#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LOC100129138	100129138	genome.wustl.edu	37	1	104615627	104615627	+	lincRNA	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr1:104615627C>T	ENST00000418362.1	+	0	0					NR_033990.1																						CAGGCCTGGCCGGAGATGCCG	0.542																																																0			1																																								104417150			100129138																															1.37:g.104615627C>T		Somatic		Capture	Illumina GAIIx	4	104417150		RNA	SNP	-	NULL	ENST00000418362.1	37	NULL		1																																																																																			-	-		0.542	RP11-364B6.1-001	KNOWN	basic	lincRNA	LOC100129138	lincRNA	OTTHUMT00000030377.1	C			104417150	1	no_errors	XR_036957	genbank	human	model	54_36p	rna	SNP	0.917	T
KCNA3	3738	genome.wustl.edu	37	1	111216633	111216633	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr1:111216633C>T	ENST00000369769.2	-	1	1022	c.799G>A	c.(799-801)Gcc>Acc	p.A267T		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	267					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)	p.A267T(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	GACGTCGAGGCGGGGTAGTCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	1											42.0	45.0	44.0					1																	111216633		2203	4300	6503	111018156	SO:0001583	missense	3738			L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.799G>A	1.37:g.111216633C>T	ENSP00000358784:p.Ala267Thr	Somatic		Capture	Illumina GAIIx	4	111018156	Q5VWN2	Missense_Mutation	SNP	-	p.A267T	ENST00000369769.2	37	c.799	CCDS828.2	1	.	.	.	.	.	.	.	.	.	.	C	0.022	-1.407959	0.01155	.	.	ENSG00000177272	ENST00000369769	D	0.96802	-4.13	4.75	-1.36	0.09085	.	0.000000	0.31323	U	0.007857	T	0.73560	0.3602	N	0.03071	-0.42	0.09310	N	1	B	0.18310	0.027	B	0.09377	0.004	T	0.73503	-0.3962	10	0.18276	T	0.48	.	8.1487	0.31128	0.3976:0.343:0.2594:0.0	.	267	P22001	KCNA3_HUMAN	T	267	ENSP00000358784:A267T	ENSP00000358784:A267T	A	-	1	0	KCNA3	111018156	0.002000	0.14202	0.041000	0.18516	0.397000	0.30659	-0.058000	0.11750	-0.214000	0.10078	-0.268000	0.10319	GCC	-	NULL		0.637	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA3	protein_coding	OTTHUMT00000083391.1	C	NM_002232		111018156	-1	no_errors	NM_002232	genbank	human	reviewed	54_36p	missense	SNP	0.054	T
SV2A	9900	genome.wustl.edu	37	1	149882378	149882378	+	Splice_Site	SNP	C	C	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr1:149882378C>A	ENST00000369146.3	-	4	1445	c.955G>T	c.(955-957)Ggg>Tgg	p.G319W	SV2A_ENST00000369145.1_Splice_Site_p.G319W	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	319					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.G319W(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	GGCTGCTCACCATAGTGGGGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											47.0	49.0	48.0					1																	149882378		2203	4300	6503	148149002	SO:0001630	splice_region_variant	9900			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.955+1G>T	1.37:g.149882378C>A		Somatic		Capture	Illumina GAIIx	4	148149002	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	-	p.G319W	ENST00000369146.3	37	c.955	CCDS940.1	1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150674	0.78001	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.71934	-0.61;-0.61	4.99	4.99	0.66335	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.86859	0.6034	H	0.94385	3.53	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90058	0.4154	9	.	.	.	-23.1236	15.8174	0.78615	0.0:1.0:0.0:0.0	.	319	Q7L0J3	SV2A_HUMAN	W	319	ENSP00000358142:G319W;ENSP00000358141:G319W	.	G	-	1	0	SV2A	148149002	1.000000	0.71417	0.971000	0.41717	0.778000	0.44026	7.651000	0.83577	2.591000	0.87537	0.585000	0.79938	GGG	-	NULL		0.592	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2A	protein_coding	OTTHUMT00000033754.1	C		Missense_Mutation	148149002	-1	no_errors	NM_014849	genbank	human	validated	54_36p	missense	SNP	1	A
CLCNKA	1187	genome.wustl.edu	37	1	16351308	16351308	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr1:16351308C>T	ENST00000331433.4	+	4	299	c.280C>T	c.(280-282)Ctt>Ttt	p.L94F	CLCNKA_ENST00000420078.1_Missense_Mutation_p.L94F|CLCNKA_ENST00000464764.1_Intron|CLCNKA_ENST00000375692.1_Missense_Mutation_p.L94F|CLCNKA_ENST00000439316.2_Intron			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	94					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)	p.L94F(1)		breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	GCTCCGGTATCTTTCCTGGAC	0.627																																																1	Substitution - Missense(1)	ovary(1)	1											139.0	105.0	116.0					1																	16351308		2203	4300	6503	16223895	SO:0001583	missense	1187				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.280C>T	1.37:g.16351308C>T	ENSP00000332771:p.Leu94Phe	Somatic		Capture	Illumina GAIIx	4	16223895	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Missense_Mutation	SNP	-	p.L94F	ENST00000331433.4	37	c.280	CCDS167.1	1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.811738	0.32053	.	.	ENSG00000186510	ENST00000375692;ENST00000420078;ENST00000331433	D;D;D	0.93763	-3.28;-3.28;-3.28	4.0	3.07	0.35406	Chloride channel, core (2);	0.201923	0.43747	D	0.000538	D	0.91081	0.7193	M	0.68593	2.085	0.80722	D	1	B;B	0.15719	0.014;0.014	B;B	0.17433	0.018;0.018	D	0.88025	0.2771	10	0.52906	T	0.07	.	10.4825	0.44702	0.1942:0.8058:0.0:0.0	.	94;94	Q5T5Q4;P51800	.;CLCKA_HUMAN	F	94	ENSP00000364844:L94F;ENSP00000410353:L94F;ENSP00000332771:L94F	ENSP00000332771:L94F	L	+	1	0	CLCNKA	16223895	0.945000	0.32115	0.992000	0.48379	0.948000	0.59901	1.472000	0.35376	1.001000	0.39076	0.462000	0.41574	CTT	-	NULL		0.627	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	protein_coding	OTTHUMT00000026326.1	C			16223895	1	no_errors	NM_004070	genbank	human	reviewed	54_36p	missense	SNP	1	T
MEF2D	4209	genome.wustl.edu	37	1	156452248	156452248	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr1:156452248G>C	ENST00000348159.4	-	3	719	c.239C>G	c.(238-240)aCc>aGc	p.T80S	MEF2D_ENST00000464356.2_Missense_Mutation_p.T80S|MEF2D_ENST00000353795.3_Missense_Mutation_p.T80S|MEF2D_ENST00000368240.2_Missense_Mutation_p.T80S|Y_RNA_ENST00000383924.1_RNA|MEF2D_ENST00000360595.3_Missense_Mutation_p.T80S|MEF2D_ENST00000340875.5_Missense_Mutation_p.T80S	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	80					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T80S(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTCGGCGTTGGTGCGGCTCTC	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											357.0	287.0	311.0					1																	156452248		2203	4300	6503	154718872	SO:0001583	missense	4209			BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.239C>G	1.37:g.156452248G>C	ENSP00000271555:p.Thr80Ser	Somatic		Capture	Illumina GAIIx	4	154718872	D3DVC0|Q14815|Q5T9U5|Q5T9U6	Missense_Mutation	SNP	-	p.T80S	ENST00000348159.4	37	c.239	CCDS1143.1	1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.825415	0.90955	.	.	ENSG00000116604	ENST00000348159;ENST00000340875;ENST00000368240;ENST00000353795;ENST00000360595;ENST00000541336;ENST00000454816	D;D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57	5.05	5.05	0.67936	Transcription factor, MADS-box (1);	0.000000	0.85682	D	0.000000	D	0.88883	0.6558	M	0.74258	2.255	0.80722	D	1	D;D;P	0.69078	0.997;0.993;0.839	D;P;P	0.67382	0.951;0.898;0.826	D	0.90316	0.4341	10	0.87932	D	0	-24.9863	16.9801	0.86325	0.0:0.0:1.0:0.0	.	85;80;80	Q4LE66;Q14814;Q14814-4	.;MEF2D_HUMAN;.	S	80	ENSP00000271555:T80S;ENSP00000343159:T80S;ENSP00000357223:T80S;ENSP00000344705:T80S;ENSP00000353803:T80S;ENSP00000388505:T80S	ENSP00000343159:T80S	T	-	2	0	MEF2D	154718872	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.824000	0.99380	2.359000	0.80004	0.561000	0.74099	ACC	-	NULL		0.572	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MEF2D	protein_coding	OTTHUMT00000080562.2	G	NM_005920		154718872	-1	no_errors	NM_005920	genbank	human	provisional	54_36p	missense	SNP	1	C
TLR5	7100	genome.wustl.edu	37	1	223286050	223286050	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr1:223286050G>T	ENST00000540964.1	-	4	785	c.324C>A	c.(322-324)taC>taA	p.Y108*	TLR5_ENST00000342210.6_Nonsense_Mutation_p.Y108*			O60602	TLR5_HUMAN	toll-like receptor 5	108					cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)	p.Y108*(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		GATGCAAGAAGTATATCTTAC	0.443																																																1	Substitution - Nonsense(1)	ovary(1)	1											91.0	90.0	90.0					1																	223286050		2203	4300	6503	221352673	SO:0001587	stop_gained	7100				CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.324C>A	1.37:g.223286050G>T	ENSP00000440643:p.Tyr108*	Somatic		Capture	Illumina GAIIx	4	221352673	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Nonsense_Mutation	SNP	-	p.Y108*	ENST00000540964.1	37	c.324	CCDS31033.1	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136326	0.77662	.	.	ENSG00000187554	ENST00000540964;ENST00000366881;ENST00000342210	.	.	.	5.03	-0.94	0.10405	.	1.363710	0.04854	N	0.442837	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.1674	0.06540	0.173:0.3389:0.3673:0.1208	.	.	.	.	X	108	.	ENSP00000340089:Y108X	Y	-	3	2	TLR5	221352673	0.000000	0.05858	0.019000	0.16419	0.515000	0.34225	-0.216000	0.09266	-0.042000	0.13535	0.655000	0.94253	TAC	-	NULL		0.443	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR5	protein_coding		G	NM_003268		221352673	-1	no_errors	NM_003268	genbank	human	validated	54_36p	nonsense	SNP	0.01	T
ZNF683	257101	genome.wustl.edu	37	1	26694252	26694252	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr1:26694252C>G	ENST00000436292.1	-	3	271	c.151G>C	c.(151-153)Gat>Cat	p.D51H	ZNF683_ENST00000403843.1_Missense_Mutation_p.D51H|ZNF683_ENST00000374204.1_Missense_Mutation_p.D51H|ZNF683_ENST00000349618.3_Missense_Mutation_p.D51H			Q8IZ20	ZN683_HUMAN	zinc finger protein 683	51					natural killer cell differentiation (GO:0001779)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D36H(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	15		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)		CCATGAGCATCCACCATGTCT	0.642																																																1	Substitution - Missense(1)	ovary(1)	1											26.0	23.0	24.0					1																	26694252		2203	4299	6502	26566839	SO:0001583	missense	257101			BC029505	CCDS279.2	1p36.11	2013-01-08			ENSG00000176083	ENSG00000176083		"""Zinc fingers, C2H2-type"""	28495	protein-coding gene	gene with protein product	"""hypothetical protein MGC33414"""					12477932	Standard	NM_173574		Approved	MGC33414	uc009vsj.1	Q8IZ20	OTTHUMG00000003521	ENST00000436292.1:c.151G>C	1.37:g.26694252C>G	ENSP00000388792:p.Asp51His	Somatic		Capture	Illumina GAIIx	Phase_III	26566839	Q5T141|Q5T146|Q5T147|Q5T149|Q8NEN4	Missense_Mutation	SNP	-	p.D51H	ENST00000436292.1	37	c.151		1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.011438	0.54468	.	.	ENSG00000176083	ENST00000403843;ENST00000436292;ENST00000374204;ENST00000349618;ENST00000455900;ENST00000451801;ENST00000423508;ENST00000416125	T;T;T;T;T;T;T;T	0.39997	2.37;2.37;2.29;2.29;1.44;1.45;1.05;1.07	4.27	2.21	0.28008	.	0.533034	0.15766	N	0.245709	T	0.38241	0.1033	L	0.32530	0.975	0.09310	N	1	D;D	0.57899	0.981;0.968	P;P	0.52109	0.69;0.493	T	0.13926	-1.0491	10	0.54805	T	0.06	-2.3527	6.0447	0.19753	0.0:0.7325:0.0:0.2675	.	51;51	Q8IZ20-2;Q8IZ20	.;ZN683_HUMAN	H	51;51;51;51;59;51;59;51	ENSP00000384782:D51H;ENSP00000388792:D51H;ENSP00000363320:D51H;ENSP00000344095:D51H;ENSP00000411289:D59H;ENSP00000411290:D51H;ENSP00000391584:D59H;ENSP00000401961:D51H	ENSP00000344095:D51H	D	-	1	0	ZNF683	26566839	0.214000	0.23563	0.026000	0.17262	0.568000	0.35870	1.445000	0.35079	0.386000	0.24997	-0.355000	0.07637	GAT	-	NULL		0.642	ZNF683-202	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF683	protein_coding	OTTHUMT00000009794.2	C	NM_173574		26566839	-1	no_errors	NM_173574	genbank	human	validated	54_36p	missense	SNP	0.014	G
MTF1	4520	genome.wustl.edu	37	1	38304313	38304313	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr1:38304313C>T	ENST00000373036.4	-	4	903	c.763G>A	c.(763-765)Ggg>Agg	p.G255R		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	255					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.G255R(1)		endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GGCTTTTCCCCTGTATGAGTT	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											155.0	131.0	139.0					1																	38304313		2203	4300	6503	38076900	SO:0001583	missense	4520			BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.763G>A	1.37:g.38304313C>T	ENSP00000362127:p.Gly255Arg	Somatic		Capture	Illumina GAIIx	4	38076900	B2RAK6|Q96CB1	Missense_Mutation	SNP	-	p.G255R	ENST00000373036.4	37	c.763	CCDS30676.1	1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.190728	0.58017	.	.	ENSG00000188786	ENST00000373036;ENST00000543396	T	0.26223	1.75	5.22	5.22	0.72569	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.053192	0.85682	D	0.000000	T	0.28532	0.0706	M	0.65320	2	0.58432	D	0.999997	B	0.22909	0.077	B	0.23419	0.046	T	0.05068	-1.0908	10	0.51188	T	0.08	.	12.4979	0.55940	0.0:0.9231:0.0:0.0768	.	255	Q14872	MTF1_HUMAN	R	255;123	ENSP00000362127:G255R	ENSP00000362127:G255R	G	-	1	0	MTF1	38076900	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.924000	0.70054	2.590000	0.87494	0.563000	0.77884	GGG	-	NULL		0.428	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTF1	protein_coding	OTTHUMT00000012984.2	C	NM_005955		38076900	-1	no_errors	NM_005955	genbank	human	reviewed	54_36p	missense	SNP	1	T
CYP4Z2P	163720	genome.wustl.edu	37	1	47325403	47325403	+	RNA	SNP	A	A	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr1:47325403A>C	ENST00000505841.1	-	0	1126					NR_002788.2		Q8N1L4	CP4Z2_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 2, pseudogene							integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)										CGGTGCGTAGAGGCGGAGGCA	0.483																																																0			1																																								47097990			163720			AY262057		1p33	2013-07-25	2013-05-03		ENSG00000154198	ENSG00000154198		"""Cytochrome P450s"""	24426	pseudogene	pseudogene						15059886	Standard	NR_002788		Approved	FLJ40054	uc031pmm.1	Q8N1L4	OTTHUMG00000008024		1.37:g.47325403A>C		Somatic		Capture	Illumina GAIIx	4	47097990	Q66ZJ5	RNA	SNP	-	NULL	ENST00000505841.1	37	NULL		1																																																																																			-	-		0.483	CYP4Z2P-002	KNOWN	basic	processed_transcript	CYP4Z2P	pseudogene	OTTHUMT00000361094.1	A	NR_002788		47097990	-1	pseudogene	NR_002788	genbank	human	provisional	54_36p	rna	SNP	0.99	C
CHRM3	1131	genome.wustl.edu	37	1	240072078	240072078	+	Missense_Mutation	SNP	G	G	A	rs144239896		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr1:240072078G>A	ENST00000255380.4	+	5	2106	c.1327G>A	c.(1327-1329)Gtc>Atc	p.V443I		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	443					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)	p.V443I(2)		breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	GACTTCTGACGTCAACTCCTC	0.537																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	1						G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	58.0	59.0	59.0		1327	2.9	0.0	1	dbSNP_134	59	1,8599	1.2+/-3.3	0,1,4299	no	missense	CHRM3	NM_000740.2	29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	443/591	240072078	2,13004	2203	4300	6503	238138701	SO:0001583	missense	1131			U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1327G>A	1.37:g.240072078G>A	ENSP00000255380:p.Val443Ile	Somatic		Capture	Illumina GAIIx	4	238138701	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	-	p.V443I	ENST00000255380.4	37	c.1327	CCDS1616.1	1	.	.	.	.	.	.	.	.	.	.	G	2.339	-0.351632	0.05173	2.27E-4	1.16E-4	ENSG00000133019	ENST00000255380	T	0.59083	0.29	5.85	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	1.076650	0.07231	N	0.862460	T	0.47116	0.1428	L	0.29908	0.895	0.09310	N	1	B	0.19073	0.033	B	0.26202	0.067	T	0.40627	-0.9553	10	0.40728	T	0.16	-1.2999	7.2987	0.26408	0.1496:0.1385:0.7119:0.0	.	443	P20309	ACM3_HUMAN	I	443	ENSP00000255380:V443I	ENSP00000255380:V443I	V	+	1	0	CHRM3	238138701	0.782000	0.28689	0.010000	0.14722	0.233000	0.25261	4.579000	0.60936	0.353000	0.24079	-0.150000	0.13652	GTC	-	NULL		0.537	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM3	protein_coding	OTTHUMT00000095644.2	G	NM_000740		238138701	1	no_errors	NM_000740	genbank	human	reviewed	54_36p	missense	SNP	0.02	A
PKD2L1	9033	genome.wustl.edu	37	10	102056751	102056751	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr10:102056751G>T	ENST00000318222.3	-	6	1553	c.1171C>A	c.(1171-1173)Ctg>Atg	p.L391M	PKD2L1_ENST00000353274.3_Missense_Mutation_p.L391M|PKD2L1_ENST00000338519.3_Missense_Mutation_p.L316M	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	391					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)	p.L391M(1)		NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		ATGACCACCAGGTCCAGTATG	0.522																																																1	Substitution - Missense(1)	ovary(1)	10											103.0	91.0	95.0					10																	102056751		2203	4300	6503	102046741	SO:0001583	missense	9033			AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.1171C>A	10.37:g.102056751G>T	ENSP00000325296:p.Leu391Met	Somatic		Capture	Illumina GAIIx	4	102046741	O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	HMMPfam_PKD_channel;superfamily_EF-hand;superfamily_Voltage-gated potassium channels	p.L391M	ENST00000318222.3	37	c.1171	CCDS7492.1	10	.	.	.	.	.	.	.	.	.	.	G	9.197	1.027544	0.19512	.	.	ENSG00000107593	ENST00000338519;ENST00000353274;ENST00000318222;ENST00000339977	D;D;D	0.98028	-4.67;-4.67;-4.67	4.95	-0.414	0.12359	Polycystin cation channel, PKD1/PKD2 (1);	0.126603	0.53938	D	0.000052	D	0.92397	0.7587	L	0.35854	1.095	0.33422	D	0.57994	P;B	0.40000	0.698;0.218	B;B	0.36766	0.232;0.196	D	0.88151	0.2851	10	0.52906	T	0.07	-10.7673	1.5337	0.02541	0.2204:0.1687:0.4149:0.196	.	344;391	Q1L4F0;Q9P0L9	.;PK2L1_HUMAN	M	316;391;391;389	ENSP00000345068:L316M;ENSP00000266049:L391M;ENSP00000325296:L391M	ENSP00000325296:L391M	L	-	1	2	PKD2L1	102046741	0.972000	0.33761	0.988000	0.46212	0.918000	0.54935	0.405000	0.21015	-0.091000	0.12440	-2.326000	0.00250	CTG	-	HMMPfam_PKD_channel		0.522	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2L1	protein_coding	OTTHUMT00000049863.2	G	NM_016112		102046741	-1	no_errors	NM_016112	genbank	human	reviewed	54_36p	missense	SNP	1	T
ANO4	121601	genome.wustl.edu	37	12	101490421	101490421	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr12:101490421G>A	ENST00000392977.3	+	19	2056	c.1846G>A	c.(1846-1848)Gga>Aga	p.G616R	ANO4_ENST00000550015.1_Missense_Mutation_p.G136R|ANO4_ENST00000392979.3_Missense_Mutation_p.G581R|ANO4_ENST00000299222.9_Missense_Mutation_p.G136R			Q32M45	ANO4_HUMAN	anoctamin 4	616					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.G581R(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						ATTCTTCCTCGGAAGGTAAGA	0.498										HNSCC(74;0.22)																																						1	Substitution - Missense(1)	ovary(1)	12											94.0	85.0	88.0					12																	101490421		2203	4300	6503	100014552	SO:0001583	missense	121601			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1846G>A	12.37:g.101490421G>A	ENSP00000376703:p.Gly616Arg	Somatic		Capture	Illumina GAIIx	4	100014552	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	-	p.G581R	ENST00000392977.3	37	c.1741		12	.	.	.	.	.	.	.	.	.	.	G	33	5.199760	0.94997	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000001	T	0.79782	0.4505	M	0.70903	2.155	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.999	D;D;D	0.76575	0.941;0.988;0.98	T	0.80714	-0.1259	10	0.87932	D	0	.	19.6088	0.95594	0.0:0.0:1.0:0.0	.	136;616;581	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	R	581;136;616;136	ENSP00000376705:G581R;ENSP00000299222:G136R;ENSP00000376703:G616R;ENSP00000450192:G136R	ENSP00000299222:G136R	G	+	1	0	ANO4	100014552	1.000000	0.71417	0.991000	0.47740	0.933000	0.57130	9.837000	0.99465	2.734000	0.93682	0.563000	0.77884	GGA	-	NULL		0.498	ANO4-002	KNOWN	basic	protein_coding	ANO4	protein_coding	OTTHUMT00000409295.1	G	NM_178826		100014552	1	no_errors	NM_178826	genbank	human	validated	54_36p	missense	SNP	1	A
ANAPC5	51433	genome.wustl.edu	37	12	121758249	121758250	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	GC	GC	GC	AT	GC	GC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr12:121758249_121758250GC>AT	ENST00000261819.3	-	12	1574_1575	c.1453_1454GC>AT	c.(1453-1455)GCa>ATa	p.A485I	ANAPC5_ENST00000344395.4_Missense_Mutation_p.A373I|ANAPC5_ENST00000441917.2_Missense_Mutation_p.A373I|ANAPC5_ENST00000541887.1_Missense_Mutation_p.A472I|ANAPC5_ENST00000535482.1_Missense_Mutation_p.A151I|ANAPC5_ENST00000544314.1_5'UTR	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	485					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTCAGAAGCTGCAGCAAAACAG	0.436																																																0			12																																								120242633	SO:0001583	missense	51433			AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.1453_1454delinsAT	12.37:g.121758249_121758250delinsAT	ENSP00000261819:p.Ala485Ile	Somatic		Capture	Illumina GAIIx	4	120242632	E9PFB2|Q8N4H7|Q9BQD4	Missense_Mutation	DNP	superfamily_TPR-like	p.A485I	ENST00000261819.3	37	c.1454_1453	CCDS9220.1	12																																																																																			-	NULL		0.436	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC5	protein_coding	OTTHUMT00000402582.1	GC			120242633	-1	no_errors	NM_016237	genbank	human	reviewed	54_36p	missense	DNP	1.000:0.998	AT
PITPNM2	57605	genome.wustl.edu	37	12	123471965	123471965	+	Silent	SNP	C	C	T	rs151113446		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr12:123471965C>T	ENST00000542749.1	-	21	3339	c.3276G>A	c.(3274-3276)acG>acA	p.T1092T	PITPNM2_ENST00000320201.4_Silent_p.T1092T|PITPNM2_ENST00000392428.1_Silent_p.T813T|PITPNM2_ENST00000280562.5_Silent_p.T1086T			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	1092					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)	p.T1092T(2)		NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TGTCGGCAAACGTGTGGTCTC	0.622																																																2	Substitution - coding silent(2)	ovary(1)|endometrium(1)	12						C		1,4405	2.1+/-5.4	0,1,2202	95.0	85.0	88.0		3276	-6.0	0.9	12	dbSNP_134	88	0,8600		0,0,4300	no	coding-synonymous	PITPNM2	NM_020845.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		1092/1350	123471965	1,13005	2203	4300	6503	122037918	SO:0001819	synonymous_variant	57605			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.3276G>A	12.37:g.123471965C>T		Somatic		Capture	Illumina GAIIx	4	122037918	Q9P271	Silent	SNP	HMMPfam_IP_trans;HMMPfam_DDHD;HMMPfam_LNS2;superfamily_Bet v1-like;superfamily_HAD-like	p.T1092	ENST00000542749.1	37	c.3276	CCDS9242.1	12																																																																																			-	NULL		0.622	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PITPNM2	protein_coding	OTTHUMT00000401342.1	C	NM_020845		122037918	-1	no_errors	NM_020845	genbank	human	validated	54_36p	silent	SNP	0.01	T
OVCH1	341350	genome.wustl.edu	37	12	29648367	29648367	+	Missense_Mutation	SNP	A	A	G	rs111993736	byFrequency	TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr12:29648367A>G	ENST00000318184.5	-	4	304	c.305T>C	c.(304-306)gTg>gCg	p.V102A		NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	102	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.V102A(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					CCCAGAAGTCACAGTTATATT	0.363													A|||	24	0.00479233	0.0174	0.0014	5008	,	,		17837	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	12						A	ALA/VAL	47,3599		0,47,1776	77.0	71.0	73.0		305	2.9	0.5	12	dbSNP_132	73	0,8170		0,0,4085	yes	missense	OVCH1	NM_183378.2	64	0,47,5861	GG,GA,AA		0.0,1.2891,0.3978	possibly-damaging	102/1135	29648367	47,11769	1823	4085	5908	29539634	SO:0001583	missense	341350			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.305T>C	12.37:g.29648367A>G	ENSP00000326708:p.Val102Ala	Somatic		Capture	Illumina GAIIx	4	29539634		Missense_Mutation	SNP	HMMPfam_CUB;superfamily_Spermadhesin CUB domain;HMMPfam_Trypsin;superfamily_Trypsin-like serine proteases	p.V102A	ENST00000318184.5	37	c.305		12	9	0.004120879120879121	9	0.018292682926829267	0	0.0	0	0.0	0	0.0	A	9.768	1.172009	0.21704	0.012891	0.0	ENSG00000187950	ENST00000318184	D	0.96136	-3.92	2.89	2.89	0.33648	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.84938	0.5583	L	0.41124	1.26	0.09310	N	1	P	0.40731	0.728	B	0.41619	0.361	T	0.79487	-0.1783	9	0.20519	T	0.43	.	4.74	0.13008	0.8579:0.0:0.1421:0.0	.	102	Q7RTY7	OVCH1_HUMAN	A	102	ENSP00000326708:V102A	ENSP00000326708:V102A	V	-	2	0	OVCH1	29539634	0.972000	0.33761	0.481000	0.27354	0.053000	0.15095	3.778000	0.55371	1.569000	0.49696	0.533000	0.62120	GTG	-	HMMPfam_Trypsin		0.363	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	protein_coding	OTTHUMT00000395997.2	A	NM_183378		29539634	-1	no_errors	NM_183378	genbank	human	validated	54_36p	missense	SNP	0.58	G
CEP290	80184	genome.wustl.edu	37	12	88477655	88477655	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr12:88477655C>A	ENST00000552810.1	-	36	5124	c.4781G>T	c.(4780-4782)aGt>aTt	p.S1594I	CEP290_ENST00000547691.2_Missense_Mutation_p.S654I|CEP290_ENST00000397838.3_Missense_Mutation_p.S654I|CEP290_ENST00000309041.7_Missense_Mutation_p.S1596I	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1594					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.S1596I(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						ATTTAGTGAACTATCAGCCTG	0.323																																																1	Substitution - Missense(1)	ovary(1)	12											128.0	116.0	120.0					12																	88477655		1802	4073	5875	87001786	SO:0001583	missense	80184			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.4781G>T	12.37:g.88477655C>A	ENSP00000448012:p.Ser1594Ile	Somatic		Capture	Illumina GAIIx	4	87001786	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	superfamily_Spectrin repeat;superfamily_Translin	p.S1594I	ENST00000552810.1	37	c.4781	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	C	14.33	2.502635	0.44455	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	D;D;D;D	0.91945	-2.94;-2.94;-2.94;-2.94	5.43	1.52	0.23074	.	0.308243	0.41194	D	0.000928	D	0.82462	0.5042	N	0.22421	0.69	0.24669	N	0.993428	B	0.28605	0.217	B	0.28991	0.097	T	0.71009	-0.4716	10	0.37606	T	0.19	.	4.5313	0.12006	0.0:0.3893:0.1618:0.4489	.	1594	O15078	CE290_HUMAN	I	654;1594;1596;654	ENSP00000446905:S654I;ENSP00000448012:S1594I;ENSP00000308021:S1596I;ENSP00000380938:S654I	ENSP00000308021:S1596I	S	-	2	0	CEP290	87001786	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	0.206000	0.17375	0.350000	0.24002	0.650000	0.86243	AGT	-	NULL		0.323	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	protein_coding	OTTHUMT00000406344.1	C	NM_025114		87001786	-1	no_errors	NM_025114	genbank	human	reviewed	54_36p	missense	SNP	1	A
TMEM132D	121256	genome.wustl.edu	37	12	130184667	130184667	+	Missense_Mutation	SNP	G	G	A	rs146143180		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr12:130184667G>A	ENST00000422113.2	-	2	982	c.656C>T	c.(655-657)cCg>cTg	p.P219L	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	219					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.P219L(2)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GGTCCCCTCCGGCTGGTCCAC	0.682																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	12						G	LEU/PRO	0,4406		0,0,2203	38.0	40.0	39.0		656	2.5	0.0	12	dbSNP_134	39	3,8597	3.0+/-9.4	0,3,4297	no	missense	TMEM132D	NM_133448.2	98	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	219/1100	130184667	3,13003	2203	4300	6503	128750620	SO:0001583	missense	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.656C>T	12.37:g.130184667G>A	ENSP00000408581:p.Pro219Leu	Somatic		Capture	Illumina GAIIx	Phase_III	128750620	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	-	p.P219L	ENST00000422113.2	37	c.656	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	G	1.196	-0.633920	0.03584	0.0	3.49E-4	ENSG00000151952	ENST00000422113	T	0.10860	2.83	5.35	2.46	0.29980	.	0.521615	0.18832	N	0.129936	T	0.08714	0.0216	L	0.40543	1.245	0.09310	N	0.999999	B	0.12630	0.006	B	0.06405	0.002	T	0.34576	-0.9823	9	.	.	.	-7.5313	9.0373	0.36296	0.069:0.0:0.6664:0.2646	.	219	Q14C87	T132D_HUMAN	L	219	ENSP00000408581:P219L	.	P	-	2	0	TMEM132D	128750620	0.002000	0.14202	0.000000	0.03702	0.022000	0.10575	1.224000	0.32539	0.212000	0.20703	-0.175000	0.13238	CCG	-	NULL		0.682	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	protein_coding	OTTHUMT00000399592.1	G	NM_133448		128750620	-1	no_errors	NM_133448	genbank	human	validated	54_36p	missense	SNP	0.001	A
COL4A2	1284	genome.wustl.edu	37	13	111082244	111082244	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr13:111082244C>T	ENST00000360467.5	+	8	796	c.490C>T	c.(490-492)Cca>Tca	p.P164S		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	164					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)	p.P164S(1)		NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GCCCCAAGGACCAAAAGGGCA	0.458																																																1	Substitution - Missense(1)	ovary(1)	13											68.0	68.0	68.0					13																	111082244		1869	4093	5962	109880245	SO:0001583	missense	1284			AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.490C>T	13.37:g.111082244C>T	ENSP00000353654:p.Pro164Ser	Somatic		Capture	Illumina GAIIx	4	109880245	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	HMMPfam_C4;HMMPfam_Collagen;superfamily_C-type lectin-like	p.P164S	ENST00000360467.5	37	c.490	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	C	11.30	1.597092	0.28445	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.96587	-4.06	5.33	5.33	0.75918	.	0.000000	0.56097	D	0.000038	D	0.96405	0.8827	L	0.41632	1.29	0.39551	D	0.968977	D	0.89917	1.0	D	0.75484	0.986	D	0.94277	0.7516	10	0.08381	T	0.77	.	17.1996	0.86902	0.0:1.0:0.0:0.0	.	164	P08572	CO4A2_HUMAN	S	164	ENSP00000353654:P164S	ENSP00000257309:P164S	P	+	1	0	COL4A2	109880245	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.947000	0.63583	2.479000	0.83701	0.555000	0.69702	CCA	-	HMMPfam_Collagen		0.458	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	protein_coding	OTTHUMT00000045761.2	C	NM_001846		109880245	1	no_errors	NM_001846	genbank	human	reviewed	54_36p	missense	SNP	1	T
OCA2	4948	genome.wustl.edu	37	15	28000554	28000554	+	Missense_Mutation	SNP	C	C	A	rs200396611	byFrequency	TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr15:28000554C>A	ENST00000354638.3	-	24	2652	c.2497G>T	c.(2497-2499)Gtg>Ttg	p.V833L	OCA2_ENST00000353809.5_Missense_Mutation_p.V809L	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	833			Missing (in OCA2). {ECO:0000269|PubMed:10987646}.		cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.V833L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		CCCACCACCACATGAGCCACA	0.438									Oculocutaneous Albinism																																							1	Substitution - Missense(1)	ovary(1)	15											167.0	142.0	150.0					15																	28000554		2203	4300	6503	25674149	SO:0001583	missense	4948	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.2497G>T	15.37:g.28000554C>A	ENSP00000346659:p.Val833Leu	Somatic		Capture	Illumina GAIIx	4	25674149	Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	HMMPfam_CitMHS	p.V833L	ENST00000354638.3	37	c.2497	CCDS10020.1	15	.	.	.	.	.	.	.	.	.	.	C	6.721	0.501678	0.12822	.	.	ENSG00000104044	ENST00000354638;ENST00000353809	D;D	0.90563	-2.69;-2.54	5.77	3.81	0.43845	.	0.301301	0.30704	N	0.009056	T	0.80341	0.4605	N	0.12920	0.275	0.23620	N	0.997277	B;B	0.31274	0.317;0.05	B;B	0.30943	0.089;0.122	T	0.68546	-0.5380	10	0.32370	T	0.25	-7.9587	8.6917	0.34271	0.0:0.8144:0.0:0.1856	.	809;833	Q04671-2;Q04671	.;P_HUMAN	L	833;809	ENSP00000346659:V833L;ENSP00000261276:V809L	ENSP00000261276:V809L	V	-	1	0	OCA2	25674149	0.883000	0.30277	0.037000	0.18230	0.115000	0.19883	1.301000	0.33447	0.718000	0.32166	0.563000	0.77884	GTG	-	NULL		0.438	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCA2	protein_coding	OTTHUMT00000250823.1	C	NM_000275		25674149	-1	no_errors	NM_000275	genbank	human	reviewed	54_36p	missense	SNP	0.57	A
SLC12A1	6557	genome.wustl.edu	37	15	48521515	48521515	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr15:48521515A>T	ENST00000558405.1	+	5	868	c.854A>T	c.(853-855)gAt>gTt	p.D285V	SLC12A1_ENST00000396577.3_Missense_Mutation_p.D285V|SLC12A1_ENST00000380993.3_Missense_Mutation_p.D285V|SLC12A1_ENST00000559723.1_3'UTR|SLC12A1_ENST00000330289.6_Missense_Mutation_p.D285V			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	285					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)	p.D285V(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	ACTGTAGTAGATCTTCTTAAG	0.413																																																1	Substitution - Missense(1)	ovary(1)	15											106.0	88.0	94.0					15																	48521515		2198	4297	6495	46308807	SO:0001583	missense	6557				CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.854A>T	15.37:g.48521515A>T	ENSP00000453409:p.Asp285Val	Somatic		Capture	Illumina GAIIx	4	46308807	A8JYA2|E9PDW4	Missense_Mutation	SNP	HMMPfam_AA_permease;HMMPfam_AA_permease_N	p.D285V	ENST00000558405.1	37	c.854	CCDS10129.2	15	.	.	.	.	.	.	.	.	.	.	A	16.37	3.105434	0.56291	.	.	ENSG00000074803	ENST00000428362;ENST00000380993;ENST00000396577;ENST00000330289	D;D;D	0.99042	-5.36;-5.36;-5.36	5.81	4.69	0.59074	Amino acid permease domain (1);	0.150607	0.64402	D	0.000015	D	0.98896	0.9626	M	0.70595	2.14	0.80722	D	1	P;D;P	0.57899	0.741;0.981;0.933	B;D;P	0.65233	0.405;0.933;0.756	D	0.98979	1.0804	10	0.66056	D	0.02	.	11.2818	0.49199	0.9294:0.0:0.0706:0.0	.	285;285;285	Q8IUN5;E9PDW4;Q13621	.;.;S12A1_HUMAN	V	98;285;285;285	ENSP00000370381:D285V;ENSP00000379822:D285V;ENSP00000331550:D285V	ENSP00000331550:D285V	D	+	2	0	SLC12A1	46308807	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.175000	0.77632	2.217000	0.71921	0.533000	0.62120	GAT	-	HMMPfam_AA_permease		0.413	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC12A1	protein_coding	OTTHUMT00000417131.1	A			46308807	1	no_errors	NM_000338	genbank	human	validated	54_36p	missense	SNP	1	T
CYP11A1	1583	genome.wustl.edu	37	15	74636161	74636161	+	Silent	SNP	A	A	G			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr15:74636161A>G	ENST00000268053.6	-	4	952	c.798T>C	c.(796-798)caT>caC	p.H266H	CYP11A1_ENST00000541301.1_3'UTR|CYP11A1_ENST00000358632.4_Silent_p.H108H|CYP11A1_ENST00000419019.2_Silent_p.H108H	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	266					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.H266H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	ATGCAGCCACATGGTCCTTCC	0.582																																					Esophageal Squamous(87;818 1337 4093 9268 37314)											1	Substitution - coding silent(1)	ovary(1)	15											179.0	169.0	172.0					15																	74636161		2197	4296	6493	72423214	SO:0001819	synonymous_variant	1583			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.798T>C	15.37:g.74636161A>G		Somatic		Capture	Illumina GAIIx	4	72423214	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Silent	SNP	HMMPfam_p450;superfamily_Cytochrome P450	p.H266	ENST00000268053.6	37	c.798	CCDS32291.1	15																																																																																			-	HMMPfam_p450		0.582	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11A1	protein_coding	OTTHUMT00000319737.1	A			72423214	-1	no_errors	NM_000781	genbank	human	reviewed	54_36p	silent	SNP	1	G
SETD1A	9739	genome.wustl.edu	37	16	30976945	30976945	+	Silent	SNP	C	C	T	rs146323096	byFrequency	TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr16:30976945C>T	ENST00000262519.8	+	8	2429	c.1743C>T	c.(1741-1743)gaC>gaT	p.D581D		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	581	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.D581D(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CTTCTGGAGACGACATGGAGA	0.667													C|||	2	0.000399361	0.0	0.0	5008	,	,		11093	0.002		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	16						C		2,4386		0,2,2192	23.0	27.0	26.0		1743	2.4	1.0	16	dbSNP_134	26	0,8586		0,0,4293	no	coding-synonymous	SETD1A	NM_014712.1		0,2,6485	TT,TC,CC		0.0,0.0456,0.0154		581/1708	30976945	2,12972	2194	4293	6487	30884446	SO:0001819	synonymous_variant	9739			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.1743C>T	16.37:g.30976945C>T		Somatic		Capture	Illumina GAIIx	4	30884446	A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	HMMPfam_RRM_1;HMMPfam_SET;superfamily_RNA-binding domain RBD;superfamily_SET domain	p.D581	ENST00000262519.8	37	c.1743	CCDS32435.1	16																																																																																			-	NULL		0.667	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	protein_coding	OTTHUMT00000318244.2	C	NM_014712		30884446	1	no_errors	NM_014712	genbank	human	provisional	54_36p	silent	SNP	1	T
GSE1	23199	genome.wustl.edu	37	16	85704652	85704652	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr16:85704652C>T	ENST00000253458.7	+	15	3643	c.3467C>T	c.(3466-3468)gCc>gTc	p.A1156V	GSE1_ENST00000405402.2_Missense_Mutation_p.A1052V|GSE1_ENST00000393243.1_Missense_Mutation_p.A1083V	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	1156								p.A1156V(1)									CGACTGGAGGCCCGGCACTAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	16											69.0	72.0	71.0					16																	85704652		2198	4300	6498	84262153	SO:0001583	missense	23199			D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.3467C>T	16.37:g.85704652C>T	ENSP00000253458:p.Ala1156Val	Somatic		Capture	Illumina GAIIx	4	84262153	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Missense_Mutation	SNP	-	p.A1156V	ENST00000253458.7	37	c.3467	CCDS10952.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.768082|5.768082	0.96914|0.96914	.|.	.|.	ENSG00000131149|ENSG00000131149	ENST00000405402;ENST00000253458;ENST00000393243|ENST00000412692;ENST00000438180	T;T;T|.	0.38401|.	1.14;1.14;1.14|.	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	0.107337|.	0.64402|.	D|.	0.000005|.	T|T	0.73171|0.73171	0.3553|0.3553	L|L	0.55481|0.55481	1.735|1.735	0.54753|0.54753	D|D	0.999988|0.999988	D;D;D;D|.	0.71674|.	0.967;0.998;0.998;0.997|.	P;D;D;D|.	0.69142|.	0.554;0.962;0.962;0.917|.	T|T	0.67436|0.67436	-0.5671|-0.5671	10|5	0.59425|.	D|.	0.04|.	-28.9046|-28.9046	20.5596|20.5596	0.99324|0.99324	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	919;1052;1083;1156|.	Q59GZ0;Q14687-2;Q14687-3;Q14687|.	.;.;.;GSE1_HUMAN|.	V|S	1052;1156;1083|925;358	ENSP00000384839:A1052V;ENSP00000253458:A1156V;ENSP00000376934:A1083V|.	ENSP00000253458:A1156V|.	A|P	+|+	2|1	0|0	KIAA0182|KIAA0182	84262153|84262153	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.985000|0.985000	0.73830|0.73830	7.363000|7.363000	0.79516|0.79516	2.868000|2.868000	0.98415|0.98415	0.555000|0.555000	0.69702|0.69702	GCC|CCC	-	NULL		0.537	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA0182	protein_coding	OTTHUMT00000325527.1	C	NM_014615		84262153	1	no_errors	NM_014615	genbank	human	validated	54_36p	missense	SNP	1	T
MYH4	4622	genome.wustl.edu	37	17	10350377	10350377	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr17:10350377G>C	ENST00000255381.2	-	35	5232	c.5122C>G	c.(5122-5124)Caa>Gaa	p.Q1708E	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1708					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.Q1708E(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						AGAAGCTCTTGCTCTGCCATT	0.498																																																1	Substitution - Missense(1)	ovary(1)	17											156.0	125.0	136.0					17																	10350377		2203	4300	6503	10291102	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5122C>G	17.37:g.10350377G>C	ENSP00000255381:p.Gln1708Glu	Somatic		Capture	Illumina GAIIx	4	10291102		Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Prefoldin;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.Q1708E	ENST00000255381.2	37	c.5122	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	G	27.2	4.811788	0.90707	.	.	ENSG00000141048	ENST00000255381	T	0.77489	-1.1	5.29	5.29	0.74685	Myosin tail (1);	0.000000	0.36002	U	0.002841	D	0.82774	0.5110	M	0.81179	2.53	0.58432	D	0.999998	P	0.37612	0.602	B	0.42625	0.393	T	0.82707	-0.0324	10	0.40728	T	0.16	.	19.2859	0.94069	0.0:0.0:1.0:0.0	.	1708	Q9Y623	MYH4_HUMAN	E	1708	ENSP00000255381:Q1708E	ENSP00000255381:Q1708E	Q	-	1	0	MYH4	10291102	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.796000	0.99103	2.646000	0.89796	0.563000	0.77884	CAA	-	HMMPfam_Myosin_tail_1		0.498	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	protein_coding	OTTHUMT00000252731.1	G	NM_017533		10291102	-1	no_errors	NM_017533	genbank	human	validated	54_36p	missense	SNP	1	C
NUFIP2	57532	genome.wustl.edu	37	17	27613766	27613766	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr17:27613766T>C	ENST00000225388.4	-	2	1304	c.1246A>G	c.(1246-1248)Aat>Gat	p.N416D	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	416						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.N416D(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			ACAGGCCCATTAGAAAAGTTG	0.473																																																1	Substitution - Missense(1)	ovary(1)	17											75.0	77.0	76.0					17																	27613766		2203	4300	6503	24637892	SO:0001583	missense	57532			AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.1246A>G	17.37:g.27613766T>C	ENSP00000225388:p.Asn416Asp	Somatic		Capture	Illumina GAIIx	4	24637892	A1L3A6|Q9P2M5	Missense_Mutation	SNP	-	p.N416D	ENST00000225388.4	37	c.1246	CCDS32600.1	17	.	.	.	.	.	.	.	.	.	.	T	16.11	3.031605	0.54790	.	.	ENSG00000108256	ENST00000225388	.	.	.	6.17	5.07	0.68467	.	0.061993	0.64402	D	0.000004	T	0.53818	0.1820	L	0.36672	1.1	0.80722	D	1	P	0.40534	0.72	B	0.43728	0.429	T	0.57004	-0.7885	9	0.87932	D	0	-9.5139	13.5131	0.61524	0.0:0.0:0.1302:0.8698	.	416	Q7Z417	NUFP2_HUMAN	D	416	.	ENSP00000225388:N416D	N	-	1	0	NUFIP2	24637892	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.698000	0.84413	1.104000	0.41587	0.533000	0.62120	AAT	-	NULL		0.473	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP2	protein_coding	OTTHUMT00000447015.2	T	NM_020772		24637892	-1	no_errors	NM_020772	genbank	human	validated	54_36p	missense	SNP	1	C
CDK12	51755	genome.wustl.edu	37	17	37618687	37618688	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	CT	CT	CT	-	CT	CT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr17:37618687_37618688delCT	ENST00000447079.4	+	1	396_397	c.363_364delCT	c.(361-366)gacttafs	p.L123fs	CDK12_ENST00000430627.2_Frame_Shift_Del_p.L123fs	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	123					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.L122fs*4(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						GTTCCCGGGACTTACTAAAAGC	0.515			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																													Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	1	Deletion - Frameshift(1)	ovary(1)	17																																								34872214	SO:0001589	frameshift_variant	51755			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.363_364delCT	17.37:g.37618687_37618688delCT	ENSP00000398880:p.Leu123fs	Somatic		Capture	Illumina GAIIx	Phase_III	34872213	A7E2B2|B4DYX4|B9EIQ6|O94978	Frame_Shift_Del	DEL	Pkinase,HMMPfam_Pkinase	p.L122fs	ENST00000447079.4	37	c.363_364	CCDS11337.1	17																																																																																			(deletion:cds_exon[34871851,34872896])	NULL		0.515	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CRKRS	protein_coding	OTTHUMT00000256941.4	CT	NM_016507		34872214	1	no_errors	NM_016507	genbank	human	validated	54_36p	frame_shift_del	DEL	0.061:0.049	-
TOP2A	7153	genome.wustl.edu	37	17	38569194	38569195	+	Frame_Shift_Ins	INS	-	-	CCAG			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr17:38569194_38569195insCCAG	ENST00000423485.1	-	7	763_764	c.605_606insCTGG	c.(604-606)ggtfs	p.-202fs		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa						apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	GTTCCATCTCACCAGCTCTTCC	0.351																																																0			17																																								35822721	SO:0001589	frameshift_variant	7153				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.602_605dupCTGG	17.37:g.38569195_38569198dupCCAG	ENSP00000411532:p.Gly202fs	Somatic		Capture	Illumina GAIIx	4	35822720	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Frame_Shift_Ins	INS	HMMPfam_DNA_topoisoIV;HMMPfam_HATPase_c;superfamily_ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase;HMMPfam_DTHCT;HMMPfam_DNA_gyraseB;superfamily_Type II DNA topoisomerase;superfamily_Ribosomal protein S5 domain 2-like	p.E203fs	ENST00000423485.1	37	c.606_605	CCDS45672.1	17																																																																																			-	HMMPfam_HATPase_c		0.351	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP2A	protein_coding	OTTHUMT00000338035.1	-			35822721	-1	no_errors	NM_001067	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.949:0.985	CCAG
GLOD4	51031	genome.wustl.edu	37	17	685836	685836	+	5'Flank	SNP	A	A	G	rs368602188		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr17:685836A>G	ENST00000301328.5	-	0	0				GLOD4_ENST00000536578.1_5'Flank|RNMTL1_ENST00000304478.4_Missense_Mutation_p.K73R|GLOD4_ENST00000301329.6_5'Flank			Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4							extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)		p.K73R(1)		endometrium(1)|large_intestine(1)|prostate(1)	3				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		CAACGAGAGAAACAACCGCTC	0.622																																																1	Substitution - Missense(1)	ovary(1)	17						A	ARG/LYS	0,4406		0,0,2203	33.0	32.0	32.0		218	0.7	0.0	17		32	1,8589	1.2+/-3.3	0,1,4294	no	missense	RNMTL1	NM_018146.2	26	0,1,6497	GG,GA,AA		0.0116,0.0,0.0077	benign	73/421	685836	1,12995	2203	4295	6498	632586	SO:0001631	upstream_gene_variant	55178			AF177342	CCDS32520.1	17p13.3	2008-02-05	2007-03-14	2007-03-14		ENSG00000167699			14111	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 25"""	C17orf25		11642406, 12528892	Standard	NM_016080		Approved	CGI-150, HC71	uc002fru.3	Q9HC38			17.37:g.685836A>G	Exception_encountered	Somatic		Capture	Illumina GAIIx	Phase_III	632586	D3DTG9|D3DTH1|Q96B89|Q9H3J8|Q9HC37|Q9NVN1	Missense_Mutation	SNP	-	p.K73R	ENST00000301328.5	37	c.218		17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.23|10.23	1.293705|1.293705	0.23564|0.23564	0.0|0.0	1.16E-4|1.16E-4	ENSG00000167699|ENSG00000171861	ENST00000397393|ENST00000304478	.|T	.|0.18338	.|2.22	4.63|4.63	0.665|0.665	0.17896|0.17896	.|.	.|0.743101	.|0.12683	.|N	.|0.447801	T|T	0.09335|0.09335	0.0230|0.0230	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B	.|0.18461	.|0.028	.|B	.|0.14023	.|0.01	T|T	0.38693|0.38693	-0.9649|-0.9649	6|10	0.87932|0.18710	D|T	0|0.47	-2.4228|-2.4228	6.3097|6.3097	0.21159|0.21159	0.3832:0.5207:0.0961:0.0|0.3832:0.5207:0.0961:0.0	.|.	.|73	.|Q9HC36	.|RMTL1_HUMAN	S|R	94|73	.|ENSP00000306080:K73R	ENSP00000380548:F94S|ENSP00000306080:K73R	F|K	-|+	2|2	0|0	GLOD4|RNMTL1	632586|632586	0.000000|0.000000	0.05858|0.05858	0.029000|0.029000	0.17559|0.17559	0.003000|0.003000	0.03518|0.03518	0.137000|0.137000	0.15995|0.15995	0.300000|0.300000	0.22699|0.22699	-0.460000|-0.460000	0.05396|0.05396	TTT|AAA	-	NULL		0.622	GLOD4-005	KNOWN	basic	protein_coding	RNMTL1	protein_coding	OTTHUMT00000437190.1	A	NM_016080		632586	1	no_errors	NM_018146	genbank	human	provisional	54_36p	missense	SNP	0	G
TP53	7157	genome.wustl.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	A	rs28934576		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr17:7577120C>A	ENST00000269305.4	-	8	1007	c.818G>T	c.(817-819)cGt>cTt	p.R273L	TP53_ENST00000455263.2_Missense_Mutation_p.R273L|TP53_ENST00000359597.4_Missense_Mutation_p.R273L|TP53_ENST00000445888.2_Missense_Mutation_p.R273L|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R273L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	17	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	7517845	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>T	17.37:g.7577120C>A	ENSP00000269305:p.Arg273Leu	Somatic		Capture	Illumina GAIIx	4	7517845	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R273L	ENST00000269305.4	37	c.818	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.6	4.554800	0.86231	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99866	-7.3;-7.3;-7.3;-7.3;-7.3;-7.3	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99871	0.9939	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.77557	0.988;0.987;0.99;0.986	D	0.96378	0.9279	10	0.87932	D	0	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	L	273;273;273;273;273;262;141	ENSP00000352610:R273L;ENSP00000269305:R273L;ENSP00000398846:R273L;ENSP00000391127:R273L;ENSP00000391478:R273L;ENSP00000425104:R141L	ENSP00000269305:R273L	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	-	HMMPfam_P53		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7517845	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.81	A
ITGA2B	3674	genome.wustl.edu	37	17	42457993	42457993	+	Missense_Mutation	SNP	C	C	T	rs375195998		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr17:42457993C>T	ENST00000262407.5	-	14	1445	c.1414G>A	c.(1414-1416)Ggg>Agg	p.G472R	ITGA2B_ENST00000353281.4_Missense_Mutation_p.G472R|ITGA2B_ENST00000377068.3_3'UTR	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	472					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.G472R(1)		biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	TGGTTGGCCCCGTAAGCTCCC	0.597																																																1	Substitution - Missense(1)	ovary(1)	17						C	ARG/GLY	0,4406		0,0,2203	117.0	108.0	111.0		1414	5.0	0.3	17		111	2,8598	2.2+/-6.3	0,2,4298	no	missense	ITGA2B	NM_000419.3	125	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	472/1040	42457993	2,13004	2203	4300	6503	39813519	SO:0001583	missense	3674				CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.1414G>A	17.37:g.42457993C>T	ENSP00000262407:p.Gly472Arg	Somatic		Capture	Illumina GAIIx	4	39813519	B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	HMMPfam_Integrin_alpha;HMMPfam_FG-GAP;HMMPfam_Integrin_alpha2;superfamily_Integrin domains;superfamily_Integrin alpha N-terminal domain	p.G472R	ENST00000262407.5	37	c.1414	CCDS32665.1	17	.	.	.	.	.	.	.	.	.	.	C	15.97	2.989917	0.54041	0.0	2.33E-4	ENSG00000005961	ENST00000262407;ENST00000353281	T;T	0.74315	-0.83;-0.83	5.02	5.02	0.67125	.	0.270310	0.20133	N	0.098542	D	0.85831	0.5788	M	0.90870	3.155	0.80722	D	1	D	0.76494	0.999	P	0.57846	0.828	D	0.88186	0.2874	10	0.87932	D	0	.	11.3725	0.49708	0.0:0.9133:0.0:0.0867	.	472	P08514	ITA2B_HUMAN	R	472	ENSP00000262407:G472R;ENSP00000340536:G472R	ENSP00000262407:G472R	G	-	1	0	ITGA2B	39813519	0.992000	0.36948	0.258000	0.24420	0.099000	0.18886	4.720000	0.61944	2.613000	0.88420	0.655000	0.94253	GGG	-	HMMPfam_FG-GAP		0.597	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2B	protein_coding	OTTHUMT00000439823.1	C			39813519	-1	no_errors	NM_000419	genbank	human	reviewed	54_36p	missense	SNP	0.88	T
DCC	1630	genome.wustl.edu	37	18	50683842	50683842	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr18:50683842C>G	ENST00000442544.2	+	8	1994	c.1378C>G	c.(1378-1380)Caa>Gaa	p.Q460E	DCC_ENST00000412726.1_Missense_Mutation_p.Q308E|DCC_ENST00000581580.1_Missense_Mutation_p.Q115E	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	460	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.Q460E(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AGGGAACATTCAAACTTTCAC	0.488																																																1	Substitution - Missense(1)	ovary(1)	18											96.0	87.0	90.0					18																	50683842		2203	4300	6503	48937840	SO:0001583	missense	1630			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1378C>G	18.37:g.50683842C>G	ENSP00000389140:p.Gln460Glu	Somatic		Capture	Illumina GAIIx	4	48937840		Missense_Mutation	SNP	HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_Neogenin_C;HMMPfam_I-set;superfamily_Immunoglobulin	p.Q460E	ENST00000442544.2	37	c.1378	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660274	0.47572	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.56275	0.47;0.47	5.59	5.59	0.84812	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.59609	0.2206	L	0.52206	1.635	0.46096	D	0.998863	B;B;B	0.29270	0.175;0.175;0.24	B;B;B	0.41691	0.28;0.28;0.364	T	0.60816	-0.7188	10	0.72032	D	0.01	.	18.3678	0.90397	0.0:1.0:0.0:0.0	.	308;308;460	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	E	460;393;308	ENSP00000389140:Q460E;ENSP00000397322:Q308E	ENSP00000304146:Q393E	Q	+	1	0	DCC	48937840	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	7.027000	0.76463	2.648000	0.89879	0.561000	0.74099	CAA	-	HMMPfam_fn3		0.488	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	protein_coding	OTTHUMT00000255996.3	C	NM_005215		48937840	1	no_errors	NM_005215	genbank	human	validated	54_36p	missense	SNP	1	G
ATP9B	374868	genome.wustl.edu	37	18	77063608	77063608	+	Silent	SNP	C	C	A	rs373609399		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr18:77063608C>A	ENST00000426216.2	+	14	1433	c.1416C>A	c.(1414-1416)acC>acA	p.T472T	ATP9B_ENST00000307671.7_Silent_p.T472T	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	472					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T472T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		TCCTAGGAACCCTCACCCAGA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	18											77.0	70.0	72.0					18																	77063608		2203	4300	6503	75164596	SO:0001819	synonymous_variant	374868			R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.1416C>A	18.37:g.77063608C>A		Somatic		Capture	Illumina GAIIx	4	75164596	O60872|Q08AD8|Q08AD9	Silent	SNP	-	p.T472	ENST00000426216.2	37	c.1416	CCDS12014.1	18																																																																																			-	NULL		0.542	ATP9B-001	KNOWN	basic|CCDS	protein_coding	ATP9B	protein_coding	OTTHUMT00000256402.3	C	NM_198531		75164596	1	no_errors	NM_198531	genbank	human	validated	54_36p	silent	SNP	1	A
ADNP2	22850	genome.wustl.edu	37	18	77896044	77896044	+	Silent	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr18:77896044C>T	ENST00000262198.4	+	4	3203	c.2748C>T	c.(2746-2748)atC>atT	p.I916I		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	916					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I916I(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		TCAAGTGCATCCACTGCTGTG	0.572																																																1	Substitution - coding silent(1)	ovary(1)	18											91.0	87.0	89.0					18																	77896044		2203	4300	6503	75997035	SO:0001819	synonymous_variant	22850			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2748C>T	18.37:g.77896044C>T		Somatic		Capture	Illumina GAIIx	4	75997035	A8K951|O94943|Q9H9P3	Silent	SNP	-	p.I916	ENST00000262198.4	37	c.2748	CCDS32853.1	18																																																																																			-	NULL		0.572	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	protein_coding	OTTHUMT00000418979.1	C	NM_014913		75997035	1	no_errors	NM_014913	genbank	human	validated	54_36p	silent	SNP	1	T
ZNF799	90576	genome.wustl.edu	37	19	12501677	12501677	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr19:12501677G>T	ENST00000430385.3	-	4	1735	c.1535C>A	c.(1534-1536)gCc>gAc	p.A512D	ZNF799_ENST00000419318.1_Missense_Mutation_p.A480D|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	512					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A299D(1)		breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						ATGACTGAAGGCTTTCTTACA	0.393																																																1	Substitution - Missense(1)	ovary(1)	19											97.0	101.0	100.0					19																	12501677		2201	4300	6501	12362677	SO:0001583	missense	90576			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1535C>A	19.37:g.12501677G>T	ENSP00000411084:p.Ala512Asp	Somatic		Capture	Illumina GAIIx	4	12362677		Missense_Mutation	SNP	-	p.A512D	ENST00000430385.3	37	c.1535	CCDS45989.1	19	.	.	.	.	.	.	.	.	.	.	G	13.55	2.271406	0.40194	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.14266	2.52;2.52	1.14	-1.82	0.07857	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24699	0.0599	M	0.64080	1.96	0.09310	N	1	D	0.60575	0.988	P	0.62184	0.899	T	0.11867	-1.0570	9	0.87932	D	0	.	5.2832	0.15686	0.1757:0.5572:0.2671:0.0	.	512	Q96GE5	ZN799_HUMAN	D	480;512	ENSP00000415278:A480D;ENSP00000411084:A512D	ENSP00000415278:A480D	A	-	2	0	ZNF799	12362677	0.000000	0.05858	0.000000	0.03702	0.415000	0.31203	-1.051000	0.03507	-0.438000	0.07232	0.195000	0.17529	GCC	-	NULL		0.393	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF799	protein_coding	OTTHUMT00000344099.2	G	NM_001080821		12362677	-1	no_errors	NM_001080821	genbank	human	validated	54_36p	missense	SNP		T
ZNF599	148103	genome.wustl.edu	37	19	35250006	35250006	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr19:35250006T>C	ENST00000329285.8	-	4	2073	c.1700A>G	c.(1699-1701)gAa>gGa	p.E567G		NM_001007248.2	NP_001007249.1	Q96NL3	ZN599_HUMAN	zinc finger protein 599	567					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E567G(1)		endometrium(3)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|skin(1)	24	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			CTTTCCACATTCATTGCATTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	19											153.0	143.0	146.0					19																	35250006		2203	4300	6503	39941846	SO:0001583	missense	148103			AK055225	CCDS32991.1	19q13.13	2013-01-08				ENSG00000153896		"""Zinc fingers, C2H2-type"", ""-"""	26408	protein-coding gene	gene with protein product							Standard	NM_001007248		Approved	FLJ30663	uc010edn.1	Q96NL3		ENST00000329285.8:c.1700A>G	19.37:g.35250006T>C	ENSP00000333802:p.Glu567Gly	Somatic		Capture	Illumina GAIIx	4	39941846	Q569K0|Q5PRG1	Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers;HMMPfam_KRAB	p.E567G	ENST00000329285.8	37	c.1700	CCDS32991.1	19	.	.	.	.	.	.	.	.	.	.	T	14.16	2.451446	0.43531	.	.	ENSG00000153896	ENST00000392231;ENST00000329285	T	0.07444	3.19	2.43	1.36	0.22044	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11110	0.0271	M	0.77486	2.375	0.09310	N	0.999993	B	0.32753	0.383	B	0.29716	0.106	T	0.18147	-1.0346	9	0.72032	D	0.01	.	6.0624	0.19844	0.229:0.0:0.0:0.771	.	567	Q96NL3	ZN599_HUMAN	G	566;567	ENSP00000333802:E567G	ENSP00000333802:E567G	E	-	2	0	ZNF599	39941846	0.000000	0.05858	0.996000	0.52242	0.990000	0.78478	0.547000	0.23299	0.334000	0.23590	0.402000	0.26972	GAA	-	HMMPfam_zf-C2H2		0.408	ZNF599-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF599	protein_coding	OTTHUMT00000460648.2	T	XM_086046		39941846	-1	no_errors	NM_001007248	genbank	human	validated	54_36p	missense	SNP	0.24	C
CEACAM6	4680	genome.wustl.edu	37	19	42265290	42265290	+	Silent	SNP	G	G	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr19:42265290G>A	ENST00000199764.6	+	3	776	c.558G>A	c.(556-558)ccG>ccA	p.P186P	AC011513.4_ENST00000601409.1_RNA	NM_002483.4	NP_002474.3	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)	186	Ig-like C2-type 1.				cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.P186P(1)		breast(1)|kidney(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		AGAGCCTCCCGGTCAGTCCCA	0.532																																																1	Substitution - coding silent(1)	ovary(1)	19											222.0	198.0	206.0					19																	42265290		2203	4299	6502	46957130	SO:0001819	synonymous_variant	4680			M29541	CCDS12585.1	19q13.1-q13.2	2013-01-29			ENSG00000086548	ENSG00000086548		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1818	protein-coding gene	gene with protein product		163980		NCA			Standard	NM_002483		Approved	CD66c	uc002orm.2	P40199	OTTHUMG00000151064	ENST00000199764.6:c.558G>A	19.37:g.42265290G>A		Somatic		Capture	Illumina GAIIx	4	46957130	Q13774|Q14920|Q53XP7	Silent	SNP	HMMPfam_V-set;HMMPfam_ig;superfamily_Immunoglobulin	p.P186	ENST00000199764.6	37	c.558	CCDS12585.1	19																																																																																			-	HMMPfam_ig		0.532	CEACAM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM6	protein_coding	OTTHUMT00000321147.1	G			46957130	1	no_errors	NM_002483	genbank	human	validated	54_36p	silent	SNP		A
EMR4P	326342	genome.wustl.edu	37	19	6981089	6981090	+	RNA	INS	-	-	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr19:6981089_6981090insC	ENST00000600751.1	-	0	589					NR_024075.1		Q86SQ3	EMR4_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 4 pseudogene						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)										AGCCTCTCTTACCTATATCAAA	0.441																																																0			19																																								6932090			326342			AY181245		19p13.2	2014-08-08	2008-06-06	2008-06-06	ENSG00000268758	ENSG00000268758		"""-"", ""GPCR / Class B : Orphans"""	19240	pseudogene	pseudogene		612305	"""G protein-coupled receptor 127"", ""egf-like module containing, mucin-like, hormone receptor-like 4"""	GPR127, EMR4		12565841	Standard	NR_024075		Approved	PGR16	uc010xjk.2	Q86SQ3	OTTHUMG00000177251		19.37:g.6981091_6981091dupC		Somatic		Capture	Illumina GAIIx	4	6932089	Q86SP1	Splice_Site	INS	-	e6+1	ENST00000600751.1	37	c.NULL		19																																																																																			-	-		0.441	EMR4P-002	KNOWN	basic	processed_transcript	EMR4P	pseudogene	OTTHUMT00000436007.1	-	NR_024075		6932090	-1	no_errors	ENST00000359590	ensembl	human	known	54_36p	splice_site_ins	INS	0.776:0.771	C
ZNF841	284371	genome.wustl.edu	37	19	52569914	52569914	+	Silent	SNP	G	G	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr19:52569914G>A	ENST00000426391.2	-	5	1424	c.873C>T	c.(871-873)ggC>ggT	p.G291G	ZNF432_ENST00000598446.1_Intron|CTC-471J1.2_ENST00000569091.1_RNA|ZNF841_ENST00000359973.2_Silent_p.G291G|ZNF841_ENST00000389534.4_Silent_p.G407G|ZNF841_ENST00000594295.1_Silent_p.G407G			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G291G(1)		breast(1)|endometrium(4)|kidney(3)|lung(3)	11						TAAAGGTTTTGCCACATTCAT	0.393																																																1	Substitution - coding silent(1)	ovary(1)	19											122.0	104.0	110.0					19																	52569914		692	1591	2283	57261726	SO:0001819	synonymous_variant	284371			AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.873C>T	19.37:g.52569914G>A		Somatic		Capture	Illumina GAIIx	4	57261726	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Silent	SNP	HMMPfam_zf-C2H2;superfamily_SSF57667	p.G291	ENST00000426391.2	37	c.873		19																																																																																			-	NULL		0.393	ZNF841-001	PUTATIVE	basic	protein_coding	ZNF841	protein_coding	OTTHUMT00000462435.1	G	XM_209155		57261726	-1	no_errors	ENST00000389534	ensembl	human	known	54_36p	silent	SNP	0.99	A
CNTNAP5	129684	genome.wustl.edu	37	2	125660527	125660527	+	Missense_Mutation	SNP	G	G	A	rs375640846		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr2:125660527G>A	ENST00000431078.1	+	22	3866	c.3502G>A	c.(3502-3504)Gtc>Atc	p.V1168I		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1168	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.V1168I(2)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CATGTCTTCCGTCCAGTACAA	0.493																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	2						G	ILE/VAL	1,4133		0,1,2066	65.0	66.0	66.0		3502	5.5	1.0	2		66	0,8442		0,0,4221	no	missense	CNTNAP5	NM_130773.2	29	0,1,6287	AA,AG,GG		0.0,0.0242,0.0080	probably-damaging	1168/1307	125660527	1,12575	2067	4221	6288	125376997	SO:0001583	missense	129684			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3502G>A	2.37:g.125660527G>A	ENSP00000399013:p.Val1168Ile	Somatic		Capture	Illumina GAIIx	4	125376997	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	HMMPfam_F5_F8_type_C;HMMPfam_EGF;superfamily_Galactose-binding domain-like;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_Fibrinogen C-terminal domain-like	p.V1168I	ENST00000431078.1	37	c.3502	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	G	16.75	3.210686	0.58343	2.42E-4	0.0	ENSG00000155052	ENST00000431078	T	0.79845	-1.31	5.5	5.5	0.81552	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.44097	D	0.000491	D	0.91683	0.7371	M	0.90650	3.135	0.52501	D	0.999955	D	0.76494	0.999	D	0.81914	0.995	D	0.92645	0.6128	10	0.59425	D	0.04	.	18.4001	0.90513	0.0:0.0:1.0:0.0	.	1168	Q8WYK1	CNTP5_HUMAN	I	1168	ENSP00000399013:V1168I	ENSP00000399013:V1168I	V	+	1	0	CNTNAP5	125376997	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	7.339000	0.79282	2.597000	0.87782	0.655000	0.94253	GTC	-	HMMPfam_Laminin_G_2		0.493	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	G			125376997	1	no_errors	NM_130773	genbank	human	reviewed	54_36p	missense	SNP	1	A
ZNF806	646915	genome.wustl.edu	37	2	133076200	133076200	+	IGR	SNP	T	T	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr2:133076200T>C								AC097532.2 (24250 upstream) : RP11-725P16.2 (26988 downstream)																							AATTCGCACCTCCTTGCCCAA	0.463																																																0			2																																								132792670	SO:0001628	intergenic_variant	646915																															2.37:g.133076200T>C		Somatic		Capture	Illumina GAIIx	4	132792670		Missense_Mutation	SNP	-	p.L554P		37	c.1661		2																																																																																			-	NULL	0	0.463					ZNF806			T			132792670	1	no_errors	XM_001724242	genbank	human	model	54_36p	missense	SNP	0.02	C
APOB	338	genome.wustl.edu	37	2	21233155	21233155	+	Silent	SNP	T	T	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr2:21233155T>C	ENST00000233242.1	-	26	6712	c.6585A>G	c.(6583-6585)aaA>aaG	p.K2195K		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2195					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.K2195K(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAATAGCTATTTTCAAATCAT	0.254																																																1	Substitution - coding silent(1)	ovary(1)	2											31.0	33.0	32.0					2																	21233155		2178	4266	6444	21086660	SO:0001819	synonymous_variant	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.6585A>G	2.37:g.21233155T>C		Somatic		Capture	Illumina GAIIx	4	21086660	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	HMMPfam_Vitellogenin_N;HMMPfam_DUF1081;HMMPfam_DUF1943	p.K2195	ENST00000233242.1	37	c.6585	CCDS1703.1	2																																																																																			-	NULL		0.254	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	T			21086660	-1	no_errors	NM_000384	genbank	human	reviewed	54_36p	silent	SNP	0.01	C
SPATS2L	26010	genome.wustl.edu	37	2	201284181	201284181	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr2:201284181T>A	ENST00000358677.5	+	6	654	c.407T>A	c.(406-408)aTa>aAa	p.I136K	SPATS2L_ENST00000409151.1_Missense_Mutation_p.I144K|SPATS2L_ENST00000409385.1_Missense_Mutation_p.I76K|SPATS2L_ENST00000409140.3_Missense_Mutation_p.I136K|SPATS2L_ENST00000409755.3_Missense_Mutation_p.I166K|SPATS2L_ENST00000360760.5_Missense_Mutation_p.I136K|SPATS2L_ENST00000451764.2_Missense_Mutation_p.I136K|SPATS2L_ENST00000409718.1_Missense_Mutation_p.I136K|SPATS2L_ENST00000409988.3_Missense_Mutation_p.I136K	NM_001282735.1|NM_001282743.1|NM_001282744.1|NM_015535.2	NP_001269664.1|NP_001269672.1|NP_001269673.1|NP_056350.2	Q9NUQ6	SPS2L_HUMAN	spermatogenesis associated, serine-rich 2-like	136						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)	p.I136K(1)		endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	10						AAGATCTCGATACTTGAGGAA	0.463																																																1	Substitution - Missense(1)	ovary(1)	2											43.0	44.0	44.0					2																	201284181		1941	4134	6075	200992426	SO:0001583	missense	26010			AF193059	CCDS46483.1, CCDS46484.1, CCDS74621.1, CCDS74622.1	2q33.1	2009-06-12			ENSG00000196141	ENSG00000196141			24574	protein-coding gene	gene with protein product	"""DNA polymerase transactivated protein 6"""	613817				11230166	Standard	NM_001100422		Approved	DNAPTP6	uc002uvr.4	Q9NUQ6	OTTHUMG00000154589	ENST00000358677.5:c.407T>A	2.37:g.201284181T>A	ENSP00000351503:p.Ile136Lys	Somatic		Capture	Illumina GAIIx	4	200992426	A8K381|B4DRE6|B4DT67|B7WNZ7|Q53T22|Q8WV53|Q8WYG1|Q9NTW4	Missense_Mutation	SNP	-	p.I136K	ENST00000358677.5	37	c.407	CCDS46483.1	2	.	.	.	.	.	.	.	.	.	.	T	5.910	0.351997	0.11182	.	.	ENSG00000196141	ENST00000409718;ENST00000358677;ENST00000409988;ENST00000409385;ENST00000451764;ENST00000360760;ENST00000423749;ENST00000457757;ENST00000453663;ENST00000409140;ENST00000409397;ENST00000409755;ENST00000409151;ENST00000421573;ENST00000449647;ENST00000438761	.	.	.	5.53	4.36	0.52297	.	0.389740	0.24737	N	0.036006	T	0.19167	0.0460	N	0.14661	0.345	0.18873	N	0.999988	B;P;B	0.36535	0.101;0.557;0.324	B;B;B	0.36534	0.062;0.159;0.227	T	0.08617	-1.0713	8	.	.	.	-18.809	6.6125	0.22759	0.0:0.1693:0.0:0.8307	.	166;136;136	B4DT67;Q9NUQ6-2;Q9NUQ6	.;.;SPS2L_HUMAN	K	136;136;136;76;136;136;136;136;136;136;136;166;144;136;136;131	.	.	I	+	2	0	SPATS2L	200992426	0.003000	0.15002	0.838000	0.33150	0.503000	0.33858	0.789000	0.26886	2.228000	0.72767	0.528000	0.53228	ATA	-	NULL		0.463	SPATS2L-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC26010	protein_coding	OTTHUMT00000336208.3	T	NM_015535		200992426	1	no_errors	NM_001100422	genbank	human	validated	54_36p	missense	SNP		A
KCNE4	23704	genome.wustl.edu	37	2	223917939	223917939	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr2:223917939T>G	ENST00000281830.3	+	2	875	c.544T>G	c.(544-546)Tcc>Gcc	p.S182A	KCNE4_ENST00000604125.1_Missense_Mutation_p.S131A|KCNE4_ENST00000488477.2_Intron			Q8WWG9	KCNE4_HUMAN	potassium voltage-gated channel, Isk-related family, member 4	182						apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	voltage-gated potassium channel activity (GO:0005249)	p.S131A(1)		large_intestine(2)|lung(5)|ovary(2)|skin(1)	10		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)		CGAGTCCTCCTCCCCGGACGT	0.657																																																1	Substitution - Missense(1)	ovary(1)	2											42.0	44.0	43.0					2																	223917939		2203	4300	6503	223626183	SO:0001583	missense	23704			AY065987	CCDS2456.1, CCDS2456.2	2q36.1	2008-02-05			ENSG00000152049	ENSG00000152049		"""Potassium channels"""	6244	protein-coding gene	gene with protein product		607775				10219239, 12670483	Standard	NM_080671		Approved	MiRP3	uc002vnl.5	Q8WWG9	OTTHUMG00000133161	ENST00000281830.3:c.544T>G	2.37:g.223917939T>G	ENSP00000281830:p.Ser182Ala	Somatic		Capture	Illumina GAIIx	4	223626183	B7Z275|Q53SM4|Q96CC4	Missense_Mutation	SNP	-	p.S131A	ENST00000281830.3	37	c.391		2	.	.	.	.	.	.	.	.	.	.	T	15.88	2.963480	0.53507	.	.	ENSG00000152049	ENST00000281830	.	.	.	6.17	5.01	0.66863	.	0.246389	0.41938	D	0.000784	T	0.32793	0.0841	L	0.32530	0.975	0.23376	N	0.997808	B	0.23650	0.089	B	0.23852	0.049	T	0.24799	-1.0150	9	0.49607	T	0.09	-15.0805	10.8493	0.46761	0.2517:0.0:0.0:0.7483	.	131	Q8WWG9	KCNE4_HUMAN	A	131	.	ENSP00000281830:S131A	S	+	1	0	KCNE4	223626183	0.932000	0.31603	0.987000	0.45799	0.970000	0.65996	2.381000	0.44336	1.130000	0.42092	0.533000	0.62120	TCC	-	NULL		0.657	KCNE4-001	KNOWN	basic	protein_coding	KCNE4	protein_coding	OTTHUMT00000330997.2	T	NM_080671		223626183	1	no_errors	NM_080671	genbank	human	validated	54_36p	missense	SNP	0.42	G
NRXN1	9378	genome.wustl.edu	37	2	50463931	50463931	+	Missense_Mutation	SNP	T	T	A	rs200915287		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr2:50463931T>A	ENST00000406316.2	-	18	5018	c.3542A>T	c.(3541-3543)cAt>cTt	p.H1181L	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000404971.1_Missense_Mutation_p.H1221L|NRXN1_ENST00000406859.3_Missense_Mutation_p.H1181L|NRXN1_ENST00000342183.5_Missense_Mutation_p.H146L|NRXN1_ENST00000401710.1_Missense_Mutation_p.H199L|NRXN1_ENST00000401669.2_Missense_Mutation_p.H1181L|NRXN1_ENST00000405472.3_Missense_Mutation_p.H1173L|NRXN1_ENST00000402717.3_Missense_Mutation_p.H1173L	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1181	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.H146L(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ACTTACTATATGCAGTTCTAG	0.398																																																1	Substitution - Missense(1)	ovary(1)	2											93.0	84.0	87.0					2																	50463931		2203	4300	6503	50317435	SO:0001583	missense	9378			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3542A>T	2.37:g.50463931T>A	ENSP00000384311:p.His1181Leu	Somatic		Capture	Illumina GAIIx	4	50317435	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_EGF/Laminin	p.H1181L	ENST00000406316.2	37	c.3542	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	T	19.67	3.870770	0.72065	.	.	ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.68	5.68	0.88126	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.187162	0.34411	U	0.003987	D	0.85961	0.5819	L	0.61387	1.9	0.58432	D	0.999995	P;D;P;P	0.62365	0.785;0.991;0.907;0.924	P;D;P;P	0.67382	0.452;0.951;0.631;0.832	D	0.87279	0.2291	10	0.72032	D	0.01	.	15.9365	0.79712	0.0:0.0:0.0:1.0	.	1221;146;1181;1173	Q9ULB1-3;P58400;F8WB18;A7E294	.;NRX1B_HUMAN;.;.	L	146;100;199;1221;1181;1173;1181;1222;1173;1181	ENSP00000341184:H146L;ENSP00000385580:H199L;ENSP00000385142:H1221L;ENSP00000384311:H1181L;ENSP00000434015:H1173L;ENSP00000385017:H1181L;ENSP00000385434:H1173L;ENSP00000385681:H1181L	ENSP00000341184:H146L	H	-	2	0	NRXN1	50317435	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.871000	0.87180	2.164000	0.68074	0.528000	0.53228	CAT	-	HMMPfam_Laminin_G_2		0.398	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	protein_coding	OTTHUMT00000325291.2	T			50317435	-1	no_errors	NM_004801	genbank	human	reviewed	54_36p	missense	SNP	1	A
ALMS1P	200420	genome.wustl.edu	37	2	73901058	73901058	+	RNA	SNP	C	C	T	rs143380586	byFrequency	TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr2:73901058C>T	ENST00000450720.1	+	0	856					NR_003683.2		Q96L16	ALM1L_HUMAN	Alstrom syndrome 1 pseudogene						endosomal transport (GO:0016197)|regulation of stress fiber assembly (GO:0051492)												GAGCGGGATGCGCTATTCGAC	0.542													.|||	13	0.00259585	0.0	0.0	5008	,	,		18889	0.0119		0.0	False		,,,				2504	0.001															0			2											87.0	76.0	80.0					2																	73901058		692	1591	2283	73754566			200420			BC014492		2p13.2	2008-01-31	2008-01-31	2008-01-31	ENSG00000163016	ENSG00000163016			29586	pseudogene	pseudogene			"""Alstrom syndrome 1-like"""	ALMS1L		12477932	Standard	NR_003683		Approved		uc010yrl.2	Q96L16	OTTHUMG00000152773		2.37:g.73901058C>T		Somatic		Capture	Illumina GAIIx	4	73754566		Missense_Mutation	SNP	-	p.A125V	ENST00000450720.1	37	c.374		2																																																																																			-	NULL		0.542	ALMS1P-002	KNOWN	basic	processed_transcript	ALMS1P	pseudogene	OTTHUMT00000339824.1	C	NR_003683		73754566	1	no_start_codon	ENST00000295136	ensembl	human	known	54_36p	missense	SNP	0.13	T
GCFC2	6936	genome.wustl.edu	37	2	75928348	75928348	+	Nonsense_Mutation	SNP	G	G	A	rs35854365		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr2:75928348G>A	ENST00000321027.3	-	4	818	c.685C>T	c.(685-687)Cag>Tag	p.Q229*	GCFC2_ENST00000409857.3_Nonsense_Mutation_p.Q191*|GCFC2_ENST00000541687.1_Nonsense_Mutation_p.Q229*	NM_001201334.1|NM_003203.4	NP_001188263.1|NP_003194.3	P16383	GCFC2_HUMAN	GC-rich sequence DNA-binding factor 2	229					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.Q229*(1)									CTCATTTGCTGTTGTTCCCAA	0.353																																																1	Substitution - Nonsense(1)	ovary(1)	2											223.0	184.0	197.0					2																	75928348		2203	4299	6502	75781856	SO:0001587	stop_gained	6936			AB026911	CCDS1961.1, CCDS62943.1	2p12	2014-01-17	2011-11-24	2011-11-24	ENSG00000005436	ENSG00000005436			1317	protein-coding gene	gene with protein product	"""GC binding factor"""	189901	"""transcription factor 9 (binds GC-rich sequences)"", ""chromosome 2 open reading frame 3"""	TCF9, C2orf3		1370479, 2556218, 17309879, 24304693	Standard	NM_003203		Approved	DNABF, GCF	uc002sno.3	P16383	OTTHUMG00000129989	ENST00000321027.3:c.685C>T	2.37:g.75928348G>A	ENSP00000318690:p.Gln229*	Somatic		Capture	Illumina GAIIx	4	75781856	A4UHQ8|O95032|Q53TY0|Q6P2F2	Nonsense_Mutation	SNP	-	p.Q229*	ENST00000321027.3	37	c.685	CCDS1961.1	2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297009	0.81025	.	.	ENSG00000005436	ENST00000321027;ENST00000541687;ENST00000409857;ENST00000442309	.	.	.	4.85	3.97	0.46021	.	0.124991	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-15.7266	11.736	0.51765	0.0892:0.0:0.9108:0.0	.	.	.	.	X	229;229;191;154	.	ENSP00000318690:Q229X	Q	-	1	0	C2orf3	75781856	1.000000	0.71417	0.984000	0.44739	0.160000	0.22226	4.991000	0.63883	1.358000	0.45922	0.655000	0.94253	CAG	-	NULL		0.353	GCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf3	protein_coding	OTTHUMT00000252255.2	G	NM_003203		75781856	-1	no_errors	NM_003203	genbank	human	validated	54_36p	nonsense	SNP	1	A
RTP5	285093	genome.wustl.edu	37	2	242815214	242815214	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr2:242815214G>A	ENST00000343216.3	+	2	1535	c.1507G>A	c.(1507-1509)Ggc>Agc	p.G503S		NM_173821.2	NP_776182.2												p.G503S(1)									CTTCTCCCAAGGCTATTACCA	0.652																																																1	Substitution - Missense(1)	ovary(1)	2											65.0	77.0	73.0					2																	242815214		2051	4177	6228	242463887	SO:0001583	missense	285093																														ENST00000343216.3:c.1507G>A	2.37:g.242815214G>A	ENSP00000345374:p.Gly503Ser	Somatic		Capture	Illumina GAIIx	Phase_III	242463887		Missense_Mutation	SNP	-	p.G503S	ENST00000343216.3	37	c.1507	CCDS42843.1	2	.	.	.	.	.	.	.	.	.	.	.	15.79	2.936767	0.52972	.	.	ENSG00000188011	ENST00000343216	T	0.28454	1.61	2.14	-1.07	0.09968	.	.	.	.	.	T	0.18676	0.0448	N	0.19112	0.55	0.09310	N	1	P	0.51147	0.942	P	0.45406	0.479	T	0.12578	-1.0542	9	0.87932	D	0	-4.8096	2.8163	0.05457	0.3314:0.2481:0.4205:0.0	.	503	Q14D33	CB085_HUMAN	S	503	ENSP00000345374:G503S	ENSP00000345374:G503S	G	+	1	0	C2orf85	242463887	0.006000	0.16342	0.000000	0.03702	0.696000	0.40369	0.386000	0.20702	-0.290000	0.09025	0.196000	0.17591	GGC	-	NULL		0.652	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf85	protein_coding	OTTHUMT00000322310.1	G			242463887	1	no_errors	NM_173821	genbank	human	validated	54_36p	missense	SNP	0.008	A
MYO18B	84700	genome.wustl.edu	37	22	26423142	26423142	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr22:26423142A>G	ENST00000407587.2	+	43	7374	c.7205A>G	c.(7204-7206)aAg>aGg	p.K2402R	MYO18B_ENST00000536101.1_Missense_Mutation_p.K2401R|MYO18B_ENST00000335473.7_Missense_Mutation_p.K2401R			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2401						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.K2402R(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GACCTTGGAAAGGAGCCGCTT	0.597																																																1	Substitution - Missense(1)	ovary(1)	22											63.0	69.0	67.0					22																	26423142		1952	4132	6084	24753142	SO:0001583	missense	84700			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7205A>G	22.37:g.26423142A>G	ENSP00000386096:p.Lys2402Arg	Somatic		Capture	Illumina GAIIx	4	24753142	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	HMMPfam_Myosin_head;superfamily_tRNA-binding arm;superfamily_P-loop containing nucleoside triphosphate hydrolases;HMMPfam_IQ	p.K2401R	ENST00000407587.2	37	c.7202		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.11|13.11	2.138911|2.138911	0.37728|0.37728	.|.	.|.	ENSG00000133454|ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587|ENST00000543971	D;D;D|.	0.87491|.	-2.24;-2.24;-2.26|.	5.12|5.12	2.94|2.94	0.34122|0.34122	.|.	0.467890|.	0.18958|.	N|.	0.126479|.	T|T	0.34890|0.34890	0.0913|0.0913	L|L	0.46157|0.46157	1.445|1.445	0.09310|0.09310	N|N	1|1	P;P;P;D;P|.	0.76494|.	0.865;0.881;0.881;0.999;0.927|.	B;B;B;D;P|.	0.68765|.	0.421;0.322;0.322;0.96;0.521|.	T|T	0.27536|0.27536	-1.0071|-1.0071	10|5	0.54805|.	T|.	0.06|.	.|.	2.6085|2.6085	0.04884|0.04884	0.6107:0.1552:0.0847:0.1495|0.6107:0.1552:0.0847:0.1495	.|.	1914;2403;2401;2402;2401|.	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7|.	.;.;MY18B_HUMAN;.;.|.	R|G	2401;2401;2402|351	ENSP00000441229:K2401R;ENSP00000334563:K2401R;ENSP00000386096:K2402R|.	ENSP00000334563:K2401R|.	K|R	+|+	2|1	0|2	MYO18B|MYO18B	24753142|24753142	0.148000|0.148000	0.22702|0.22702	0.498000|0.498000	0.27564|0.27564	0.466000|0.466000	0.32739|0.32739	0.646000|0.646000	0.24797|0.24797	0.757000|0.757000	0.33036|0.33036	0.459000|0.459000	0.35465|0.35465	AAG|AGG	-	NULL		0.597	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	protein_coding	OTTHUMT00000400691.1	A	NM_032608		24753142	1	no_errors	NM_032608	genbank	human	reviewed	54_36p	missense	SNP	0.04	G
SNHG14	104472715	genome.wustl.edu	37	15	25332897	25332897	+	RNA	SNP	G	G	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr15:25332897G>T	ENST00000546682.1	+	0	586				SNHG14_ENST00000549804.2_RNA|SNHG14_ENST00000384430.1_RNA|SNORD116-19_ENST00000384729.1_RNA|SNORD116-20_ENST00000384529.1_lincRNA|SNORD116-20_ENST00000384507.1_lincRNA|SNORD116-18_ENST00000383961.1_RNA|SNHG14_ENST00000553108.1_RNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		TCGAACTGAGGTCCAGCACAT	0.443																																																0			15											229.0	199.0	208.0					15																	25332897		876	1991	2867	22883990			100033431					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25332897G>T		Somatic		Capture	Illumina GAIIx	4	22883990		RNA	SNP	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			-	-		0.443	SNHG14-022	KNOWN	basic	antisense	SNORD116-20	processed_transcript	OTTHUMT00000408281.1	G			22883990	1	no_errors	NR_003334	genbank	human	provisional	54_36p	rna	SNP	0.36	T
KBTBD12	166348	genome.wustl.edu	37	3	127682210	127682210	+	Silent	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr3:127682210C>T	ENST00000405109.1	+	5	2138	c.1671C>T	c.(1669-1671)tgC>tgT	p.C557C	KBTBD12_ENST00000405256.1_Silent_p.C557C|KBTBD12_ENST00000492025.1_3'UTR|KBTBD12_ENST00000407609.3_Silent_p.C164C|KBTBD12_ENST00000343941.4_Silent_p.C132C|RNA5SP139_ENST00000364340.1_RNA			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	557								p.C557C(1)		endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						TCTATGTCTGCGGGGGATTCC	0.498																																																1	Substitution - coding silent(1)	ovary(1)	3											40.0	33.0	35.0					3																	127682210		2203	4300	6503	129164900	SO:0001819	synonymous_variant	166348				CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.1671C>T	3.37:g.127682210C>T		Somatic		Capture	Illumina GAIIx	4	129164900	B5MCC6|Q6ZRK1	Silent	SNP	-	p.C557	ENST00000405109.1	37	c.1671	CCDS33848.2	3																																																																																			-	NULL		0.498	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC6	protein_coding	OTTHUMT00000318682.1	C	NM_207335		129164900	1	no_errors	NM_207335	genbank	human	validated	54_36p	silent	SNP	1	T
SETD5	55209	genome.wustl.edu	37	3	9512592	9512592	+	Silent	SNP	G	G	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr3:9512592G>A	ENST00000406341.1	+	18	3364	c.3174G>A	c.(3172-3174)caG>caA	p.Q1058Q	SETD5_ENST00000302463.6_Silent_p.Q960Q|SETD5_ENST00000407969.1_Silent_p.Q1077Q|SETD5_ENST00000402466.1_Silent_p.Q960Q|SETD5_ENST00000402198.1_Silent_p.Q1058Q			Q9C0A6	SETD5_HUMAN	SET domain containing 5	1058								p.Q960Q(1)|p.Q1058Q(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		CTGCCCCCCAGAACCCACCAC	0.433																																																2	Substitution - coding silent(2)	ovary(2)	3											15.0	14.0	15.0					3																	9512592		1849	4075	5924	9487592	SO:0001819	synonymous_variant	55209			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.3174G>A	3.37:g.9512592G>A		Somatic		Capture	Illumina GAIIx	4	9487592	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Silent	SNP	-	p.Q1058	ENST00000406341.1	37	c.3174	CCDS46741.1	3	.	.	.	.	.	.	.	.	.	.	G	8.597	0.885847	0.17540	.	.	ENSG00000168137	ENST00000399686;ENST00000421188	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	T	0.75413	0.3846	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73566	-0.3942	4	.	.	.	-10.3697	19.3917	0.94585	0.0:0.0:1.0:0.0	.	.	.	.	K	726;389	.	.	E	+	1	0	SETD5	9487592	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.195000	0.51013	2.585000	0.87301	0.591000	0.81541	GAA	-	NULL		0.433	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	SETD5	protein_coding	OTTHUMT00000318425.1	G	XM_371614		9487592	1	no_errors	NM_001080517	genbank	human	provisional	54_36p	silent	SNP	1	A
NEK10	152110	genome.wustl.edu	37	3	27204018	27204018	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr3:27204018C>G	ENST00000429845.2	-	32	3306	c.2944G>C	c.(2944-2946)Gag>Cag	p.E982Q	NEK10_ENST00000383771.4_Missense_Mutation_p.E294Q|NEK10_ENST00000357467.2_Missense_Mutation_p.E379Q|NEK10_ENST00000383770.3_Intron|NEK10_ENST00000498182.1_Intron|NEK10_ENST00000295720.6_Missense_Mutation_p.E294Q			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	982					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GTCACTAACTCAGCCTCTATT	0.458																																																0			3											97.0	94.0	95.0					3																	27204018		2203	4300	6503	27179022	SO:0001583	missense	152110			AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.2944G>C	3.37:g.27204018C>G	ENSP00000395849:p.Glu982Gln	Somatic		Capture	Illumina GAIIx	4	27179022	A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	-	p.E379Q	ENST00000429845.2	37	c.1135		3	.	.	.	.	.	.	.	.	.	.	C	9.994	1.231550	0.22626	.	.	ENSG00000163491	ENST00000295720;ENST00000383771;ENST00000357467	T;T;T	0.73897	2.79;2.86;-0.79	5.69	3.7	0.42460	.	.	.	.	.	T	0.45617	0.1351	.	.	.	0.19575	N	0.999964	B;B	0.25609	0.13;0.023	B;B	0.24701	0.055;0.015	T	0.44205	-0.9343	8	0.02654	T	1	.	5.2135	0.15331	0.2539:0.6392:0.0:0.107	.	294;379	Q6ZWH5-5;Q8N774	.;.	Q	294;294;379	ENSP00000295720:E294Q;ENSP00000373281:E294Q;ENSP00000350059:E379Q	ENSP00000295720:E294Q	E	-	1	0	NEK10	27179022	0.755000	0.28372	0.943000	0.38184	0.767000	0.43475	0.234000	0.17930	1.375000	0.46248	0.655000	0.94253	GAG	-	NULL		0.458	NEK10-016	NOVEL	basic|appris_principal	protein_coding	NEK10	protein_coding	OTTHUMT00000438156.1	C	NM_152534		27179022	-1	no_errors	ENST00000396636	ensembl	human	known	54_36p	missense	SNP	0.98	G
TGFBR2	7048	genome.wustl.edu	37	3	30729881	30729881	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr3:30729881A>C	ENST00000295754.5	+	6	1784	c.1402A>C	c.(1402-1404)Aaa>Caa	p.K468Q	TGFBR2_ENST00000359013.4_Missense_Mutation_p.K493Q	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	468	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.K468Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CACAGAAGTAAAAGATTATGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	3											115.0	109.0	111.0					3																	30729881		2203	4300	6503	30704885	SO:0001583	missense	7048				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1402A>C	3.37:g.30729881A>C	ENSP00000295754:p.Lys468Gln	Somatic		Capture	Illumina GAIIx	4	30704885	B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	Pkinase;HMMPfam_Pkinase;ecTbetaR2;HMMPfam_ecTbetaR2	p.K493Q	ENST00000295754.5	37	c.1477	CCDS2648.1	3	.	.	.	.	.	.	.	.	.	.	A	23.8	4.457257	0.84317	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	D;D	0.93366	-3.21;-3.21	5.17	5.17	0.71159	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93739	0.7999	N	0.25332	0.735	0.58432	D	0.999999	D;D	0.69078	0.997;0.993	D;D	0.70487	0.969;0.958	D	0.94260	0.7501	10	0.51188	T	0.08	.	15.3078	0.74008	1.0:0.0:0.0:0.0	.	468;493	P37173;D2JYI1	TGFR2_HUMAN;.	Q	468;493;298	ENSP00000295754:K468Q;ENSP00000351905:K493Q	ENSP00000295754:K468Q	K	+	1	0	TGFBR2	30704885	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	9.236000	0.95360	2.079000	0.62486	0.482000	0.46254	AAA	-	HMMPfam_Pkinase		0.512	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	protein_coding	OTTHUMT00000252994.2	A			30704885	1	no_errors	NM_001024847	genbank	human	reviewed	54_36p	missense	SNP	1	C
ITIH1	3697	genome.wustl.edu	37	3	52822297	52822297	+	Silent	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr3:52822297C>T	ENST00000273283.2	+	18	2079	c.2055C>T	c.(2053-2055)acC>acT	p.T685T	ITIH1_ENST00000542827.1_Missense_Mutation_p.P640S|ITIH1_ENST00000537050.1_Silent_p.T397T|ITIH1_ENST00000540715.1_Silent_p.T543T|ITIH1_ENST00000405128.3_Silent_p.T51T	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	685	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.T685T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		AAGAGGACACCCTGTGCTTCA	0.567																																																1	Substitution - coding silent(1)	ovary(1)	3											126.0	102.0	110.0					3																	52822297		2203	4299	6502	52797337	SO:0001819	synonymous_variant	3697				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2055C>T	3.37:g.52822297C>T		Somatic		Capture	Illumina GAIIx	Phase_III	52797337	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Silent	SNP	-	p.T685	ENST00000273283.2	37	c.2055	CCDS2864.1	3	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392745	0.25118	.	.	ENSG00000055957	ENST00000542827	T	0.01963	4.53	5.39	-2.69	0.06022	.	.	.	.	.	T	0.01124	0.0037	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.48210	-0.9055	6	0.17832	T	0.49	-7.364	1.0882	0.01658	0.2256:0.3565:0.2198:0.1981	.	.	.	.	S	640	ENSP00000442584:P640S	ENSP00000442584:P640S	P	+	1	0	ITIH1	52797337	0.000000	0.05858	0.000000	0.03702	0.575000	0.36095	-1.666000	0.01963	-0.591000	0.05859	0.655000	0.94253	CCT	-	NULL		0.567	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	protein_coding	OTTHUMT00000317522.1	C	NM_002215		52797337	1	no_errors	NM_002215	genbank	human	validated	54_36p	silent	SNP	0.023	T
ROBO2	6092	genome.wustl.edu	37	3	76484116	76484116	+	Intron	SNP	T	T	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr3:76484116T>C	ENST00000487694.3	+	2	388					NM_001128929.2	NP_001122401.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)						apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CCAGCTGTACTTGAACTGGAG	0.493																																																0			3																																								76566806	SO:0001627	intron_variant	401076			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000487694.3:c.109+497363T>C	3.37:g.76484116T>C		Somatic		Capture	Illumina GAIIx	4	76566806	O43608|Q19AB4|Q19AB5	RNA	SNP	-	NULL	ENST00000487694.3	37	NULL	CCDS54609.1	3																																																																																			-	-		0.493	ROBO2-013	NOVEL	basic|CCDS	protein_coding	LOC401076	protein_coding	OTTHUMT00000467720.1	T	XM_031246		76566806	1	pseudogene	XR_016406	genbank	human	model	54_36p	rna	SNP	1	C
HTR1F	3355	genome.wustl.edu	37	3	88040240	88040240	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr3:88040240T>C	ENST00000319595.4	+	1	395	c.341T>C	c.(340-342)cTc>cCc	p.L114P		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	114					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.L114P(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	ATCTTGCATCTCTCAGCTATA	0.448																																																1	Substitution - Missense(1)	ovary(1)	3											86.0	72.0	77.0					3																	88040240		2203	4300	6503	88122930	SO:0001583	missense	3355			L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.341T>C	3.37:g.88040240T>C	ENSP00000322924:p.Leu114Pro	Somatic		Capture	Illumina GAIIx	4	88122930		Missense_Mutation	SNP	-	p.L114P	ENST00000319595.4	37	c.341	CCDS2920.1	3	.	.	.	.	.	.	.	.	.	.	T	18.26	3.583963	0.65992	.	.	ENSG00000179097	ENST00000319595	D	0.81659	-1.52	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.93684	0.7982	H	0.98833	4.345	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95612	0.8673	10	0.87932	D	0	.	12.9737	0.58527	0.0:0.0:0.0:1.0	.	114	P30939	5HT1F_HUMAN	P	114	ENSP00000322924:L114P	ENSP00000322924:L114P	L	+	2	0	HTR1F	88122930	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.004000	0.88535	1.964000	0.57103	0.397000	0.26171	CTC	-	NULL		0.448	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1F	protein_coding	OTTHUMT00000352890.1	T	NM_000866		88122930	1	no_errors	NM_000866	genbank	human	validated	54_36p	missense	SNP	1	C
OR5K2	402135	genome.wustl.edu	37	3	98216962	98216962	+	Silent	SNP	A	A	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr3:98216962A>T	ENST00000427338.1	+	1	515	c.438A>T	c.(436-438)acA>acT	p.T146T	CLDND1_ENST00000502288.1_3'UTR	NM_001004737.1	NP_001004737.1	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K, member 2	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T146T(1)		endometrium(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AGATGACCACAGGCGCCTTCA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	3											145.0	147.0	146.0					3																	98216962		2203	4300	6503	99699652	SO:0001819	synonymous_variant	402135			AC021660	CCDS33804.1	3q11.2	2013-09-23			ENSG00000231861	ENSG00000231861		"""GPCR / Class A : Olfactory receptors"""	14774	protein-coding gene	gene with protein product							Standard	NM_001004737		Approved		uc011bgx.2	Q8NHB8	OTTHUMG00000160049	ENST00000427338.1:c.438A>T	3.37:g.98216962A>T		Somatic		Capture	Illumina GAIIx	4	99699652	B2RN70|Q6IF47	Silent	SNP	-	p.T146	ENST00000427338.1	37	c.438	CCDS33804.1	3																																																																																			-	NULL		0.458	OR5K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K2	protein_coding	OTTHUMT00000359020.2	A			99699652	1	no_errors	NM_001004737	genbank	human	provisional	54_36p	silent	SNP		T
CPN2	1370	genome.wustl.edu	37	3	194062030	194062030	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr3:194062030A>T	ENST00000323830.3	-	2	1491	c.1402T>A	c.(1402-1404)Tgg>Agg	p.W468R	CPN2_ENST00000429275.1_Missense_Mutation_p.W468R	NM_001080513.2	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	468					protein stabilization (GO:0050821)|regulation of catalytic activity (GO:0050790)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme regulator activity (GO:0030234)	p.W468R(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(5)|prostate(1)	27	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		GCCAGATCCCAGCTGCCCCCT	0.667																																																1	Substitution - Missense(1)	ovary(1)	3											58.0	61.0	60.0					3																	194062030		2203	4300	6503	195543725	SO:0001583	missense	1370			J05158	CCDS33920.1	3q29	2012-02-10	2007-02-23		ENSG00000178772	ENSG00000178772	3.4.17.3		2313	protein-coding gene	gene with protein product		603104	"""carboxypeptidase N, polypeptide 2, 83kD"""	ACBP		2378615, 9628828	Standard	XM_005269280		Approved		uc003fts.3	P22792	OTTHUMG00000156047	ENST00000323830.3:c.1402T>A	3.37:g.194062030A>T	ENSP00000319464:p.Trp468Arg	Somatic		Capture	Illumina GAIIx	4	195543725	B2RPE7|Q86SU4|Q8N5V4	Missense_Mutation	SNP	-	p.W468R	ENST00000323830.3	37	c.1402	CCDS33920.1	3	.	.	.	.	.	.	.	.	.	.	A	16.64	3.178678	0.57692	.	.	ENSG00000178772	ENST00000323830;ENST00000429275	T;T	0.52526	0.66;0.66	5.56	4.4	0.53042	.	0.000000	0.35207	N	0.003380	T	0.31071	0.0785	L	0.29908	0.895	0.36065	D	0.841695	B	0.21753	0.06	B	0.20577	0.03	T	0.24905	-1.0147	10	0.20046	T	0.44	.	6.8309	0.23909	0.7805:0.0:0.2195:0.0	.	468	P22792	CPN2_HUMAN	R	468	ENSP00000319464:W468R;ENSP00000402232:W468R	ENSP00000319464:W468R	W	-	1	0	CPN2	195543725	0.947000	0.32204	0.695000	0.30226	0.882000	0.50991	1.416000	0.34759	1.045000	0.40225	0.533000	0.62120	TGG	-	NULL		0.667	CPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPN2	protein_coding	OTTHUMT00000342856.2	A	NM_001080513		195543725	-1	no_errors	NM_001080513	genbank	human	validated	54_36p	missense	SNP	0.38	T
TLR6	10333	genome.wustl.edu	37	4	38829983	38829983	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr4:38829983T>C	ENST00000381950.1	-	1	1177	c.1112A>G	c.(1111-1113)gAa>gGa	p.E371G	TLR6_ENST00000436693.2_Missense_Mutation_p.E371G			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	371					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.E371G(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGAACATTTTTCAAAAATACT	0.348																																																1	Substitution - Missense(1)	ovary(1)	4											43.0	45.0	44.0					4																	38829983		2202	4300	6502	38506378	SO:0001583	missense	10333				CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.1112A>G	4.37:g.38829983T>C	ENSP00000371376:p.Glu371Gly	Somatic		Capture	Illumina GAIIx	4	38506378	B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Missense_Mutation	SNP	-	p.E371G	ENST00000381950.1	37	c.1112	CCDS3446.1	4	.	.	.	.	.	.	.	.	.	.	T	11.40	1.628975	0.28978	.	.	ENSG00000174130	ENST00000436693;ENST00000381950;ENST00000508542	T;T	0.53206	0.63;0.63	5.15	3.9	0.45041	.	0.538617	0.18974	N	0.126058	T	0.41834	0.1176	L	0.47190	1.495	0.21915	N	0.999477	B	0.13594	0.008	B	0.17722	0.019	T	0.43310	-0.9399	10	0.72032	D	0.01	.	11.8156	0.52209	0.0:0.0:0.1465:0.8535	.	371	Q9Y2C9	TLR6_HUMAN	G	371	ENSP00000389600:E371G;ENSP00000371376:E371G	ENSP00000371376:E371G	E	-	2	0	TLR6	38506378	0.138000	0.22547	0.976000	0.42696	0.732000	0.41865	2.005000	0.40864	1.940000	0.56252	0.402000	0.26972	GAA	-	NULL		0.348	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR6	protein_coding	OTTHUMT00000250431.1	T			38506378	-1	no_errors	NM_006068	genbank	human	reviewed	54_36p	missense	SNP	0.92	C
FAT1	2195	genome.wustl.edu	37	4	187557245	187557245	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr4:187557245C>T	ENST00000441802.2	-	6	4326	c.4117G>A	c.(4117-4119)Gtt>Att	p.V1373I		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1373	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V1373I(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						ATGTGAGCAACGGGGTCACTT	0.458										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)											1	Substitution - Missense(1)	ovary(1)	4											71.0	69.0	69.0					4																	187557245		1881	4111	5992	187794239	SO:0001583	missense	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.4117G>A	4.37:g.187557245C>T	ENSP00000406229:p.Val1373Ile	Somatic		Capture	Illumina GAIIx	4	187794239		Missense_Mutation	SNP	-	p.V1373I	ENST00000441802.2	37	c.4117	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785063	0.90282	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.71341	-0.56	5.4	5.4	0.78164	Cadherin (2);Cadherin-like (1);	0.122576	0.53938	D	0.000048	D	0.83496	0.5267	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80460	-0.1373	10	0.32370	T	0.25	.	19.3716	0.94490	0.0:1.0:0.0:0.0	.	1373	Q14517	FAT1_HUMAN	I	1373	ENSP00000406229:V1373I	ENSP00000260147:V1373I	V	-	1	0	FAT1	187794239	1.000000	0.71417	0.861000	0.33841	0.598000	0.36846	5.588000	0.67517	2.805000	0.96524	0.655000	0.94253	GTT	-	NULL		0.458	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	protein_coding	OTTHUMT00000360209.3	C	NM_005245		187794239	-1	no_errors	NM_005245	genbank	human	reviewed	54_36p	missense	SNP	1	T
PCDHA7	56141	genome.wustl.edu	37	5	140215375	140215375	+	Silent	SNP	G	G	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr5:140215375G>A	ENST00000525929.1	+	1	1407	c.1407G>A	c.(1405-1407)ccG>ccA	p.P469P	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000378125.3_Silent_p.P469P|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	469	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P469P(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAACAACCCGCCGGGCTGCC	0.682																																					NSCLC(160;258 2013 5070 22440 28951)											1	Substitution - coding silent(1)	ovary(1)	5											42.0	48.0	46.0					5																	140215375		2202	4298	6500	140195559	SO:0001819	synonymous_variant	56141			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1407G>A	5.37:g.140215375G>A		Somatic		Capture	Illumina GAIIx	Phase_III	140195559	O75282	Silent	SNP	-	p.P469	ENST00000525929.1	37	c.1407	CCDS54918.1	5																																																																																			-	NULL		0.682	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	protein_coding	OTTHUMT00000372887.2	G	NM_018910		140195559	1	no_errors	NM_018910	genbank	human	reviewed	54_36p	silent	SNP	0.575	A
PCDHB16	57717	genome.wustl.edu	37	5	140568415	140568415	+	IGR	SNP	G	G	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr5:140568415G>C	ENST00000361016.2	+	0	4814					NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCATCAACGCGGACAATGGCC	0.667																																																0			5											104.0	123.0	117.0					5																	140568415		2203	4299	6502	140548599	SO:0001628	intergenic_variant	56127			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325		5.37:g.140568415G>C		Somatic		Capture	Illumina GAIIx	4	140548599	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	-	p.R508P	ENST00000361016.2	37	c.1523	CCDS4251.1	5																																																																																			-	NULL		0.667	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB9	protein_coding	OTTHUMT00000251800.1	G	NM_020957		140548599	1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_019119	genbank	human	reviewed	54_36p	missense	SNP		C
RNF145	153830	genome.wustl.edu	37	5	158603759	158603759	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr5:158603759T>C	ENST00000424310.2	-	5	861	c.502A>G	c.(502-504)Att>Gtt	p.I168V	RNF145_ENST00000274542.2_Missense_Mutation_p.I196V|RNF145_ENST00000519865.1_Missense_Mutation_p.I168V|RNF145_ENST00000520638.1_Missense_Mutation_p.I182V|RNF145_ENST00000518802.1_Missense_Mutation_p.I198V|RNF145_ENST00000521606.2_Missense_Mutation_p.I185V	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	168						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.I196V(1)		endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATGATAACAATTGTCTCCAAA	0.378																																																1	Substitution - Missense(1)	ovary(1)	5											52.0	52.0	52.0					5																	158603759		2203	4300	6503	158536337	SO:0001583	missense	153830			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.502A>G	5.37:g.158603759T>C	ENSP00000409064:p.Ile168Val	Somatic		Capture	Illumina GAIIx	4	158536337	B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	-	p.I196V	ENST00000424310.2	37	c.586	CCDS56390.1	5	.	.	.	.	.	.	.	.	.	.	T	16.31	3.087080	0.55861	.	.	ENSG00000145860	ENST00000274542;ENST00000519865;ENST00000424310;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000535312;ENST00000520638	T;T;T;T;T;T;T	0.76709	-1.04;-1.02;-1.02;-1.03;-1.03;-1.04;-1.03	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.63117	0.2484	N	0.08118	0	0.58432	D	0.999997	P;P;P;P;P;P	0.39535	0.677;0.677;0.677;0.677;0.483;0.627	B;B;B;B;B;B	0.40199	0.322;0.322;0.322;0.322;0.322;0.216	T	0.66444	-0.5922	10	0.33940	T	0.23	-20.5003	15.8333	0.78778	0.0:0.0:0.0:1.0	.	184;185;182;198;168;196	E7EW26;B7Z949;B7Z903;E7EVI7;Q96MT1;Q96MT1-2	.;.;.;.;RN145_HUMAN;.	V	196;168;168;184;185;198;168;182	ENSP00000274542:I196V;ENSP00000430397:I168V;ENSP00000409064:I168V;ENSP00000430753:I184V;ENSP00000445115:I185V;ENSP00000430955:I198V;ENSP00000429071:I182V	ENSP00000274542:I196V	I	-	1	0	RNF145	158536337	1.000000	0.71417	0.783000	0.31826	0.945000	0.59286	4.992000	0.63889	2.200000	0.70718	0.377000	0.23210	ATT	-	NULL		0.378	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF145	protein_coding	OTTHUMT00000374048.1	T	NM_144726		158536337	-1	no_errors	NM_144726	genbank	human	provisional	54_36p	missense	SNP	1	C
ZNF354C	30832	genome.wustl.edu	37	5	178505824	178505824	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr5:178505824G>C	ENST00000315475.6	+	5	697	c.391G>C	c.(391-393)Gag>Cag	p.E131Q		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	131					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E131Q(1)		endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		TGTGGAATTTGAGAGCGAGAT	0.378																																																1	Substitution - Missense(1)	ovary(1)	5											88.0	93.0	91.0					5																	178505824		2203	4300	6503	178438430	SO:0001583	missense	30832				CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.391G>C	5.37:g.178505824G>C	ENSP00000324064:p.Glu131Gln	Somatic		Capture	Illumina GAIIx	4	178438430	Q6P4P9|Q8NFX1	Missense_Mutation	SNP	-	p.E131Q	ENST00000315475.6	37	c.391	CCDS4443.1	5	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714712	0.30413	.	.	ENSG00000177932	ENST00000315475	T	0.05447	3.44	3.87	2.03	0.26663	.	.	.	.	.	T	0.05227	0.0139	L	0.38175	1.15	0.09310	N	1	B	0.17465	0.022	B	0.09377	0.004	T	0.39840	-0.9594	9	0.34782	T	0.22	-4.6231	5.1769	0.15139	0.1169:0.2128:0.6703:0.0	.	131	Q86Y25	Z354C_HUMAN	Q	131	ENSP00000324064:E131Q	ENSP00000324064:E131Q	E	+	1	0	ZNF354C	178438430	0.029000	0.19370	0.003000	0.11579	0.018000	0.09664	0.547000	0.23299	0.385000	0.24970	0.591000	0.81541	GAG	-	NULL		0.378	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354C	protein_coding	OTTHUMT00000253473.2	G			178438430	1	no_errors	NM_014594	genbank	human	provisional	54_36p	missense	SNP	0.98	C
ASCC3	10973	genome.wustl.edu	37	6	101165950	101165950	+	Splice_Site	SNP	C	C	G			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr6:101165950C>G	ENST00000369162.2	-	12	2424		c.e12+1		ASCC3_ENST00000522650.1_Splice_Site	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3						cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.?(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TGAGTATTTACCTTATTTGCA	0.318																																																1	Unknown(1)	ovary(1)	6											47.0	49.0	48.0					6																	101165950		2202	4299	6501	101272671	SO:0001630	splice_region_variant	10973			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.2079+1G>C	6.37:g.101165950C>G		Somatic		Capture	Illumina GAIIx	4	101272671	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Splice_Site	SNP	-	e11+1	ENST00000369162.2	37	c.2079+1	CCDS5046.1	6	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747962	0.89663	.	.	ENSG00000112249	ENST00000369162;ENST00000522650	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4129	0.94683	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ASCC3	101272671	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.818000	0.86416	2.580000	0.87095	0.585000	0.79938	.	-	-		0.318	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCC3	protein_coding	OTTHUMT00000041632.2	C	NM_006828	Intron	101272671	-1	no_errors	NM_006828	genbank	human	validated	54_36p	splice_site	SNP	1	G
TAAR6	319100	genome.wustl.edu	37	6	132892221	132892221	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr6:132892221G>T	ENST00000275198.1	+	1	761	c.761G>T	c.(760-762)aGa>aTa	p.R254I		NM_175067.1	NP_778237.1	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	254					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.R254I(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(19)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		AGGAGAGAGAGAAAAGCAGCT	0.413																																																1	Substitution - Missense(1)	ovary(1)	6											89.0	86.0	87.0					6																	132892221		2203	4300	6503	132933914	SO:0001583	missense	319100			AF380192	CCDS5155.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146383	ENSG00000146383		"""GPCR / Class A : Trace amine associated receptors"""	20978	protein-coding gene	gene with protein product		608923	"""trace amine receptor 4"""	TRAR4		11459929, 15718104	Standard	NM_175067		Approved	TA4	uc011eck.2	Q96RI8	OTTHUMG00000015579	ENST00000275198.1:c.761G>T	6.37:g.132892221G>T	ENSP00000275198:p.Arg254Ile	Somatic		Capture	Illumina GAIIx	4	132933914	Q5VUQ4	Missense_Mutation	SNP	-	p.R254I	ENST00000275198.1	37	c.761	CCDS5155.1	6	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527781	0.64860	.	.	ENSG00000146383	ENST00000275198;ENST00000539228	T	0.73575	-0.76	5.11	5.11	0.69529	GPCR, rhodopsin-like superfamily (1);	0.093749	0.42682	D	0.000661	D	0.85026	0.5603	M	0.86805	2.84	0.43287	D	0.99526	D	0.89917	1.0	D	0.83275	0.996	D	0.86923	0.2068	10	0.72032	D	0.01	-11.0269	13.064	0.59022	0.0769:0.0:0.9231:0.0	.	254	Q96RI8	TAAR6_HUMAN	I	254;229	ENSP00000275198:R254I	ENSP00000275198:R254I	R	+	2	0	TAAR6	132933914	0.955000	0.32602	1.000000	0.80357	0.996000	0.88848	1.861000	0.39438	2.639000	0.89480	0.650000	0.86243	AGA	-	NULL		0.413	TAAR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAAR6	protein_coding	OTTHUMT00000042255.1	G	NM_175067		132933914	1	no_errors	NM_175067	genbank	human	provisional	54_36p	missense	SNP	1	T
PPIL1	51645	genome.wustl.edu	37	6	36842541	36842541	+	Missense_Mutation	SNP	G	G	A	rs201439954		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr6:36842541G>A	ENST00000373699.5	-	1	259	c.8C>T	c.(7-9)gCa>gTa	p.A3V	C6orf89_ENST00000359359.2_Intron|C6orf89_ENST00000510325.2_Intron	NM_016059.4	NP_057143.1	Q9Y3C6	PPIL1_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 1	3					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.A3V(1)		lung(1)|ovary(1)	2						TGGGGGAATTGCCGCCATAGC	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		17327	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	6											27.0	31.0	30.0					6																	36842541		2203	4300	6503	36950519	SO:0001583	missense	51645			AF090992	CCDS4826.1	6p21.1	2008-08-29			ENSG00000137168	ENSG00000137168			9260	protein-coding gene	gene with protein product		601301				10072585, 8978786	Standard	NM_016059		Approved	CYPL1	uc003omu.2	Q9Y3C6	OTTHUMG00000014612	ENST00000373699.5:c.8C>T	6.37:g.36842541G>A	ENSP00000362803:p.Ala3Val	Somatic		Capture	Illumina GAIIx	Phase_III	36950519	O15001|Q5TDC9	Missense_Mutation	SNP	-	p.A3V	ENST00000373699.5	37	c.8	CCDS4826.1	6	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.45	3.627708	0.66901	.	.	ENSG00000137168	ENST00000373699	T	0.23950	1.88	5.49	5.49	0.81192	.	0.059397	0.64402	D	0.000004	T	0.08133	0.0203	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06534	-1.0821	10	0.49607	T	0.09	.	12.5857	0.56416	0.0:0.167:0.833:0.0	.	3	Q9Y3C6	PPIL1_HUMAN	V	3	ENSP00000362803:A3V	ENSP00000362803:A3V	A	-	2	0	PPIL1	36950519	1.000000	0.71417	0.979000	0.43373	0.692000	0.40212	6.147000	0.71783	2.596000	0.87737	0.557000	0.71058	GCA	-	NULL		0.637	PPIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL1	protein_coding	OTTHUMT00000040382.1	G			36950519	-1	no_errors	NM_016059	genbank	human	reviewed	54_36p	missense	SNP	0.945	A
FNDC1	84624	genome.wustl.edu	37	6	159653534	159653534	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr6:159653534G>A	ENST00000297267.9	+	11	2190	c.1990G>A	c.(1990-1992)Gcc>Acc	p.A664T	FNDC1_ENST00000340366.6_Missense_Mutation_p.A601T	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	664					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A664T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GGGCGCCTTCGCCCAGCCCCG	0.682																																																1	Substitution - Missense(1)	ovary(1)	6											16.0	21.0	19.0					6																	159653534		1990	4126	6116	159573524	SO:0001583	missense	84624			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1990G>A	6.37:g.159653534G>A	ENSP00000297267:p.Ala664Thr	Somatic		Capture	Illumina GAIIx	4	159573524	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	-	p.A664T	ENST00000297267.9	37	c.1990	CCDS47512.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.51|11.51	1.659471|1.659471	0.29515|0.29515	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000297267;ENST00000340366|ENST00000329629	T;T|.	0.07800|.	3.16;3.91|.	4.41|4.41	-2.31|-2.31	0.06765|0.06765	.|.	0.908340|.	0.09468|.	N|.	0.798079|.	T|T	0.05731|0.05731	0.0150|0.0150	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B|.	0.19935|.	0.04;0.024|.	B;B|.	0.10450|.	0.005;0.002|.	T|T	0.36286|0.36286	-0.9754|-0.9754	10|5	0.14252|.	T|.	0.57|.	-3.266|-3.266	1.1723|1.1723	0.01828|0.01828	0.1368:0.1975:0.3312:0.3346|0.1368:0.1975:0.3312:0.3346	.|.	601;664|.	Q4ZHG4-2;Q4ZHG4|.	.;FNDC1_HUMAN|.	T|H	664;601|559	ENSP00000297267:A664T;ENSP00000342460:A601T|.	ENSP00000297267:A664T|.	A|R	+|+	1|2	0|0	FNDC1|FNDC1	159573524|159573524	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.013000|0.013000	0.08279|0.08279	-0.319000|-0.319000	0.08039|0.08039	-0.640000|-0.640000	0.05495|0.05495	-0.136000|-0.136000	0.14681|0.14681	GCC|CGC	-	NULL		0.682	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	protein_coding	OTTHUMT00000042897.3	G	NM_032532		159573524	1	no_errors	NM_032532	genbank	human	validated	54_36p	missense	SNP	0	A
BBS9	27241	genome.wustl.edu	37	7	33376159	33376159	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr7:33376159G>T	ENST00000242067.6	+	10	1644	c.1123G>T	c.(1123-1125)Gaa>Taa	p.E375*	BBS9_ENST00000355070.2_Nonsense_Mutation_p.E375*|BBS9_ENST00000350941.3_Nonsense_Mutation_p.E375*|BBS9_ENST00000354265.4_Nonsense_Mutation_p.E375*|BBS9_ENST00000396127.2_Nonsense_Mutation_p.E375*	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	375					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.E375*(1)	BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			TCAATCTCGAGAACTAAACTA	0.378									Bardet-Biedl syndrome																																							1	Substitution - Nonsense(1)	ovary(1)	7											82.0	73.0	76.0					7																	33376159		2203	4300	6503	33342684	SO:0001587	stop_gained	27241	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1123G>T	7.37:g.33376159G>T	ENSP00000242067:p.Glu375*	Somatic		Capture	Illumina GAIIx	4	33342684	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Nonsense_Mutation	SNP	-	p.E375*	ENST00000242067.6	37	c.1123	CCDS43566.1	7	.	.	.	.	.	.	.	.	.	.	G	42	9.201737	0.99098	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000537775	.	.	.	5.54	5.54	0.83059	.	0.108196	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-22.6325	19.4774	0.94994	0.0:0.0:1.0:0.0	.	.	.	.	X	375;375;375;375;375;375;375;253	.	ENSP00000242067:E375X	E	+	1	0	BBS9	33342684	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	9.322000	0.96357	2.604000	0.88044	0.467000	0.42956	GAA	-	NULL		0.378	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	protein_coding	OTTHUMT00000329064.1	G			33342684	1	no_errors	NM_198428	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
ZNF733P	643955	genome.wustl.edu	37	7	62752326	62752326	+	RNA	SNP	G	G	C			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr7:62752326G>C	ENST00000331425.6	-	0	1109					NR_003952.1				zinc finger protein 733, pseudogene																		CATATGTGTAGGGTTTCTCTC	0.428																																																0			7																																								62389761			643955					7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62752326G>C		Somatic		Capture	Illumina GAIIx	4	62389761		RNA	SNP	-	NULL	ENST00000331425.6	37	NULL		7																																																																																			-	-		0.428	ZNF733P-002	KNOWN	basic	processed_transcript	LOC643955	pseudogene	OTTHUMT00000343679.1	G			62389761	-1	pseudogene	NR_003952	genbank	human	validated	54_36p	rna	SNP	0.8	C
GNAT3	346562	genome.wustl.edu	37	7	80088087	80088087	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr7:80088087T>A	ENST00000398291.3	-	8	1058	c.965A>T	c.(964-966)cAc>cTc	p.H322L	CD36_ENST00000435819.1_Intron	NM_001102386.1	NP_001095856.1	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha transducing 3	322					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of visible light (GO:0009584)|platelet activation (GO:0030168)|response to nicotine (GO:0035094)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|synaptic transmission (GO:0007268)	acrosomal vesicle (GO:0001669)|apical plasma membrane (GO:0016324)|axoneme (GO:0005930)|heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)	p.H322L(1)		endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	9						ACAGGTCATGTGGGAATAAAT	0.348																																																1	Substitution - Missense(1)	ovary(1)	7											85.0	84.0	84.0					7																	80088087		1839	4109	5948	79926023	SO:0001583	missense	346562				CCDS47625.1	7q21.11	2007-06-13			ENSG00000214415	ENSG00000214415			22800	protein-coding gene	gene with protein product		139395					Standard	NM_001102386		Approved	gustducin, GDCA	uc011kgu.2	A8MTJ3	OTTHUMG00000155401	ENST00000398291.3:c.965A>T	7.37:g.80088087T>A	ENSP00000381339:p.His322Leu	Somatic		Capture	Illumina GAIIx	4	79926023	A4D1B2|A4D1B3|B9EJG5	Missense_Mutation	SNP	-	p.H322L	ENST00000398291.3	37	c.965	CCDS47625.1	7	.	.	.	.	.	.	.	.	.	.	T	26.9	4.778396	0.90195	.	.	ENSG00000214415	ENST00000398291	D	0.90504	-2.68	5.47	5.47	0.80525	.	0.000000	0.85682	U	0.000000	D	0.97349	0.9133	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98997	1.0810	9	.	.	.	.	15.8518	0.78937	0.0:0.0:0.0:1.0	.	322	A8MTJ3	GNAT3_HUMAN	L	322	ENSP00000381339:H322L	.	H	-	2	0	GNAT3	79926023	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.040000	0.89188	2.216000	0.71823	0.528000	0.53228	CAC	-	NULL		0.348	GNAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAT3	protein_coding	OTTHUMT00000339909.3	T	XM_294370		79926023	-1	no_errors	NM_001102386	genbank	human	provisional	54_36p	missense	SNP	1	A
CHRM2	1129	genome.wustl.edu	37	7	136699767	136699767	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr7:136699767G>A	ENST00000445907.2	+	3	683	c.155G>A	c.(154-156)cGc>cAc	p.R52H	hsa-mir-490_ENST00000597642.1_RNA|CHRM2_ENST00000320658.5_Missense_Mutation_p.R52H|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000397608.3_Missense_Mutation_p.R52H|CHRM2_ENST00000402486.3_Missense_Mutation_p.R52H|CHRM2_ENST00000401861.1_Missense_Mutation_p.R52H|CHRM2_ENST00000453373.1_Missense_Mutation_p.R52H|hsa-mir-490_ENST00000439694.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	52					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)	p.R52H(3)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	AAAGTCAACCGCCACCTCCAG	0.448																																																3	Substitution - Missense(3)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	7											203.0	171.0	181.0					7																	136699767		2203	4300	6503	136350307	SO:0001583	missense	1129				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.155G>A	7.37:g.136699767G>A	ENSP00000399745:p.Arg52His	Somatic		Capture	Illumina GAIIx	4	136350307	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	-	p.R52H	ENST00000445907.2	37	c.155	CCDS5843.1	7	.	.	.	.	.	.	.	.	.	.	G	22.9	4.349237	0.82132	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01	5.32	5.32	0.75619	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.71542	0.3352	M	0.89030	3	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.77544	-0.2548	10	0.72032	D	0.01	-14.4422	19.0529	0.93053	0.0:0.0:1.0:0.0	.	52	P08172	ACM2_HUMAN	H	52	ENSP00000399745:R52H;ENSP00000415386:R52H;ENSP00000319984:R52H;ENSP00000380733:R52H;ENSP00000384937:R52H;ENSP00000384401:R52H	ENSP00000319984:R52H	R	+	2	0	CHRM2	136350307	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.766000	0.98957	2.502000	0.84385	0.585000	0.79938	CGC	-	NULL		0.448	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM2	protein_coding	OTTHUMT00000341010.1	G			136350307	1	no_errors	NM_000739	genbank	human	reviewed	54_36p	missense	SNP	1	A
MROH5	389690	genome.wustl.edu	37	8	142487536	142487536	+	RNA	SNP	C	C	T	rs199975856		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr8:142487536C>T	ENST00000430863.1	-	0	1492					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5									p.R471H(1)									GGCCTGCTGGCGACTCCGCGT	0.652													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17607	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	8						C	HIS/ARG	1,4369		0,1,2184	45.0	61.0	56.0		1412	3.5	0.9	8		56	1,8569		0,1,4284	yes	missense	FLJ43860	NM_207414.2	29	0,2,6468	TT,TC,CC		0.0117,0.0229,0.0155	benign	471/1319	142487536	2,12938	2185	4285	6470	142556718			389690					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142487536C>T		Somatic		Capture	Illumina GAIIx	4	142556718		Missense_Mutation	SNP	HMMPfam_HEAT;superfamily_ARM repeat	p.R471H	ENST00000430863.1	37	c.1412		8																																																																																			-	NULL		0.652	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	polymorphic_pseudogene	OTTHUMT00000342412.4	C	NM_207414		142556718	-1	pseudogene	NM_207414	genbank	human	validated	54_36p	missense	SNP	0.96	T
EEF1D	1936	genome.wustl.edu	37	8	144668985	144668985	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr8:144668985T>A	ENST00000529272.1	-	2	431	c.31A>T	c.(31-33)Atc>Ttc	p.I11F	EEF1D_ENST00000528610.1_Missense_Mutation_p.I11F|EEF1D_ENST00000419152.2_Missense_Mutation_p.I11F|EEF1D_ENST00000532741.1_Missense_Mutation_p.I427F|EEF1D_ENST00000395119.3_Missense_Mutation_p.I11F|EEF1D_ENST00000442189.2_Missense_Mutation_p.I377F|EEF1D_ENST00000531621.1_Missense_Mutation_p.I11F|EEF1D_ENST00000524624.1_Missense_Mutation_p.I11F|EEF1D_ENST00000317198.6_Missense_Mutation_p.I11F|EEF1D_ENST00000532400.1_Missense_Mutation_p.I11F|EEF1D_ENST00000423316.2_Missense_Mutation_p.I377F|EEF1D_ENST00000526838.1_Missense_Mutation_p.I11F			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)	11					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)	p.I377F(1)		breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			TCGAACCAGATCTTCTCATGT	0.552																																																1	Substitution - Missense(1)	ovary(1)	8											130.0	129.0	129.0					8																	144668985		2203	4300	6503	144740128	SO:0001583	missense	1936			AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191	ENST00000529272.1:c.31A>T	8.37:g.144668985T>A	ENSP00000434872:p.Ile11Phe	Somatic		Capture	Illumina GAIIx	4	144740128	B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Missense_Mutation	SNP	-	p.I377F	ENST00000529272.1	37	c.1129	CCDS6405.1	8	.	.	.	.	.	.	.	.	.	.	T	19.15	3.771317	0.69992	.	.	ENSG00000104529	ENST00000419152;ENST00000532400;ENST00000532741;ENST00000526838;ENST00000442189;ENST00000528610;ENST00000395119;ENST00000529272;ENST00000423316;ENST00000356793;ENST00000317198;ENST00000337369;ENST00000531621;ENST00000524624;ENST00000534380;ENST00000534377;ENST00000533204;ENST00000530191;ENST00000531218;ENST00000533494;ENST00000530445;ENST00000529516;ENST00000533749;ENST00000526340;ENST00000525223;ENST00000532543;ENST00000531931	.	.	.	4.81	2.41	0.29592	.	0.218494	0.46442	D	0.000296	T	0.66587	0.2804	L	0.56396	1.775	0.44110	D	0.996889	B;D;D;P;D;D	0.89917	0.023;0.999;1.0;0.822;1.0;1.0	B;D;D;B;D;D	0.83275	0.017;0.939;0.996;0.384;0.99;0.973	T	0.61227	-0.7105	9	0.37606	T	0.19	.	7.2874	0.26346	0.0:0.2533:0.0:0.7467	.	11;377;329;11;427;377	E9PBQ9;D3DWK1;F8W934;P29692;E9PRY8;P29692-2	.;.;.;EF1D_HUMAN;.;.	F	11;11;427;11;377;11;11;11;377;329;11;377;11;11;11;11;11;11;11;11;11;11;27;11;11;11;11	.	ENSP00000317399:I11F	I	-	1	0	EEF1D	144740128	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.088000	0.30877	0.292000	0.22492	0.459000	0.35465	ATC	-	NULL		0.552	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	EEF1D	protein_coding	OTTHUMT00000382592.2	T	NM_032378		144740128	-1	no_errors	NM_032378	genbank	human	reviewed	54_36p	missense	SNP	1	A
CHMP5	51510	genome.wustl.edu	37	9	33267862	33267862	+	Silent	SNP	G	G	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr9:33267862G>A	ENST00000223500.8	+	3	323	c.186G>A	c.(184-186)aaG>aaA	p.K62K	CHMP5_ENST00000419016.2_Silent_p.K62K	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5	62					endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.K62K(2)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			ATATGGTCAAGCAGAAAGCCT	0.358																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	9											96.0	93.0	94.0					9																	33267862		2203	4300	6503	33257862	SO:0001819	synonymous_variant	51510			AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765	ENST00000223500.8:c.186G>A	9.37:g.33267862G>A		Somatic		Capture	Illumina GAIIx	4	33257862	B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	Silent	SNP	-	p.K62	ENST00000223500.8	37	c.186	CCDS6537.1	9																																																																																			-	NULL		0.358	CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP5	protein_coding	OTTHUMT00000052040.3	G	NM_016410		33257862	1	no_errors	NM_016410	genbank	human	validated	54_36p	silent	SNP	0.99	A
ATXN3L	92552	genome.wustl.edu	37	X	13337616	13337616	+	Silent	SNP	T	T	G			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chrX:13337616T>G	ENST00000380622.2	-	1	902	c.438A>C	c.(436-438)acA>acC	p.T146T	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	146	Josephin. {ECO:0000255|PROSITE- ProRule:PRU00331}.				protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)	p.T146T(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						TTGCAAGGCATGTATCTGATA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	X											65.0	61.0	62.0					X																	13337616		1568	3582	5150	13247537	SO:0001819	synonymous_variant	92552				CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.438A>C	X.37:g.13337616T>G		Somatic		Capture	Illumina GAIIx	4	13247537	B2RNY8	Silent	SNP	HMMPfam_UIM;HMMPfam_Josephin	p.T146	ENST00000380622.2	37	c.438	CCDS48080.1	X																																																																																			-	HMMPfam_Josephin		0.373	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN3L	protein_coding	OTTHUMT00000055785.2	T	NM_001135995		13247537	-1	no_errors	ENST00000380622	ensembl	human	known	54_36p	silent	SNP	1	G
LAMP2	3920	genome.wustl.edu	37	X	119582824	119582824	+	Splice_Site	SNP	C	C	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chrX:119582824C>A	ENST00000200639.4	-	4	693		c.e4+1		LAMP2_ENST00000540603.1_Splice_Site|LAMP2_ENST00000371335.4_Splice_Site|LAMP2_ENST00000538785.1_Splice_Site|LAMP2_ENST00000434600.2_Splice_Site			P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	enzyme binding (GO:0019899)	p.?(1)		endometrium(4)|large_intestine(2)|lung(5)|ovary(2)|urinary_tract(2)	15						ACTTTACTCACCATTTGTGCT	0.333																																																1	Unknown(1)	ovary(1)	X											79.0	74.0	76.0					X																	119582824		2203	4300	6503	119466852	SO:0001630	splice_region_variant	3920			X77196	CCDS14599.1, CCDS14600.1, CCDS48159.1	Xq24-q25	2014-09-17			ENSG00000005893	ENSG00000005893		"""CD molecules"""	6501	protein-coding gene	gene with protein product		309060					Standard	NM_002294		Approved	CD107b	uc004ess.4	P13473	OTTHUMG00000022301	ENST00000200639.4:c.556+1G>T	X.37:g.119582824C>A		Somatic		Capture	Illumina GAIIx	4	119466852	A8K4X5|D3DTF0|Q16641|Q6Q3G8|Q96J30|Q99534|Q9UD93	Splice_Site	SNP	-	e4+1	ENST00000200639.4	37	c.556+1	CCDS14599.1	X	.	.	.	.	.	.	.	.	.	.	C	15.92	2.975812	0.53720	.	.	ENSG00000005893	ENST00000434600;ENST00000538785;ENST00000200639;ENST00000371335;ENST00000540603	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5831	0.68305	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LAMP2	119466852	1.000000	0.71417	0.901000	0.35422	0.769000	0.43574	5.351000	0.66022	2.437000	0.82529	0.538000	0.68166	.	-	-		0.333	LAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LAMP2	protein_coding	OTTHUMT00000058099.1	C		Intron	119466852	-1	no_errors	NM_002294	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
DCAF8L1	139425	genome.wustl.edu	37	X	27998165	27998165	+	Silent	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chrX:27998165C>T	ENST00000441525.1	-	1	1401	c.1287G>A	c.(1285-1287)aaG>aaA	p.K429K		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	429								p.K429K(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						CCTTATATCTCTTAACATATT	0.453																																																1	Substitution - coding silent(1)	ovary(1)	X											64.0	58.0	60.0					X																	27998165		2202	4300	6502	27908086	SO:0001819	synonymous_variant	139425				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.1287G>A	X.37:g.27998165C>T		Somatic		Capture	Illumina GAIIx	4	27908086	B3KXX1	Silent	SNP	-	p.K429	ENST00000441525.1	37	c.1287	CCDS35222.1	X																																																																																			-	NULL		0.453	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR42B	protein_coding	OTTHUMT00000056150.2	C	XM_066690		27908086	-1	no_errors	NM_001017930	genbank	human	provisional	54_36p	silent	SNP	1	T
WDR13	64743	genome.wustl.edu	37	X	48458030	48458030	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chrX:48458030G>A	ENST00000218056.5	+	4	953	c.448G>A	c.(448-450)Ggg>Agg	p.G150R	WDR13_ENST00000492715.1_3'UTR|WDR13_ENST00000376729.5_Missense_Mutation_p.G150R	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	150						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.G150R(1)		endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						GGCCATGGCCGGGGACACGTC	0.617																																																1	Substitution - Missense(1)	ovary(1)	X											99.0	82.0	88.0					X																	48458030		2203	4300	6503	48342974	SO:0001583	missense	64743			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.448G>A	X.37:g.48458030G>A	ENSP00000218056:p.Gly150Arg	Somatic		Capture	Illumina GAIIx	4	48342974	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	HMMPfam_WD40;superfamily_WD40 repeat-like	p.G150R	ENST00000218056.5	37	c.448	CCDS14302.1	X	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963100	0.74016	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.71698	-0.59;-0.59	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.58264	0.2110	L	0.35854	1.095	0.80722	D	1	P;B	0.40050	0.7;0.109	B;B	0.31191	0.125;0.022	T	0.61763	-0.6996	10	0.39692	T	0.17	-20.0815	15.6128	0.76740	0.0:0.0:1.0:0.0	.	28;150	B4DVQ7;Q9H1Z4	.;WDR13_HUMAN	R	150	ENSP00000365919:G150R;ENSP00000218056:G150R	ENSP00000218056:G150R	G	+	1	0	WDR13	48342974	1.000000	0.71417	0.990000	0.47175	0.931000	0.56810	8.609000	0.90898	2.281000	0.76405	0.529000	0.55759	GGG	-	NULL		0.617	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	protein_coding	OTTHUMT00000060743.2	G			48342974	1	no_errors	NM_017883	genbank	human	reviewed	54_36p	missense	SNP	1	A
EDA	1896	genome.wustl.edu	37	X	68836277	68836277	+	Missense_Mutation	SNP	T	T	G	rs149975042		TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chrX:68836277T>G	ENST00000374552.4	+	1	367	c.125T>G	c.(124-126)cTc>cGc	p.L42R	EDA_ENST00000527388.1_Missense_Mutation_p.L42R|EDA_ENST00000502251.1_3'UTR|EDA_ENST00000524573.1_Missense_Mutation_p.L42R|EDA_ENST00000525810.1_Missense_Mutation_p.L42R|EDA_ENST00000374553.2_Missense_Mutation_p.L42R|EDA_ENST00000338901.3_Missense_Mutation_p.L42R	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A	42					cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.L42R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						AGCTGCCTGCTCTTCCTGGGT	0.697																																																1	Substitution - Missense(1)	ovary(1)	X						T	ARG/LEU,ARG/LEU,ARG/LEU,ARG/LEU,ARG/LEU	0,3835		0,0,1632,571	57.0	43.0	47.0		125,125,125,125,125	4.8	1.0	X	dbSNP_134	47	1,6727		0,1,2427,1872	no	missense,missense,missense,missense,missense	EDA	NM_001005609.1,NM_001005610.2,NM_001005612.2,NM_001005613.2,NM_001399.4	102,102,102,102,102	0,1,4059,2443	GG,GT,TT,T		0.0149,0.0,0.0095	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	42/390,42/136,42/387,42/149,42/392	68836277	1,10562	2203	4300	6503	68753002	SO:0001583	missense	1896			U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.125T>G	X.37:g.68836277T>G	ENSP00000363680:p.Leu42Arg	Somatic		Capture	Illumina GAIIx	4	68753002	A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Missense_Mutation	SNP	HMMPfam_TNF;HMMPfam_Collagen;superfamily_TNF-like	p.L42R	ENST00000374552.4	37	c.125	CCDS14394.1	X	.	.	.	.	.	.	.	.	.	.	T	15.34	2.803362	0.50315	0.0	1.49E-4	ENSG00000158813	ENST00000513754;ENST00000338901;ENST00000374552;ENST00000374553;ENST00000525810;ENST00000527388;ENST00000524573	D;D;D;D;D;D	0.98362	-4.89;-3.95;-3.99;-4.85;-4.89;-3.84	4.8	4.8	0.61643	.	0.092912	0.45606	D	0.000345	D	0.97564	0.9202	L	0.27053	0.805	0.40130	D	0.976704	D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D	0.78314	0.964;0.921;0.964;0.991;0.991;0.987;0.991;0.991	D	0.98366	1.0551	10	0.87932	D	0	-10.143	11.1641	0.48533	0.0:0.0:0.0:1.0	.	42;42;42;42;42;42;42;42	Q92838-9;Q92838;Q92838-3;Q92838-8;Q92838-6;Q92838-2;Q92838-7;Q92838-5	.;EDA_HUMAN;.;.;.;.;.;.	R	42	ENSP00000340611:L42R;ENSP00000363680:L42R;ENSP00000363681:L42R;ENSP00000434195:L42R;ENSP00000434861:L42R;ENSP00000432585:L42R	ENSP00000340611:L42R	L	+	2	0	EDA	68753002	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.686000	0.61700	1.761000	0.52028	0.486000	0.48141	CTC	-	NULL		0.697	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EDA	protein_coding	OTTHUMT00000057048.2	T	NM_001399		68753002	1	no_errors	NM_001399	genbank	human	reviewed	54_36p	missense	SNP	1	G
MTMR1	8776	genome.wustl.edu	37	X	149901048	149901048	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chrX:149901048C>T	ENST00000370390.3	+	9	1059	c.902C>T	c.(901-903)aCg>aTg	p.T301M	MTMR1_ENST00000541925.1_Missense_Mutation_p.T207M|MTMR1_ENST00000445323.2_Missense_Mutation_p.T309M|MTMR1_ENST00000538506.1_Missense_Mutation_p.T188M|MTMR1_ENST00000544228.1_Missense_Mutation_p.T301M|MTMR1_ENST00000451863.2_Missense_Mutation_p.T301M|MTMR1_ENST00000542156.1_Missense_Mutation_p.T301M	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1	301	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)	p.T301M(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					AGTCAAGCAACGATTACCCGT	0.408																																																1	Substitution - Missense(1)	ovary(1)	X											76.0	63.0	67.0					X																	149901048		2203	4300	6503	149651706	SO:0001583	missense	8776			U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.902C>T	X.37:g.149901048C>T	ENSP00000359417:p.Thr301Met	Somatic		Capture	Illumina GAIIx	4	149651706	A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Missense_Mutation	SNP	HMMPfam_GRAM;HMMPfam_Myotub-related;superfamily_PH domain-like;superfamily_(Phosphotyrosine protein) phosphatases II	p.T301M	ENST00000370390.3	37	c.902	CCDS14695.1	X	.	.	.	.	.	.	.	.	.	.	C	26.7	4.766385	0.90020	.	.	ENSG00000063601	ENST00000541925;ENST00000542156;ENST00000370390;ENST00000445323;ENST00000544228;ENST00000451863;ENST00000538506	D;D;D;D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67;-2.67;-2.67;-2.67	5.93	5.93	0.95920	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.043909	0.85682	D	0.000000	D	0.96371	0.8816	M	0.90198	3.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74348	0.971;0.958;0.983	D	0.96771	0.9568	10	0.87932	D	0	.	19.2891	0.94092	0.0:1.0:0.0:0.0	.	301;309;301	Q13613;F8WA39;Q8NEC6	MTMR1_HUMAN;.;.	M	207;301;301;309;301;301;188	ENSP00000441879:T207M;ENSP00000445281:T301M;ENSP00000359417:T301M;ENSP00000414178:T309M;ENSP00000440534:T301M;ENSP00000387446:T301M;ENSP00000443444:T188M	ENSP00000359417:T301M	T	+	2	0	MTMR1	149651706	1.000000	0.71417	0.765000	0.31456	0.901000	0.52897	7.818000	0.86416	2.508000	0.84585	0.523000	0.50628	ACG	-	HMMPfam_Myotub-related		0.408	MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR1	protein_coding	OTTHUMT00000060863.2	C	NM_003828, NM_176789		149651706	1	no_errors	NM_003828	genbank	human	reviewed	54_36p	missense	SNP	1	T
SLC13A1	6561	genome.wustl.edu	37	7	122808565	122808567	+	In_Frame_Del	DEL	CTG	CTG	AT			TCGA-13-0791-01A-01W-0372-09	TCGA-13-0791-10A-01W-0372-09	CTG	CTG	CTG	AT	CTG	CTG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	70f63e2f-9bc6-4ed9-8d91-f1889287d7b7	65955726-5cf6-4150-9ad1-e68ce5aa7d6a	g.chr7:122808565_122808567delCTG	ENST00000194130.2	-	5	641_643	c.602_604delCAG	c.(601-606)ccagtt>ctt	p.201_202PV>L	SLC13A1_ENST00000539873.1_In_Frame_Del_p.137_138PV>L	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	201					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TACCCTGGAACTGGTTTTGTTTT	0.261																																																0			7																																								122595803	SO:0001651	inframe_deletion	6561				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.602_604delCAG	7.37:g.122808565_122808567delCTG	ENSP00000194130:p.Pro201_Val202delinsLeu	Somatic		Capture	Illumina GAIIx	Phase_III	122595801	Q9H5Z0	Frame_Shift_Del	DEL	-	p.P201fs	ENST00000194130.2	37	c.602	CCDS5786.1	7																																																																																			(deletion:cds_exon[122595794,122595851])	NULL		0.261	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	protein_coding	OTTHUMT00000347404.1	CTG	NM_022444		122595803	-1	no_errors	NM_022444	genbank	human	validated	54_36p	frame_shift_del	DEL	0.98:0.976	AT
