#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF8	943	broad.mit.edu	37	1	12164533	12164533	+	Silent	SNP	T	T	C			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr1:12164533T>C	ENST00000263932.2	+	4	588	c.366T>C	c.(364-366)tgT>tgC	p.C122C	TNFRSF8_ENST00000417814.2_Silent_p.C11C	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	122					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.C122C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	TCAACTCCTGTGCCCGCTGCT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											156.0	115.0	129.0					1																	12164533		2203	4300	6503	12087120	SO:0001819	synonymous_variant	943			M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.366T>C	1.37:g.12164533T>C		Somatic		Capture	Illumina GAIIx	Phase_I	12087120	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Silent	SNP	ENST00000263932.2	37	CCDS144.1																																																																																				0.562	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005130.1		
COL16A1	1307	broad.mit.edu	37	1	32165426	32165426	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr1:32165426G>T	ENST00000373672.3	-	4	770	c.254C>A	c.(253-255)aCc>aAc	p.T85N	COL16A1_ENST00000271069.6_Missense_Mutation_p.T85N|COL16A1_ENST00000373668.3_Missense_Mutation_p.T85N	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	85	Laminin G-like.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.T85N(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CGTGGGCTGGGTCACGGGGGC	0.602																																					Colon(143;498 1786 21362 25193 36625)											1	Substitution - Missense(1)	ovary(1)	1											55.0	57.0	57.0					1																	32165426		1963	4145	6108	31938013	SO:0001583	missense	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.254C>A	1.37:g.32165426G>T	ENSP00000362776:p.Thr85Asn	Somatic		Capture	Illumina GAIIx	Phase_I	31938013	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.694554	0.48202	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668	T;T;T	0.42900	0.96;0.96;0.96	4.64	4.64	0.57946	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.339452	0.29093	N	0.013165	T	0.43433	0.1247	L	0.32530	0.975	0.31059	N	0.71436	D;P	0.63880	0.993;0.838	P;B	0.56788	0.806;0.276	T	0.50406	-0.8832	10	0.72032	D	0.01	.	7.5107	0.27573	0.185:0.0:0.815:0.0	.	85;85	A6NCT7;Q07092	.;COGA1_HUMAN	N	85	ENSP00000362776:T85N;ENSP00000271069:T85N;ENSP00000362772:T85N	ENSP00000271069:T85N	T	-	2	0	COL16A1	31938013	1.000000	0.71417	1.000000	0.80357	0.039000	0.13416	4.193000	0.58385	2.306000	0.77630	0.561000	0.74099	ACC		0.602	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
GPBP1L1	60313	broad.mit.edu	37	1	46120314	46120314	+	Silent	SNP	G	G	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr1:46120314G>A	ENST00000290795.3	-	5	1599	c.378C>T	c.(376-378)tcC>tcT	p.S126S	GPBP1L1_ENST00000355105.3_Silent_p.S126S			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	126					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S126S(1)	GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					ACCCTTTCCGGGAGTGGAAGC	0.502																																																1	Substitution - coding silent(1)	ovary(1)	1											68.0	65.0	66.0					1																	46120314		2203	4300	6503	45892901	SO:0001819	synonymous_variant	60313				CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.378C>T	1.37:g.46120314G>A		Somatic		Capture	Illumina GAIIx	Phase_I	45892901	D3DQ10|Q9H751	Silent	SNP	ENST00000290795.3	37	CCDS528.1																																																																																				0.502	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098375.1	NM_021639	
LRRC8C	84230	broad.mit.edu	37	1	90180366	90180366	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr1:90180366C>T	ENST00000370454.4	+	3	2492	c.2237C>T	c.(2236-2238)cCg>cTg	p.P746L	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	746					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.P746L(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		GTACTTTCACCGAAAATTGGA	0.393																																																1	Substitution - Missense(1)	ovary(1)	1											71.0	73.0	72.0					1																	90180366		2203	4300	6503	89952954	SO:0001583	missense	84230				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.2237C>T	1.37:g.90180366C>T	ENSP00000359483:p.Pro746Leu	Somatic		Capture	Illumina GAIIx	Phase_I	89952954	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	ENST00000370454.4	37	CCDS725.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918714	0.73098	.	.	ENSG00000171488	ENST00000370454	T	0.26223	1.75	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.32010	0.0815	M	0.66297	2.02	0.80722	D	1	D	0.64830	0.994	P	0.49502	0.613	T	0.02917	-1.1094	10	0.51188	T	0.08	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	746	Q8TDW0	LRC8C_HUMAN	L	746	ENSP00000359483:P746L	ENSP00000359483:P746L	P	+	2	0	LRRC8C	89952954	1.000000	0.71417	0.957000	0.39632	0.993000	0.82548	7.445000	0.80570	2.941000	0.99782	0.655000	0.94253	CCG		0.393	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
TARS2	80222	broad.mit.edu	37	1	150470084	150470084	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr1:150470084C>T	ENST00000369064.3	+	10	1133	c.1099C>T	c.(1099-1101)Cac>Tac	p.H367Y	TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000606933.1_Missense_Mutation_p.H285Y|TARS2_ENST00000369054.2_Missense_Mutation_p.H237Y|TARS2_ENST00000463555.1_3'UTR	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	367					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)	p.H367Y(1)		cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	ACAGTCAGGGCACTGGGAGCA	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											82.0	72.0	76.0					1																	150470084		2203	4300	6503	148736708	SO:0001583	missense	80222			BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.1099C>T	1.37:g.150470084C>T	ENSP00000358060:p.His367Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	148736708	Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	ENST00000369064.3	37	CCDS952.1	.	.	.	.	.	.	.	.	.	.	C	33	5.226701	0.95173	.	.	ENSG00000143374	ENST00000369054;ENST00000369064;ENST00000369051;ENST00000369052	T;T;T	0.72835	-0.69;-0.69;-0.69	5.53	5.53	0.82687	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.90403	0.6996	H	0.98314	4.2	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.984;0.999;0.999	D	0.93276	0.6656	10	0.87932	D	0	-9.0372	19.2635	0.93977	0.0:1.0:0.0:0.0	.	237;92;367	Q9H9V2;E7EVR9;Q9BW92	.;.;SYTM_HUMAN	Y	237;367;92;92	ENSP00000358050:H237Y;ENSP00000358060:H367Y;ENSP00000358047:H92Y	ENSP00000358047:H92Y	H	+	1	0	TARS2	148736708	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.126000	0.77201	2.882000	0.98803	0.655000	0.94253	CAC		0.547	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1	NM_025150	
USF1	7391	broad.mit.edu	37	1	161011479	161011479	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr1:161011479G>A	ENST00000368021.3	-	6	638	c.434C>T	c.(433-435)tCa>tTa	p.S145L	USF1_ENST00000435396.1_Missense_Mutation_p.S86L|TSTD1_ENST00000423014.2_5'Flank|TSTD1_ENST00000318289.10_5'Flank|TSTD1_ENST00000368024.1_5'Flank|USF1_ENST00000368020.1_Missense_Mutation_p.S145L|TSTD1_ENST00000466967.1_5'Flank|F11R_ENST00000289779.3_5'Flank|TSTD1_ENST00000368023.3_5'Flank|USF1_ENST00000368019.1_Intron	NM_007122.3	NP_009053.1	P22415	USF1_HUMAN	upstream transcription factor 1	145					carbon catabolite regulation of transcription (GO:0045990)|cellular response to insulin stimulus (GO:0032869)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|negative regulation of fibrinolysis (GO:0051918)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)	p.S145L(1)		central_nervous_system(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CAGTGCCTCTGAGCCCTGGGT	0.587											OREG0013936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											70.0	67.0	68.0					1																	161011479		2203	4300	6503	159278103	SO:0001583	missense	7391			BC035505	CCDS1214.1	1q22-q23	2013-05-21			ENSG00000158773	ENSG00000158773		"""Basic helix-loop-helix proteins"""	12593	protein-coding gene	gene with protein product		191523				8486371	Standard	NM_007122		Approved	UEF, MLTFI, bHLHb11	uc031pqv.1	P22415	OTTHUMG00000031472	ENST00000368021.3:c.434C>T	1.37:g.161011479G>A	ENSP00000357000:p.Ser145Leu	Somatic	1813	Capture	Illumina GAIIx	Phase_I	159278103	B2RBZ4|Q5SY46|Q7Z5Y1	Missense_Mutation	SNP	ENST00000368021.3	37	CCDS1214.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062307	0.55432	.	.	ENSG00000158773	ENST00000368020;ENST00000368021;ENST00000435396;ENST00000534633	D;D;D	0.93659	-3.26;-3.26;-3.24	5.02	5.02	0.67125	.	0.064073	0.64402	D	0.000004	D	0.84133	0.5405	L	0.57536	1.79	0.49213	D	0.999764	P	0.37548	0.599	B	0.32677	0.15	T	0.82554	-0.0399	10	0.11485	T	0.65	-6.253	11.5433	0.50679	0.0:0.1802:0.8198:0.0	.	145	P22415	USF1_HUMAN	L	145;145;86;86	ENSP00000356999:S145L;ENSP00000357000:S145L;ENSP00000390109:S86L	ENSP00000356999:S145L	S	-	2	0	USF1	159278103	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.016000	0.64041	2.607000	0.88179	0.655000	0.94253	TCA		0.587	USF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077050.1	NM_007122	
AHCTF1	25909	broad.mit.edu	37	1	247025452	247025452	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr1:247025452C>A	ENST00000391829.2	-	28	3667	c.3544G>T	c.(3544-3546)Gct>Tct	p.A1182S	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Missense_Mutation_p.A1191S|AHCTF1_ENST00000366508.1_Missense_Mutation_p.A1217S			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1182	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A1182S(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AAACTTTTAGCTTTCTATAGT	0.468																																					Colon(145;197 1800 4745 15099 26333)											1	Substitution - Missense(1)	ovary(1)	1											60.0	60.0	60.0					1																	247025452		2203	4300	6503	245092075	SO:0001583	missense	25909				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3544G>T	1.37:g.247025452C>A	ENSP00000375705:p.Ala1182Ser	Somatic		Capture	Illumina GAIIx	Phase_I	245092075	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37		.	.	.	.	.	.	.	.	.	.	C	23.5	4.424781	0.83667	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.41400	1.0;1.01;1.01	5.64	5.64	0.86602	.	0.263447	0.37136	N	0.002239	T	0.64627	0.2615	M	0.70275	2.135	0.46798	D	0.999204	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.85130	0.961;0.997;0.923	T	0.61068	-0.7137	10	0.36615	T	0.2	-17.1586	17.8956	0.88887	0.0:1.0:0.0:0.0	.	43;1217;1182	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	S	1217;1191;1182	ENSP00000355464:A1217S;ENSP00000355465:A1191S;ENSP00000375705:A1182S	ENSP00000355465:A1191S	A	-	1	0	AHCTF1	245092075	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	5.385000	0.66231	2.667000	0.90743	0.650000	0.86243	GCT		0.468	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
NLRP14	338323	broad.mit.edu	37	11	7064450	7064450	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr11:7064450C>A	ENST00000299481.4	+	4	1539	c.1193C>A	c.(1192-1194)gCt>gAt	p.A398D		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	398	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.A398D(1)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		ACAACCACAGCTCTGTTTACC	0.512																																																1	Substitution - Missense(1)	ovary(1)	11											156.0	149.0	151.0					11																	7064450		2201	4296	6497	7021026	SO:0001583	missense	338323			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.1193C>A	11.37:g.7064450C>A	ENSP00000299481:p.Ala398Asp	Somatic		Capture	Illumina GAIIx	Phase_I	7021026	Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	C	10.90	1.480108	0.26598	.	.	ENSG00000158077	ENST00000299481	D	0.83914	-1.78	4.48	2.49	0.30216	.	0.800697	0.10952	N	0.615956	T	0.75004	0.3791	N	0.20530	0.585	0.18873	N	0.999987	D	0.54047	0.964	P	0.47981	0.563	T	0.64110	-0.6484	10	0.72032	D	0.01	.	7.1881	0.25811	0.3463:0.4852:0.1684:0.0	.	398	Q86W24	NAL14_HUMAN	D	398	ENSP00000299481:A398D	ENSP00000299481:A398D	A	+	2	0	NLRP14	7021026	0.014000	0.17966	0.031000	0.17742	0.898000	0.52572	0.337000	0.19841	0.567000	0.29293	0.655000	0.94253	GCT		0.512	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822	
EIF3M	10480	broad.mit.edu	37	11	32608572	32608572	+	Silent	SNP	T	T	G			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr11:32608572T>G	ENST00000531120.1	+	2	120	c.57T>G	c.(55-57)cgT>cgG	p.R19R	EIF3M_ENST00000524896.1_Intron|EIF3M_ENST00000532054.1_3'UTR	NM_006360.4	NP_006351.2			eukaryotic translation initiation factor 3, subunit M									p.R19R(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16	Breast(20;0.109)					CTGAGCTTCGTGCTTATCTGA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	11											127.0	133.0	131.0					11																	32608572		2202	4299	6501	32565148	SO:0001819	synonymous_variant	10480			AK131064	CCDS7880.1	11p13	2012-12-13	2007-07-27	2007-07-27	ENSG00000149100	ENSG00000149100			24460	protein-coding gene	gene with protein product	"""transport and golgi organization 7 homolog (Drosophila)"""	609641	"""PCI domain containing 1 (herpesvirus entry mediator)"""	PCID1		15919898, 15919899	Standard	NM_006360		Approved	hfl-B5, FLJ29030, GA17, eIF3m, TANGO7	uc001mtu.4	Q7L2H7	OTTHUMG00000166258	ENST00000531120.1:c.57T>G	11.37:g.32608572T>G		Somatic		Capture	Illumina GAIIx	Phase_I	32565148		Silent	SNP	ENST00000531120.1	37	CCDS7880.1																																																																																				0.393	EIF3M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388762.2	NM_006360	
OR4B1	119765	broad.mit.edu	37	11	48239032	48239032	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr11:48239032G>C	ENST00000309562.2	+	1	689	c.671G>C	c.(670-672)aGg>aCg	p.R224T		NM_001005470.1	NP_001005470.1	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B, member 1	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R224T(1)		breast(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						GTCAACTTGAGGAACCATTCT	0.468																																																1	Substitution - Missense(1)	ovary(1)	11											144.0	112.0	123.0					11																	48239032		2201	4298	6499	48195608	SO:0001583	missense	119765			AB065848	CCDS31485.1	11p11.2	2012-08-09			ENSG00000175619	ENSG00000175619		"""GPCR / Class A : Olfactory receptors"""	8290	protein-coding gene	gene with protein product							Standard	NM_001005470		Approved	OST208	uc010rhs.2	Q8NGF8	OTTHUMG00000166576	ENST00000309562.2:c.671G>C	11.37:g.48239032G>C	ENSP00000311605:p.Arg224Thr	Somatic		Capture	Illumina GAIIx	Phase_I	48195608	Q6IF75|Q96R64	Missense_Mutation	SNP	ENST00000309562.2	37	CCDS31485.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762777	0.31228	.	.	ENSG00000175619	ENST00000309562	T	0.00241	8.46	5.5	3.52	0.40303	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000015	T	0.00468	0.0015	M	0.84326	2.69	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.38542	-0.9656	10	0.87932	D	0	.	5.259	0.15563	0.1774:0.1693:0.6533:0.0	.	224	Q8NGF8	OR4B1_HUMAN	T	224	ENSP00000311605:R224T	ENSP00000311605:R224T	R	+	2	0	OR4B1	48195608	0.003000	0.15002	0.973000	0.42090	0.326000	0.28443	0.167000	0.16602	1.339000	0.45563	-0.369000	0.07265	AGG		0.468	OR4B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390554.1	NM_001005470	
OR5M10	390167	broad.mit.edu	37	11	56345094	56345094	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr11:56345094T>G	ENST00000526812.2	-	1	169	c.104A>C	c.(103-105)tAc>tCc	p.Y35S		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	35						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						TGTGATTAGGTAGATCGCCAG	0.488																																																0			11											169.0	162.0	164.0					11																	56345094		1951	4144	6095	56101670	SO:0001583	missense	390167			BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.104A>C	11.37:g.56345094T>G	ENSP00000436004:p.Tyr35Ser	Somatic		Capture	Illumina GAIIx	Phase_I	56101670	B9EIL9	Missense_Mutation	SNP	ENST00000526812.2	37	CCDS53630.1	.	.	.	.	.	.	.	.	.	.	T	18.09	3.545392	0.65198	.	.	ENSG00000254834	ENST00000526812	T	0.04654	3.58	4.04	4.04	0.47022	.	.	.	.	.	T	0.29882	0.0747	H	0.96142	3.775	0.37758	D	0.926219	D	0.71674	0.998	D	0.68943	0.961	T	0.52616	-0.8552	9	0.87932	D	0	.	12.2902	0.54815	0.0:0.0:0.0:1.0	.	35	Q6IEU7	OR5MA_HUMAN	S	35	ENSP00000436004:Y35S	ENSP00000436004:Y35S	Y	-	2	0	OR5M10	56101670	1.000000	0.71417	0.134000	0.22075	0.046000	0.14306	4.482000	0.60257	1.816000	0.52996	0.514000	0.50259	TAC		0.488	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741	
TAF6L	10629	broad.mit.edu	37	11	62554166	62554166	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr11:62554166C>T	ENST00000294168.3	+	11	1468	c.1267C>T	c.(1267-1269)Cca>Tca	p.P423S	RP11-727F15.12_ENST00000601484.1_RNA|TMEM223_ENST00000527073.1_Intron|TMEM179B_ENST00000533861.1_5'Flank|TMEM179B_ENST00000333449.4_5'Flank	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	423					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.P423S(1)		endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						CCCGCTGCCGCCAGGGGGCGC	0.677											OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	11											14.0	17.0	16.0					11																	62554166		2172	4269	6441	62310742	SO:0001583	missense	10629			BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.1267C>T	11.37:g.62554166C>T	ENSP00000294168:p.Pro423Ser	Somatic	1062	Capture	Illumina GAIIx	Phase_I	62310742	B2RAT0|Q96HA6	Missense_Mutation	SNP	ENST00000294168.3	37	CCDS8035.1	.	.	.	.	.	.	.	.	.	.	C	6.506	0.461628	0.12342	.	.	ENSG00000162227	ENST00000294168	T	0.39997	1.05	5.09	3.16	0.36331	.	0.287960	0.33290	N	0.005066	T	0.19846	0.0477	N	0.14661	0.345	0.29967	N	0.818882	B	0.02656	0.0	B	0.04013	0.001	T	0.18116	-1.0347	10	0.11182	T	0.66	-6.5676	5.7428	0.18104	0.1923:0.7074:0.0:0.1003	.	423	Q9Y6J9	TAF6L_HUMAN	S	423	ENSP00000294168:P423S	ENSP00000294168:P423S	P	+	1	0	TAF6L	62310742	0.000000	0.05858	0.005000	0.12908	0.208000	0.24298	-0.003000	0.12901	0.785000	0.33685	0.655000	0.94253	CCA		0.677	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395352.1	NM_006473	
DDX6	1656	broad.mit.edu	37	11	118627891	118627891	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr11:118627891T>C	ENST00000526070.2	-	10	1459	c.1099A>G	c.(1099-1101)Aaa>Gaa	p.K367E	DDX6_ENST00000264018.4_Missense_Mutation_p.K367E|DDX6_ENST00000534980.1_Missense_Mutation_p.K367E	NM_001257191.1	NP_001244120.1	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 6	367	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cytoplasmic mRNA processing body assembly (GO:0033962)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.K356E(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	13	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		TGCCTCATTTTAGCATGAATA	0.323			T	IGH@	B-NHL																																		Dom	yes		11	11q23.3	1656	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6		L	1	Substitution - Missense(1)	ovary(1)	11											43.0	38.0	40.0					11																	118627891		1794	4061	5855	118133101	SO:0001583	missense	1656			D17532	CCDS44751.1	11q23.3	2012-02-23	2012-02-23		ENSG00000110367	ENSG00000110367		"""DEAD-boxes"""	2747	protein-coding gene	gene with protein product		600326	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA helicase, 54kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 6"""	HLR2		1579499, 11839790	Standard	NM_004397		Approved	RCK	uc001pub.2	P26196	OTTHUMG00000166411	ENST00000526070.2:c.1099A>G	11.37:g.118627891T>C	ENSP00000433704:p.Lys367Glu	Somatic		Capture	Illumina GAIIx	Phase_I	118133101	Q5D048	Missense_Mutation	SNP	ENST00000526070.2	37	CCDS44751.1	.	.	.	.	.	.	.	.	.	.	T	18.87	3.715786	0.68844	.	.	ENSG00000110367	ENST00000264018;ENST00000534980;ENST00000526070	T;T;T	0.04654	3.58;3.58;3.58	5.79	5.79	0.91817	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.03871	0.0109	N	0.12920	0.275	0.80722	D	1	P	0.41345	0.746	B	0.36534	0.227	T	0.58674	-0.7595	10	0.34782	T	0.22	.	15.7947	0.78401	0.0:0.0:0.0:1.0	.	367	P26196	DDX6_HUMAN	E	367	ENSP00000264018:K367E;ENSP00000442266:K367E;ENSP00000433704:K367E	ENSP00000264018:K367E	K	-	1	0	DDX6	118133101	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.036000	0.88901	2.193000	0.70182	0.482000	0.46254	AAA		0.323	DDX6-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000389647.2	NM_004397	
DCD	117159	broad.mit.edu	37	12	55038511	55038511	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr12:55038511C>G	ENST00000293371.6	-	5	508	c.319G>C	c.(319-321)Gac>Cac	p.D107H	DCD_ENST00000456047.2_3'UTR	NM_053283.2	NP_444513.1	P81605	DCD_HUMAN	dermcidin	107					defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|poly(A) RNA binding (GO:0044822)	p.D107H(1)		large_intestine(2)|lung(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(1001;0.0255)				AGTACTGAGTCAAGGACGTCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	12											38.0	33.0	34.0					12																	55038511		2203	4299	6502	53324778	SO:0001583	missense	117159			AF144011	CCDS8884.1, CCDS73478.1	12q13.1	2008-08-04				ENSG00000161634			14669	protein-coding gene	gene with protein product	"""proteolysis inducing factor"", ""preproteolysin"", ""diffusible survival/evasion peptide"", ""survival promoting peptide"""	606634				11694882	Standard	XM_005268627		Approved	AIDD, PIF, DSEP, HCAP, DCD-1	uc001sgj.3	P81605	OTTHUMG00000169937	ENST00000293371.6:c.319G>C	12.37:g.55038511C>G	ENSP00000293371:p.Asp107His	Somatic		Capture	Illumina GAIIx	Phase_I	53324778	A5JHP2|A5JHP3|P58461|Q53YJ2	Missense_Mutation	SNP	ENST00000293371.6	37	CCDS8884.1	.	.	.	.	.	.	.	.	.	.	C	1.435	-0.569150	0.03910	.	.	ENSG00000161634	ENST00000293371	.	.	.	2.01	-1.38	0.09027	.	.	.	.	.	T	0.19805	0.0476	N	0.08118	0	0.09310	N	1	D	0.71674	0.998	P	0.52514	0.701	T	0.13176	-1.0519	8	0.62326	D	0.03	.	4.292	0.10883	0.0:0.3689:0.4693:0.1618	.	107	P81605	DCD_HUMAN	H	107	.	ENSP00000293371:D107H	D	-	1	0	DCD	53324778	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.307000	0.02733	-0.356000	0.08187	-0.253000	0.11424	GAC		0.423	DCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406617.1	NM_053283	
TBX5	6910	broad.mit.edu	37	12	114793778	114793778	+	Silent	SNP	C	C	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr12:114793778C>T	ENST00000310346.4	-	9	1782	c.1116G>A	c.(1114-1116)tcG>tcA	p.S372S	TBX5_ENST00000405440.2_Silent_p.S372S|TBX5_ENST00000349716.5_Silent_p.S322S	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	372					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S372S(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GCCGCTGTGCCGACTCTGTCC	0.592																																					NSCLC(152;1358 1980 4050 23898 40356)											1	Substitution - coding silent(1)	ovary(1)	12											99.0	87.0	91.0					12																	114793778		2203	4300	6503	113278161	SO:0001819	synonymous_variant	6910			U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.1116G>A	12.37:g.114793778C>T		Somatic		Capture	Illumina GAIIx	Phase_I	113278161	A6ND77|O15301|Q96TB0|Q9Y4I2	Silent	SNP	ENST00000310346.4	37	CCDS9173.1																																																																																				0.592	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717	
SCEL	8796	broad.mit.edu	37	13	78137968	78137968	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr13:78137968A>G	ENST00000349847.3	+	5	308	c.224A>G	c.(223-225)aAa>aGa	p.K75R	SCEL_ENST00000377246.3_Missense_Mutation_p.K75R|SCEL_ENST00000535157.1_Missense_Mutation_p.K75R	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	75					embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)	p.K75R(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TGCTACAGGAAAGTAAATGAG	0.308																																																1	Substitution - Missense(1)	ovary(1)	13											99.0	106.0	103.0					13																	78137968		2203	4300	6503	77035969	SO:0001583	missense	8796			AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.224A>G	13.37:g.78137968A>G	ENSP00000302579:p.Lys75Arg	Somatic		Capture	Illumina GAIIx	Phase_I	77035969	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	ENST00000349847.3	37	CCDS9459.1	.	.	.	.	.	.	.	.	.	.	A	12.60	1.987665	0.35036	.	.	ENSG00000136155	ENST00000348770;ENST00000535157;ENST00000377246;ENST00000349847	T;T;T	0.22743	1.94;1.94;1.94	5.21	2.69	0.31865	.	0.227925	0.31246	N	0.007982	T	0.24353	0.0590	M	0.64997	1.995	0.25727	N	0.98531	P;D;D	0.53462	0.477;0.96;0.96	B;P;P	0.49829	0.288;0.52;0.623	T	0.05666	-1.0871	10	0.29301	T	0.29	-18.3371	5.93	0.19134	0.7404:0.1693:0.0903:0.0	.	75;75;75	F5H651;O95171-2;O95171	.;.;SCEL_HUMAN	R	75	ENSP00000437895:K75R;ENSP00000366454:K75R;ENSP00000302579:K75R	ENSP00000315127:K75R	K	+	2	0	SCEL	77035969	0.972000	0.33761	0.934000	0.37439	0.109000	0.19521	1.659000	0.37387	2.086000	0.62901	0.459000	0.35465	AAA		0.308	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045339.2	NM_144777	
YLPM1	56252	broad.mit.edu	37	14	75265137	75265137	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr14:75265137G>A	ENST00000325680.7	+	5	3261	c.3137G>A	c.(3136-3138)aGt>aAt	p.S1046N	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Missense_Mutation_p.S851N	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	851	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.S851N(1)		breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CAGGCAATCAGTCGAGGCCCA	0.498																																																1	Substitution - Missense(1)	ovary(1)	14											103.0	105.0	105.0					14																	75265137		1969	4153	6122	74334890	SO:0001583	missense	56252			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3137G>A	14.37:g.75265137G>A	ENSP00000324463:p.Ser1046Asn	Somatic		Capture	Illumina GAIIx	Phase_I	74334890	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000325680.7	37	CCDS45135.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.521379	0.00967	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.85	-2.43	0.06522	.	0.737841	0.13586	N	0.376948	T	0.06826	0.0174	N	0.01109	-1.01	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34925	-0.9809	9	0.12103	T	0.63	0.0339	3.3015	0.06984	0.4995:0.0954:0.2734:0.1317	.	1046	P49750-4	.	N	1046;851;759	.	ENSP00000238571:S851N	S	+	2	0	YLPM1	74334890	0.000000	0.05858	0.002000	0.10522	0.950000	0.60333	-0.015000	0.12634	-0.346000	0.08312	-0.148000	0.13756	AGT		0.498	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404451.1	NM_019589	
CGNL1	84952	broad.mit.edu	37	15	57810602	57810602	+	Silent	SNP	A	A	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr15:57810602A>T	ENST00000281282.5	+	10	2700	c.2622A>T	c.(2620-2622)cgA>cgT	p.R874R		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	874						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)	p.R874R(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		GAGAAATACGACAGTTAGAGG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	15											84.0	73.0	77.0					15																	57810602		2192	4292	6484	55597894	SO:0001819	synonymous_variant	84952			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.2622A>T	15.37:g.57810602A>T		Somatic		Capture	Illumina GAIIx	Phase_I	55597894	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Silent	SNP	ENST00000281282.5	37	CCDS10161.1																																																																																				0.473	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
DCUN1D3	123879	broad.mit.edu	37	16	20871561	20871561	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr16:20871561G>T	ENST00000324344.4	-	3	847	c.562C>A	c.(562-564)Cag>Aag	p.Q188K	ERI2_ENST00000564349.1_Intron|DCUN1D3_ENST00000563934.1_Missense_Mutation_p.Q188K	NM_173475.2	NP_775746.1	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 3	188	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.				negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)	perinuclear region of cytoplasm (GO:0048471)		p.Q188K(1)		NS(2)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)	14				GBM - Glioblastoma multiforme(48;0.249)		AGGCCAAACTGAAATGTAAAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	16											148.0	152.0	150.0					16																	20871561		2201	4300	6501	20779062	SO:0001583	missense	123879			BC040442	CCDS10592.1	16p12.3	2013-06-10	2013-06-10		ENSG00000188215	ENSG00000188215			28734	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)"""			15988528	Standard	NM_173475		Approved	MGC48972, FLJ41725, DKFZp686O0290	uc002dhz.3	Q8IWE4	OTTHUMG00000131553	ENST00000324344.4:c.562C>A	16.37:g.20871561G>T	ENSP00000319482:p.Gln188Lys	Somatic		Capture	Illumina GAIIx	Phase_I	20779062	B3KVY4	Missense_Mutation	SNP	ENST00000324344.4	37	CCDS10592.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.330403	0.60743	.	.	ENSG00000188215	ENST00000324344	.	.	.	5.92	5.92	0.95590	Domain of unknown function DUF298 (2);	0.000000	0.85682	D	0.000000	T	0.41880	0.1178	N	0.17474	0.49	0.80722	D	1	B	0.23377	0.084	B	0.22880	0.042	T	0.39800	-0.9596	9	0.05436	T	0.98	.	20.3248	0.98698	0.0:0.0:1.0:0.0	.	188	Q8IWE4	DCNL3_HUMAN	K	188	.	ENSP00000319482:Q188K	Q	-	1	0	DCUN1D3	20779062	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.793000	0.99091	2.818000	0.97014	0.655000	0.94253	CAG		0.478	DCUN1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254415.2	NM_173475	
TP53	7157	broad.mit.edu	37	17	7577124	7577124	+	Missense_Mutation	SNP	C	C	T	rs121912657		TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr17:7577124C>T	ENST00000269305.4	-	8	1003	c.814G>A	c.(814-816)Gtg>Atg	p.V272M	TP53_ENST00000359597.4_Missense_Mutation_p.V272M|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.V272M|TP53_ENST00000455263.2_Missense_Mutation_p.V272M|TP53_ENST00000445888.2_Missense_Mutation_p.V272M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	272	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1737852}.|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V272M(82)|p.V272L(26)|p.0?(8)|p.V272fs*73(4)|p.?(2)|p.F270fs*72(1)|p.E271fs*73(1)|p.V272fs*34(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.G266_E271delGRNSFE(1)|p.V272fs*74(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAACACGCACCTCAAAGCTG	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	133	Substitution - Missense(108)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)	large_intestine(23)|ovary(16)|lung(14)|breast(14)|oesophagus(11)|upper_aerodigestive_tract(9)|haematopoietic_and_lymphoid_tissue(9)|central_nervous_system(7)|bone(5)|stomach(4)|pancreas(4)|liver(4)|kidney(3)|urinary_tract(3)|endometrium(2)|thyroid(1)|vulva(1)|soft_tissue(1)|testis(1)|skin(1)	17	GRCh37	CM920676	TP53	M	rs121912657						62.0	54.0	57.0					17																	7577124		2203	4300	6503	7517849	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.814G>A	17.37:g.7577124C>T	ENSP00000269305:p.Val272Met	Somatic		Capture	Illumina GAIIx	Phase_I	7517849	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318455	0.81469	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99833	-7.03;-7.03;-7.03;-7.03;-7.03;-7.03	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057604	0.64402	D	0.000002	D	0.99843	0.9928	M	0.90309	3.105	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.96721	0.9532	10	0.87932	D	0	-27.8222	16.1198	0.81342	0.0:1.0:0.0:0.0	.	272;272;272;272	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	M	272;272;272;272;272;261;140	ENSP00000352610:V272M;ENSP00000269305:V272M;ENSP00000398846:V272M;ENSP00000391127:V272M;ENSP00000391478:V272M;ENSP00000425104:V140M	ENSP00000269305:V272M	V	-	1	0	TP53	7517849	1.000000	0.71417	0.986000	0.45419	0.849000	0.48306	5.871000	0.69628	2.667000	0.90743	0.462000	0.41574	GTG		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ALDH3A1	218	broad.mit.edu	37	17	19644431	19644431	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr17:19644431A>C	ENST00000457500.2	-	5	1111	c.782T>G	c.(781-783)gTg>gGg	p.V261G	ALDH3A1_ENST00000225740.6_Missense_Mutation_p.V261G|ALDH3A1_ENST00000485231.1_5'Flank|ALDH3A1_ENST00000444455.1_Missense_Mutation_p.V261G|RP11-311F12.2_ENST00000580884.1_RNA|ALDH3A1_ENST00000395555.3_Missense_Mutation_p.V261G|ALDH3A1_ENST00000494157.2_Missense_Mutation_p.V188G	NM_001135168.1	NP_001128640.1	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3 family, member A1	261					aging (GO:0007568)|cellular aldehyde metabolic process (GO:0006081)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|alcohol dehydrogenase (NADP+) activity (GO:0008106)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)	p.V261G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)		GAGCTTCTCCACAATTTGGTT	0.557																																																1	Substitution - Missense(1)	ovary(1)	17											82.0	72.0	75.0					17																	19644431		2203	4300	6503	19585023	SO:0001583	missense	218			M74542	CCDS11212.1	17p11.2	2010-05-07	2010-05-07		ENSG00000108602	ENSG00000108602	1.2.1.5	"""Aldehyde dehydrogenases"""	405	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase, dimeric NADP-preferring"""	100660		ALDH3		7774944, 1737758	Standard	NM_000691		Approved		uc010cqu.3	P30838	OTTHUMG00000059469	ENST00000457500.2:c.782T>G	17.37:g.19644431A>C	ENSP00000411821:p.Val261Gly	Somatic		Capture	Illumina GAIIx	Phase_I	19585023	A8K828|Q9BT37	Missense_Mutation	SNP	ENST00000457500.2	37	CCDS11212.1	.	.	.	.	.	.	.	.	.	.	A	18.19	3.568423	0.65651	.	.	ENSG00000108602	ENST00000225740;ENST00000395555;ENST00000379258;ENST00000444455;ENST00000457500;ENST00000457844;ENST00000439102	T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3	5.27	4.2	0.49525	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.115008	0.56097	D	0.000022	D	0.91408	0.7289	H	0.94222	3.51	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.994;0.996;0.994	D	0.91703	0.5375	10	0.87932	D	0	-3.2745	10.0586	0.42261	0.9209:0.0:0.0791:0.0	.	261;378;261	A8K828;Q8N9T9;P30838	.;.;AL3A1_HUMAN	G	261;261;319;261;261;188;261	ENSP00000225740:V261G;ENSP00000378923:V261G;ENSP00000388469:V261G;ENSP00000411821:V261G;ENSP00000389766:V261G	ENSP00000225740:V261G	V	-	2	0	ALDH3A1	19585023	1.000000	0.71417	0.946000	0.38457	0.601000	0.36947	5.779000	0.68948	0.871000	0.35750	0.482000	0.46254	GTG		0.557	ALDH3A1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132265.4	NM_000691	
SPATA32	124783	broad.mit.edu	37	17	43333263	43333263	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr17:43333263C>G	ENST00000331780.4	-	4	381	c.286G>C	c.(286-288)Gag>Cag	p.E96Q	MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|SPATA32_ENST00000543122.1_Missense_Mutation_p.E75Q|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000588160.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA	NM_152343.2	NP_689556.2	Q96LK8	SPT32_HUMAN	spermatogenesis associated 32	96					spermatogenesis (GO:0007283)	perinuclear region of cytoplasm (GO:0048471)		p.E96Q(1)									AAGTCAGACTCCTCGTTCGAG	0.557																																																1	Substitution - Missense(1)	ovary(1)	17											130.0	120.0	123.0					17																	43333263		2203	4300	6503	40689046	SO:0001583	missense	124783			AK058143	CCDS32669.1	17q21.31	2013-10-11	2012-10-08	2012-10-08	ENSG00000184361	ENSG00000184361			26349	protein-coding gene	gene with protein product	"""acrosome expressed 2"""		"""chromosome 17 open reading frame 46"", ""testis expressed 34"""	C17orf46, TEX34		18621766	Standard	NM_152343		Approved	FLJ25414, AEP2, VAD1.2	uc002iis.1	Q96LK8	OTTHUMG00000180363	ENST00000331780.4:c.286G>C	17.37:g.43333263C>G	ENSP00000331532:p.Glu96Gln	Somatic		Capture	Illumina GAIIx	Phase_I	40689046	Q7Z4U1|Q8N6V6	Missense_Mutation	SNP	ENST00000331780.4	37	CCDS32669.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.628771	0.28978	.	.	ENSG00000184361	ENST00000331780;ENST00000543122	T;T	0.47528	0.84;0.89	3.33	-5.17	0.02849	.	.	.	.	.	T	0.28632	0.0709	N	0.19112	0.55	0.09310	N	1	P	0.50528	0.936	P	0.44561	0.453	T	0.23762	-1.0179	9	0.46703	T	0.11	.	5.7807	0.18304	0.0:0.2884:0.1494:0.5622	.	96	Q96LK8	CQ046_HUMAN	Q	96;75	ENSP00000331532:E96Q;ENSP00000442724:E75Q	ENSP00000331532:E96Q	E	-	1	0	C17orf46	40689046	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.116000	0.10724	-1.009000	0.03400	-1.224000	0.01588	GAG		0.557	SPATA32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450946.1	NM_152343	
RGL3	57139	broad.mit.edu	37	19	11508184	11508184	+	Silent	SNP	C	C	T	rs376798441		TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr19:11508184C>T	ENST00000380456.3	-	17	1899	c.1836G>A	c.(1834-1836)tcG>tcA	p.S612S	RGL3_ENST00000393423.3_Silent_p.S618S|RGL3_ENST00000568628.1_5'UTR	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	612	Interaction with HRAS, MRAS and RIT1. {ECO:0000250}.				small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.S612S(1)|p.S376S(1)		breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						CACGGGCCTCCGAGCTCTGCT	0.682																																					GBM(174;751 2067 17998 27979 33959)											2	Substitution - coding silent(2)	ovary(2)	19						C	,	0,4402		0,0,2201	21.0	24.0	23.0		1836,1854	-9.0	0.1	19		23	2,8590		0,2,4294	no	coding-synonymous,coding-synonymous	RGL3	NM_001035223.2,NM_001161616.1	,	0,2,6495	TT,TC,CC		0.0233,0.0,0.0154	,	612/711,618/717	11508184	2,12992	2201	4296	6497	11369184	SO:0001819	synonymous_variant	57139			BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.1836G>A	19.37:g.11508184C>T		Somatic		Capture	Illumina GAIIx	Phase_I	11369184	B5ME84|B7ZL22|Q0P6G0	Silent	SNP	ENST00000380456.3	37	CCDS32910.1																																																																																				0.682	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421208.3	XM_290867	
ZNF471	57573	broad.mit.edu	37	19	57037056	57037056	+	Silent	SNP	G	G	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr19:57037056G>A	ENST00000308031.5	+	5	1753	c.1620G>A	c.(1618-1620)gaG>gaA	p.E540E	ZNF471_ENST00000591537.1_3'UTR|ZNF471_ENST00000593197.1_Intron	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	540					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E540E(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		ATACAGGAGAGAAACCTTATG	0.383																																					Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)											1	Substitution - coding silent(1)	ovary(1)	19											101.0	107.0	105.0					19																	57037056		2203	4300	6503	61728868	SO:0001819	synonymous_variant	57573			AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.1620G>A	19.37:g.57037056G>A		Somatic		Capture	Illumina GAIIx	Phase_I	61728868	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Silent	SNP	ENST00000308031.5	37	CCDS12945.1																																																																																				0.383	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458405.1	NM_020813	
ZNF513	130557	broad.mit.edu	37	2	27600891	27600891	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr2:27600891T>A	ENST00000323703.6	-	4	1345	c.1147A>T	c.(1147-1149)Agt>Tgt	p.S383C	ZNF513_ENST00000491924.1_5'UTR|ZNF513_ENST00000407879.1_Missense_Mutation_p.S321C	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	383					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)	p.S383C(1)		endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCTCACCACTGTGTGTCTTC	0.607																																																1	Substitution - Missense(1)	ovary(1)	2											111.0	128.0	122.0					2																	27600891		2203	4300	6503	27454395	SO:0001583	missense	130557			AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.1147A>T	2.37:g.27600891T>A	ENSP00000318373:p.Ser383Cys	Somatic		Capture	Illumina GAIIx	Phase_I	27454395	A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Missense_Mutation	SNP	ENST00000323703.6	37	CCDS1751.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.561977	0.45590	.	.	ENSG00000163795	ENST00000323703;ENST00000407879	T;T	0.19938	2.11;2.11	5.29	5.29	0.74685	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000009	T	0.43919	0.1269	M	0.81112	2.525	0.44927	D	0.997949	P	0.51057	0.941	P	0.57152	0.814	T	0.47407	-0.9120	10	0.87932	D	0	-9.0673	14.1902	0.65633	0.0:0.0:0.0:1.0	.	383	Q8N8E2	ZN513_HUMAN	C	383;321	ENSP00000318373:S383C;ENSP00000384874:S321C	ENSP00000318373:S383C	S	-	1	0	ZNF513	27454395	1.000000	0.71417	1.000000	0.80357	0.167000	0.22549	6.106000	0.71511	2.221000	0.72209	0.533000	0.62120	AGT		0.607	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215026.2	NM_144631	
GMCL1	64395	broad.mit.edu	37	2	70081984	70081984	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr2:70081984G>A	ENST00000282570.3	+	9	1215	c.964G>A	c.(964-966)Gaa>Aaa	p.E322K		NM_178439.3	NP_848526.1	Q96IK5	GMCL1_HUMAN	germ cell-less, spermatogenesis associated 1	322					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)	nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)		p.E322K(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	15						TCTTGAAACTGAACAAGGAAA	0.323																																																1	Substitution - Missense(1)	ovary(1)	2											75.0	78.0	77.0					2																	70081984		2203	4293	6496	69935488	SO:0001583	missense	64395			AK023119	CCDS1895.1	2p13.3	2013-01-09	2012-08-20		ENSG00000087338	ENSG00000087338		"""BTB/POZ domain containing"""	23843	protein-coding gene	gene with protein product	"""spermatogenesis associated 29"""		"""germ cell-less homolog 1 (Drosophila)"""				Standard	NM_178439		Approved	FLJ13057, BTBD13, GCL1, SPATA29	uc002sfu.3	Q96IK5	OTTHUMG00000129643	ENST00000282570.3:c.964G>A	2.37:g.70081984G>A	ENSP00000282570:p.Glu322Lys	Somatic		Capture	Illumina GAIIx	Phase_I	69935488	Q9H826|Q9H8V7|Q9H927	Missense_Mutation	SNP	ENST00000282570.3	37	CCDS1895.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.552809	0.65425	.	.	ENSG00000087338	ENST00000282570	T	0.55413	0.52	4.73	4.73	0.59995	.	0.166067	0.52532	D	0.000070	T	0.47637	0.1456	L	0.47716	1.5	0.53688	D	0.999979	B	0.15930	0.015	B	0.19946	0.027	T	0.40997	-0.9533	10	0.36615	T	0.2	-7.5524	15.2376	0.73443	0.0:0.0:1.0:0.0	.	322	Q96IK5	GMCL1_HUMAN	K	322	ENSP00000282570:E322K	ENSP00000282570:E322K	E	+	1	0	GMCL1	69935488	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.752000	0.74898	2.456000	0.83038	0.555000	0.69702	GAA		0.323	GMCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251841.2	NM_178439	
TTLL4	9654	broad.mit.edu	37	2	219616467	219616467	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr2:219616467G>A	ENST00000392102.1	+	16	3254	c.2914G>A	c.(2914-2916)Gag>Aag	p.E972K	TTLL4_ENST00000442769.1_Missense_Mutation_p.E908K|TTLL4_ENST00000258398.4_Missense_Mutation_p.E972K|TTLL4_ENST00000457313.1_Missense_Mutation_p.E807K	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	972					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)	p.E972K(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		AATGGCTCCAGAGCATGTCAC	0.512																																					GBM(172;1818 2053 15407 20943 49753)											1	Substitution - Missense(1)	ovary(1)	2											89.0	78.0	81.0					2																	219616467		2203	4300	6503	219324711	SO:0001583	missense	9654				CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.2914G>A	2.37:g.219616467G>A	ENSP00000375951:p.Glu972Lys	Somatic		Capture	Illumina GAIIx	Phase_I	219324711	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	37	CCDS2422.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.62|17.62	3.434802|3.434802	0.62955|0.62955	.|.	.|.	ENSG00000135912|ENSG00000135912	ENST00000457313;ENST00000392102;ENST00000442769;ENST00000258398|ENST00000436668	T;T;T;T|.	0.04015|.	3.86;4.1;3.73;4.1|.	5.28|5.28	4.4|4.4	0.53042|0.53042	.|.	0.550750|.	0.16042|.	N|.	0.232395|.	T|T	0.72534|0.72534	0.3472|0.3472	M|M	0.70595|0.70595	2.14|2.14	0.50313|0.50313	D|D	0.999868|0.999868	B;P;P;B|.	0.49961|.	0.046;0.722;0.93;0.138|.	B;B;P;B|.	0.44422|.	0.028;0.118;0.449;0.065|.	T|T	0.73225|0.73225	-0.4050|-0.4050	10|5	0.36615|.	T|.	0.2|.	.|.	14.7331|14.7331	0.69397|0.69397	0.0:0.1583:0.8417:0.0|0.0:0.1583:0.8417:0.0	.|.	175;807;908;972|.	B4DJF5;E9PH58;E7EX20;Q14679|.	.;.;.;TTLL4_HUMAN|.	K|K	807;972;908;972|116	ENSP00000393332:E807K;ENSP00000375951:E972K;ENSP00000396555:E908K;ENSP00000258398:E972K|.	ENSP00000258398:E972K|.	E|R	+|+	1|2	0|0	TTLL4|TTLL4	219324711|219324711	1.000000|1.000000	0.71417|0.71417	0.209000|0.209000	0.23619|0.23619	0.988000|0.988000	0.76386|0.76386	5.023000|5.023000	0.64084|0.64084	1.427000|1.427000	0.47276|0.47276	0.655000|0.655000	0.94253|0.94253	GAG|AGA		0.512	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
TUBB1	81027	broad.mit.edu	37	20	57598984	57598984	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr20:57598984A>T	ENST00000217133.1	+	4	771	c.502A>T	c.(502-504)Agc>Tgc	p.S168C		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	168					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.S168C(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	GAATTCCTTCAGCGTCATGCC	0.567																																																1	Substitution - Missense(1)	ovary(1)	20											126.0	128.0	128.0					20																	57598984		2203	4300	6503	57032379	SO:0001583	missense	81027			AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.502A>T	20.37:g.57598984A>T	ENSP00000217133:p.Ser168Cys	Somatic		Capture	Illumina GAIIx	Phase_I	57032379		Missense_Mutation	SNP	ENST00000217133.1	37	CCDS13475.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.431077	0.83776	.	.	ENSG00000101162	ENST00000217133	T	0.72394	-0.65	5.39	5.39	0.77823	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.85682	D	0.000000	D	0.87018	0.6073	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89962	0.4087	10	0.87932	D	0	.	14.5622	0.68148	1.0:0.0:0.0:0.0	.	168	Q9H4B7	TBB1_HUMAN	C	168	ENSP00000217133:S168C	ENSP00000217133:S168C	S	+	1	0	TUBB1	57032379	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.339000	0.96797	2.050000	0.60909	0.533000	0.62120	AGC		0.567	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079903.1	NM_030773	
DSCAM	1826	broad.mit.edu	37	21	41559851	41559851	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr21:41559851C>A	ENST00000400454.1	-	13	3094	c.2617G>T	c.(2617-2619)Gag>Tag	p.E873*		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	873	Ig-like C2-type 9.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.E873*(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCACGGTCCTCCCCATAAGAA	0.413																																					Melanoma(134;970 1778 1785 21664 32388)											1	Substitution - Nonsense(1)	ovary(1)	21											125.0	113.0	117.0					21																	41559851		1897	4113	6010	40481721	SO:0001587	stop_gained	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2617G>T	21.37:g.41559851C>A	ENSP00000383303:p.Glu873*	Somatic		Capture	Illumina GAIIx	Phase_I	40481721	O60468	Nonsense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	C	40	8.082710	0.98646	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	.	.	.	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	18.0962	0.89490	0.0:1.0:0.0:0.0	.	.	.	.	X	873;625	.	ENSP00000383303:E873X	E	-	1	0	DSCAM	40481721	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.953000	0.70290	2.309000	0.77851	0.561000	0.74099	GAG		0.413	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
CRYBB1	1414	broad.mit.edu	37	22	26997971	26997971	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr22:26997971G>T	ENST00000215939.2	-	5	577	c.447C>A	c.(445-447)caC>caA	p.H149Q		NM_001887.3	NP_001878.1	P53674	CRBB1_HUMAN	crystallin, beta B1	149	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.H149Q(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(3)|skin(2)|urinary_tract(4)	31						GGGAGATTTTGTGCTCCTGGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	22											89.0	68.0	75.0					22																	26997971		2203	4300	6503	25327971	SO:0001583	missense	1414				CCDS13840.1	22q12.1	2008-06-10			ENSG00000100122	ENSG00000100122			2397	protein-coding gene	gene with protein product		600929				8575764, 12360425	Standard	NM_001887		Approved		uc003acy.1	P53674	OTTHUMG00000150980	ENST00000215939.2:c.447C>A	22.37:g.26997971G>T	ENSP00000215939:p.His149Gln	Somatic		Capture	Illumina GAIIx	Phase_I	25327971		Missense_Mutation	SNP	ENST00000215939.2	37	CCDS13840.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378698	0.42207	.	.	ENSG00000100122	ENST00000215939	T	0.75050	-0.9	4.7	1.39	0.22231	Beta/gamma crystallin (2);Gamma-crystallin-related (1);	0.000000	0.85682	D	0.000000	D	0.84763	0.5544	M	0.88775	2.98	0.52501	D	0.999958	D	0.76494	0.999	D	0.70935	0.971	D	0.84048	0.0368	10	0.87932	D	0	.	7.8496	0.29446	0.3365:0.0:0.6635:0.0	.	149	P53674	CRBB1_HUMAN	Q	149	ENSP00000215939:H149Q	ENSP00000215939:H149Q	H	-	3	2	CRYBB1	25327971	1.000000	0.71417	1.000000	0.80357	0.392000	0.30506	1.127000	0.31357	0.577000	0.29470	-0.140000	0.14226	CAC		0.572	CRYBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320767.1	NM_001887	
BANK1	55024	broad.mit.edu	37	4	102750969	102750969	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr4:102750969T>G	ENST00000322953.4	+	2	349	c.75T>G	c.(73-75)aaT>aaG	p.N25K	BANK1_ENST00000428908.1_Intron|BANK1_ENST00000508653.1_Intron|BANK1_ENST00000504592.1_Missense_Mutation_p.N10K|BANK1_ENST00000444316.2_De_novo_Start_OutOfFrame	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	25	Interaction with ITPR2.				B cell activation (GO:0042113)			p.N25K(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TTCCAGGAAATACAAAAGATA	0.294																																																1	Substitution - Missense(1)	ovary(1)	4											25.0	26.0	26.0					4																	102750969		2133	4272	6405	102969992	SO:0001583	missense	55024			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.75T>G	4.37:g.102750969T>G	ENSP00000320509:p.Asn25Lys	Somatic		Capture	Illumina GAIIx	Phase_I	102969992	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	37	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	T	11.03	1.518672	0.27211	.	.	ENSG00000153064	ENST00000504592;ENST00000322953	T;T	0.20069	2.1;2.1	5.18	-1.73	0.08081	.	0.231631	0.29646	N	0.011571	T	0.14917	0.0360	L	0.48642	1.525	0.09310	N	1	B;B	0.25904	0.137;0.069	B;B	0.26310	0.068;0.055	T	0.14924	-1.0455	10	0.56958	D	0.05	.	5.8587	0.18734	0.1395:0.4526:0.0:0.4078	.	25;10	Q8NDB2;Q8NDB2-2	BANK1_HUMAN;.	K	10;25	ENSP00000421443:N10K;ENSP00000320509:N25K	ENSP00000320509:N25K	N	+	3	2	BANK1	102969992	0.003000	0.15002	0.005000	0.12908	0.751000	0.42716	-0.176000	0.09811	-0.240000	0.09696	0.528000	0.53228	AAT		0.294	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	
GZMA	3001	broad.mit.edu	37	5	54401388	54401388	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr5:54401388A>T	ENST00000274306.6	+	2	192	c.157A>T	c.(157-159)Atc>Ttc	p.I53F		NM_006144.3	NP_006135	P12544	GRAA_HUMAN	granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)	53	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|immune response (GO:0006955)|negative regulation of DNA binding (GO:0043392)|negative regulation of endodeoxyribonuclease activity (GO:0032078)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of apoptotic process (GO:0043065)|proteolysis involved in cellular protein catabolic process (GO:0051603)	extracellular region (GO:0005576)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.I53F(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	25		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				CAGAAAAACCATCTGTGCTGG	0.388																																																1	Substitution - Missense(1)	ovary(1)	5											104.0	96.0	99.0					5																	54401388		2203	4300	6503	54437145	SO:0001583	missense	3001				CCDS3965.1	5q11-q12	2008-07-18			ENSG00000145649	ENSG00000145649			4708	protein-coding gene	gene with protein product	"""CTL tryptase"", ""Granzyme A (Cytotoxic T-lymphocyte-associated serine esterase-3; Hanukah factor serine protease)"""	140050		HFSP, CTLA3		3262682, 3533635	Standard	NM_006144		Approved		uc003jpm.3	P12544	OTTHUMG00000097011	ENST00000274306.6:c.157A>T	5.37:g.54401388A>T	ENSP00000274306:p.Ile53Phe	Somatic		Capture	Illumina GAIIx	Phase_I	54437145	A4PHN1|Q6IB36	Missense_Mutation	SNP	ENST00000274306.6	37	CCDS3965.1	.	.	.	.	.	.	.	.	.	.	A	11.98	1.800073	0.31869	.	.	ENSG00000145649	ENST00000274306	D	0.87887	-2.31	4.85	-1.04	0.10068	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.670897	0.15293	N	0.270043	T	0.67021	0.2849	N	0.17764	0.52	0.26558	N	0.973797	B	0.23377	0.084	B	0.21917	0.037	T	0.55547	-0.8124	10	0.02654	T	1	.	1.3281	0.02129	0.5106:0.1182:0.1416:0.2296	.	53	P12544	GRAA_HUMAN	F	53	ENSP00000274306:I53F	ENSP00000274306:I53F	I	+	1	0	GZMA	54437145	0.000000	0.05858	0.063000	0.19743	0.499000	0.33736	-0.761000	0.04751	-0.004000	0.14419	0.533000	0.62120	ATC		0.388	GZMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214100.2	NM_006144	
PCDH1	5097	broad.mit.edu	37	5	141248323	141248323	+	Silent	SNP	C	C	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr5:141248323C>T	ENST00000394536.3	-	2	853	c.714G>A	c.(712-714)ctG>ctA	p.L238L	PCDH1_ENST00000536585.1_Silent_p.L216L|PCDH1_ENST00000503492.1_Silent_p.L238L|PCDH1_ENST00000456271.1_Silent_p.L226L|PCDH1_ENST00000511044.1_5'Flank|PCDH1_ENST00000287008.3_Silent_p.L238L	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	238	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L238L(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GCTCACGGTCCAGGTTGCCCA	0.637																																					Ovarian(132;1609 1739 4190 14731 45037)											1	Substitution - coding silent(1)	ovary(1)	5											92.0	82.0	85.0					5																	141248323		2203	4300	6503	141228507	SO:0001819	synonymous_variant	5097			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.714G>A	5.37:g.141248323C>T		Somatic		Capture	Illumina GAIIx	Phase_I	141228507	Q8IUP2	Silent	SNP	ENST00000394536.3	37	CCDS43375.1																																																																																				0.637	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420	
ADAM19	8728	broad.mit.edu	37	5	156917401	156917401	+	Silent	SNP	C	C	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr5:156917401C>A	ENST00000517905.1	-	19	2201	c.2157G>T	c.(2155-2157)ctG>ctT	p.L719L	ADAM19_ENST00000394020.1_Silent_p.L721L|ADAM19_ENST00000257527.4_Silent_p.L719L|ADAM19_ENST00000430702.2_Silent_p.L452L			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	719					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L720L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGTAGTACATCAGCATGAGGA	0.522																																																1	Substitution - coding silent(1)	ovary(1)	5											202.0	178.0	186.0					5																	156917401		2203	4300	6503	156849979	SO:0001819	synonymous_variant	8728			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.2157G>T	5.37:g.156917401C>A		Somatic		Capture	Illumina GAIIx	Phase_I	156849979	Q9BZL5|Q9UHP2	Silent	SNP	ENST00000517905.1	37		.	.	.	.	.	.	.	.	.	.	C	6.891	0.533826	0.13188	.	.	ENSG00000135074	ENST00000517374	.	.	.	5.41	3.59	0.41128	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.1687	0.37067	0.0:0.8211:0.0:0.1789	.	.	.	.	L	290	.	.	X	-	2	2	ADAM19	156849979	0.788000	0.28762	0.786000	0.31890	0.094000	0.18550	1.054000	0.30455	1.256000	0.44068	0.655000	0.94253	TGA		0.522	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1	NM_033274	
STK10	6793	broad.mit.edu	37	5	171520431	171520431	+	Silent	SNP	G	G	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr5:171520431G>T	ENST00000176763.5	-	9	1882	c.1539C>A	c.(1537-1539)ggC>ggA	p.G513G	STK10_ENST00000517775.1_5'UTR	NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	513					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.G513G(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGGACAGAGAGCCCATCTCTT	0.527																																																1	Substitution - coding silent(1)	ovary(1)	5											78.0	78.0	78.0					5																	171520431		2203	4300	6503	171453036	SO:0001819	synonymous_variant	6793			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.1539C>A	5.37:g.171520431G>T		Somatic		Capture	Illumina GAIIx	Phase_I	171453036	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Silent	SNP	ENST00000176763.5	37	CCDS34290.1																																																																																				0.527	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990	
SIMC1	375484	broad.mit.edu	37	5	175740768	175740768	+	Silent	SNP	C	C	G			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr5:175740768C>G	ENST00000443967.1	+	7	2159	c.1752C>G	c.(1750-1752)acC>acG	p.T584T	SIMC1_ENST00000430704.2_Silent_p.T169T|SIMC1_ENST00000341199.6_Silent_p.T169T|SIMC1_ENST00000332772.4_Silent_p.T45T			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1	584							SUMO polymer binding (GO:0032184)	p.T584T(1)									TTCAGCAGACCCTGAGGAGGC	0.532																																																1	Substitution - coding silent(1)	ovary(1)	5											165.0	166.0	166.0					5																	175740768		2203	4300	6503	175673374	SO:0001819	synonymous_variant	375484			BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	ENST00000443967.1:c.1752C>G	5.37:g.175740768C>G		Somatic		Capture	Illumina GAIIx	Phase_I	175673374	J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Silent	SNP	ENST00000443967.1	37																																																																																					0.532	SIMC1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000253155.2	NM_198567	
SLC17A1	6568	broad.mit.edu	37	6	25826832	25826832	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr6:25826832A>T	ENST00000244527.4	-	3	179	c.64T>A	c.(64-66)Ttg>Atg	p.L22M	SLC17A1_ENST00000468082.1_Missense_Mutation_p.L22M|SLC17A1_ENST00000476801.1_Missense_Mutation_p.L22M|SLC17A1_ENST00000427328.1_Missense_Mutation_p.L22M	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	22					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.L22M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						AGGAAAGACAATCCATAGCGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	6											109.0	90.0	97.0					6																	25826832		2203	4300	6503	25934811	SO:0001583	missense	6568				CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.64T>A	6.37:g.25826832A>T	ENSP00000244527:p.Leu22Met	Somatic		Capture	Illumina GAIIx	Phase_I	25934811	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	ENST00000244527.4	37	CCDS4565.1	.	.	.	.	.	.	.	.	.	.	A	12.71	2.019235	0.35606	.	.	ENSG00000124568	ENST00000244527;ENST00000427328;ENST00000476801;ENST00000468082	T;T;T;T	0.60672	0.17;0.17;0.17;0.17	3.29	-6.58	0.01836	Major facilitator superfamily domain, general substrate transporter (1);	0.296096	0.17860	N	0.159566	T	0.46756	0.1409	M	0.86502	2.82	0.09310	N	1	D;D	0.60160	0.987;0.978	P;P	0.53224	0.721;0.701	T	0.54918	-0.8221	10	0.44086	T	0.13	.	7.3535	0.26706	0.177:0.0:0.5472:0.2759	.	22;22	Q14916-2;Q14916	.;NPT1_HUMAN	M	22	ENSP00000244527:L22M;ENSP00000410549:L22M;ENSP00000420614:L22M;ENSP00000420546:L22M	ENSP00000244527:L22M	L	-	1	2	SLC17A1	25934811	0.000000	0.05858	0.000000	0.03702	0.113000	0.19764	-3.297000	0.00522	-2.147000	0.00799	-1.127000	0.01993	TTG		0.418	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2		
ZBED9	114821	broad.mit.edu	37	6	28554487	28554487	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr6:28554487G>A	ENST00000452236.2	-	1	625	c.8C>T	c.(7-9)gCa>gTa	p.A3V	SCAND3_ENST00000530247.1_Intron|RP5-1186N24.3_ENST00000499525.1_RNA	NM_052923.1	NP_443155.1												p.A3V(1)		NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						CCTAGAGACTGCTTCCATCCC	0.488																																																1	Substitution - Missense(1)	ovary(1)	6											65.0	61.0	63.0					6																	28554487		2203	4300	6503	28662466	SO:0001583	missense	114821																														ENST00000452236.2:c.8C>T	6.37:g.28554487G>A	ENSP00000395259:p.Ala3Val	Somatic		Capture	Illumina GAIIx	Phase_I	28662466		Missense_Mutation	SNP	ENST00000452236.2	37	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.490899	0.26774	.	.	ENSG00000232040	ENST00000452236	T	0.01572	4.76	3.37	2.5	0.30297	.	.	.	.	.	T	0.00524	0.0017	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45716	-0.9242	9	0.30854	T	0.27	.	7.1863	0.25801	0.1323:0.0:0.8677:0.0	.	3	Q6R2W3	SCND3_HUMAN	V	3	ENSP00000395259:A3V	ENSP00000395259:A3V	A	-	2	0	SCAND3	28662466	0.001000	0.12720	0.036000	0.18154	0.106000	0.19336	0.840000	0.27600	0.716000	0.32124	0.563000	0.77884	GCA		0.488	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3		
UNC5CL	222643	broad.mit.edu	37	6	41002717	41002717	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr6:41002717A>G	ENST00000373164.1	-	1	157	c.97T>C	c.(97-99)Tgg>Cgg	p.W33R	UNC5CL_ENST00000244565.3_Missense_Mutation_p.W33R|UNC5CL_ENST00000470102.1_5'Flank			Q8IV45	UN5CL_HUMAN	unc-5 homolog C (C. elegans)-like	33					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|proteolysis (GO:0006508)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	peptidase activity (GO:0008233)	p.W33R(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGGCAGTGCCATCGAAGGCAT	0.587																																																1	Substitution - Missense(1)	ovary(1)	6											65.0	60.0	62.0					6																	41002717		2203	4300	6503	41110695	SO:0001583	missense	222643			BC035284	CCDS4847.1	6p21.1	2013-10-15			ENSG00000124602	ENSG00000124602			21203	protein-coding gene	gene with protein product	"""ZU5 and death domain containing"""					14769797	Standard	NM_173561		Approved	MGC34763, ZUD	uc003opi.3	Q8IV45	OTTHUMG00000014665	ENST00000373164.1:c.97T>C	6.37:g.41002717A>G	ENSP00000362258:p.Trp33Arg	Somatic		Capture	Illumina GAIIx	Phase_I	41110695	Q5TGU1	Missense_Mutation	SNP	ENST00000373164.1	37	CCDS4847.1	.	.	.	.	.	.	.	.	.	.	A	17.49	3.403208	0.62288	.	.	ENSG00000124602	ENST00000244565;ENST00000373164	T;T	0.18016	2.24;2.24	4.49	4.49	0.54785	.	0.000000	0.45126	D	0.000393	T	0.07999	0.0200	L	0.29908	0.895	0.80722	D	1	P	0.50943	0.94	P	0.44860	0.462	T	0.05225	-1.0898	10	0.87932	D	0	-15.1531	10.1002	0.42499	1.0:0.0:0.0:0.0	.	33	Q8IV45	UN5CL_HUMAN	R	33	ENSP00000244565:W33R;ENSP00000362258:W33R	ENSP00000244565:W33R	W	-	1	0	UNC5CL	41110695	0.965000	0.33210	0.990000	0.47175	0.965000	0.64279	2.824000	0.48088	1.898000	0.54952	0.460000	0.39030	TGG		0.587	UNC5CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040491.1	NM_173561	
TTBK1	84630	broad.mit.edu	37	6	43230673	43230673	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr6:43230673G>A	ENST00000259750.4	+	13	1654	c.1571G>A	c.(1570-1572)aGc>aAc	p.S524N	TTBK1_ENST00000304139.5_Missense_Mutation_p.S473N	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	524					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S524N(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GAGGCCCTGAGCAACGCCTTC	0.622																																																1	Substitution - Missense(1)	ovary(1)	6											77.0	59.0	65.0					6																	43230673		2203	4300	6503	43338651	SO:0001583	missense	84630			AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.1571G>A	6.37:g.43230673G>A	ENSP00000259750:p.Ser524Asn	Somatic		Capture	Illumina GAIIx	Phase_I	43338651	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	37	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019264	0.75275	.	.	ENSG00000146216	ENST00000393984;ENST00000259750;ENST00000304139	T	0.68765	-0.35	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.70219	0.3199	L	0.40543	1.245	0.47994	D	0.999566	D;P	0.61080	0.989;0.682	D;B	0.72982	0.979;0.188	T	0.73471	-0.3972	10	0.66056	D	0.02	.	16.0488	0.80740	0.0:0.0:1.0:0.0	.	47;524	Q9H6N8;Q5TCY1	.;TTBK1_HUMAN	N	473;524;473	ENSP00000259750:S524N	ENSP00000259750:S524N	S	+	2	0	TTBK1	43338651	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.496000	0.97967	2.532000	0.85374	0.484000	0.47621	AGC		0.622	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
DST	667	broad.mit.edu	37	6	56497759	56497759	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr6:56497759T>C	ENST00000361203.3	-	24	3072	c.3065A>G	c.(3064-3066)gAt>gGt	p.D1022G	DST_ENST00000370788.2_Missense_Mutation_p.D1022G|DST_ENST00000421834.2_Missense_Mutation_p.D1022G|DST_ENST00000370754.5_Missense_Mutation_p.D1200G|DST_ENST00000446842.2_Missense_Mutation_p.D696G|DST_ENST00000312431.6_Missense_Mutation_p.D1022G|DST_ENST00000370765.6_Missense_Mutation_p.D696G|DST_ENST00000244364.6_Missense_Mutation_p.D696G|DST_ENST00000370769.4_Missense_Mutation_p.D1022G|DST_ENST00000518935.1_Missense_Mutation_p.D696G			Q03001	DYST_HUMAN	dystonin	1022					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.D696G(1)|p.D1022G(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCCTGGCTATCTTCCAGAAA	0.368																																																2	Substitution - Missense(2)	ovary(2)	6											114.0	111.0	112.0					6																	56497759		2203	4300	6503	56605718	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3065A>G	6.37:g.56497759T>C	ENSP00000354508:p.Asp1022Gly	Somatic		Capture	Illumina GAIIx	Phase_I	56605718	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	T	22.9	4.356114	0.82243	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	T;T;T;T;T;T;T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.37	5.73	5.73	0.89815	.	0.000000	0.56097	D	0.000028	T	0.58380	0.2118	M	0.84683	2.71	0.34405	D	0.695705	D;D;D;P;D;D;D;B	0.76494	0.966;0.997;0.966;0.901;0.992;0.999;0.966;0.038	P;D;P;P;D;D;P;B	0.78314	0.505;0.989;0.505;0.49;0.953;0.991;0.505;0.054	T	0.66582	-0.5887	9	0.72032	D	0.01	.	16.3123	0.82883	0.0:0.0:0.0:1.0	.	1022;1022;1200;696;696;696;1022;696	Q5TBT1;E7ERU2;E9PEB9;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;DYST_HUMAN;.	G	696;1200;1022;1022;696;1022;1022;1022;696;1062;696;696	ENSP00000244364:D696G;ENSP00000359790:D1200G;ENSP00000359805:D1022G;ENSP00000400883:D1022G;ENSP00000393645:D696G;ENSP00000307959:D1022G;ENSP00000359824:D1022G;ENSP00000354508:D1022G;ENSP00000404924:D696G;ENSP00000431030:D1062G;ENSP00000359801:D696G;ENSP00000431003:D696G	ENSP00000244364:D696G	D	-	2	0	DST	56605718	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.880000	0.69698	2.308000	0.77769	0.533000	0.62120	GAT		0.368	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
DST	667	broad.mit.edu	37	6	56535540	56535540	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr6:56535540C>A	ENST00000361203.3	-	6	487	c.480G>T	c.(478-480)tgG>tgT	p.W160C	DST_ENST00000370788.2_Missense_Mutation_p.W160C|DST_ENST00000421834.2_Missense_Mutation_p.W160C|DST_ENST00000370754.5_Missense_Mutation_p.W338C|DST_ENST00000312431.6_Missense_Mutation_p.W160C|DST_ENST00000370769.4_Missense_Mutation_p.W160C			Q03001	DYST_HUMAN	dystonin	160	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.W160C(1)|p.W338C(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCTGCTGCGTCCAGAGTAGCA	0.388																																																2	Substitution - Missense(2)	ovary(2)	6											63.0	57.0	59.0					6																	56535540		1886	4129	6015	56643499	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.480G>T	6.37:g.56535540C>A	ENSP00000354508:p.Trp160Cys	Somatic		Capture	Illumina GAIIx	Phase_I	56643499	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	C	17.06	3.293644	0.60086	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000421834;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000520645;ENST00000449297;ENST00000522538;ENST00000523817	D;D;D;D;D;D;D;D;D;D	0.99727	-6.55;-6.55;-6.55;-6.55;-6.55;-6.55;-6.55;-6.55;-6.55;-6.55	4.76	4.76	0.60689	Calponin homology domain (5);	0.000000	0.50627	D	0.000113	D	0.99862	0.9935	H	0.97077	3.935	0.38590	D	0.950393	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;0.999;1.0	D	0.96608	0.9450	9	0.87932	D	0	.	18.3201	0.90236	0.0:1.0:0.0:0.0	.	189;160;160;338;276;160	B4DGY0;Q5TBT1;E7ERU2;E9PEB9;Q03001-13;Q03001	.;.;.;.;.;DYST_HUMAN	C	338;160;160;160;160;160;200;338;111;153	ENSP00000359790:W338C;ENSP00000359805:W160C;ENSP00000400883:W160C;ENSP00000307959:W160C;ENSP00000359824:W160C;ENSP00000354508:W160C;ENSP00000431030:W200C;ENSP00000393082:W338C;ENSP00000429075:W111C;ENSP00000429221:W153C	ENSP00000307959:W160C	W	-	3	0	DST	56643499	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.609000	0.82925	2.623000	0.88846	0.591000	0.81541	TGG		0.388	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
L3MBTL3	84456	broad.mit.edu	37	6	130389525	130389525	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr6:130389525G>T	ENST00000529410.1	+	14	1530	c.1051G>T	c.(1051-1053)Gct>Tct	p.A351S	L3MBTL3_ENST00000361794.2_Missense_Mutation_p.A351S|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.A351S|L3MBTL3_ENST00000533560.1_Missense_Mutation_p.A326S|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.A326S|L3MBTL3_ENST00000526019.1_Missense_Mutation_p.A326S			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	351					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.A351S(1)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		GACATGTAAAGCTCAAGCTGC	0.323																																																1	Substitution - Missense(1)	ovary(1)	6											108.0	110.0	109.0					6																	130389525		2203	4298	6501	130431218	SO:0001583	missense	84456			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1051G>T	6.37:g.130389525G>T	ENSP00000431962:p.Ala351Ser	Somatic		Capture	Illumina GAIIx	Phase_I	130431218	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	ENST00000529410.1	37	CCDS34537.1	.	.	.	.	.	.	.	.	.	.	G	19.88	3.909100	0.72868	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	D;D;D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87;-2.87;-2.87	5.84	4.97	0.65823	.	0.165145	0.53938	D	0.000042	D	0.87815	0.6272	L	0.42487	1.325	0.41767	D	0.989744	B;B	0.27380	0.177;0.145	B;P	0.46275	0.25;0.51	D	0.85123	0.0970	10	0.26408	T	0.33	.	14.9191	0.70822	0.0685:0.0:0.9315:0.0	.	326;351	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	S	351;326;351;326;326;351	ENSP00000431962:A351S;ENSP00000437185:A326S;ENSP00000354526:A351S;ENSP00000357121:A326S;ENSP00000436706:A326S;ENSP00000357118:A351S	ENSP00000354526:A351S	A	+	1	0	L3MBTL3	130431218	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.769000	0.85360	1.479000	0.48272	0.557000	0.71058	GCT		0.323	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042195.2	XM_027074	
ISPD	729920	broad.mit.edu	37	7	16445915	16445915	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr7:16445915A>C	ENST00000407010.2	-	2	304	c.305T>G	c.(304-306)aTg>aGg	p.M102R	ISPD_ENST00000399310.3_Missense_Mutation_p.M102R	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	102					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)	p.M102R(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						CATTACTTCCATGTTCTCTCC	0.363										Multiple Myeloma(15;0.18)																																						1	Substitution - Missense(1)	ovary(1)	7											105.0	101.0	102.0					7																	16445915		1916	4132	6048	16412440	SO:0001583	missense	729920			AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.305T>G	7.37:g.16445915A>C	ENSP00000385478:p.Met102Arg	Somatic		Capture	Illumina GAIIx	Phase_I	16412440	A8MU35|H9KVB2	Missense_Mutation	SNP	ENST00000407010.2	37		.	.	.	.	.	.	.	.	.	.	A	12.80	2.046756	0.36085	.	.	ENSG00000214960	ENST00000407010;ENST00000399310	D;D	0.85484	-1.99;-1.99	5.69	3.28	0.37604	4-diphosphocytidyl-2C-methyl-D-erythritol synthase (1);	0.529823	0.18170	U	0.149494	T	0.77948	0.4207	N	0.11284	0.12	0.28518	N	0.913209	P	0.52170	0.951	P	0.53861	0.736	T	0.69595	-0.5103	10	0.32370	T	0.25	-11.0741	8.2964	0.31988	0.7974:0.1339:0.0688:0.0	.	102	A4D126	ISPD_HUMAN	R	102	ENSP00000385478:M102R;ENSP00000382249:M102R	ENSP00000382249:M102R	M	-	2	0	ISPD	16412440	1.000000	0.71417	0.998000	0.56505	0.699000	0.40488	3.257000	0.51500	0.415000	0.25817	0.460000	0.39030	ATG		0.363	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000326252.4	NM_001101426	
CPA2	1358	broad.mit.edu	37	7	129929521	129929521	+	Silent	SNP	C	C	G			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr7:129929521C>G	ENST00000222481.4	+	11	1249	c.1194C>G	c.(1192-1194)ccC>ccG	p.P398P		NM_001869.2	NP_001860.2	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic)	398					protein catabolic process in the vacuole (GO:0007039)	extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.P396P(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Melanoma(18;0.0435)					AGATCCTGCCCACAGCCGAGG	0.527																																																1	Substitution - coding silent(1)	ovary(1)	7											110.0	103.0	105.0					7																	129929521		2203	4300	6503	129716757	SO:0001819	synonymous_variant	1358			U19977	CCDS5817.2	7q32	2012-02-10			ENSG00000158516	ENSG00000158516	3.4.17.15		2297	protein-coding gene	gene with protein product		600688				7896805, 10860668	Standard	NM_001869		Approved		uc003vpq.3	P48052	OTTHUMG00000157019	ENST00000222481.4:c.1194C>G	7.37:g.129929521C>G		Somatic		Capture	Illumina GAIIx	Phase_I	129716757	A4D1M4|C9JIK1|Q53XS1|Q96A12|Q96QN3|Q9UCF1	Silent	SNP	ENST00000222481.4	37	CCDS5817.2																																																																																				0.527	CPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347124.2	NM_001869	
FBXO16	157574	broad.mit.edu	37	8	28314347	28314347	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr8:28314347T>A	ENST00000380254.2	-	5	591	c.443A>T	c.(442-444)gAg>gTg	p.E148V	RP11-181B11.2_ENST00000518819.1_RNA|FBXO16_ENST00000517436.1_5'UTR|FBXO16_ENST00000518734.1_Missense_Mutation_p.E136V|RP11-181B11.2_ENST00000523935.1_RNA|FBXO16_ENST00000346498.2_Missense_Mutation_p.E136V	NM_001258211.1|NM_172366.3	NP_001245140.1|NP_758954.1	Q8IX29	FBX16_HUMAN	F-box protein 16	148								p.E148V(1)		large_intestine(2)|ovary(1)	3		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.121)|Kidney(114;0.144)|Colorectal(74;0.249)		GATCCCCTGCTCAAAGGGAGT	0.433																																																1	Substitution - Missense(1)	ovary(1)	8											125.0	121.0	122.0					8																	28314347		2203	4300	6503	28370266	SO:0001583	missense	157574			AF453435	CCDS6068.1, CCDS59099.1	8p21.1	2008-02-05	2004-06-15		ENSG00000214050	ENSG00000214050		"""F-boxes /  ""other"""""	13618	protein-coding gene	gene with protein product		608519	"""F-box only protein 16"""			12243353	Standard	NM_172366		Approved	FBX16	uc003xgu.4	Q8IX29	OTTHUMG00000102147	ENST00000380254.2:c.443A>T	8.37:g.28314347T>A	ENSP00000369604:p.Glu148Val	Somatic		Capture	Illumina GAIIx	Phase_I	28370266	Q3T1B2|Q3T1B3|Q3T1B4	Missense_Mutation	SNP	ENST00000380254.2	37	CCDS6068.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.723223	0.89298	.	.	ENSG00000214050	ENST00000380254;ENST00000346498;ENST00000518734	T;T;T	0.56275	0.47;0.47;0.47	5.93	5.93	0.95920	F-box domain, Skp2-like (1);	0.000000	0.85682	U	0.000000	T	0.72087	0.3417	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;1.0	T	0.75181	-0.3408	10	0.87932	D	0	-11.1604	15.5755	0.76380	0.0:0.0:0.0:1.0	.	136;136;148	Q3T1B3;Q3T1B2;Q8IX29	.;.;FBX16_HUMAN	V	148;136;136	ENSP00000369604:E148V;ENSP00000341416:E136V;ENSP00000429687:E136V	ENSP00000341416:E136V	E	-	2	0	FBXO16	28370266	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.712000	0.84684	2.281000	0.76405	0.533000	0.62120	GAG		0.433	FBXO16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219988.2	NM_172366	
DFNB31	25861	broad.mit.edu	37	9	117186763	117186763	+	Missense_Mutation	SNP	G	G	C	rs397517255		TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chr9:117186763G>C	ENST00000362057.3	-	6	1435	c.1267C>G	c.(1267-1269)Cga>Gga	p.R423G	DFNB31_ENST00000265134.6_Missense_Mutation_p.R40G|DFNB31_ENST00000374059.3_Missense_Mutation_p.R72G	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	423			R -> P (in dbSNP:rs35003670).		inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)		p.R423G(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AGCAGCACTCGTGTCTGGTTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	9											45.0	36.0	39.0					9																	117186763		2203	4300	6503	116226584	SO:0001583	missense	25861			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1267C>G	9.37:g.117186763G>C	ENSP00000354623:p.Arg423Gly	Somatic		Capture	Illumina GAIIx	Phase_I	116226584	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948964	0.53186	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.09630	3.87;3.85;2.96	5.79	5.79	0.91817	.	0.183563	0.48286	D	0.000195	T	0.35219	0.0924	M	0.73598	2.24	0.80722	D	1	D;P;D	0.71674	0.977;0.95;0.998	P;P;D	0.68483	0.632;0.632;0.958	T	0.00936	-1.1508	10	0.45353	T	0.12	-9.8188	20.0407	0.97588	0.0:0.0:1.0:0.0	.	423;423;72	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	G	40;72;423	ENSP00000265134:R40G;ENSP00000363172:R72G;ENSP00000354623:R423G	ENSP00000265134:R40G	R	-	1	2	DFNB31	116226584	1.000000	0.71417	0.063000	0.19743	0.919000	0.55068	4.628000	0.61282	2.746000	0.94184	0.561000	0.74099	CGA		0.592	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404	
HUWE1	10075	broad.mit.edu	37	X	53612055	53612055	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chrX:53612055A>T	ENST00000342160.3	-	39	5375	c.4918T>A	c.(4918-4920)Tct>Act	p.S1640T	HUWE1_ENST00000218328.8_Missense_Mutation_p.S1640T|HUWE1_ENST00000262854.6_Missense_Mutation_p.S1640T			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1640	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.S1503T(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TTCCAGGCAGAATCAATAGTG	0.488																																																1	Substitution - Missense(1)	ovary(1)	X											241.0	184.0	203.0					X																	53612055		2203	4300	6503	53628780	SO:0001583	missense	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.4918T>A	X.37:g.53612055A>T	ENSP00000340648:p.Ser1640Thr	Somatic		Capture	Illumina GAIIx	Phase_I	53628780	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.22|11.22	1.573473|1.573473	0.28092|0.28092	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854;ENST00000218328	.|T;T;T	.|0.40476	.|1.03;1.03;1.03	5.61|5.61	4.5|4.5	0.54988|0.54988	.|WWE domain (2);	.|0.615221	.|0.16667	.|N	.|0.204534	T|T	0.21387|0.21387	0.0515|0.0515	N|N	0.14661|0.14661	0.345|0.345	0.36541|0.36541	D|D	0.871274|0.871274	.|B;B	.|0.16396	.|0.017;0.014	.|B;B	.|0.11329	.|0.006;0.004	T|T	0.17471|0.17471	-1.0368|-1.0368	5|10	.|0.14656	.|T	.|0.56	.|.	5.39|5.39	0.16240|0.16240	0.508:0.3509:0.0:0.1411|0.508:0.3509:0.0:0.1411	.|.	.|1640;1640	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	Y|T	673|1640	.|ENSP00000340648:S1640T;ENSP00000262854:S1640T;ENSP00000218328:S1640T	.|ENSP00000218328:S1640T	F|S	-|-	2|1	0|0	HUWE1|HUWE1	53628780|53628780	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.964000|1.964000	0.40462|0.40462	1.887000|1.887000	0.54652|0.54652	0.486000|0.486000	0.48141|0.48141	TTC|TCT		0.488	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
PHF8	23133	broad.mit.edu	37	X	54026305	54026305	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0886-01A-01W-0420-08	TCGA-13-0886-10A-01D-0399-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	06903a57-1b66-484e-a4ab-a4eccbd17567	f6ba1700-e115-4b2a-b4cb-33ce44be8343	g.chrX:54026305C>T	ENST00000357988.5	-	11	1697	c.1339G>A	c.(1339-1341)Gaa>Aaa	p.E447K	PHF8_ENST00000338154.6_Missense_Mutation_p.E411K|PHF8_ENST00000322659.8_Missense_Mutation_p.E411K|PHF8_ENST00000338946.6_Missense_Mutation_p.E411K	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	447					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.E411K(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						ATATTTACTTCTTTCCTTGTC	0.483																																																1	Substitution - Missense(1)	ovary(1)	X											64.0	52.0	56.0					X																	54026305		2203	4300	6503	54043030	SO:0001583	missense	23133			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.1339G>A	X.37:g.54026305C>T	ENSP00000350676:p.Glu447Lys	Somatic		Capture	Illumina GAIIx	Phase_I	54043030	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	CCDS55420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.235345|4.235345	0.79800|0.79800	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659|ENST00000443302	T;T;T;T|.	0.54071|.	0.59;0.59;0.59;0.59|.	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70072|0.70072	0.3182|0.3182	L|L	0.57536|0.57536	1.79|1.79	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;B|.	0.65815|.	0.995;0.976;0.986;0.147|.	P;P;P;B|.	0.59948|.	0.866;0.556;0.741;0.054|.	T|T	0.68671|0.68671	-0.5347|-0.5347	10|5	0.56958|.	D|.	0.05|.	-17.1937|-17.1937	15.417|15.417	0.74977|0.74977	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	411;411;447;447|.	Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1|.	.;.;.;PHF8_HUMAN|.	K|K	447;411;411;441;411|174	ENSP00000350676:E447K;ENSP00000338868:E411K;ENSP00000340051:E411K;ENSP00000319473:E411K|.	ENSP00000319473:E411K|.	E|R	-|-	1|2	0|0	PHF8|PHF8	54043030|54043030	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	4.517000|4.517000	0.60503|0.60503	2.232000|2.232000	0.73038|0.73038	0.600000|0.600000	0.82982|0.82982	GAA|AGA		0.483	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107	
