#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
STXBP3	6814	genome.wustl.edu	37	1	109321979	109321979	+	Silent	SNP	G	G	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:109321979G>C	ENST00000370008.3	+	9	806	c.756G>C	c.(754-756)ctG>ctC	p.L252L	STXBP3_ENST00000485167.1_3'UTR	NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	252	Mediates interaction with DOC2B. {ECO:0000250}.				blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)	p.L252L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		TGCATGAACTGACCTTTCAGG	0.368																																																1	Substitution - coding silent(1)	ovary(1)	1											207.0	195.0	199.0					1																	109321979		2203	4300	6503	109123502	SO:0001819	synonymous_variant	6814			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.756G>C	1.37:g.109321979G>C		Somatic		Capture	Illumina GAIIx	4	109123502	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Silent	SNP	-	p.L252	ENST00000370008.3	37	c.756	CCDS790.1	1																																																																																			-	NULL		0.368	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP3	protein_coding	OTTHUMT00000030591.1	G	NM_007269		109123502	1	no_errors	NM_007269	genbank	human	validated	54_36p	silent	SNP	1	C
UBL4B	164153	genome.wustl.edu	37	1	110655347	110655347	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:110655347A>G	ENST00000334179.3	+	1	286	c.191A>G	c.(190-192)aAt>aGt	p.N64S		NM_203412.1	NP_981957.1	Q8N7F7	UBL4B_HUMAN	ubiquitin-like 4B	64	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.					cytoplasm (GO:0005737)		p.N64S(1)		endometrium(1)|kidney(1)|large_intestine(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	7		all_cancers(81;1.14e-05)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0236)|all cancers(265;0.0823)|Epithelial(280;0.0917)|Colorectal(144;0.109)|LUSC - Lung squamous cell carcinoma(189;0.134)		ATTGGGCCCAATGCCTCTATC	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											87.0	84.0	85.0					1																	110655347		2203	4300	6503	110456870	SO:0001583	missense	164153				CCDS820.1	1p13.3	2013-09-24			ENSG00000186150	ENSG00000186150			32309	protein-coding gene	gene with protein product		611127				16872915	Standard	NM_203412		Approved	FLJ25690	uc001dzc.3	Q8N7F7	OTTHUMG00000166989	ENST00000334179.3:c.191A>G	1.37:g.110655347A>G	ENSP00000334044:p.Asn64Ser	Somatic		Capture	Illumina GAIIx	4	110456870		Missense_Mutation	SNP	-	p.N64S	ENST00000334179.3	37	c.191	CCDS820.1	1	.	.	.	.	.	.	.	.	.	.	A	8.163	0.789897	0.16258	.	.	ENSG00000186150	ENST00000334179	T	0.43688	0.94	4.14	1.81	0.25067	Ubiquitin supergroup (1);Ubiquitin (2);	0.219310	0.39274	N	0.001406	T	0.15305	0.0369	L	0.50919	1.6	0.26015	N	0.981949	B	0.15473	0.013	B	0.18561	0.022	T	0.23655	-1.0182	10	0.45353	T	0.12	-5.1392	6.4785	0.22049	0.7946:0.0:0.2054:0.0	.	64	Q8N7F7	UBL4B_HUMAN	S	64	ENSP00000334044:N64S	ENSP00000334044:N64S	N	+	2	0	UBL4B	110456870	1.000000	0.71417	0.992000	0.48379	0.325000	0.28411	1.664000	0.37439	0.173000	0.19788	-0.411000	0.06167	AAT	-	NULL		0.607	UBL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBL4B	protein_coding	OTTHUMT00000392303.1	A	NM_203412		110456870	1	no_errors	NM_203412	genbank	human	validated	54_36p	missense	SNP	0.96	G
KCNA2	3737	genome.wustl.edu	37	1	111146570	111146570	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:111146570C>G	ENST00000485317.1	-	3	1508	c.835G>C	c.(835-837)Gag>Cag	p.E279Q	KCNA2_ENST00000440270.1_Missense_Mutation_p.E279Q|KCNA2_ENST00000369770.3_Missense_Mutation_p.E279Q|KCNA2_ENST00000525120.1_5'Flank|KCNA2_ENST00000316361.4_Missense_Mutation_p.E279Q			P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 2	279					optic nerve structural organization (GO:0021633)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.E279Q(1)		endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	Dalfampridine(DB06637)	TGAGCGTCCTCTGGCTTCTCA	0.522																																					Pancreas(18;568 735 10587 23710 36357)											1	Substitution - Missense(1)	ovary(1)	1											101.0	101.0	101.0					1																	111146570		2203	4300	6503	110948093	SO:0001583	missense	3737			L02752	CCDS827.1, CCDS55625.1	1p13	2012-07-05			ENSG00000177301	ENSG00000177301		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6220	protein-coding gene	gene with protein product		176262				16382104	Standard	NM_004974		Approved	Kv1.2, HK4	uc009wfw.3	P16389	OTTHUMG00000011567	ENST00000485317.1:c.835G>C	1.37:g.111146570C>G	ENSP00000433109:p.Glu279Gln	Somatic		Capture	Illumina GAIIx	4	110948093	Q86XG6	Missense_Mutation	SNP	HMMPfam_K_tetra;HMMPfam_Ion_trans;superfamily_POZ domain;superfamily_Voltage-gated potassium channels	p.E279Q	ENST00000485317.1	37	c.835	CCDS827.1	1	.	.	.	.	.	.	.	.	.	.	C	11.30	1.598694	0.28445	.	.	ENSG00000177301	ENST00000369770;ENST00000485317;ENST00000440270;ENST00000316361	D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9	5.87	5.87	0.94306	Ion transport (1);	0.000000	0.41097	D	0.000951	D	0.94729	0.8299	L	0.33245	0.995	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.11329	0.006;0.005	D	0.90337	0.4356	10	0.30078	T	0.28	.	20.2182	0.98305	0.0:1.0:0.0:0.0	.	279;279	Q86XG6;P16389	.;KCNA2_HUMAN	Q	279	ENSP00000358785:E279Q;ENSP00000433109:E279Q;ENSP00000415257:E279Q;ENSP00000314520:E279Q	ENSP00000314520:E279Q	E	-	1	0	KCNA2	110948093	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.770000	0.85390	2.785000	0.95823	0.655000	0.94253	GAG	-	HMMPfam_Ion_trans		0.522	KCNA2-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA2	protein_coding	OTTHUMT00000128001.2	C	NM_004974		110948093	-1	no_errors	NM_004974	genbank	human	reviewed	54_36p	missense	SNP	1	G
CHD1L	9557	genome.wustl.edu	37	1	146767111	146767111	+	Splice_Site	SNP	G	G	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:146767111G>A	ENST00000369258.4	+	23	2635		c.e23-1		CHD1L_ENST00000369259.3_Splice_Site|CHD1L_ENST00000361293.5_Splice_Site|CHD1L_ENST00000431239.1_Splice_Site|CHD1L_ENST00000467213.1_Splice_Site	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like						ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)	p.?(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					ATCCTTATCAGATATTATTTT	0.393																																																1	Unknown(1)	ovary(1)	1											124.0	113.0	116.0					1																	146767111		2203	4300	6503	145233735	SO:0001630	splice_region_variant	9557			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.2616-1G>A	1.37:g.146767111G>A		Somatic		Capture	Illumina GAIIx	4	145233735	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Splice_Site	SNP	-	e23-1	ENST00000369258.4	37	c.2616-1	CCDS927.1	1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564428	0.65651	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000361293	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2767	0.66184	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CHD1L	145233735	1.000000	0.71417	0.997000	0.53966	0.807000	0.45602	4.857000	0.62939	2.735000	0.93741	0.655000	0.94253	.	-	-		0.393	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1L	protein_coding	OTTHUMT00000040377.1	G	NM_004284	Intron	145233735	1	no_errors	NM_004284	genbank	human	validated	54_36p	splice_site	SNP	1	A
PAPPA2	60676	genome.wustl.edu	37	1	176664958	176664958	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:176664958T>G	ENST00000367662.3	+	7	3873	c.2709T>G	c.(2707-2709)tgT>tgG	p.C903W		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	903					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.C903W(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GGCGGGTGTGTGACTCCTCAG	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											67.0	71.0	69.0					1																	176664958		2052	4213	6265	174931581	SO:0001583	missense	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2709T>G	1.37:g.176664958T>G	ENSP00000356634:p.Cys903Trp	Somatic		Capture	Illumina GAIIx	4	174931581	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	-	p.C903W	ENST00000367662.3	37	c.2709	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	T	17.87	3.495738	0.64186	.	.	ENSG00000116183	ENST00000367662	T	0.01902	4.57	5.41	-0.986	0.10252	Fibronectin, type III (2);	0.000000	0.85682	D	0.000000	T	0.09992	0.0245	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.01256	-1.1404	10	0.87932	D	0	-13.3223	11.2023	0.48749	0.0:0.4311:0.0:0.5689	.	903	Q9BXP8	PAPP2_HUMAN	W	903	ENSP00000356634:C903W	ENSP00000356634:C903W	C	+	3	2	PAPPA2	174931581	0.555000	0.26530	1.000000	0.80357	0.962000	0.63368	-0.273000	0.08548	0.031000	0.15407	-0.376000	0.06991	TGT	-	NULL		0.547	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	protein_coding	OTTHUMT00000084763.1	T			174931581	1	no_errors	NM_020318	genbank	human	validated	54_36p	missense	SNP	1	G
CEP350	9857	genome.wustl.edu	37	1	180061860	180061860	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:180061860C>G	ENST00000367607.3	+	34	7038	c.6620C>G	c.(6619-6621)cCa>cGa	p.P2207R	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2207					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P2207R(1)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						ACCCCATCTCCAGTTCTCAGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											41.0	41.0	41.0					1																	180061860		2202	4300	6502	178328483	SO:0001583	missense	9857			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.6620C>G	1.37:g.180061860C>G	ENSP00000356579:p.Pro2207Arg	Somatic		Capture	Illumina GAIIx	4	178328483	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	-	p.P2206R	ENST00000367607.3	37	c.6617	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	C	9.218	1.032711	0.19590	.	.	ENSG00000135837	ENST00000367607	T	0.61392	0.11	5.73	4.82	0.62117	.	0.144833	0.31747	N	0.007128	T	0.46268	0.1384	L	0.32530	0.975	0.33950	D	0.644285	B;B	0.34329	0.449;0.314	B;B	0.36885	0.235;0.141	T	0.57608	-0.7782	9	.	.	.	.	11.1059	0.48203	0.0:0.8527:0.0:0.1473	.	2207;2207	E7EU22;Q5VT06	.;CE350_HUMAN	R	2207	ENSP00000356579:P2207R	.	P	+	2	0	CEP350	178328483	0.744000	0.28250	0.947000	0.38551	0.045000	0.14185	1.876000	0.39588	1.420000	0.47138	0.655000	0.94253	CCA	-	NULL		0.383	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	protein_coding	OTTHUMT00000085315.2	C	NM_014810		178328483	1	no_errors	NM_014810	genbank	human	reviewed	54_36p	missense	SNP	0.97	G
KIF21B	23046	genome.wustl.edu	37	1	200959145	200959145	+	Silent	SNP	G	G	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:200959145G>C	ENST00000422435.2	-	21	3373	c.3057C>G	c.(3055-3057)tcC>tcG	p.S1019S	KIF21B_ENST00000360529.5_Silent_p.S1019S|KIF21B_ENST00000461742.2_Silent_p.S1019S|KIF21B_ENST00000332129.2_Silent_p.S1019S	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1019					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S1019S(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						TGATGACCACGGATGTGTCTG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	1											68.0	63.0	65.0					1																	200959145		2203	4300	6503	199225768	SO:0001819	synonymous_variant	23046			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.3057C>G	1.37:g.200959145G>C		Somatic		Capture	Illumina GAIIx	4	199225768	B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	HMMPfam_WD40;HMMPfam_Kinesin;superfamily_Prefoldin;superfamily_WD40 repeat-like;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.S1019	ENST00000422435.2	37	c.3057	CCDS58056.1	1																																																																																			-	NULL		0.637	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF21B	protein_coding	OTTHUMT00000382635.1	G	XM_371332		199225768	-1	no_errors	NM_017596	genbank	human	provisional	54_36p	silent	SNP	0.43	C
ITPKB	3707	genome.wustl.edu	37	1	226829735	226829735	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:226829735C>T	ENST00000272117.3	-	4	2337	c.2338G>A	c.(2338-2340)Gcc>Acc	p.A780T	ITPKB_ENST00000429204.1_Missense_Mutation_p.A780T			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	780					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.A306T(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				TCGGTGGGGGCCTCGGGGTCC	0.632																																					Colon(84;110 1851 5306 33547)											1	Substitution - Missense(1)	ovary(1)	1											163.0	149.0	154.0					1																	226829735		2203	4300	6503	224896358	SO:0001583	missense	3707			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2338G>A	1.37:g.226829735C>T	ENSP00000272117:p.Ala780Thr	Somatic		Capture	Illumina GAIIx	4	224896358	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	HMMPfam_IPK;superfamily_SAICAR synthase-like	p.A780T	ENST00000272117.3	37	c.2338	CCDS1555.1	1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.475646	0.84640	.	.	ENSG00000143772	ENST00000272117;ENST00000429204	T;T	0.15487	2.42;2.42	5.8	5.8	0.92144	.	0.049229	0.85682	D	0.000000	T	0.36717	0.0977	M	0.87381	2.88	0.80722	D	1	P	0.40302	0.712	B	0.43386	0.418	T	0.32455	-0.9906	10	0.62326	D	0.03	-27.4039	20.0586	0.97663	0.0:1.0:0.0:0.0	.	780	P27987	IP3KB_HUMAN	T	780	ENSP00000272117:A780T;ENSP00000411152:A780T	ENSP00000272117:A780T	A	-	1	0	ITPKB	224896358	1.000000	0.71417	0.998000	0.56505	0.527000	0.34593	5.882000	0.69714	2.741000	0.93983	0.650000	0.86243	GCC	-	HMMPfam_IPK		0.632	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	protein_coding	OTTHUMT00000091632.1	C	NM_002221		224896358	-1	no_errors	NM_002221	genbank	human	reviewed	54_36p	missense	SNP	1	T
TARBP1	6894	genome.wustl.edu	37	1	234553941	234553941	+	Silent	SNP	A	A	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:234553941A>G	ENST00000040877.1	-	22	3593	c.3594T>C	c.(3592-3594)gcT>gcC	p.A1198A		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1198					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.A1198A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TGGTGAAACCAGCCTGGAAAA	0.284																																																1	Substitution - coding silent(1)	ovary(1)	1											32.0	37.0	35.0					1																	234553941		2194	4267	6461	232620564	SO:0001819	synonymous_variant	6894				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.3594T>C	1.37:g.234553941A>G		Somatic		Capture	Illumina GAIIx	4	232620564	Q9H581	Silent	SNP	-	p.A1198	ENST00000040877.1	37	c.3594	CCDS1601.1	1																																																																																			-	NULL		0.284	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	protein_coding	OTTHUMT00000092616.1	A	NM_005646		232620564	-1	no_errors	NM_005646	genbank	human	reviewed	54_36p	silent	SNP	1	G
ARHGEF16	27237	genome.wustl.edu	37	1	3389714	3389714	+	Silent	SNP	G	G	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:3389714G>A	ENST00000378378.4	+	7	1500	c.1095G>A	c.(1093-1095)gaG>gaA	p.E365E	ARHGEF16_ENST00000413250.2_Silent_p.E69E|ARHGEF16_ENST00000378373.1_Silent_p.E77E|ARHGEF16_ENST00000378371.2_Silent_p.E77E	NM_014448.3	NP_055263.2	Q5VV41	ARHGG_HUMAN	Rho guanine nucleotide exchange factor (GEF) 16	365	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.|Required for RHOG activation and mediates interaction with EPHA2.				activation of Cdc42 GTPase activity (GO:0032864)|activation of Rac GTPase activity (GO:0032863)|apoptotic signaling pathway (GO:0097190)|cell chemotaxis (GO:0060326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	PDZ domain binding (GO:0030165)|receptor tyrosine kinase binding (GO:0030971)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E77E(1)		lung(6)|ovary(1)	7	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TCCTGGAGGAGCACGCTGAGA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	1											160.0	114.0	129.0					1																	3389714		2203	4300	6503	3379574	SO:0001819	synonymous_variant	27237			D89016	CCDS46.2	1p36.3	2013-01-10	2010-04-13		ENSG00000130762	ENSG00000130762		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15515	protein-coding gene	gene with protein product	"""putative neuroblastoma protein"""						Standard	NM_014448		Approved	NBR, GEF16	uc001akg.4	Q5VV41	OTTHUMG00000000625	ENST00000378378.4:c.1095G>A	1.37:g.3389714G>A		Somatic		Capture	Illumina GAIIx	4	3379574	Q86TF0|Q99434	Silent	SNP	-	p.E77	ENST00000378378.4	37	c.231	CCDS46.2	1																																																																																			-	NULL		0.622	ARHGEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF16	protein_coding	OTTHUMT00000001515.1	G	NM_014448		3379574	1	no_errors	NM_014448	genbank	human	reviewed	54_36p	silent	SNP	0.938	A
SLC9A1	6548	genome.wustl.edu	37	1	27427698	27427698	+	Silent	SNP	G	G	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:27427698G>A	ENST00000263980.3	-	11	2681	c.2106C>T	c.(2104-2106)ggC>ggT	p.G702G	SLC9A1_ENST00000545949.1_Silent_p.G363G|SLC9A1_ENST00000490329.1_5'Flank	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	702					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)	p.G702G(1)		central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	CCTTACCTGAGCCGATGCGGG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	1											43.0	45.0	44.0					1																	27427698		2203	4300	6503	27300285	SO:0001819	synonymous_variant	6548			M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.2106C>T	1.37:g.27427698G>A		Somatic		Capture	Illumina GAIIx	4	27300285	B1ALD6|D3DPL4|Q96EM2	Silent	SNP	-	p.G702	ENST00000263980.3	37	c.2106	CCDS295.1	1																																																																																			-	NULL		0.637	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A1	protein_coding	OTTHUMT00000012336.2	G	NM_003047		27300285	-1	no_errors	NM_003047	genbank	human	validated	54_36p	silent	SNP	1	A
TM2D1	83941	genome.wustl.edu	37	1	62190763	62190763	+	Silent	SNP	A	A	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:62190763A>C	ENST00000606498.1	-	1	50	c.30T>G	c.(28-30)tcT>tcG	p.S10S	TM2D1_ENST00000371177.2_Silent_p.S10S|TM2D1_ENST00000371180.2_Silent_p.S72S|TM2D1_ENST00000294613.5_Silent_p.S10S			Q9BX74	TM2D1_HUMAN	TM2 domain containing 1	10					apoptotic signaling pathway (GO:0097190)	integral component of plasma membrane (GO:0005887)	beta-amyloid binding (GO:0001540)|G-protein coupled receptor activity (GO:0004930)	p.S72S(1)		large_intestine(2)|lung(3)|ovary(1)	6						CCTCCGGAGCAGACGGACCAG	0.682																																																1	Substitution - coding silent(1)	ovary(1)	1											37.0	44.0	42.0					1																	62190763		1919	4103	6022	61963351	SO:0001819	synonymous_variant	83941			AF353990	CCDS65554.1	1p32.1	2008-02-05			ENSG00000162604	ENSG00000162604			24142	protein-coding gene	gene with protein product		610080				11278849, 12553667	Standard	NM_032027		Approved	BBP	uc001czz.1	Q9BX74	OTTHUMG00000008466	ENST00000606498.1:c.30T>G	1.37:g.62190763A>C		Somatic		Capture	Illumina GAIIx	4	61963351	A6NDA8	Silent	SNP	-	p.S10	ENST00000606498.1	37	c.30		1																																																																																			-	NULL		0.682	TM2D1-012	KNOWN	non_canonical_U12|basic|appris_principal	protein_coding	TM2D1	protein_coding	OTTHUMT00000470779.2	A	NM_032027		61963351	-1	no_errors	NM_032027	genbank	human	reviewed	54_36p	silent	SNP		C
DOCK7	85440	genome.wustl.edu	37	1	63119432	63119432	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:63119432C>G	ENST00000340370.5	-	4	370	c.353G>C	c.(352-354)aGa>aCa	p.R118T	DOCK7_ENST00000404627.2_Missense_Mutation_p.R118T|DOCK7_ENST00000251157.5_Missense_Mutation_p.R118T	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	118					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)	p.R118T(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						TGTATAACTTCTTATACAGTC	0.303																																																1	Substitution - Missense(1)	ovary(1)	1											61.0	62.0	62.0					1																	63119432		2203	4295	6498	62892020	SO:0001583	missense	85440				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.353G>C	1.37:g.63119432C>G	ENSP00000340742:p.Arg118Thr	Somatic		Capture	Illumina GAIIx	4	62892020	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	HMMPfam_Ded_cyto;superfamily_ARM repeat	p.R118T	ENST00000340370.5	37	c.353	CCDS30734.1	1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497444	0.85069	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000404627	T;T;T	0.42900	0.96;0.96;0.96	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.28234	0.0697	L	0.40543	1.245	0.80722	D	1	P;B;B;B;B	0.43352	0.804;0.129;0.129;0.129;0.217	B;B;B;B;B	0.40329	0.326;0.138;0.089;0.138;0.138	T	0.06356	-1.0831	10	0.45353	T	0.12	.	18.898	0.92432	0.0:1.0:0.0:0.0	.	118;118;118;118;118	Q96NI0;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3	.;.;.;.;.	T	118	ENSP00000251157:R118T;ENSP00000340742:R118T;ENSP00000384446:R118T	ENSP00000251157:R118T	R	-	2	0	DOCK7	62892020	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.633000	0.83260	2.699000	0.92147	0.655000	0.94253	AGA	-	NULL		0.303	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	protein_coding	OTTHUMT00000036806.1	C	NM_033407		62892020	-1	no_errors	NM_033407	genbank	human	validated	54_36p	missense	SNP	1	G
AHCTF1	25909	genome.wustl.edu	37	1	247021017	247021017	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr1:247021017A>T	ENST00000391829.2	-	30	4355	c.4232T>A	c.(4231-4233)cTt>cAt	p.L1411H	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Missense_Mutation_p.L1420H|AHCTF1_ENST00000366508.1_Missense_Mutation_p.L1446H			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1411	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L1411H(1)		NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TGGTGCACAAAGAGAAGCTTC	0.353																																					Colon(145;197 1800 4745 15099 26333)											1	Substitution - Missense(1)	ovary(1)	1											59.0	60.0	60.0					1																	247021017		2203	4300	6503	245087640	SO:0001583	missense	25909				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4232T>A	1.37:g.247021017A>T	ENSP00000375705:p.Leu1411His	Somatic		Capture	Illumina GAIIx	4	245087640	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	-	p.L1411H	ENST00000391829.2	37	c.4232		1	.	.	.	.	.	.	.	.	.	.	A	0.446	-0.896036	0.02472	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.32753	1.44;1.44;1.44	5.64	0.814	0.18756	.	1.110310	0.06870	N	0.800608	T	0.24812	0.0602	L	0.47716	1.5	0.09310	N	1	B;B;B	0.23249	0.082;0.002;0.001	B;B;B	0.20384	0.029;0.005;0.002	T	0.30736	-0.9968	10	0.46703	T	0.11	-0.0173	3.0172	0.06064	0.2369:0.0:0.3407:0.4224	.	272;1446;1411	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	H	1446;1420;1411	ENSP00000355464:L1446H;ENSP00000355465:L1420H;ENSP00000375705:L1411H	ENSP00000355465:L1420H	L	-	2	0	AHCTF1	245087640	0.027000	0.19231	0.007000	0.13788	0.029000	0.11900	0.404000	0.20999	-0.197000	0.10350	-0.372000	0.07161	CTT	-	NULL		0.353	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	protein_coding		A	NM_015446		245087640	-1	no_errors	NM_015446	genbank	human	validated	54_36p	missense	SNP	0.08	T
SFXN3	81855	genome.wustl.edu	37	10	102796226	102796241	+	Splice_Site	DEL	GGCTTTTCCACCCACA	GGCTTTTCCACCCACA	-	rs376385079		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	GGCTTTTCCACCCACA	GGCTTTTCCACCCACA	GGCTTTTCCACCCACA	-	GGCTTTTCCACCCACA	GGCTTTTCCACCCACA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr10:102796226_102796241delGGCTTTTCCACCCACA	ENST00000224807.5	+	6	899		c.e6-1		SFXN3_ENST00000393459.1_Splice_Site	NM_030971.3	NP_112233.2	Q9BWM7	SFXN3_HUMAN	sideroflexin 3						iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	cation transmembrane transporter activity (GO:0008324)	p.?(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Colorectal(252;0.234)		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CCCGTGACCTGGCTTTTCCACCCACAGGCAGCTGGG	0.579																																																1	Unknown(1)	ovary(1)	10																																								102786231	SO:0001630	splice_region_variant	81855			AK074707	CCDS7508.2	10q24.32	2008-09-04			ENSG00000107819	ENSG00000107819		"""Sideroflexins"""	16087	protein-coding gene	gene with protein product		615571					Standard	NM_030971		Approved	SFX3	uc001ksp.3	Q9BWM7	OTTHUMG00000018921	ENST00000224807.5:c.444-1GGCTTTTCCACCCACA>-	10.37:g.102796226_102796241delGGCTTTTCCACCCACA		Somatic		Capture	Illumina GAIIx	4	102786216	Q8NCJ0|Q9NTP4	Splice_Site	DEL	-	e5-2	ENST00000224807.5	37	c.NULL	CCDS7508.2	10																																																																																			(deletion:intron[102785849;102786232])	-		0.579	SFXN3-201	KNOWN	basic|CCDS	protein_coding	SFXN3	protein_coding		GGCTTTTCCACCCACA	NM_030971	Intron	102786231	1	no_errors	NM_030971	genbank	human	validated	54_36p	splice_site_del	DEL	0.195:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.066:0.543:0.964:0.983:0.997:1.000	-
BTRC	8945	genome.wustl.edu	37	10	103221777	103221777	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr10:103221777C>T	ENST00000370187.3	+	3	314	c.196C>T	c.(196-198)Cct>Tct	p.P66S	BTRC_ENST00000393441.4_Intron|BTRC_ENST00000408038.2_Missense_Mutation_p.P30S	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	66					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.P66S(1)		endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		TGGCGAACCCCCTAGGAAGAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	10											97.0	103.0	100.0					10																	103221777		2203	4300	6503	103211767	SO:0001583	missense	8945			Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.196C>T	10.37:g.103221777C>T	ENSP00000359206:p.Pro66Ser	Somatic		Capture	Illumina GAIIx	4	103211767	B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	HMMPfam_WD40;HMMPfam_F-box;superfamily_WD40 repeat-like;superfamily_F-box domain	p.P66S	ENST00000370187.3	37	c.196	CCDS7512.1	10	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048038	0.55110	.	.	ENSG00000166167	ENST00000370187;ENST00000408038;ENST00000370183	T;T	0.61274	0.31;0.12	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000005	T	0.65439	0.2691	N	0.19112	0.55	0.80722	D	1	D;D	0.67145	0.996;0.967	D;P	0.75484	0.986;0.901	T	0.63042	-0.6725	10	0.35671	T	0.21	-12.3347	20.5568	0.99304	0.0:1.0:0.0:0.0	.	30;66	Q9Y297-2;Q9Y297	.;FBW1A_HUMAN	S	66;30;48	ENSP00000359206:P66S;ENSP00000385339:P30S	ENSP00000359202:P48S	P	+	1	0	BTRC	103211767	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.664000	0.68045	2.861000	0.98227	0.655000	0.94253	CCT	-	NULL		0.363	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTRC	protein_coding	OTTHUMT00000049936.1	C	NM_033637		103211767	1	no_errors	NM_033637	genbank	human	reviewed	54_36p	missense	SNP	1	T
KAT6B	23522	genome.wustl.edu	37	10	76788700	76788700	+	Missense_Mutation	SNP	A	A	G	rs373140884		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr10:76788700A>G	ENST00000287239.4	+	18	4607	c.4118A>G	c.(4117-4119)gAa>gGa	p.E1373G	KAT6B_ENST00000372725.1_Missense_Mutation_p.E1081G|KAT6B_ENST00000372711.1_Missense_Mutation_p.E1190G|KAT6B_ENST00000372724.1_Missense_Mutation_p.E1081G|KAT6B_ENST00000372714.1_Missense_Mutation_p.E1081G	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1373	Poly-Glu.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E1373G(1)									gaagaagaagaaggaggagga	0.448																																																1	Substitution - Missense(1)	ovary(1)	10						A	GLY/GLU	1,4405	2.1+/-5.4	0,1,2202	51.0	50.0	50.0		4118	2.5	0.0	10		50	0,8600		0,0,4300	no	missense	KAT6B	NM_012330.2	98	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign	1373/2074	76788700	1,13005	2203	4300	6503	76458706	SO:0001583	missense	23522			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.4118A>G	10.37:g.76788700A>G	ENSP00000287239:p.Glu1373Gly	Somatic		Capture	Illumina GAIIx	4	76458706	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	"PHD;HMMPfam_PHD;MOZ_SAS;HMMPfam_MOZ_SAS;FYVE/PHD zinc finger;superfamily_FYVE/PHD zinc finger;""Winged helix"" DNA-binding domain;superfamily_""Winged helix"" DNA-binding domain;Acyl-CoA N-acyltransferases (Nat);superfamily_Acyl-CoA N-acyltransferases (Nat)"	p.E1373G	ENST00000287239.4	37	c.4118	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	A	0.012	-1.671003	0.00758	2.27E-4	0.0	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	T;T;T;T;T	0.78924	1.12;1.12;-1.22;1.12;-1.21	3.69	2.5	0.30297	.	0.141093	0.31963	N	0.006799	T	0.59142	0.2172	N	0.19112	0.55	0.19300	N	0.999979	B;P;B	0.40731	0.275;0.728;0.18	B;B;B	0.36186	0.088;0.219;0.04	T	0.52366	-0.8585	10	0.48119	T	0.1	-2.877	8.4038	0.32603	0.8007:0.1992:0.0:0.0	.	1190;1081;1373	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	G	1081;1081;1373;1081;1190	ENSP00000361810:E1081G;ENSP00000361809:E1081G;ENSP00000287239:E1373G;ENSP00000361799:E1081G;ENSP00000361796:E1190G	ENSP00000287239:E1373G	E	+	2	0	KAT6B	76458706	0.428000	0.25522	0.007000	0.13788	0.001000	0.01503	0.602000	0.24134	0.415000	0.25817	-0.622000	0.04023	GAA	-	NULL		0.448	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYST4	protein_coding	OTTHUMT00000048771.1	A	NM_012330		76458706	1	no_errors	NM_012330	genbank	human	validated	54_36p	missense	SNP	1	G
MGEA5	10724	genome.wustl.edu	37	10	103546267	103546267	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr10:103546267C>A	ENST00000361464.3	-	16	3087	c.2692G>T	c.(2692-2694)Gaa>Taa	p.E898*	MGEA5_ENST00000439817.1_Nonsense_Mutation_p.E845*|MGEA5_ENST00000357797.5_Nonsense_Mutation_p.E831*|MGEA5_ENST00000482611.1_5'UTR	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	898					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)	p.E898*(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		TTTGCAATTTCAAAACATCCT	0.383																																																1	Substitution - Nonsense(1)	ovary(1)	10											118.0	114.0	115.0					10																	103546267		2203	4300	6503	103536257	SO:0001587	stop_gained	10724			AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.2692G>T	10.37:g.103546267C>A	ENSP00000354850:p.Glu898*	Somatic		Capture	Illumina GAIIx	4	103536257	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Nonsense_Mutation	SNP	-	p.E898*	ENST00000361464.3	37	c.2692	CCDS7520.1	10	.	.	.	.	.	.	.	.	.	.	C	42	9.562877	0.99205	.	.	ENSG00000198408	ENST00000439817;ENST00000361464;ENST00000357797	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-19.9422	20.5568	0.99304	0.0:1.0:0.0:0.0	.	.	.	.	X	845;898;831	.	ENSP00000350445:E831X	E	-	1	0	MGEA5	103536257	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	GAA	-	NULL		0.383	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MGEA5	protein_coding	OTTHUMT00000049987.1	C	NM_012215		103536257	-1	no_errors	NM_012215	genbank	human	validated	54_36p	nonsense	SNP	1	A
CCKBR	887	genome.wustl.edu	37	11	6292408	6292408	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr11:6292408G>C	ENST00000334619.2	+	5	1172	c.979G>C	c.(979-981)Gct>Cct	p.A327P	CCKBR_ENST00000525462.1_Missense_Mutation_p.A396P|CCKBR_ENST00000532715.1_Missense_Mutation_p.A243P|CCKBR_ENST00000532396.1_3'UTR	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	327					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)	p.A327P(1)		NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	CAAGCTGCTGGCTAAGAAGCG	0.612																																																1	Substitution - Missense(1)	ovary(1)	11											135.0	113.0	121.0					11																	6292408		2200	4296	6496	6248984	SO:0001583	missense	887			D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.979G>C	11.37:g.6292408G>C	ENSP00000335544:p.Ala327Pro	Somatic		Capture	Illumina GAIIx	4	6248984	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	HMMPfam_7tm_1,superfamily_Family A G protein-coupled receptor-like	p.A327P	ENST00000334619.2	37	c.979	CCDS7761.1	11	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677974	0.88445	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.73258	-0.73;-0.73;-0.73	4.86	4.86	0.63082	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.86892	0.6042	M	0.90759	3.145	0.58432	D	0.999993	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.996;0.998	D	0.89552	0.3800	10	0.72032	D	0.01	.	16.7176	0.85400	0.0:0.0:1.0:0.0	.	396;261;327	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	P	327;243;396	ENSP00000335544:A327P;ENSP00000432079:A243P;ENSP00000435534:A396P	ENSP00000335544:A327P	A	+	1	0	CCKBR	6248984	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	9.595000	0.98260	2.513000	0.84729	0.557000	0.71058	GCT	-	HMMPfam_7tm_1		0.612	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCKBR	protein_coding	OTTHUMT00000257230.2	G	NM_176875		6248984	1	no_errors	NM_176875	genbank	human	reviewed	54_36p	missense	SNP	1	C
STK33	65975	genome.wustl.edu	37	11	8486290	8486290	+	Missense_Mutation	SNP	G	G	A	rs199852553		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr11:8486290G>A	ENST00000447869.1	-	3	1337	c.419C>T	c.(418-420)aCg>aTg	p.T140M	STK33_ENST00000396672.1_Missense_Mutation_p.T140M|STK33_ENST00000534493.1_Missense_Mutation_p.T99M|STK33_ENST00000358872.3_De_novo_Start_InFrame|STK33_ENST00000315204.1_Missense_Mutation_p.T140M|STK33_ENST00000396673.1_Missense_Mutation_p.T140M			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	140	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T140M(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		TGCCCACTTCGTTTCTGTTTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	11						G	MET/THR	0,4402		0,0,2201	345.0	280.0	302.0		419	3.1	1.0	11		302	1,8589	1.2+/-3.3	0,1,4294	no	missense	STK33	NM_030906.2	81	0,1,6495	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	140/515	8486290	1,12991	2201	4295	6496	8442866	SO:0001583	missense	65975			AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.419C>T	11.37:g.8486290G>A	ENSP00000416750:p.Thr140Met	Somatic		Capture	Illumina GAIIx	4	8442866	Q658S6|Q8NEF5	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.T140M	ENST00000447869.1	37	c.419	CCDS7789.1	11	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834610	0.32421	0.0	1.16E-4	ENSG00000130413	ENST00000447869;ENST00000315204;ENST00000396672;ENST00000396673;ENST00000534493;ENST00000418597;ENST00000422559;ENST00000457885	T;T;T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	6.02	3.13	0.36017	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.264388	0.41823	D	0.000810	T	0.45175	0.1329	N	0.25789	0.76	0.18873	N	0.999981	P	0.42483	0.781	B	0.40702	0.338	T	0.36768	-0.9734	10	0.49607	T	0.09	.	6.1542	0.20328	0.2366:0.0:0.6253:0.1382	.	140	Q9BYT3	STK33_HUMAN	M	140;140;140;140;99;99;99;140	ENSP00000416750:T140M;ENSP00000320754:T140M;ENSP00000379905:T140M;ENSP00000379906:T140M;ENSP00000436418:T99M;ENSP00000391362:T99M;ENSP00000411510:T99M;ENSP00000403599:T140M	ENSP00000320754:T140M	T	-	2	0	STK33	8442866	0.443000	0.25641	0.993000	0.49108	0.642000	0.38348	0.230000	0.17852	1.552000	0.49463	0.650000	0.86243	ACG	-	HMMPfam_Pkinase		0.408	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STK33	protein_coding	OTTHUMT00000276819.2	G	NM_030906		8442866	-1	no_errors	NM_030906	genbank	human	validated	54_36p	missense	SNP	0.75	A
MYO7A	4647	genome.wustl.edu	37	11	76914147	76914147	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr11:76914147G>C	ENST00000409709.3	+	38	5483	c.5211G>C	c.(5209-5211)aaG>aaC	p.K1737N	MYO7A_ENST00000409619.2_Missense_Mutation_p.K1688N|MYO7A_ENST00000458637.2_Missense_Mutation_p.K1699N	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1737					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)	p.K1737N(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGGTGTCCAAGGCCCGAGGCA	0.682																																																1	Substitution - Missense(1)	ovary(1)	11											11.0	18.0	15.0					11																	76914147		1934	3966	5900	76591795	SO:0001583	missense	4647			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.5211G>C	11.37:g.76914147G>C	ENSP00000386331:p.Lys1737Asn	Somatic		Capture	Illumina GAIIx	Phase_III	76591795	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	-	p.K1699N	ENST00000409709.3	37	c.5097	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	G	16.41	3.115290	0.56505	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169;ENST00000544424	T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53	5.14	3.26	0.37387	.	0.046728	0.85682	D	0.000000	T	0.74306	0.3699	M	0.80183	2.485	0.38882	D	0.956931	P;P;P	0.51057	0.941;0.868;0.941	P;P;P	0.51582	0.598;0.674;0.474	T	0.71721	-0.4507	10	0.25106	T	0.35	.	7.3837	0.26870	0.1456:0.0:0.7174:0.137	.	1688;1699;1737	B9A011;F8VUN5;Q13402	.;.;MYO7A_HUMAN	N	1737;1699;1688;910;1736;1706;1613;879;352	ENSP00000386331:K1737N;ENSP00000392185:K1699N;ENSP00000386635:K1688N;ENSP00000417017:K879N	ENSP00000345075:K1613N	K	+	3	2	MYO7A	76591795	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.440000	0.35024	0.576000	0.29452	0.591000	0.81541	AAG	-	NULL		0.682	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	protein_coding	OTTHUMT00000328133.1	G	NM_000260		76591795	1	no_errors	NM_000260	genbank	human	reviewed	54_36p	missense	SNP	0.996	C
SORL1	6653	genome.wustl.edu	37	11	121391551	121391551	+	Missense_Mutation	SNP	A	A	G	rs377405996		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr11:121391551A>G	ENST00000260197.7	+	9	1526	c.1397A>G	c.(1396-1398)aAt>aGt	p.N466S	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	466					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.N466S(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GAGAAAATCAATTGTGAGGTA	0.393																																																1	Substitution - Missense(1)	ovary(1)	11						A	SER/ASN	0,4406		0,0,2203	48.0	51.0	50.0		1397	4.4	0.9	11		50	1,8597	1.2+/-3.3	0,1,4298	no	missense	SORL1	NM_003105.5	46	0,1,6501	GG,GA,AA		0.0116,0.0,0.0077	benign	466/2215	121391551	1,13003	2203	4299	6502	120896761	SO:0001583	missense	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.1397A>G	11.37:g.121391551A>G	ENSP00000260197:p.Asn466Ser	Somatic		Capture	Illumina GAIIx	4	120896761	B2RNX7|Q92856	Missense_Mutation	SNP	HMMPfam_Ldl_recept_b;HMMPfam_Ldl_recept_a;HMMPfam_BNR;HMMPfam_fn3;superfamily_Fibronectin type III;superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase;superfamily_EGF/Laminin;superfamily_LDL receptor-like module;superfamily_YWTD domain	p.N466S	ENST00000260197.7	37	c.1397	CCDS8436.1	11	.	.	.	.	.	.	.	.	.	.	A	12.26	1.885995	0.33348	0.0	1.16E-4	ENSG00000137642	ENST00000260197	T	0.21932	1.98	5.55	4.42	0.53409	VPS10 (1);	0.429735	0.25405	N	0.030902	T	0.16471	0.0396	L	0.42487	1.325	0.54753	D	0.999983	B	0.18461	0.028	B	0.13407	0.009	T	0.06481	-1.0824	10	0.27082	T	0.32	.	7.4783	0.27390	0.7854:0.1424:0.0721:0.0	.	466	Q92673	SORL_HUMAN	S	466	ENSP00000260197:N466S	ENSP00000260197:N466S	N	+	2	0	SORL1	120896761	0.487000	0.25988	0.934000	0.37439	0.973000	0.67179	4.569000	0.60865	0.929000	0.37192	0.383000	0.25322	AAT	-	NULL		0.393	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	protein_coding	OTTHUMT00000387626.2	A	NM_003105		120896761	1	no_errors	NM_003105	genbank	human	reviewed	54_36p	missense	SNP	1	G
C12orf42	374470	genome.wustl.edu	37	12	103696330	103696330	+	Silent	SNP	G	G	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr12:103696330G>A	ENST00000378113.2	-	6	864	c.639C>T	c.(637-639)gcC>gcT	p.A213A	C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548048.1_Silent_p.A146A|C12orf42_ENST00000548883.1_Silent_p.A213A	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	213								p.A213A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						AAGGTCTGGCGGCAGAACCTG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	12											24.0	27.0	26.0					12																	103696330		1973	4148	6121	102220460	SO:0001819	synonymous_variant	374470			AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.639C>T	12.37:g.103696330G>A		Somatic		Capture	Illumina GAIIx	4	102220460	Q49A64|Q4G0S2	Silent	SNP	-	p.A213	ENST00000378113.2	37	c.639	CCDS44963.1	12																																																																																			-	NULL		0.637	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf42	protein_coding	OTTHUMT00000406754.1	G	NM_198521		102220460	-1	no_errors	NM_001099336	genbank	human	validated	54_36p	silent	SNP		A
CACNA1C	775	genome.wustl.edu	37	12	2788613	2788613	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr12:2788613G>T	ENST00000347598.4	+	44	5239	c.5239G>T	c.(5239-5241)Gcc>Tcc	p.A1747S	CACNA1C_ENST00000335762.5_Missense_Mutation_p.A1724S|CACNA1C_ENST00000399597.1_Missense_Mutation_p.A1699S|CACNA1C_ENST00000344100.3_Missense_Mutation_p.A1740S|CACNA1C_ENST00000399617.1_Missense_Mutation_p.A1699S|CACNA1C_ENST00000327702.7_Missense_Mutation_p.A1699S|CACNA1C_ENST00000399644.1_Missense_Mutation_p.A1699S|CACNA1C_ENST00000399634.1_Missense_Mutation_p.A1699S|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399603.1_Missense_Mutation_p.A1699S|CACNA1C_ENST00000399601.1_Missense_Mutation_p.A1699S|CACNA1C_ENST00000399591.1_Missense_Mutation_p.A1707S|CACNA1C_ENST00000406454.3_Missense_Mutation_p.A1699S|CACNA1C_ENST00000399649.1_Missense_Mutation_p.A1705S|CACNA1C_ENST00000399655.1_Missense_Mutation_p.A1699S|CACNA1C_ENST00000402845.3_Missense_Mutation_p.A1718S|CACNA1C_ENST00000399637.1_Missense_Mutation_p.A1718S|CACNA1C_ENST00000399595.1_Missense_Mutation_p.A1707S|CACNA1C_ENST00000399629.1_Missense_Mutation_p.A1716S|CACNA1C_ENST00000399606.1_Missense_Mutation_p.A1719S|CACNA1C_ENST00000399641.1_Missense_Mutation_p.A1699S|CACNA1C_ENST00000399638.1_Missense_Mutation_p.A1727S|CACNA1C_ENST00000399621.1_Missense_Mutation_p.A1718S	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1747					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.A1777S(1)|p.A1234S(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTACAGAGGGCCGGTGGCCT	0.642																																																2	Substitution - Missense(2)	ovary(2)	12											13.0	15.0	15.0					12																	2788613		1961	4157	6118	2658874	SO:0001583	missense	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5239G>T	12.37:g.2788613G>T	ENSP00000266376:p.Ala1747Ser	Somatic		Capture	Illumina GAIIx	Phase_III	2658874	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ,superfamily_EF-hand,superfamily_Voltage-gated potassium channels	p.A1699S	ENST00000347598.4	37	c.5095	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	6.744	0.506034	0.12883	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96011	-3.81;-3.82;-3.81;-3.81;-3.81;-3.84;-3.73;-3.77;-3.82;-3.74;-3.74;-3.82;-3.87;-3.74;-3.65;-3.88;-3.83;-3.81;-3.85;-3.75;-3.84;-3.88	4.4	4.4	0.53042	.	0.841365	0.10517	N	0.665439	D	0.96005	0.8699	L	0.35723	1.085	0.40338	D	0.979004	B;D;B;B;D;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.71674	0.017;0.996;0.018;0.007;0.998;0.126;0.023;0.126;0.006;0.004;0.126;0.018;0.013;0.073;0.051;0.044;0.084;0.007;0.204;0.006;0.018;0.126;0.126;0.105;0.018	B;D;B;B;D;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.80764	0.009;0.923;0.011;0.005;0.994;0.046;0.015;0.046;0.012;0.006;0.046;0.007;0.02;0.046;0.007;0.027;0.022;0.012;0.032;0.02;0.011;0.046;0.032;0.021;0.011	D	0.92324	0.5868	10	0.11794	T	0.64	.	17.178	0.86846	0.0:0.0:1.0:0.0	.	390;1740;1696;1747;1699;1718;1699;1716;1727;1699;1719;1699;1659;1747;1699;1699;1699;1707;1705;1707;1688;1718;1718;1699;1699	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	S	1724;1699;1699;1727;1699;1718;1718;1707;1699;1747;1719;1699;1740;1716;1699;1705;1718;1699;1699;1699;1699;1707;1529	ENSP00000336982:A1724S;ENSP00000382563:A1699S;ENSP00000382552:A1699S;ENSP00000382547:A1727S;ENSP00000382506:A1699S;ENSP00000382530:A1718S;ENSP00000382546:A1718S;ENSP00000382500:A1707S;ENSP00000382549:A1699S;ENSP00000266376:A1747S;ENSP00000382515:A1719S;ENSP00000382510:A1699S;ENSP00000341092:A1740S;ENSP00000382537:A1716S;ENSP00000329877:A1699S;ENSP00000382557:A1705S;ENSP00000385724:A1718S;ENSP00000382512:A1699S;ENSP00000382542:A1699S;ENSP00000382526:A1699S;ENSP00000385896:A1699S;ENSP00000382504:A1707S	ENSP00000323129:A1529S	A	+	1	0	CACNA1C	2658874	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	4.594000	0.61041	2.293000	0.77203	0.313000	0.20887	GCC	-	NULL		0.642	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	protein_coding	OTTHUMT00000317035.1	G	NM_000719		2658874	1	no_errors	NM_000719	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
PLCZ1	89869	genome.wustl.edu	37	12	18846898	18846898	+	Intron	SNP	G	G	A	rs562058585	byFrequency	TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr12:18846898G>A	ENST00000538330.1	-	8	1189				PLCZ1_ENST00000534932.1_Intron|PLCZ1_ENST00000539875.1_Intron|PLCZ1_ENST00000435379.1_Intron|PLCZ1_ENST00000542762.1_5'Flank|PLCZ1_ENST00000541695.1_Intron|PLCZ1_ENST00000266505.7_Intron|PLCZ1_ENST00000447925.2_Intron					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					CTGACATCAAGGCAGTCTGTA	0.413																																																0			12																																								18738165	SO:0001627	intron_variant	643668			AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.807+945C>T	12.37:g.18846898G>A		Somatic		Capture	Illumina GAIIx	4	18738165		RNA	SNP	-	NULL	ENST00000538330.1	37	NULL		12																																																																																			-	-		0.413	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	LOC643668	protein_coding	OTTHUMT00000401666.3	G	NM_033123		18738165	1	pseudogene	XR_016986	genbank	human	model	54_36p	rna	SNP	1	A
KIF21A	55605	genome.wustl.edu	37	12	39726178	39726178	+	Silent	SNP	T	T	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr12:39726178T>C	ENST00000361418.5	-	21	2904	c.2889A>G	c.(2887-2889)aaA>aaG	p.K963K	KIF21A_ENST00000395670.3_Silent_p.K963K|KIF21A_ENST00000541463.2_Silent_p.K927K|KIF21A_ENST00000361961.3_Silent_p.K950K|KIF21A_ENST00000544797.2_Silent_p.K950K			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	963					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K950K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TTTTTGAAAGTTTCTCTCGTC	0.373																																																1	Substitution - coding silent(1)	ovary(1)	12											214.0	200.0	205.0					12																	39726178		2203	4299	6502	38012445	SO:0001819	synonymous_variant	55605			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.2889A>G	12.37:g.39726178T>C		Somatic		Capture	Illumina GAIIx	4	38012445	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Silent	SNP	-	p.K950	ENST00000361418.5	37	c.2850	CCDS53776.1	12	.	.	.	.	.	.	.	.	.	.	T	9.459	1.092554	0.20471	.	.	ENSG00000139116	ENST00000552961	.	.	.	5.67	-3.96	0.04106	.	.	.	.	.	T	0.66567	0.2802	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65356	-0.6188	4	.	.	.	.	17.0843	0.86606	0.0:0.658:0.0:0.342	.	.	.	.	S	311	.	.	N	-	2	0	KIF21A	38012445	0.136000	0.22515	0.892000	0.35008	0.994000	0.84299	-0.515000	0.06290	-1.079000	0.03113	0.455000	0.32223	AAC	-	NULL		0.373	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	protein_coding	OTTHUMT00000403581.1	T	NM_017641		38012445	-1	no_errors	NM_017641	genbank	human	validated	54_36p	silent	SNP	0.89	C
BIN2	51411	genome.wustl.edu	37	12	51696508	51696508	+	Missense_Mutation	SNP	C	C	T	rs555115486		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr12:51696508C>T	ENST00000267012.4	-	4	335	c.274G>A	c.(274-276)Gag>Aag	p.E92K	BIN2_ENST00000604560.1_Missense_Mutation_p.E65K|BIN2_ENST00000544402.1_Missense_Mutation_p.E66K|BIN2_ENST00000452142.2_Missense_Mutation_p.E92K	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	92	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)	p.E92K(1)		NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						CCGTCCCACTCGCTGCTGTAG	0.473													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19510	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	12											230.0	211.0	217.0					12																	51696508		2203	4300	6503	49982775	SO:0001583	missense	51411			AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.274G>A	12.37:g.51696508C>T	ENSP00000267012:p.Glu92Lys	Somatic		Capture	Illumina GAIIx	4	49982775	Q86VV0|Q9NWK4|Q9UKN4	Missense_Mutation	SNP	HMMPfam_BAR	p.E92K	ENST00000267012.4	37	c.274	CCDS8811.1	12	.	.	.	.	.	.	.	.	.	.	C	16.30	3.083528	0.55861	.	.	ENSG00000110934	ENST00000452142;ENST00000267012;ENST00000544402	D;T;T	0.96745	-4.11;0.01;0.01	5.18	4.23	0.50019	BAR (3);	0.203237	0.40554	N	0.001063	D	0.93736	0.7998	L	0.49126	1.545	0.39639	D	0.970291	B;B;B	0.22211	0.036;0.066;0.045	B;B;B	0.16722	0.009;0.009;0.016	D	0.91658	0.5340	10	0.46703	T	0.11	-6.535	12.5224	0.56067	0.0:0.913:0.0:0.087	.	66;92;92	F5H0W4;Q9UBW5-2;Q9UBW5	.;.;BIN2_HUMAN	K	92;92;66	ENSP00000410217:E92K;ENSP00000267012:E92K;ENSP00000445874:E66K	ENSP00000267012:E92K	E	-	1	0	BIN2	49982775	1.000000	0.71417	0.947000	0.38551	0.553000	0.35397	4.883000	0.63128	1.226000	0.43582	0.655000	0.94253	GAG	-	HMMPfam_BAR		0.473	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BIN2	protein_coding	OTTHUMT00000469800.1	C			49982775	-1	no_errors	NM_016293	genbank	human	validated	54_36p	missense	SNP	1	T
DGKA	1606	genome.wustl.edu	37	12	56347170	56347170	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr12:56347170A>T	ENST00000331886.5	+	23	2554	c.2100A>T	c.(2098-2100)gaA>gaT	p.E700D	DGKA_ENST00000551156.1_Missense_Mutation_p.E700D|DGKA_ENST00000394147.1_Missense_Mutation_p.E700D|DGKA_ENST00000549079.2_3'UTR	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	700					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)	p.E700D(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	TTGACGGAGAACCCTGGATGC	0.463																																																1	Substitution - Missense(1)	ovary(1)	12											247.0	241.0	243.0					12																	56347170		2203	4300	6503	54633437	SO:0001583	missense	1606			AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.2100A>T	12.37:g.56347170A>T	ENSP00000328405:p.Glu700Asp	Somatic		Capture	Illumina GAIIx	4	54633437	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	HMMPfam_DAGK_acc;HMMPfam_DAGK_cat;HMMPfam_efhand;HMMPfam_C1_1;superfamily_EF-hand;superfamily_Cysteine-rich domain	p.E700D	ENST00000331886.5	37	c.2100	CCDS8896.1	12	.	.	.	.	.	.	.	.	.	.	A	22.3	4.266004	0.80358	.	.	ENSG00000065357	ENST00000331886;ENST00000394147;ENST00000551156	T;T;T	0.61158	0.13;0.13;0.13	4.71	-0.782	0.10961	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.81138	0.4760	H	0.97214	3.96	0.44523	D	0.997473	D	0.89917	1.0	D	0.97110	1.0	T	0.82161	-0.0594	10	0.87932	D	0	.	10.7645	0.46286	0.4482:0.0:0.5518:0.0	.	700	P23743	DGKA_HUMAN	D	700	ENSP00000328405:E700D;ENSP00000377703:E700D;ENSP00000450359:E700D	ENSP00000328405:E700D	E	+	3	2	DGKA	54633437	1.000000	0.71417	0.990000	0.47175	0.908000	0.53690	0.543000	0.23237	-0.330000	0.08514	0.459000	0.35465	GAA	-	HMMPfam_DAGK_acc		0.463	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKA	protein_coding	OTTHUMT00000407291.1	A			54633437	1	no_errors	NM_001345	genbank	human	reviewed	54_36p	missense	SNP	1	T
THAP2	83591	genome.wustl.edu	37	12	72058300	72058300	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr12:72058300A>G	ENST00000308086.2	+	1	1512	c.11A>G	c.(10-12)aAt>aGt	p.N4S	ZFC3H1_ENST00000548100.1_5'Flank|ZFC3H1_ENST00000378743.3_5'Flank|ZFC3H1_ENST00000552037.1_5'Flank|THAP2_ENST00000547843.1_Missense_Mutation_p.N4S|ZFC3H1_ENST00000549407.1_5'Flank	NM_031435.3	NP_113623.1	Q9H0W7	THAP2_HUMAN	THAP domain containing, apoptosis associated protein 2	4						nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N4S(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	10						ATGCCGACCAATTGCGCTGCG	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											123.0	125.0	124.0					12																	72058300		2203	4300	6503	70344567	SO:0001583	missense	83591			BC008358	CCDS9001.1	12q21.1	2013-01-25				ENSG00000173451		"""THAP (C2CH-type zinc finger) domain containing"""	20854	protein-coding gene	gene with protein product		612531				12575992	Standard	NM_031435		Approved	DKFZP564I0422	uc001swq.3	Q9H0W7	OTTHUMG00000169556	ENST00000308086.2:c.11A>G	12.37:g.72058300A>G	ENSP00000310796:p.Asn4Ser	Somatic		Capture	Illumina GAIIx	4	70344567	B2R8P3	Missense_Mutation	SNP	-	p.N4S	ENST00000308086.2	37	c.11	CCDS9001.1	12	.	.	.	.	.	.	.	.	.	.	A	12.36	1.915085	0.33815	.	.	ENSG00000173451	ENST00000308086;ENST00000547843	D	0.95885	-3.84	5.17	5.17	0.71159	Zinc finger, C2CH-type (3);	0.235594	0.36628	N	0.002489	D	0.89378	0.6698	N	0.00422	-1.515	0.31928	N	0.612562	D	0.69078	0.997	D	0.80764	0.994	D	0.86032	0.1514	10	0.13470	T	0.59	.	11.3256	0.49446	1.0:0.0:0.0:0.0	.	4	Q9H0W7	THAP2_HUMAN	S	4	ENSP00000310796:N4S	ENSP00000310796:N4S	N	+	2	0	THAP2	70344567	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.050000	0.41297	2.165000	0.68154	0.533000	0.62120	AAT	-	NULL		0.562	THAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP2	protein_coding	OTTHUMT00000404796.1	A	NM_031435		70344567	1	no_errors	NM_031435	genbank	human	provisional	54_36p	missense	SNP	1	G
NAA25	80018	genome.wustl.edu	37	12	112516501	112516501	+	Silent	SNP	C	C	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr12:112516501C>T	ENST00000261745.4	-	6	770	c.522G>A	c.(520-522)ctG>ctA	p.L174L		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	174						cytoplasm (GO:0005737)		p.L174L(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						CAGCAAGGGGCAGAAACATTG	0.368																																																1	Substitution - coding silent(1)	ovary(1)	12											170.0	154.0	159.0					12																	112516501		2203	4300	6503	111000884	SO:0001819	synonymous_variant	80018			AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.522G>A	12.37:g.112516501C>T		Somatic		Capture	Illumina GAIIx	4	111000884	A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Silent	SNP	-	p.L174	ENST00000261745.4	37	c.522	CCDS9159.1	12	.	.	.	.	.	.	.	.	.	.	C	8.674	0.903605	0.17760	.	.	ENSG00000111300	ENST00000547133	.	.	.	6.05	-1.67	0.08238	.	.	.	.	.	T	0.41373	0.1156	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27640	-1.0068	4	.	.	.	-7.5836	2.3184	0.04204	0.3124:0.411:0.1011:0.1754	.	.	.	.	T	136	.	.	A	-	1	0	NAA25	111000884	0.984000	0.35163	0.986000	0.45419	0.998000	0.95712	0.242000	0.18087	-0.326000	0.08564	0.650000	0.86243	GCC	-	NULL		0.368	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf30	protein_coding	OTTHUMT00000405205.1	C	NM_024953		111000884	-1	no_errors	NM_024953	genbank	human	validated	54_36p	silent	SNP	1	T
SLC15A1	6564	genome.wustl.edu	37	13	99360992	99360992	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr13:99360992A>G	ENST00000376503.5	-	15	1152	c.1097T>C	c.(1096-1098)gTc>gCc	p.V366A		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	366					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)	p.V366A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	GGAGGCCAGGACCATGCCAAC	0.527																																																1	Substitution - Missense(1)	ovary(1)	13											99.0	75.0	83.0					13																	99360992		2203	4300	6503	98158993	SO:0001583	missense	6564			U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.1097T>C	13.37:g.99360992A>G	ENSP00000365686:p.Val366Ala	Somatic		Capture	Illumina GAIIx	4	98158993	Q5VW82	Missense_Mutation	SNP	-	p.V366A	ENST00000376503.5	37	c.1097	CCDS9489.1	13	.	.	.	.	.	.	.	.	.	.	A	13.90	2.374245	0.42105	.	.	ENSG00000088386	ENST00000376503	T	0.04119	3.7	5.32	4.13	0.48395	Major facilitator superfamily domain, general substrate transporter (1);	0.166906	0.53938	D	0.000049	T	0.05960	0.0155	L	0.33624	1.015	0.80722	D	1	B	0.17038	0.02	B	0.28232	0.087	T	0.26292	-1.0107	10	0.66056	D	0.02	-15.9923	12.3878	0.55343	0.8591:0.1409:0.0:0.0	.	366	P46059	S15A1_HUMAN	A	366	ENSP00000365686:V366A	ENSP00000365686:V366A	V	-	2	0	SLC15A1	98158993	1.000000	0.71417	1.000000	0.80357	0.381000	0.30169	6.786000	0.75094	0.945000	0.37605	0.533000	0.62120	GTC	-	NULL		0.527	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC15A1	protein_coding	OTTHUMT00000045560.3	A	NM_005073		98158993	-1	no_errors	NM_005073	genbank	human	validated	54_36p	missense	SNP	1	G
RNASE11	122651	genome.wustl.edu	37	14	21052117	21052117	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr14:21052117T>A	ENST00000610205.1	-	3	700	c.517A>T	c.(517-519)Agt>Tgt	p.S173C	RNASE11_ENST00000398008.2_Missense_Mutation_p.S173C|RNASE11_ENST00000398009.2_Missense_Mutation_p.S173C|RNASE11_ENST00000432835.2_Missense_Mutation_p.S173C|RNASE11_ENST00000555841.1_Missense_Mutation_p.S173C|RNASE11_ENST00000553849.1_Missense_Mutation_p.S173C	NM_145250.3	NP_660293.1	Q8TAA1	RNS11_HUMAN	ribonuclease, RNase A family, 11 (non-active)	173						extracellular region (GO:0005576)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)	p.S173C(1)		endometrium(1)|large_intestine(6)|lung(7)|ovary(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	21	all_cancers(95;0.00238)	all_lung(585;0.235)	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.0139)		GAGGTAACACTATGGTATTGG	0.443																																																1	Substitution - Missense(1)	ovary(1)	14											107.0	89.0	95.0					14																	21052117		2203	4300	6503	20121957	SO:0001583	missense	122651			BC025410	CCDS9553.1	14q11.1	2013-08-05	2004-11-18	2004-11-18	ENSG00000173464	ENSG00000173464		"""Ribonucleases, RNase A"""	19269	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 6"""	C14orf6			Standard	NM_145250		Approved		uc001vxs.3	Q8TAA1	OTTHUMG00000170990	ENST00000610205.1:c.517A>T	14.37:g.21052117T>A	ENSP00000476537:p.Ser173Cys	Somatic		Capture	Illumina GAIIx	4	20121957		Missense_Mutation	SNP	superfamily_RNase A-like	p.S173C	ENST00000610205.1	37	c.517	CCDS9553.1	14	.	.	.	.	.	.	.	.	.	.	T	16.39	3.109588	0.56398	.	.	ENSG00000173464	ENST00000335950;ENST00000553849;ENST00000555841;ENST00000398009;ENST00000398008;ENST00000432835;ENST00000443456;ENST00000557503	T;T;T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	4.06	-2.45	0.06481	Ribonuclease A, domain (3);	0.766368	0.12270	N	0.483906	T	0.70954	0.3283	N	0.24115	0.695	0.09310	N	1	D	0.67145	0.996	P	0.62649	0.905	T	0.64080	-0.6491	10	0.62326	D	0.03	-12.3081	8.8942	0.35453	0.0:0.5134:0.0:0.4866	.	173	Q8TAA1	RNS11_HUMAN	C	173	ENSP00000338288:S173C;ENSP00000451318:S173C;ENSP00000451563:S173C;ENSP00000381093:S173C;ENSP00000381092:S173C;ENSP00000395210:S173C;ENSP00000401398:S173C;ENSP00000451839:S173C	ENSP00000338288:S173C	S	-	1	0	RNASE11	20121957	0.046000	0.20272	0.005000	0.12908	0.220000	0.24768	0.907000	0.28531	-0.455000	0.07054	-0.558000	0.04189	AGT	-	NULL		0.443	RNASE11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE11	protein_coding	OTTHUMT00000073662.3	T	NM_145250		20121957	-1	no_errors	NM_145250	genbank	human	validated	54_36p	missense	SNP		A
PABPN1	8106	genome.wustl.edu	37	14	23793464	23793464	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr14:23793464G>A	ENST00000216727.4	+	6	1028	c.847G>A	c.(847-849)Ggt>Agt	p.G283S	AL049829.1_ENST00000594872.1_5'Flank|BCL2L2-PABPN1_ENST00000557008.1_Missense_Mutation_p.G310S|PABPN1_ENST00000397276.2_Missense_Mutation_p.G283S|PABPN1_ENST00000556821.1_Missense_Mutation_p.G155S|BCL2L2-PABPN1_ENST00000553781.1_Missense_Mutation_p.G310S|PABPN1_ENST00000557702.1_Missense_Mutation_p.G155S	NM_004643.3	NP_004634.1	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	283	Necessary for homooligomerization.				gene expression (GO:0010467)|modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|muscle contraction (GO:0006936)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G283S(1)		large_intestine(1)|lung(1)|ovary(2)	4	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)		ATTCTACAGTGGTTTTAACAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	14											81.0	83.0	82.0					14																	23793464		2203	4300	6503	22863304	SO:0001583	missense	8106			AF026029	CCDS9592.1	14q11.2	2013-02-12	2001-11-28		ENSG00000100836	ENSG00000100836		"""RNA binding motif (RRM) containing"""	8565	protein-coding gene	gene with protein product		602279	"""poly(A)-binding protein, nuclear 1"""	OPMD, PABP2		7795598	Standard	NM_004643		Approved	PAB2		Q86U42	OTTHUMG00000028739	ENST00000216727.4:c.847G>A	14.37:g.23793464G>A	ENSP00000216727:p.Gly283Ser	Somatic		Capture	Illumina GAIIx	4	22863304	D3DS49|O43484	Missense_Mutation	SNP	-	p.G283S	ENST00000216727.4	37	c.847	CCDS9592.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.67|19.67	3.870715|3.870715	0.72065|0.72065	.|.	.|.	ENSG00000258643;ENSG00000258643;ENSG00000100836;ENSG00000100836;ENSG00000100836;ENSG00000100836|ENSG00000100836	ENST00000553781;ENST00000557008;ENST00000216727;ENST00000397276;ENST00000556821;ENST00000557702|ENST00000555295	T;T;T;T;T;T|.	0.60040|.	2.7;2.7;0.22;0.6;2.04;2.08|.	5.47|5.47	4.55|4.55	0.56014|0.56014	.|.	0.111045|.	0.64402|.	D|.	0.000010|.	T|.	0.70211|.	0.3198|.	L|L	0.61218|0.61218	1.895|1.895	0.58432|0.58432	D|D	0.999994|0.999994	P;P;P|.	0.52842|.	0.956;0.82;0.879|.	P;B;P|.	0.47528|.	0.549;0.403;0.473|.	T|.	0.69363|.	-0.5165|.	10|.	0.51188|.	T|.	0.08|.	-3.6982|-3.6982	14.933|14.933	0.70933|0.70933	0.0:0.1442:0.8558:0.0|0.0:0.1442:0.8558:0.0	.|.	283;283;310|.	Q86U42;Q86U42-2;G3V5R7|.	PABP2_HUMAN;.;.|.	S|X	310;310;283;283;155;155|82	ENSP00000451320:G310S;ENSP00000452479:G310S;ENSP00000216727:G283S;ENSP00000380446:G283S;ENSP00000451970:G155S;ENSP00000450724:G155S|.	ENSP00000216727:G283S|.	G|W	+|+	1|2	0|0	PABPN1;RP11-124D2.2|PABPN1	22863304|22863304	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.898000|5.898000	0.69838|0.69838	1.259000|1.259000	0.44117|0.44117	0.655000|0.655000	0.94253|0.94253	GGT|TGG	-	NULL		0.612	PABPN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PABPN1	protein_coding	OTTHUMT00000071767.4	G	NM_004643		22863304	1	no_errors	NM_004643	genbank	human	reviewed	54_36p	missense	SNP	1	A
SYNE2	23224	genome.wustl.edu	37	14	64680986	64680986	+	Silent	SNP	T	T	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr14:64680986T>G	ENST00000344113.4	+	106	19343	c.19131T>G	c.(19129-19131)tcT>tcG	p.S6377S	SYNE2_ENST00000441438.2_5'Flank|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000554584.1_Silent_p.S6319S|SYNE2_ENST00000555002.1_Silent_p.S3011S|SYNE2_ENST00000394768.2_Silent_p.S2762S|SYNE2_ENST00000358025.3_Silent_p.S6377S|SYNE2_ENST00000458046.2_Silent_p.S11S|SYNE2_ENST00000554805.1_Silent_p.S160S|SYNE2_ENST00000555022.1_Silent_p.S255S|SYNE2_ENST00000357395.3_Silent_p.S2762S	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6377					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.S6377S(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGACTGATTCTTGGCGTAAAC	0.537																																																1	Substitution - coding silent(1)	ovary(1)	14											131.0	132.0	132.0					14																	64680986		2203	4300	6503	63750739	SO:0001819	synonymous_variant	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.19131T>G	14.37:g.64680986T>G		Somatic		Capture	Illumina GAIIx	4	63750739	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	-	p.S6377	ENST00000344113.4	37	c.19131	CCDS41963.1	14																																																																																			-	NULL		0.537	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	protein_coding	OTTHUMT00000276994.2	T	NM_182914		63750739	1	no_errors	NM_182914	genbank	human	validated	54_36p	silent	SNP	0.04	G
MOK	5891	genome.wustl.edu	37	14	102695885	102695885	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr14:102695885G>C	ENST00000361847.2	-	11	1322	c.1091C>G	c.(1090-1092)tCc>tGc	p.S364C	MOK_ENST00000522867.1_Silent_p.L58L|MOK_ENST00000523231.1_Silent_p.L58L|MOK_ENST00000522534.1_Silent_p.L58L|MOK_ENST00000561150.1_Intron|MOK_ENST00000520266.1_5'UTR|MOK_ENST00000524214.1_Missense_Mutation_p.S334C|MOK_ENST00000517966.1_Silent_p.L58L|MOK_ENST00000193029.6_Intron|MOK_ENST00000522874.1_Missense_Mutation_p.S363C|MOK_ENST00000519058.1_Silent_p.L58L|MOK_ENST00000524370.1_Silent_p.L58L	NM_014226.1	NP_055041.1	Q9UQ07	MOK_HUMAN	MOK protein kinase	364					protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S364C(1)									CGTGGGGCTGGAGTAAGACGA	0.567																																																1	Substitution - Missense(1)	ovary(1)	14											93.0	86.0	88.0					14																	102695885		2203	4300	6503	101765638	SO:0001583	missense	5891			AB022694	CCDS9971.1, CCDS61552.1	14q32	2014-04-23	2011-09-06	2011-09-06	ENSG00000080823	ENSG00000080823			9833	protein-coding gene	gene with protein product		605762	"""renal tumor antigen"""	RAGE		8781117, 10421840	Standard	NM_014226		Approved	RAGE1, STK30	uc001ylm.4	Q9UQ07	OTTHUMG00000164896	ENST00000361847.2:c.1091C>G	14.37:g.102695885G>C	ENSP00000355304:p.Ser364Cys	Somatic		Capture	Illumina GAIIx	4	101765638	B2R6Z4|B7Z7P6|E7ER76|E7ERR8|Q92790|Q93067	Missense_Mutation	SNP	-	p.S364C	ENST00000361847.2	37	c.1091	CCDS9971.1	14	.	.	.	.	.	.	.	.	.	.	G	14.06	2.424017	0.43020	.	.	ENSG00000080823	ENST00000522874;ENST00000361847;ENST00000524214	T;T;T	0.77098	-0.54;-0.6;-1.07	5.12	3.3	0.37823	.	0.310502	0.31797	N	0.007055	T	0.78742	0.4331	M	0.72118	2.19	0.80722	D	1	D;D	0.57571	0.98;0.98	P;P	0.50231	0.635;0.635	T	0.76187	-0.3051	10	0.48119	T	0.1	-3.2679	7.6313	0.28240	0.0848:0.0:0.7528:0.1624	.	334;364	E7ERR8;Q9UQ07	.;MOK_HUMAN	C	363;364;334	ENSP00000429469:S363C;ENSP00000355304:S364C;ENSP00000428942:S334C	ENSP00000355304:S364C	S	-	2	0	RAGE	101765638	1.000000	0.71417	0.954000	0.39281	0.227000	0.25037	3.721000	0.54941	0.567000	0.29293	0.561000	0.74099	TCC	-	NULL		0.567	MOK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAGE	protein_coding	OTTHUMT00000380848.3	G			101765638	-1	no_errors	NM_014226	genbank	human	provisional	54_36p	missense	SNP	1	C
CILP	8483	genome.wustl.edu	37	15	65499322	65499322	+	Silent	SNP	C	C	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr15:65499322C>A	ENST00000261883.4	-	4	388	c.222G>T	c.(220-222)ctG>ctT	p.L74L		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	74					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.L74L(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						GAATGGCGTCCAGCCGCTCAT	0.617																																																1	Substitution - coding silent(1)	ovary(1)	15											53.0	43.0	46.0					15																	65499322		2201	4299	6500	63286375	SO:0001819	synonymous_variant	8483			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.222G>T	15.37:g.65499322C>A		Somatic		Capture	Illumina GAIIx	4	63286375	B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	HMMPfam_TSP_1,superfamily_Carboxypeptidase regulatory domain,HMMPfam_ig,superfamily_Immunoglobulin,superfamily_TSP-1 type 1 repeat	p.L74	ENST00000261883.4	37	c.222	CCDS10203.1	15																																																																																			-	NULL		0.617	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	protein_coding	OTTHUMT00000256829.1	C	NM_003613		63286375	-1	no_errors	NM_003613	genbank	human	reviewed	54_36p	silent	SNP	1	A
ABCC1	4363	genome.wustl.edu	37	16	16173319	16173319	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr16:16173319G>C	ENST00000399410.3	+	16	2274	c.2099G>C	c.(2098-2100)gGg>gCg	p.G700A	ABCC1_ENST00000346370.5_Missense_Mutation_p.G700A|ABCC1_ENST00000351154.5_Missense_Mutation_p.G700A|ABCC1_ENST00000345148.5_Missense_Mutation_p.G700A|ABCC1_ENST00000349029.5_Missense_Mutation_p.G700A|ABCC1_ENST00000399408.2_Missense_Mutation_p.G700A	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	700	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.G700A(1)		breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	AAAGTGGAGGGGCACGTGGCT	0.587																																																1	Substitution - Missense(1)	ovary(1)	16											48.0	50.0	49.0					16																	16173319		2029	4191	6220	16080820	SO:0001583	missense	4363			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2099G>C	16.37:g.16173319G>C	ENSP00000382342:p.Gly700Ala	Somatic		Capture	Illumina GAIIx	Phase_III	16080820	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	HMMPfam_ABC_membrane,HMMPfam_ABC_tran,superfamily_P-loop containing nucleoside triphosphate hydrolases,superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain	p.G700A	ENST00000399410.3	37	c.2099	CCDS42122.1	16	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662710	0.67700	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.98701	-5.08;-5.08;-5.08;-5.08;-5.08;-4.66	4.77	4.77	0.60923	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.99348	0.9771	M	0.93241	3.395	0.80722	D	1	P;D;D;D;D;D	0.89917	0.706;1.0;0.999;1.0;1.0;0.999	B;D;D;D;D;D	0.91635	0.422;0.979;0.996;0.999;0.999;0.921	D	0.98708	1.0703	10	0.87932	D	0	-23.0115	16.7985	0.85608	0.0:0.0:1.0:0.0	.	700;700;700;700;700;700	P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;MRP1_HUMAN;.	A	700;700;700;700;700;700;374	ENSP00000382342:G700A;ENSP00000382340:G700A;ENSP00000263019:G700A;ENSP00000263017:G700A;ENSP00000263014:G700A;ENSP00000263016:G700A	ENSP00000263014:G700A	G	+	2	0	ABCC1	16080820	1.000000	0.71417	0.999000	0.59377	0.359000	0.29487	9.716000	0.98752	2.207000	0.71202	0.563000	0.77884	GGG	-	HMMPfam_ABC_tran		0.587	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC1	protein_coding	OTTHUMT00000109701.1	G	NM_004996		16080820	1	no_errors	NM_004996	genbank	human	reviewed	54_36p	missense	SNP	0.999	C
WDR90	197335	genome.wustl.edu	37	16	704990	704990	+	Intron	SNP	C	C	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr16:704990C>T	ENST00000293879.4	+	14	1437				WDR90_ENST00000549091.1_Intron|LA16c-349E10.1_ENST00000573609.1_RNA			Q96KV7	WDR90_HUMAN	WD repeat domain 90											endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GTGGCCCCGACTGGCCCTGCC	0.687																																																0			16											14.0	19.0	17.0					16																	704990		1945	4113	6058	644991	SO:0001627	intron_variant	100131582			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.1438-39C>T	16.37:g.704990C>T		Somatic		Capture	Illumina GAIIx	4	644991	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	-	p.S148N	ENST00000293879.4	37	c.443	CCDS42092.1	16																																																																																			-	NULL		0.687	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	LOC100131582	protein_coding	OTTHUMT00000404335.1	C	NM_145294		644991	-1	no_errors	XM_001720183	genbank	human	model	54_36p	missense	SNP	0.004	T
MYLK3	91807	genome.wustl.edu	37	16	46746655	46746655	+	Silent	SNP	G	G	A	rs373988254		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr16:46746655G>A	ENST00000394809.4	-	10	2134	c.2019C>T	c.(2017-2019)ttC>ttT	p.F673F	MYLK3_ENST00000536476.1_Silent_p.F332F|MYLK3_ENST00000562104.1_5'Flank	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	673	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)	p.F673F(1)|p.F752F(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CAGGAGTGCCGAAGTTCACCT	0.547																																																2	Substitution - coding silent(2)	ovary(2)	16						G		0,4406		0,0,2203	86.0	72.0	77.0		2019	-8.0	0.9	16		77	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MYLK3	NM_182493.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		673/820	46746655	1,13005	2203	4300	6503	45304156	SO:0001819	synonymous_variant	91807			AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.2019C>T	16.37:g.46746655G>A		Somatic		Capture	Illumina GAIIx	4	45304156	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Silent	SNP	-	p.F673	ENST00000394809.4	37	c.2019	CCDS10723.2	16																																																																																			-	NULL		0.547	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLK3	protein_coding	OTTHUMT00000255743.2	G	NM_182493		45304156	-1	no_errors	NM_182493	genbank	human	validated	54_36p	silent	SNP	1	A
USP6	9098	genome.wustl.edu	37	17	5035594	5035594	+	Intron	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr17:5035594A>T	ENST00000574788.1	+	12	2385				USP6_ENST00000304328.5_Intron|USP6_ENST00000250066.6_Intron|USP6_ENST00000572429.1_3'UTR|USP6_ENST00000332776.4_Intron			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6						cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CCTGAGCTGGATAGGGACAGA	0.652			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0			17																																								4976318	SO:0001627	intron_variant	9098			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.156-97A>T	17.37:g.5035594A>T		Somatic		Capture	Illumina GAIIx	4	4976318	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	-	p.D81V	ENST00000574788.1	37	c.242	CCDS11069.2	17																																																																																			-	NULL		0.652	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	protein_coding	OTTHUMT00000438990.1	A	NM_004505		4976318	1	no_errors	ENST00000396805	ensembl	human	known	54_36p	missense	SNP	0.9	T
PITPNM3	83394	genome.wustl.edu	37	17	6371565	6371565	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr17:6371565G>A	ENST00000262483.8	-	14	1957	c.1870C>T	c.(1870-1872)Cgg>Tgg	p.R624W	PITPNM3_ENST00000421306.3_Missense_Mutation_p.R588W|PITPNM3_ENST00000576664.1_5'UTR	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	624					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)	p.R624W(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		ACCTGAGTCCGCTTACGAAGC	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											75.0	72.0	73.0					17																	6371565		2203	4300	6503	6312289	SO:0001583	missense	83394			AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.1870C>T	17.37:g.6371565G>A	ENSP00000262483:p.Arg624Trp	Somatic		Capture	Illumina GAIIx	4	6312289	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	-	p.R624W	ENST00000262483.8	37	c.1870	CCDS11076.1	17	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640400	0.67244	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.54479	0.57;0.57	4.91	1.06	0.20224	.	0.051263	0.64402	D	0.000001	T	0.74336	0.3703	M	0.89601	3.045	0.48341	D	0.999637	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.78516	-0.2174	10	0.87932	D	0	.	12.3287	0.55026	0.0:0.0:0.3549:0.6451	.	588;624	F8WEW5;Q9BZ71	.;PITM3_HUMAN	W	624;588	ENSP00000262483:R624W;ENSP00000407882:R588W	ENSP00000262483:R624W	R	-	1	2	PITPNM3	6312289	1.000000	0.71417	0.996000	0.52242	0.897000	0.52465	0.660000	0.25009	0.316000	0.23135	0.462000	0.41574	CGG	-	NULL		0.637	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNM3	protein_coding	OTTHUMT00000219824.2	G	NM_031220		6312289	-1	no_errors	NM_031220	genbank	human	validated	54_36p	missense	SNP	1	A
FZD2	2535	genome.wustl.edu	37	17	42636601	42636601	+	Silent	SNP	G	G	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr17:42636601G>A	ENST00000315323.3	+	1	1677	c.1545G>A	c.(1543-1545)tcG>tcA	p.S515S		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	515					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.S515S(2)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CGCGCATGTCGCCCGACTTCA	0.637																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	17											43.0	40.0	41.0					17																	42636601		2203	4300	6503	39992127	SO:0001819	synonymous_variant	2535			L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.1545G>A	17.37:g.42636601G>A		Somatic		Capture	Illumina GAIIx	4	39992127	Q0VG82	Silent	SNP	HMMPfam_Fz,HMMPfam_Frizzled,superfamily_Frizzled cysteine-rich domain	p.S515	ENST00000315323.3	37	c.1545	CCDS11484.1	17																																																																																			-	HMMPfam_Frizzled		0.637	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD2	protein_coding	OTTHUMT00000457806.1	G	NM_001466		39992127	1	no_errors	NM_001466	genbank	human	reviewed	54_36p	silent	SNP	0.998	A
TP53	7157	genome.wustl.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	17	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	7518937	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*	Somatic		Capture	Illumina GAIIx	4	7518937	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R213*	ENST00000269305.4	37	c.637	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	-	HMMPfam_P53		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7518937	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	0.38	A
SDK2	54549	genome.wustl.edu	37	17	71410827	71410827	+	Missense_Mutation	SNP	C	C	T	rs147112459		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr17:71410827C>T	ENST00000392650.3	-	18	2440	c.2440G>A	c.(2440-2442)Gcc>Acc	p.A814T	SDK2_ENST00000388726.3_Missense_Mutation_p.A814T	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	814	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.A814T(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GGGCTGGGGGCGTTCCAGGTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	17						C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	97.0	79.0	85.0		2440	5.4	1.0	17	dbSNP_134	85	0,8600		0,0,4300	no	missense	SDK2	NM_001144952.1	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	814/2173	71410827	1,13005	2203	4300	6503	68922422	SO:0001583	missense	54549			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.2440G>A	17.37:g.71410827C>T	ENSP00000376421:p.Ala814Thr	Somatic		Capture	Illumina GAIIx	4	68922422	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	-	p.A493T	ENST00000392650.3	37	c.1477	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	c	19.80	3.894252	0.72639	2.27E-4	0.0	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.58797	0.31;0.31	5.39	5.39	0.77823	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.055135	0.64402	D	0.000001	T	0.56441	0.1985	L	0.46947	1.48	0.48975	D	0.999734	P;P	0.43431	0.807;0.7	P;P	0.44990	0.454;0.466	T	0.58736	-0.7584	10	0.51188	T	0.08	.	13.7709	0.63023	0.0:0.7203:0.2797:0.0	.	814;814	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	T	438;814;814;814	ENSP00000376421:A814T;ENSP00000373378:A814T	ENSP00000324967:A814T	A	-	1	0	SDK2	68922422	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	5.216000	0.65246	2.536000	0.85505	0.543000	0.68304	GCC	-	NULL		0.602	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	protein_coding	OTTHUMT00000327598.2	C	NM_019064		68922422	-1	no_errors	ENST00000334543	ensembl	human	known	54_36p	missense	SNP	0.99	T
RIOK3	8780	genome.wustl.edu	37	18	21059302	21059302	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr18:21059302A>C	ENST00000339486.3	+	12	1983	c.1366A>C	c.(1366-1368)Aag>Cag	p.K456Q	RIOK3_ENST00000581585.1_Missense_Mutation_p.K440Q|RIOK3_ENST00000577501.1_Missense_Mutation_p.K453Q	NM_003831.3	NP_003822.2	O14730	RIOK3_HUMAN	RIO kinase 3	456	Protein kinase.				chromosome segregation (GO:0007059)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.K456Q(1)		central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(2)	10	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AGGAGGAGTCAAGGAAGCCCT	0.368																																																1	Substitution - Missense(1)	ovary(1)	18											105.0	95.0	99.0					18																	21059302		2203	4300	6503	19313300	SO:0001583	missense	8780			AF013591	CCDS11877.1	18q11.2	2012-12-10	2012-12-10	2003-06-25	ENSG00000101782	ENSG00000101782			11451	protein-coding gene	gene with protein product		603579	"""sudD (suppressor of bimD6, Aspergillus nidulans) homolog"", ""RIO kinase 3 (yeast)"""	SUDD		9602165	Standard	NM_003831		Approved		uc002kui.4	O14730	OTTHUMG00000131813	ENST00000339486.3:c.1366A>C	18.37:g.21059302A>C	ENSP00000341874:p.Lys456Gln	Somatic		Capture	Illumina GAIIx	4	19313300	Q8IXN9	Missense_Mutation	SNP	HMMPfam_RIO1;superfamily_Protein kinase-like (PK-like)	p.K456Q	ENST00000339486.3	37	c.1366	CCDS11877.1	18	.	.	.	.	.	.	.	.	.	.	A	9.573	1.121559	0.20877	.	.	ENSG00000101782	ENST00000339486	T	0.06849	3.25	5.75	5.75	0.90469	RIO kinase (1);Protein kinase-like domain (1);RIO-like kinase (1);	0.774566	0.12631	N	0.452149	T	0.08891	0.0220	L	0.27053	0.805	0.09310	N	1	P;B;B;B	0.44627	0.839;0.004;0.071;0.026	P;B;B;B	0.48063	0.565;0.017;0.054;0.024	T	0.32851	-0.9891	10	0.38643	T	0.18	-12.4959	4.5996	0.12347	0.6292:0.0:0.0824:0.2884	.	200;440;453;456	E7ESK5;B4E1Q4;O14730-2;O14730	.;.;.;RIOK3_HUMAN	Q	456	ENSP00000341874:K456Q	ENSP00000341874:K456Q	K	+	1	0	RIOK3	19313300	0.602000	0.26916	0.975000	0.42487	0.807000	0.45602	1.931000	0.40134	2.202000	0.70862	0.451000	0.29950	AAG	-	HMMPfam_RIO1		0.368	RIOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK3	protein_coding	OTTHUMT00000254756.1	A	NM_003831		19313300	1	no_errors	NM_003831	genbank	human	reviewed	54_36p	missense	SNP	0.3	C
ZNF521	25925	genome.wustl.edu	37	18	22806157	22806157	+	Silent	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr18:22806157A>T	ENST00000361524.3	-	4	1873	c.1725T>A	c.(1723-1725)ctT>ctA	p.L575L	ZNF521_ENST00000538137.2_Silent_p.L575L|ZNF521_ENST00000584787.1_Silent_p.L355L|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	575					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.L575L(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGTTCAGTTTAAGAACGCTGT	0.423			T	PAX5	ALL																																		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	1	Substitution - coding silent(1)	ovary(1)	18											119.0	122.0	121.0					18																	22806157		2203	4300	6503	21060155	SO:0001819	synonymous_variant	25925			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1725T>A	18.37:g.22806157A>T		Somatic		Capture	Illumina GAIIx	4	21060155	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.L575	ENST00000361524.3	37	c.1725	CCDS32806.1	18																																																																																			-	NULL		0.423	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	protein_coding	OTTHUMT00000446781.2	A	NM_015461		21060155	-1	no_errors	NM_015461	genbank	human	validated	54_36p	silent	SNP	0.96	T
RGL3	57139	genome.wustl.edu	37	19	11526798	11526798	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr19:11526798C>T	ENST00000380456.3	-	5	515	c.452G>A	c.(451-453)tGg>tAg	p.W151*	RGL3_ENST00000393423.3_Nonsense_Mutation_p.W151*	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	151	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.W151*(1)		breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						GTCCTGCAGCCAGGAGCCCAG	0.622																																					GBM(174;751 2067 17998 27979 33959)											1	Substitution - Nonsense(1)	ovary(1)	19											15.0	17.0	16.0					19																	11526798		2203	4298	6501	11387798	SO:0001587	stop_gained	57139			BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.452G>A	19.37:g.11526798C>T	ENSP00000369823:p.Trp151*	Somatic		Capture	Illumina GAIIx	4	11387798	B5ME84|B7ZL22|Q0P6G0	Nonsense_Mutation	SNP	HMMPfam_RA;HMMPfam_RasGEF_N;HMMPfam_RasGEF;superfamily_Ras GEF;superfamily_Ubiquitin-like	p.W151*	ENST00000380456.3	37	c.452	CCDS32910.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.798123	0.96952	.	.	ENSG00000205517	ENST00000393423;ENST00000380456	.	.	.	4.88	4.88	0.63580	.	0.060260	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.7728	0.85543	0.0:1.0:0.0:0.0	.	.	.	.	X	151	.	ENSP00000369823:W151X	W	-	2	0	RGL3	11387798	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	5.414000	0.66405	2.249000	0.74217	0.511000	0.50034	TGG	-	HMMPfam_RasGEF_N		0.622	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL3	protein_coding	OTTHUMT00000421208.3	C	XM_290867		11387798	-1	no_errors	NM_001035223	genbank	human	provisional	54_36p	nonsense	SNP	1	T
EMR2	30817	genome.wustl.edu	37	19	14862306	14862306	+	Missense_Mutation	SNP	C	C	A	rs143530914		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr19:14862306C>A	ENST00000315576.3	-	16	2417	c.1966G>T	c.(1966-1968)Gct>Tct	p.A656S	EMR2_ENST00000346057.1_Missense_Mutation_p.A607S|EMR2_ENST00000594076.1_Missense_Mutation_p.A563S|EMR2_ENST00000392967.2_Missense_Mutation_p.A645S|EMR2_ENST00000596991.2_Missense_Mutation_p.A645S|EMR2_ENST00000392964.3_3'UTR|EMR2_ENST00000353876.1_Missense_Mutation_p.A563S|EMR2_ENST00000594294.1_Missense_Mutation_p.A607S|EMR2_ENST00000601345.1_Missense_Mutation_p.A645S|EMR2_ENST00000353005.1_Missense_Mutation_p.A514S|EMR2_ENST00000392965.3_Missense_Mutation_p.A598S|EMR2_ENST00000595839.1_Missense_Mutation_p.A514S	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	656					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)	p.A656S(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						ACTGTCACAGCTGGGACTCCG	0.512																																																1	Substitution - Missense(1)	ovary(1)	19											122.0	115.0	117.0					19																	14862306		2203	4300	6503	14723306	SO:0001583	missense	30817			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.1966G>T	19.37:g.14862306C>A	ENSP00000319883:p.Ala656Ser	Somatic		Capture	Illumina GAIIx	4	14723306	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	HMMPfam_GPS;HMMPfam_7tm_2;HMMPfam_EGF_CA;superfamily_EGF/Laminin;superfamily_Family A G protein-coupled receptor-like	p.A656S	ENST00000315576.3	37	c.1966	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657851	0.47467	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965	T;T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19;1.19	4.62	2.37	0.29283	GPCR, family 2-like (1);	.	.	.	.	T	0.70360	0.3215	H	0.96720	3.87	0.22389	N	0.99914	D;P;D;D;P;P;D;P	0.69078	0.994;0.929;0.997;0.996;0.929;0.942;0.988;0.824	D;P;D;D;P;P;D;P	0.71414	0.934;0.839;0.973;0.939;0.839;0.868;0.939;0.607	T	0.65026	-0.6268	9	0.72032	D	0.01	.	12.6581	0.56799	0.0:0.6808:0.3192:0.0	.	598;563;656;514;607;656;656;645	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;.;EMR2_HUMAN;.	S	656;645;607;563;514;598	ENSP00000319883:A656S;ENSP00000376694:A645S;ENSP00000263380:A607S;ENSP00000319454:A563S;ENSP00000319838:A514S;ENSP00000376692:A598S	ENSP00000319883:A656S	A	-	1	0	EMR2	14723306	0.000000	0.05858	0.001000	0.08648	0.069000	0.16628	0.115000	0.15540	0.437000	0.26423	0.514000	0.50259	GCT	-	HMMPfam_7tm_2		0.512	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	protein_coding	OTTHUMT00000466502.2	C			14723306	-1	no_errors	NM_013447	genbank	human	reviewed	54_36p	missense	SNP	0.85	A
IRGC	56269	genome.wustl.edu	37	19	44223100	44223100	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr19:44223100C>A	ENST00000244314.5	+	2	589	c.390C>A	c.(388-390)gaC>gaA	p.D130E		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	130	IRG-type G.					membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)	p.D130E(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				AGCAGGTAGACTTCAGCCGCT	0.647																																					Colon(189;350 2037 11447 13433 38914)											1	Substitution - Missense(1)	ovary(1)	19											20.0	18.0	19.0					19																	44223100		2202	4299	6501	48914940	SO:0001583	missense	56269			BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.390C>A	19.37:g.44223100C>A	ENSP00000244314:p.Asp130Glu	Somatic		Capture	Illumina GAIIx	4	48914940	Q05BR8	Missense_Mutation	SNP	-	p.D130E	ENST00000244314.5	37	c.390	CCDS12629.1	19	.	.	.	.	.	.	.	.	.	.	C	3.232	-0.157161	0.06544	.	.	ENSG00000124449	ENST00000244314	T	0.20738	2.05	5.71	-2.41	0.06562	.	0.592248	0.15890	N	0.239594	T	0.04588	0.0125	N	0.02854	-0.475	0.09310	N	1	B	0.24823	0.112	B	0.25405	0.06	T	0.32134	-0.9918	10	0.02654	T	1	.	0.5314	0.00629	0.2494:0.2857:0.2438:0.221	.	130	Q6NXR0	IIGP5_HUMAN	E	130	ENSP00000244314:D130E	ENSP00000244314:D130E	D	+	3	2	IRGC	48914940	0.982000	0.34865	0.646000	0.29493	0.992000	0.81027	0.111000	0.15458	-0.176000	0.10707	0.555000	0.69702	GAC	-	NULL		0.647	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRGC	protein_coding	OTTHUMT00000336191.1	C	NM_019612		48914940	1	no_errors	NM_019612	genbank	human	validated	54_36p	missense	SNP	0.01	A
BCAT2	587	genome.wustl.edu	37	19	49309829	49309829	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr19:49309829G>T	ENST00000316273.6	-	3	257	c.245C>A	c.(244-246)cCc>cAc	p.P82H	BCAT2_ENST00000402551.1_Missense_Mutation_p.P42H|BCAT2_ENST00000598162.1_Missense_Mutation_p.P82H|BCAT2_ENST00000597011.1_Missense_Mutation_p.P42H|BCAT2_ENST00000601496.1_5'Flank|BCAT2_ENST00000545387.2_Intron|BCAT2_ENST00000599246.1_Intron	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	82					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)	p.P82H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	GTTCTGGAAGGGCTGGATTCG	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											114.0	124.0	121.0					19																	49309829		2203	4300	6503	54001641	SO:0001583	missense	587			U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.245C>A	19.37:g.49309829G>T	ENSP00000322991:p.Pro82His	Somatic		Capture	Illumina GAIIx	4	54001641	B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Missense_Mutation	SNP	HMMPfam_Aminotran_4,superfamily_D-aminoacid aminotransferase-like PLP-dependent enzymes	p.P82H	ENST00000316273.6	37	c.245	CCDS12735.1	19	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828870	0.90955	.	.	ENSG00000105552	ENST00000316273;ENST00000402551	T;T	0.21031	2.03;2.03	5.27	5.27	0.74061	.	0.054027	0.85682	D	0.000000	T	0.62171	0.2406	H	0.96916	3.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75858	-0.3169	10	0.87932	D	0	-7.8449	16.7525	0.85489	0.0:0.0:1.0:0.0	.	82;82	Q53EW7;O15382	.;BCAT2_HUMAN	H	82;42	ENSP00000322991:P82H;ENSP00000385161:P42H	ENSP00000322991:P82H	P	-	2	0	BCAT2	54001641	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.980000	0.93460	2.626000	0.88956	0.650000	0.86243	CCC	-	HMMPfam_Aminotran_4		0.642	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAT2	protein_coding	OTTHUMT00000466202.1	G			54001641	-1	no_errors	NM_001190	genbank	human	validated	54_36p	missense	SNP	1	T
OR7G1	125962	genome.wustl.edu	37	19	9225597	9225597	+	Silent	SNP	G	G	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr19:9225597G>T	ENST00000541538.1	-	1	842	c.843C>A	c.(841-843)gtC>gtA	p.V281V	OR7G1_ENST00000293614.1_Silent_p.V281V	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V281V(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						TCATTTGAGGGACCACAGTGT	0.433																																																1	Substitution - coding silent(1)	ovary(1)	19											126.0	112.0	117.0					19																	9225597		2203	4300	6503	9086597	SO:0001819	synonymous_variant	125962				CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.843C>A	19.37:g.9225597G>T		Somatic		Capture	Illumina GAIIx	Phase_III	9086597	Q6IFJ5|Q96RA1	Silent	SNP	-	p.V281	ENST00000541538.1	37	c.843	CCDS32898.2	19																																																																																			-	NULL		0.433	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7G1	protein_coding	OTTHUMT00000397912.1	G			9086597	-1	no_errors	NM_001005192	genbank	human	provisional	54_36p	silent	SNP	0.473	T
RCN3	57333	genome.wustl.edu	37	19	50037525	50037525	+	Silent	SNP	C	C	T	rs576658208		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr19:50037525C>T	ENST00000270645.3	+	3	765	c.318C>T	c.(316-318)atC>atT	p.I106I	RCN3_ENST00000593644.1_Intron	NM_020650.2	NP_065701.2	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain	106	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)	p.I106I(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		GCGCGTGGATCGCGCACACGC	0.726													C|||	1	0.000199681	0.0	0.0	5008	,	,		11863	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	19											11.0	9.0	10.0					19																	50037525		2101	4113	6214	54729337	SO:0001819	synonymous_variant	57333			AY195859	CCDS12771.1	19q13.33	2013-01-10				ENSG00000142552		"""EF-hand domain containing"""	21145	protein-coding gene	gene with protein product							Standard	NM_020650		Approved	RLP49	uc002poj.3	Q96D15		ENST00000270645.3:c.318C>T	19.37:g.50037525C>T		Somatic		Capture	Illumina GAIIx	Phase_III	54729337	Q9HBZ8	Silent	SNP	-	p.I106	ENST00000270645.3	37	c.318	CCDS12771.1	19																																																																																			-	NULL		0.726	RCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCN3	protein_coding	OTTHUMT00000465261.1	C	NM_020650		54729337	1	no_errors	NM_020650	genbank	human	provisional	54_36p	silent	SNP	0.996	T
EPC2	26122	genome.wustl.edu	37	2	149539287	149539287	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:149539287G>T	ENST00000258484.6	+	11	1829	c.1795G>T	c.(1795-1797)Gcc>Tcc	p.A599S		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	599	Gln-rich.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)		p.A599S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		GCAGCAACTTGCCCAGCTTCA	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											115.0	117.0	116.0					2																	149539287		2037	4200	6237	149255757	SO:0001583	missense	26122			AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.1795G>T	2.37:g.149539287G>T	ENSP00000258484:p.Ala599Ser	Somatic		Capture	Illumina GAIIx	4	149255757	B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Missense_Mutation	SNP	HMMPfam_E_Pc_C	p.A555S	ENST00000258484.6	37	c.1663	CCDS46422.1	2	.	.	.	.	.	.	.	.	.	.	G	16.65	3.182922	0.57800	.	.	ENSG00000135999	ENST00000258484	T	0.34667	1.35	5.19	5.19	0.71726	.	0.203904	0.41605	N	0.000859	T	0.54095	0.1837	L	0.48642	1.525	0.80722	D	1	D	0.63046	0.992	D	0.74348	0.983	T	0.44574	-0.9319	10	0.33141	T	0.24	-2.134	19.0877	0.93212	0.0:0.0:1.0:0.0	.	599	Q52LR7	EPC2_HUMAN	S	599	ENSP00000258484:A599S	ENSP00000258484:A599S	A	+	1	0	EPC2	149255757	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.816000	0.86201	2.574000	0.86865	0.563000	0.77884	GCC	-	HMMPfam_E_Pc_C		0.433	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPC2	protein_coding	OTTHUMT00000332278.1	G	NM_015630		149255757	1	no_errors	NM_015630	genbank	human	validated	54_36p	missense	SNP	1	T
NEB	4703	genome.wustl.edu	37	2	152346909	152346909	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:152346909C>T	ENST00000172853.10	-	147	19853	c.19706G>A	c.(19705-19707)gGg>gAg	p.G6569E	NEB_ENST00000427231.2_Missense_Mutation_p.G8425E|NEB_ENST00000603639.1_Missense_Mutation_p.G8425E|NEB_ENST00000409198.1_Missense_Mutation_p.G6569E|RIF1_ENST00000457745.1_Intron|NEB_ENST00000509223.2_Missense_Mutation_p.G338E|NEB_ENST00000397336.2_Missense_Mutation_p.G400E|NEB_ENST00000498015.2_5'Flank|NEB_ENST00000397345.3_Missense_Mutation_p.G8425E|NEB_ENST00000604864.1_Missense_Mutation_p.G8425E			P20929	NEBU_HUMAN	nebulin	6569	Interaction with SVIL.				muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.G6569E(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AAAGACACCCCCGTCGCTGTA	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											59.0	63.0	62.0					2																	152346909		1972	4146	6118	152055155	SO:0001583	missense	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.19706G>A	2.37:g.152346909C>T	ENSP00000172853:p.Gly6569Glu	Somatic		Capture	Illumina GAIIx	4	152055155	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	-	p.G6569E	ENST00000172853.10	37	c.19706		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.029|1.029	-0.682397|-0.682397	0.03353|0.03353	.|.	.|.	ENSG00000183091|ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853;ENST00000397336;ENST00000509223|ENST00000397337;ENST00000434685	T;T;T;T;T;T;T|T;T	0.06449|0.11277	3.45;3.5;3.5;3.3;3.45;4.01;4.17|4.07;2.79	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.101710|0.101710	0.43416|0.43416	D|D	0.000571|0.000571	T|T	0.15912|0.15912	0.0383|0.0383	L|L	0.29908|0.29908	0.895|0.895	0.54753|0.54753	D|D	0.999988|0.999988	B;B;B;B;D;P|.	0.59767|.	0.012;0.024;0.002;0.026;0.986;0.547|.	B;B;B;B;P;B|.	0.56398|.	0.007;0.017;0.003;0.021;0.797;0.281|.	T|T	0.00745|0.00745	-1.1584|-1.1584	10|8	0.25751|0.59425	T|D	0.34|0.04	.|.	14.65|14.65	0.68789|0.68789	0.0:0.8546:0.1454:0.0|0.0:0.8546:0.1454:0.0	.|.	338;400;338;6569;2907;8425|.	B7Z6B9;B7Z6P9;B7Z6N8;P20929;Q14215;F8WCL5|.	.;.;.;NEBU_HUMAN;.;.|.	E|R	6569;8425;8425;2525;2907;6569;400;338|559;666	ENSP00000386259:G6569E;ENSP00000380505:G8425E;ENSP00000416578:G8425E;ENSP00000410961:G2907E;ENSP00000172853:G6569E;ENSP00000380497:G400E;ENSP00000427083:G338E|ENSP00000380498:G559R;ENSP00000389074:G666R	ENSP00000172853:G6569E|ENSP00000380498:G559R	G|G	-|-	2|1	0|0	NEB|NEB	152055155|152055155	0.970000|0.970000	0.33590|0.33590	0.609000|0.609000	0.28983|0.28983	0.087000|0.087000	0.18053|0.18053	3.662000|3.662000	0.54510|0.54510	2.595000|2.595000	0.87683|0.87683	0.561000|0.561000	0.74099|0.74099	GGG|GGG	-	NULL		0.532	NEB-201	KNOWN	basic	protein_coding	NEB	protein_coding		C	NM_004543		152055155	-1	no_errors	NM_004543	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
TTN	7273	genome.wustl.edu	37	2	179577181	179577181	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:179577181C>G	ENST00000591111.1	-	93	26741	c.26517G>C	c.(26515-26517)caG>caC	p.Q8839H	TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.Q7912H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Q9156H|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12988	Ig-like 71.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Q7912H(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTACACCTCTGAGAAGGAG	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											89.0	88.0	88.0					2																	179577181		1849	4098	5947	179285426	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26517G>C	2.37:g.179577181C>G	ENSP00000465570:p.Gln8839His	Somatic		Capture	Illumina GAIIx	4	179285426	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	-	p.Q7912H	ENST00000591111.1	37	c.23736		2	.	.	.	.	.	.	.	.	.	.	C	11.06	1.527200	0.27299	.	.	ENSG00000155657	ENST00000342992	T	0.41065	1.01	5.88	3.83	0.44106	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.33235	0.0856	N	0.25957	0.775	0.80722	D	1	P	0.45634	0.863	P	0.46419	0.516	T	0.14476	-1.0471	9	0.87932	D	0	.	6.1887	0.20512	0.0:0.6598:0.0:0.3402	.	8839	Q8WZ42	TITIN_HUMAN	H	7912	ENSP00000343764:Q7912H	ENSP00000343764:Q7912H	Q	-	3	2	TTN	179285426	0.997000	0.39634	1.000000	0.80357	0.986000	0.74619	0.421000	0.21280	1.450000	0.47717	0.655000	0.94253	CAG	-	NULL		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179285426	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	missense	SNP	1	G
DUSP19	142679	genome.wustl.edu	37	2	183960264	183960264	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:183960264T>C	ENST00000354221.4	+	4	707	c.532T>C	c.(532-534)Tct>Cct	p.S178P	AC064871.3_ENST00000413954.1_RNA|AC064871.3_ENST00000444562.1_RNA|DUSP19_ENST00000469344.1_3'UTR|DUSP19_ENST00000342619.6_Missense_Mutation_p.S127P	NM_080876.3	NP_543152.1	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19	178	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase activity (GO:0045860)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	JUN kinase phosphatase activity (GO:0008579)|MAP-kinase scaffold activity (GO:0005078)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase activator activity (GO:0030295)|protein kinase inhibitor activity (GO:0004860)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/threonine phosphatase activity (GO:0008330)	p.S178P(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(4)|pancreas(1)	17						CAGTGCTTTTTCTTTGGTGAA	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											137.0	139.0	138.0					2																	183960264		2203	4300	6503	183668509	SO:0001583	missense	142679			AB038770	CCDS2289.1, CCDS46469.1	2q32.1	2011-06-09			ENSG00000162999	ENSG00000162999		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18894	protein-coding gene	gene with protein product		611437					Standard	NM_080876		Approved	SKRP1, DUSP17	uc002upd.3	Q8WTR2	OTTHUMG00000132622	ENST00000354221.4:c.532T>C	2.37:g.183960264T>C	ENSP00000346160:p.Ser178Pro	Somatic		Capture	Illumina GAIIx	4	183668509	B2RA79|Q547H4|Q8WYN4	Missense_Mutation	SNP	HMMPfam_DSPc;superfamily_(Phosphotyrosine protein) phosphatases II	p.S178P	ENST00000354221.4	37	c.532	CCDS2289.1	2	.	.	.	.	.	.	.	.	.	.	T	18.59	3.657738	0.67586	.	.	ENSG00000162999	ENST00000342619;ENST00000354221	D;D	0.86562	-2.14;-2.14	5.74	1.69	0.24217	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.436736	0.28176	N	0.016317	D	0.90397	0.6994	M	0.88512	2.96	0.54753	D	0.99998	P;P	0.44281	0.831;0.767	P;P	0.50896	0.522;0.653	D	0.88391	0.3008	10	0.52906	T	0.07	.	8.3501	0.32297	0.1232:0.0:0.2574:0.6194	.	127;178	Q8WTR2-2;Q8WTR2	.;DUS19_HUMAN	P	127;178	ENSP00000343905:S127P;ENSP00000346160:S178P	ENSP00000343905:S127P	S	+	1	0	DUSP19	183668509	1.000000	0.71417	0.993000	0.49108	0.793000	0.44817	0.620000	0.24403	0.397000	0.25310	0.482000	0.46254	TCT	-	HMMPfam_DSPc		0.413	DUSP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP19	protein_coding	OTTHUMT00000255866.1	T			183668509	1	no_errors	NM_080876	genbank	human	validated	54_36p	missense	SNP	1	C
ZNF804A	91752	genome.wustl.edu	37	2	185800654	185800654	+	Silent	SNP	T	T	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:185800654T>A	ENST00000302277.6	+	4	1125	c.531T>A	c.(529-531)acT>acA	p.T177T		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	177							metal ion binding (GO:0046872)	p.T177T(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AAGAGAATACTAAAGATGCTA	0.363																																																1	Substitution - coding silent(1)	ovary(1)	2											63.0	66.0	65.0					2																	185800654		2203	4300	6503	185508899	SO:0001819	synonymous_variant	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.531T>A	2.37:g.185800654T>A		Somatic		Capture	Illumina GAIIx	4	185508899	A7E253|Q6ZN26	Silent	SNP	-	p.T177	ENST00000302277.6	37	c.531	CCDS2291.1	2																																																																																			-	NULL		0.363	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	protein_coding	OTTHUMT00000255871.1	T	NM_194250		185508899	1	no_errors	NM_194250	genbank	human	provisional	54_36p	silent	SNP		A
COL5A2	1290	genome.wustl.edu	37	2	189898938	189898938	+	Missense_Mutation	SNP	C	C	T	rs149064715		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:189898938C>T	ENST00000374866.3	-	54	4632	c.4358G>A	c.(4357-4359)cGg>cAg	p.R1453Q		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1453	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.R1453Q(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			ATTTCCATTCCGCTTCTGAAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	2						C	GLN/ARG	0,4406		0,0,2203	89.0	78.0	82.0		4358	4.8	1.0	2	dbSNP_134	82	3,8597	3.0+/-9.4	0,3,4297	yes	missense	COL5A2	NM_000393.3	43	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	1453/1500	189898938	3,13003	2203	4300	6503	189607183	SO:0001583	missense	1290			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.4358G>A	2.37:g.189898938C>T	ENSP00000364000:p.Arg1453Gln	Somatic		Capture	Illumina GAIIx	Phase_III	189607183	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	-	p.R1453Q	ENST00000374866.3	37	c.4358	CCDS33350.1	2	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747127	0.49257	0.0	3.49E-4	ENSG00000204262	ENST00000374866;ENST00000452536	T	0.73681	-0.77	4.8	4.8	0.61643	Fibrillar collagen, C-terminal (4);	0.000000	0.43579	D	0.000547	T	0.70037	0.3178	L	0.45285	1.41	0.42098	D	0.99132	P;D	0.53151	0.888;0.958	B;P	0.44359	0.25;0.447	T	0.68138	-0.5488	10	0.22109	T	0.4	.	18.4013	0.90518	0.0:1.0:0.0:0.0	.	1093;1453	Q5PR22;P05997	.;CO5A2_HUMAN	Q	1453;1093	ENSP00000364000:R1453Q	ENSP00000364000:R1453Q	R	-	2	0	COL5A2	189607183	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	2.416000	0.44644	2.647000	0.89833	0.650000	0.86243	CGG	-	NULL		0.408	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	protein_coding	OTTHUMT00000313523.1	C	NM_000393		189607183	-1	no_errors	NM_000393	genbank	human	reviewed	54_36p	missense	SNP	1	T
AC118063.1	0	genome.wustl.edu	37	2	190176853	190176853	+	RNA	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:190176853A>T	ENST00000579501.1	-	0	0																											AAGATCTGAGACCTCAGGTCC	0.507																																																0			2																																								189885098			339781																															2.37:g.190176853A>T		Somatic		Capture	Illumina GAIIx	4	189885098		RNA	SNP	-	NULL	ENST00000579501.1	37	NULL		2																																																																																			-	-		0.507	AC118063.1-201	NOVEL	basic	miRNA	KRT18P19	miRNA		A			189885098	-1	pseudogene	XR_016833	genbank	human	model	54_36p	rna	SNP	0.98	T
AOX1	316	genome.wustl.edu	37	2	201474125	201474125	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:201474125T>G	ENST00000374700.2	+	12	1382	c.1141T>G	c.(1141-1143)Ttg>Gtg	p.L381V	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	381	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)	p.L381V(1)		breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TACCCTCAACTTGCTATCAAA	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											81.0	76.0	78.0					2																	201474125		2203	4300	6503	201182370	SO:0001583	missense	316			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.1141T>G	2.37:g.201474125T>G	ENSP00000363832:p.Leu381Val	Somatic		Capture	Illumina GAIIx	4	201182370	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	HMMPfam_Fer2;superfamily_2Fe-2S ferredoxin-like;HMMPfam_FAD_binding_5;HMMPfam_Fer2_2;superfamily_CO dehydrogenase ISP C-domain like;HMMPfam_CO_deh_flav_C;superfamily_CO dehydrogenase flavoprotein C-terminal domain-like;HMMPfam_Ald_Xan_dh_C2;superfamily_Molybdenum cofactor-binding domain;superfamily_FAD-binding domain;HMMPfam_Ald_Xan_dh_C;superfamily_CO dehydrogenase molybdoprotein N-domain-like	p.L381V	ENST00000374700.2	37	c.1141	CCDS33360.1	2	.	.	.	.	.	.	.	.	.	.	T	0.173	-1.069942	0.01918	.	.	ENSG00000138356	ENST00000374700	T	0.26518	1.73	5.48	-3.47	0.04753	FAD-binding, type 2 (2);CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (1);Molybdopterin dehydrogenase, FAD-binding (1);	0.324591	0.28889	N	0.013816	T	0.10423	0.0255	N	0.17379	0.485	0.19945	N	0.999946	B	0.02656	0.0	B	0.13407	0.009	T	0.37957	-0.9683	10	0.08179	T	0.78	-2.5129	9.0108	0.36139	0.0:0.3662:0.4806:0.1532	.	381	Q06278	ADO_HUMAN	V	381	ENSP00000363832:L381V	ENSP00000363832:L381V	L	+	1	2	AOX1	201182370	0.052000	0.20516	0.092000	0.20876	0.020000	0.10135	0.227000	0.17795	-0.502000	0.06596	-0.371000	0.07208	TTG	-	HMMPfam_FAD_binding_5		0.428	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOX1	protein_coding	OTTHUMT00000335844.1	T	NM_001159		201182370	1	no_errors	NM_001159	genbank	human	reviewed	54_36p	missense	SNP		G
Unknown	0	genome.wustl.edu	37	2	210045262	210045262	+	IGR	SNP	G	G	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:210045262G>C								RNA5SP117 (259874 upstream) : MAP2 (243519 downstream)																							AGGCAGGGGCGACAGATCATC	0.473																																																0			2																																								209753507	SO:0001628	intergenic_variant	402116																															2.37:g.210045262G>C		Somatic		Capture	Illumina GAIIx	4	209753507		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.473					LOC402116			G			209753507	1	pseudogene	XR_017081	genbank	human	model	54_36p	rna	SNP	1	C
TUBA4A	7277	genome.wustl.edu	37	2	220115769	220115769	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:220115769C>G	ENST00000248437.4	-	4	825	c.652G>C	c.(652-654)Gac>Cac	p.D218H	TUBA4A_ENST00000498660.1_5'UTR|TUBA4A_ENST00000392088.2_Missense_Mutation_p.D203H|TUBA4B_ENST00000490341.1_RNA	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a	218					'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.D203H(1)|p.D218H(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	CGCTCGATGTCTAGGTTGCGG	0.542																																																2	Substitution - Missense(2)	ovary(2)	2											119.0	118.0	118.0					2																	220115769		2203	4300	6503	219824013	SO:0001583	missense	7277			AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.652G>C	2.37:g.220115769C>G	ENSP00000248437:p.Asp218His	Somatic		Capture	Illumina GAIIx	4	219824013	A8MUB1|B3KNQ6|P05215	Missense_Mutation	SNP	HMMPfam_Tubulin;HMMPfam_Tubulin_C;superfamily_Tubulin nucleotide-binding domain-like;superfamily_Tubulin C-terminal domain-like	p.D218H	ENST00000248437.4	37	c.652	CCDS2438.1	2	.	.	.	.	.	.	.	.	.	.	C	17.23	3.335962	0.60853	.	.	ENSG00000127824	ENST00000248437;ENST00000392088;ENST00000398989	T;T;T	0.70869	-0.52;-0.52;-0.52	5.44	5.44	0.79542	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.85682	D	0.000000	T	0.80954	0.4723	L	0.51853	1.615	0.80722	D	1	P	0.43662	0.814	P	0.60012	0.867	T	0.81088	-0.1091	10	0.87932	D	0	.	19.4628	0.94924	0.0:1.0:0.0:0.0	.	218	P68366	TBA4A_HUMAN	H	218;203;65	ENSP00000248437:D218H;ENSP00000375938:D203H;ENSP00000396212:D65H	ENSP00000248437:D218H	D	-	1	0	TUBA4A	219824013	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.808000	0.69165	2.837000	0.97791	0.655000	0.94253	GAC	-	HMMPfam_Tubulin		0.542	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA4A	protein_coding	OTTHUMT00000256816.3	C	NM_006000		219824013	-1	no_errors	NM_006000	genbank	human	reviewed	54_36p	missense	SNP	1	G
ADI1	55256	genome.wustl.edu	37	2	3502844	3502844	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:3502844T>C	ENST00000327435.6	-	4	678	c.430A>G	c.(430-432)Aag>Gag	p.K144E	RP11-1293J14.1_ENST00000607415.1_lincRNA|ADI1_ENST00000382093.5_Missense_Mutation_p.K138E	NM_018269.3	NP_060739.2			acireductone dioxygenase 1									p.K144E(1)		breast(2)|large_intestine(2)|lung(4)|ovary(1)|stomach(1)	10	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0729)|Epithelial(75;0.173)|all cancers(51;0.228)		CGCATGGCCTTCGTGTAGTTC	0.473																																																1	Substitution - Missense(1)	ovary(1)	2											45.0	44.0	44.0					2																	3502844		2203	4300	6503	3481851	SO:0001583	missense	55256				CCDS1653.1	2p25.2	2013-05-29			ENSG00000182551	ENSG00000182551	1.13.11.54		30576	protein-coding gene	gene with protein product	"""membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1"""	613400				14718544, 15938715	Standard	NM_018269		Approved	SIPL, MTCBP-1, ARD, APL1, FLJ10913, HMFT1638, mtnD	uc002qxp.4	Q9BV57	OTTHUMG00000112441	ENST00000327435.6:c.430A>G	2.37:g.3502844T>C	ENSP00000333666:p.Lys144Glu	Somatic		Capture	Illumina GAIIx	4	3481851		Missense_Mutation	SNP	-	p.K144E	ENST00000327435.6	37	c.430	CCDS1653.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.2|23.2	4.390213|4.390213	0.82902|0.82902	.|.	.|.	ENSG00000182551|ENSG00000182551	ENST00000415131|ENST00000327435;ENST00000382093	.|.	.|.	.|.	4.59|4.59	4.59|4.59	0.56863|0.56863	.|Cupin, RmlC-type (1);RmlC-like jelly roll fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77532|0.77532	0.4144|0.4144	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	.|D	.|0.59357	.|0.985	.|P	.|0.57720	.|0.826	T|T	0.81790|0.81790	-0.0771|-0.0771	5|9	.|0.59425	.|D	.|0.04	-50.1714|-50.1714	13.2379|13.2379	0.59979|0.59979	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|144	.|Q9BV57	.|MTND_HUMAN	G|E	81|144;138	.|.	.|ENSP00000333666:K144E	E|K	-|-	2|1	0|0	ADI1|ADI1	3481851|3481851	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.312000|0.312000	0.27988|0.27988	7.072000|7.072000	0.76777|0.76777	2.052000|2.052000	0.61016|0.61016	0.533000|0.533000	0.62120|0.62120	GAA|AAG	-	NULL		0.473	ADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADI1	protein_coding	OTTHUMT00000231914.6	T	NM_018269		3481851	-1	no_errors	NM_018269	genbank	human	reviewed	54_36p	missense	SNP	1	C
MFSD2B	388931	genome.wustl.edu	37	2	24244573	24244573	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:24244573T>A	ENST00000406420.3	+	7	753	c.737T>A	c.(736-738)aTc>aAc	p.I246N	MFSD2B_ENST00000338315.4_Missense_Mutation_p.I246N	NM_001080473.1	NP_001073942.1	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing 2B	246					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.I246N(1)		cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10						CCCGTGTGCATCAGTTTACTG	0.592																																																1	Substitution - Missense(1)	ovary(1)	2											86.0	92.0	90.0					2																	24244573		2032	4180	6212	24098077	SO:0001583	missense	388931				CCDS46228.1	2p23.3	2010-05-11			ENSG00000205639	ENSG00000205639			37207	protein-coding gene	gene with protein product						18694395	Standard	NM_001080473		Approved		uc002reo.2	A6NFX1	OTTHUMG00000090819	ENST00000406420.3:c.737T>A	2.37:g.24244573T>A	ENSP00000385527:p.Ile246Asn	Somatic		Capture	Illumina GAIIx	Phase_III	24098077	B5MC32	Missense_Mutation	SNP	-	p.I246N	ENST00000406420.3	37	c.737	CCDS46228.1	2	.	.	.	.	.	.	.	.	.	.	t	8.446	0.851961	0.17034	.	.	ENSG00000205639	ENST00000406420;ENST00000338315	D;D	0.88201	-2.35;-2.35	4.68	-2.45	0.06481	Major facilitator superfamily domain, general substrate transporter (1);	1.066930	0.07475	U	0.902904	D	0.83764	0.5325	L	0.44542	1.39	0.09310	N	1	B	0.31705	0.336	B	0.36335	0.222	T	0.70357	-0.4894	10	0.27785	T	0.31	2.7995	8.8498	0.35192	0.0:0.335:0.1995:0.4656	.	246	A6NFX1	MFS2B_HUMAN	N	246	ENSP00000385527:I246N;ENSP00000342501:I246N	ENSP00000342501:I246N	I	+	2	0	MFSD2B	24098077	0.000000	0.05858	0.005000	0.12908	0.348000	0.29142	-0.674000	0.05233	-0.229000	0.09854	-0.259000	0.10710	ATC	-	NULL		0.592	MFSD2B-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	LOC388931	protein_coding	OTTHUMT00000324307.1	T	NM_001080473		24098077	1	no_errors	NM_001080473	genbank	human	predicted	54_36p	missense	SNP	0.036	A
PRKCE	5581	genome.wustl.edu	37	2	46206132	46206132	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:46206132A>C	ENST00000306156.3	+	4	917	c.590A>C	c.(589-591)cAg>cCg	p.Q197P		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	197					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)	p.Q197P(1)	MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	ATAGGAAAGCAGGGATACCAG	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											123.0	119.0	120.0					2																	46206132		1702	3697	5399	46059636	SO:0001583	missense	5581				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.590A>C	2.37:g.46206132A>C	ENSP00000306124:p.Gln197Pro	Somatic		Capture	Illumina GAIIx	4	46059636	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	C2;HMMPfam_C2;Pkinase;HMMPfam_Pkinase;Pkinase_C;HMMPfam_Pkinase_C;C1_1;HMMPfam_C1_1	p.Q197P	ENST00000306156.3	37	c.590	CCDS1824.1	2	.	.	.	.	.	.	.	.	.	.	A	22.0	4.225885	0.79576	.	.	ENSG00000171132	ENST00000306156	D	0.94232	-3.38	4.87	4.87	0.63330	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);Diacylglycerol/phorbol-ester binding (1);	0.000000	0.85682	D	0.000000	D	0.97663	0.9234	H	0.96805	3.885	0.80722	D	1	D	0.65815	0.995	D	0.68039	0.955	D	0.98725	1.0710	10	0.62326	D	0.03	.	14.6501	0.68792	1.0:0.0:0.0:0.0	.	197	Q02156	KPCE_HUMAN	P	197	ENSP00000306124:Q197P	ENSP00000306124:Q197P	Q	+	2	0	PRKCE	46059636	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.139000	0.94554	2.044000	0.60594	0.533000	0.62120	CAG	-	HMMPfam_C1_1		0.413	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCE	protein_coding	OTTHUMT00000250751.2	A			46059636	1	no_errors	NM_005400	genbank	human	reviewed	54_36p	missense	SNP	1	C
EFEMP1	2202	genome.wustl.edu	37	2	56145354	56145354	+	Splice_Site	SNP	C	C	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:56145354C>A	ENST00000394555.2	-	3	565	c.130G>T	c.(130-132)Gat>Tat	p.D44Y	EFEMP1_ENST00000394554.1_Splice_Site_p.D44Y|EFEMP1_ENST00000424836.2_5'UTR|EFEMP1_ENST00000355426.3_Splice_Site_p.D44Y	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	44	EGF-like 1; atypical. {ECO:0000255|PROSITE-ProRule:PRU00076}.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)	p.D44Y(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GCTGGCTCACCTTTGCATTGC	0.473																																					GBM(92;934 1319 7714 28760 40110)											1	Substitution - Missense(1)	ovary(1)	2											213.0	181.0	192.0					2																	56145354		2203	4300	6503	55998858	SO:0001630	splice_region_variant	2202			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.130+1G>T	2.37:g.56145354C>A		Somatic		Capture	Illumina GAIIx	4	55998858	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	HMMPfam_EGF_CA;superfamily_EGF/Laminin	p.D44Y	ENST00000394555.2	37	c.130	CCDS1857.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.170241	0.94768	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000355426;ENST00000438672;ENST00000439193;ENST00000440439;ENST00000429909;ENST00000452337;ENST00000421664	D;D;D;D;D;D;D;D;T	0.99582	-5.4;-5.4;-5.4;-5.4;-5.4;-5.4;-5.4;-6.22;1.2	5.41	5.41	0.78517	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);	0.000000	0.64402	D	0.000008	D	0.99670	0.9877	M	0.90705	3.14	0.80722	D	1	D	0.71674	0.998	D	0.66716	0.946	D	0.97925	1.0317	9	.	.	.	.	19.1797	0.93617	0.0:1.0:0.0:0.0	.	44	Q12805	FBLN3_HUMAN	Y	44	ENSP00000378058:D44Y;ENSP00000378057:D44Y;ENSP00000347596:D44Y;ENSP00000392055:D44Y;ENSP00000408195:D44Y;ENSP00000398345:D44Y;ENSP00000389319:D44Y;ENSP00000399480:D44Y;ENSP00000405686:D44Y	.	D	-	1	0	EFEMP1	55998858	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.294000	0.78760	2.549000	0.85964	0.563000	0.77884	GAT	-	HMMPfam_EGF_CA		0.473	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP1	protein_coding	OTTHUMT00000251491.2	C		Missense_Mutation	55998858	-1	no_errors	NM_001039348	genbank	human	reviewed	54_36p	missense	SNP	1	A
TRIM43CP	643445	genome.wustl.edu	37	2	97691939	97691939	+	IGR	SNP	A	A	T	rs564292763		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:97691939A>T								FAM178B (7764 upstream) : FAHD2B (57380 downstream)														p.F371I(1)									AAAAGAAGAAATATGTCCTCA	0.473																																																1	Substitution - Missense(1)	ovary(1)	2																																								97055666	SO:0001628	intergenic_variant	0																															2.37:g.97691939A>T		Somatic		Capture	Illumina GAIIx	4	97055666		Missense_Mutation	SNP	-	p.F371I		37	c.1111		2																																																																																			-	NULL	0	0.473					ENSG00000144188			A			97055666	-1	no_errors	ENST00000272598	ensembl	human	known	54_36p	missense	SNP	0	T
UGT1A10	54575	genome.wustl.edu	37	2	234545279	234545279	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr2:234545279C>G	ENST00000344644.5	+	1	180	c.111C>G	c.(109-111)caC>caG	p.H37Q	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000373445.1_Missense_Mutation_p.H37Q	NM_019075.2	NP_061948.1	Q9HAW8	UD110_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A10	37					cellular glucuronidation (GO:0052695)|flavone metabolic process (GO:0051552)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)	p.H37Q(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(2)|skin(3)	32		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)	ATGGGAGTCACTGGTTCACCA	0.557																																																1	Substitution - Missense(1)	ovary(1)	2											98.0	84.0	89.0					2																	234545279		2203	4298	6501	234210018	SO:0001583	missense	54575			U39550	CCDS33403.1	2q37	2010-03-05	2005-07-20		ENSG00000242515	ENSG00000242515		"""UDP glucuronosyltransferases"""	12531	other	complex locus constituent		606435	"""UDP glycosyltransferase 1 family, polypeptide A10"""			9295054, 9325166	Standard	NM_019075		Approved	UGT1J		Q9HAW8	OTTHUMG00000059121	ENST00000344644.5:c.111C>G	2.37:g.234545279C>G	ENSP00000343838:p.His37Gln	Somatic		Capture	Illumina GAIIx	4	234210018	O00474|Q6NT91|Q7Z6H8	Missense_Mutation	SNP	-	p.H37Q	ENST00000344644.5	37	c.111	CCDS33403.1	2	.	.	.	.	.	.	.	.	.	.	C	19.19	3.778767	0.70107	.	.	ENSG00000242515	ENST00000344644;ENST00000373445	T;T	0.75367	-0.93;-0.93	3.83	3.83	0.44106	.	.	.	.	.	D	0.88811	0.6538	H	0.95504	3.68	0.42411	D	0.992602	D;D	0.89917	0.999;1.0	D;D	0.81914	0.992;0.995	D	0.91012	0.4850	9	0.72032	D	0.01	.	11.0627	0.47957	0.0:0.9074:0.0:0.0926	.	37;37	Q9HAW8;Q7Z6H8	UD110_HUMAN;.	Q	37	ENSP00000343838:H37Q;ENSP00000362544:H37Q	ENSP00000343838:H37Q	H	+	3	2	UGT1A10	234210018	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.179000	0.31993	2.157000	0.67596	0.537000	0.68136	CAC	-	NULL		0.557	UGT1A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A10	protein_coding	OTTHUMT00000130986.1	C	NM_019075		234210018	1	no_errors	NM_019075	genbank	human	reviewed	54_36p	missense	SNP	1	G
RALGAPA2	57186	genome.wustl.edu	37	20	20585856	20585856	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr20:20585856T>A	ENST00000202677.7	-	15	2008	c.2001A>T	c.(1999-2001)aaA>aaT	p.K667N	RALGAPA2_ENST00000495793.1_5'UTR	NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	667					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.K667N(1)		endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						GTTCACTTAATTTATCCAGAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	20											83.0	77.0	79.0					20																	20585856		1879	4122	6001	20533856	SO:0001583	missense	57186			AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.2001A>T	20.37:g.20585856T>A	ENSP00000202677:p.Lys667Asn	Somatic		Capture	Illumina GAIIx	4	20533856	Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	HMMPfam_Rap_GAP;superfamily_Rap/Ran-GAP (Pfam 02145);superfamily_ARM repeat	p.K667N	ENST00000202677.7	37	c.2001	CCDS46584.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.96|15.96	2.986501|2.986501	0.53934|0.53934	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000202677|ENST00000430436	D|.	0.96396|.	-4.0|.	5.28|5.28	2.26|2.26	0.28386|0.28386	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71247|0.71247	0.3317|0.3317	M|M	0.80847|0.80847	2.515|2.515	0.41256|0.41256	D|D	0.986748|0.986748	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.71656|.	0.974;0.974|.	T|T	0.68450|0.68450	-0.5405|-0.5405	10|5	0.51188|.	T|.	0.08|.	.|.	9.5718|9.5718	0.39433|0.39433	0.0:0.45:0.0:0.55|0.0:0.45:0.0:0.55	.|.	505;667|.	A8MSM5;Q2PPJ7|.	.;RGPA2_HUMAN|.	N|I	667|484	ENSP00000202677:K667N|.	ENSP00000202677:K667N|.	K|N	-|-	3|2	2|0	RALGAPA2|RALGAPA2	20533856|20533856	0.998000|0.998000	0.40836|0.40836	0.983000|0.983000	0.44433|0.44433	0.948000|0.948000	0.59901|0.59901	0.476000|0.476000	0.22180|0.22180	0.131000|0.131000	0.18576|0.18576	0.377000|0.377000	0.23210|0.23210	AAA|AAT	-	NULL		0.428	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf74	protein_coding	OTTHUMT00000471941.1	T	NM_020343		20533856	-1	no_errors	NM_020343	genbank	human	validated	54_36p	missense	SNP	1	A
ZMYND8	23613	genome.wustl.edu	37	20	45891162	45891162	+	Silent	SNP	G	G	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr20:45891162G>A	ENST00000311275.7	-	12	1684	c.1431C>T	c.(1429-1431)gcC>gcT	p.A477A	ZMYND8_ENST00000540497.1_Intron|ZMYND8_ENST00000372023.3_Silent_p.A472A|ZMYND8_ENST00000360911.3_Silent_p.A472A|ZMYND8_ENST00000471951.2_Silent_p.A497A|ZMYND8_ENST00000536340.1_Silent_p.A504A|ZMYND8_ENST00000396281.4_Silent_p.A477A|ZMYND8_ENST00000458360.2_Silent_p.A472A|ZMYND8_ENST00000352431.2_Silent_p.A497A|ZMYND8_ENST00000446994.2_Silent_p.A414A|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000355972.4_Silent_p.A477A|ZMYND8_ENST00000262975.4_Silent_p.A477A|ZMYND8_ENST00000461685.1_Silent_p.A497A	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	477					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)	p.A497A(1)		NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			TCTTGGTGGAGGCTGGTGAAG	0.468																																																1	Substitution - coding silent(1)	ovary(1)	20											114.0	107.0	109.0					20																	45891162		2203	4300	6503	45324569	SO:0001819	synonymous_variant	23613			U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.1431C>T	20.37:g.45891162G>A		Somatic		Capture	Illumina GAIIx	4	45324569	B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Silent	SNP	HMMPfam_PWWP;HMMPfam_Bromodomain;HMMPfam_PHD;HMMPfam_zf-MYND;superfamily_FYVE/PHD zinc finger;superfamily_Bromodomain;superfamily_Tudor/PWWP/MBT	p.A497	ENST00000311275.7	37	c.1491		20	.	.	.	.	.	.	.	.	.	.	G	9.125	1.009864	0.19277	.	.	ENSG00000101040	ENST00000467200	.	.	.	5.34	-0.202	0.13208	.	.	.	.	.	T	0.50360	0.1611	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39781	-0.9597	4	.	.	.	-12.9635	4.9382	0.13952	0.3209:0.0:0.4197:0.2593	.	.	.	.	F	404	.	.	L	-	1	0	ZMYND8	45324569	1.000000	0.71417	0.982000	0.44146	0.853000	0.48598	0.448000	0.21726	0.268000	0.21939	-0.237000	0.12165	CTC	-	NULL		0.468	ZMYND8-007	KNOWN	basic	protein_coding	ZMYND8	protein_coding	OTTHUMT00000079596.2	G	NM_183047		45324569	-1	no_errors	NM_183047	genbank	human	reviewed	54_36p	silent	SNP	0.99	A
IGLV2-11	28816	genome.wustl.edu	37	22	23135262	23135262	+	RNA	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr22:23135262A>T	ENST00000390314.2	+	0	166				D86998.1_ENST00000385098.1_RNA					immunoglobulin lambda variable 2-11																		CATCTCCTGCACTGGAACCAG	0.532																																																0			22											229.0	230.0	230.0					22																	23135262		2088	4228	6316	21465262			3535			Z73657		22q11.2	2012-02-08			ENSG00000211668	ENSG00000211668		"""Immunoglobulins / IGL locus"""	5887	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151236		22.37:g.23135262A>T		Somatic		Capture	Illumina GAIIx	4	21465262		Missense_Mutation	SNP	-	p.T42S	ENST00000390314.2	37	c.124		22																																																																																			-	NULL		0.532	IGLV2-11-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGL@	IG_V_gene	OTTHUMT00000321841.1	A	NG_000002		21465262	1	no_stop_codon	ENST00000390314	ensembl	human	known	54_36p	missense	SNP	0.01	T
MKL1	57591	genome.wustl.edu	37	22	40805279	40805279	+	IGR	SNP	G	G	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr22:40805279G>C	ENST00000355630.3	-	0	4496				SGSM3_ENST00000454798.2_3'UTR|SGSM3_ENST00000248929.9_Missense_Mutation_p.E672Q	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1						negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.E672Q(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						CCTGTGGCTGGAGGTGCTCTG	0.672			T	RBM15	acute megakaryocytic leukemia																																		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	1	Substitution - Missense(1)	ovary(1)	22											39.0	43.0	41.0					22																	40805279		2198	4298	6496	39135225	SO:0001628	intergenic_variant	27352			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146		22.37:g.40805279G>C		Somatic		Capture	Illumina GAIIx	4	39135225	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	-	p.E672Q	ENST00000355630.3	37	c.2014	CCDS14003.1	22	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856869	0.91433	.	.	ENSG00000100359	ENST00000248929;ENST00000427834	T;T	0.10573	2.86;2.86	4.73	4.73	0.59995	RUN (3);	0.000000	0.85682	D	0.000000	T	0.37376	0.1001	M	0.80982	2.52	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.993;0.991;0.996	T	0.34800	-0.9814	10	0.87932	D	0	.	18.1418	0.89642	0.0:0.0:1.0:0.0	.	583;700;672	B4DVE3;Q96HU1-2;Q96HU1	.;.;SGSM3_HUMAN	Q	672;117	ENSP00000248929:E672Q;ENSP00000407286:E117Q	ENSP00000248929:E672Q	E	+	1	0	SGSM3	39135225	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.949000	0.93012	2.364000	0.80123	0.456000	0.33151	GAG	-	NULL		0.672	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSM3	protein_coding	OTTHUMT00000321522.1	G	NM_020831		39135225	1	no_errors	NM_015705	genbank	human	validated	54_36p	missense	SNP	1	C
PLXNB2	23654	genome.wustl.edu	37	22	50721516	50721516	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr22:50721516C>A	ENST00000449103.1	-	17	2919	c.2779G>T	c.(2779-2781)Gac>Tac	p.D927Y	PLXNB2_ENST00000496720.1_5'Flank|PLXNB2_ENST00000359337.4_Missense_Mutation_p.D927Y			O15031	PLXB2_HUMAN	plexin B2	927	IPT/TIG 2.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.D970Y(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACCCGCACGTCCTCCTGGGAG	0.687																																																1	Substitution - Missense(1)	ovary(1)	22											18.0	24.0	22.0					22																	50721516		2019	4170	6189	49063643	SO:0001583	missense	23654				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.2779G>T	22.37:g.50721516C>A	ENSP00000409171:p.Asp927Tyr	Somatic		Capture	Illumina GAIIx	4	49063643	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	-	p.D927Y	ENST00000449103.1	37	c.2779	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278679	0.80692	.	.	ENSG00000196576	ENST00000449103;ENST00000359337	T;T	0.77877	-1.13;-1.13	3.83	3.83	0.44106	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.322809	0.22319	N	0.061631	D	0.88232	0.6381	M	0.85859	2.78	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.89928	0.4064	10	0.72032	D	0.01	.	13.2734	0.60175	0.0:1.0:0.0:0.0	.	927	O15031	PLXB2_HUMAN	Y	927	ENSP00000409171:D927Y;ENSP00000352288:D927Y	ENSP00000352288:D927Y	D	-	1	0	PLXNB2	49063643	0.998000	0.40836	1.000000	0.80357	0.778000	0.44026	3.792000	0.55476	1.966000	0.57179	0.561000	0.74099	GAC	-	NULL		0.687	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	protein_coding	OTTHUMT00000316874.3	C	NM_012401		49063643	-1	no_errors	NM_012401	genbank	human	validated	54_36p	missense	SNP	0.722	A
IFT57	55081	genome.wustl.edu	37	3	107932813	107932813	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr3:107932813C>T	ENST00000264538.3	-	4	797	c.550G>A	c.(550-552)Gaa>Aaa	p.E184K		NM_018010.3	NP_060480.1	Q9NWB7	IFT57_HUMAN	intraflagellar transport 57	184					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cilium assembly (GO:0042384)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|photoreceptor connecting cilium (GO:0032391)	DNA binding (GO:0003677)	p.E184K(1)		kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	14			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			AATGTTAATTCTGCATCATCT	0.323																																																1	Substitution - Missense(1)	ovary(1)	3											229.0	213.0	218.0					3																	107932813		2202	4297	6499	109415503	SO:0001583	missense	55081			AK001009	CCDS2951.1	3q13.13	2014-07-03	2014-07-03	2005-11-02	ENSG00000114446	ENSG00000114446		"""Intraflagellar transport homologs"""	17367	protein-coding gene	gene with protein product		606621	"""estrogen-related receptor beta like 1"", ""intraflagellar transport 57 homolog (Chlamydomonas)"""	ESRRBL1			Standard	NM_018010		Approved	FLJ10147, HIPPI, MHS4R2	uc003dwx.4	Q9NWB7	OTTHUMG00000159223	ENST00000264538.3:c.550G>A	3.37:g.107932813C>T	ENSP00000264538:p.Glu184Lys	Somatic		Capture	Illumina GAIIx	4	109415503	Q96DA9	Missense_Mutation	SNP	-	p.E184K	ENST00000264538.3	37	c.550	CCDS2951.1	3	.	.	.	.	.	.	.	.	.	.	C	36	5.634079	0.96682	.	.	ENSG00000114446	ENST00000264538	.	.	.	5.77	5.77	0.91146	.	0.046260	0.85682	D	0.000000	T	0.79793	0.4507	M	0.76170	2.325	0.80722	D	1	D	0.76494	0.999	D	0.70227	0.968	T	0.78814	-0.2056	9	0.48119	T	0.1	.	19.9869	0.97352	0.0:1.0:0.0:0.0	.	184	Q9NWB7	IFT57_HUMAN	K	184	.	ENSP00000264538:E184K	E	-	1	0	IFT57	109415503	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.285000	0.78660	2.722000	0.93159	0.655000	0.94253	GAA	-	NULL		0.323	IFT57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT57	protein_coding	OTTHUMT00000353918.1	C	NM_018010		109415503	-1	no_errors	NM_018010	genbank	human	validated	54_36p	missense	SNP	1	T
MYLK	4638	genome.wustl.edu	37	3	123426709	123426709	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr3:123426709A>T	ENST00000475616.1	-	13	2281	c.2282T>A	c.(2281-2283)cTc>cAc	p.L761H	MYLK_ENST00000360772.3_Missense_Mutation_p.L761H|MYLK_ENST00000359169.1_Missense_Mutation_p.L761H|MYLK_ENST00000360304.3_Missense_Mutation_p.L761H|MYLK_ENST00000346322.5_Missense_Mutation_p.L692H			Q15746	MYLK_HUMAN	myosin light chain kinase	761	Ig-like C2-type 6.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.L761H(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GTCTTTGCAGAGGGCTTTGCC	0.582																																																1	Substitution - Missense(1)	ovary(1)	3											70.0	61.0	64.0					3																	123426709		2203	4300	6503	124909399	SO:0001583	missense	4638			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.2282T>A	3.37:g.123426709A>T	ENSP00000418335:p.Leu761His	Somatic		Capture	Illumina GAIIx	4	124909399	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_fn3;superfamily_Fibronectin type III;superfamily_Protein kinase-like (PK-like);HMMPfam_I-set;superfamily_Immunoglobulin	p.L761H	ENST00000475616.1	37	c.2282	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	A	19.82	3.898904	0.72754	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69	4.99	4.99	0.66335	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.86657	0.5985	H	0.94503	3.545	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;0.999	D;D;D;D;D	0.76071	0.971;0.987;0.971;0.975;0.983	D	0.88931	0.3373	9	0.87932	D	0	.	9.3662	0.38226	0.9202:0.0:0.0798:0.0	.	761;692;761;692;761	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	H	761;761;761;692;761	ENSP00000354004:L761H;ENSP00000353452:L761H;ENSP00000352088:L761H;ENSP00000320622:L692H;ENSP00000418335:L761H	ENSP00000320622:L692H	L	-	2	0	MYLK	124909399	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	6.755000	0.74914	2.099000	0.63709	0.533000	0.62120	CTC	-	HMMPfam_I-set		0.582	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	protein_coding	OTTHUMT00000356464.1	A	NM_053025		124909399	-1	no_errors	NM_053025	genbank	human	reviewed	54_36p	missense	SNP	0.04	T
SLC12A8	84561	genome.wustl.edu	37	3	124909320	124909320	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr3:124909320T>G	ENST00000393469.4	-	2	146	c.97A>C	c.(97-99)Atg>Ctg	p.M33L	SLC12A8_ENST00000314584.7_5'UTR|SLC12A8_ENST00000423114.2_Missense_Mutation_p.M62L|SLC12A8_ENST00000469902.1_Missense_Mutation_p.M33L	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	33					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.M33L(1)		endometrium(2)|kidney(2)|lung(12)	16						GGCTCCCACATGAACAGCTGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	3											132.0	142.0	139.0					3																	124909320		2040	4197	6237	126392010	SO:0001583	missense	84561				CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.97A>C	3.37:g.124909320T>G	ENSP00000377112:p.Met33Leu	Somatic		Capture	Illumina GAIIx	4	126392010	C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Missense_Mutation	SNP	-	p.M33L	ENST00000393469.4	37	c.97	CCDS43143.1	3	.	.	.	.	.	.	.	.	.	.	C	12.77	2.038695	0.35989	.	.	ENSG00000221955	ENST00000393469;ENST00000423114;ENST00000469902;ENST00000462437	D;D;D;D	0.95272	-2.21;-2.21;-2.21;-3.66	5.03	1.25	0.21368	.	.	.	.	.	D	0.87341	0.6153	N	0.22421	0.69	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.74551	-0.3628	9	0.25106	T	0.35	.	8.5487	0.33438	0.0:0.6188:0.0:0.3812	.	62;33	A0AV02-2;A0AV02	.;S12A8_HUMAN	L	33;62;33;1	ENSP00000377112:M33L;ENSP00000404243:M62L;ENSP00000418783:M33L;ENSP00000418636:M1L	ENSP00000377112:M33L	M	-	1	0	SLC12A8	126392010	0.374000	0.25081	0.602000	0.28890	0.667000	0.39255	0.405000	0.21015	-0.160000	0.11002	-0.735000	0.03563	ATG	-	NULL		0.582	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A8	protein_coding	OTTHUMT00000355711.4	T	NM_024628		126392010	-1	no_errors	NM_024628	genbank	human	validated	54_36p	missense	SNP	1	G
SETP14	389168	genome.wustl.edu	37	3	155705245	155705245	+	IGR	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr3:155705245A>T								GMPS (43430 upstream) : KCNAB1 (133091 downstream)																							TTGATGAAGTACAAAATGAAA	0.433																																																0			3																																								157187939	SO:0001628	intergenic_variant	389168																															3.37:g.155705245A>T		Somatic		Capture	Illumina GAIIx	4	157187939		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.433					LOC389168			A			157187939	1	pseudogene	XR_017613	genbank	human	model	54_36p	rna	SNP	1	T
KCNAB1	7881	genome.wustl.edu	37	3	155838589	155838589	+	Silent	SNP	G	G	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr3:155838589G>T	ENST00000490337.1	+	1	253	c.189G>T	c.(187-189)ctG>ctT	p.L63L	KCNAB1_ENST00000389636.5_Silent_p.L63L	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	63					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.L63L(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TGGCTCTGCTGCGCGAAGTGG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	3											60.0	56.0	58.0					3																	155838589		2203	4300	6503	157321283	SO:0001819	synonymous_variant	7881			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.189G>T	3.37:g.155838589G>T		Somatic		Capture	Illumina GAIIx	4	157321283	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Silent	SNP	HMMPfam_Aldo_ket_red;superfamily_NAD(P)-linked oxidoreductase	p.L63	ENST00000490337.1	37	c.189	CCDS3174.1	3																																																																																			-	NULL		0.577	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	KCNAB1	protein_coding	OTTHUMT00000351411.1	G	NM_003471		157321283	1	no_errors	NM_172160	genbank	human	reviewed	54_36p	silent	SNP	0.98	T
SLC7A14	57709	genome.wustl.edu	37	3	170244654	170244654	+	Silent	SNP	G	G	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr3:170244654G>T	ENST00000231706.5	-	2	387	c.72C>A	c.(70-72)tcC>tcA	p.S24S	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	24					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)	p.S24S(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			GTAGGATCCTGGAGTGCATTG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	3											139.0	112.0	121.0					3																	170244654		2203	4300	6503	171727348	SO:0001819	synonymous_variant	57709			BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.72C>A	3.37:g.170244654G>T		Somatic		Capture	Illumina GAIIx	4	171727348	B3KV33|Q9HCF9	Silent	SNP	HMMPfam_AA_permease	p.S24	ENST00000231706.5	37	c.72	CCDS33892.1	3																																																																																			-	NULL		0.592	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A14	protein_coding	OTTHUMT00000352598.2	G	NM_020949		171727348	-1	no_errors	NM_020949	genbank	human	validated	54_36p	silent	SNP	1	T
CCDC39	339829	genome.wustl.edu	37	3	180377524	180377524	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr3:180377524C>A	ENST00000442201.2	-	5	669	c.550G>T	c.(550-552)Gaa>Taa	p.E184*	CCDC39_ENST00000273654.4_Nonsense_Mutation_p.E268*	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	184					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.E268*(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TGATTACATTCCAAAGTTAGT	0.289																																																1	Substitution - Nonsense(1)	ovary(1)	3											146.0	137.0	139.0					3																	180377524		1818	4078	5896	181860218	SO:0001587	stop_gained	339829			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.550G>T	3.37:g.180377524C>A	ENSP00000405708:p.Glu184*	Somatic		Capture	Illumina GAIIx	4	181860218	B4E2H1	Nonsense_Mutation	SNP	-	p.E184*	ENST00000442201.2	37	c.550	CCDS46964.1	3	.	.	.	.	.	.	.	.	.	.	C	42	9.544725	0.99201	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	.	.	.	5.87	5.87	0.94306	.	0.139600	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-25.7666	16.8816	0.86064	0.0:0.808:0.192:0.0	.	.	.	.	X	268;184	.	ENSP00000273654:E268X	E	-	1	0	CCDC39	181860218	1.000000	0.71417	0.999000	0.59377	0.072000	0.16883	3.373000	0.52394	2.784000	0.95788	0.585000	0.79938	GAA	-	NULL		0.289	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC39	protein_coding	OTTHUMT00000349783.3	C	XM_291028		181860218	-1	no_errors	NM_181426	genbank	human	validated	54_36p	nonsense	SNP	1	A
CRELD1	78987	genome.wustl.edu	37	3	9985176	9985176	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr3:9985176T>A	ENST00000383811.3	+	9	1624	c.1025T>A	c.(1024-1026)aTc>aAc	p.I342N	CRELD1_ENST00000326434.5_Missense_Mutation_p.I342N|CRELD1_ENST00000452070.1_Missense_Mutation_p.I342N|CRELD1_ENST00000489674.1_3'UTR|CRELD1_ENST00000397170.3_Missense_Mutation_p.I342N	NM_015513.4	NP_056328	Q96HD1	CREL1_HUMAN	cysteine-rich with EGF-like domains 1	342	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cardiac septum development (GO:0003279)|endocardial cushion development (GO:0003197)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.I342N(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|urinary_tract(1)	14						ATGGAAGGCATCTGTGTGAAG	0.592																																																1	Substitution - Missense(1)	ovary(1)	3											118.0	117.0	117.0					3																	9985176		2203	4300	6503	9960176	SO:0001583	missense	78987			AF452623	CCDS2593.1, CCDS33693.1	3p25.3	2005-12-08	2004-02-13		ENSG00000163703	ENSG00000163703			14630	protein-coding gene	gene with protein product		607170	"""atrioventricular septal defect 2"""	AVSD2		10922384, 12137942	Standard	NM_015513		Approved		uc003buf.3	Q96HD1	OTTHUMG00000128653	ENST00000383811.3:c.1025T>A	3.37:g.9985176T>A	ENSP00000373322:p.Ile342Asn	Somatic		Capture	Illumina GAIIx	Phase_III	9960176	A8MX90|B2RAA9|Q6I9X5|Q8NFT4|Q9Y409	Missense_Mutation	SNP	-	p.I342N	ENST00000383811.3	37	c.1025	CCDS2593.1	3	.	.	.	.	.	.	.	.	.	.	T	9.904	1.207572	0.22205	.	.	ENSG00000163703	ENST00000397170;ENST00000383811;ENST00000452070;ENST00000326434;ENST00000435417	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	4.96	1.38	0.22167	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.678460	0.14460	N	0.318255	T	0.65995	0.2745	N	0.02296	-0.605	0.22127	N	0.999341	B;D	0.53151	0.002;0.958	B;P	0.45506	0.023;0.483	T	0.61227	-0.7105	9	.	.	.	-2.0E-4	0.7341	0.00962	0.1477:0.2098:0.2314:0.411	.	342;342	Q96HD1;Q96HD1-2	CREL1_HUMAN;.	N	342;342;342;342;98	ENSP00000380355:I342N;ENSP00000373322:I342N;ENSP00000393643:I342N;ENSP00000321856:I342N	.	I	+	2	0	CRELD1	9960176	0.942000	0.31987	0.278000	0.24718	0.707000	0.40811	1.666000	0.37460	0.272000	0.22027	0.459000	0.35465	ATC	-	NULL		0.592	CRELD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRELD1	protein_coding	OTTHUMT00000250533.1	T	NM_015513		9960176	1	no_errors	NM_001031717	genbank	human	validated	54_36p	missense	SNP	0.995	A
ATP11B	23200	genome.wustl.edu	37	3	182584208	182584208	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr3:182584208G>T	ENST00000323116.5	+	14	1856	c.1596G>T	c.(1594-1596)aaG>aaT	p.K532N		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	532					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.K532N(1)		breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			CAGATGAAAAGGCTCTAGTAG	0.388																																																1	Substitution - Missense(1)	ovary(1)	3											87.0	86.0	86.0					3																	182584208		2203	4300	6503	184066902	SO:0001583	missense	23200			AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.1596G>T	3.37:g.182584208G>T	ENSP00000321195:p.Lys532Asn	Somatic		Capture	Illumina GAIIx	4	184066902	Q96FN1|Q9UKK7	Missense_Mutation	SNP	-	p.K532N	ENST00000323116.5	37	c.1596	CCDS33896.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.50|13.50	2.255725|2.255725	0.39896|0.39896	.|.	.|.	ENSG00000058063|ENSG00000058063	ENST00000323116|ENST00000498086	T|.	0.63096|.	-0.02|.	5.28|5.28	-0.841|-0.841	0.10752|0.10752	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67850|0.67850	0.2937|0.2937	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.91635|.	0.999;0.995|.	T|T	0.66093|0.66093	-0.6009|-0.6009	10|5	0.38643|.	T|.	0.18|.	.|.	11.7688|11.7688	0.51945|0.51945	0.3332:0.0:0.6668:0.0|0.3332:0.0:0.6668:0.0	.|.	106;532|.	B3KSJ2;Q9Y2G3|.	.;AT11B_HUMAN|.	N|M	532|333	ENSP00000321195:K532N|.	ENSP00000321195:K532N|.	K|R	+|+	3|2	2|0	ATP11B|ATP11B	184066902|184066902	0.725000|0.725000	0.28048|0.28048	0.967000|0.967000	0.41034|0.41034	0.156000|0.156000	0.22039|0.22039	-0.130000|-0.130000	0.10498|0.10498	-0.146000|-0.146000	0.11274|0.11274	-0.225000|-0.225000	0.12378|0.12378	AAG|AGG	-	NULL		0.388	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP11B	protein_coding	OTTHUMT00000350598.1	G	NM_014616		184066902	1	no_errors	NM_014616	genbank	human	validated	54_36p	missense	SNP	1	T
CTBP1	1487	genome.wustl.edu	37	4	1207364	1207364	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr4:1207364G>T	ENST00000290921.6	-	7	1104	c.923C>A	c.(922-924)cCc>cAc	p.P308H	CTBP1_ENST00000382952.3_Missense_Mutation_p.P297H	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1	308	Interaction with GLIS2 2. {ECO:0000250}.				Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.P308H(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		GATGAGGTTGGGTGCATCCTT	0.632																																																1	Substitution - Missense(1)	ovary(1)	4											85.0	69.0	75.0					4																	1207364		2203	4300	6503	1197364	SO:0001583	missense	1487			U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259	ENST00000290921.6:c.923C>A	4.37:g.1207364G>T	ENSP00000290921:p.Pro308His	Somatic		Capture	Illumina GAIIx	4	1197364	Q4W5N3|Q7Z2Q5	Missense_Mutation	SNP	HMMPfam_2-Hacid_dh;HMMPfam_2-Hacid_dh_C;superfamily_NAD(P)-binding Rossmann-fold domains;superfamily_Formate/glycerate dehydrogenase catalytic domain-like	p.P308H	ENST00000290921.6	37	c.923	CCDS3348.1	4	.	.	.	.	.	.	.	.	.	.	G	18.54	3.647089	0.67358	.	.	ENSG00000159692	ENST00000382952;ENST00000290921	D;D	0.82619	-1.63;-1.63	4.48	3.62	0.41486	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (1);D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.90126	0.6915	M	0.81682	2.555	0.80722	D	1	D;D	0.69078	0.997;0.994	D;D	0.67725	0.953;0.932	D	0.90848	0.4729	10	0.72032	D	0.01	-26.7294	13.6493	0.62301	0.0:0.0:0.8438:0.1562	.	308;297	Q13363;Q7Z2Q5	CTBP1_HUMAN;.	H	297;308	ENSP00000372411:P297H;ENSP00000290921:P308H	ENSP00000290921:P308H	P	-	2	0	CTBP1	1197364	1.000000	0.71417	0.929000	0.37066	0.572000	0.35998	8.932000	0.92897	0.853000	0.35312	0.591000	0.81541	CCC	-	HMMPfam_2-Hacid_dh:HMMPfam_2-Hacid_dh_C		0.632	CTBP1-001	KNOWN	basic|CCDS	protein_coding	CTBP1	protein_coding	OTTHUMT00000202938.1	G	NM_001328		1197364	-1	no_errors	NM_001328	genbank	human	reviewed	54_36p	missense	SNP	1	T
SORCS2	57537	genome.wustl.edu	37	4	7705920	7705920	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr4:7705920G>A	ENST00000507866.2	+	14	1886	c.1777G>A	c.(1777-1779)Ggc>Agc	p.G593S	SORCS2_ENST00000329016.9_Missense_Mutation_p.G421S	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	593					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.G443S(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						TGTGGACGAGGGCCTCACCTG	0.632																																																1	Substitution - Missense(1)	ovary(1)	4											48.0	56.0	53.0					4																	7705920		2134	4223	6357	7756820	SO:0001583	missense	57537			AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.1777G>A	4.37:g.7705920G>A	ENSP00000422185:p.Gly593Ser	Somatic		Capture	Illumina GAIIx	4	7756820	Q9P2L7	Missense_Mutation	SNP	HMMPfam_PKD,superfamily_PKD domain,HMMPfam_BNR,superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase	p.G443S	ENST00000507866.2	37	c.1327	CCDS47008.1	4	.	.	.	.	.	.	.	.	.	.	G	19.15	3.771274	0.69992	.	.	ENSG00000184985	ENST00000507866;ENST00000329016	T;T	0.48522	0.81;0.81	3.61	3.61	0.41365	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.73760	0.3628	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.81642	-0.0840	10	0.87932	D	0	.	14.5317	0.67931	0.0:0.0:1.0:0.0	.	421;593	B5MED8;Q96PQ0	.;SORC2_HUMAN	S	593;421	ENSP00000422185:G593S;ENSP00000329124:G421S	ENSP00000329124:G421S	G	+	1	0	SORCS2	7756820	1.000000	0.71417	1.000000	0.80357	0.389000	0.30415	7.813000	0.86123	1.994000	0.58287	0.650000	0.86243	GGC	-	HMMPfam_BNR		0.632	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS2	protein_coding	OTTHUMT00000358685.4	G	NM_020777		7756820	1	no_errors	NM_020777	genbank	human	reviewed	54_36p	missense	SNP	1	A
POLR2B	5431	genome.wustl.edu	37	4	57883852	57883852	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr4:57883852A>T	ENST00000381227.1	+	17	2694	c.2281A>T	c.(2281-2283)Aca>Tca	p.T761S	POLR2B_ENST00000314595.5_Missense_Mutation_p.T761S|POLR2B_ENST00000441246.2_Missense_Mutation_p.T754S|POLR2B_ENST00000431623.2_Missense_Mutation_p.T686S			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	761					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)	p.T761S(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					ACTTGTGACTACACGGTCTAT	0.433																																																1	Substitution - Missense(1)	ovary(1)	4											119.0	105.0	110.0					4																	57883852		2203	4300	6503	57578609	SO:0001583	missense	5431				CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2281A>T	4.37:g.57883852A>T	ENSP00000370625:p.Thr761Ser	Somatic		Capture	Illumina GAIIx	4	57578609	A8K1A8|Q8IZ61	Missense_Mutation	SNP	HMMPfam_RNA_pol_Rpb2_6;HMMPfam_RNA_pol_Rpb2_7;HMMPfam_RNA_pol_Rpb2_2;HMMPfam_RNA_pol_Rpb2_1;HMMPfam_RNA_pol_Rpb2_3;HMMPfam_RNA_pol_Rpb2_4;HMMPfam_RNA_pol_Rpb2_5;superfamily_beta and beta-prime subunits of DNA dependent RNA-polymerase	p.T761S	ENST00000381227.1	37	c.2281	CCDS3511.1	4	.	.	.	.	.	.	.	.	.	.	A	29.7	5.030032	0.93575	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7	5.23	5.23	0.72850	DNA-directed RNA polymerase, subunit 2, domain 6 (1);	0.000000	0.85682	D	0.000000	D	0.84306	0.5443	M	0.81682	2.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86021	0.1507	10	0.54805	T	0.06	.	15.1017	0.72284	1.0:0.0:0.0:0.0	.	686;761	C9J4M6;P30876	.;RPB2_HUMAN	S	761;686;754;761	ENSP00000370625:T761S;ENSP00000391096:T686S;ENSP00000391452:T754S;ENSP00000312735:T761S	ENSP00000312735:T761S	T	+	1	0	POLR2B	57578609	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.164000	0.94755	1.972000	0.57404	0.379000	0.24179	ACA	-	HMMPfam_RNA_pol_Rpb2_6		0.433	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2B	protein_coding	OTTHUMT00000250692.1	A	NM_000938		57578609	1	no_errors	NM_000938	genbank	human	reviewed	54_36p	missense	SNP	1	T
UGT2B17	7367	genome.wustl.edu	37	4	69433615	69433615	+	Silent	SNP	A	A	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr4:69433615A>G	ENST00000317746.2	-	1	630	c.588T>C	c.(586-588)ccT>ccC	p.P196P		NM_001077.3	NP_001068.1	O75795	UDB17_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B17	196					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)	p.P196P(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(14)|ovary(2)|prostate(1)	30					Losartan(DB00678)	ACATAACAACAGGTACATAGG	0.363																																					Melanoma(18;649 833 28984 37818 38500)											1	Substitution - coding silent(1)	ovary(1)	4											100.0	96.0	97.0					4																	69433615		2088	3929	6017	69116210	SO:0001819	synonymous_variant	7367			U59209	CCDS3523.1	4q13	2008-02-05	2005-07-20		ENSG00000197888	ENSG00000197888		"""UDP glucuronosyltransferases"""	12547	protein-coding gene	gene with protein product		601903	"""UDP glycosyltransferase 2 family, polypeptide B17"""			8798464	Standard	NM_001077		Approved		uc021xov.1	O75795	OTTHUMG00000129305	ENST00000317746.2:c.588T>C	4.37:g.69433615A>G		Somatic		Capture	Illumina GAIIx	4	69116210		Silent	SNP	HMMPfam_UDPGT;superfamily_UDP-Glycosyltransferase/glycogen phosphorylase	p.P196	ENST00000317746.2	37	c.588	CCDS3523.1	4																																																																																			-	HMMPfam_UDPGT		0.363	UGT2B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B17	protein_coding	OTTHUMT00000251436.1	A	NM_001077		69116210	-1	no_errors	NM_001077	genbank	human	provisional	54_36p	silent	SNP	0.96	G
LRBA	987	genome.wustl.edu	37	4	151271167	151271167	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr4:151271167T>C	ENST00000357115.3	-	49	7615	c.7372A>G	c.(7372-7374)Ata>Gta	p.I2458V	LRBA_ENST00000535741.1_Missense_Mutation_p.I2447V|LRBA_ENST00000510413.1_Missense_Mutation_p.I2447V|LRBA_ENST00000507224.1_Missense_Mutation_p.I2447V|LRBA_ENST00000503716.1_5'UTR	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2458	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.					cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.I2458V(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					GGATCAGTTATTGAATTCAGA	0.403																																																1	Substitution - Missense(1)	ovary(1)	4											107.0	98.0	101.0					4																	151271167		2203	4300	6503	151490617	SO:0001583	missense	987			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.7372A>G	4.37:g.151271167T>C	ENSP00000349629:p.Ile2458Val	Somatic		Capture	Illumina GAIIx	4	151490617	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	HMMPfam_Beach;HMMPfam_WD40;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_DUF1088;superfamily_WD40 repeat-like;superfamily_ARM repeat;superfamily_PH domain-like;superfamily_BEACH domain	p.I2458V	ENST00000357115.3	37	c.7372	CCDS3773.1	4	.	.	.	.	.	.	.	.	.	.	T	13.62	2.291507	0.40494	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	5.47	5.47	0.80525	BEACH domain (4);	0.000000	0.85682	D	0.000000	T	0.50463	0.1617	L	0.41632	1.29	0.58432	D	0.999998	B;B;B	0.20780	0.048;0.001;0.0	B;B;B	0.17979	0.02;0.007;0.001	T	0.46091	-0.9216	10	0.27785	T	0.31	.	9.9763	0.41786	0.0:0.0758:0.0:0.9242	.	2458;2447;348	P50851;P50851-2;Q68D03	LRBA_HUMAN;.;.	V	2447;2447;2458;2447	ENSP00000446299:I2447V;ENSP00000421552:I2447V;ENSP00000349629:I2458V;ENSP00000422180:I2447V	ENSP00000349629:I2458V	I	-	1	0	LRBA	151490617	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.040000	0.89188	2.078000	0.62432	0.383000	0.25322	ATA	-	HMMPfam_Beach		0.403	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	protein_coding	OTTHUMT00000364939.1	T			151490617	-1	no_errors	NM_006726	genbank	human	validated	54_36p	missense	SNP	1	C
FAM35DP	439965	genome.wustl.edu	37	10	47416883	47416883	+	IGR	SNP	G	G	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr10:47416883G>C								RN7SL453P (34136 upstream) : RP11-292F22.5 (153629 downstream)																							GACTGCCGTTGATGGAAGACA	0.348																																																0			10																																								46836889	SO:0001628	intergenic_variant	439965																															10.37:g.47416883G>C		Somatic		Capture	Illumina GAIIx	4	46836889		Missense_Mutation	SNP	-	p.D461H		37	c.1381		10																																																																																			-	NULL	0	0.348					FAM35B2			G			46836889	1	no_start_codon	ENST00000342900	ensembl	human	known	54_36p	missense	SNP	0.4	C
OR4C2P	119750	genome.wustl.edu	37	11	48442289	48442289	+	IGR	SNP	C	C	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr11:48442289C>T								OR4C5 (54272 upstream) : OR4A47 (67979 downstream)														p.P165L(2)									GTATGGCTGCCCTTCTGTGGC	0.463																																																2	Substitution - Missense(2)	ovary(2)	11																																								48398865	SO:0001628	intergenic_variant	119750																															11.37:g.48442289C>T		Somatic		Capture	Illumina GAIIx	4	48398865		Missense_Mutation	SNP	HMMPfam_7tm_1;superfamily_SSF81321	p.P165L		37	c.494		11																																																																																			-	NULL	0	0.463					OR4C2P			C			48398865	1	no_errors	ENST00000330155	ensembl	human	known	54_36p	missense	SNP	0.68	T
CTNND2	1501	genome.wustl.edu	37	5	11397167	11397167	+	Silent	SNP	T	T	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr5:11397167T>C	ENST00000304623.8	-	6	777	c.588A>G	c.(586-588)cgA>cgG	p.R196R	CTNND2_ENST00000458100.2_5'UTR|CTNND2_ENST00000359640.2_Silent_p.R196R|CTNND2_ENST00000511377.1_Silent_p.R105R|CTNND2_ENST00000503622.1_Intron	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	196					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R196R(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGCCCGTAGCTCGGGCTTGTG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	5											99.0	101.0	100.0					5																	11397167		2203	4300	6503	11450167	SO:0001819	synonymous_variant	1501			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.588A>G	5.37:g.11397167T>C		Somatic		Capture	Illumina GAIIx	4	11450167	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	HMMPfam_Arm;superfamily_ARM repeat	p.R196	ENST00000304623.8	37	c.588	CCDS3881.1	5																																																																																			-	NULL		0.617	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	protein_coding	OTTHUMT00000206999.1	T	NM_001332		11450167	-1	no_errors	NM_001332	genbank	human	validated	54_36p	silent	SNP	1	C
CDH6	1004	genome.wustl.edu	37	5	31267705	31267705	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr5:31267705G>C	ENST00000265071.2	+	2	390	c.125G>C	c.(124-126)gGa>gCa	p.G42A	RP11-152K4.2_ENST00000523584.1_RNA|CDH6_ENST00000514738.1_5'UTR	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	42					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G42A(1)		NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GAGCTCTCTGGAAACAGCAAA	0.493																																																1	Substitution - Missense(1)	ovary(1)	5											105.0	112.0	110.0					5																	31267705		2203	4300	6503	31303462	SO:0001583	missense	1004			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.125G>C	5.37:g.31267705G>C	ENSP00000265071:p.Gly42Ala	Somatic		Capture	Illumina GAIIx	4	31303462	A8K5H5|Q9BWS0	Missense_Mutation	SNP	HMMPfam_Cadherin_C;HMMPfam_Cadherin;superfamily_Cadherin-like	p.G42A	ENST00000265071.2	37	c.125	CCDS3894.1	5	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299911	0.40694	.	.	ENSG00000113361	ENST00000265071	T	0.56444	0.46	5.8	4.92	0.64577	.	0.304500	0.36815	N	0.002387	T	0.46405	0.1391	L	0.54323	1.7	0.32926	D	0.516518	B;B	0.11235	0.0;0.004	B;B	0.15052	0.003;0.012	T	0.54596	-0.8270	10	0.36615	T	0.2	.	9.9926	0.41881	0.0722:0.1443:0.7835:0.0	.	42;42	P55285;P55285-2	CADH6_HUMAN;.	A	42	ENSP00000265071:G42A	ENSP00000265071:G42A	G	+	2	0	CDH6	31303462	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.540000	0.60664	1.420000	0.47138	0.655000	0.94253	GGA	-	NULL		0.493	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	protein_coding	OTTHUMT00000207355.2	G	NM_004932		31303462	1	no_errors	NM_004932	genbank	human	reviewed	54_36p	missense	SNP	1	C
EGFLAM	133584	genome.wustl.edu	37	5	38438523	38438523	+	Silent	SNP	C	C	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr5:38438523C>T	ENST00000354891.3	+	17	2776	c.2430C>T	c.(2428-2430)tgC>tgT	p.C810C	EGFLAM_ENST00000336740.6_Silent_p.C576C|EGFLAM_ENST00000397202.2_Silent_p.C176C|EGFLAM_ENST00000322350.5_Silent_p.C810C	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	810	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)	p.C810C(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					ACTGTGACTGCCCCTTGGGCT	0.637																																					Colon(62;485 1295 3347 17454)											1	Substitution - coding silent(1)	ovary(1)	5											34.0	34.0	34.0					5																	38438523		2203	4300	6503	38474280	SO:0001819	synonymous_variant	133584			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2430C>T	5.37:g.38438523C>T		Somatic		Capture	Illumina GAIIx	4	38474280	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	HMMPfam_fn3;HMMPfam_EGF;superfamily_Fibronectin type III;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_1;HMMPfam_Laminin_G_2	p.C810	ENST00000354891.3	37	c.2430	CCDS56363.1	5																																																																																			-	HMMPfam_EGF		0.637	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	protein_coding	OTTHUMT00000367323.1	C	NM_152403		38474280	1	no_errors	NM_152403	genbank	human	validated	54_36p	silent	SNP	1	T
CD180	4064	genome.wustl.edu	37	5	66480368	66480368	+	Silent	SNP	A	A	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr5:66480368A>G	ENST00000256447.4	-	3	460	c.303T>C	c.(301-303)caT>caC	p.H101H		NM_005582.2	NP_005573.2	Q99467	CD180_HUMAN	CD180 molecule	101					B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H101H(1)		cervix(1)|endometrium(2)|kidney(7)|large_intestine(12)|liver(1)|lung(8)|ovary(1)|stomach(2)	34		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		TGCTTAATTGATGATGGCTTT	0.338																																																1	Substitution - coding silent(1)	ovary(1)	5											100.0	101.0	100.0					5																	66480368		2203	4299	6502	66516124	SO:0001819	synonymous_variant	4064			D83597	CCDS3992.1	5q12	2008-02-05	2006-03-28	2005-06-07	ENSG00000134061	ENSG00000134061		"""CD molecules"""	6726	protein-coding gene	gene with protein product		602226	"""lymphocyte antigen 64 (mouse) homolog, radioprotective, 105kD"", ""CD180 antigen"""	LY64		9763566, 8975706	Standard	NM_005582		Approved	RP105, Ly78	uc003juy.2	Q99467	OTTHUMG00000131229	ENST00000256447.4:c.303T>C	5.37:g.66480368A>G		Somatic		Capture	Illumina GAIIx	4	66516124	B2R7Z7|Q32MM5	Silent	SNP	-	p.H101	ENST00000256447.4	37	c.303	CCDS3992.1	5																																																																																			-	NULL		0.338	CD180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD180	protein_coding	OTTHUMT00000253973.2	A	NM_005582		66516124	-1	no_errors	NM_005582	genbank	human	validated	54_36p	silent	SNP		G
CMYA5	202333	genome.wustl.edu	37	5	79029153	79029153	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr5:79029153T>G	ENST00000446378.2	+	2	4596	c.4565T>G	c.(4564-4566)gTg>gGg	p.V1522G		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1522					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.V1522G(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ACCTCAGAGGTGTTAGAGCCT	0.418																																																1	Substitution - Missense(1)	ovary(1)	5											100.0	96.0	98.0					5																	79029153		1890	4116	6006	79064909	SO:0001583	missense	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.4565T>G	5.37:g.79029153T>G	ENSP00000394770:p.Val1522Gly	Somatic		Capture	Illumina GAIIx	4	79064909	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	HMMPfam_SPRY;HMMPfam_fn3;superfamily_Fibronectin type III	p.V1522G	ENST00000446378.2	37	c.4565	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	T	13.26	2.183541	0.38609	.	.	ENSG00000164309	ENST00000446378	T	0.06849	3.25	5.8	-2.79	0.05841	.	0.885835	0.09652	N	0.773592	T	0.13628	0.0330	L	0.47190	1.495	0.09310	N	1	D	0.67145	0.996	P	0.57101	0.813	T	0.20505	-1.0273	10	0.87932	D	0	.	6.9616	0.24599	0.0:0.4239:0.1362:0.4398	.	1522	Q8N3K9	CMYA5_HUMAN	G	1522	ENSP00000394770:V1522G	ENSP00000394770:V1522G	V	+	2	0	CMYA5	79064909	0.000000	0.05858	0.011000	0.14972	0.083000	0.17756	-0.377000	0.07456	-0.339000	0.08401	-0.379000	0.06801	GTG	-	NULL		0.418	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	protein_coding	OTTHUMT00000369497.1	T	NM_153610		79064909	1	no_errors	NM_153610	genbank	human	validated	54_36p	missense	SNP		G
CHD1	1105	genome.wustl.edu	37	5	98236762	98236762	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr5:98236762C>A	ENST00000284049.3	-	6	761	c.612G>T	c.(610-612)aaG>aaT	p.K204N		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	204					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)	p.K204N(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	GTCCAAGAATCTTCTTTCCAT	0.318																																																1	Substitution - Missense(1)	ovary(1)	5											83.0	79.0	81.0					5																	98236762		2203	4300	6503	98264662	SO:0001583	missense	1105			AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.612G>T	5.37:g.98236762C>A	ENSP00000284049:p.Lys204Asn	Somatic		Capture	Illumina GAIIx	4	98264662	Q17RZ3	Missense_Mutation	SNP	-	p.K204N	ENST00000284049.3	37	c.612	CCDS34204.1	5	.	.	.	.	.	.	.	.	.	.	C	5.424	0.263461	0.10294	.	.	ENSG00000153922	ENST00000284049	D	0.90324	-2.65	5.64	1.87	0.25490	.	0.000000	0.34879	U	0.003614	T	0.80314	0.4600	N	0.21448	0.665	0.41141	D	0.985955	B	0.02656	0.0	B	0.04013	0.001	T	0.66512	-0.5905	10	0.32370	T	0.25	.	5.6097	0.17398	0.0:0.5142:0.1276:0.3582	.	204	O14646	CHD1_HUMAN	N	204	ENSP00000284049:K204N	ENSP00000284049:K204N	K	-	3	2	CHD1	98264662	1.000000	0.71417	0.981000	0.43875	0.040000	0.13550	0.989000	0.29629	0.122000	0.18314	0.557000	0.71058	AAG	-	NULL		0.318	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1	protein_coding	OTTHUMT00000370295.1	C	NM_001270		98264662	-1	no_errors	NM_001270	genbank	human	reviewed	54_36p	missense	SNP	0.99	A
VPS53	55275	genome.wustl.edu	37	17	560597	560597	+	Intron	SNP	T	T	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr17:560597T>C	ENST00000571805.1	-	6	509				VPS53_ENST00000576149.1_Intron|VPS53_ENST00000437048.2_Intron|VPS53_ENST00000401468.3_Intron|VPS53_ENST00000446250.2_Intron|VPS53_ENST00000574029.1_Intron|VPS53_ENST00000291074.5_Intron			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)						protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		GACCGTGCCATCGATCTTAAT	0.468																																																0			17																																								507347	SO:0001627	intron_variant	100128140				CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.373-1404A>G	17.37:g.560597T>C		Somatic		Capture	Illumina GAIIx	4	507347	A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	RNA	SNP	-	NULL	ENST00000571805.1	37	NULL		17																																																																																			-	-		0.468	VPS53-006	KNOWN	basic	protein_coding	LOC100128140	protein_coding	OTTHUMT00000436940.2	T	NM_018289		507347	-1	pseudogene	XR_037026	genbank	human	model	54_36p	rna	SNP	1	C
MLANA	2315	genome.wustl.edu	37	9	5890215	5890215	+	5'Flank	SNP	C	C	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr9:5890215C>G	ENST00000381477.3	+	0	0				snoU13_ENST00000459519.1_RNA|MLANA_ENST00000381471.1_5'Flank|MLANA_ENST00000381476.1_5'Flank	NM_005511.1	NP_005502.1	Q16655	MAR1_HUMAN	melan-A							endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|melanosome (GO:0042470)|trans-Golgi network (GO:0005802)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)	8		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(1;1.15e-06)|Lung(218;0.103)		atgcctccctcaaaccttgtt	0.388																																																0			9																																								5880215	SO:0001631	upstream_gene_variant	0				CCDS6466.1	9p24.1	2008-02-05			ENSG00000120215	ENSG00000120215			7124	protein-coding gene	gene with protein product		605513					Standard	NM_005511		Approved	MART1	uc003zjo.1	Q16655	OTTHUMG00000019510		9.37:g.5890215C>G	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	5880215	Q6ICU4	RNA	SNP	-	NULL	ENST00000381477.3	37	NULL	CCDS6466.1	9																																																																																			-	-		0.388	MLANA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000210211	protein_coding	OTTHUMT00000051643.1	C			5880215	1	pseudogene	ENST00000387476	ensembl	human	novel	54_36p	rna	SNP	0.001	G
PTPRK	5796	genome.wustl.edu	37	6	128297859	128297859	+	Silent	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr6:128297859A>T	ENST00000368215.3	-	27	3908	c.3909T>A	c.(3907-3909)tcT>tcA	p.S1303S	PTPRK_ENST00000368207.3_Silent_p.S1336S|PTPRK_ENST00000368210.3_Silent_p.S1322S|PTPRK_ENST00000368213.5_Silent_p.S1310S|PTPRK_ENST00000368227.3_Silent_p.S1321S|PTPRK_ENST00000532331.1_Silent_p.S1326S|PTPRK_ENST00000368226.4_Silent_p.S1304S			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1303	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.S1304S(1)	PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CCATTGAACAAGACATACATT	0.418																																																1	Substitution - coding silent(1)	ovary(1)	6											104.0	87.0	93.0					6																	128297859		2203	4300	6503	128339552	SO:0001819	synonymous_variant	5796			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.3909T>A	6.37:g.128297859A>T		Somatic		Capture	Illumina GAIIx	4	128339552	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Silent	SNP	superfamily_Fibronectin type III;superfamily_Immunoglobulin;superfamily_(Phosphotyrosine protein) phosphatases II;HMMPfam_Y_phosphatase;HMMPfam_MAM;HMMPfam_fn3;HMMPfam_ig	p.S1304	ENST00000368215.3	37	c.3912		6																																																																																			-	HMMPfam_Y_phosphatase		0.418	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	protein_coding	OTTHUMT00000042163.1	A			128339552	-1	no_errors	NM_002844	genbank	human	validated	54_36p	silent	SNP	1	T
EHMT2	10919	genome.wustl.edu	37	6	31864266	31864266	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr6:31864266G>A	ENST00000375537.4	-	4	362	c.356C>T	c.(355-357)tCc>tTc	p.S119F	EHMT2_ENST00000395728.3_Missense_Mutation_p.S176F|C2_ENST00000469372.1_5'Flank|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375530.4_Missense_Mutation_p.S119F|EHMT2_ENST00000375528.4_Missense_Mutation_p.S176F	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	119					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)	p.S119F(1)		central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						CTTGCTGGGGGAAGAGGGGAA	0.532																																																1	Substitution - Missense(1)	ovary(1)	6											91.0	111.0	104.0					6																	31864266		1507	2708	4215	31972245	SO:0001583	missense	10919			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.356C>T	6.37:g.31864266G>A	ENSP00000364687:p.Ser119Phe	Somatic		Capture	Illumina GAIIx	4	31972245	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	HMMPfam_Ank;superfamily_Ankyrin repeat;HMMPfam_Pre-SET;superfamily_RING/U-box;superfamily_SET domain;HMMPfam_SET	p.S119F	ENST00000375537.4	37	c.356	CCDS4725.1	6	.	.	.	.	.	.	.	.	.	.	G	15.83	2.947719	0.53186	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	3.31	2.43	0.29744	.	0.323008	0.22789	N	0.055640	T	0.08670	0.0215	N	0.08118	0	0.35124	D	0.767306	B;B;B;B	0.14805	0.001;0.011;0.0;0.0	B;B;B;B	0.15052	0.0;0.012;0.001;0.0	T	0.07366	-1.0776	10	0.72032	D	0.01	.	10.2669	0.43460	0.1057:0.0:0.8943:0.0	.	176;119;119;119	A2ABF8;Q96KQ7-3;Q96KQ7-2;Q96KQ7	.;.;.;EHMT2_HUMAN	F	176;176;119;119	ENSP00000379078:S176F;ENSP00000364678:S176F;ENSP00000364680:S119F;ENSP00000364687:S119F	ENSP00000364678:S176F	S	-	2	0	EHMT2	31972245	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	4.490000	0.60319	0.963000	0.38082	-0.258000	0.10820	TCC	-	NULL		0.532	EHMT2-001	KNOWN	basic|CCDS	protein_coding	EHMT2	protein_coding	OTTHUMT00000076355.5	G	NM_006709		31972245	-1	no_errors	NM_006709	genbank	human	reviewed	54_36p	missense	SNP	1	A
ETV7	51513	genome.wustl.edu	37	6	36343687	36343687	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr6:36343687G>T	ENST00000340181.4	-	3	509	c.268C>A	c.(268-270)Ctc>Atc	p.L90I	ETV7_ENST00000373737.4_Missense_Mutation_p.L90I|ETV7_ENST00000339796.5_Missense_Mutation_p.L90I|ETV7_ENST00000538992.1_Intron|ETV7_ENST00000373738.1_Intron	NM_001207037.1|NM_001207040.1|NM_016135.3	NP_001193966.1|NP_001193969.1|NP_057219.1	Q9Y603	ETV7_HUMAN	ets variant 7	90	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L90I(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(4)	10						TCCTTGGTGAGGATGCAGAGG	0.647																																																1	Substitution - Missense(1)	ovary(1)	6											125.0	109.0	115.0					6																	36343687		2203	4300	6503	36451665	SO:0001583	missense	51513			AF116508	CCDS4819.1, CCDS56422.1, CCDS56423.1, CCDS56424.1, CCDS56425.1, CCDS75440.1, CCDS75441.1	6p21	2008-09-12	2008-09-12		ENSG00000010030	ENSG00000010030			18160	protein-coding gene	gene with protein product	"""TEL2 oncogene"""	605255	"""ets variant gene 7 (TEL2 oncogene)"""			10828014, 11108721	Standard	NM_016135		Approved	TEL2, TEL-2	uc003omb.3	Q9Y603	OTTHUMG00000014594	ENST00000340181.4:c.268C>A	6.37:g.36343687G>T	ENSP00000341843:p.Leu90Ile	Somatic		Capture	Illumina GAIIx	4	36451665	B3KVC2|B4DVB6|B4E1G4|Q5R3L3|Q5R3L4|Q9NZ65|Q9NZ66|Q9NZ68|Q9NZR8|Q9UNJ7|Q9Y5K4|Q9Y604	Missense_Mutation	SNP	-	p.L90I	ENST00000340181.4	37	c.268	CCDS4819.1	6	.	.	.	.	.	.	.	.	.	.	G	25.7	4.666151	0.88251	.	.	ENSG00000010030	ENST00000339796;ENST00000340181;ENST00000373737	T;T;T	0.47869	0.83;0.83;0.83	3.38	3.38	0.38709	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.000000	0.64402	U	0.000002	T	0.60869	0.2302	.	.	.	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.994;0.997;0.998	T	0.68123	-0.5492	9	0.62326	D	0.03	.	14.355	0.66730	0.0:0.0:1.0:0.0	.	90;90;90	Q9Y603-7;Q9Y603;Q9Y603-5	.;ETV7_HUMAN;.	I	90	ENSP00000342260:L90I;ENSP00000341843:L90I;ENSP00000362842:L90I	ENSP00000342260:L90I	L	-	1	0	ETV7	36451665	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.007000	0.76335	1.449000	0.47699	0.585000	0.79938	CTC	-	NULL		0.647	ETV7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ETV7	protein_coding	OTTHUMT00000040341.1	G	NM_016135		36451665	-1	no_errors	NM_016135	genbank	human	provisional	54_36p	missense	SNP	1	T
PTCRA	171558	genome.wustl.edu	37	6	42890866	42890866	+	Missense_Mutation	SNP	C	C	A	rs146960695		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr6:42890866C>A	ENST00000304672.1	+	2	241	c.160C>A	c.(160-162)Ccc>Acc	p.P54T	PTCRA_ENST00000446507.1_Intron|PTCRA_ENST00000441198.1_Intron	NM_001243168.1|NM_138296.2	NP_001230097.1|NP_612153.2	Q6ISU1	PTCRA_HUMAN	pre T-cell antigen receptor alpha	54					negative regulation of thymocyte apoptotic process (GO:0070244)	integral component of membrane (GO:0016021)		p.P54T(1)		large_intestine(2)|lung(4)|ovary(2)	8	Colorectal(47;0.196)		all cancers(41;0.000731)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			TGATGTTGCACCCCCTGGCCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	6											163.0	137.0	146.0					6																	42890866		2203	4300	6503	42998844	SO:0001583	missense	171558			AF084941	CCDS4874.1, CCDS59019.1, CCDS59020.1, CCDS75457.1	6p21.3	2008-02-05			ENSG00000171611	ENSG00000171611			21290	protein-coding gene	gene with protein product		606817				8618853, 9842925	Standard	NM_138296		Approved	PTA, PT-ALPHA	uc021yzp.1	Q6ISU1	OTTHUMG00000014709	ENST00000304672.1:c.160C>A	6.37:g.42890866C>A	ENSP00000304447:p.Pro54Thr	Somatic		Capture	Illumina GAIIx	4	42998844	Q5TFZ7	Missense_Mutation	SNP	superfamily_Immunoglobulin	p.P54T	ENST00000304672.1	37	c.160	CCDS4874.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.355|9.355	1.066522|1.066522	0.20067|0.20067	.|.	.|.	ENSG00000171611|ENSG00000171611	ENST00000418903|ENST00000304672	.|T	.|0.63255	.|-0.03	5.84|5.84	4.03|4.03	0.46877|0.46877	.|Immunoglobulin-like fold (1);	.|0.149520	.|0.31660	.|N	.|0.007274	T|T	0.40196|0.40196	0.1107|0.1107	L|L	0.36672|0.36672	1.1|1.1	0.34888|0.34888	D|D	0.745229|0.745229	.|P	.|0.51057	.|0.941	.|P	.|0.46362	.|0.514	T|T	0.47674|0.47674	-0.9099|-0.9099	6|10	0.87932|0.87932	D|D	0|0	-18.3824|-18.3824	8.2919|8.2919	0.31963|0.31963	0.0:0.7619:0.1551:0.083|0.0:0.7619:0.1551:0.083	.|.	.|54	.|Q6ISU1	.|PTCRA_HUMAN	Q|T	64|54	.|ENSP00000304447:P54T	ENSP00000407061:H64Q|ENSP00000304447:P54T	H|P	+|+	3|1	2|0	PTCRA|PTCRA	42998844|42998844	0.003000|0.003000	0.15002|0.15002	0.021000|0.021000	0.16686|0.16686	0.319000|0.319000	0.28217|0.28217	0.146000|0.146000	0.16180|0.16180	0.774000|0.774000	0.33427|0.33427	0.650000|0.650000	0.86243|0.86243	CAC|CCC	-	NULL		0.607	PTCRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCRA	protein_coding	OTTHUMT00000040565.2	C	NM_138296		42998844	1	no_errors	NM_138296	genbank	human	validated	54_36p	missense	SNP	0.02	A
RIMS1	22999	genome.wustl.edu	37	6	72975691	72975691	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr6:72975691A>T	ENST00000521978.1	+	22	3337	c.3337A>T	c.(3337-3339)Agg>Tgg	p.R1113W	RIMS1_ENST00000425662.2_Missense_Mutation_p.R442W|RIMS1_ENST00000491071.2_Missense_Mutation_p.R1049W|RIMS1_ENST00000538414.1_Intron|RIMS1_ENST00000348717.5_Intron|RIMS1_ENST00000264839.7_Missense_Mutation_p.R1075W|RIMS1_ENST00000517960.1_Intron|RIMS1_ENST00000518273.1_Missense_Mutation_p.R1049W|RIMS1_ENST00000517827.1_Missense_Mutation_p.R508W|RIMS1_ENST00000520567.1_Missense_Mutation_p.R1048W|RIMS1_ENST00000401910.3_Missense_Mutation_p.R522W|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000523963.1_Missense_Mutation_p.R523W	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1113					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.R1113W(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TGACAGGGCTAGGAGTGCTAG	0.403																																																1	Substitution - Missense(1)	ovary(1)	6											48.0	46.0	47.0					6																	72975691		1874	4111	5985	73032412	SO:0001583	missense	22999			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3337A>T	6.37:g.72975691A>T	ENSP00000428417:p.Arg1113Trp	Somatic		Capture	Illumina GAIIx	4	73032412	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	HMMPfam_C2,HMMPfam_PDZ,superfamily_PDZ domain-like,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),superfamily_FYVE/PHD zinc finger	p.R1113W	ENST00000521978.1	37	c.3337	CCDS47449.1	6	.	.	.	.	.	.	.	.	.	.	A	24.5	4.537482	0.85917	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000349908;ENST00000264839;ENST00000518273;ENST00000520567;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000517827;ENST00000370420	T;T;T;T;T;T;T;T;T;T	0.20200	2.37;2.4;2.42;2.44;2.32;2.4;2.42;2.36;2.36;2.09	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000005	T	0.27489	0.0675	L	0.36672	1.1	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.994;0.999;0.99;0.994;0.981;0.997;0.999;0.999	D;P;D;P;P;P;P;D;D	0.81914	0.995;0.87;0.993;0.79;0.87;0.865;0.887;0.987;0.994	T	0.02450	-1.1157	10	0.48119	T	0.1	-21.2401	16.1469	0.81577	1.0:0.0:0.0:0.0	.	508;523;508;522;301;1049;302;1049;1113	B7Z3S3;E9PHF5;B7Z9Z3;E9PF48;Q5JY22;E7ERQ1;Q5JY21;C9JNW6;Q86UR5	.;.;.;.;.;.;.;.;RIMS1_HUMAN	W	1049;1075;1049;1049;1075;1049;1048;1113;522;523;442;508;274	ENSP00000430101:R1049W;ENSP00000264839:R1075W;ENSP00000430408:R1049W;ENSP00000430502:R1048W;ENSP00000428417:R1113W;ENSP00000385649:R522W;ENSP00000428328:R523W;ENSP00000411235:R442W;ENSP00000428367:R508W;ENSP00000359448:R274W	ENSP00000264839:R1075W	R	+	1	2	RIMS1	73032412	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.914000	0.75764	2.214000	0.71695	0.519000	0.50382	AGG	-	NULL		0.403	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	protein_coding	OTTHUMT00000374968.1	A			73032412	1	no_errors	NM_014989	genbank	human	validated	54_36p	missense	SNP	1	T
LAMA2	3908	genome.wustl.edu	37	6	129479382	129479382	+	Intron	SNP	A	A	G	rs199690868		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr6:129479382A>G	ENST00000421865.2	+	8	1255					NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TACCTTTAATATCTGCCGCTA	0.413																																																0			6																																								129521075	SO:0001627	intron_variant	643778			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.1206+3554A>G	6.37:g.129479382A>G		Somatic		Capture	Illumina GAIIx	4	129521075	Q14736|Q5VUM2|Q93022	RNA	SNP	-	NULL	ENST00000421865.2	37	NULL	CCDS5138.1	6																																																																																			-	-		0.413	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643778	protein_coding	OTTHUMT00000042180.1	A			129521075	-1	pseudogene	XR_017181	genbank	human	model	54_36p	rna	SNP	1	G
ST7	7982	genome.wustl.edu	37	7	116774178	116774178	+	Splice_Site	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr7:116774178A>T	ENST00000265437.5	+	7	856	c.642A>T	c.(640-642)gaA>gaT	p.E214D	ST7_ENST00000323984.3_Splice_Site_p.E214D|ST7_ENST00000393444.3_Intron|ST7_ENST00000432298.1_Splice_Site_p.E168D|ST7-AS2_ENST00000432541.1_RNA|ST7_ENST00000393451.3_Intron|ST7_ENST00000465133.1_Intron|ST7_ENST00000393443.1_Intron|ST7-AS2_ENST00000434993.1_RNA|ST7_ENST00000487459.1_3'UTR|ST7_ENST00000393449.1_Splice_Site_p.E214D|ST7-AS2_ENST00000442719.1_RNA|ST7_ENST00000422922.1_Intron|ST7_ENST00000393446.2_Intron|ST7_ENST00000393447.4_Splice_Site_p.E171D	NM_021908.2	NP_068708.1	Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7	0	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.E214D(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		tcttggtcagaattaggtcca	0.398																																																1	Substitution - Missense(1)	ovary(1)	7											93.0	93.0	93.0					7																	116774178		2203	4299	6502	116561414	SO:0001630	splice_region_variant	7982			AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000265437.5:c.642-1A>T	7.37:g.116774178A>T		Somatic		Capture	Illumina GAIIx	4	116561414	A8K137|B4DRQ2	Missense_Mutation	SNP	ST7;HMMPfam_ST7;TPR-like;superfamily_TPR-like	p.E214D	ENST00000265437.5	37	c.642	CCDS5770.1	7	.	.	.	.	.	.	.	.	.	.	A	11.92	1.781905	0.31502	.	.	ENSG00000004866	ENST00000265437;ENST00000323984;ENST00000393449;ENST00000432298;ENST00000393447;ENST00000490039	T;T;T;T;T;T	0.19532	2.2;2.19;2.19;2.2;2.21;2.14	4.55	4.55	0.56014	.	0.042272	0.85682	D	0.000000	T	0.11836	0.0288	N	0.08118	0	0.80722	D	1	B;B;B;B	0.29805	0.011;0.0;0.0;0.257	B;B;B;B	0.36030	0.022;0.002;0.002;0.216	T	0.24119	-1.0169	9	.	.	.	.	10.5774	0.45235	1.0:0.0:0.0:0.0	.	162;171;168;214	C9JU30;B7Z4L1;B7Z4U3;Q9NRC1	.;.;.;ST7_HUMAN	D	214;214;214;168;171;162	ENSP00000265437:E214D;ENSP00000325673:E214D;ENSP00000377095:E214D;ENSP00000411118:E168D;ENSP00000377093:E171D;ENSP00000419516:E162D	.	E	+	3	2	ST7	116561414	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.612000	0.54142	2.276000	0.75962	0.454000	0.30748	GAA	-	HMMPfam_ST7		0.398	ST7-002	KNOWN	basic|CCDS	protein_coding	ST7	protein_coding	OTTHUMT00000141622.1	A	NM_021908	Missense_Mutation	116561414	1	no_errors	NM_021908	genbank	human	reviewed	54_36p	missense	SNP	1	T
IQUB	154865	genome.wustl.edu	37	7	123152367	123152367	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr7:123152367C>A	ENST00000466202.1	-	2	604	c.28G>T	c.(28-30)Gct>Tct	p.A10S	IQUB_ENST00000434450.1_Missense_Mutation_p.A10S|IQUB_ENST00000488987.1_Intron|IQUB_ENST00000324698.6_Missense_Mutation_p.A10S	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	10					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)		p.A10S(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						ATATTCTGAGCTTCATACTTC	0.338																																																1	Substitution - Missense(1)	ovary(1)	7											79.0	77.0	78.0					7																	123152367		2203	4300	6503	122939603	SO:0001583	missense	154865			AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.28G>T	7.37:g.123152367C>A	ENSP00000417769:p.Ala10Ser	Somatic		Capture	Illumina GAIIx	4	122939603	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Missense_Mutation	SNP	-	p.A10S	ENST00000466202.1	37	c.28	CCDS5787.1	7	.	.	.	.	.	.	.	.	.	.	C	6.224	0.409383	0.11812	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	T;T;T	0.49139	1.83;1.83;0.79	4.04	-6.9	0.01655	.	5.141830	0.00397	N	0.000040	T	0.27027	0.0662	L	0.27053	0.805	0.09310	N	1	B;B;B	0.16396	0.016;0.017;0.01	B;B;B	0.12837	0.008;0.008;0.004	T	0.08659	-1.0711	10	0.21540	T	0.41	.	1.4905	0.02456	0.2372:0.1674:0.1175:0.4779	.	10;10;10	A1A4Z1;Q8NA54-2;Q8NA54	.;.;IQUB_HUMAN	S	10	ENSP00000417769:A10S;ENSP00000324882:A10S;ENSP00000388498:A10S	ENSP00000324882:A10S	A	-	1	0	IQUB	122939603	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.908000	0.01587	-1.647000	0.01511	-1.011000	0.02470	GCT	-	NULL		0.338	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IQUB	protein_coding	OTTHUMT00000348529.1	C	NM_178827		122939603	-1	no_errors	NM_178827	genbank	human	validated	54_36p	missense	SNP		A
STK31	56164	genome.wustl.edu	37	7	23810666	23810666	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr7:23810666A>G	ENST00000355870.3	+	14	1875	c.1756A>G	c.(1756-1758)Agt>Ggt	p.S586G	STK31_ENST00000433467.2_Missense_Mutation_p.S586G|STK31_ENST00000354639.3_Missense_Mutation_p.S563G|STK31_ENST00000428484.1_Missense_Mutation_p.S563G|STK31_ENST00000405627.3_3'UTR	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	586						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)	p.S586G(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						AAATACATATAGTCAAGTACT	0.358																																																1	Substitution - Missense(1)	ovary(1)	7											177.0	178.0	177.0					7																	23810666		2203	4300	6503	23777191	SO:0001583	missense	56164			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.1756A>G	7.37:g.23810666A>G	ENSP00000348132:p.Ser586Gly	Somatic		Capture	Illumina GAIIx	4	23777191	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_TUDOR;superfamily_Protein kinase-like (PK-like);superfamily_Staphylococcal nuclease;superfamily_Tudor/PWWP/MBT	p.S586G	ENST00000355870.3	37	c.1756	CCDS5386.1	7	.	.	.	.	.	.	.	.	.	.	A	11.87	1.768488	0.31320	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.70516	-0.49;1.24;-0.49;-0.49	5.51	4.35	0.52113	.	0.387436	0.30374	N	0.009763	T	0.64136	0.2571	L	0.56769	1.78	0.28170	N	0.928622	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.59648	-0.7415	10	0.54805	T	0.06	-4.5313	8.3064	0.32045	0.8276:0.0:0.1724:0.0	.	586;586	B4DZ06;Q9BXU1	.;STK31_HUMAN	G	586;586;563;563	ENSP00000348132:S586G;ENSP00000411852:S586G;ENSP00000346660:S563G;ENSP00000406146:S563G	ENSP00000346660:S563G	S	+	1	0	STK31	23777191	0.511000	0.26179	0.994000	0.49952	0.994000	0.84299	1.692000	0.37731	0.905000	0.36596	0.528000	0.53228	AGT	-	NULL		0.358	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK31	protein_coding	OTTHUMT00000214036.2	A	NM_031414		23777191	1	no_errors	NM_031414	genbank	human	reviewed	54_36p	missense	SNP	0.99	G
C7orf57	136288	genome.wustl.edu	37	7	48080991	48080991	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr7:48080991C>T	ENST00000348904.3	+	3	328	c.116C>T	c.(115-117)tCc>tTc	p.S39F	C7orf57_ENST00000420324.1_Missense_Mutation_p.S84F|C7orf57_ENST00000435376.1_5'UTR|C7orf57_ENST00000430738.1_Missense_Mutation_p.S84F|C7orf57_ENST00000539619.1_Missense_Mutation_p.S39F	NM_001100159.2	NP_001093629.1	Q8NEG2	CG057_HUMAN	chromosome 7 open reading frame 57	39								p.S39F(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						CCACCAGCGTCCCAGATCCCA	0.537																																																1	Substitution - Missense(1)	ovary(1)	7											53.0	57.0	55.0					7																	48080991		1921	4147	6068	48047516	SO:0001583	missense	136288			BC031107	CCDS47583.1, CCDS59054.1, CCDS75594.1	7p12.3	2011-11-25			ENSG00000164746	ENSG00000164746			22247	protein-coding gene	gene with protein product							Standard	NM_001100159		Approved		uc003toh.5	Q8NEG2	OTTHUMG00000155808	ENST00000348904.3:c.116C>T	7.37:g.48080991C>T	ENSP00000335500:p.Ser39Phe	Somatic		Capture	Illumina GAIIx	4	48047516	C9JBJ8	Missense_Mutation	SNP	-	p.S39F	ENST00000348904.3	37	c.116	CCDS47583.1	7	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409868	0.62399	.	.	ENSG00000164746	ENST00000420324;ENST00000430738;ENST00000348904;ENST00000539619	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.72293	0.3442	M	0.84326	2.69	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.75983	-0.3125	10	0.87932	D	0	-19.8225	17.2972	0.87173	0.0:1.0:0.0:0.0	.	39	Q8NEG2	CG057_HUMAN	F	84;84;39;39	ENSP00000394648:S84F;ENSP00000410944:S84F;ENSP00000335500:S39F;ENSP00000442474:S39F	ENSP00000335500:S39F	S	+	2	0	C7orf57	48047516	0.999000	0.42202	0.979000	0.43373	0.239000	0.25481	4.864000	0.62990	2.670000	0.90874	0.563000	0.77884	TCC	-	NULL		0.537	C7orf57-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf57	protein_coding	OTTHUMT00000341745.1	C	NM_001100159		48047516	1	no_errors	NM_001100159	genbank	human	validated	54_36p	missense	SNP	0.94	T
AKAP9	10142	genome.wustl.edu	37	7	91722506	91722506	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr7:91722506G>T	ENST00000359028.2	+	39	9691	c.9466G>T	c.(9466-9468)Gag>Tag	p.E3156*	AKAP9_ENST00000356239.3_Nonsense_Mutation_p.E3152*|AKAP9_ENST00000358100.2_Nonsense_Mutation_p.E3102*			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3156					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.E3152*(1)|p.E3156*(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GGAACTGCAGGAGCAGCTGAG	0.433			T	BRAF	papillary thyroid																																		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	2	Substitution - Nonsense(2)	ovary(2)	7											102.0	97.0	99.0					7																	91722506		2203	4300	6503	91560442	SO:0001587	stop_gained	10142			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.9466G>T	7.37:g.91722506G>T	ENSP00000351922:p.Glu3156*	Somatic		Capture	Illumina GAIIx	4	91560442	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Nonsense_Mutation	SNP	-	p.E3152*	ENST00000359028.2	37	c.9454		7	.	.	.	.	.	.	.	.	.	.	G	51	17.974472	0.99897	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	.	.	.	5.77	5.77	0.91146	.	0.000000	0.40640	N	0.001042	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	.	.	.	X	3152;3156;3102;3156;998	.	ENSP00000348573:E3152X	E	+	1	0	AKAP9	91560442	1.000000	0.71417	0.996000	0.52242	0.367000	0.29736	6.355000	0.73041	2.885000	0.99019	0.655000	0.94253	GAG	-	NULL		0.433	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	protein_coding		G	NM_005751		91560442	1	no_errors	NM_005751	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
ZSCAN21	7589	genome.wustl.edu	37	7	99661412	99661412	+	Splice_Site	SNP	T	T	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr7:99661412T>A	ENST00000292450.4	+	4	758	c.594T>A	c.(592-594)gaT>gaA	p.D198E	ZSCAN21_ENST00000456748.2_Splice_Site_p.D198E|ZSCAN21_ENST00000477297.1_Intron|ZSCAN21_ENST00000543588.1_Splice_Site_p.D198E	NM_145914.2	NP_666019.1	Q9Y5A6	ZSC21_HUMAN	zinc finger and SCAN domain containing 21	198					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D198E(1)		breast(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|skin(1)	21	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TTGTTTCAGATTGCAGATTGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	7											62.0	64.0	64.0					7																	99661412		2203	4300	6503	99499348	SO:0001630	splice_region_variant	7589			AL136865	CCDS5681.1	7q11.1	2013-01-08	2006-10-06	2006-10-06	ENSG00000166529	ENSG00000166529		"""-"", ""Zinc fingers, C2H2-type"""	13104	protein-coding gene	gene with protein product		601261	"""zinc finger protein 38 (KOX 25)"", ""zinc finger protein 38"""	ZNF38		2288909, 2014798	Standard	NM_145914		Approved	DKFZp434L134, NY-REN-21, Zipro1	uc003uso.3	Q9Y5A6	OTTHUMG00000154583	ENST00000292450.4:c.593-1T>A	7.37:g.99661412T>A		Somatic		Capture	Illumina GAIIx	4	99499348	A4D2A6|D6W5T9|Q9H0B5	Missense_Mutation	SNP	HMMPfam_SCAN;HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.D198E	ENST00000292450.4	37	c.594	CCDS5681.1	7	.	.	.	.	.	.	.	.	.	.	T	7.497	0.651862	0.14516	.	.	ENSG00000166529	ENST00000543588;ENST00000292450;ENST00000456748;ENST00000379635	T;T;T	0.05025	4.38;3.51;4.38	4.79	4.79	0.61399	.	0.424791	0.17490	N	0.172385	T	0.04318	0.0119	N	0.24115	0.695	0.27734	N	0.944715	B;B	0.29432	0.083;0.244	B;B	0.25506	0.023;0.061	T	0.27739	-1.0065	10	0.06757	T	0.87	.	12.3465	0.55124	0.0:0.0:0.0:1.0	.	198;198	Q9Y5A6;G3V1M0	ZSC21_HUMAN;.	E	198;198;198;173	ENSP00000441212:D198E;ENSP00000292450:D198E;ENSP00000390960:D198E	ENSP00000292450:D198E	D	+	3	2	ZSCAN21	99499348	0.403000	0.25319	0.625000	0.29200	0.370000	0.29829	0.955000	0.29188	2.016000	0.59253	0.533000	0.62120	GAT	-	NULL		0.418	ZSCAN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN21	protein_coding	OTTHUMT00000336166.1	T	NM_145914	Missense_Mutation	99499348	1	no_errors	NM_145914	genbank	human	validated	54_36p	missense	SNP	0.28	A
GALNTL5	168391	genome.wustl.edu	37	7	151711779	151711779	+	Silent	SNP	A	A	G			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr7:151711779A>G	ENST00000392800.2	+	8	1331	c.1077A>G	c.(1075-1077)ggA>ggG	p.G359G	GALNTL5_ENST00000431418.2_Silent_p.G359G	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	359	Catalytic subdomain B.				spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.G359G(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		CTCGAGTAGGACATATCAGTA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	7											159.0	140.0	146.0					7																	151711779		2203	4300	6503	151342712	SO:0001819	synonymous_variant	168391			AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.1077A>G	7.37:g.151711779A>G		Somatic		Capture	Illumina GAIIx	4	151342712	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Silent	SNP	HMMPfam_Glycos_transf_2;superfamily_Nucleotide-diphospho-sugar transferases	p.G359	ENST00000392800.2	37	c.1077	CCDS5929.1	7																																																																																			-	NULL		0.398	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL5	protein_coding	OTTHUMT00000348395.1	A	NM_145292		151342712	1	no_errors	NM_145292	genbank	human	provisional	54_36p	silent	SNP	1	G
HAS2	3037	genome.wustl.edu	37	8	122641165	122641165	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr8:122641165C>A	ENST00000303924.4	-	2	953	c.416G>T	c.(415-417)gGc>gTc	p.G139V		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	139					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)	p.G139V(1)	HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			TTTGTCTCTGCCCATGACTTC	0.448																																																1	Substitution - Missense(1)	ovary(1)	8											251.0	226.0	234.0					8																	122641165		2203	4300	6503	122710346	SO:0001583	missense	3037			U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.416G>T	8.37:g.122641165C>A	ENSP00000306991:p.Gly139Val	Somatic		Capture	Illumina GAIIx	4	122710346	Q32MM3	Missense_Mutation	SNP	HMMPfam_Glycos_transf_2;superfamily_Nucleotide-diphospho-sugar transferases	p.G139V	ENST00000303924.4	37	c.416	CCDS6335.1	8	.	.	.	.	.	.	.	.	.	.	C	25.5	4.641843	0.87859	.	.	ENSG00000170961	ENST00000303924;ENST00000443194	T	0.59638	0.25	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.71609	0.3360	M	0.75777	2.31	0.80722	D	1	D	0.54772	0.968	P	0.52066	0.689	T	0.72184	-0.4367	10	0.59425	D	0.04	-16.1531	20.8794	0.99867	0.0:1.0:0.0:0.0	.	139	Q92819	HAS2_HUMAN	V	139	ENSP00000306991:G139V	ENSP00000306991:G139V	G	-	2	0	HAS2	122710346	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.772000	0.85439	2.941000	0.99782	0.655000	0.94253	GGC	-	NULL		0.448	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS2	protein_coding	OTTHUMT00000381150.2	C	NM_005328		122710346	-1	no_errors	NM_005328	genbank	human	reviewed	54_36p	missense	SNP	1	A
SPATA31E1	286234	genome.wustl.edu	37	9	90500353	90500353	+	Silent	SNP	C	C	A	rs201064219		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr9:90500353C>A	ENST00000325643.5	+	4	1017	c.951C>A	c.(949-951)ggC>ggA	p.G317G		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	317					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.G317G(1)									CCACCTGGGGCCTCTCCACCT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	9											39.0	43.0	41.0					9																	90500353		2203	4300	6503	89690173	SO:0001819	synonymous_variant	286234			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.951C>A	9.37:g.90500353C>A		Somatic		Capture	Illumina GAIIx	4	89690173	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	-	p.G317	ENST00000325643.5	37	c.951	CCDS6676.1	9																																																																																			-	NULL		0.627	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf79	protein_coding	OTTHUMT00000052954.2	C	NM_178828		89690173	1	no_errors	NM_178828	genbank	human	validated	54_36p	silent	SNP		A
IPPK	64768	genome.wustl.edu	37	9	95400399	95400399	+	Missense_Mutation	SNP	C	C	T	rs150868938		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr9:95400399C>T	ENST00000287996.3	-	9	1076	c.800G>A	c.(799-801)cGg>cAg	p.R267Q	IPPK_ENST00000375522.1_5'Flank	NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	267					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)	p.R267Q(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						CAGCAGCACCCGTGTGATCAC	0.667																																																1	Substitution - Missense(1)	ovary(1)	9						C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	43.0	42.0	43.0		800	1.7	0.9	9	dbSNP_134	43	0,8600		0,0,4300	no	missense	IPPK	NM_022755.5	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	267/492	95400399	1,13005	2203	4300	6503	94440220	SO:0001583	missense	64768			AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.800G>A	9.37:g.95400399C>T	ENSP00000287996:p.Arg267Gln	Somatic		Capture	Illumina GAIIx	4	94440220	Q5T9F7|Q9H7V8	Missense_Mutation	SNP	HMMPfam_DUF941	p.R267Q	ENST00000287996.3	37	c.800	CCDS6699.1	9	.	.	.	.	.	.	.	.	.	.	C	9.534	1.111522	0.20714	2.27E-4	0.0	ENSG00000127080	ENST00000287996	T	0.29142	1.58	5.11	1.72	0.24424	.	0.536654	0.20746	N	0.086441	T	0.07413	0.0187	N	0.03608	-0.345	0.28375	N	0.919836	P	0.45768	0.866	B	0.30716	0.119	T	0.15178	-1.0446	10	0.15066	T	0.55	-17.6797	3.2612	0.06849	0.4503:0.3445:0.115:0.0901	.	267	Q9H8X2	IPPK_HUMAN	Q	267	ENSP00000287996:R267Q	ENSP00000287996:R267Q	R	-	2	0	IPPK	94440220	0.333000	0.24731	0.858000	0.33744	0.312000	0.27988	1.020000	0.30027	0.651000	0.30788	0.462000	0.41574	CGG	-	HMMPfam_DUF941		0.667	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPPK	protein_coding	OTTHUMT00000053101.1	C	NM_022755		94440220	-1	no_errors	NM_022755	genbank	human	validated	54_36p	missense	SNP	0.06	T
RAPGEF1	2889	genome.wustl.edu	37	9	134464201	134464201	+	Missense_Mutation	SNP	C	C	A	rs539844465		TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr9:134464201C>A	ENST00000372189.3	-	17	2605	c.2482G>T	c.(2482-2484)Ggg>Tgg	p.G828W	RAPGEF1_ENST00000372190.3_Missense_Mutation_p.G846W|RAPGEF1_ENST00000372195.1_Missense_Mutation_p.G845W	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	828					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)	p.G846W(1)		NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		GCTGCTACCCCCCGGGCTGCC	0.657													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16942	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9											21.0	26.0	25.0					9																	134464201		2007	4161	6168	133454022	SO:0001583	missense	2889			BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.2482G>T	9.37:g.134464201C>A	ENSP00000361263:p.Gly828Trp	Somatic		Capture	Illumina GAIIx	4	133454022	Q5JUE4|Q8IV73	Missense_Mutation	SNP	RasGEF_N,HMMPfam_RasGEF_N,RasGEF,HMMPfam_RasGEF	p.G846W	ENST00000372189.3	37	c.2536	CCDS48047.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.26|17.26	3.344895|3.344895	0.61073|0.61073	.|.	.|.	ENSG00000107263|ENSG00000107263	ENST00000414781|ENST00000266110;ENST00000372195;ENST00000429421;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000337036;ENST00000398415;ENST00000357686	.|T;T;T	.|0.30714	.|1.52;1.52;1.52	5.45|5.45	5.45|5.45	0.79879|0.79879	.|Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.102535|0.102535	0.64402|0.64402	N|D	0.000003|0.000003	T|T	0.46347|0.46347	0.1388|0.1388	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.997;0.999	T|T	0.45527|0.45527	-0.9255|-0.9255	6|10	.|0.72032	.|D	.|0.01	.|.	18.2518|18.2518	0.90006|0.90006	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|828;846	.|Q13905;Q13905-3	.|RPGF1_HUMAN;.	V|W	255|828;845;774;828;846;808;806;273;845	.|ENSP00000361269:G845W;ENSP00000361263:G828W;ENSP00000361264:G846W	.|ENSP00000266110:G828W	G|G	-|-	2|1	0|0	RAPGEF1|RAPGEF1	133454022|133454022	1.000000|1.000000	0.71417|0.71417	0.283000|0.283000	0.24790|0.24790	0.414000|0.414000	0.31173|0.31173	5.676000|5.676000	0.68131|0.68131	2.546000|2.546000	0.85860|0.85860	0.462000|0.462000	0.41574|0.41574	GGG|GGG	-	NULL		0.657	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	RAPGEF1	protein_coding	OTTHUMT00000054759.2	C	NM_005312		133454022	-1	no_errors	NM_198679	genbank	human	reviewed	54_36p	missense	SNP	0.997	A
MUM1L1	139221	genome.wustl.edu	37	X	105450659	105450659	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chrX:105450659A>T	ENST00000357175.2	+	4	1883	c.1234A>T	c.(1234-1236)Agt>Tgt	p.S412C	MUM1L1_ENST00000337685.2_Missense_Mutation_p.S412C|MUM1L1_ENST00000372552.1_Missense_Mutation_p.S412C	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	412	PWWP.					extracellular vesicular exosome (GO:0070062)		p.S412C(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						AGTGATAAAAAGTATCAGACG	0.343																																																1	Substitution - Missense(1)	ovary(1)	X											37.0	33.0	34.0					X																	105450659		1836	4072	5908	105337315	SO:0001583	missense	139221			AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1234A>T	X.37:g.105450659A>T	ENSP00000349699:p.Ser412Cys	Somatic		Capture	Illumina GAIIx	4	105337315	D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	superfamily_SSF63748	p.S412C	ENST00000357175.2	37	c.1234	CCDS55469.1	X	.	.	.	.	.	.	.	.	.	.	A	14.77	2.634407	0.47049	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.72167	-0.63;-0.63;-0.63	4.31	4.31	0.51392	.	0.000000	0.64402	D	0.000012	T	0.76378	0.3979	M	0.68317	2.08	0.32173	N	0.581412	D	0.69078	0.997	P	0.56960	0.81	T	0.81616	-0.0852	10	0.87932	D	0	-33.04	8.8406	0.35140	1.0:0.0:0.0:0.0	.	412	Q5H9M0	MUML1_HUMAN	C	412	ENSP00000349699:S412C;ENSP00000338641:S412C;ENSP00000361632:S412C	ENSP00000338641:S412C	S	+	1	0	MUM1L1	105337315	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	4.085000	0.57657	1.908000	0.55244	0.430000	0.28490	AGT	-	NULL		0.343	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MUM1L1	protein_coding	OTTHUMT00000057795.1	A	NM_152423		105337315	1	no_errors	ENST00000337685	ensembl	human	known	54_36p	missense	SNP	1	T
MAGEB5	347541	genome.wustl.edu	37	X	26236041	26236041	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chrX:26236041C>A	ENST00000602297.1	+	2	870	c.623C>A	c.(622-624)gCc>gAc	p.A208D	MAGEB5_ENST00000379029.2_Missense_Mutation_p.A208D	NM_001271752.1	NP_001258681.1	Q9BZ81	MAGB5_HUMAN	melanoma antigen family B, 5	208	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.A208D(1)		lung(1)|ovary(1)	2						GGTCCAAGAGCCTATACTGAA	0.468																																																1	Substitution - Missense(1)	ovary(1)	X																																								26145962	SO:0001583	missense	347541			AF333705	CCDS65233.1	Xp22	2012-04-20			ENSG00000188408	ENSG00000188408			23795	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 3"""	300466				10861452	Standard	NM_001271752		Approved	MAGE-B5, CT3.3	uc031thc.1	Q9BZ81	OTTHUMG00000021288	ENST00000602297.1:c.623C>A	X.37:g.26236041C>A	ENSP00000473493:p.Ala208Asp	Somatic		Capture	Illumina GAIIx	4	26145962		Missense_Mutation	SNP	-	p.A300D	ENST00000602297.1	37	c.899		X	.	.	.	.	.	.	.	.	.	.	C	15.11	2.735292	0.48939	.	.	ENSG00000188408	ENST00000379029	T	0.06768	3.26	4.06	4.06	0.47325	.	0.000000	0.85682	U	0.000000	T	0.27027	0.0662	M	0.90198	3.095	0.09310	N	1	.	.	.	.	.	.	T	0.08953	-1.0697	8	0.72032	D	0.01	.	10.6146	0.45443	0.0:1.0:0.0:0.0	.	.	.	.	D	208	ENSP00000368315:A208D	ENSP00000368315:A208D	A	+	2	0	MAGEB5	26145962	0.034000	0.19679	0.128000	0.21923	0.002000	0.02628	0.806000	0.27126	2.265000	0.75225	0.600000	0.82982	GCC	-	NULL		0.468	MAGEB5-001	KNOWN	basic|appris_principal	protein_coding	MAGEB5	protein_coding	OTTHUMT00000056126.2	C	XM_293407		26145962	1	no_errors	XM_293407	genbank	human	model	54_36p	missense	SNP	0.01	A
HUWE1	10075	genome.wustl.edu	37	X	53578151	53578151	+	Splice_Site	SNP	C	C	A			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chrX:53578151C>A	ENST00000342160.3	-	64	9554		c.e64-1		HUWE1_ENST00000262854.6_Splice_Site			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase						base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.?(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GTGCCAGTACCTATGGAGCAG	0.572																																																1	Unknown(1)	ovary(1)	X											78.0	70.0	73.0					X																	53578151		2203	4300	6503	53594876	SO:0001630	splice_region_variant	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.9097-1G>T	X.37:g.53578151C>A		Somatic		Capture	Illumina GAIIx	4	53594876	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Splice_Site	SNP	-	e62-1	ENST00000342160.3	37	c.9097-1	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541453	0.65085	.	.	ENSG00000086758	ENST00000342160;ENST00000427052;ENST00000262854	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8502	0.88744	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HUWE1	53594876	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	7.070000	0.76763	2.489000	0.83994	0.600000	0.82982	.	-	-		0.572	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	protein_coding	OTTHUMT00000056766.1	C	XM_497119	Intron	53594876	-1	no_errors	NM_031407	genbank	human	validated	54_36p	splice_site	SNP	1	A
GPR101	83550	genome.wustl.edu	37	X	136113603	136113603	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chrX:136113603G>C	ENST00000298110.1	-	1	230	c.231C>G	c.(229-231)gaC>gaG	p.D77E		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.D77E(1)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					TCTGCAGCAGGTCGGTGACGA	0.602																																																1	Substitution - Missense(1)	ovary(1)	X											58.0	55.0	56.0					X																	136113603		2203	4300	6503	135941269	SO:0001583	missense	83550			AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.231C>G	X.37:g.136113603G>C	ENSP00000298110:p.Asp77Glu	Somatic		Capture	Illumina GAIIx	4	135941269	Q5JSM8|Q8NG93	Missense_Mutation	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.D77E	ENST00000298110.1	37	c.231	CCDS14662.1	X	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300614	0.60195	.	.	ENSG00000165370	ENST00000298110	D	0.87966	-2.32	4.85	2.76	0.32466	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.93132	0.7813	M	0.92738	3.34	0.37145	D	0.901905	D	0.89917	1.0	D	0.81914	0.995	D	0.92035	0.5636	9	0.87932	D	0	-26.4374	4.357	0.11183	0.4782:0.0:0.5218:0.0	.	77	Q96P66	GP101_HUMAN	E	77	ENSP00000298110:D77E	ENSP00000298110:D77E	D	-	3	2	GPR101	135941269	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.844000	0.39269	0.835000	0.34877	0.544000	0.68410	GAC	-	HMMPfam_7tm_1		0.602	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR101	protein_coding	OTTHUMT00000058519.1	G			135941269	-1	no_errors	NM_054021	genbank	human	provisional	54_36p	missense	SNP	1	C
PRSS27	83886	genome.wustl.edu	37	16	2764189	2764190	+	Nonsense_Mutation	DNP	CC	CC	AG			TCGA-13-0887-01A-01W-0421-09	TCGA-13-0887-10A-01W-0421-09	CC	CC	CC	AG	CC	CC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e05146f2-688d-416b-a992-e2c7a2b7b244	a7b1690e-9c43-4c92-b1a8-6e1c488da73a	g.chr16:2764189_2764190CC>AG	ENST00000302641.3	-	4	438_439	c.384_385GG>CT	c.(382-387)gtGGag>gtCTag	p.E129*	AC092117.1_ENST00000410123.1_RNA	NM_031948.3	NP_114154.1	Q9BQR3	PRS27_HUMAN	protease, serine 27	129	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8						GCCTCCAGCTCCACCAGGGCCA	0.639																																																0			16																																								2704191	SO:0001587	stop_gained	83886			AB056161	CCDS10476.1	16p13.3	2010-05-07			ENSG00000172382	ENSG00000172382		"""Serine peptidases / Serine peptidases"""	15475	protein-coding gene	gene with protein product		608018					Standard	NM_031948		Approved	MPN, pancreasin, CAPH2, marapsin	uc002crf.3	Q9BQR3	OTTHUMG00000128929	ENST00000302641.3:c.384_385delinsAG	16.37:g.2764189_2764190delinsAG	ENSP00000306390:p.Glu129*	Somatic		Capture	Illumina GAIIx	4	2704190		Nonsense_Mutation	DNP	superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.EL129*	ENST00000302641.3	37	c.385_384	CCDS10476.1	16																																																																																			-	superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc,HMMPfam_Trypsin		0.639	PRSS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS27	protein_coding	OTTHUMT00000250908.1	CC	NM_031948		2704191	-1	no_errors	NM_031948	genbank	human	validated	54_36p	nonsense	DNP	0.985:0.986	AG
