#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PHTF1	10745	genome.wustl.edu	37	1	114249243	114249243	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr1:114249243C>A	ENST00000369604.1	-	12	1854	c.1371G>T	c.(1369-1371)ttG>ttT	p.L457F	PHTF1_ENST00000369600.1_Missense_Mutation_p.L404F|PHTF1_ENST00000357783.2_Missense_Mutation_p.L457F|PHTF1_ENST00000369598.1_Missense_Mutation_p.L412F|PHTF1_ENST00000447664.2_3'UTR|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000369596.2_Missense_Mutation_p.L404F|PHTF1_ENST00000393357.2_Missense_Mutation_p.L457F			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	457					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L457F(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACTTATTTCCAACACAGACA	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											158.0	152.0	154.0					1																	114249243		2203	4300	6503	114050766	SO:0001583	missense	10745			AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.1371G>T	1.37:g.114249243C>A	ENSP00000358617:p.Leu457Phe	Somatic		Capture	Illumina GAIIx	4	114050766	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Missense_Mutation	SNP	-	p.L457F	ENST00000369604.1	37	c.1371	CCDS861.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.1|26.1	4.705043|4.705043	0.88924|0.88924	.|.	.|.	ENSG00000116793|ENSG00000116793	ENST00000369597;ENST00000393357;ENST00000369596;ENST00000369598;ENST00000369600;ENST00000369604;ENST00000357783|ENST00000412670	.|.	.|.	.|.	5.75|5.75	4.83|4.83	0.62350|0.62350	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.66548|0.66548	0.2800|0.2800	M|M	0.76170|0.76170	2.325|2.325	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.999;0.999|.	T|T	0.68957|0.68957	-0.5272|-0.5272	9|5	0.87932|.	D|.	0|.	-14.0675|-14.0675	15.155|15.155	0.72733|0.72733	0.0:0.9314:0.0:0.0686|0.0:0.9314:0.0:0.0686	.|.	457;212;457|.	Q9UMS5;Q5TCR1;Q9UMS5-2|.	PHTF1_HUMAN;.;.|.	F|L	412;457;404;412;404;457;457|213	.|.	ENSP00000350428:L457F|.	L|W	-|-	3|2	2|0	PHTF1|PHTF1	114050766|114050766	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.989000|0.989000	0.77384|0.77384	4.085000|4.085000	0.57657|0.57657	1.406000|1.406000	0.46857|0.46857	0.585000|0.585000	0.79938|0.79938	TTG|TGG	-	NULL		0.363	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHTF1	protein_coding	OTTHUMT00000032666.1	C	NM_006608		114050766	-1	no_errors	NM_006608	genbank	human	validated	54_36p	missense	SNP	1	A
FMO5	2330	genome.wustl.edu	37	1	146696572	146696572	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	T	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr1:146696572G>T	ENST00000254090.4	-	2	438	c.50C>A	c.(49-51)tCt>tAt	p.S17Y	FMO5_ENST00000369272.3_Missense_Mutation_p.S17Y|FMO5_ENST00000465173.1_5'UTR|FMO5_ENST00000441068.2_Missense_Mutation_p.S17Y|RP11-337C18.10_ENST00000606856.1_RNA	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5	17						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.S17Y(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					CTTGATGGAAGAGAGCCCGCT	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											146.0	136.0	139.0					1																	146696572		2203	4300	6503	145163196	SO:0001583	missense	2330			Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607	ENST00000254090.4:c.50C>A	1.37:g.146696572G>T	ENSP00000254090:p.Ser17Tyr	Somatic		Capture	Illumina GAIIx	Phase_III	145163196	B2RBG1|C9JJD1|Q8IV22	Missense_Mutation	SNP	-	p.S17Y	ENST00000254090.4	37	c.50	CCDS926.1	1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.482896	0.63962	.	.	ENSG00000131781	ENST00000441068;ENST00000254090;ENST00000369272;ENST00000533174;ENST00000533848	T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27	5.37	-1.06	0.10002	.	1.866590	0.02188	N	0.061105	T	0.57681	0.2070	M	0.77103	2.36	0.09310	N	1	P;P;P;P	0.52061	0.858;0.779;0.767;0.95	P;P;P;P	0.53266	0.617;0.516;0.516;0.722	T	0.55289	-0.8164	10	0.87932	D	0	-0.9958	11.7871	0.52049	0.0778:0.5325:0.3897:0.0	.	17;17;17;17	Q9HA79;Q8IV22;P49326;C9JJD1	.;.;FMO5_HUMAN;.	Y	17	ENSP00000416011:S17Y;ENSP00000254090:S17Y;ENSP00000358277:S17Y;ENSP00000436429:S17Y;ENSP00000432569:S17Y	ENSP00000254090:S17Y	S	-	2	0	FMO5	145163196	0.062000	0.20869	0.000000	0.03702	0.947000	0.59692	2.580000	0.46068	0.024000	0.15214	0.650000	0.86243	TCT	-	NULL		0.502	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO5	protein_coding	OTTHUMT00000040373.2	G	NM_001461		145163196	-1	no_errors	NM_001461	genbank	human	reviewed	54_36p	missense	SNP	0.01	T
BCL9	607	genome.wustl.edu	37	1	147091720	147091720	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	G	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA		dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr1:147091720C>G	ENST00000234739.3	+	8	2499	c.1759C>G	c.(1759-1761)Ctt>Gtt	p.L587V		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	587	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.L587V(1)		breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					TAGACCAGGTCTTTCTGGAGT	0.547			T	"""IGH@, IGL@"""	B-ALL																																		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	1	Substitution - Missense(1)	ovary(1)	1											83.0	91.0	88.0					1																	147091720		2203	4300	6503	145558344	SO:0001583	missense	607			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.1759C>G	1.37:g.147091720C>G	ENSP00000234739:p.Leu587Val	Somatic		Capture	Illumina GAIIx	Phase_III	145558344	Q5T489	Missense_Mutation	SNP	-	p.L587V	ENST00000234739.3	37	c.1759	CCDS30833.1	1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.889876	0.52014	.	.	ENSG00000116128	ENST00000234739	T	0.49139	0.79	5.41	5.41	0.78517	.	0.052683	0.85682	D	0.000000	T	0.47248	0.1435	L	0.36672	1.1	0.42692	D	0.993582	D;D	0.61697	0.99;0.99	P;P	0.57620	0.824;0.824	T	0.27938	-1.0059	10	0.39692	T	0.17	-18.622	19.3785	0.94521	0.0:1.0:0.0:0.0	.	587;587	Q1JQ81;O00512	.;BCL9_HUMAN	V	587	ENSP00000234739:L587V	ENSP00000234739:L587V	L	+	1	0	BCL9	145558344	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.591000	0.67536	2.815000	0.96918	0.561000	0.74099	CTT	-	NULL		0.547	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	protein_coding	OTTHUMT00000039468.1	C	NM_004326		145558344	1	no_errors	NM_004326	genbank	human	reviewed	54_36p	missense	SNP	1	G
SDC3	9672	genome.wustl.edu	37	1	31349816	31349816	+	Silent	SNP	C	C	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr1:31349816C>T	ENST00000339394.6	-	3	627	c.453G>A	c.(451-453)gaG>gaA	p.E151E	SDC3_ENST00000336798.7_Silent_p.E93E|SDC3_ENST00000471567.1_5'UTR	NM_014654.3	NP_055469.3	O75056	SDC3_HUMAN	syndecan 3	151	Ser/Thr-rich (mucin-like).				carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.E151E(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGGCTGGGCTCTTCCGGGA	0.647																																																1	Substitution - coding silent(1)	ovary(1)	1											35.0	37.0	36.0					1																	31349816		2203	4300	6503	31122403	SO:0001819	synonymous_variant	9672			AF248634	CCDS30661.1	1p35.2	2013-09-19	2007-02-15		ENSG00000162512	ENSG00000162512		"""Proteoglycans / Cell Surface : Syndecans"""	10660	protein-coding gene	gene with protein product	"""syndecan proteoglycan 3"""	186357	"""syndecan 3 (N-syndecan)"""			1556152, 11527150	Standard	NM_014654		Approved	N-syndecan, SYND3	uc001bse.2	O75056	OTTHUMG00000043646	ENST00000339394.6:c.453G>A	1.37:g.31349816C>T		Somatic		Capture	Illumina GAIIx	4	31122403	Q5T1Z6|Q5T1Z7|Q96CT3|Q96PR8	Silent	SNP	HMMPfam_Syndecan	p.E151	ENST00000339394.6	37	c.453	CCDS30661.1	1																																																																																			-	HMMPfam_Syndecan		0.647	SDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC3	protein_coding	OTTHUMT00000102017.1	C	NM_014654		31122403	-1	no_errors	NM_014654	genbank	human	validated	54_36p	silent	SNP	0.99	T
DPYD	1806	genome.wustl.edu	37	1	98157280	98157280	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	A	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr1:98157280C>A	ENST00000370192.3	-	7	855	c.755G>T	c.(754-756)gGt>gTt	p.G252V	DPYD_ENST00000474241.1_5'UTR|DPYD_ENST00000423006.2_3'UTR	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	252					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.G252V(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	TACCTTTACACCAAGGTCCTT	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											101.0	102.0	102.0					1																	98157280		2203	4300	6503	97929868	SO:0001583	missense	1806			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.755G>T	1.37:g.98157280C>A	ENSP00000359211:p.Gly252Val	Somatic		Capture	Illumina GAIIx	Phase_III	97929868	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	HMMPfam_DHO_dh;HMMPfam_Fer4;superfamily_alpha-helical ferredoxin;HMMPfam_Pyr_redox_2;superfamily_FMN-linked oxidoreductases;superfamily_Nucleotide-binding domain;superfamily_4Fe-4S ferredoxins	p.G252V	ENST00000370192.3	37	c.755	CCDS30777.1	1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.750245	0.89753	.	.	ENSG00000188641	ENST00000370192	D	0.96334	-3.98	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.99080	0.9684	H	0.99238	4.48	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	D	0.99150	1.0858	10	0.87932	D	0	-16.9303	18.7184	0.91685	0.0:1.0:0.0:0.0	.	252	Q12882	DPYD_HUMAN	V	252	ENSP00000359211:G252V	ENSP00000359211:G252V	G	-	2	0	DPYD	97929868	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.707000	0.68370	2.497000	0.84241	0.460000	0.39030	GGT	-	HMMPfam_Pyr_redox_2		0.363	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYD	protein_coding	OTTHUMT00000095698.3	C	NM_000110		97929868	-1	no_errors	NM_000110	genbank	human	reviewed	54_36p	missense	SNP	1	A
CHRM3	1131	genome.wustl.edu	37	1	240071910	240071910	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	C	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr1:240071910G>C	ENST00000255380.4	+	5	1938	c.1159G>C	c.(1159-1161)Gac>Cac	p.D387H		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	387					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)	p.D387H(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	ACCCTCATCGGACAACCTGCA	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											34.0	28.0	30.0					1																	240071910		2203	4300	6503	238138533	SO:0001583	missense	1131			U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1159G>C	1.37:g.240071910G>C	ENSP00000255380:p.Asp387His	Somatic		Capture	Illumina GAIIx	Phase_III	238138533	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	-	p.D387H	ENST00000255380.4	37	c.1159	CCDS1616.1	1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476171	0.44044	.	.	ENSG00000133019	ENST00000255380	T	0.59502	0.26	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.454917	0.22891	N	0.054400	T	0.52869	0.1761	N	0.20986	0.625	0.49299	D	0.99977	P	0.42941	0.794	P	0.48524	0.58	T	0.55958	-0.8058	10	0.72032	D	0.01	-29.6902	12.7337	0.57212	0.0744:0.0:0.9255:0.0	.	387	P20309	ACM3_HUMAN	H	387	ENSP00000255380:D387H	ENSP00000255380:D387H	D	+	1	0	CHRM3	238138533	1.000000	0.71417	0.964000	0.40570	0.370000	0.29829	6.613000	0.74192	2.828000	0.97474	0.655000	0.94253	GAC	-	NULL		0.587	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM3	protein_coding	OTTHUMT00000095644.2	G	NM_000740		238138533	1	no_errors	NM_000740	genbank	human	reviewed	54_36p	missense	SNP	1	C
OR8J1	219477	genome.wustl.edu	37	11	56128009	56128009	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr11:56128009A>C	ENST00000303039.3	+	1	319	c.287A>C	c.(286-288)gAa>gCa	p.E96A		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E96A(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					TCATTCTATGAATGTGCCACC	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											145.0	137.0	140.0					11																	56128009		2201	4296	6497	55884585	SO:0001583	missense	219477			AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.287A>C	11.37:g.56128009A>C	ENSP00000304060:p.Glu96Ala	Somatic		Capture	Illumina GAIIx	4	55884585	B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Missense_Mutation	SNP	-	p.E96A	ENST00000303039.3	37	c.287	CCDS31529.1	11	.	.	.	.	.	.	.	.	.	.	A	0.245	-1.011045	0.02095	.	.	ENSG00000172487	ENST00000303039	T	0.02863	4.13	4.76	2.29	0.28610	GPCR, rhodopsin-like superfamily (1);	0.497754	0.19291	N	0.117900	T	0.01222	0.0040	N	0.10733	0.035	0.24613	N	0.993716	B	0.06786	0.001	B	0.08055	0.003	T	0.50092	-0.8868	10	0.09843	T	0.71	.	1.9335	0.03332	0.5277:0.0:0.2359:0.2364	.	96	Q8NGP2	OR8J1_HUMAN	A	96	ENSP00000304060:E96A	ENSP00000304060:E96A	E	+	2	0	OR8J1	55884585	0.000000	0.05858	1.000000	0.80357	0.420000	0.31355	-0.740000	0.04861	1.910000	0.55303	0.523000	0.50628	GAA	-	NULL		0.413	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8J1	protein_coding	OTTHUMT00000391606.2	A	NM_001005205		55884585	1	no_errors	NM_001005205	genbank	human	provisional	54_36p	missense	SNP	0.95	C
OR8U1	219417	genome.wustl.edu	37	11	56143809	56143809	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr11:56143809C>A	ENST00000302270.1	+	1	710	c.710C>A	c.(709-711)gCt>gAt	p.A237D		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A237D(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					AGACAGAAGGCTTTCTCGACG	0.473																																																1	Substitution - Missense(1)	ovary(1)	11											125.0	127.0	126.0					11																	56143809		2061	4235	6296	55900385	SO:0001583	missense	219417			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.710C>A	11.37:g.56143809C>A	ENSP00000304188:p.Ala237Asp	Somatic		Capture	Illumina GAIIx	4	55900385		Missense_Mutation	SNP	-	p.A237D	ENST00000302270.1	37	c.710	CCDS41647.1	11	.	.	.	.	.	.	.	.	.	.	C	13.02	2.110912	0.37242	.	.	ENSG00000172199	ENST00000302270	T	0.00358	7.88	5.78	5.78	0.91487	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000193	T	0.01730	0.0055	H	0.99454	4.575	0.26642	N	0.972277	D	0.54397	0.966	P	0.62491	0.903	T	0.24835	-1.0149	10	0.87932	D	0	.	14.2137	0.65779	0.0:0.9288:0.0:0.0711	.	237	Q8NH10	OR8U1_HUMAN	D	237	ENSP00000304188:A237D	ENSP00000304188:A237D	A	+	2	0	OR8U1	55900385	0.867000	0.29959	0.069000	0.20011	0.001000	0.01503	1.977000	0.40589	2.743000	0.94032	0.643000	0.83706	GCT	-	NULL		0.473	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8U1	protein_coding	OTTHUMT00000391607.1	C	NM_001005204		55900385	1	no_errors	NM_001005204	genbank	human	provisional	54_36p	missense	SNP	1	A
DPP3	10072	genome.wustl.edu	37	11	66272241	66272241	+	Silent	SNP	T	T	G			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr11:66272241T>G	ENST00000360510.2	+	17	2102	c.2037T>G	c.(2035-2037)ctT>ctG	p.L679L	DPP3_ENST00000530165.1_Silent_p.L649L|DPP3_ENST00000541961.1_Silent_p.L679L|DPP3_ENST00000531863.1_Silent_p.L699L|DPP3_ENST00000453114.1_Silent_p.L679L|DPP3_ENST00000532677.1_Silent_p.L698L			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	679					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L679L(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						ACACTCGCCTTGAAGGTAATG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	11											104.0	93.0	97.0					11																	66272241		2200	4295	6495	66028817	SO:0001819	synonymous_variant	10072			AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.2037T>G	11.37:g.66272241T>G		Somatic		Capture	Illumina GAIIx	4	66028817	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Silent	SNP	HMMPfam_Peptidase_M49	p.L679	ENST00000360510.2	37	c.2037	CCDS8141.1	11																																																																																			-	HMMPfam_Peptidase_M49		0.562	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP3	protein_coding	OTTHUMT00000393424.2	T			66028817	1	no_errors	NM_005700	genbank	human	reviewed	54_36p	silent	SNP	0.97	G
MMP19	4327	genome.wustl.edu	37	12	56231082	56231084	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	AAC	AAC	AAC	-	AAC	AAC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr12:56231082_56231084delAAC	ENST00000322569.4	-	9	1354_1356	c.1263_1265delGTT	c.(1261-1266)ttgttt>ttt	p.L421del	MMP19_ENST00000409200.3_3'UTR|MMP19_ENST00000394182.1_In_Frame_Del_p.L135del|MMP19_ENST00000548629.1_In_Frame_Del_p.L398del|TMEM198B_ENST00000478241.1_RNA	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	421					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L421del(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	CACTCCCGTAAACAAACCCTTGA	0.571																																																1	Deletion - In frame(1)	ovary(1)	12																																								54517351	SO:0001651	inframe_deletion	4327			X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.1263_1265delGTT	12.37:g.56231082_56231084delAAC	ENSP00000313437:p.Leu421del	Somatic		Capture	Illumina GAIIx	4	54517349	B4E030|O15278|O95606|Q99580	In_Frame_Del	DEL	"HMMPfam_Hemopexin;superfamily_Hemopexin-like domain;HMMPfam_Peptidase_M10;HMMPfam_PG_binding_1;superfamily_PGBD-like;superfamily_Metalloproteases (""zincins"") catalytic domain"	p.L421in_frame_del	ENST00000322569.4	37	c.1265_1263	CCDS8895.1	12																																																																																			(deletion:cds_exon[54517087;54517425])	HMMPfam_Hemopexin		0.571	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP19	protein_coding	OTTHUMT00000408023.1	AAC	NM_002429		54517351	-1	no_errors	NM_002429	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:1.000:0.983	-
KRR1	11103	genome.wustl.edu	37	12	75897755	75897755	+	Missense_Mutation	SNP	G	G	A	rs368830982		TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr12:75897755G>A	ENST00000229214.4	-	7	783	c.760C>T	c.(760-762)Cgc>Tgc	p.R254C	KRR1_ENST00000438169.2_Intron	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	254	Lys-rich.				rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.R254C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						GGTTCCTTGCGTTTATTCACA	0.358																																																1	Substitution - Missense(1)	ovary(1)	12						G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	212.0	197.0	202.0		760	5.0	1.0	12		202	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRR1	NM_007043.6	180	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	254/382	75897755	2,13004	2203	4300	6503	74184022	SO:0001583	missense	11103			U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.760C>T	12.37:g.75897755G>A	ENSP00000229214:p.Arg254Cys	Somatic		Capture	Illumina GAIIx	4	74184022	A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Missense_Mutation	SNP	HMMPfam_KH_1;superfamily_Eukaryotic type KH-domain (KH-domain type I)	p.R254C	ENST00000229214.4	37	c.760	CCDS9012.1	12	.	.	.	.	.	.	.	.	.	.	G	17.05	3.288961	0.59976	2.27E-4	1.16E-4	ENSG00000111615	ENST00000229214	T	0.31247	1.5	5.86	4.98	0.66077	.	0.098444	0.64402	D	0.000001	T	0.42899	0.1223	M	0.91196	3.185	0.80722	D	1	B	0.19445	0.036	B	0.17098	0.017	T	0.48328	-0.9045	10	0.72032	D	0.01	-11.0911	10.4769	0.44670	0.0688:0.0:0.7973:0.134	.	254	Q13601	KRR1_HUMAN	C	254	ENSP00000229214:R254C	ENSP00000229214:R254C	R	-	1	0	KRR1	74184022	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.929000	0.70096	1.495000	0.48549	0.585000	0.79938	CGC	-	NULL		0.358	KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRR1	protein_coding	OTTHUMT00000405727.1	G	NM_007043		74184022	-1	no_errors	NM_007043	genbank	human	validated	54_36p	missense	SNP	1	A
SEMA6D	80031	genome.wustl.edu	37	15	48022323	48022323	+	Intron	SNP	C	C	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr15:48022323C>T	ENST00000316364.5	+	1	385				SEMA6D_ENST00000536845.2_Intron|SEMA6D_ENST00000355997.3_Intron|SEMA6D_ENST00000358066.4_Intron|SEMA6D_ENST00000389425.3_Intron|SEMA6D_ENST00000389432.2_Intron|SEMA6D_ENST00000537942.1_Intron|SEMA6D_ENST00000558816.1_Intron|SEMA6D_ENST00000389433.2_Intron|SEMA6D_ENST00000354744.4_Intron|SEMA6D_ENST00000558014.1_Intron|SEMA6D_ENST00000389428.3_Intron	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D						axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GTACAGAAAACTCAACAGTGT	0.338																																																0			15																																								45809615	SO:0001627	intron_variant	644029			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.-55+11253C>T	15.37:g.48022323C>T		Somatic		Capture	Illumina GAIIx	4	45809615	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	RNA	SNP	-	NULL	ENST00000316364.5	37	NULL	CCDS32225.1	15																																																																																			-	-		0.338	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC644029	protein_coding	OTTHUMT00000416868.1	C	NM_024966		45809615	-1	pseudogene	XR_017397	genbank	human	model	54_36p	rna	SNP	0.83	T
SLX4	84464	genome.wustl.edu	37	16	3647922	3647922	+	Silent	SNP	G	G	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr16:3647922G>A	ENST00000294008.3	-	6	1882	c.1242C>T	c.(1240-1242)gaC>gaT	p.D414D		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	414	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)	p.D414D(1)		breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						ACGGTGCCTCGTCCACCTTCC	0.592								Direct reversal of damage																																								1	Substitution - coding silent(1)	ovary(1)	16											82.0	79.0	80.0					16																	3647922		2197	4300	6497	3587923	SO:0001819	synonymous_variant	84464			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.1242C>T	16.37:g.3647922G>A		Somatic		Capture	Illumina GAIIx	4	3587923	Q69YT8|Q8TF15|Q96JP1	Silent	SNP	-	p.D414	ENST00000294008.3	37	c.1242	CCDS10506.2	16																																																																																			-	NULL		0.592	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD12	protein_coding	OTTHUMT00000157301.3	G	NM_032444		3587923	-1	no_errors	NM_032444	genbank	human	provisional	54_36p	silent	SNP		A
CREBBP	1387	genome.wustl.edu	37	16	3820936	3820942	+	Frame_Shift_Del	DEL	GAGGCCC	GAGGCCC	-			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	GAGGCCC	GAGGCCC	GAGGCCC	-	GAGGCCC	GAGGCCC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr16:3820936_3820942delGAGGCCC	ENST00000262367.5	-	14	3318_3324	c.2509_2515delGGGCCTC	c.(2509-2517)gggcctcagfs	p.GPQ837fs	CREBBP_ENST00000382070.3_Frame_Shift_Del_p.GPQ799fs	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	837					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.G837fs*10(1)|p.Q839*(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TGGCTGGCCTGAGGCCCCAGCATGTTG	0.556			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	2	Substitution - Nonsense(1)|Deletion - Frameshift(1)	urinary_tract(1)|ovary(1)	16	GRCh37	CI084719	CREBBP	I																																				3760943	SO:0001589	frameshift_variant	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.2509_2515delGGGCCTC	16.37:g.3820936_3820942delGAGGCCC	ENSP00000262367:p.Gly837fs	Somatic		Capture	Illumina GAIIx	4	3760937	D3DUC9|O00147|Q16376|Q4LE28	Frame_Shift_Del	DEL	HMMPfam_zf-TAZ;superfamily_TAZ domain;HMMPfam_ZZ;HMMPfam_Bromodomain;HMMPfam_KIX;superfamily_Nuclear receptor coactivator interlocking domain;HMMPfam_DUF906;HMMPfam_DUF902;superfamily_FYVE/PHD zinc finger;HMMPfam_Creb_binding;superfamily_Kix domain of CBP (creb binding protein);superfamily_Bromodomain;superfamily_Immunoglobulin	p.G837fs	ENST00000262367.5	37	c.2515_2509	CCDS10509.1	16																																																																																			(deletion:cds_exon[3760572;3760988])	NULL		0.556	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	protein_coding	OTTHUMT00000251591.2	GAGGCCC	NM_004380		3760943	-1	no_errors	NM_004380	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.954:0.932:1.000:1.000:0.991:1.000:1.000	-
TP53	7157	genome.wustl.edu	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	C	A	rs121912654		TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr17:7578461C>A	ENST00000269305.4	-	5	658	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	TP53_ENST00000359597.4_Missense_Mutation_p.V157F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.V157F|TP53_ENST00000420246.2_Missense_Mutation_p.V157F|TP53_ENST00000445888.2_Missense_Mutation_p.V157F|TP53_ENST00000413465.2_Missense_Mutation_p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCGCGGACGCGGGTGCCG	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	231	Substitution - Missense(189)|Deletion - Frameshift(15)|Deletion - In frame(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	lung(69)|liver(30)|upper_aerodigestive_tract(26)|breast(19)|oesophagus(14)|ovary(13)|stomach(9)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|bone(5)|vulva(4)|urinary_tract(4)|skin(3)|pancreas(3)|endometrium(2)|kidney(2)|biliary_tract(2)|soft_tissue(2)|prostate(1)|adrenal_gland(1)|salivary_gland(1)|thymus(1)	17											50.0	52.0	51.0					17																	7578461		2202	4300	6502	7519186	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.469G>T	17.37:g.7578461C>A	ENSP00000269305:p.Val157Phe	Somatic		Capture	Illumina GAIIx	4	7519186	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.V157F	ENST00000269305.4	37	c.469	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	12.19	1.865109	0.32977	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.47	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99718	0.9891	M	0.86420	2.815	0.33606	D	0.603	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.994;0.984;0.981;0.996;0.998;0.996	D	0.97998	1.0358	10	0.72032	D	0.01	-16.7152	5.3541	0.16051	0.0:0.6119:0.146:0.2421	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157F;ENSP00000352610:V157F;ENSP00000269305:V157F;ENSP00000398846:V157F;ENSP00000391127:V157F;ENSP00000391478:V157F;ENSP00000425104:V25F;ENSP00000423862:V64F;ENSP00000424104:V157F	ENSP00000269305:V157F	V	-	1	0	TP53	7519186	0.137000	0.22531	0.013000	0.15412	0.150000	0.21749	0.548000	0.23314	0.386000	0.24997	-0.253000	0.11424	GTC	-	HMMPfam_P53		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7519186	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.1	A
CARD14	79092	genome.wustl.edu	37	17	78178061	78178061	+	Silent	SNP	C	C	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr17:78178061C>T	ENST00000573882.1	+	19	2855	c.2319C>T	c.(2317-2319)atC>atT	p.I773I	RP11-334C17.5_ENST00000573346.1_RNA|RP11-334C17.5_ENST00000572730.1_RNA|RP11-334C17.5_ENST00000570309.1_RNA|RP11-334C17.5_ENST00000576824.1_RNA|RP11-334C17.5_ENST00000573935.1_RNA|CARD14_ENST00000344227.2_Silent_p.I773I			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	773					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)	p.I773I(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TGGTCCGCATCGTCAGTATGG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	17											54.0	45.0	48.0					17																	78178061		2202	4299	6501	75792656	SO:0001819	synonymous_variant	79092			AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.2319C>T	17.37:g.78178061C>T		Somatic		Capture	Illumina GAIIx	4	75792656	B8QQJ3|Q9BVB5	Silent	SNP	HMMPfam_CARD;superfamily_PDZ domain-like;superfamily_DEATH domain;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.I773	ENST00000573882.1	37	c.2319	CCDS11768.1	17																																																																																			-	NULL		0.567	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD14	protein_coding	OTTHUMT00000437507.1	C			75792656	1	no_errors	NM_024110	genbank	human	reviewed	54_36p	silent	SNP	1	T
TCEB3B	51224	genome.wustl.edu	37	18	44560014	44560014	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr18:44560014G>T	ENST00000332567.4	-	1	1974	c.1622C>A	c.(1621-1623)cCg>cAg	p.P541Q	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	541	Activation domain. {ECO:0000250}.				regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P541Q(1)		breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GAGGGCGTCCGGATTGTTTCT	0.597																																																1	Substitution - Missense(1)	ovary(1)	18											60.0	62.0	61.0					18																	44560014		2203	4300	6503	42814012	SO:0001583	missense	51224			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.1622C>A	18.37:g.44560014G>T	ENSP00000331302:p.Pro541Gln	Somatic		Capture	Illumina GAIIx	4	42814012	Q9P2V9	Missense_Mutation	SNP	HMMPfam_Elongin_A;HMMPfam_TFIIS;superfamily_Conserved domain common to transcription factors TFIIS elongin A CRSP70	p.P541Q	ENST00000332567.4	37	c.1622	CCDS11932.1	18	.	.	.	.	.	.	.	.	.	.	G	3.588	-0.084256	0.07097	.	.	ENSG00000206181	ENST00000332567	T	0.06449	3.3	1.36	-2.73	0.05950	.	54.837800	0.00166	U	0.000010	T	0.06962	0.0177	L	0.44542	1.39	0.09310	N	1	P	0.42692	0.787	B	0.39805	0.31	T	0.18808	-1.0325	10	0.59425	D	0.04	1.0541	3.8439	0.08926	0.5538:0.1992:0.2471:0.0	.	541	Q8IYF1	ELOA2_HUMAN	Q	541	ENSP00000331302:P541Q	ENSP00000331302:P541Q	P	-	2	0	TCEB3B	42814012	0.223000	0.23663	0.000000	0.03702	0.000000	0.00434	0.629000	0.24538	-1.600000	0.01603	-2.125000	0.00346	CCG	-	HMMPfam_Elongin_A		0.597	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	protein_coding	OTTHUMT00000255900.1	G	NM_016427		42814012	-1	no_errors	NM_016427	genbank	human	reviewed	54_36p	missense	SNP		T
AP1M2	10053	genome.wustl.edu	37	19	10690457	10690457	+	Missense_Mutation	SNP	G	G	A	rs376655050		TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr19:10690457G>A	ENST00000250244.6	-	7	833	c.751C>T	c.(751-753)Cgc>Tgc	p.R251C	AP1M2_ENST00000590923.1_Missense_Mutation_p.R253C	NM_005498.4	NP_005489.2	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	251	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein targeting (GO:0006605)|regulation of defense response to virus by virus (GO:0050690)|vesicle targeting (GO:0006903)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)		p.R251C(1)		endometrium(4)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	9			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			GAGATGGTGCGGTCGTTGTCA	0.557																																																1	Substitution - Missense(1)	ovary(1)	19											136.0	141.0	139.0					19																	10690457		2186	4296	6482	10551457	SO:0001583	missense	10053			AF020797	CCDS45964.1	19p13.2	2008-10-07				ENSG00000129354			558	protein-coding gene	gene with protein product		607309				10338135	Standard	NM_005498		Approved	HSMU1B, mu2, AP1-mu2	uc002mpc.3	Q9Y6Q5		ENST00000250244.6:c.751C>T	19.37:g.10690457G>A	ENSP00000250244:p.Arg251Cys	Somatic		Capture	Illumina GAIIx	4	10551457	B2RDV5|Q9BSI8	Missense_Mutation	SNP	-	p.R251C	ENST00000250244.6	37	c.751	CCDS45964.1	19	.	.	.	.	.	.	.	.	.	.	g	15.85	2.954752	0.53293	.	.	ENSG00000129354	ENST00000250244	T	0.25085	1.82	5.21	4.18	0.49190	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.67239	0.2872	H	0.99286	4.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.982	T	0.79361	-0.1835	10	0.87932	D	0	-30.7159	11.6721	0.51408	0.0864:0.0:0.9136:0.0	.	253;251	Q9Y6Q5-2;Q9Y6Q5	.;AP1M2_HUMAN	C	251	ENSP00000250244:R251C	ENSP00000250244:R251C	R	-	1	0	AP1M2	10551457	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	2.123000	0.41996	1.221000	0.43506	0.555000	0.69702	CGC	-	NULL		0.557	AP1M2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP1M2	protein_coding	OTTHUMT00000452034.1	G			10551457	-1	no_errors	NM_005498	genbank	human	reviewed	54_36p	missense	SNP	1	A
NOTCH3	4854	genome.wustl.edu	37	19	15276882	15276882	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr19:15276882G>T	ENST00000263388.2	-	30	5458	c.5383C>A	c.(5383-5385)Ctg>Atg	p.L1795M		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1795					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.L1795M(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			AAGGAAGCCAGCATTAGCGGG	0.547																																																1	Substitution - Missense(1)	ovary(1)	19											52.0	52.0	52.0					19																	15276882		2203	4300	6503	15137882	SO:0001583	missense	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5383C>A	19.37:g.15276882G>T	ENSP00000263388:p.Leu1795Met	Somatic		Capture	Illumina GAIIx	4	15137882	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	superfamily_Ankyrin repeat;superfamily_EGF/Laminin;superfamily_Notch domain;Notch;HMMPfam_Notch;Ank;HMMPfam_Ank;EGF;HMMPfam_EGF;NOD;HMMPfam_NOD;NODP;HMMPfam_NODP;EGF_CA;HMMPfam_EGF_CA;EGF_2;HMMPfam_EGF_2	p.L1795M	ENST00000263388.2	37	c.5383	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885328	0.72410	.	.	ENSG00000074181	ENST00000263388	T	0.56941	0.43	5.18	4.11	0.48088	Ankyrin repeat-containing domain (3);	0.000000	0.26553	N	0.023725	T	0.72036	0.3411	M	0.81112	2.525	0.50813	D	0.999896	D	0.89917	1.0	D	0.85130	0.997	T	0.75238	-0.3388	10	0.66056	D	0.02	.	13.2631	0.60117	0.0801:0.0:0.9199:0.0	.	1795	Q9UM47	NOTC3_HUMAN	M	1795	ENSP00000263388:L1795M	ENSP00000263388:L1795M	L	-	1	2	NOTCH3	15137882	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.601000	0.36773	2.688000	0.91661	0.655000	0.94253	CTG	-	HMMPfam_Ank		0.547	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	protein_coding	OTTHUMT00000465714.1	G	NM_000435		15137882	-1	no_errors	NM_000435	genbank	human	reviewed	54_36p	missense	SNP	1	T
NOTCH3	4854	genome.wustl.edu	37	19	15278142	15278142	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr19:15278142G>C	ENST00000263388.2	-	29	5355	c.5280C>G	c.(5278-5280)atC>atG	p.I1760M		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1760					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.I1760M(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GTGCCACGCGGATGTCAGCAG	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											145.0	108.0	121.0					19																	15278142		2203	4300	6503	15139142	SO:0001583	missense	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5280C>G	19.37:g.15278142G>C	ENSP00000263388:p.Ile1760Met	Somatic		Capture	Illumina GAIIx	4	15139142	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	superfamily_Ankyrin repeat;superfamily_EGF/Laminin;superfamily_Notch domain;Notch;HMMPfam_Notch;Ank;HMMPfam_Ank;EGF;HMMPfam_EGF;NOD;HMMPfam_NOD;NODP;HMMPfam_NODP;EGF_CA;HMMPfam_EGF_CA;EGF_2;HMMPfam_EGF_2	p.I1760M	ENST00000263388.2	37	c.5280	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165910	0.57476	.	.	ENSG00000074181	ENST00000263388	D	0.83335	-1.71	4.26	3.22	0.36961	.	.	.	.	.	D	0.90120	0.6913	M	0.81112	2.525	0.45962	D	0.998787	D	0.89917	1.0	D	0.77557	0.99	D	0.90523	0.4490	9	0.62326	D	0.03	.	12.4525	0.55684	0.0:0.0:0.8307:0.1693	.	1760	Q9UM47	NOTC3_HUMAN	M	1760	ENSP00000263388:I1760M	ENSP00000263388:I1760M	I	-	3	3	NOTCH3	15139142	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	2.083000	0.41615	0.992000	0.38840	-0.470000	0.05040	ATC	-	NULL		0.622	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	protein_coding	OTTHUMT00000465714.1	G	NM_000435		15139142	-1	no_errors	NM_000435	genbank	human	reviewed	54_36p	missense	SNP	1	C
NOTCH3	4854	genome.wustl.edu	37	19	15281228	15281228	+	Silent	SNP	G	G	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr19:15281228G>A	ENST00000263388.2	-	27	5103	c.5028C>T	c.(5026-5028)ttC>ttT	p.F1676F		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1676					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.F1676F(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			AGCCCTCAGGGAACCAGAGGG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	19											42.0	46.0	45.0					19																	15281228		2203	4300	6503	15142228	SO:0001819	synonymous_variant	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5028C>T	19.37:g.15281228G>A		Somatic		Capture	Illumina GAIIx	4	15142228	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	superfamily_Ankyrin repeat;superfamily_EGF/Laminin;superfamily_Notch domain;Notch;HMMPfam_Notch;Ank;HMMPfam_Ank;EGF;HMMPfam_EGF;NOD;HMMPfam_NOD;NODP;HMMPfam_NODP;EGF_CA;HMMPfam_EGF_CA;EGF_2;HMMPfam_EGF_2	p.F1676	ENST00000263388.2	37	c.5028	CCDS12326.1	19																																																																																			-	NULL		0.657	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	protein_coding	OTTHUMT00000465714.1	G	NM_000435		15142228	-1	no_errors	NM_000435	genbank	human	reviewed	54_36p	silent	SNP	1	A
NOTCH3	4854	genome.wustl.edu	37	19	15281296	15281296	+	Silent	SNP	G	G	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr19:15281296G>A	ENST00000263388.2	-	27	5035	c.4960C>T	c.(4960-4962)Ctg>Ttg	p.L1654L		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1654					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.L1654L(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			ATGACCAGCAGCAAGACAGCG	0.662																																																1	Substitution - coding silent(1)	ovary(1)	19											24.0	29.0	27.0					19																	15281296		2188	4278	6466	15142296	SO:0001819	synonymous_variant	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.4960C>T	19.37:g.15281296G>A		Somatic		Capture	Illumina GAIIx	4	15142296	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	superfamily_Ankyrin repeat,superfamily_EGF/Laminin,superfamily_Notch domain,Notch,HMMPfam_Notch,Ank,HMMPfam_Ank,EGF,HMMPfam_EGF,NOD,HMMPfam_NOD,NODP,HMMPfam_NODP,EGF_CA,HMMPfam_EGF_CA,EGF_2,HMMPfam_EGF_2	p.L1654	ENST00000263388.2	37	c.4960	CCDS12326.1	19																																																																																			-	NULL		0.662	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	protein_coding	OTTHUMT00000465714.1	G	NM_000435		15142296	-1	no_errors	NM_000435	genbank	human	reviewed	54_36p	silent	SNP	0.991	A
CYP4F11	57834	genome.wustl.edu	37	19	16025127	16025127	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr19:16025127G>A	ENST00000402119.4	-	11	1811	c.1385C>T	c.(1384-1386)tCg>tTg	p.S462L	CYP4F11_ENST00000591841.1_Missense_Mutation_p.S137L|CYP4F11_ENST00000248041.8_Missense_Mutation_p.S462L|CYP4F11_ENST00000326742.8_Silent_p.L440L	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11									p.S462L(1)		NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						GGGCCCTGCCGAGAAGGGAAT	0.562																																																1	Substitution - Missense(1)	ovary(1)	19											207.0	206.0	206.0					19																	16025127		2203	4300	6503	15886127	SO:0001583	missense	57834			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.1385C>T	19.37:g.16025127G>A	ENSP00000384588:p.Ser462Leu	Somatic		Capture	Illumina GAIIx	4	15886127		Missense_Mutation	SNP	HMMPfam_p450;superfamily_Cytochrome P450	p.S462L	ENST00000402119.4	37	c.1385	CCDS12337.1	19	.	.	.	.	.	.	.	.	.	.	g	22.2	4.261847	0.80358	.	.	ENSG00000171903	ENST00000402119;ENST00000248041	T;T	0.75367	-0.93;-0.93	2.93	2.93	0.34026	Cytochrome P450, conserved site (1);	0.000000	0.64402	U	0.000006	D	0.88040	0.6330	M	0.93854	3.465	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.90306	0.4333	10	0.87932	D	0	.	11.6202	0.51113	0.0:0.0:1.0:0.0	.	462	Q9HBI6	CP4FB_HUMAN	L	462	ENSP00000384588:S462L;ENSP00000248041:S462L	ENSP00000248041:S462L	S	-	2	0	CYP4F11	15886127	1.000000	0.71417	0.837000	0.33122	0.948000	0.59901	8.074000	0.89500	1.621000	0.50320	0.462000	0.41574	TCG	-	HMMPfam_p450		0.562	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP4F11	protein_coding	OTTHUMT00000460385.2	G	NM_021187		15886127	-1	no_errors	NM_021187	genbank	human	reviewed	54_36p	missense	SNP	1	A
ZNF557	79230	genome.wustl.edu	37	19	7083614	7083614	+	Silent	SNP	C	C	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr19:7083614C>T	ENST00000439035.2	+	8	1371	c.1131C>T	c.(1129-1131)tcC>tcT	p.S377S	ZNF557_ENST00000414706.1_Silent_p.S384S|ZNF557_ENST00000252840.6_Silent_p.S384S			Q8N988	ZN557_HUMAN	zinc finger protein 557	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S384S(1)		endometrium(6)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17				Lung(535;0.179)		GTGGAAAATCCTTTAATGTTC	0.368																																																1	Substitution - coding silent(1)	ovary(1)	19											65.0	68.0	67.0					19																	7083614		2127	4266	6393	7034614	SO:0001819	synonymous_variant	79230			AK095524	CCDS42485.1, CCDS45945.1	19p13.2	2013-09-20			ENSG00000130544	ENSG00000130544		"""Zinc fingers, C2H2-type"", ""-"""	28632	protein-coding gene	gene with protein product						12477932	Standard	NM_024341		Approved	MGC4054	uc002mgc.3	Q8N988	OTTHUMG00000181977	ENST00000439035.2:c.1131C>T	19.37:g.7083614C>T		Somatic		Capture	Illumina GAIIx	4	7034614	Q6PEJ3|Q9BTZ1	Silent	SNP	-	p.S384	ENST00000439035.2	37	c.1152	CCDS45945.1	19																																																																																			-	NULL		0.368	ZNF557-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF557	protein_coding	OTTHUMT00000458502.1	C	NM_024341		7034614	1	no_errors	NM_001044387	genbank	human	validated	54_36p	silent	SNP	0.24	T
FBN3	84467	genome.wustl.edu	37	19	8155128	8155128	+	Silent	SNP	C	C	G			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr19:8155128C>G	ENST00000600128.1	-	49	6453	c.6039G>C	c.(6037-6039)cgG>cgC	p.R2013R	FBN3_ENST00000601739.1_Silent_p.R2013R|FBN3_ENST00000270509.2_Silent_p.R2013R			Q75N90	FBN3_HUMAN	fibrillin 3	2013						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.R2013R(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						AGAAACTCTGCCGTGTGTCTG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	19											43.0	43.0	43.0					19																	8155128		2203	4300	6503	8061128	SO:0001819	synonymous_variant	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.6039G>C	19.37:g.8155128C>G		Somatic		Capture	Illumina GAIIx	4	8061128	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	HMMPfam_TB;HMMPfam_EGF_CA;superfamily_EGF/Laminin;superfamily_TB module/8-cys domain	p.G133A	ENST00000600128.1	37	c.398	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	C	8.862	0.947154	0.18356	.	.	ENSG00000142449	ENST00000341066	.	.	.	4.58	-3.61	0.04556	.	.	.	.	.	T	0.38506	0.1043	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44892	-0.9298	5	0.33141	T	0.24	.	0.9039	0.01280	0.2012:0.1945:0.3432:0.261	.	.	.	.	A	133	.	ENSP00000341317:G133A	G	-	2	0	FBN3	8061128	0.186000	0.23225	0.914000	0.36105	0.930000	0.56654	-0.608000	0.05641	0.048000	0.15891	-0.258000	0.10820	GGC	-	NULL		0.617	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	protein_coding	OTTHUMT00000461428.2	C	NM_032447		8061128	-1	no_errors	ENST00000341066	ensembl	human	known	54_36p	missense	SNP	0.98	G
PSG1	5669	genome.wustl.edu	37	19	43376194	43376194	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr19:43376194T>C	ENST00000436291.2	-	3	550	c.434A>G	c.(433-435)gAg>gGg	p.E145G	PSG1_ENST00000595356.1_Missense_Mutation_p.E145G|PSG1_ENST00000403380.3_Intron|PSG1_ENST00000595124.1_Intron|PSG1_ENST00000312439.6_Missense_Mutation_p.E145G|PSG1_ENST00000244296.2_Missense_Mutation_p.E145G	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	145					female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.E145G(2)		breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				CTTAGGAGTCTCCACTGTGCA	0.522																																																2	Substitution - Missense(2)	ovary(2)	19											135.0	128.0	130.0					19																	43376194		2201	4299	6500	48068034	SO:0001583	missense	5669				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.434A>G	19.37:g.43376194T>C	ENSP00000413041:p.Glu145Gly	Somatic		Capture	Illumina GAIIx	4	48068034	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	HMMPfam_V-set;HMMPfam_ig;superfamily_Immunoglobulin	p.E145G	ENST00000436291.2	37	c.434	CCDS54275.1	19	.	.	.	.	.	.	.	.	.	.	N	7.763	0.705831	0.15172	.	.	ENSG00000231924	ENST00000436291;ENST00000312439;ENST00000244296	T;T;T	0.38240	1.15;1.15;1.2	1.46	-2.93	0.05598	Immunoglobulin subtype (1);	.	.	.	.	T	0.44477	0.1295	M	0.68952	2.095	0.09310	N	1	D;B;P;B;B;P;B	0.56521	0.976;0.367;0.817;0.11;0.022;0.555;0.028	P;P;P;B;B;B;B	0.60473	0.875;0.502;0.653;0.321;0.081;0.406;0.122	T	0.34750	-0.9816	9	0.56958	D	0.05	.	2.052	0.03573	0.4043:0.0:0.227:0.3688	.	145;145;145;145;145;145;145	O75238;P11464-4;P11464;P11464-3;Q9UPK8;O75237;P11464-2	.;.;PSG1_HUMAN;.;.;.;.	G	145	ENSP00000413041:E145G;ENSP00000308970:E145G;ENSP00000244296:E145G	ENSP00000244296:E145G	E	-	2	0	PSG1	48068034	0.000000	0.05858	0.001000	0.08648	0.056000	0.15407	-2.303000	0.01135	-1.251000	0.02494	0.155000	0.16302	GAG	-	NULL		0.522	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	protein_coding	OTTHUMT00000321426.1	T			48068034	-1	no_errors	NM_006905	genbank	human	provisional	54_36p	missense	SNP	0.02	C
NT5C1B	93034	genome.wustl.edu	37	2	18768370	18768370	+	Missense_Mutation	SNP	G	G	A	rs199544140	byFrequency	TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr2:18768370G>A	ENST00000359846.2	-	3	267	c.190C>T	c.(190-192)Cgc>Tgc	p.R64C	NT5C1B_ENST00000600945.1_Missense_Mutation_p.R64C|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.R64C|NT5C1B_ENST00000304081.4_Intron|NT5C1B_ENST00000460052.1_Intron	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	64					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.R64C(1)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				CAAAGGCAGCGTCTACACGAC	0.537													G|||	2	0.000399361	0.0	0.0	5008	,	,		20114	0.0		0.002	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2											67.0	54.0	58.0					2																	18768370		2203	4300	6503	18631851	SO:0001583	missense	93034			AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.190C>T	2.37:g.18768370G>A	ENSP00000352904:p.Arg64Cys	Somatic		Capture	Illumina GAIIx	4	18631851	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	HMMPfam_5-nucleotidase	p.R64C	ENST00000359846.2	37	c.190	CCDS33150.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	23.2	4.388482	0.82902	.	.	ENSG00000250741;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000359846;ENST00000416783	.	.	.	5.39	5.39	0.77823	.	0.133787	0.34700	N	0.003758	T	0.52108	0.1714	N	0.14661	0.345	0.41628	D	0.989007	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	P;P;P;P;P	0.59288	0.719;0.791;0.719;0.719;0.855	T	0.58476	-0.7630	9	0.87932	D	0	-18.0153	14.5287	0.67909	0.0:0.0:1.0:0.0	.	47;64;47;64;64	E7EXB7;B4DZ86;B4DXZ9;Q96P26;Q96P26-4	.;.;.;5NT1B_HUMAN;.	C	64	.	ENSP00000352904:R64C	R	-	1	0	NT5C1B-RDH14;NT5C1B	18631851	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.235000	0.58666	2.809000	0.96659	0.467000	0.42956	CGC	-	NULL		0.537	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NT5C1B	protein_coding	OTTHUMT00000323822.1	G			18631851	-1	no_errors	NM_001002006	genbank	human	validated	54_36p	missense	SNP	1	A
GMCL1	64395	genome.wustl.edu	37	2	70064744	70064744	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr2:70064744A>G	ENST00000282570.3	+	2	577	c.326A>G	c.(325-327)gAc>gGc	p.D109G	GMCL1_ENST00000468386.2_3'UTR	NM_178439.3	NP_848526.1	Q96IK5	GMCL1_HUMAN	germ cell-less, spermatogenesis associated 1	109	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)	nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)		p.D109G(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	15						GAAAACAGTGACATTAAGATT	0.259																																																1	Substitution - Missense(1)	ovary(1)	2											42.0	44.0	44.0					2																	70064744		2192	4291	6483	69918248	SO:0001583	missense	64395			AK023119	CCDS1895.1	2p13.3	2013-01-09	2012-08-20		ENSG00000087338	ENSG00000087338		"""BTB/POZ domain containing"""	23843	protein-coding gene	gene with protein product	"""spermatogenesis associated 29"""		"""germ cell-less homolog 1 (Drosophila)"""				Standard	NM_178439		Approved	FLJ13057, BTBD13, GCL1, SPATA29	uc002sfu.3	Q96IK5	OTTHUMG00000129643	ENST00000282570.3:c.326A>G	2.37:g.70064744A>G	ENSP00000282570:p.Asp109Gly	Somatic		Capture	Illumina GAIIx	4	69918248	Q9H826|Q9H8V7|Q9H927	Missense_Mutation	SNP	-	p.D109G	ENST00000282570.3	37	c.326	CCDS1895.1	2	.	.	.	.	.	.	.	.	.	.	A	22.4	4.281341	0.80692	.	.	ENSG00000087338	ENST00000282570	D	0.91351	-2.83	4.92	4.92	0.64577	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.96750	0.8939	H	0.97077	3.935	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97655	1.0157	10	0.87932	D	0	-32.076	12.832	0.57750	1.0:0.0:0.0:0.0	.	109	Q96IK5	GMCL1_HUMAN	G	109	ENSP00000282570:D109G	ENSP00000282570:D109G	D	+	2	0	GMCL1	69918248	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	8.131000	0.89601	2.181000	0.69327	0.455000	0.32223	GAC	-	NULL		0.259	GMCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMCL1	protein_coding	OTTHUMT00000251841.2	A	NM_178439		69918248	1	no_errors	NM_178439	genbank	human	provisional	54_36p	missense	SNP	1	G
KRCC1	51315	genome.wustl.edu	37	2	88327856	88327856	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr2:88327856T>C	ENST00000347055.3	-	4	620	c.227A>G	c.(226-228)aAt>aGt	p.N76S		NM_016618.1	NP_057702.1	Q9NPI7	KRCC1_HUMAN	lysine-rich coiled-coil 1	76								p.N76S(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	7						TTGTGGAATATTGCATGATCT	0.478																																																1	Substitution - Missense(1)	ovary(1)	2											127.0	113.0	118.0					2																	88327856		2203	4300	6503	88108971	SO:0001583	missense	51315			AF208845	CCDS2000.1	2p11.2	2008-02-05			ENSG00000172086	ENSG00000172086			28039	protein-coding gene	gene with protein product						12477932	Standard	XM_005264360		Approved	FLJ22333	uc002sso.1	Q9NPI7	OTTHUMG00000130315	ENST00000347055.3:c.227A>G	2.37:g.88327856T>C	ENSP00000340083:p.Asn76Ser	Somatic		Capture	Illumina GAIIx	4	88108971	Q3B7J7	Missense_Mutation	SNP	-	p.N76S	ENST00000347055.3	37	c.227	CCDS2000.1	2	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.362573	0.00016	.	.	ENSG00000172086	ENST00000347055	T	0.29917	1.55	5.73	-11.5	0.00074	.	1.570320	0.03659	N	0.242270	T	0.09642	0.0237	N	0.02286	-0.61	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.26258	-1.0108	10	0.02654	T	1	-7.7686	13.2776	0.60196	0.0:0.1168:0.375:0.5082	.	76	Q9NPI7	KRCC1_HUMAN	S	76	ENSP00000340083:N76S	ENSP00000340083:N76S	N	-	2	0	KRCC1	88108971	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-2.027000	0.01433	-3.613000	0.00132	-2.511000	0.00188	AAT	-	NULL		0.478	KRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRCC1	protein_coding	OTTHUMT00000252664.1	T	NM_016618		88108971	-1	no_errors	NM_016618	genbank	human	provisional	54_36p	missense	SNP		C
GRB14	2888	genome.wustl.edu	37	2	165358822	165358822	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr2:165358822A>T	ENST00000263915.3	-	9	1585	c.1047T>A	c.(1045-1047)aaT>aaA	p.N349K	GRB14_ENST00000543549.1_Missense_Mutation_p.N262K	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	349					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.N349K(1)		breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						GATGCATATAATTCTGGTACA	0.358																																																1	Substitution - Missense(1)	ovary(1)	2											92.0	82.0	86.0					2																	165358822		2203	4300	6503	165067068	SO:0001583	missense	2888				CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.1047T>A	2.37:g.165358822A>T	ENSP00000263915:p.Asn349Lys	Somatic		Capture	Illumina GAIIx	4	165067068	B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	RA;HMMPfam_RA;SH2;HMMPfam_SH2;PH;HMMPfam_PH;BPS;HMMPfam_BPS	p.N349K	ENST00000263915.3	37	c.1047	CCDS2222.1	2	.	.	.	.	.	.	.	.	.	.	A	20.5	3.993467	0.74703	.	.	ENSG00000115290	ENST00000263915;ENST00000543549;ENST00000446413	T;T;T	0.52754	1.03;1.06;0.65	5.88	5.88	0.94601	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.70815	0.3267	M	0.87971	2.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.76041	-0.3104	10	0.87932	D	0	-15.3913	10.5966	0.45341	0.9283:0.0:0.0717:0.0	.	262;349	B7Z7F9;Q14449	.;GRB14_HUMAN	K	349;262;304	ENSP00000263915:N349K;ENSP00000443699:N262K;ENSP00000416786:N304K	ENSP00000263915:N349K	N	-	3	2	GRB14	165067068	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.768000	0.38511	2.248000	0.74166	0.477000	0.44152	AAT	-	NULL		0.358	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB14	protein_coding	OTTHUMT00000255180.2	A			165067068	-1	no_errors	NM_004490	genbank	human	reviewed	54_36p	missense	SNP	1	T
NCOA6	23054	genome.wustl.edu	37	20	33330015	33330015	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr20:33330015A>C	ENST00000374796.2	-	12	6615	c.4045T>G	c.(4045-4047)Tca>Gca	p.S1349A	NCOA6_ENST00000359003.2_Missense_Mutation_p.S1349A			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1349					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.S1349A(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GGGGCTTTTGAATTTTGCCTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	20											88.0	86.0	86.0					20																	33330015		2203	4300	6503	32793676	SO:0001583	missense	23054			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4045T>G	20.37:g.33330015A>C	ENSP00000363929:p.Ser1349Ala	Somatic		Capture	Illumina GAIIx	4	32793676	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	-	p.S1349A	ENST00000374796.2	37	c.4045	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	A	12.94	2.087614	0.36855	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.25414	1.8;1.8	6.08	4.93	0.64822	.	0.114867	0.40554	N	0.001073	T	0.12092	0.0294	N	0.19112	0.55	0.30076	N	0.809573	B	0.15473	0.013	B	0.09377	0.004	T	0.18871	-1.0323	10	0.12103	T	0.63	-11.704	3.5983	0.08014	0.6562:0.1398:0.0702:0.1337	.	1349	Q14686	NCOA6_HUMAN	A	1349	ENSP00000363929:S1349A;ENSP00000351894:S1349A	ENSP00000351894:S1349A	S	-	1	0	NCOA6	32793676	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.781000	0.47750	2.333000	0.79357	0.482000	0.46254	TCA	-	NULL		0.507	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	protein_coding	OTTHUMT00000078811.2	A	NM_014071		32793676	-1	no_errors	NM_014071	genbank	human	reviewed	54_36p	missense	SNP	0.98	C
SON	6651	genome.wustl.edu	37	21	34932243	34932243	+	Intron	SNP	T	T	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr21:34932243T>A	ENST00000356577.4	+	6	7132				SON_ENST00000290239.6_Intron|SON_ENST00000300278.4_Missense_Mutation_p.L2240M|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein						cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						AGCTTCTCATTTGACAGTAAC	0.453																																																0			21											49.0	42.0	45.0					21																	34932243		2203	4300	6503	33854113	SO:0001627	intron_variant	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.6657+162T>A	21.37:g.34932243T>A		Somatic		Capture	Illumina GAIIx	4	33854113	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	-	p.L2240M	ENST00000356577.4	37	c.6718	CCDS13629.1	21	.	.	.	.	.	.	.	.	.	.	T	13.39	2.222683	0.39300	.	.	ENSG00000159140	ENST00000300278	T	0.13538	2.58	5.58	5.58	0.84498	.	.	.	.	.	T	0.25865	0.0630	.	.	.	0.80722	D	1	P	0.51791	0.948	P	0.55577	0.779	T	0.00867	-1.1534	8	0.34782	T	0.22	.	12.1393	0.53989	0.0:0.0:0.0:1.0	.	2240	P18583-3	.	M	2240	ENSP00000300278:L2240M	ENSP00000300278:L2240M	L	+	1	2	SON	33854113	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.640000	0.54350	2.124000	0.65301	0.460000	0.39030	TTG	-	NULL		0.453	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	protein_coding	OTTHUMT00000140978.2	T	NM_138927		33854113	1	no_errors	NM_032195	genbank	human	reviewed	54_36p	missense	SNP	1	A
SLITRK3	22865	genome.wustl.edu	37	3	164906391	164906391	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr3:164906391A>T	ENST00000475390.1	-	2	2671	c.2228T>A	c.(2227-2229)aTc>aAc	p.I743N	SLITRK3_ENST00000241274.3_Missense_Mutation_p.I743N			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	743					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.I743N(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CGGGTGGGGGATGTACTCATA	0.582										HNSCC(40;0.11)																																						1	Substitution - Missense(1)	ovary(1)	3											72.0	67.0	69.0					3																	164906391		2203	4300	6503	166389085	SO:0001583	missense	22865			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2228T>A	3.37:g.164906391A>T	ENSP00000420091:p.Ile743Asn	Somatic		Capture	Illumina GAIIx	4	166389085	Q1RMY6	Missense_Mutation	SNP	HMMPfam_LRR_1;superfamily_L domain-like	p.I743N	ENST00000475390.1	37	c.2228	CCDS3197.1	3	.	.	.	.	.	.	.	.	.	.	A	16.53	3.149478	0.57151	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.59906	0.23;0.23	5.44	5.44	0.79542	.	0.000000	0.38837	N	0.001549	T	0.51295	0.1666	N	0.24115	0.695	0.49582	D	0.999803	D	0.59357	0.985	P	0.47827	0.558	T	0.58228	-0.7673	10	0.87932	D	0	-17.2245	14.6193	0.68572	1.0:0.0:0.0:0.0	.	743	O94933	SLIK3_HUMAN	N	743	ENSP00000420091:I743N;ENSP00000241274:I743N	ENSP00000241274:I743N	I	-	2	0	SLITRK3	166389085	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.044000	0.93805	2.285000	0.76669	0.533000	0.62120	ATC	-	NULL		0.582	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	protein_coding	OTTHUMT00000350126.1	A	NM_014926		166389085	-1	no_errors	NM_014926	genbank	human	validated	54_36p	missense	SNP	1	T
MINA	84864	genome.wustl.edu	37	3	97668726	97668726	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr3:97668726G>C	ENST00000333396.7	-	7	1604	c.1022C>G	c.(1021-1023)cCt>cGt	p.P341R	MINA_ENST00000360258.4_Missense_Mutation_p.P340R|MINA_ENST00000394198.2_Missense_Mutation_p.P341R	NM_001042533.2|NM_032778.5	NP_001035998.1|NP_116167.3			MYC induced nuclear antigen									p.P340R(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)	13						CGCAGAGTAAGGGGGGAGTCT	0.507																																																1	Substitution - Missense(1)	ovary(1)	3											71.0	71.0	71.0					3																	97668726		2203	4300	6503	99151416	SO:0001583	missense	84864			AB083189	CCDS2929.1, CCDS43114.1	3q22.1	2005-07-22			ENSG00000170854	ENSG00000170854			19441	protein-coding gene	gene with protein product		612049				12091391	Standard	NM_001042533		Approved	MINA53, FLJ14393, mdig	uc003dsb.1	Q8IUF8	OTTHUMG00000160107	ENST00000333396.7:c.1022C>G	3.37:g.97668726G>C	ENSP00000328251:p.Pro341Arg	Somatic		Capture	Illumina GAIIx	4	99151416		Missense_Mutation	SNP	-	p.P341R	ENST00000333396.7	37	c.1022	CCDS43114.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.660090	0.96734	.	.	ENSG00000170854	ENST00000442492;ENST00000333396;ENST00000394198;ENST00000360258	T;T;T	0.20069	2.1;2.1;2.1	5.95	5.95	0.96441	Cupin, JmjC-type (1);	0.000000	0.85682	D	0.000000	T	0.59702	0.2213	M	0.92555	3.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.66292	-0.5960	10	0.56958	D	0.05	-10.5485	20.3854	0.98941	0.0:0.0:1.0:0.0	.	340;341	Q8IUF8-4;Q8IUF8	.;MINA_HUMAN	R	87;341;341;340	ENSP00000328251:P341R;ENSP00000377748:P341R;ENSP00000353395:P340R	ENSP00000328251:P341R	P	-	2	0	MINA	99151416	1.000000	0.71417	0.873000	0.34254	0.757000	0.42996	7.672000	0.83956	2.825000	0.97269	0.655000	0.94253	CCT	-	NULL		0.507	MINA-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	MINA	protein_coding	OTTHUMT00000359244.3	G	NM_032778		99151416	-1	no_errors	NM_001042533	genbank	human	validated	54_36p	missense	SNP	1	C
ABCC5	10057	genome.wustl.edu	37	3	183639181	183639181	+	Silent	SNP	C	C	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr3:183639181C>T	ENST00000334444.6	-	30	4461	c.4221G>A	c.(4219-4221)gaG>gaA	p.E1407E	ABCC5_ENST00000265586.6_Silent_p.E1364E	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1407	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.E1407E(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GGGTGTCAAACTCCACCACCT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	3											82.0	90.0	87.0					3																	183639181		2089	4229	6318	185121875	SO:0001819	synonymous_variant	10057			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.4221G>A	3.37:g.183639181C>T		Somatic		Capture	Illumina GAIIx	4	185121875	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Silent	SNP	HMMPfam_ABC_membrane;HMMPfam_ABC_tran;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain	p.E1407	ENST00000334444.6	37	c.4221	CCDS43176.1	3																																																																																			-	NULL		0.562	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	protein_coding	OTTHUMT00000346350.1	C	NM_005688		185121875	-1	no_errors	NM_005688	genbank	human	reviewed	54_36p	silent	SNP	1	T
PPEF2	5470	genome.wustl.edu	37	4	76811270	76811270	+	Missense_Mutation	SNP	C	C	T	rs112682717	byFrequency	TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr4:76811270C>T	ENST00000286719.7	-	5	613	c.257G>A	c.(256-258)cGc>cAc	p.R86H	PPEF2_ENST00000510607.1_5'Flank	NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	86					detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)	p.R86H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AGTGAATATGCGGGTCAGGAA	0.507													C|||	5	0.000998403	0.003	0.0	5008	,	,		20030	0.0		0.0	False		,,,				2504	0.001				NSCLC(105;1359 1603 15961 44567 47947)											1	Substitution - Missense(1)	ovary(1)	4						C	HIS/ARG	10,4396	16.8+/-37.8	0,10,2193	154.0	142.0	146.0		257	3.3	1.0	4	dbSNP_132	146	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PPEF2	NM_006239.2	29	0,11,6492	TT,TC,CC		0.0116,0.227,0.0846	benign	86/754	76811270	11,12995	2203	4300	6503	77030294	SO:0001583	missense	5470			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.257G>A	4.37:g.76811270C>T	ENSP00000286719:p.Arg86His	Somatic		Capture	Illumina GAIIx	4	77030294	O14831	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_efhand;HMMPfam_Metallophos;HMMPfam_PPP5;superfamily_EF-hand;superfamily_Metallo-dependent phosphatases	p.R86H	ENST00000286719.7	37	c.257	CCDS34013.1	4	.	.	.	.	.	.	.	.	.	.	C	5.026	0.190443	0.09547	0.00227	1.16E-4	ENSG00000156194	ENST00000286719;ENST00000337500	T	0.54866	0.55	5.07	3.33	0.38152	.	1.404560	0.04188	N	0.327755	T	0.42404	0.1201	L	0.27053	0.805	0.35716	D	0.816798	B;B	0.17465	0.02;0.022	B;B	0.15052	0.009;0.012	T	0.12941	-1.0528	10	0.23302	T	0.38	-0.3045	9.4751	0.38867	0.0:0.8244:0.0:0.1756	.	86;86	O14830-2;O14830	.;PPE2_HUMAN	H	86	ENSP00000286719:R86H	ENSP00000286719:R86H	R	-	2	0	PPEF2	77030294	1.000000	0.71417	0.996000	0.52242	0.015000	0.08874	2.004000	0.40854	0.540000	0.28808	0.313000	0.20887	CGC	-	HMMPfam_PPP5		0.507	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF2	protein_coding	OTTHUMT00000362929.1	C	NM_006239		77030294	-1	no_errors	NM_006239	genbank	human	reviewed	54_36p	missense	SNP	1	T
FGF5	2250	genome.wustl.edu	37	4	81188190	81188190	+	Missense_Mutation	SNP	G	G	T	rs139356908		TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr4:81188190G>T	ENST00000312465.7	+	1	438	c.212G>T	c.(211-213)gGa>gTa	p.G71V	FGF5_ENST00000456523.3_Missense_Mutation_p.G71V	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5	71					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)	p.G71V(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						GGCAGCCAAGGAAGTGGCTTG	0.612																																																1	Substitution - Missense(1)	ovary(1)	4											62.0	67.0	65.0					4																	81188190		2203	4300	6503	81407214	SO:0001583	missense	2250			M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.212G>T	4.37:g.81188190G>T	ENSP00000311697:p.Gly71Val	Somatic		Capture	Illumina GAIIx	4	81407214	B2R554|O75846|Q3Y8M3|Q8NF90	Missense_Mutation	SNP	HMMPfam_FGF,superfamily_Cytokine	p.G71V	ENST00000312465.7	37	c.212	CCDS34021.1	4	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623746	0.46840	.	.	ENSG00000138675	ENST00000312465;ENST00000456523	T;T	0.08193	3.12;3.12	5.41	3.64	0.41730	.	2.681430	0.02070	N	0.051474	T	0.22859	0.0552	L	0.34521	1.04	0.58432	D	0.999996	D;P	0.55605	0.972;0.953	D;P	0.63488	0.915;0.537	T	0.00327	-1.1814	10	0.51188	T	0.08	.	14.097	0.65029	0.0:0.2867:0.7133:0.0	.	71;71	P12034-2;P12034	.;FGF5_HUMAN	V	71	ENSP00000311697:G71V;ENSP00000398353:G71V	ENSP00000311697:G71V	G	+	2	0	FGF5	81407214	1.000000	0.71417	0.042000	0.18584	0.744000	0.42396	2.822000	0.48073	0.804000	0.34136	0.561000	0.74099	GGA	-	NULL		0.612	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF5	protein_coding	OTTHUMT00000252627.2	G			81407214	1	no_errors	NM_004464	genbank	human	reviewed	54_36p	missense	SNP	0.673	T
MMRN1	22915	genome.wustl.edu	37	4	90857010	90857010	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr4:90857010G>A	ENST00000394980.1	+	7	2498	c.2179G>A	c.(2179-2181)Ggc>Agc	p.G727S	MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000264790.2_Missense_Mutation_p.G727S|MMRN1_ENST00000508372.1_Missense_Mutation_p.G469S			Q13201	MMRN1_HUMAN	multimerin 1	727					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)		p.G727S(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		AATGGAAGATGGCCTCAATAA	0.318																																																1	Substitution - Missense(1)	ovary(1)	4											70.0	72.0	71.0					4																	90857010		2203	4298	6501	91076033	SO:0001583	missense	22915			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.2179G>A	4.37:g.90857010G>A	ENSP00000378431:p.Gly727Ser	Somatic		Capture	Illumina GAIIx	4	91076033	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	-	p.G727S	ENST00000394980.1	37	c.2179	CCDS3635.1	4	.	.	.	.	.	.	.	.	.	.	G	20.2	3.941555	0.73557	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000508372	D;D;D	0.83335	-1.52;-1.52;-1.71	5.2	5.2	0.72013	.	0.071295	0.64402	D	0.000019	D	0.89560	0.6750	M	0.68952	2.095	0.80722	D	1	D	0.64830	0.994	D	0.63877	0.919	D	0.87526	0.2449	10	0.35671	T	0.21	.	19.6319	0.95708	0.0:0.0:1.0:0.0	.	727	Q13201	MMRN1_HUMAN	S	727;727;469	ENSP00000378431:G727S;ENSP00000264790:G727S;ENSP00000426461:G469S	ENSP00000264790:G727S	G	+	1	0	MMRN1	91076033	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.326000	0.72905	2.805000	0.96524	0.655000	0.94253	GGC	-	NULL		0.318	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN1	protein_coding	OTTHUMT00000253546.2	G	NM_007351		91076033	1	no_errors	NM_007351	genbank	human	reviewed	54_36p	missense	SNP	1	A
TRAPPC13	80006	genome.wustl.edu	37	5	64957893	64957893	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr5:64957893A>G	ENST00000399438.3	+	11	1259	c.914A>G	c.(913-915)gAt>gGt	p.D305G	TRAPPC13_ENST00000231526.4_Missense_Mutation_p.D299G|TRAPPC13_ENST00000545191.1_Missense_Mutation_p.D306G|TRAPPC13_ENST00000505553.1_Missense_Mutation_p.D299G|TRAPPC13_ENST00000438419.2_Missense_Mutation_p.D305G	NM_001093755.1|NM_024941.3	NP_001087224.1|NP_079217.2	A5PLN9	TPC13_HUMAN	trafficking protein particle complex 13	305								p.D305G(1)									GGTTATGGAGATGTTAGGTTG	0.378																																																1	Substitution - Missense(1)	ovary(1)	5											178.0	164.0	169.0					5																	64957893		1884	4104	5988	64993649	SO:0001583	missense	80006				CCDS47221.1, CCDS47222.1, CCDS47223.1, CCDS58950.1	5q12.3	2013-01-31	2013-01-24	2013-01-24	ENSG00000113597	ENSG00000113597			25828	protein-coding gene	gene with protein product	"""Trs65-related"""		"""chromosome 5 open reading frame 44"""	C5orf44		12477932	Standard	NM_024941		Approved	FLJ13611, FLJ26957, MGC48585	uc010iwu.1	A5PLN9	OTTHUMG00000163649	ENST00000399438.3:c.914A>G	5.37:g.64957893A>G	ENSP00000382367:p.Asp305Gly	Somatic		Capture	Illumina GAIIx	4	64993649	Q17RZ9|Q49A23|Q4JHG0|Q6MZG4|Q8TCM2|Q9H8I3	Missense_Mutation	SNP	-	p.D305G	ENST00000399438.3	37	c.914	CCDS47222.1	5	.	.	.	.	.	.	.	.	.	.	A	23.2	4.381975	0.82792	.	.	ENSG00000113597	ENST00000399438;ENST00000438419;ENST00000231526;ENST00000505553;ENST00000545191	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.79323	0.4426	M	0.76838	2.35	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;0.999	D;D;D;D	0.79784	0.993;0.982;0.993;0.984	T	0.82106	-0.0621	9	0.72032	D	0.01	-25.4577	15.5124	0.75793	1.0:0.0:0.0:0.0	.	299;299;305;305	A5PLN9-4;A5PLN9-2;A5PLN9-5;A5PLN9	.;.;.;CE044_HUMAN	G	305;305;299;299;306	.	ENSP00000231526:D299G	D	+	2	0	C5orf44	64993649	1.000000	0.71417	0.994000	0.49952	0.931000	0.56810	8.660000	0.91121	2.253000	0.74438	0.455000	0.32223	GAT	-	NULL		0.378	TRAPPC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C5orf44	protein_coding	OTTHUMT00000370113.1	A	NM_024941		64993649	1	no_errors	NM_001093755	genbank	human	validated	54_36p	missense	SNP	1	G
XAGE-4	139629	genome.wustl.edu	37	X	55681240	55681240	+	RNA	SNP	T	T	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chrX:55681240T>A	ENST00000513415.1	-	0	123																											CTGAGACAGCTCCTGGAGATC	0.403																																																0			X																																								55697965			0																															X.37:g.55681240T>A		Somatic		Capture	Illumina GAIIx	4	55697965		Missense_Mutation	SNP	-	p.E41V	ENST00000513415.1	37	c.122		X																																																																																			-	NULL		0.403	RP11-167P23.2-002	KNOWN	basic	processed_transcript	ENSG00000169164	pseudogene	OTTHUMT00000367028.1	T			55697965	-1	no_start_codon:no_stop_codon	ENST00000347911	ensembl	human	known	54_36p	missense	SNP		A
MTHFD1L	25902	genome.wustl.edu	37	6	151336686	151336686	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr6:151336686G>C	ENST00000367321.3	+	24	2717	c.2443G>C	c.(2443-2445)Gag>Cag	p.E815Q		NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	815	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)	p.E815Q(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		CTTGGTGTGTGAGCTTGCAAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	6											176.0	156.0	163.0					6																	151336686		2203	4300	6503	151378379	SO:0001583	missense	25902			BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.2443G>C	6.37:g.151336686G>C	ENSP00000356290:p.Glu815Gln	Somatic		Capture	Illumina GAIIx	4	151378379	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	HMMPfam_FTHFS;HMMPfam_THF_DHG_CYH;HMMPfam_THF_DHG_CYH_C;superfamily_NAD(P)-binding Rossmann-fold domains;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Aminoacid dehydrogenase-like N-terminal domain	p.E815Q	ENST00000367321.3	37	c.2443	CCDS5228.1	6	.	.	.	.	.	.	.	.	.	.	G	12.19	1.862791	0.32884	.	.	ENSG00000120254	ENST00000367321;ENST00000420192	T;T	0.24151	1.87;1.87	5.98	5.1	0.69264	.	0.275476	0.42420	D	0.000710	T	0.08492	0.0211	N	0.25286	0.73	0.80722	D	1	B;B;B	0.22800	0.075;0.002;0.036	B;B;B	0.23574	0.047;0.014;0.034	T	0.08269	-1.0730	10	0.33940	T	0.23	.	9.987	0.41847	0.2328:0.0:0.7672:0.0	.	816;570;815	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	Q	815;46	ENSP00000356290:E815Q;ENSP00000395158:E46Q	ENSP00000356290:E815Q	E	+	1	0	MTHFD1L	151378379	0.696000	0.27757	1.000000	0.80357	0.991000	0.79684	0.030000	0.13688	2.843000	0.97960	0.585000	0.79938	GAG	-	HMMPfam_FTHFS		0.507	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD1L	protein_coding	OTTHUMT00000042699.1	G	NM_015440		151378379	1	no_errors	NM_015440	genbank	human	validated	54_36p	missense	SNP	0.96	C
Unknown	0	genome.wustl.edu	37	2	62759869	62759869	+	IGR	SNP	C	C	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr2:62759869C>A								TMEM17 (26393 upstream) : AC092155.4 (57520 downstream)																							CATTTTCCTTCATGCGTTTCA	0.398																																																0			2																																								62613373	SO:0001628	intergenic_variant	100129141																															2.37:g.62759869C>A		Somatic		Capture	Illumina GAIIx	4	62613373		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.398					LOC100129141			C			62613373	-1	pseudogene	XR_039484	genbank	human	model	54_36p	rna	SNP	1	A
ZNF713	349075	genome.wustl.edu	37	7	55991392	55991392	+	Splice_Site	SNP	G	G	C	rs151202323		TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr7:55991392G>C	ENST00000429591.2	+	3	306	c.268G>C	c.(268-270)Gat>Cat	p.D90H	ZNF713_ENST00000482436.1_3'UTR|MRPS17_ENST00000426595.1_Splice_Site_p.G90R	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	90					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D90H(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TACTCATCCAGGTAAGTGCAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	7						G	HIS/ASP	0,4406		0,0,2203	80.0	67.0	71.0		268	3.8	1.0	7	dbSNP_134	71	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice	ZNF713	NM_182633.1	81	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	probably-damaging	90/431	55991392	1,13005	2203	4300	6503	55958886	SO:0001630	splice_region_variant	349075			AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.268+1G>C	7.37:g.55991392G>C		Somatic		Capture	Illumina GAIIx	4	55958886		Missense_Mutation	SNP	-	p.D90H	ENST00000429591.2	37	c.268	CCDS34639.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.99|13.99	2.401786|2.401786	0.42613|0.42613	0.0|0.0	1.16E-4|1.16E-4	ENSG00000178665|ENSG00000249773	ENST00000429591|ENST00000426595	T|T	0.08634|0.00995	3.07|5.46	3.76|3.76	3.76|3.76	0.43208|0.43208	.|.	0.000000|.	0.39615|.	N|.	0.001305|.	T|T	0.02929|0.02929	0.0087|0.0087	M|M	0.79011|0.79011	2.435|2.435	0.29969|0.29969	N|N	0.818685|0.818685	D|P	0.69078|0.51240	0.997|0.943	P|P	0.55011|0.49683	0.766|0.619	T|T	0.05007|0.05007	-1.0912|-1.0912	10|9	0.66056|0.72032	D|D	0.02|0.01	.|.	11.3734|11.3734	0.49713|0.49713	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	90|7	Q8N859|Q8IY71	ZN713_HUMAN|.	H|R	90|90	ENSP00000416662:D90H|ENSP00000390331:G90R	ENSP00000416662:D90H|ENSP00000390331:G90R	D|G	+|+	1|1	0|0	ZNF713|RP11-15K19.2	55958886|55958886	0.999000|0.999000	0.42202|0.42202	0.990000|0.990000	0.47175|0.47175	0.061000|0.061000	0.15899|0.15899	3.559000|3.559000	0.53756|0.53756	2.379000|2.379000	0.81126|0.81126	0.655000|0.655000	0.94253|0.94253	GAT|GGT	-	NULL		0.478	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF713	protein_coding	OTTHUMT00000343297.1	G	NM_182633	Missense_Mutation	55958886	1	no_errors	NM_182633	genbank	human	provisional	54_36p	missense	SNP	0.84	C
SEMA3C	10512	genome.wustl.edu	37	7	80432078	80432078	+	Silent	SNP	C	C	G			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr7:80432078C>G	ENST00000265361.3	-	9	1380	c.819G>C	c.(817-819)ctG>ctC	p.L273L	SEMA3C_ENST00000544525.1_Silent_p.L291L|SEMA3C_ENST00000419255.2_Silent_p.L273L|SEMA3C_ENST00000536800.1_Silent_p.L125L	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	273	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.L273L(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						CAAGGCTACGCAGTCCACCAG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	7											107.0	98.0	101.0					7																	80432078		2203	4300	6503	80270014	SO:0001819	synonymous_variant	10512			AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.819G>C	7.37:g.80432078C>G		Somatic		Capture	Illumina GAIIx	4	80270014	B4DRL8	Silent	SNP	HMMPfam_Sema;superfamily_Sema domain;superfamily_Plexin repeat;superfamily_Immunoglobulin	p.L273	ENST00000265361.3	37	c.819	CCDS5596.1	7																																																																																			-	HMMPfam_Sema		0.398	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3C	protein_coding	OTTHUMT00000253279.1	C	NM_006379		80270014	-1	no_errors	NM_006379	genbank	human	validated	54_36p	silent	SNP	1	G
GBA2	57704	genome.wustl.edu	37	9	35738807	35738807	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr9:35738807C>T	ENST00000378103.3	-	12	2412	c.1889G>A	c.(1888-1890)cGg>cAg	p.R630Q	GBA2_ENST00000378094.4_Missense_Mutation_p.R630Q|GBA2_ENST00000545786.1_Missense_Mutation_p.R636Q|GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000378088.1_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	630			R -> W (in SPG46). {ECO:0000269|PubMed:23332916}.		bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)	p.R630Q(1)		NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GTAATAGTCCCGATAAACCTG	0.498																																																1	Substitution - Missense(1)	ovary(1)	9											123.0	116.0	118.0					9																	35738807		2203	4300	6503	35728807	SO:0001583	missense	57704			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1889G>A	9.37:g.35738807C>T	ENSP00000367343:p.Arg630Gln	Somatic		Capture	Illumina GAIIx	4	35728807	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	HMMPfam_DUF608;superfamily_Six-hairpin glycosidases	p.R630Q	ENST00000378103.3	37	c.1889	CCDS6589.1	9	.	.	.	.	.	.	.	.	.	.	C	34	5.304230	0.95601	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	6.08	6.08	0.98989	Six-hairpin glycosidase-like (1);Glucosylceramidase (1);	0.098532	0.64402	D	0.000001	D	0.87160	0.6108	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.99;0.998	D	0.89231	0.3577	9	0.72032	D	0.01	-22.5191	18.844	0.92196	0.0:1.0:0.0:0.0	.	636;630;630	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	Q	630;630;636	.	ENSP00000367334:R630Q	R	-	2	0	GBA2	35728807	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.709000	0.84645	2.894000	0.99253	0.655000	0.94253	CGG	-	HMMPfam_DUF608		0.498	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GBA2	protein_coding	OTTHUMT00000055456.1	C	NM_020944		35728807	-1	no_errors	NM_020944	genbank	human	reviewed	54_36p	missense	SNP	1	T
SPATA31A3	727830	genome.wustl.edu	37	9	40705599	40705599	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chr9:40705599G>A	ENST00000356699.5	+	4	3285	c.3256G>A	c.(3256-3258)Gag>Aag	p.E1086K	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	1086					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.E1086K(1)									ACTGGTGCACGAGGAGCCCAG	0.537																																																1	Substitution - Missense(1)	ovary(1)	9											63.0	55.0	58.0					9																	40705599		1547	3060	4607	40695599	SO:0001583	missense	727830					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.3256G>A	9.37:g.40705599G>A	ENSP00000349132:p.Glu1086Lys	Somatic		Capture	Illumina GAIIx	4	40695599		Missense_Mutation	SNP	-	p.E1086K	ENST00000356699.5	37	c.3256	CCDS47969.1	9	.	.	.	.	.	.	.	.	.	.	G	3.050	-0.195654	0.06259	.	.	ENSG00000147926	ENST00000356699	T	0.03717	3.83	2.79	-0.251	0.13003	.	1.104000	0.07015	N	0.825774	T	0.01029	0.0034	N	0.00538	-1.39	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.47262	-0.9131	10	0.18710	T	0.47	.	1.3434	0.02159	0.2345:0.4166:0.2145:0.1344	.	1086	Q5VYP0	F75A3_HUMAN	K	1086	ENSP00000349132:E1086K	ENSP00000349132:E1086K	E	+	1	0	FAM75A3	40695599	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.029000	0.12329	-0.043000	0.13513	-2.445000	0.00210	GAG	-	NULL		0.537	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A3	protein_coding	OTTHUMT00000036919.1	G	NM_001083124		40695599	1	no_errors	NM_001083124	genbank	human	predicted	54_36p	missense	SNP	0	A
TBC1D8B	54885	genome.wustl.edu	37	X	106064217	106064217	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chrX:106064217A>G	ENST00000357242.5	+	3	526	c.352A>G	c.(352-354)Aaa>Gaa	p.K118E	TBC1D8B_ENST00000481617.2_Missense_Mutation_p.K118E|TBC1D8B_ENST00000276175.3_Missense_Mutation_p.K118E|TBC1D8B_ENST00000310452.2_Missense_Mutation_p.K118E	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	118							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.K118E(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TGTACAAGGAAAAATAAGAGT	0.338																																																1	Substitution - Missense(1)	ovary(1)	X											60.0	58.0	58.0					X																	106064217		2203	4297	6500	105950873	SO:0001583	missense	54885			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.352A>G	X.37:g.106064217A>G	ENSP00000349781:p.Lys118Glu	Somatic		Capture	Illumina GAIIx	4	105950873	B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	-	p.K118E	ENST00000357242.5	37	c.352	CCDS14522.1	X	.	.	.	.	.	.	.	.	.	.	A	14.64	2.594988	0.46318	.	.	ENSG00000133138	ENST00000357242;ENST00000310452;ENST00000481617;ENST00000276175;ENST00000460545	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.53045	0.1772	M	0.87269	2.87	0.80722	D	1	P;D;P	0.59357	0.685;0.985;0.89	B;P;B	0.62649	0.356;0.905;0.393	T	0.61936	-0.6960	10	0.87932	D	0	-16.6277	12.9925	0.58627	1.0:0.0:0.0:0.0	.	118;118;118	Q0IIM8;B9A6K6;D6RFZ2	TBC8B_HUMAN;.;.	E	118;118;118;118;20	ENSP00000349781:K118E;ENSP00000310675:K118E;ENSP00000421375:K118E;ENSP00000276175:K118E	ENSP00000276175:K118E	K	+	1	0	TBC1D8B	105950873	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.284000	0.95882	1.813000	0.52934	0.339000	0.21740	AAA	-	NULL		0.338	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D8B	protein_coding	OTTHUMT00000057807.2	A	NM_017752		105950873	1	no_errors	NM_017752	genbank	human	validated	54_36p	missense	SNP	1	G
LUZP4	51213	genome.wustl.edu	37	X	114524416	114524416	+	Splice_Site	SNP	G	G	T			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	G	T	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chrX:114524416G>T	ENST00000371920.3	+	1	98	c.91G>T	c.(91-93)Gac>Tac	p.D31Y	LUZP4_ENST00000451986.2_5'UTR	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	31						nucleus (GO:0005634)		p.D31Y(1)		endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						TATGTCTCTAGGTATGTAGAT	0.507																																																1	Substitution - Missense(1)	ovary(1)	X											69.0	55.0	59.0					X																	114524416		2203	4300	6503	114430672	SO:0001630	splice_region_variant	51213			AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.91+1G>T	X.37:g.114524416G>T		Somatic		Capture	Illumina GAIIx	Phase_III	114430672	B3KSD6	Missense_Mutation	SNP	-	p.D31Y	ENST00000371920.3	37	c.91	CCDS14567.1	X	.	.	.	.	.	.	.	.	.	.	g	17.29	3.351918	0.61183	.	.	ENSG00000102021	ENST00000371921;ENST00000371920	T;T	0.67171	-0.25;0.28	2.35	2.35	0.29111	.	.	.	.	.	T	0.66577	0.2803	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66484	-0.5912	9	0.59425	D	0.04	.	7.4674	0.27330	0.0:0.0:1.0:0.0	.	31	Q9P127	LUZP4_HUMAN	Y	31	ENSP00000360989:D31Y;ENSP00000360988:D31Y	ENSP00000360988:D31Y	D	+	1	0	LUZP4	114430672	1.000000	0.71417	0.986000	0.45419	0.536000	0.34869	2.914000	0.48797	1.456000	0.47831	0.509000	0.49947	GAC	-	NULL		0.507	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LUZP4	protein_coding	OTTHUMT00000057972.1	G	NM_016383	Missense_Mutation	114430672	1	no_errors	NM_016383	genbank	human	validated	54_36p	missense	SNP	0.97	T
GABRQ	55879	genome.wustl.edu	37	X	151821311	151821311	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0724-01A-01W-0372-09	TCGA-13-0724-10B-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	2b6aa1c8-5150-4d8f-af59-d5a826321308	071f2eff-e6f5-4aec-84dd-d54da1ce9001	g.chrX:151821311A>G	ENST00000370306.2	+	9	1486	c.1466A>G	c.(1465-1467)cAt>cGt	p.H489R		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	489					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)	p.H489R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTCGAAGCCCATGGCCATGGT	0.542																																																1	Substitution - Missense(1)	ovary(1)	X											113.0	97.0	102.0					X																	151821311		2203	4300	6503	151571967	SO:0001583	missense	55879			U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1466A>G	X.37:g.151821311A>G	ENSP00000359329:p.His489Arg	Somatic		Capture	Illumina GAIIx	4	151571967	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	HMMPfam_Neur_chan_memb;HMMPfam_Neur_chan_LBD;superfamily_Nicotinic receptor ligand binding domain-like;superfamily_Neurotransmitter-gated ion-channel transmembrane pore	p.H489R	ENST00000370306.2	37	c.1466	CCDS14707.1	X	.	.	.	.	.	.	.	.	.	.	A	9.429	1.084956	0.20390	.	.	ENSG00000147402	ENST00000370306	T	0.77750	-1.12	3.26	-1.09	0.09904	Neurotransmitter-gated ion-channel transmembrane domain (2);	3.532650	0.00541	N	0.000229	T	0.67757	0.2927	L	0.39898	1.24	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.47209	-0.9135	10	0.49607	T	0.09	.	2.3886	0.04372	0.4263:0.0:0.3417:0.2319	.	489	Q9UN88	GBRT_HUMAN	R	489	ENSP00000359329:H489R	ENSP00000359329:H489R	H	+	2	0	GABRQ	151571967	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	0.037000	0.13840	-0.311000	0.08754	0.486000	0.48141	CAT	-	HMMPfam_Neur_chan_memb		0.542	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRQ	protein_coding	OTTHUMT00000058763.2	A	NM_018558		151571967	1	no_errors	NM_018558	genbank	human	reviewed	54_36p	missense	SNP	0.01	G
