#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CSDE1	7812	genome.wustl.edu	37	1	115282409	115282409	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr1:115282409T>G	ENST00000358528.4	-	3	529	c.103A>C	c.(103-105)Acc>Ccc	p.T35P	CSDE1_ENST00000534699.1_Missense_Mutation_p.T35P|CSDE1_ENST00000438362.2_Missense_Mutation_p.T81P|CSDE1_ENST00000530886.1_Intron|CSDE1_ENST00000261443.5_Missense_Mutation_p.T35P|CSDE1_ENST00000369530.1_Missense_Mutation_p.T81P|CSDE1_ENST00000339438.6_Missense_Mutation_p.T35P	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	35	CSD 1.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.T35P(1)		NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCGTAAGAGGTTAACAGTTTT	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											291.0	298.0	296.0					1																	115282409		2203	4300	6503	115083932	SO:0001583	missense	7812				CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.103A>C	1.37:g.115282409T>G	ENSP00000351329:p.Thr35Pro	Somatic		Capture	Illumina GAIIx	4	115083932	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	-	p.T35P	ENST00000358528.4	37	c.103	CCDS30812.1	1	.	.	.	.	.	.	.	.	.	.	T	16.99	3.273724	0.59649	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000369530;ENST00000534699;ENST00000534389;ENST00000525878	.	.	.	5.81	5.81	0.92471	Cold shock protein (1);Nucleic acid-binding, OB-fold-like (1);Cold-shock protein, DNA-binding (1);	0.047513	0.85682	D	0.000000	T	0.54127	0.1839	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;0.977;0.997	D;P;D	0.87578	0.998;0.798;0.986	T	0.58956	-0.7544	9	0.38643	T	0.18	-27.0422	16.1616	0.81721	0.0:0.0:0.0:1.0	.	81;35;81	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	P	35;81;35;35;81;35;35;35	.	ENSP00000261443:T35P	T	-	1	0	CSDE1	115083932	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.961000	0.70356	2.218000	0.71995	0.377000	0.23210	ACC	-	NULL		0.413	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CSDE1	protein_coding	OTTHUMT00000033397.1	T	NM_007158		115083932	-1	no_errors	NM_001007553	genbank	human	validated	54_36p	missense	SNP	1	G
PRPF3	9129	genome.wustl.edu	37	1	150307613	150307613	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr1:150307613C>A	ENST00000324862.6	+	7	1101	c.936C>A	c.(934-936)gaC>gaA	p.D312E	PRPF3_ENST00000543398.1_Missense_Mutation_p.D177E|PRPF3_ENST00000467329.1_3'UTR|PRPF3_ENST00000414970.2_Missense_Mutation_p.D263E	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3	312					mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.D312E(1)		breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		CCTTTTTTGACCCCCGAGTCT	0.453																																					Ovarian(168;1070 2670 5178 20729)											1	Substitution - Missense(1)	ovary(1)	1											85.0	81.0	82.0					1																	150307613		2203	4300	6503	148574237	SO:0001583	missense	9129			AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.936C>A	1.37:g.150307613C>A	ENSP00000315379:p.Asp312Glu	Somatic		Capture	Illumina GAIIx	4	148574237	B4DSY9|O43446|Q5VT54	Missense_Mutation	SNP	-	p.D312E	ENST00000324862.6	37	c.936	CCDS951.1	1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419790	0.83559	.	.	ENSG00000117360	ENST00000324862;ENST00000414970;ENST00000543398	D;D;D	0.86769	-2.17;-2.17;-2.17	5.78	-1.65	0.08291	Pre-mRNA-splicing factor 3 (1);	0.000000	0.85682	D	0.000000	D	0.92077	0.7489	M	0.92604	3.325	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92183	0.5753	10	0.87932	D	0	-16.2282	11.5049	0.50459	0.0:0.5687:0.0:0.4313	.	263;312	E7EVD1;O43395	.;PRPF3_HUMAN	E	312;263;177	ENSP00000315379:D312E;ENSP00000387844:D263E;ENSP00000445421:D177E	ENSP00000315379:D312E	D	+	3	2	PRPF3	148574237	0.966000	0.33281	0.987000	0.45799	0.981000	0.71138	0.197000	0.17197	-0.228000	0.09869	-0.150000	0.13652	GAC	-	NULL		0.453	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF3	protein_coding	OTTHUMT00000035836.1	C	NM_004698		148574237	1	no_errors	NM_004698	genbank	human	reviewed	54_36p	missense	SNP	1	A
FCRL5	83416	genome.wustl.edu	37	1	157497673	157497673	+	Missense_Mutation	SNP	C	C	T	rs376321602		TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr1:157497673C>T	ENST00000361835.3	-	9	1851	c.1694G>A	c.(1693-1695)cGc>cAc	p.R565H	FCRL5_ENST00000368190.3_Missense_Mutation_p.R565H|FCRL5_ENST00000368191.3_Missense_Mutation_p.R480H|FCRL5_ENST00000356953.4_Missense_Mutation_p.R565H	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	565					negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.R565H(2)|p.R565P(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GAGGATGGGGCGAGACACTGG	0.527																																																3	Substitution - Missense(3)	ovary(1)|large_intestine(1)|kidney(1)	1						C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	44.0	49.0	47.0		1694,1694	1.6	0.9	1		47	2,8598		0,2,4298	no	missense,missense	FCRL5	NM_001195388.1,NM_031281.2	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	565/999,565/978	157497673	2,13004	2203	4300	6503	155764297	SO:0001583	missense	83416			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1694G>A	1.37:g.157497673C>T	ENSP00000354691:p.Arg565His	Somatic		Capture	Illumina GAIIx	4	155764297	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	HMMPfam_ig;superfamily_Immunoglobulin	p.R565H	ENST00000361835.3	37	c.1694	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	C	7.816	0.716824	0.15306	0.0	2.33E-4	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191	T;T;T;T	0.03496	3.91;3.91;3.91;3.91	3.53	1.59	0.23543	.	0.445392	0.16880	N	0.195724	T	0.01523	0.0049	L	0.45352	1.415	0.80722	D	1	P;P;P;P	0.51057	0.514;0.941;0.783;0.783	B;B;B;B	0.43809	0.167;0.432;0.38;0.38	T	0.63152	-0.6701	10	0.30854	T	0.27	.	6.3384	0.21309	0.0:0.7603:0.0:0.2397	.	480;565;565;565	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9	.;.;.;FCRL5_HUMAN	H	565;565;565;480	ENSP00000354691:R565H;ENSP00000349434:R565H;ENSP00000357173:R565H;ENSP00000357174:R480H	ENSP00000349434:R565H	R	-	2	0	FCRL5	155764297	0.001000	0.12720	0.922000	0.36590	0.821000	0.46438	-2.375000	0.01071	0.293000	0.22520	0.650000	0.86243	CGC	-	NULL		0.527	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	protein_coding	OTTHUMT00000046263.1	C	NM_031281		155764297	-1	no_errors	NM_031281	genbank	human	validated	54_36p	missense	SNP	0.75	T
OR4F5	79501	genome.wustl.edu	37	1	69538	69538	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr1:69538G>A	ENST00000335137.3	+	1	448	c.448G>A	c.(448-450)Gtg>Atg	p.V150M		NM_001005484.1	NP_001005484.1	Q8NH21	OR4F5_HUMAN	olfactory receptor, family 4, subfamily F, member 5	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V150M(1)		lung(1)|ovary(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;3.48e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.21e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TCTCCATTCGGTGAGCCAGTT	0.468																																																1	Substitution - Missense(1)	ovary(1)	1											160.0	92.0	117.0					1																	69538		1774	3031	4805	59401	SO:0001583	missense	79501			AB065592	CCDS30547.1	1p36.33	2012-08-09			ENSG00000186092	ENSG00000186092		"""GPCR / Class A : Olfactory receptors"""	14825	protein-coding gene	gene with protein product							Standard	NM_001005484		Approved		uc001aal.1	Q8NH21	OTTHUMG00000001094	ENST00000335137.3:c.448G>A	1.37:g.69538G>A	ENSP00000334393:p.Val150Met	Somatic		Capture	Illumina GAIIx	4	59401	Q5VT22	Missense_Mutation	SNP	-	p.V150M	ENST00000335137.3	37	c.448	CCDS30547.1	1	.	.	.	.	.	.	.	.	.	.	.	0.204	-1.042343	0.01997	.	.	ENSG00000186092	ENST00000534990;ENST00000335137	T	0.00183	8.6	2.31	1.15	0.20763	GPCR, rhodopsin-like superfamily (1);	0.160951	0.28504	N	0.015115	T	0.00210	0.0006	N	0.16233	0.39	0.09310	N	1	D	0.76494	0.999	D	0.85130	0.997	T	0.61332	-0.7084	10	0.18710	T	0.47	.	7.4074	0.26998	0.0:0.0:0.7421:0.2579	.	150	Q8NH21	OR4F5_HUMAN	M	198;150	ENSP00000334393:V150M	ENSP00000334393:V150M	V	+	1	0	OR4F5	59401	0.000000	0.05858	0.997000	0.53966	0.535000	0.34838	-0.639000	0.05446	1.232000	0.43678	0.398000	0.26397	GTG	-	NULL		0.468	OR4F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F5	protein_coding	OTTHUMT00000003223.1	G	NM_001005484		59401	1	no_errors	NM_001005484	genbank	human	provisional	54_36p	missense	SNP		A
NBPF3	84224	genome.wustl.edu	37	1	21798254	21798254	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr1:21798254C>G	ENST00000318249.5	+	5	989	c.639C>G	c.(637-639)caC>caG	p.H213Q	NBPF3_ENST00000454000.2_Missense_Mutation_p.H143Q|NBPF3_ENST00000342104.5_Missense_Mutation_p.H213Q|NBPF3_ENST00000318220.6_Missense_Mutation_p.H157Q	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	213						cytoplasm (GO:0005737)		p.H213Q(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TGGCACAGCACCTCGTCCAAA	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											59.0	64.0	62.0					1																	21798254		2203	4300	6503	21670841	SO:0001583	missense	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.639C>G	1.37:g.21798254C>G	ENSP00000316782:p.His213Gln	Somatic		Capture	Illumina GAIIx	4	21670841	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	-	p.H213Q	ENST00000318249.5	37	c.639	CCDS216.1	1	.	.	.	.	.	.	.	.	.	.	.	3.659	-0.069881	0.07228	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000417552;ENST00000342104;ENST00000434838	T;T;T;T;T	0.39406	1.08;4.09;4.07;4.08;4.09	1.23	1.23	0.21249	.	.	.	.	.	T	0.29556	0.0737	L	0.35341	1.055	0.09310	N	1	B;B;B	0.31680	0.007;0.335;0.013	B;B;B	0.34824	0.012;0.19;0.006	T	0.20075	-1.0286	9	0.33141	T	0.24	.	5.9218	0.19086	0.0:1.0:0.0:0.0	.	143;213;213	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	Q	143;157;213;157;213;157	ENSP00000415711:H143Q;ENSP00000316739:H157Q;ENSP00000316782:H213Q;ENSP00000340336:H213Q;ENSP00000391865:H157Q	ENSP00000316739:H157Q	H	+	3	2	NBPF3	21670841	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	0.184000	0.16939	1.002000	0.39104	0.398000	0.26397	CAC	-	NULL		0.582	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBPF3	protein_coding		C	NM_032264		21670841	1	no_errors	NM_032264	genbank	human	validated	54_36p	missense	SNP		G
SPTA1	6708	genome.wustl.edu	37	1	158606539	158606539	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr1:158606539T>C	ENST00000368147.4	-	37	5382	c.5202A>G	c.(5200-5202)atA>atG	p.I1734M		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1734					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.I1734M(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AGCTCACTCGTATCAACTTCT	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											111.0	107.0	108.0					1																	158606539		1877	4111	5988	156873163	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5202A>G	1.37:g.158606539T>C	ENSP00000357129:p.Ile1734Met	Somatic		Capture	Illumina GAIIx	4	156873163	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	-	p.I1734M	ENST00000368147.4	37	c.5202	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	T	6.347	0.432140	0.12045	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.49720	0.77;0.77	5.26	-1.82	0.07857	.	.	.	.	.	T	0.14874	0.0359	N	0.22421	0.69	0.09310	N	1	P	0.34629	0.46	B	0.42738	0.396	T	0.33954	-0.9848	9	0.46703	T	0.11	.	0.5937	0.00732	0.3998:0.1569:0.1375:0.3058	.	1734	P02549	SPTA1_HUMAN	M	1734	ENSP00000357130:I1734M;ENSP00000357129:I1734M	ENSP00000357129:I1734M	I	-	3	3	SPTA1	156873163	0.003000	0.15002	0.003000	0.11579	0.013000	0.08279	-0.554000	0.06006	-0.126000	0.11682	0.528000	0.53228	ATA	-	NULL		0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	protein_coding	OTTHUMT00000051851.3	T	NM_003126		156873163	-1	no_errors	NM_003126	genbank	human	reviewed	54_36p	missense	SNP	0.32	C
LRRC37A6P	387646	genome.wustl.edu	37	10	27539503	27539503	+	lincRNA	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr10:27539503G>A	ENST00000574842.1	+	0	772				LRRC37A6P_ENST00000284414.4_RNA																							GAAAGTTCACGCTCCGTAGGA	0.577																																																0			10																																								27579509			387646																															10.37:g.27539503G>A		Somatic		Capture	Illumina GAIIx	4	27579509		RNA	SNP	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			-	-		0.577	RP11-85G18.6-001	KNOWN	basic	lincRNA	LOC387646	lincRNA	OTTHUMT00000436904.1	G			27579509	-1	pseudogene	NR_003525	genbank	human	provisional	54_36p	rna	SNP	0.002	A
ANKRD30A	91074	genome.wustl.edu	37	10	37486216	37486216	+	Silent	SNP	C	C	T	rs574286090	byFrequency	TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr10:37486216C>T	ENST00000602533.1	+	28	2553	c.2454C>T	c.(2452-2454)ccC>ccT	p.P818P	ANKRD30A_ENST00000374660.1_Silent_p.P937P|ANKRD30A_ENST00000361713.1_Silent_p.P818P			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	874					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P818P(4)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TAGAGCCTCCCGAGAAGCCAT	0.323																																																4	Substitution - coding silent(4)	lung(1)|ovary(1)|prostate(1)|kidney(1)	10											201.0	165.0	176.0					10																	37486216		1812	4087	5899	37526222	SO:0001819	synonymous_variant	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2454C>T	10.37:g.37486216C>T		Somatic		Capture	Illumina GAIIx	4	37526222	Q5W025	Silent	SNP	HMMPfam_Ank;superfamily_Ankyrin repeat	p.P818	ENST00000602533.1	37	c.2454		10																																																																																			-	NULL		0.323	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	protein_coding	OTTHUMT00000047588.2	C	NM_052997		37526222	1	no_errors	NM_052997	genbank	human	validated	54_36p	silent	SNP	0.02	T
RNLS	55328	genome.wustl.edu	37	10	90122431	90122431	+	Missense_Mutation	SNP	C	C	G	rs556716831		TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr10:90122431C>G	ENST00000331772.4	-	5	600	c.578G>C	c.(577-579)cGa>cCa	p.R193P	RNLS_ENST00000466945.1_5'UTR|RNLS_ENST00000371947.3_Missense_Mutation_p.R193P|RNLS_ENST00000437752.1_Missense_Mutation_p.R110P	NM_001031709.2	NP_001026879.2	Q5VYX0	RNLS_HUMAN	renalase, FAD-dependent amine oxidase	193					cardiac left ventricle morphogenesis (GO:0003214)|dopamine metabolic process (GO:0042417)|epinephrine metabolic process (GO:0042414)|heart contraction (GO:0060047)|norepinephrine metabolic process (GO:0042415)|phosphate ion homeostasis (GO:0055062)|regulation of systemic arterial blood pressure (GO:0003073)|response to epinephrine (GO:0071871)|response to ischemia (GO:0002931)|response to norepinephrine (GO:0071873)|response to salt (GO:1902074)	extracellular space (GO:0005615)	oxidoreductase activity (GO:0016491)	p.R193P(1)		breast(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	7						CAGAGCATATCGAGAGGAGTA	0.448																																																1	Substitution - Missense(1)	ovary(1)	10											105.0	96.0	99.0					10																	90122431		2203	4300	6503	90112411	SO:0001583	missense	55328			BC005364	CCDS7388.1, CCDS31239.1	10q23.31	2009-04-22	2009-04-22	2009-04-22	ENSG00000184719	ENSG00000184719			25641	protein-coding gene	gene with protein product		609360	"""chromosome 10 open reading frame 59"""	C10orf59		15841207, 17565281	Standard	NM_001031709		Approved	FLJ11218, renalase	uc001kfe.3	Q5VYX0	OTTHUMG00000018692	ENST00000331772.4:c.578G>C	10.37:g.90122431C>G	ENSP00000332530:p.Arg193Pro	Somatic		Capture	Illumina GAIIx	4	90112411	Q9BS33|Q9NUP8	Missense_Mutation	SNP	HMMPfam_FAD_binding_3;superfamily_FAD/NAD(P)-binding domain	p.R193P	ENST00000331772.4	37	c.578	CCDS31239.1	10	.	.	.	.	.	.	.	.	.	.	C	23.7	4.447066	0.84101	.	.	ENSG00000184719	ENST00000371947;ENST00000437752;ENST00000331772	D;T;D	0.92495	-3.05;0.52;-3.05	6.07	6.07	0.98685	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.95940	0.8678	M	0.79475	2.455	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.995;0.996	D	0.93728	0.7039	10	0.25106	T	0.35	.	19.424	0.94734	0.0:1.0:0.0:0.0	.	110;193;193	B4DJW3;Q5VYX0;Q5VYX0-2	.;RNLS_HUMAN;.	P	193;110;193	ENSP00000361015:R193P;ENSP00000387577:R110P;ENSP00000332530:R193P	ENSP00000332530:R193P	R	-	2	0	RNLS	90112411	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	6.778000	0.75043	2.890000	0.99128	0.585000	0.79938	CGA	-	NULL		0.448	RNLS-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf59	protein_coding	OTTHUMT00000049250.1	C	NM_018363		90112411	-1	no_errors	NM_001031709	genbank	human	provisional	54_36p	missense	SNP	1	G
ENTPD1	953	genome.wustl.edu	37	10	97599531	97599531	+	Silent	SNP	C	C	T	rs538046581		TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr10:97599531C>T	ENST00000371205.4	+	3	511	c.228C>T	c.(226-228)ggC>ggT	p.G76G	ENTPD1_ENST00000371203.5_5'UTR|ENTPD1_ENST00000543964.1_5'UTR|ENTPD1_ENST00000539125.1_Intron|ENTPD1_ENST00000490659.1_3'UTR|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1_ENST00000453258.2_Silent_p.G83G|ENTPD1_ENST00000371207.3_Silent_p.G88G|RP11-429G19.3_ENST00000433113.1_RNA			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	76					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)	p.G76G(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		ATGACACAGGCGTGGTGCATC	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		8800	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	10											174.0	163.0	166.0					10																	97599531		2203	4300	6503	97589521	SO:0001819	synonymous_variant	953			S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.228C>T	10.37:g.97599531C>T		Somatic		Capture	Illumina GAIIx	4	97589521	A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Silent	SNP	-	p.G83	ENST00000371205.4	37	c.249	CCDS7444.1	10																																																																																			-	NULL		0.478	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD1	protein_coding	OTTHUMT00000049566.1	C	NM_001776		97589521	1	no_errors	NM_001098175	genbank	human	validated	54_36p	silent	SNP	1	T
PNLIP	5406	genome.wustl.edu	37	10	118318717	118318717	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr10:118318717G>A	ENST00000369221.2	+	10	1010	c.982G>A	c.(982-984)Gct>Act	p.A328T		NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	328					intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)	p.A328T(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	GGGTCACTATGCTGATAGATA	0.408																																																1	Substitution - Missense(1)	ovary(1)	10											106.0	99.0	102.0					10																	118318717		2203	4300	6503	118308707	SO:0001583	missense	5406			BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.982G>A	10.37:g.118318717G>A	ENSP00000358223:p.Ala328Thr	Somatic		Capture	Illumina GAIIx	4	118308707	Q5VSQ2	Missense_Mutation	SNP	HMMPfam_PLAT;HMMPfam_Lipase;superfamily_Lipase/lipooxygenase domain (PLAT/LH2 domain);superfamily_alpha/beta-Hydrolases	p.A328T	ENST00000369221.2	37	c.982	CCDS7594.1	10	.	.	.	.	.	.	.	.	.	.	G	31	5.074581	0.94000	.	.	ENSG00000175535	ENST00000369221	D	0.91124	-2.79	6.05	6.05	0.98169	Lipase, N-terminal (1);	0.000000	0.64402	D	0.000001	D	0.95201	0.8444	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94791	0.7962	10	0.66056	D	0.02	.	19.3727	0.94495	0.0:0.0:1.0:0.0	.	328	P16233	LIPP_HUMAN	T	328	ENSP00000358223:A328T	ENSP00000358223:A328T	A	+	1	0	PNLIP	118308707	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.462000	0.80851	2.878000	0.98634	0.650000	0.86243	GCT	-	HMMPfam_Lipase		0.408	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIP	protein_coding	OTTHUMT00000050524.1	G	NM_000936		118308707	1	no_errors	NM_000936	genbank	human	reviewed	54_36p	missense	SNP	1	A
POLD3	10714	genome.wustl.edu	37	11	74347268	74347268	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr11:74347268A>C	ENST00000263681.2	+	11	1275	c.1146A>C	c.(1144-1146)aaA>aaC	p.K382N	POLD3_ENST00000532497.1_Missense_Mutation_p.K276N|POLD3_ENST00000527458.1_Missense_Mutation_p.K343N	NM_006591.2	NP_006582.1	Q15054	DPOD3_HUMAN	polymerase (DNA-directed), delta 3, accessory subunit	382					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)	p.K382N(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|stomach(1)	18	Breast(11;3.21e-06)					ACAAAAGAAAACGAAAACGCG	0.343																																																1	Substitution - Missense(1)	ovary(1)	11											81.0	78.0	79.0					11																	74347268		2200	4293	6493	74024916	SO:0001583	missense	10714			D26018	CCDS8233.1	11q14	2014-06-13			ENSG00000077514	ENSG00000077514		"""DNA polymerases"""	20932	protein-coding gene	gene with protein product	"""DNA polymerase delta subunit p66"", ""Pol delta C subunit (p66)"", ""protein phosphatase 1, regulatory subunit 128"""	611415				10219083	Standard	NM_006591		Approved	P66, KIAA0039, P68, PPP1R128	uc001ovf.2	Q15054	OTTHUMG00000165621	ENST00000263681.2:c.1146A>C	11.37:g.74347268A>C	ENSP00000263681:p.Lys382Asn	Somatic		Capture	Illumina GAIIx	4	74024916	B7ZAI6|Q32MZ9|Q32N00	Missense_Mutation	SNP	-	p.K382N	ENST00000263681.2	37	c.1146	CCDS8233.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.4|20.4	3.986332|3.986332	0.74589|0.74589	.|.	.|.	ENSG00000077514|ENSG00000077514	ENST00000263681;ENST00000527458;ENST00000532497|ENST00000524752	.|.	.|.	.|.	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.041276|.	0.85682|.	D|.	0.000000|.	T|T	0.66684|0.66684	0.2814|0.2814	M|M	0.73962|0.73962	2.25|2.25	0.49798|0.49798	D|D	0.99982|0.99982	P|.	0.51147|.	0.942|.	P|.	0.54759|.	0.76|.	T|T	0.68262|0.68262	-0.5455|-0.5455	9|5	0.22706|.	T|.	0.39|.	-16.9767|-16.9767	8.4602|8.4602	0.32923|0.32923	0.9139:0.0:0.0861:0.0|0.9139:0.0:0.0861:0.0	.|.	382|.	Q15054|.	DPOD3_HUMAN|.	N|T	382;343;276|106	.|.	ENSP00000263681:K382N|.	K|N	+|+	3|2	2|0	POLD3|POLD3	74024916|74024916	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.953000|0.953000	0.61014|0.61014	2.180000|2.180000	0.42537|0.42537	2.178000|2.178000	0.69098|0.69098	0.459000|0.459000	0.35465|0.35465	AAA|AAC	-	NULL		0.343	POLD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLD3	protein_coding	OTTHUMT00000385376.1	A	NM_006591		74024916	1	no_errors	NM_006591	genbank	human	validated	54_36p	missense	SNP	1	C
GRIN2B	2904	genome.wustl.edu	37	12	13768146	13768146	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr12:13768146C>T	ENST00000609686.1	-	7	1765	c.1556G>A	c.(1555-1557)cGa>cAa	p.R519Q		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	519					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.R519Q(2)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CACCTCCGATCGTTCCTCATT	0.517																																																2	Substitution - Missense(2)	ovary(2)	12											158.0	125.0	136.0					12																	13768146		2203	4300	6503	13659413	SO:0001583	missense	2904				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1556G>A	12.37:g.13768146C>T	ENSP00000477455:p.Arg519Gln	Somatic		Capture	Illumina GAIIx	4	13659413	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	HMMPfam_Lig_chan;superfamily_Periplasmic binding protein-like I;superfamily_Periplasmic binding protein-like II;superfamily_Voltage-gated potassium channels	p.R519Q	ENST00000609686.1	37	c.1556	CCDS8662.1	12	.	.	.	.	.	.	.	.	.	.	C	37	6.060417	0.97246	.	.	ENSG00000150086	ENST00000279593	T	0.70631	-0.5	6.17	6.17	0.99709	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.90549	0.7038	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92383	0.5915	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	519	Q13224	NMDE2_HUMAN	Q	519	ENSP00000279593:R519Q	ENSP00000279593:R519Q	R	-	2	0	GRIN2B	13659413	1.000000	0.71417	0.940000	0.37924	0.994000	0.84299	7.813000	0.86123	2.941000	0.99782	0.655000	0.94253	CGA	-	NULL		0.517	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	protein_coding	OTTHUMT00000268014.2	C			13659413	-1	no_errors	NM_000834	genbank	human	reviewed	54_36p	missense	SNP	1	T
ITPR2	3709	genome.wustl.edu	37	12	26985673	26985673	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr12:26985673G>C	ENST00000381340.3	-	1	458	c.42C>G	c.(40-42)atC>atG	p.I14M	ITPR2_ENST00000242737.5_Missense_Mutation_p.I14M	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	14					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.I14M(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	ACAGGGACACGATGTCCCCTA	0.622																																																1	Substitution - Missense(1)	ovary(1)	12											88.0	101.0	97.0					12																	26985673		2189	4300	6489	26876940	SO:0001583	missense	3709			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.42C>G	12.37:g.26985673G>C	ENSP00000370744:p.Ile14Met	Somatic		Capture	Illumina GAIIx	4	26876940	O94773	Missense_Mutation	SNP	-	p.I14M	ENST00000381340.3	37	c.42	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	G	18.12	3.552368	0.65311	.	.	ENSG00000123104	ENST00000381340;ENST00000242737	D;D	0.98666	-5.06;-5.06	4.08	2.21	0.28008	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);	0.269187	0.41294	N	0.000902	D	0.99001	0.9659	M	0.89785	3.06	0.42476	D	0.992842	B;B	0.30563	0.285;0.121	P;B	0.52481	0.7;0.266	D	0.99914	1.1215	10	0.72032	D	0.01	.	9.4635	0.38798	0.1815:0.0:0.8185:0.0	.	14;14	Q14571-2;Q14571	.;ITPR2_HUMAN	M	14	ENSP00000370744:I14M;ENSP00000242737:I14M	ENSP00000242737:I14M	I	-	3	3	ITPR2	26876940	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	0.806000	0.27126	0.481000	0.27557	-0.225000	0.12378	ATC	-	NULL		0.622	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	protein_coding	OTTHUMT00000402732.1	G	NM_002223		26876940	-1	no_errors	NM_002223	genbank	human	validated	54_36p	missense	SNP	1	C
KRT1	3848	genome.wustl.edu	37	12	53072390	53072390	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr12:53072390C>T	ENST00000252244.3	-	2	800	c.742G>A	c.(742-744)Gat>Aat	p.D248N		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	248	Coil 1B.|Rod.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)	p.D248N(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						CGAGATTGATCACTCTTCAGT	0.473																																																1	Substitution - Missense(1)	ovary(1)	12											183.0	162.0	169.0					12																	53072390		2203	4300	6503	51358657	SO:0001583	missense	3848			X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.742G>A	12.37:g.53072390C>T	ENSP00000252244:p.Asp248Asn	Somatic		Capture	Illumina GAIIx	4	51358657	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	HMMPfam_Filament;superfamily_Prefoldin	p.D248N	ENST00000252244.3	37	c.742	CCDS8836.1	12	.	.	.	.	.	.	.	.	.	.	C	22.8	4.343589	0.82022	.	.	ENSG00000167768	ENST00000252244	T	0.78595	-1.19	4.98	4.98	0.66077	Filament (1);	.	.	.	.	D	0.87700	0.6243	M	0.79343	2.45	0.46203	D	0.998929	D	0.61080	0.989	D	0.72982	0.979	D	0.89208	0.3562	9	0.87932	D	0	.	15.7745	0.78204	0.0:0.8639:0.1361:0.0	.	248	P04264	K2C1_HUMAN	N	248	ENSP00000252244:D248N	ENSP00000252244:D248N	D	-	1	0	KRT1	51358657	0.996000	0.38824	0.094000	0.20943	0.007000	0.05969	3.366000	0.52343	2.482000	0.83794	0.655000	0.94253	GAT	-	HMMPfam_Filament		0.473	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	protein_coding	OTTHUMT00000405706.1	C	NM_006121		51358657	-1	no_errors	NM_006121	genbank	human	reviewed	54_36p	missense	SNP	0.52	T
Unknown	0	genome.wustl.edu	37	12	94914974	94914974	+	IGR	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr12:94914974G>A								RN7SL483P (5438 upstream) : MIR5700 (40590 downstream)																							GGCCCAATTCGCTCATATTTA	0.403																																																0			12																																								93439105	SO:0001628	intergenic_variant	400061																															12.37:g.94914974G>A		Somatic		Capture	Illumina GAIIx	4	93439105		RNA	SNP	-	NULL		37	NULL		12																																																																																			-	-	0	0.403					LOC400061			G			93439105	-1	pseudogene	XR_016608	genbank	human	model	54_36p	rna	SNP	1	A
LCP1	3936	genome.wustl.edu	37	13	46716516	46716516	+	Silent	SNP	C	C	T	rs141184605	byFrequency	TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr13:46716516C>T	ENST00000398576.2	-	16	1801	c.1413G>A	c.(1411-1413)gcG>gcA	p.A471A	LCP1_ENST00000323076.2_Silent_p.A471A|LCP1_ENST00000435666.2_Silent_p.A40A			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	471	Actin-binding 2.|CH 3. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)	p.A471A(1)		breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		GGGAGAACTTCGCTTGATTCT	0.428			T	BCL6	NHL																																		Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	1	Substitution - coding silent(1)	ovary(1)	13						C		1,4405	2.1+/-5.4	0,1,2202	172.0	143.0	153.0		1413	-4.7	1.0	13	dbSNP_134	153	0,8600		0,0,4300	no	coding-synonymous	LCP1	NM_002298.4		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		471/628	46716516	1,13005	2203	4300	6503	45614517	SO:0001819	synonymous_variant	3936			M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1413G>A	13.37:g.46716516C>T		Somatic		Capture	Illumina GAIIx	4	45614517	B2R613|B4DUA0|Q5TBN4	Silent	SNP	HMMPfam_CH;HMMPfam_efhand;superfamily_EF-hand;superfamily_Calponin-homology domain CH-domain	p.A471	ENST00000398576.2	37	c.1413	CCDS9403.1	13																																																																																			-	HMMPfam_CH		0.428	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP1	protein_coding	OTTHUMT00000044800.3	C	NM_002298		45614517	-1	no_errors	NM_002298	genbank	human	reviewed	54_36p	silent	SNP	1	T
MYO16	23026	genome.wustl.edu	37	13	109777500	109777500	+	Silent	SNP	A	A	G			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr13:109777500A>G	ENST00000357550.2	+	29	3551	c.3510A>G	c.(3508-3510)agA>agG	p.R1170R	MYO16_ENST00000356711.2_Silent_p.R1170R|MYO16_ENST00000457511.2_Silent_p.R682R	NM_001198950.1	NP_001185879.1			myosin XVI									p.R1170R(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TGCTTCAGAGAATAAGCATCA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	13											69.0	67.0	68.0					13																	109777500		2203	4300	6503	108575501	SO:0001819	synonymous_variant	23026				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3510A>G	13.37:g.109777500A>G		Somatic		Capture	Illumina GAIIx	4	108575501		Silent	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Ank;superfamily_Ankyrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R1170	ENST00000357550.2	37	c.3510	CCDS32008.1	13																																																																																			-	NULL		0.428	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	protein_coding	OTTHUMT00000045746.1	A	NM_015011		108575501	1	no_errors	NM_015011	genbank	human	validated	54_36p	silent	SNP	1	G
NYNRIN	57523	genome.wustl.edu	37	14	24877706	24877706	+	Missense_Mutation	SNP	C	C	T	rs35050968		TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr14:24877706C>T	ENST00000382554.3	+	3	1148	c.830C>T	c.(829-831)cCg>cTg	p.P277L		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	277					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)	p.P277L(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						CAGAGCACACCGCAGGAGGCA	0.537																																																1	Substitution - Missense(1)	ovary(1)	14											15.0	17.0	16.0					14																	24877706		2110	4225	6335	23947546	SO:0001583	missense	57523			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.830C>T	14.37:g.24877706C>T	ENSP00000371994:p.Pro277Leu	Somatic		Capture	Illumina GAIIx	4	23947546	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	-	p.P277L	ENST00000382554.3	37	c.830	CCDS45090.1	14	.	.	.	.	.	.	.	.	.	.	C	3.347	-0.133431	0.06711	.	.	ENSG00000205978	ENST00000382554	T	0.10005	2.92	4.96	1.05	0.20165	.	4.508000	0.00166	N	0.000018	T	0.05227	0.0139	N	0.08118	0	0.27420	N	0.954327	B	0.02656	0.0	B	0.01281	0.0	T	0.33394	-0.9870	10	0.02654	T	1	.	5.8172	0.18500	0.4827:0.3662:0.0:0.1511	.	277	Q9P2P1	NYNRI_HUMAN	L	277	ENSP00000371994:P277L	ENSP00000371994:P277L	P	+	2	0	NYNRIN	23947546	0.013000	0.17824	0.867000	0.34043	0.145000	0.21501	-0.151000	0.10175	0.369000	0.24510	-0.397000	0.06425	CCG	-	NULL		0.537	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1305	protein_coding	OTTHUMT00000412939.1	C			23947546	1	no_errors	NM_025081	genbank	human	validated	54_36p	missense	SNP	0.47	T
PRTG	283659	genome.wustl.edu	37	15	56032827	56032827	+	Silent	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr15:56032827G>A	ENST00000561292.1	-	2	308	c.150C>T	c.(148-150)gtC>gtT	p.V50V	PRTG_ENST00000389286.4_Silent_p.V50V					protogenin									p.V50V(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		CCTTTCTTGTGACAGTTACAT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	15											86.0	82.0	83.0					15																	56032827		1835	4089	5924	53820119	SO:0001819	synonymous_variant	283659			AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000561292.1:c.150C>T	15.37:g.56032827G>A		Somatic		Capture	Illumina GAIIx	4	53820119		Silent	SNP	-	p.V50	ENST00000561292.1	37	c.150		15																																																																																			-	NULL		0.408	PRTG-004	PUTATIVE	basic|exp_conf	protein_coding	PRTG	protein_coding	OTTHUMT00000419360.1	G	NM_173814		53820119	-1	no_errors	NM_173814	genbank	human	validated	54_36p	silent	SNP	1	A
WHAMM	123720	genome.wustl.edu	37	15	83499813	83499813	+	Nonsense_Mutation	SNP	G	G	T			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr15:83499813G>T	ENST00000286760.4	+	9	2203	c.2104G>T	c.(2104-2106)Gaa>Taa	p.E702*		NM_001080435.1	NP_001073904.1	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules	702	Mediates actin nucleation. {ECO:0000269|PubMed:18614018}.				actin filament organization (GO:0007015)|actin filament reorganization (GO:0090527)|ER to Golgi vesicle-mediated transport (GO:0006888)|focal adhesion assembly (GO:0048041)|lamellipodium assembly (GO:0030032)|membrane tubulation (GO:0097320)|positive regulation of actin nucleation (GO:0051127)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|Golgi membrane (GO:0000139)	Arp2/3 complex binding (GO:0071933)|GTP-Rho binding (GO:0017049)|microtubule binding (GO:0008017)	p.E702*(1)		endometrium(6)|large_intestine(5)|lung(1)|prostate(1)	13						TGACTCCTTGGAAAGTTTTTC	0.493																																																1	Substitution - Nonsense(1)	ovary(1)	15											112.0	118.0	116.0					15																	83499813		2164	4279	6443	81296867	SO:0001587	stop_gained	123720			AK126887	CCDS45333.1	15q25.2	2009-02-18	2009-02-18	2009-02-18	ENSG00000156232	ENSG00000156232			30493	protein-coding gene	gene with protein product		612393	"""WAS protein homology region 2 domain containing 1"""	WHDC1		11853319, 18226259, 18614018, 18812086	Standard	XM_005272422		Approved	KIAA1971	uc002bje.3	Q8TF30		ENST00000286760.4:c.2104G>T	15.37:g.83499813G>T	ENSP00000286760:p.Glu702*	Somatic		Capture	Illumina GAIIx	4	81296867	Q8N1J9	Nonsense_Mutation	SNP	-	p.E702*	ENST00000286760.4	37	c.2104	CCDS45333.1	15	.	.	.	.	.	.	.	.	.	.	G	28.3	4.912138	0.92178	.	.	ENSG00000156232	ENST00000286760;ENST00000234505	.	.	.	4.46	2.34	0.29019	.	6.470100	0.00424	N	0.000074	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	4.6407	0.12546	0.1278:0.2296:0.6425:0.0	.	.	.	.	X	702	.	ENSP00000234505:E702X	E	+	1	0	WHAMM	81296867	0.001000	0.12720	0.001000	0.08648	0.015000	0.08874	0.980000	0.29513	1.044000	0.40200	0.306000	0.20318	GAA	-	NULL		0.493	WHAMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WHAMM	protein_coding	OTTHUMT00000418463.1	G			81296867	1	no_errors	NM_001080435	genbank	human	provisional	54_36p	nonsense	SNP		T
WHAMM	123720	genome.wustl.edu	37	15	83502192	83502192	+	Silent	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr15:83502192G>A	ENST00000286760.4	+	10	2433	c.2334G>A	c.(2332-2334)gaG>gaA	p.E778E		NM_001080435.1	NP_001073904.1	Q8TF30	WHAMM_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules	778	Mediates actin nucleation. {ECO:0000269|PubMed:18614018}.				actin filament organization (GO:0007015)|actin filament reorganization (GO:0090527)|ER to Golgi vesicle-mediated transport (GO:0006888)|focal adhesion assembly (GO:0048041)|lamellipodium assembly (GO:0030032)|membrane tubulation (GO:0097320)|positive regulation of actin nucleation (GO:0051127)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|Golgi membrane (GO:0000139)	Arp2/3 complex binding (GO:0071933)|GTP-Rho binding (GO:0017049)|microtubule binding (GO:0008017)	p.E752E(1)		endometrium(6)|large_intestine(5)|lung(1)|prostate(1)	13						GTGACCTTGAGAGGAGCATCA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	15											53.0	56.0	55.0					15																	83502192		2098	4230	6328	81299246	SO:0001819	synonymous_variant	123720			AK126887	CCDS45333.1	15q25.2	2009-02-18	2009-02-18	2009-02-18	ENSG00000156232	ENSG00000156232			30493	protein-coding gene	gene with protein product		612393	"""WAS protein homology region 2 domain containing 1"""	WHDC1		11853319, 18226259, 18614018, 18812086	Standard	XM_005272422		Approved	KIAA1971	uc002bje.3	Q8TF30		ENST00000286760.4:c.2334G>A	15.37:g.83502192G>A		Somatic		Capture	Illumina GAIIx	4	81299246	Q8N1J9	Silent	SNP	-	p.E778	ENST00000286760.4	37	c.2334	CCDS45333.1	15																																																																																			-	NULL		0.557	WHAMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WHAMM	protein_coding	OTTHUMT00000418463.1	G			81299246	1	no_errors	NM_001080435	genbank	human	provisional	54_36p	silent	SNP	1	A
SLC7A6OS	84138	genome.wustl.edu	37	16	68338020	68338020	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr16:68338020T>C	ENST00000263997.6	-	3	605	c.587A>G	c.(586-588)tAt>tGt	p.Y196C		NM_032178.2	NP_115554.2	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite strand	196					hematopoietic progenitor cell differentiation (GO:0002244)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Y196C(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)		GTCATACACATAGTCATCGTG	0.517																																																1	Substitution - Missense(1)	ovary(1)	16											213.0	196.0	202.0					16																	68338020		2198	4300	6498	66895521	SO:0001583	missense	84138				CCDS10865.1	16q22.1	2010-03-11			ENSG00000103061	ENSG00000103061			25807	protein-coding gene	gene with protein product							Standard	NM_032178		Approved	FLJ13291	uc002evw.2	Q96CW6	OTTHUMG00000137558	ENST00000263997.6:c.587A>G	16.37:g.68338020T>C	ENSP00000263997:p.Tyr196Cys	Somatic		Capture	Illumina GAIIx	4	66895521	Q8TCZ3|Q9H8R8	Missense_Mutation	SNP	-	p.Y196C	ENST00000263997.6	37	c.587	CCDS10865.1	16	.	.	.	.	.	.	.	.	.	.	T	17.65	3.442511	0.63067	.	.	ENSG00000103061	ENST00000263997	T	0.39997	1.05	5.79	3.4	0.38934	.	0.112845	0.64402	D	0.000007	T	0.58764	0.2145	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.60924	-0.7166	10	0.87932	D	0	-5.0871	9.2651	0.37636	0.2874:0.0:0.0:0.7126	.	196	Q96CW6	S7A6O_HUMAN	C	196	ENSP00000263997:Y196C	ENSP00000263997:Y196C	Y	-	2	0	SLC7A6OS	66895521	1.000000	0.71417	0.981000	0.43875	0.480000	0.33159	4.377000	0.59562	1.011000	0.39340	0.454000	0.30748	TAT	-	NULL		0.517	SLC7A6OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A6OS	protein_coding	OTTHUMT00000268894.3	T	NM_032178		66895521	-1	no_errors	NM_032178	genbank	human	provisional	54_36p	missense	SNP	1	C
TP53	7157	genome.wustl.edu	37	17	7578290	7578290	+	Splice_Site	SNP	C	C	G			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr17:7578290C>G	ENST00000269305.4	-	6	749		c.e6-1		TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(40)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGCCAGACCTAAGAGCAAT	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	54	Unknown(40)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	upper_aerodigestive_tract(11)|lung(9)|large_intestine(6)|central_nervous_system(5)|ovary(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|liver(3)|oesophagus(2)|breast(2)|stomach(1)|genital_tract(1)|eye(1)	17	GRCh37	CD043957|CS011574|CS083991	TP53	D|S							82.0	74.0	76.0					17																	7578290		2203	4300	6503	7519015	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.560-1G>C	17.37:g.7578290C>G		Somatic		Capture	Illumina GAIIx	4	7519015	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e5-1	ENST00000269305.4	37	c.560-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	8.588	0.883886	0.17467	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.89	0.79291	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519015	1.000000	0.71417	0.995000	0.50966	0.031000	0.12232	3.449000	0.52950	2.539000	0.85634	0.655000	0.94253	.	-	-		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Intron	7519015	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	0.38	G
MYH10	4628	genome.wustl.edu	37	17	8396296	8396296	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr17:8396296T>C	ENST00000269243.4	-	31	4301	c.4163A>G	c.(4162-4164)gAa>gGa	p.E1388G	MYH10_ENST00000360416.3_Missense_Mutation_p.E1419G|MYH10_ENST00000396239.1_Missense_Mutation_p.E1409G|MYH10_ENST00000379980.4_Missense_Mutation_p.E1404G	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1388					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.E1388G(1)		breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TTCCAGACTTTCAATTGTTCC	0.488																																																1	Substitution - Missense(1)	ovary(1)	17											87.0	88.0	88.0					17																	8396296		2203	4300	6503	8337021	SO:0001583	missense	4628			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.4163A>G	17.37:g.8396296T>C	ENSP00000269243:p.Glu1388Gly	Somatic		Capture	Illumina GAIIx	4	8337021	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Myosin S1 fragment N-terminal domain;superfamily_Prefoldin;superfamily_UBA-like;superfamily_HR1 repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.E1388G	ENST00000269243.4	37	c.4163	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	T	34	5.292830	0.95546	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.31	5.31	0.75309	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.92815	0.7715	H	0.94385	3.53	0.80722	D	1	D;D;D	0.55605	0.972;0.965;0.972	P;P;P	0.61874	0.895;0.831;0.895	D	0.94621	0.7813	10	0.72032	D	0.01	.	15.4317	0.75105	0.0:0.0:0.0:1.0	.	1397;1419;1388	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	G	1388;1419;1409;1404	ENSP00000269243:E1388G;ENSP00000353590:E1419G;ENSP00000379539:E1409G;ENSP00000369315:E1404G	ENSP00000269243:E1388G	E	-	2	0	MYH10	8337021	1.000000	0.71417	0.978000	0.43139	0.988000	0.76386	7.825000	0.86693	2.224000	0.72417	0.528000	0.53228	GAA	-	HMMPfam_Myosin_tail_1		0.488	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	protein_coding	OTTHUMT00000227001.2	T			8337021	-1	no_errors	NM_005964	genbank	human	validated	54_36p	missense	SNP	1	C
ANKRD30B	374860	genome.wustl.edu	37	18	14782535	14782535	+	Nonsense_Mutation	SNP	G	G	T			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr18:14782535G>T	ENST00000358984.4	+	12	1672	c.1492G>T	c.(1492-1494)Gag>Tag	p.E498*	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Nonsense_Mutation_p.E498*	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	498								p.E498*(1)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GAGTCTCTTTGAGAGTTCTGC	0.269																																																1	Substitution - Nonsense(1)	ovary(1)	18											61.0	52.0	55.0					18																	14782535		692	1583	2275	14772535	SO:0001587	stop_gained	374860			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1492G>T	18.37:g.14782535G>T	ENSP00000351875:p.Glu498*	Somatic		Capture	Illumina GAIIx	4	14772535	B4DGP1|F8WAG3|Q4G175	Nonsense_Mutation	SNP	-	p.E498*	ENST00000358984.4	37	c.1492	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	N	14.53	2.564066	0.45694	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	.	.	.	1.11	0.0712	0.14381	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	4.969	0.14105	0.0:0.3885:0.6115:0.0	.	.	.	.	X	498	.	ENSP00000351875:E498X	E	+	1	0	ANKRD30B	14772535	0.004000	0.15560	0.002000	0.10522	0.376000	0.30014	0.085000	0.14912	0.046000	0.15833	0.089000	0.15464	GAG	-	NULL		0.269	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	protein_coding	OTTHUMT00000443557.1	G	NM_001145029		14772535	1	no_errors	ENST00000358984	ensembl	human	known	54_36p	nonsense	SNP		T
DSC1	1823	genome.wustl.edu	37	18	28714698	28714698	+	Missense_Mutation	SNP	G	G	T	rs376495489		TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr18:28714698G>T	ENST00000257198.5	-	12	1974	c.1713C>A	c.(1711-1713)aaC>aaA	p.N571K	RP11-408H20.3_ENST00000582307.1_RNA|DSC1_ENST00000257197.3_Missense_Mutation_p.N571K|RP11-408H20.2_ENST00000581836.1_RNA	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	571	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N571K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			GTGCGTGATCGTTGTAATCAT	0.353																																																1	Substitution - Missense(1)	ovary(1)	18						G	LYS/ASN,LYS/ASN	0,4406		0,0,2203	76.0	68.0	71.0		1713,1713	0.2	0.9	18		71	1,8599		0,1,4299	no	missense,missense	DSC1	NM_004948.3,NM_024421.2	94,94	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	571/841,571/895	28714698	1,13005	2203	4300	6503	26968696	SO:0001583	missense	1823			AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.1713C>A	18.37:g.28714698G>T	ENSP00000257198:p.Asn571Lys	Somatic		Capture	Illumina GAIIx	4	26968696	Q9HB01	Missense_Mutation	SNP	HMMPfam_Cadherin;HMMPfam_Cadherin_pro;superfamily_Cadherin-like	p.N571K	ENST00000257198.5	37	c.1713	CCDS11894.1	18	.	.	.	.	.	.	.	.	.	.	g	11.99	1.804193	0.31869	0.0	1.16E-4	ENSG00000134765	ENST00000257197;ENST00000257198	T;T	0.75477	-0.94;-0.94	5.35	0.222	0.15288	Cadherin (4);Cadherin conserved site (1);Cadherin-like (2);	0.000000	0.56097	D	0.000024	D	0.88366	0.6417	H	0.97051	3.93	0.50313	D	0.999865	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.86381	0.1729	10	0.87932	D	0	.	8.4381	0.32799	0.6864:0.0:0.3136:0.0	.	571;571	Q08554;Q9HB00	DSC1_HUMAN;.	K	571	ENSP00000257197:N571K;ENSP00000257198:N571K	ENSP00000257197:N571K	N	-	3	2	DSC1	26968696	0.986000	0.35501	0.928000	0.36995	0.005000	0.04900	0.068000	0.14531	-0.118000	0.11851	-1.213000	0.01624	AAC	-	NULL		0.353	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC1	protein_coding	OTTHUMT00000254946.1	G	NM_004948, NM_024421		26968696	-1	no_errors	NM_024421	genbank	human	reviewed	54_36p	missense	SNP	0.88	T
OR7G3	390883	genome.wustl.edu	37	19	9237569	9237569	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr19:9237569C>A	ENST00000305444.2	-	1	57	c.58G>T	c.(58-60)Gat>Tat	p.D20Y		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D20Y(1)		NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						AGCTCCGGATCCCCTGACAAT	0.478																																																1	Substitution - Missense(1)	ovary(1)	19											73.0	72.0	73.0					19																	9237569		2203	4300	6503	9098569	SO:0001583	missense	390883				CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.58G>T	19.37:g.9237569C>A	ENSP00000302867:p.Asp20Tyr	Somatic		Capture	Illumina GAIIx	4	9098569	Q6IFJ6|Q96R99	Missense_Mutation	SNP	-	p.D20Y	ENST00000305444.2	37	c.58	CCDS32899.1	19	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132725	0.37630	.	.	ENSG00000170920	ENST00000305444	T	0.01092	5.35	4.16	2.02	0.26589	.	1.078070	0.07332	U	0.879275	T	0.02267	0.0070	L	0.58101	1.795	0.09310	N	1	P	0.45176	0.852	P	0.47206	0.541	T	0.47018	-0.9149	10	0.66056	D	0.02	.	2.7876	0.05378	0.214:0.5097:0.0:0.2763	.	20	Q8NG95	OR7G3_HUMAN	Y	20	ENSP00000302867:D20Y	ENSP00000302867:D20Y	D	-	1	0	OR7G3	9098569	0.000000	0.05858	0.011000	0.14972	0.002000	0.02628	-0.864000	0.04254	1.111000	0.41721	0.558000	0.71614	GAT	-	NULL		0.478	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7G3	protein_coding	OTTHUMT00000384611.1	C			9098569	-1	no_errors	NM_001001958	genbank	human	provisional	54_36p	missense	SNP		A
RTN2	6253	genome.wustl.edu	37	19	45992653	45992653	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr19:45992653G>A	ENST00000245923.4	-	6	1427	c.1192C>T	c.(1192-1194)Cgc>Tgc	p.R398C	PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000590526.1_Missense_Mutation_p.R124C|RTN2_ENST00000430715.2_Missense_Mutation_p.R58C|RTN2_ENST00000344680.4_Missense_Mutation_p.R325C	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	398	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)		p.R398C(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		AGCACTTTGCGGTAAACCCTG	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											45.0	33.0	37.0					19																	45992653		2202	4299	6501	50684493	SO:0001583	missense	6253			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.1192C>T	19.37:g.45992653G>A	ENSP00000245923:p.Arg398Cys	Somatic		Capture	Illumina GAIIx	4	50684493	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	HMMPfam_Reticulon	p.R398C	ENST00000245923.4	37	c.1192	CCDS12665.1	19	.	.	.	.	.	.	.	.	.	.	G	14.89	2.671235	0.47781	.	.	ENSG00000125744	ENST00000344680;ENST00000245923;ENST00000430715	T;T;T	0.44881	0.91;0.91;0.91	4.55	4.55	0.56014	.	0.299715	0.33438	N	0.004902	T	0.34890	0.0913	N	0.08118	0	0.80722	D	1	D;P	0.64830	0.994;0.646	P;B	0.53649	0.731;0.087	T	0.38499	-0.9658	10	0.72032	D	0.01	-7.7129	12.73	0.57193	0.0:0.0:1.0:0.0	.	325;398	O75298-2;O75298	.;RTN2_HUMAN	C	325;398;58	ENSP00000345127:R325C;ENSP00000245923:R398C;ENSP00000398178:R58C	ENSP00000245923:R398C	R	-	1	0	RTN2	50684493	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.236000	0.43052	2.376000	0.81061	0.558000	0.71614	CGC	-	HMMPfam_Reticulon		0.627	RTN2-001	KNOWN	basic|CCDS	protein_coding	RTN2	protein_coding	OTTHUMT00000459574.1	G	NM_005619		50684493	-1	no_errors	NM_005619	genbank	human	reviewed	54_36p	missense	SNP	1	A
TTN	7273	genome.wustl.edu	37	2	179397440	179397440	+	Silent	SNP	T	T	C			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr2:179397440T>C	ENST00000591111.1	-	308	99203	c.98979A>G	c.(98977-98979)ccA>ccG	p.P32993P	TTN-AS1_ENST00000592182.1_RNA|TTN_ENST00000342175.6_Silent_p.P25761P|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Silent_p.P25569P|TTN_ENST00000359218.5_Silent_p.P25694P|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000342992.6_Silent_p.P32066P|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Silent_p.P34634P|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000588257.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32993					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P32064P(1)|p.P25569P(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCGGCGGGCTGGTCTCACTA	0.458																																																2	Substitution - coding silent(2)	ovary(2)	2											71.0	67.0	68.0					2																	179397440		1941	4126	6067	179105686	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98979A>G	2.37:g.179397440T>C		Somatic		Capture	Illumina GAIIx	4	179105686	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	-	p.Q32066R	ENST00000591111.1	37	c.96197		2																																																																																			-	NULL		0.458	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378		179105686	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	missense	SNP	0.99	C
CYP1B1	1545	genome.wustl.edu	37	2	38298138	38298138	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr2:38298138G>C	ENST00000260630.3	-	3	1760	c.1359C>G	c.(1357-1359)aaC>aaG	p.N453K	CYP1B1_ENST00000494864.1_5'UTR|CYP1B1_ENST00000407341.1_Missense_Mutation_p.N453K	NM_000104.3	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B, polypeptide 1	453			N -> S (in allele CYP1B1*4; dbSNP:rs1800440). {ECO:0000269|PubMed:10655546, ECO:0000269|PubMed:11854439, ECO:0000269|PubMed:12036985, ECO:0000269|PubMed:12525557, ECO:0000269|PubMed:14635112, ECO:0000269|PubMed:15342693, ECO:0000269|PubMed:15475877, ECO:0000269|PubMed:16688110, ECO:0000269|PubMed:9823305, ECO:0000269|Ref.4, ECO:0000269|Ref.5}.		angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|blood vessel morphogenesis (GO:0048514)|cell adhesion (GO:0007155)|cellular aromatic compound metabolic process (GO:0006725)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to organic cyclic compound (GO:0071407)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell-cell adhesion (GO:0071603)|epoxygenase P450 pathway (GO:0019373)|estrogen metabolic process (GO:0008210)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|membrane lipid catabolic process (GO:0046466)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nitric oxide biosynthetic process (GO:0006809)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to toxic substance (GO:0009636)|retinal blood vessel morphogenesis (GO:0061304)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|toxin metabolic process (GO:0009404)|trabecular meshwork development (GO:0002930)|visual perception (GO:0007601)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.N453K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	13		all_hematologic(82;0.21)			Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Biotin(DB00121)|Caffeine(DB00201)|Clozapine(DB00363)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Flutamide(DB00499)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Melatonin(DB01065)|Mitoxantrone(DB01204)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Primaquine(DB01087)|Procarbazine(DB01168)|Progesterone(DB00396)|Propofol(DB00818)|Tamoxifen(DB00675)|Testosterone(DB00624)|Theophylline(DB00277)	TCAGGTCCTTGTTGATGAGGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	2											83.0	77.0	79.0					2																	38298138		2203	4300	6503	38151642	SO:0001583	missense	1545			U56438	CCDS1793.1	2p22.2	2008-02-05	2003-01-14		ENSG00000138061	ENSG00000138061		"""Cytochrome P450s"""	2597	protein-coding gene	gene with protein product		601771	"""cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile)"""	GLC3A		8175734, 15128046	Standard	NM_000104		Approved	CP1B	uc002rqo.2	Q16678	OTTHUMG00000100970	ENST00000260630.3:c.1359C>G	2.37:g.38298138G>C	ENSP00000260630:p.Asn453Lys	Somatic		Capture	Illumina GAIIx	4	38151642	Q5TZW8|Q93089|Q9H316	Missense_Mutation	SNP	HMMPfam_p450;superfamily_Cytochrome P450	p.N453K	ENST00000260630.3	37	c.1359	CCDS1793.1	2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221358	0.79464	.	.	ENSG00000138061	ENST00000260630;ENST00000407341	T;T	0.66815	-0.23;-0.23	5.95	5.08	0.68730	.	0.172254	0.64402	D	0.000008	T	0.68210	0.2976	L	0.38838	1.175	0.51233	D	0.999918	D	0.59357	0.985	P	0.58172	0.834	T	0.70773	-0.4781	10	0.72032	D	0.01	.	9.3946	0.38394	0.1602:0.0:0.8398:0.0	.	453	Q53TK1	.	K	453	ENSP00000260630:N453K;ENSP00000384972:N453K	ENSP00000260630:N453K	N	-	3	2	CYP1B1	38151642	1.000000	0.71417	0.989000	0.46669	0.917000	0.54804	1.202000	0.32271	1.530000	0.49136	0.655000	0.94253	AAC	-	HMMPfam_p450		0.473	CYP1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP1B1	protein_coding	OTTHUMT00000218580.3	G	NM_000104		38151642	-1	no_errors	NM_000104	genbank	human	reviewed	54_36p	missense	SNP	1	C
COL3A1	1281	genome.wustl.edu	37	2	189873731	189873731	+	Missense_Mutation	SNP	G	G	A	rs550665335		TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr2:189873731G>A	ENST00000304636.3	+	48	3777	c.3607G>A	c.(3607-3609)Gct>Act	p.A1203T	COL3A1_ENST00000317840.5_Missense_Mutation_p.A900T	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1203	Nonhelical region (C-terminal).			A -> P (in Ref. 10; CAA33387). {ECO:0000305}.	aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.A1203T(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TGTTGGAGCCGCTGCCATTGC	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		16413	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	2											81.0	88.0	85.0					2																	189873731		2203	4300	6503	189581976	SO:0001583	missense	1281			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.3607G>A	2.37:g.189873731G>A	ENSP00000304408:p.Ala1203Thr	Somatic		Capture	Illumina GAIIx	4	189581976	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	COLFI;HMMPfam_COLFI;VWC;HMMPfam_VWC;Collagen;HMMPfam_Collagen;Fibrinogen C-terminal domain-like;superfamily_Fibrinogen C-terminal domain-like	p.A1203T	ENST00000304636.3	37	c.3607	CCDS2297.1	2	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968934	0.53614	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.90563	-2.56;-2.69	5.4	3.56	0.40772	.	0.261056	0.26907	N	0.021892	T	0.75443	0.3850	N	0.08118	0	0.09310	N	1	B	0.32781	0.384	B	0.22152	0.038	T	0.63368	-0.6653	10	0.20519	T	0.43	.	8.5613	0.33511	0.0815:0.0:0.7671:0.1514	.	1203	P02461	CO3A1_HUMAN	T	1203;900	ENSP00000304408:A1203T;ENSP00000315243:A900T	ENSP00000304408:A1203T	A	+	1	0	COL3A1	189581976	0.071000	0.21146	0.001000	0.08648	0.524000	0.34500	2.543000	0.45752	0.619000	0.30197	0.561000	0.74099	GCT	-	NULL		0.542	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL3A1	protein_coding	OTTHUMT00000255899.3	G	NM_000090		189581976	1	no_errors	NM_000090	genbank	human	reviewed	54_36p	missense	SNP	0.29	A
BTBD3	22903	genome.wustl.edu	37	20	11904279	11904279	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr20:11904279G>A	ENST00000405977.1	+	5	2159	c.1534G>A	c.(1534-1536)Gga>Aga	p.G512R	BTBD3_ENST00000254977.3_Missense_Mutation_p.G451R|BTBD3_ENST00000378226.2_Missense_Mutation_p.G512R|BTBD3_ENST00000399006.2_Missense_Mutation_p.G451R	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	512					cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.G512R(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						TGGGGTACAGGGAGGGCAGAT	0.483																																																1	Substitution - Missense(1)	ovary(1)	20											133.0	121.0	125.0					20																	11904279		2203	4300	6503	11852279	SO:0001583	missense	22903			AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.1534G>A	20.37:g.11904279G>A	ENSP00000384545:p.Gly512Arg	Somatic		Capture	Illumina GAIIx	4	11852279	D3DW19|Q5JY73	Missense_Mutation	SNP	-	p.G512R	ENST00000405977.1	37	c.1534	CCDS13113.1	20	.	.	.	.	.	.	.	.	.	.	G	22.5	4.300097	0.81136	.	.	ENSG00000132640	ENST00000254977;ENST00000399006;ENST00000405977;ENST00000378226	T;T;T;T	0.77750	-1.05;-1.05;-1.12;-1.12	6.02	6.02	0.97574	PHR (1);	0.000000	0.85682	D	0.000000	D	0.86230	0.5883	L	0.52206	1.635	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86079	0.1543	10	0.72032	D	0.01	.	19.5289	0.95219	0.0:0.0:1.0:0.0	.	512	Q9Y2F9	BTBD3_HUMAN	R	451;451;512;512	ENSP00000254977:G451R;ENSP00000381971:G451R;ENSP00000384545:G512R;ENSP00000367471:G512R	ENSP00000254977:G451R	G	+	1	0	BTBD3	11852279	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.869000	0.99810	2.865000	0.98341	0.655000	0.94253	GGA	-	NULL		0.483	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD3	protein_coding	OTTHUMT00000078021.3	G			11852279	1	no_errors	NM_014962	genbank	human	validated	54_36p	missense	SNP	1	A
PHACTR3	116154	genome.wustl.edu	37	20	58318324	58318324	+	Splice_Site	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr20:58318324G>A	ENST00000371015.1	+	2	747		c.e2+1		PHACTR3_ENST00000359926.3_Splice_Site|PHACTR3_ENST00000541461.1_Splice_Site|PHACTR3_ENST00000395639.4_Splice_Site|PHACTR3_ENST00000355648.4_Splice_Site|PHACTR3_ENST00000361300.4_Splice_Site|PHACTR3_ENST00000395636.2_Splice_Site	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3							nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.?(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			ACAACGTCAGGTAAAGGCCTG	0.577																																																1	Unknown(1)	ovary(1)	20											50.0	47.0	48.0					20																	58318324		2203	4300	6503	57751719	SO:0001630	splice_region_variant	116154			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.280+1G>A	20.37:g.58318324G>A		Somatic		Capture	Illumina GAIIx	4	57751719	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Splice_Site	SNP	-	e2+1	ENST00000371015.1	37	c.280+1	CCDS13480.1	20	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663039	0.67700	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6464	0.77055	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PHACTR3	57751719	1.000000	0.71417	0.958000	0.39756	0.789000	0.44602	8.606000	0.90888	1.910000	0.55303	0.462000	0.41574	.	-	-		0.577	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHACTR3	protein_coding	OTTHUMT00000079923.3	G	NM_080672	Intron	57751719	1	no_errors	NM_080672	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
SON	6651	genome.wustl.edu	37	21	34926420	34926420	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr21:34926420T>A	ENST00000356577.4	+	3	5358	c.4883T>A	c.(4882-4884)gTt>gAt	p.V1628D	SON_ENST00000381679.4_Missense_Mutation_p.V1628D|SON_ENST00000300278.4_Missense_Mutation_p.V1628D|SON_ENST00000381692.2_Intron|SON_ENST00000290239.6_Missense_Mutation_p.V1628D	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1628					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V1628D(1)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						AAATATGATGTTGATTTATCT	0.398																																																1	Substitution - Missense(1)	ovary(1)	21											55.0	56.0	55.0					21																	34926420		2203	4299	6502	33848290	SO:0001583	missense	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.4883T>A	21.37:g.34926420T>A	ENSP00000348984:p.Val1628Asp	Somatic		Capture	Illumina GAIIx	4	33848290	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	HMMPfam_G-patch;HMMPfam_dsrm;superfamily_WD40 repeat-like;superfamily_dsRNA-binding domain-like	p.V1628D	ENST00000356577.4	37	c.4883	CCDS13629.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.77|12.77	2.036220|2.036220	0.35893|0.35893	.|.	.|.	ENSG00000159140|ENSG00000159140	ENST00000436227|ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	.|T;T;T;T	.|0.16897	.|2.52;2.5;2.48;2.31	4.35|4.35	1.87|1.87	0.25490|0.25490	.|.	.|0.498297	.|0.16923	.|N	.|0.194018	T|T	0.30541|0.30541	0.0768|0.0768	L|L	0.47716|0.47716	1.5|1.5	0.36064|0.36064	D|D	0.841663|0.841663	.|P;B;B;P;D	.|0.76494	.|0.527;0.392;0.235;0.739;0.999	.|B;B;B;B;D	.|0.73708	.|0.246;0.193;0.246;0.354;0.981	T|T	0.21895|0.21895	-1.0232|-1.0232	5|10	.|0.87932	.|D	.|0	.|.	9.1476|9.1476	0.36942|0.36942	0.0:0.0:0.3594:0.6406|0.0:0.0:0.3594:0.6406	.|.	.|1628;1628;1309;1628;1628	.|P18583-10;P18583;P18583-2;P18583-3;P18583-6	.|.;SON_HUMAN;.;.;.	M|D	623|1628	.|ENSP00000348984:V1628D;ENSP00000290239:V1628D;ENSP00000300278:V1628D;ENSP00000371095:V1628D	.|ENSP00000290239:V1628D	L|V	+|+	1|2	2|0	SON|SON	33848290|33848290	0.994000|0.994000	0.37717|0.37717	0.992000|0.992000	0.48379|0.48379	0.807000|0.807000	0.45602|0.45602	-0.012000|-0.012000	0.12699|0.12699	0.194000|0.194000	0.20326|0.20326	0.482000|0.482000	0.46254|0.46254	TTG|GTT	-	NULL		0.398	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	protein_coding	OTTHUMT00000140978.2	T	NM_138927		33848290	1	no_errors	NM_138927	genbank	human	reviewed	54_36p	missense	SNP	1	A
OR5H2	79310	genome.wustl.edu	37	3	98001940	98001940	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr3:98001940G>T	ENST00000355273.2	+	1	209	c.209G>T	c.(208-210)aGt>aTt	p.S70I	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S70I(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						TTTCTTGGGAGTTTAGCCTTT	0.403																																																1	Substitution - Missense(1)	ovary(1)	3											283.0	266.0	272.0					3																	98001940		2203	4300	6503	99484630	SO:0001583	missense	79310				CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.209G>T	3.37:g.98001940G>T	ENSP00000347418:p.Ser70Ile	Somatic		Capture	Illumina GAIIx	4	99484630	Q6IF87	Missense_Mutation	SNP	-	p.S70I	ENST00000355273.2	37	c.209	CCDS33801.1	3	.	.	.	.	.	.	.	.	.	.	G	8.301	0.819973	0.16678	.	.	ENSG00000197938	ENST00000355273	T	0.03065	4.06	3.2	0.311	0.15831	GPCR, rhodopsin-like superfamily (1);	0.467995	0.18019	U	0.154311	T	0.03959	0.0111	L	0.28014	0.82	0.09310	N	1	P	0.48640	0.913	P	0.48141	0.568	T	0.38908	-0.9639	10	0.66056	D	0.02	.	6.1733	0.20429	0.4923:0.0:0.5077:0.0	.	70	Q8NGV7	OR5H2_HUMAN	I	70	ENSP00000347418:S70I	ENSP00000347418:S70I	S	+	2	0	OR5H2	99484630	0.000000	0.05858	0.161000	0.22692	0.188000	0.23474	0.115000	0.15540	-0.068000	0.12953	-0.256000	0.11100	AGT	-	NULL		0.403	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H2	protein_coding	OTTHUMT00000359113.2	G			99484630	1	no_errors	NM_001005482	genbank	human	provisional	54_36p	missense	SNP		T
SPRY1	10252	genome.wustl.edu	37	4	124323351	124323351	+	Missense_Mutation	SNP	T	T	C	rs376045682		TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr4:124323351T>C	ENST00000394339.2	+	2	945	c.605T>C	c.(604-606)tTg>tCg	p.L202S	SPRY1_ENST00000339241.1_Missense_Mutation_p.L202S	NM_001258039.1|NM_005841.2	NP_001244968.1|NP_005832.1	O43609	SPY1_HUMAN	sprouty homolog 1, antagonist of FGF signaling (Drosophila)	202	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytosol (GO:0005829)|plasma membrane (GO:0005886)		p.L202S(1)		NS(1)|large_intestine(4)|lung(2)|ovary(1)|skin(3)	11						CCATCCTGTTTGGCCTGTAAC	0.512																																																1	Substitution - Missense(1)	ovary(1)	4						T	SER/LEU,SER/LEU	0,4406		0,0,2203	182.0	151.0	161.0		605,605	3.8	0.9	4		161	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SPRY1	NM_005841.1,NM_199327.1	145,145	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging,probably-damaging	202/320,202/320	124323351	1,13005	2203	4300	6503	124542801	SO:0001583	missense	10252			AF041037	CCDS3731.1	4q	2009-04-17	2001-11-28		ENSG00000164056	ENSG00000164056			11269	protein-coding gene	gene with protein product		602465	"""sprouty (Drosophila) homolog 1 (antagonist of FGF signaling)"""			9458049, 15962011	Standard	NM_001258038		Approved	hSPRY1	uc003ifa.4	O43609	OTTHUMG00000133071	ENST00000394339.2:c.605T>C	4.37:g.124323351T>C	ENSP00000377871:p.Leu202Ser	Somatic		Capture	Illumina GAIIx	4	124542801	D3DNX6|Q6PNE0	Missense_Mutation	SNP	-	p.L202S	ENST00000394339.2	37	c.605	CCDS3731.1	4	.	.	.	.	.	.	.	.	.	.	T	16.46	3.128268	0.56721	0.0	1.16E-4	ENSG00000164056	ENST00000339241;ENST00000507703;ENST00000394339	T;T;T	0.62788	0.0;1.32;0.0	5.06	3.84	0.44239	.	0.000000	0.64402	D	0.000009	T	0.68997	0.3062	L	0.41236	1.265	0.51767	D	0.999932	D	0.76494	0.999	D	0.83275	0.996	T	0.66027	-0.6025	9	.	.	.	-8.4287	11.5987	0.50990	0.0:0.0:0.1495:0.8505	.	202	O43609	SPY1_HUMAN	S	202	ENSP00000343785:L202S;ENSP00000421036:L202S;ENSP00000377871:L202S	.	L	+	2	0	SPRY1	124542801	0.997000	0.39634	0.921000	0.36526	0.983000	0.72400	2.681000	0.46926	0.907000	0.36646	0.459000	0.35465	TTG	-	NULL		0.512	SPRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY1	protein_coding	OTTHUMT00000256711.1	T			124542801	1	no_errors	NM_005841	genbank	human	validated	54_36p	missense	SNP	0.96	C
GABRA2	2555	genome.wustl.edu	37	4	46252524	46252524	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr4:46252524G>C	ENST00000510861.1	-	10	1330	c.1157C>G	c.(1156-1158)aCc>aGc	p.T386S	GABRA2_ENST00000540012.1_Missense_Mutation_p.T391S|GABRA2_ENST00000507069.1_Missense_Mutation_p.T446S|GABRA2_ENST00000514090.1_Missense_Mutation_p.T386S|GABRA2_ENST00000381620.4_Missense_Mutation_p.T386S|GABRA2_ENST00000356504.1_Missense_Mutation_p.T386S			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	386					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.T386S(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTTGGAGATGGTGGAGAGAAC	0.428																																																1	Substitution - Missense(1)	ovary(1)	4											169.0	168.0	169.0					4																	46252524		2203	4299	6502	45947281	SO:0001583	missense	2555				CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.1157C>G	4.37:g.46252524G>C	ENSP00000421828:p.Thr386Ser	Somatic		Capture	Illumina GAIIx	4	45947281	A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	HMMPfam_Neur_chan_memb;HMMPfam_Neur_chan_LBD;superfamily_Nicotinic receptor ligand binding domain-like;superfamily_Neurotransmitter-gated ion-channel transmembrane pore	p.T386S	ENST00000510861.1	37	c.1157	CCDS3471.1	4	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149525	0.37923	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069	D;D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91;-1.91	5.96	5.96	0.96718	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.048010	0.85682	D	0.000000	D	0.82779	0.5111	L	0.29908	0.895	0.21933	N	0.999466	D;B	0.54047	0.964;0.344	P;B	0.50192	0.634;0.134	T	0.72484	-0.4279	10	0.11485	T	0.65	.	19.3998	0.94623	0.0:0.0:1.0:0.0	.	391;386	B7Z1H8;P47869	.;GBRA2_HUMAN	S	386;386;386;386;391;446	ENSP00000421828:T386S;ENSP00000421300:T386S;ENSP00000371033:T386S;ENSP00000348897:T386S;ENSP00000444409:T391S;ENSP00000427603:T446S	ENSP00000348897:T386S	T	-	2	0	GABRA2	45947281	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.876000	0.87215	2.827000	0.97445	0.655000	0.94253	ACC	-	HMMPfam_Neur_chan_memb		0.428	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GABRA2	protein_coding	OTTHUMT00000360848.2	G			45947281	-1	no_errors	NM_000807	genbank	human	reviewed	54_36p	missense	SNP	1	C
UGT2B10	7365	genome.wustl.edu	37	4	69693267	69693267	+	Splice_Site	SNP	G	G	C	rs201190671		TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr4:69693267G>C	ENST00000265403.7	+	5	1334		c.e5+1		UGT2B10_ENST00000458688.2_Splice_Site	NM_001075.4	NP_001066.1	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B10						lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.?(4)		endometrium(3)|kidney(4)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	29						ATGATCCTTCGTGAGTAGAAC	0.383																																					Melanoma(133;755 1763 25578 26334 46021)											4	Unknown(4)	ovary(2)|prostate(2)	4											126.0	136.0	132.0					4																	69693267		1511	2708	4219	69727856	SO:0001630	splice_region_variant	7365			X63359	CCDS75135.1, CCDS75136.1	4q13.3	2008-02-05	2005-07-20			ENSG00000109181		"""UDP glucuronosyltransferases"""	12544	protein-coding gene	gene with protein product		600070	"""UDP glycosyltransferase 2 family, polypeptide B10"""			8333863	Standard	NM_001075		Approved		uc003hee.3	P36537		ENST00000265403.7:c.1307+1G>C	4.37:g.69693267G>C		Somatic		Capture	Illumina GAIIx	4	69727856	A8K9M3|B4DPP1|Q14CR8	Splice_Site	SNP	-	e5+1	ENST00000265403.7	37	c.1307+1		4	.	.	.	.	.	.	.	.	.	.	g	11.26	1.586143	0.28268	.	.	ENSG00000109181	ENST00000265403;ENST00000458688	.	.	.	2.25	2.25	0.28309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.874	0.41191	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UGT2B10	69727856	1.000000	0.71417	0.355000	0.25773	0.034000	0.12701	3.794000	0.55492	1.089000	0.41292	0.184000	0.17185	.	-	-		0.383	UGT2B10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal	protein_coding	UGT2B10	protein_coding	OTTHUMT00000365169.1	G	NM_001075	Intron	69727856	1	no_errors	NM_001075	genbank	human	validated	54_36p	splice_site	SNP	1	C
CLCN3	1182	genome.wustl.edu	37	4	170634429	170634429	+	Missense_Mutation	SNP	C	C	G	rs150635179		TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr4:170634429C>G	ENST00000513761.1	+	12	2908	c.2349C>G	c.(2347-2349)tgC>tgG	p.C783W	CLCN3_ENST00000504131.2_Missense_Mutation_p.C766W|CLCN3_ENST00000360642.3_Missense_Mutation_p.C756W|CLCN3_ENST00000347613.4_Missense_Mutation_p.C783W	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	783	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)	p.C783W(1)		breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		TGAGGCAGTGCCTTGTAACTC	0.448																																																1	Substitution - Missense(1)	ovary(1)	4											90.0	81.0	84.0					4																	170634429		2203	4300	6503	170871004	SO:0001583	missense	1182			X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.2349C>G	4.37:g.170634429C>G	ENSP00000424603:p.Cys783Trp	Somatic		Capture	Illumina GAIIx	4	170871004	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Missense_Mutation	SNP	HMMPfam_CBS;HMMPfam_Voltage_CLC;superfamily_CBS-domain;superfamily_Clc chloride channel	p.C783W	ENST00000513761.1	37	c.2349	CCDS34101.1	4	.	.	.	.	.	.	.	.	.	.	C	17.52	3.410620	0.62399	.	.	ENSG00000109572	ENST00000513761;ENST00000347613;ENST00000360642;ENST00000504131	D;D;D;D	0.93366	-3.21;-3.21;-3.21;-3.21	5.2	5.2	0.72013	Cystathionine beta-synthase, core (3);	0.042013	0.85682	D	0.000000	D	0.94542	0.8242	L	0.43152	1.355	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.998;0.997	D;D;D;D	0.69479	0.964;0.964;0.964;0.94	D	0.94815	0.7982	10	0.87932	D	0	-2.5636	13.2429	0.60008	0.0:0.9236:0.0:0.0764	.	756;766;783;783	B7Z932;B9EGJ9;P51790;P51790-2	.;.;CLCN3_HUMAN;.	W	783;783;756;766	ENSP00000424603:C783W;ENSP00000261514:C783W;ENSP00000353857:C756W;ENSP00000424540:C766W	ENSP00000261514:C783W	C	+	3	2	CLCN3	170871004	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.183000	0.42565	2.452000	0.82932	0.638000	0.83543	TGC	-	HMMPfam_CBS		0.448	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLCN3	protein_coding	OTTHUMT00000363210.2	C			170871004	1	no_errors	NM_173872	genbank	human	validated	54_36p	missense	SNP	1	G
PCDHA9	9752	genome.wustl.edu	37	5	140228182	140228182	+	Silent	SNP	C	C	T	rs71588636|rs151001396	byFrequency	TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr5:140228182C>T	ENST00000532602.1	+	1	1135	c.102C>T	c.(100-102)tcC>tcT	p.S34S	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000378122.3_Silent_p.S34S|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	34	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S34S(1)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCACTACTCCGTCCCGGAGG	0.632																																					Melanoma(55;1800 1972 14909)											1	Substitution - coding silent(1)	ovary(1)	5											60.0	62.0	61.0					5																	140228182		2197	4270	6467	140208366	SO:0001819	synonymous_variant	9752			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.102C>T	5.37:g.140228182C>T		Somatic		Capture	Illumina GAIIx	4	140208366	O15053|Q2M3S5	Silent	SNP	-	p.S34	ENST00000532602.1	37	c.102	CCDS54920.1	5																																																																																			-	NULL		0.632	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	protein_coding	OTTHUMT00000372896.2	C	NM_031857		140208366	1	no_errors	NM_031857	genbank	human	reviewed	54_36p	silent	SNP	0.22	T
HTR1A	3350	genome.wustl.edu	37	5	63256867	63256867	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr5:63256867C>T	ENST00000323865.3	-	1	913	c.680G>A	c.(679-681)cGc>cAc	p.R227H	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	227					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)	p.R227H(1)		cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GACCGTCTTGCGGATGCGGAA	0.587																																																1	Substitution - Missense(1)	ovary(1)	5											68.0	75.0	73.0					5																	63256867		2203	4299	6502	63292623	SO:0001583	missense	3350			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.680G>A	5.37:g.63256867C>T	ENSP00000316244:p.Arg227His	Somatic		Capture	Illumina GAIIx	4	63292623	Q6LAE7	Missense_Mutation	SNP	-	p.R227H	ENST00000323865.3	37	c.680	CCDS34168.1	5	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593113	0.86953	.	.	ENSG00000178394	ENST00000323865	T	0.42513	0.97	5.7	5.7	0.88788	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.68329	0.2989	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.69503	-0.5128	10	0.52906	T	0.07	.	18.8287	0.92128	0.0:1.0:0.0:0.0	.	227	P08908	5HT1A_HUMAN	H	227	ENSP00000316244:R227H	ENSP00000316244:R227H	R	-	2	0	HTR1A	63292623	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	3.312000	0.51927	2.692000	0.91855	0.655000	0.94253	CGC	-	NULL		0.587	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1A	protein_coding	OTTHUMT00000368397.1	C	NM_000524		63292623	-1	no_errors	NM_000524	genbank	human	validated	54_36p	missense	SNP	1	T
PCDHGA12	26025	genome.wustl.edu	37	5	140810709	140810709	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr5:140810709A>G	ENST00000252085.3	+	1	525	c.383A>G	c.(382-384)gAc>gGc	p.D128G	PCDHGB6_ENST00000520790.1_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGB7_ENST00000398594.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	128	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D128G(2)		breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACATTAACGACAATGCGCCT	0.418																																																2	Substitution - Missense(2)	ovary(2)	5											79.0	93.0	88.0					5																	140810709		2203	4300	6503	140790893	SO:0001583	missense	26025			AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.383A>G	5.37:g.140810709A>G	ENSP00000252085:p.Asp128Gly	Somatic		Capture	Illumina GAIIx	4	140790893	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	-	p.D128G	ENST00000252085.3	37	c.383	CCDS4260.1	5	.	.	.	.	.	.	.	.	.	.	a	19.81	3.896635	0.72639	.	.	ENSG00000253159	ENST00000252085	T	0.54479	0.57	5.79	5.79	0.91817	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.85097	0.5619	H	0.99961	5.07	0.41548	D	0.988557	D;P	0.54772	0.968;0.946	P;P	0.60415	0.874;0.752	D	0.92562	0.6059	9	0.87932	D	0	.	15.8034	0.78473	1.0:0.0:0.0:0.0	.	128;128	O60330-2;O60330	.;PCDGC_HUMAN	G	128	ENSP00000252085:D128G	ENSP00000252085:D128G	D	+	2	0	PCDHGA12	140790893	1.000000	0.71417	0.997000	0.53966	0.947000	0.59692	7.531000	0.81973	2.215000	0.71742	0.528000	0.53228	GAC	-	NULL		0.418	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA12	protein_coding	OTTHUMT00000251806.2	A	NM_003735		140790893	1	no_errors	NM_003735	genbank	human	reviewed	54_36p	missense	SNP	1	G
OR5V1	81696	genome.wustl.edu	37	6	29323463	29323463	+	Silent	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr6:29323463G>A	ENST00000377154.1	-	4	809	c.510C>T	c.(508-510)ggC>ggT	p.G170G	OR5V1_ENST00000543825.1_Silent_p.G170G			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G170G(1)		breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TCTGATTGTTGCCACAGAAGG	0.473																																					Ovarian(32;43 883 21137 32120 42650)											1	Substitution - coding silent(1)	ovary(1)	6											90.0	86.0	87.0					6																	29323463		2203	4299	6502	29431442	SO:0001819	synonymous_variant	81696				CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.510C>T	6.37:g.29323463G>A		Somatic		Capture	Illumina GAIIx	4	29431442	A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Silent	SNP	-	p.G170	ENST00000377154.1	37	c.510	CCDS4657.1	6																																																																																			-	NULL		0.473	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5V1	protein_coding	OTTHUMT00000076398.3	G			29431442	-1	no_errors	NM_030876	genbank	human	validated	54_36p	silent	SNP		A
ROS1	6098	genome.wustl.edu	37	6	117631362	117631362	+	Missense_Mutation	SNP	C	C	T	rs150262256		TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr6:117631362C>T	ENST00000368508.3	-	40	6514	c.6316G>A	c.(6316-6318)Gcc>Acc	p.A2106T	ROS1_ENST00000368507.3_Missense_Mutation_p.A2100T	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	2106	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A2106T(1)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ATGTCTCTGGCGAGTCCAAAG	0.453			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	1	Substitution - Missense(1)	ovary(1)	6						C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	109.0	114.0	112.0		6316	5.6	0.3	6	dbSNP_134	112	0,8600		0,0,4300	no	missense	ROS1	NM_002944.2	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	2106/2348	117631362	1,13005	2203	4300	6503	117738055	SO:0001583	missense	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.6316G>A	6.37:g.117631362C>T	ENSP00000357494:p.Ala2106Thr	Somatic		Capture	Illumina GAIIx	4	117738055	Q15368|Q5TDB5	Missense_Mutation	SNP	Pkinase_Tyr;HMMPfam_Pkinase_Tyr;fn3;HMMPfam_fn3;Fibronectin type III;superfamily_Fibronectin type III;Protein kinase-like (PK-like);superfamily_Protein kinase-like (PK-like);YWTD domain;superfamily_YWTD domain	p.A2106T	ENST00000368508.3	37	c.6316	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	c	23.8	4.457610	0.84317	2.27E-4	0.0	ENSG00000047936	ENST00000368508;ENST00000368507	D;D	0.91792	-2.91;-2.91	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000006	D	0.94584	0.8255	L	0.58101	1.795	0.53005	D	0.999964	D	0.89917	1.0	D	0.85130	0.997	D	0.93322	0.6693	10	0.42905	T	0.14	.	18.8423	0.92189	0.0:1.0:0.0:0.0	.	2106	P08922	ROS1_HUMAN	T	2106;2100	ENSP00000357494:A2106T;ENSP00000357493:A2100T	ENSP00000357493:A2100T	A	-	1	0	ROS1	117738055	0.999000	0.42202	0.308000	0.25141	0.979000	0.70002	3.845000	0.55880	2.766000	0.95052	0.655000	0.94253	GCC	-	HMMPfam_Pkinase_Tyr		0.453	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	protein_coding	OTTHUMT00000043464.1	C			117738055	-1	no_errors	NM_002944	genbank	human	reviewed	54_36p	missense	SNP	0.96	T
AKR1B1	231	genome.wustl.edu	37	7	134132106	134132106	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr7:134132106T>C	ENST00000285930.4	-	8	848	c.769A>G	c.(769-771)Aac>Gac	p.N257D	AKR1B1_ENST00000489022.1_5'Flank	NM_001628.2	NP_001619.1	P15121	ALDR_HUMAN	aldo-keto reductase family 1, member B1 (aldose reductase)	257					C21-steroid hormone biosynthetic process (GO:0006700)|carbohydrate metabolic process (GO:0005975)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)|glyceraldehyde oxidoreductase activity (GO:0043795)	p.N257D(1)		kidney(1)|large_intestine(5)|lung(2)|ovary(3)|prostate(1)|skin(2)	14					Sulindac(DB00605)	ACCACCAAGTTCCTCTGCATG	0.547																																																1	Substitution - Missense(1)	ovary(1)	7											149.0	113.0	125.0					7																	134132106		2203	4300	6503	133782646	SO:0001583	missense	231			J04795	CCDS5831.1	7q35	2010-04-08			ENSG00000085662	ENSG00000085662	1.1.1.21	"""Aldo-keto reductases"""	381	protein-coding gene	gene with protein product		103880		ALDR1		1901827	Standard	NM_001628		Approved	AR	uc003vrp.1	P15121	OTTHUMG00000155322	ENST00000285930.4:c.769A>G	7.37:g.134132106T>C	ENSP00000285930:p.Asn257Asp	Somatic		Capture	Illumina GAIIx	4	133782646	B2R8N3|Q5U031|Q6FGA4|Q6ICP2|Q9BS21|Q9UCI9	Missense_Mutation	SNP	HMMPfam_Aldo_ket_red;superfamily_NAD(P)-linked oxidoreductase	p.N257D	ENST00000285930.4	37	c.769	CCDS5831.1	7	.	.	.	.	.	.	.	.	.	.	T	16.71	3.199649	0.58126	.	.	ENSG00000085662	ENST00000285930	T	0.10860	2.83	5.12	3.98	0.46160	NADP-dependent oxidoreductase domain (3);	0.130520	0.64402	N	0.000002	T	0.05364	0.0142	N	0.03154	-0.405	0.54753	D	0.999987	B	0.15141	0.012	B	0.24006	0.05	T	0.31081	-0.9956	10	0.59425	D	0.04	.	8.8072	0.34945	0.0:0.0853:0.0:0.9147	.	257	P15121	ALDR_HUMAN	D	257	ENSP00000285930:N257D	ENSP00000285930:N257D	N	-	1	0	AKR1B1	133782646	1.000000	0.71417	0.970000	0.41538	0.998000	0.95712	5.145000	0.64839	0.915000	0.36847	0.459000	0.35465	AAC	-	HMMPfam_Aldo_ket_red		0.547	AKR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1B1	protein_coding	OTTHUMT00000339448.2	T	NM_001628		133782646	-1	no_errors	NM_001628	genbank	human	reviewed	54_36p	missense	SNP	1	C
KMT2C	58508	genome.wustl.edu	37	7	151851206	151851206	+	Silent	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr7:151851206G>A	ENST00000262189.6	-	48	12383	c.12165C>T	c.(12163-12165)atC>atT	p.I4055I	KMT2C_ENST00000355193.2_Silent_p.I4112I|KMT2C_ENST00000485241.1_5'UTR	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4055					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.I4055I(1)									GCTCAGTTTTGATGTCATTCC	0.338																																																1	Substitution - coding silent(1)	ovary(1)	7											74.0	77.0	76.0					7																	151851206		2203	4300	6503	151482139	SO:0001819	synonymous_variant	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.12165C>T	7.37:g.151851206G>A		Somatic		Capture	Illumina GAIIx	4	151482139	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	AT_hook;HMMPfam_AT_hook;HMG_box;HMMPfam_HMG_box;SET;HMMPfam_SET;PHD;HMMPfam_PHD;FYRN;HMMPfam_FYRN;FYRC;HMMPfam_FYRC	p.I4055	ENST00000262189.6	37	c.12165	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	G	9.353	1.066067	0.20067	.	.	ENSG00000055609	ENST00000360104	.	.	.	5.48	-1.15	0.09709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.5428	0.12066	0.12:0.0873:0.3612:0.4316	.	.	.	.	X	1616	.	.	Q	-	1	0	MLL3	151482139	0.998000	0.40836	0.994000	0.49952	0.920000	0.55202	0.314000	0.19432	-0.109000	0.12044	-0.722000	0.03604	CAA	-	NULL		0.338	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	protein_coding	OTTHUMT00000318887.3	G			151482139	-1	no_errors	NM_170606	genbank	human	reviewed	54_36p	silent	SNP	1	A
MCMDC2	157777	genome.wustl.edu	37	8	67789597	67789597	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr8:67789597T>G	ENST00000422365.2	+	5	470	c.299T>G	c.(298-300)cTg>cGg	p.L100R	MCMDC2_ENST00000396592.3_Missense_Mutation_p.L100R|MCMDC2_ENST00000469823.1_3'UTR|MCMDC2_ENST00000541540.1_Missense_Mutation_p.L37R|MCMDC2_ENST00000492775.1_Missense_Mutation_p.L100R|MCMDC2_ENST00000313616.5_Missense_Mutation_p.L100R	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	100					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.L95R(1)		endometrium(2)|kidney(2)|lung(5)	9						AATATAGTGCTGAAATTAACA	0.279																																																1	Substitution - Missense(1)	ovary(1)	8											64.0	62.0	62.0					8																	67789597		2203	4300	6503	67952151	SO:0001583	missense	157777			BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.299T>G	8.37:g.67789597T>G	ENSP00000413632:p.Leu100Arg	Somatic		Capture	Illumina GAIIx	4	67952151	B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Missense_Mutation	SNP	-	p.L95R	ENST00000422365.2	37	c.284	CCDS6197.2	8	.	.	.	.	.	.	.	.	.	.	T	21.1	4.098292	0.76870	.	.	ENSG00000178460	ENST00000396592;ENST00000422365;ENST00000492775;ENST00000313616;ENST00000541540	T;T;T;T;T	0.32023	3.55;3.55;3.55;3.55;1.47	4.93	4.93	0.64822	.	0.163747	0.41823	D	0.000806	T	0.51176	0.1659	M	0.64997	1.995	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.999	T	0.45086	-0.9285	10	0.28530	T	0.3	-3.1261	14.8697	0.70448	0.0:0.0:0.0:1.0	.	37;100;100;100	Q4G0Z9-4;Q4G0Z9;B4DXX4;G3XAN3	.;CH045_HUMAN;.;.	R	100;100;100;100;37	ENSP00000379837:L100R;ENSP00000413632:L100R;ENSP00000428037:L100R;ENSP00000317234:L100R;ENSP00000445629:L37R	ENSP00000317234:L100R	L	+	2	0	C8orf45	67952151	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.369000	0.79578	1.956000	0.56807	0.482000	0.46254	CTG	-	NULL		0.279	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf45	protein_coding	OTTHUMT00000347350.1	T	NM_173518		67952151	1	no_errors	NM_173518	genbank	human	validated	54_36p	missense	SNP	1	G
DAB2IP	153090	genome.wustl.edu	37	9	124521255	124521255	+	Nonsense_Mutation	SNP	C	C	T	rs114266755	byFrequency	TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chr9:124521255C>T	ENST00000408936.3	+	5	777	c.595C>T	c.(595-597)Cga>Tga	p.R199*	DAB2IP_ENST00000309989.1_Nonsense_Mutation_p.R75*|DAB2IP_ENST00000259371.2_Nonsense_Mutation_p.R171*			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	199	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)	p.R75*(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						GAACCTCCGGCGAGCGGTGCA	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	9											87.0	76.0	80.0					9																	124521255		2203	4300	6503	123561076	SO:0001587	stop_gained	153090			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.595C>T	9.37:g.124521255C>T	ENSP00000386183:p.Arg199*	Somatic		Capture	Illumina GAIIx	4	123561076	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Nonsense_Mutation	SNP	-	p.R171*	ENST00000408936.3	37	c.511		9	.	.	.	.	.	.	.	.	.	.	C	37	6.203613	0.97371	.	.	ENSG00000136848	ENST00000394340;ENST00000436835;ENST00000259371;ENST00000408936;ENST00000373782;ENST00000309989	.	.	.	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.4451	0.87575	0.0:1.0:0.0:0.0	.	.	.	.	X	171;75;171;199;108;75	.	ENSP00000259371:R171X	R	+	1	2	DAB2IP	123561076	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	1.884000	0.39668	2.414000	0.81942	0.462000	0.41574	CGA	-	NULL		0.567	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	DAB2IP	protein_coding	OTTHUMT00000317857.1	C	NM_032552		123561076	1	no_errors	NM_032552	genbank	human	validated	54_36p	nonsense	SNP	1	T
ZFX	7543	genome.wustl.edu	37	X	24226376	24226376	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0935-01A-03W-0421-09	TCGA-10-0935-11A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	af0edbf4-9d90-4373-a9ce-0875ebbe1d04	3cd33d1c-0b1d-4346-840e-ba14b49f52e7	g.chrX:24226376G>A	ENST00000379177.1	+	9	1409	c.982G>A	c.(982-984)Gta>Ata	p.V328I	ZFX_ENST00000540034.1_Missense_Mutation_p.V367I|ZFX_ENST00000338565.3_Missense_Mutation_p.V278I|ZFX_ENST00000459724.1_Intron|ZFX_ENST00000379188.3_Missense_Mutation_p.V328I|ZFX_ENST00000304543.5_Missense_Mutation_p.V328I|ZFX_ENST00000539115.1_Missense_Mutation_p.V99I	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	328					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)	p.V328I(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						GGAAGTGATCGTAGGAGAGGA	0.483																																					Esophageal Squamous(20;306 562 7346 32868 37983)											1	Substitution - Missense(1)	ovary(1)	X											51.0	51.0	51.0					X																	24226376		2203	4300	6503	24136297	SO:0001583	missense	7543				CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.982G>A	X.37:g.24226376G>A	ENSP00000368475:p.Val328Ile	Somatic		Capture	Illumina GAIIx	4	24136297	B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	-	p.V328I	ENST00000379177.1	37	c.982	CCDS14211.1	X	.	.	.	.	.	.	.	.	.	.	G	16.19	3.053282	0.55218	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000535562;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565;ENST00000545937	T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68	5.53	5.53	0.82687	Transcriptional activator, Zfx / Zfy domain (1);	0.000000	0.64402	D	0.000016	T	0.65354	0.2683	L	0.52126	1.63	0.43242	D	0.995156	D;B;D;D	0.89917	0.996;0.236;0.985;1.0	P;B;D;D	0.83275	0.842;0.005;0.959;0.996	T	0.65467	-0.6161	10	0.54805	T	0.06	4.5755	18.7183	0.91684	0.0:0.0:1.0:0.0	.	367;97;328;332	B9EG97;F5GYV7;P17010;Q59EB9	.;.;ZFX_HUMAN;.	I	99;328;97;328;328;367;278;123	ENSP00000438233:V99I;ENSP00000368486:V328I;ENSP00000368475:V328I;ENSP00000304985:V328I;ENSP00000441382:V367I;ENSP00000343384:V278I	ENSP00000304985:V328I	V	+	1	0	ZFX	24136297	1.000000	0.71417	0.949000	0.38748	0.963000	0.63663	7.422000	0.80217	2.452000	0.82932	0.600000	0.82982	GTA	-	NULL		0.483	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFX	protein_coding	OTTHUMT00000056084.1	G	NM_003410		24136297	1	no_errors	NM_003410	genbank	human	validated	54_36p	missense	SNP	0.994	A
