T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		TTCTATTGGGTGTTTGATCAT	0.478																																																1	Substitution - coding silent(1)	ovary(1)	9											117.0	119.0	118.0					9																	16437049		2203	4300	6503	16427049	SO:0001819	synonymous_variant	54796			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.1143A>G	9.37:g.16437049T>C		Somatic		Capture	Illumina GAIIx	4	16427049		Silent	SNP	HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.T381	ENST00000380672.4	37	c.1143	CCDS6482.2	9																																																																																			-	NULL		0.478	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	protein_coding	OTTHUMT00000216901.5	T	NM_017637		16427049	-1	no_errors	NM_017637	genbank	human	validated	54_36p	silent	SNP	0.92	C
MLLT3	4300	genome.wustl.edu	37	9	20414188	20414188	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr9:20414188T>C	ENST00000380338.4	-	5	942	c.656A>G	c.(655-657)aAa>aGa	p.K219R	MLLT3_ENST00000429426.2_Missense_Mutation_p.K216R|MIR4473_ENST00000583731.1_RNA|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	219					anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.K219R(1)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		GGAAGGTTCTTTGAAGGCACT	0.388			T	MLL	ALL																																		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	1	Substitution - Missense(1)	ovary(1)	9											252.0	269.0	263.0					9																	20414188		2203	4300	6503	20404188	SO:0001583	missense	4300			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.656A>G	9.37:g.20414188T>C	ENSP00000369695:p.Lys219Arg	Somatic		Capture	Illumina GAIIx	4	20404188	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Missense_Mutation	SNP	HMMPfam_YEATS	p.K219R	ENST00000380338.4	37	c.656	CCDS6494.1	9	.	.	.	.	.	.	.	.	.	.	T	11.84	1.759623	0.31137	.	.	ENSG00000171843	ENST00000380338;ENST00000429426;ENST00000540751	.	.	.	5.48	5.48	0.80851	.	0.044318	0.85682	D	0.000000	T	0.54515	0.1863	L	0.39147	1.195	0.80722	D	1	B;B	0.17465	0.022;0.022	B;B	0.14578	0.011;0.011	T	0.49890	-0.8891	9	0.34782	T	0.22	-15.1527	15.5535	0.76173	0.0:0.0:0.0:1.0	.	216;219	B7Z755;P42568	.;AF9_HUMAN	R	219;216;258	.	ENSP00000369695:K219R	K	-	2	0	MLLT3	20404188	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.875000	0.69660	2.077000	0.62373	0.482000	0.46254	AAA	-	NULL		0.388	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	protein_coding	OTTHUMT00000051872.1	T	NM_004529		20404188	-1	no_errors	NM_004529	genbank	human	validated	54_36p	missense	SNP	1	C
DNM1	1759	genome.wustl.edu	37	9	131012488	131012488	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chr9:131012488G>A	ENST00000372923.3	+	20	2263	c.2171G>A	c.(2170-2172)cGg>cAg	p.R724Q	DNM1_ENST00000486160.1_Missense_Mutation_p.R724Q|DNM1_ENST00000393594.3_Missense_Mutation_p.R724Q|DNM1_ENST00000475805.1_Missense_Mutation_p.R724Q|DNM1_ENST00000341179.7_Missense_Mutation_p.R724Q	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	724	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.				endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.R724Q(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						CAGGCACAGCGGCGCGACGAG	0.637																																					GBM(113;146 1575 2722 28670 29921)											1	Substitution - Missense(1)	ovary(1)	9											45.0	33.0	37.0					9																	131012488		2203	4300	6503	130052309	SO:0001583	missense	1759			L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.2171G>A	9.37:g.131012488G>A	ENSP00000362014:p.Arg724Gln	Somatic		Capture	Illumina GAIIx	4	130052309	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	HMMPfam_Dynamin_M;HMMPfam_Dynamin_N;HMMPfam_PH;HMMPfam_GED;superfamily_PH domain-like;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R724Q	ENST00000372923.3	37	c.2171	CCDS6895.1	9	.	.	.	.	.	.	.	.	.	.	.	20.5	3.993663	0.74703	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393594;ENST00000486160;ENST00000543158	T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49	4.52	4.52	0.55395	GTPase effector domain, GED (1);Dynamin GTPase effector (2);	0.221539	0.40302	N	0.001128	T	0.50154	0.1599	M	0.78344	2.41	0.51012	D	0.999906	B;B;P	0.40794	0.161;0.133;0.729	B;B;B	0.34452	0.062;0.037;0.183	T	0.60697	-0.7212	10	0.72032	D	0.01	-18.3293	10.9943	0.47567	0.0863:0.0:0.9137:0.0	.	724;724;663	Q05193;Q05193-3;B4DHH5	DYN1_HUMAN;.;.	Q	724;724;724;724;724;269	ENSP00000419225:R724Q;ENSP00000345680:R724Q;ENSP00000362014:R724Q;ENSP00000377219:R724Q;ENSP00000420045:R724Q	ENSP00000345680:R724Q	R	+	2	0	DNM1	130052309	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.167000	0.58209	2.340000	0.79590	0.542000	0.68232	CGG	-	HMMPfam_GED		0.637	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNM1	protein_coding	OTTHUMT00000054367.1	G	NM_004408		130052309	1	no_errors	NM_004408	genbank	human	reviewed	54_36p	missense	SNP	1	A
MXRA5	25878	genome.wustl.edu	37	X	3241454	3241454	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chrX:3241454C>T	ENST00000217939.6	-	5	2426	c.2272G>A	c.(2272-2274)Gtt>Att	p.V758I		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	758						extracellular vesicular exosome (GO:0070062)		p.V758I(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CCTTCTGCAACATTGGTCTCT	0.438																																																1	Substitution - Missense(1)	ovary(1)	X											112.0	98.0	103.0					X																	3241454		2203	4300	6503	3251454	SO:0001583	missense	25878			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.2272G>A	X.37:g.3241454C>T	ENSP00000217939:p.Val758Ile	Somatic		Capture	Illumina GAIIx	4	3251454	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	HMMPfam_LRR_1;HMMPfam_I-set;HMMPfam_ig;superfamily_Immunoglobulin;superfamily_L domain-like	p.V758I	ENST00000217939.6	37	c.2272	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	c	8.830	0.939582	0.18281	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.67865	-0.29	3.63	-1.32	0.09201	.	0.755193	0.10598	N	0.656033	T	0.47930	0.1472	L	0.29908	0.895	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.29397	-1.0013	10	0.12103	T	0.63	.	8.77	0.34726	0.0:0.5571:0.0:0.4429	.	758	Q9NR99	MXRA5_HUMAN	I	758	ENSP00000217939:V758I	ENSP00000217939:V758I	V	-	1	0	MXRA5	3251454	0.000000	0.05858	0.000000	0.03702	0.118000	0.20060	-0.221000	0.09202	-1.069000	0.03153	0.529000	0.55759	GTT	-	NULL		0.438	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	protein_coding	OTTHUMT00000055655.2	C	NM_015419		3251454	-1	no_errors	NM_015419	genbank	human	validated	54_36p	missense	SNP	0.01	T
FAM47C	442444	genome.wustl.edu	37	X	37028284	37028284	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chrX:37028284A>G	ENST00000358047.3	+	1	1853	c.1801A>G	c.(1801-1803)Act>Gct	p.T601A		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	601								p.T601A(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GCCCCCCGAGACTGGAGTGTC	0.657																																																1	Substitution - Missense(1)	ovary(1)	X											13.0	16.0	15.0					X																	37028284		2160	4218	6378	36938205	SO:0001583	missense	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1801A>G	X.37:g.37028284A>G	ENSP00000367913:p.Thr601Ala	Somatic		Capture	Illumina GAIIx	4	36938205	Q6ZU46	Missense_Mutation	SNP	-	p.T601A	ENST00000358047.3	37	c.1801	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	-	8.270	0.813074	0.16537	.	.	ENSG00000198173	ENST00000358047	T	0.17691	2.26	1.71	-3.41	0.04839	.	.	.	.	.	T	0.15349	0.0370	M	0.81802	2.56	0.09310	N	1	B	0.15473	0.013	B	0.11329	0.006	T	0.46331	-0.9199	9	0.10377	T	0.69	.	3.6714	0.08276	0.3555:0.2099:0.4346:0.0	.	601	Q5HY64	FA47C_HUMAN	A	601	ENSP00000367913:T601A	ENSP00000367913:T601A	T	+	1	0	FAM47C	36938205	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-0.563000	0.05943	-1.052000	0.03222	-0.541000	0.04245	ACT	-	NULL		0.657	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	protein_coding	OTTHUMT00000060508.1	A	NM_001013736		36938205	1	no_errors	NM_001013736	genbank	human	provisional	54_36p	missense	SNP	0	G
MAOB	4129	genome.wustl.edu	37	X	43652774	43652774	+	Missense_Mutation	SNP	A	A	T			TCGA-10-0933-01A-01W-0421-09	TCGA-10-0933-11A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3ec4215f-b57d-4ae7-b247-55ea1f7e97d3	44c571b4-9884-4d27-b5cb-cbd97a9de5f4	g.chrX:43652774A>T	ENST00000378069.4	-	8	967	c.820T>A	c.(820-822)Ttc>Atc	p.F274I	MAOB_ENST00000538942.1_Missense_Mutation_p.F258I|MAOB_ENST00000536181.1_Missense_Mutation_p.F258I	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	274					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)	p.F274I(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	GGGGGATTGAAGTGAATCTTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	X											135.0	112.0	119.0					X																	43652774		2203	4300	6503	43537718	SO:0001583	missense	4129				CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.820T>A	X.37:g.43652774A>T	ENSP00000367309:p.Phe274Ile	Somatic		Capture	Illumina GAIIx	4	43537718	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Missense_Mutation	SNP	HMMPfam_Amino_oxidase;superfamily_FAD/NAD(P)-binding domain;superfamily_FAD-linked reductases C-terminal domain	p.F274I	ENST00000378069.4	37	c.820	CCDS14261.1	X	.	.	.	.	.	.	.	.	.	.	A	25.0	4.589104	0.86851	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	D;D;D	0.95205	-3.64;-3.64;-3.64	5.97	4.78	0.61160	Amine oxidase (1);	0.193518	0.56097	D	0.000028	D	0.97629	0.9223	H	0.94658	3.565	0.53005	D	0.999964	D;D	0.64830	0.994;0.978	D;D	0.66979	0.948;0.919	D	0.97108	0.9802	10	0.52906	T	0.07	-5.2192	11.4497	0.50145	0.9285:0.0:0.0715:0.0	.	258;274	B7Z5H3;P27338	.;AOFB_HUMAN	I	274;258;258	ENSP00000367309:F274I;ENSP00000441613:F258I;ENSP00000442240:F258I	ENSP00000367309:F274I	F	-	1	0	MAOB	43537718	1.000000	0.71417	0.988000	0.46212	0.997000	0.91878	6.969000	0.76092	0.830000	0.34757	0.486000	0.48141	TTC	-	HMMPfam_Amino_oxidase		0.408	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAOB	protein_coding	OTTHUMT00000056303.1	A	NM_000898		43537718	-1	no_errors	NM_000898	genbank	human	reviewed	54_36p	missense	SNP	1	T
