#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
KCNA10	3744	genome.wustl.edu	37	1	111060744	111060744	+	Silent	SNP	C	C	G	rs36028106	byFrequency	TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr1:111060744C>G	ENST00000369771.2	-	1	1053	c.666G>C	c.(664-666)tcG>tcC	p.S222S		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	222					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)	p.S222S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	CAACCAACACCGAGACCACGG	0.557																																																1	Substitution - coding silent(1)	ovary(1)	1											113.0	106.0	108.0					1																	111060744		2203	4300	6503	110862267	SO:0001819	synonymous_variant	3744			U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.666G>C	1.37:g.111060744C>G		Somatic		Capture	Illumina GAIIx	Phase_III	110862267		Silent	SNP	-	p.S222	ENST00000369771.2	37	c.666	CCDS826.1	1																																																																																			-	NULL		0.557	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA10	protein_coding	OTTHUMT00000059081.1	C	NM_005549		110862267	-1	no_errors	NM_005549	genbank	human	reviewed	54_36p	silent	SNP	0.16	G
OVGP1	5016	genome.wustl.edu	37	1	111969249	111969249	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr1:111969249G>C	ENST00000369732.3	-	3	125	c.70C>G	c.(70-72)Ctc>Gtc	p.L24V	OVGP1_ENST00000540696.1_5'UTR	NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	24					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)	p.L24V(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		TAACACACGAGTTTATGGGCA	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											62.0	58.0	59.0					1																	111969249		2203	4300	6503	111770772	SO:0001583	missense	5016			U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.70C>G	1.37:g.111969249G>C	ENSP00000358747:p.Leu24Val	Somatic		Capture	Illumina GAIIx	4	111770772	A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	HMMPfam_Glyco_hydro_18;superfamily_(Trans)glycosidases;superfamily_Chitinase insertion domain	p.L24V	ENST00000369732.3	37	c.70	CCDS834.1	1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.636645	0.47049	.	.	ENSG00000085465	ENST00000369732;ENST00000369728	T	0.04603	3.59	4.57	3.65	0.41850	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.057388	0.64402	D	0.000001	T	0.03871	0.0109	N	0.17379	0.485	0.80722	D	1	P;P	0.51653	0.947;0.947	D;D	0.66497	0.944;0.944	T	0.55749	-0.8092	10	0.32370	T	0.25	-14.3635	10.5684	0.45186	0.0957:0.0:0.9043:0.0	.	24;24	B2RA77;Q12889	.;OVGP1_HUMAN	V	24;66	ENSP00000358747:L24V	ENSP00000358743:L66V	L	-	1	0	OVGP1	111770772	1.000000	0.71417	0.997000	0.53966	0.799000	0.45148	3.586000	0.53950	1.260000	0.44134	0.491000	0.48974	CTC	-	HMMPfam_Glyco_hydro_18		0.547	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVGP1	protein_coding	OTTHUMT00000032461.1	G	NM_002557		111770772	-1	no_errors	NM_002557	genbank	human	reviewed	54_36p	missense	SNP	1	C
NUP210L	91181	genome.wustl.edu	37	1	154033062	154033062	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr1:154033062T>G	ENST00000368559.3	-	20	2875	c.2804A>C	c.(2803-2805)cAg>cCg	p.Q935P	NUP210L_ENST00000271854.3_Missense_Mutation_p.Q935P	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	935					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.Q935P(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GACAACACCCTGCTCACTGCT	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											128.0	118.0	121.0					1																	154033062		1901	4137	6038	152299686	SO:0001583	missense	91181			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2804A>C	1.37:g.154033062T>G	ENSP00000357547:p.Gln935Pro	Somatic		Capture	Illumina GAIIx	4	152299686	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	-	p.Q935P	ENST00000368559.3	37	c.2804	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	T	11.78	1.740884	0.30865	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.06528	3.55;3.29	5.14	5.14	0.70334	.	0.111651	0.39759	N	0.001270	T	0.03871	0.0109	L	0.56769	1.78	0.33337	D	0.569311	D;P	0.55385	0.971;0.915	B;B	0.42062	0.374;0.374	T	0.42120	-0.9470	10	0.33940	T	0.23	-29.6291	12.5793	0.56381	0.0:0.0:0.0:1.0	.	935;935	E7EP56;Q5VU65	.;P210L_HUMAN	P	935	ENSP00000357547:Q935P;ENSP00000271854:Q935P	ENSP00000271854:Q935P	Q	-	2	0	NUP210L	152299686	0.000000	0.05858	0.911000	0.35937	0.482000	0.33219	0.183000	0.16919	2.161000	0.67846	0.533000	0.62120	CAG	-	NULL		0.418	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	protein_coding	OTTHUMT00000087270.3	T	NM_207308		152299686	-1	no_errors	NM_207308	genbank	human	validated	54_36p	missense	SNP	0.11	G
NUP210L	91181	genome.wustl.edu	37	1	154098925	154098925	+	Silent	SNP	T	T	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr1:154098925T>C	ENST00000368559.3	-	10	1271	c.1200A>G	c.(1198-1200)acA>acG	p.T400T	NUP210L_ENST00000271854.3_Silent_p.T400T	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	400					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.T400T(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GAAAGTCGTATGTAATCCTGA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	1											127.0	113.0	117.0					1																	154098925		1875	4119	5994	152365549	SO:0001819	synonymous_variant	91181			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.1200A>G	1.37:g.154098925T>C		Somatic		Capture	Illumina GAIIx	4	152365549	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Silent	SNP	-	p.T400	ENST00000368559.3	37	c.1200	CCDS41399.1	1																																																																																			-	NULL		0.378	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	protein_coding	OTTHUMT00000087270.3	T	NM_207308		152365549	-1	no_errors	NM_207308	genbank	human	validated	54_36p	silent	SNP		C
OBSCN	84033	genome.wustl.edu	37	1	228433206	228433206	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr1:228433206C>G	ENST00000422127.1	+	12	3618	c.3574C>G	c.(3574-3576)Cag>Gag	p.Q1192E	OBSCN_ENST00000570156.2_Missense_Mutation_p.Q1284E|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.Q1192E|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1192	Ig-like 12.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.Q1192E(2)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGAGGTGGCCCAGCCCCAGAC	0.597																																																2	Substitution - Missense(2)	ovary(2)	1											83.0	83.0	83.0					1																	228433206		2088	4200	6288	226499829	SO:0001583	missense	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.3574C>G	1.37:g.228433206C>G	ENSP00000409493:p.Gln1192Glu	Somatic		Capture	Illumina GAIIx	4	226499829	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	-	p.Q1192E	ENST00000422127.1	37	c.3574	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	.	11.10	1.540208	0.27563	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.04502	3.61;3.61	4.39	1.04	0.20106	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.342558	0.28187	N	0.016280	T	0.04634	0.0126	N	0.17278	0.47	0.80722	D	1	P;D	0.53745	0.951;0.962	P;P	0.55785	0.6;0.784	T	0.38520	-0.9657	10	0.02654	T	1	.	9.2574	0.37593	0.0:0.6732:0.2471:0.0797	.	1192;1192	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	E	1192	ENSP00000284548:Q1192E;ENSP00000409493:Q1192E	ENSP00000284548:Q1192E	Q	+	1	0	OBSCN	226499829	1.000000	0.71417	0.973000	0.42090	0.237000	0.25408	3.714000	0.54889	0.842000	0.35045	0.306000	0.20318	CAG	-	NULL		0.597	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		C	NM_052843		226499829	1	no_errors	NM_001098623	genbank	human	reviewed	54_36p	missense	SNP	1	G
OR2W5	441932	genome.wustl.edu	37	1	247654759	247654759	+	RNA	SNP	C	C	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr1:247654759C>A	ENST00000522351.1	+	0	390							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T110T(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TGGGCTCCACCGAGTGCGTCC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	1											97.0	93.0	94.0					1																	247654759		2203	4300	6503	245721382			441932					1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247654759C>A		Somatic		Capture	Illumina GAIIx	4	245721382	B9EH85	Silent	SNP	-	p.T110	ENST00000522351.1	37	c.330		1																																																																																			-	NULL		0.607	OR2W5-002	KNOWN	basic	processed_transcript	OR2W5	pseudogene	OTTHUMT00000375789.1	C	NM_001004698		245721382	1	no_errors	NM_001004698	genbank	human	provisional	54_36p	silent	SNP		A
FBXO18	84893	genome.wustl.edu	37	10	5958363	5958363	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr10:5958363A>T	ENST00000362091.4	+	10	1847	c.1732A>T	c.(1732-1734)Att>Ttt	p.I578F	FBXO18_ENST00000379999.5_Missense_Mutation_p.I629F|FBXO18_ENST00000397269.3_Missense_Mutation_p.I65F	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	578					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)	p.I629F(1)		NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						TCACGTGCCTATTTGGTGTAA	0.473																																																1	Substitution - Missense(1)	ovary(1)	10											172.0	154.0	160.0					10																	5958363		2203	4300	6503	5998369	SO:0001583	missense	84893			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.1732A>T	10.37:g.5958363A>T	ENSP00000355415:p.Ile578Phe	Somatic		Capture	Illumina GAIIx	4	5998369	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	-	p.I629F	ENST00000362091.4	37	c.1885	CCDS7072.1	10	.	.	.	.	.	.	.	.	.	.	A	11.06	1.528485	0.27299	.	.	ENSG00000134452	ENST00000397269;ENST00000362091;ENST00000544954;ENST00000379999;ENST00000379994	.	.	.	5.19	4.0	0.46444	.	0.431929	0.25686	N	0.028971	T	0.22781	0.0550	N	0.24115	0.695	0.28713	N	0.903414	B;B;B	0.24483	0.104;0.067;0.017	B;B;B	0.18871	0.023;0.016;0.004	T	0.12167	-1.0558	9	0.12430	T	0.62	-17.8451	6.7315	0.23385	0.7861:0.0:0.0769:0.137	.	629;578;504	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	F	65;578;315;629;315	.	ENSP00000355415:I578F	I	+	1	0	FBXO18	5998369	0.620000	0.27068	0.992000	0.48379	0.898000	0.52572	2.138000	0.42140	1.947000	0.56498	0.454000	0.30748	ATT	-	NULL		0.473	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	protein_coding	OTTHUMT00000046596.1	A	NM_032807		5998369	1	no_errors	NM_032807	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
WAC	51322	genome.wustl.edu	37	10	28900852	28900852	+	Splice_Site	SNP	G	G	T			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr10:28900852G>T	ENST00000354911.4	+	10	1598		c.e10+1		WAC_ENST00000375646.1_Splice_Site|WAC_ENST00000375664.4_Splice_Site|WAC_ENST00000347934.4_Splice_Site	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil						cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)	p.?(2)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						ACAGCCAAAGGTATGTCACCT	0.388																																																2	Unknown(2)	ovary(1)|endometrium(1)	10											125.0	105.0	112.0					10																	28900852		2203	4300	6503	28940858	SO:0001630	splice_region_variant	51322			AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.1437+1G>T	10.37:g.28900852G>T		Somatic		Capture	Illumina GAIIx	4	28940858	A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Splice_Site	SNP	-	e10+1	ENST00000354911.4	37	c.1437+1	CCDS7159.1	10	.	.	.	.	.	.	.	.	.	.	G	25.3	4.621544	0.87460	.	.	ENSG00000095787	ENST00000375664;ENST00000375646;ENST00000347934;ENST00000354911;ENST00000338396	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7641	0.96334	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WAC	28940858	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.759000	0.98931	2.733000	0.93635	0.650000	0.86243	.	-	-		0.388	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	WAC	protein_coding	OTTHUMT00000047371.1	G	NM_100264	Intron	28940858	1	no_errors	NM_016628	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
GDF2	2658	genome.wustl.edu	37	10	48413906	48413906	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr10:48413906G>C	ENST00000249598.1	-	2	1121	c.962C>G	c.(961-963)gCc>gGc	p.A321G		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	321					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.A321G(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						GCCAGCCCCGGCGCTCCTTTT	0.612																																																1	Substitution - Missense(1)	ovary(1)	10											49.0	52.0	51.0					10																	48413906		2203	4300	6503	48033912	SO:0001583	missense	2658			AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.962C>G	10.37:g.48413906G>C	ENSP00000249598:p.Ala321Gly	Somatic		Capture	Illumina GAIIx	4	48033912	Q5VSQ9|Q9Y571	Missense_Mutation	SNP	-	p.A321G	ENST00000249598.1	37	c.962	CCDS7219.1	10	.	.	.	.	.	.	.	.	.	.	G	4.372	0.068629	0.08436	.	.	ENSG00000128802	ENST00000249598	D	0.88509	-2.39	5.46	1.52	0.23074	Transforming growth factor-beta, C-terminal (1);	0.624518	0.17938	N	0.156935	T	0.81574	0.4851	L	0.50333	1.59	0.09310	N	1	B	0.32245	0.361	B	0.27608	0.081	T	0.69503	-0.5128	10	0.42905	T	0.14	.	5.0086	0.14300	0.3589:0.0:0.5064:0.1347	.	321	Q9UK05	GDF2_HUMAN	G	321	ENSP00000249598:A321G	ENSP00000249598:A321G	A	-	2	0	GDF2	48033912	0.265000	0.24102	0.000000	0.03702	0.007000	0.05969	3.206000	0.51098	0.025000	0.15241	-0.373000	0.07131	GCC	-	NULL		0.612	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF2	protein_coding	OTTHUMT00000047891.1	G	NM_016204		48033912	-1	no_errors	NM_016204	genbank	human	reviewed	54_36p	missense	SNP	0.04	C
MCMBP	79892	genome.wustl.edu	37	10	121587056	121587056	+	IGR	SNP	G	G	T			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr10:121587056G>T	ENST00000360003.3	-	0	4113				INPP5F_ENST00000361976.2_Missense_Mutation_p.V1055L|INPP5F_ENST00000369080.3_Missense_Mutation_p.V445L	NM_001256378.1|NM_001256379.1|NM_024834.3	NP_001243307.1|NP_001243308.1|NP_079110.1	Q9BTE3	MCMBP_HUMAN	minichromosome maintenance complex binding protein						DNA-dependent DNA replication (GO:0006261)|mitotic nuclear division (GO:0007067)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.V1055L(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(2)|skin(2)	21						AGGGCTTCATGTAACTCCTTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	10											108.0	106.0	107.0					10																	121587056		2203	4300	6503	121577046	SO:0001628	intergenic_variant	22876			BC007219	CCDS7617.1, CCDS58099.1	10q26.13	2013-10-11	2011-01-05	2011-01-05	ENSG00000197771	ENSG00000197771			25782	protein-coding gene	gene with protein product		610909	"""chromosome 10 open reading frame 119"""	C10orf119		17296731	Standard	NM_024834		Approved	FLJ13081, MCM-BP	uc001ler.3	Q9BTE3	OTTHUMG00000019159		10.37:g.121587056G>T		Somatic		Capture	Illumina GAIIx	4	121577046	B3KSP7|Q6IA56|Q9BVT9|Q9H916	Missense_Mutation	SNP	HMMPfam_Syja_N	p.V1055L	ENST00000360003.3	37	c.3163	CCDS7617.1	10	.	.	.	.	.	.	.	.	.	.	G	11.81	1.749539	0.30955	.	.	ENSG00000198825	ENST00000361976;ENST00000369080	T;T	0.43294	1.18;0.95	5.92	2.93	0.34026	.	0.633658	0.16026	N	0.233094	T	0.25754	0.0627	N	0.25647	0.755	0.09310	N	0.999999	B;B	0.18013	0.025;0.0	B;B	0.15870	0.014;0.0	T	0.13764	-1.0497	10	0.31617	T	0.26	-10.0177	5.3593	0.16079	0.2181:0.4217:0.3602:0.0	.	445;1055	Q5W135;Q9Y2H2	.;SAC2_HUMAN	L	1055;445	ENSP00000354519:V1055L;ENSP00000358076:V445L	ENSP00000354519:V1055L	V	+	1	0	INPP5F	121577046	0.001000	0.12720	0.661000	0.29709	0.972000	0.66771	0.875000	0.28079	0.810000	0.34279	0.655000	0.94253	GTA	-	NULL		0.507	MCMBP-002	KNOWN	basic|CCDS	protein_coding	INPP5F	protein_coding	OTTHUMT00000050684.1	G	NM_024834		121577046	1	no_errors	NM_014937	genbank	human	reviewed	54_36p	missense	SNP	0.03	T
RAP1BP2	100128179	genome.wustl.edu	37	3	103782264	103782264	+	IGR	SNP	C	C	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr3:103782264C>G								AC016970.1 (8624 upstream) : None (None downstream)																							AGAAAAGGAACAAGGTCAAAA	0.323																																																0			3																																								105264954	SO:0001628	intergenic_variant	0																															3.37:g.103782264C>G		Somatic		Capture	Illumina GAIIx	4	105264954		Missense_Mutation	SNP	-	p.Q130E		37	c.388		3																																																																																			-	NULL	0	0.323					ENSG00000214405			C			105264954	1	no_start_codon	ENST00000341355	ensembl	human	known	54_36p	missense	SNP	1	G
PTH	5741	genome.wustl.edu	37	11	13513970	13513970	+	Silent	SNP	A	A	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr11:13513970A>G	ENST00000282091.1	-	3	444	c.330T>C	c.(328-330)acT>acC	p.T110T	PTH_ENST00000529816.1_Silent_p.T110T	NM_000315.2	NP_000306.1	P01270	PTHY_HUMAN	parathyroid hormone	110					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|bone resorption (GO:0045453)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular macromolecule biosynthetic process (GO:0034645)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to lead ion (GO:0010288)|response to parathyroid hormone (GO:0071107)|response to vitamin D (GO:0033280)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.T110T(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(625;0.00116)|Epithelial(150;0.0357)|LUSC - Lung squamous cell carcinoma(625;0.0836)		ATTTAGCTTTAGTTAATACAT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	11											90.0	82.0	85.0					11																	13513970		2200	4294	6494	13470546	SO:0001819	synonymous_variant	5741			J00301	CCDS7812.1	11p15.3-p15.1	2013-02-28				ENSG00000152266		"""Endogenous ligands"""	9606	protein-coding gene	gene with protein product	"""parathyrin"", ""parathormone"", ""parathyroid hormone 1"", ""preproparathyroid hormone"", ""prepro-PTH"""	168450				1672845	Standard	NM_000315		Approved	PTH1	uc001mlb.3	P01270		ENST00000282091.1:c.330T>C	11.37:g.13513970A>G		Somatic		Capture	Illumina GAIIx	4	13470546	Q4VB48|Q9UD38	Silent	SNP	HMMPfam_Parathyroid	p.T110	ENST00000282091.1	37	c.330	CCDS7812.1	11																																																																																			-	HMMPfam_Parathyroid		0.408	PTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH	protein_coding	OTTHUMT00000386198.1	A	NM_000315		13470546	-1	no_errors	NM_000315	genbank	human	reviewed	54_36p	silent	SNP	0.06	G
CTD-2026G22.1	0	genome.wustl.edu	37	11	49391897	49391897	+	RNA	SNP	T	T	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr11:49391897T>A	ENST00000529081.1	+	0	221																											TTCAAGACTGTTTCTTGGACG	0.318																																																0			11																																								49348473			729960																															11.37:g.49391897T>A		Somatic		Capture	Illumina GAIIx	4	49348473		RNA	SNP	-	NULL	ENST00000529081.1	37	NULL		11																																																																																			-	-		0.318	CTD-2026G22.1-002	KNOWN	basic	processed_transcript	LOC729960	pseudogene	OTTHUMT00000391375.1	T			49348473	1	pseudogene	XR_016034	genbank	human	model	54_36p	rna	SNP	0.998	A
GIF	2694	genome.wustl.edu	37	11	59609970	59609970	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr11:59609970T>A	ENST00000257248.2	-	4	504	c.457A>T	c.(457-459)Ata>Tta	p.I153L	GIF_ENST00000541311.1_Missense_Mutation_p.I128L	NM_005142.2	NP_005133.2	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	153					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)	cobalamin binding (GO:0031419)	p.I153L(1)		large_intestine(4)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	17					Cyanocobalamin(DB00115)	CGGACGGCTATCGGCAAGGTC	0.582																																					NSCLC(53;1139 1245 16872 38474 42853)											1	Substitution - Missense(1)	ovary(1)	11											114.0	98.0	103.0					11																	59609970		2201	4295	6496	59366546	SO:0001583	missense	2694			X76562	CCDS7977.1	11q12.1	2013-09-20			ENSG00000134812	ENSG00000134812			4268	protein-coding gene	gene with protein product		609342				2071148	Standard	NM_005142		Approved	TCN3, IF, IFMH, INF	uc001noi.3	P27352	OTTHUMG00000167399	ENST00000257248.2:c.457A>T	11.37:g.59609970T>A	ENSP00000257248:p.Ile153Leu	Somatic		Capture	Illumina GAIIx	4	59366546	B2RAN8|B4DVZ1	Missense_Mutation	SNP	-	p.I153L	ENST00000257248.2	37	c.457	CCDS7977.1	11	.	.	.	.	.	.	.	.	.	.	T	6.014	0.370984	0.11409	.	.	ENSG00000134812	ENST00000257248;ENST00000541311	T;T	0.35048	1.33;1.33	5.87	-0.871	0.10642	.	0.534733	0.19727	N	0.107441	T	0.09024	0.0223	N	0.01705	-0.755	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.21245	-1.0251	10	0.12766	T	0.61	-5.9434	1.0103	0.01495	0.145:0.1785:0.2995:0.377	.	153	P27352	IF_HUMAN	L	153;128	ENSP00000257248:I153L;ENSP00000440427:I128L	ENSP00000257248:I153L	I	-	1	0	GIF	59366546	0.001000	0.12720	0.045000	0.18777	0.075000	0.17131	-0.332000	0.07904	0.173000	0.19788	0.533000	0.62120	ATA	-	NULL		0.582	GIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIF	protein_coding	OTTHUMT00000394497.1	T	NM_005142		59366546	-1	no_errors	NM_005142	genbank	human	reviewed	54_36p	missense	SNP	0.01	A
C11orf30	56946	genome.wustl.edu	37	11	76175080	76175080	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr11:76175080T>C	ENST00000529032.1	+	6	787	c.787T>C	c.(787-789)Ttc>Ctc	p.F263L	C11orf30_ENST00000525919.1_Missense_Mutation_p.F264L|C11orf30_ENST00000524490.1_Missense_Mutation_p.F264L|C11orf30_ENST00000334736.3_Missense_Mutation_p.F263L|C11orf30_ENST00000524767.1_Missense_Mutation_p.F278L|C11orf30_ENST00000525038.1_Missense_Mutation_p.F278L|C11orf30_ENST00000343878.3_Missense_Mutation_p.F263L|C11orf30_ENST00000533248.1_Missense_Mutation_p.F277L			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	263	Interaction with BRCA2.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.F263L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						AAAAATAACCTTCACTAAACC	0.458																																																1	Substitution - Missense(1)	ovary(1)	11											139.0	115.0	123.0					11																	76175080		2200	4292	6492	75852728	SO:0001583	missense	56946			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.787T>C	11.37:g.76175080T>C	ENSP00000432327:p.Phe263Leu	Somatic		Capture	Illumina GAIIx	4	75852728	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	HMMPfam_ENT	p.F263L	ENST00000529032.1	37	c.787	CCDS8244.1	11	.	.	.	.	.	.	.	.	.	.	T	22.5	4.297534	0.81025	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032	T;T;T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14	5.75	5.75	0.90469	.	0.045913	0.85682	D	0.000000	T	0.45094	0.1325	L	0.29908	0.895	0.80722	D	1	P;P;P;D;D;D;P;D	0.61697	0.956;0.956;0.956;0.99;0.99;0.982;0.956;0.982	D;D;D;D;D;D;D;D	0.72982	0.931;0.931;0.931;0.979;0.979;0.952;0.931;0.952	T	0.21449	-1.0245	10	0.09590	T	0.72	-7.3134	16.0707	0.80928	0.0:0.0:0.0:1.0	.	277;278;278;263;213;264;264;263	B7ZKT8;B7ZKU2;B7ZKU0;Q7Z589-2;F5H2F0;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;.;.;EMSY_HUMAN	L	264;263;263;213;278;277;264;278;263	ENSP00000431166:F264L;ENSP00000334130:F263L;ENSP00000344688:F263L;ENSP00000433205:F278L;ENSP00000433634:F277L;ENSP00000432010:F264L;ENSP00000436968:F278L;ENSP00000432327:F263L	ENSP00000334130:F263L	F	+	1	0	C11orf30	75852728	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.040000	0.89188	2.194000	0.70268	0.533000	0.62120	TTC	-	NULL		0.458	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf30	protein_coding	OTTHUMT00000383288.2	T	NM_020193		75852728	1	no_errors	NM_020193	genbank	human	validated	54_36p	missense	SNP	1	C
SIK3	23387	genome.wustl.edu	37	11	116732096	116732096	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr11:116732096T>G	ENST00000292055.4	-	18	2036	c.2001A>C	c.(1999-2001)ttA>ttC	p.L667F	SIK3_ENST00000488337.1_Intron|SIK3_ENST00000434315.2_Missense_Mutation_p.L566F|SIK3_ENST00000375288.1_Intron|SIK3_ENST00000375300.1_Missense_Mutation_p.L725F|SIK3_ENST00000542607.1_Missense_Mutation_p.L667F|SIK3_ENST00000446921.2_Missense_Mutation_p.L725F	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	667	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.L773F(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GCTGAATCCTTAACCTTAAAA	0.443											OREG0003492	type=REGULATORY REGION|Gene=BC035583|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				1	Substitution - Missense(1)	ovary(1)	11											56.0	63.0	61.0					11																	116732096		2201	4296	6497	116237306	SO:0001583	missense	23387			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.2001A>C	11.37:g.116732096T>G	ENSP00000292055:p.Leu667Phe	Somatic	1475	Capture	Illumina GAIIx	4	116237306	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_UBA-like;superfamily_Protein kinase-like (PK-like)	p.L667F	ENST00000292055.4	37	c.2001	CCDS8379.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	19.23|19.23	3.787068|3.787068	0.70337|0.70337	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000445177;ENST00000446921|ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315	.|T;T;T;T	.|0.25912	.|1.77;1.77;1.77;1.77	5.83|5.83	3.43|3.43	0.39272|0.39272	.|Protein kinase-like domain (1);	.|0.000000	.|0.33040	.|U	.|0.005345	T|T	0.35856|0.35856	0.0946|0.0946	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.999;0.999	.|D;D;D	.|0.91635	.|0.999;0.998;0.998	T|T	0.10042|0.10042	-1.0647|-1.0647	5|10	.|0.72032	.|D	.|0.01	.|.	8.8508|8.8508	0.35199|0.35199	0.0:0.2777:0.0:0.7223|0.0:0.2777:0.0:0.7223	.|.	.|667;566;667	.|A1A5A8;A1A5A9;Q9Y2K2	.|.;.;SIK3_HUMAN	Q|F	767;690|725;667;667;566	.|ENSP00000364449:L725F;ENSP00000292055:L667F;ENSP00000438108:L667F;ENSP00000415873:L566F	.|ENSP00000292055:L667F	K|L	-|-	1|3	0|2	SIK3|SIK3	116237306|116237306	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.236000|1.236000	0.32683|0.32683	0.994000|0.994000	0.38892|0.38892	0.533000|0.533000	0.62120|0.62120	AAG|TTA	-	NULL		0.443	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0999	protein_coding		T	NM_025164		116237306	-1	no_errors	NM_025164	genbank	human	validated	54_36p	missense	SNP	1	G
STAB2	55576	genome.wustl.edu	37	12	103984748	103984748	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr12:103984748T>A	ENST00000388887.2	+	2	359	c.155T>A	c.(154-156)gTc>gAc	p.V52D	U8_ENST00000391292.1_RNA	NM_017564.9	NP_060034.9			stabilin 2									p.V52D(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						AACCTTGGAGTCAAGTGCCCG	0.433																																																1	Substitution - Missense(1)	ovary(1)	12											133.0	129.0	130.0					12																	103984748		2203	4300	6503	102508878	SO:0001583	missense	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.155T>A	12.37:g.103984748T>A	ENSP00000373539:p.Val52Asp	Somatic		Capture	Illumina GAIIx	4	102508878		Missense_Mutation	SNP	HMMPfam_Xlink;HMMPfam_Fasciclin;HMMPfam_EGF;HMMPfam_EGF_alliinase;superfamily_Mannose 6-phosphate receptor domain;superfamily_Growth factor receptor domain;HMMPfam_EGF_2;superfamily_C-type lectin-like;superfamily_EGF/Laminin;superfamily_FAS1 domain	p.V52D	ENST00000388887.2	37	c.155	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	T	12.55	1.970357	0.34754	.	.	ENSG00000136011	ENST00000388887	T	0.29142	1.58	6.02	2.38	0.29361	.	0.456644	0.21120	N	0.079835	T	0.18087	0.0434	L	0.29908	0.895	0.09310	N	0.999996	B	0.33000	0.393	B	0.31614	0.133	T	0.13176	-1.0519	10	0.36615	T	0.2	.	4.825	0.13412	0.1376:0.1493:0.0:0.7131	.	52	Q8WWQ8	STAB2_HUMAN	D	52	ENSP00000373539:V52D	ENSP00000373539:V52D	V	+	2	0	STAB2	102508878	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.227000	0.17795	0.168000	0.19655	-0.256000	0.11100	GTC	-	NULL		0.433	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	protein_coding	OTTHUMT00000407089.1	T			102508878	1	no_errors	NM_017564	genbank	human	reviewed	54_36p	missense	SNP	0.02	A
PLCZ1	89869	genome.wustl.edu	37	12	18846006	18846006	+	Intron	SNP	G	G	C	rs577404021		TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr12:18846006G>C	ENST00000538330.1	-	8	1189				PLCZ1_ENST00000539875.1_Intron|PLCZ1_ENST00000266505.7_Intron|PLCZ1_ENST00000447925.2_Intron|PLCZ1_ENST00000541695.1_Intron|PLCZ1_ENST00000435379.1_Intron|PLCZ1_ENST00000534932.1_Intron					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					AAGATCAAAAGTGGATGATCT	0.398																																																0			12																																								18737273	SO:0001627	intron_variant	643668			AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.807+1837C>G	12.37:g.18846006G>C		Somatic		Capture	Illumina GAIIx	4	18737273		RNA	SNP	-	NULL	ENST00000538330.1	37	NULL		12																																																																																			-	-		0.398	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	LOC643668	protein_coding	OTTHUMT00000401666.3	G	NM_033123		18737273	1	pseudogene	XR_016986	genbank	human	model	54_36p	rna	SNP	1	C
ADAMTS20	80070	genome.wustl.edu	37	12	43847845	43847845	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr12:43847845T>G	ENST00000389420.3	-	12	1624	c.1625A>C	c.(1624-1626)cAt>cCt	p.H542P	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.H542P	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	542	Disintegrin.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.H542P(1)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ACATAGCCCATGACGGCAATG	0.373																																																1	Substitution - Missense(1)	ovary(1)	12											86.0	74.0	78.0					12																	43847845		2203	4300	6503	42134112	SO:0001583	missense	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1625A>C	12.37:g.43847845T>G	ENSP00000374071:p.His542Pro	Somatic		Capture	Illumina GAIIx	4	42134112	A6NNC9|J3QT00	Missense_Mutation	SNP	"superfamily_Metalloproteases (""zincins"") catalytic domain;superfamily_TSP-1 type 1 repeat;TSP_1;HMMPfam_TSP_1;Reprolysin;HMMPfam_Reprolysin;Pep_M12B_propep;HMMPfam_Pep_M12B_propep;ADAM_spacer1;HMMPfam_ADAM_spacer1;GON;HMMPfam_GON"	p.H542P	ENST00000389420.3	37	c.1625	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	T	11.29	1.595812	0.28445	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.61040	0.31;0.14	4.75	-1.93	0.07594	.	0.687962	0.12996	N	0.422064	T	0.51109	0.1655	M	0.66939	2.045	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.40646	-0.9552	10	0.39692	T	0.17	.	10.6886	0.45858	0.0:0.357:0.0:0.643	.	542	P59510	ATS20_HUMAN	P	542	ENSP00000374071:H542P;ENSP00000448341:H542P	ENSP00000374068:H542P	H	-	2	0	ADAMTS20	42134112	1.000000	0.71417	0.538000	0.28064	0.707000	0.40811	1.509000	0.35780	-0.431000	0.07307	-1.140000	0.01884	CAT	-	NULL		0.373	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	protein_coding	OTTHUMT00000403643.1	T	NM_025003		42134112	-1	no_errors	NM_025003	genbank	human	validated	54_36p	missense	SNP	1	G
ACACB	32	genome.wustl.edu	37	12	109660344	109660344	+	Silent	SNP	G	G	A	rs148241794	byFrequency	TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr12:109660344G>A	ENST00000338432.7	+	25	3716	c.3597G>A	c.(3595-3597)tcG>tcA	p.S1199S	ACACB_ENST00000377854.5_Silent_p.S1129S|ACACB_ENST00000377848.3_Silent_p.S1199S			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1199					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.S1199S(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CTTCCCTGTCGGACGAGCTGA	0.577													g|||	6	0.00119808	0.0045	0.0	5008	,	,		18267	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	12						A		5,4401	8.1+/-20.4	0,5,2198	98.0	93.0	95.0		3597	-10.3	0.0	12	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ACACB	NM_001093.3		0,6,6497	AA,AG,GG		0.0116,0.1135,0.0461		1199/2459	109660344	6,13000	2203	4300	6503	108144727	SO:0001819	synonymous_variant	32			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.3597G>A	12.37:g.109660344G>A		Somatic		Capture	Illumina GAIIx	4	108144727	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	HMMPfam_Carboxyl_trans;HMMPfam_Biotin_lipoyl;HMMPfam_CPSase_L_D2;HMMPfam_CPSase_L_chain;HMMPfam_Biotin_carb_C;superfamily_Single hybrid motif;superfamily_Rudiment single hybrid motif;HMMPfam_ACC_central;superfamily_ClpP/crotonase;superfamily_PreATP-grasp domain;superfamily_Glutathione synthetase ATP-binding domain-like	p.S1199	ENST00000338432.7	37	c.3597	CCDS31898.1	12																																																																																			-	HMMPfam_ACC_central		0.577	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	protein_coding	OTTHUMT00000403077.1	G	NM_001093		108144727	1	no_errors	NM_001093	genbank	human	reviewed	54_36p	silent	SNP	0.29	A
BRCA2	675	genome.wustl.edu	37	13	32912178	32912178	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr13:32912178delT	ENST00000380152.3	+	11	3919	c.3686delT	c.(3685-3687)gttfs	p.V1229fs	BRCA2_ENST00000544455.1_Frame_Shift_Del_p.V1229fs			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1229					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.S1230fs*9(1)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AAACTGAATGTTTCTACTGAA	0.353			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	1	Deletion - Frameshift(1)	ovary(1)	13											55.0	57.0	57.0					13																	32912178		2203	4299	6502	31810178	SO:0001589	frameshift_variant	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.3686delT	13.37:g.32912178delT	ENSP00000369497:p.Val1229fs	Somatic		Capture	Illumina GAIIx	4	31810178	O00183|O15008|Q13879|Q5TBJ7	Frame_Shift_Del	DEL	superfamily_Nucleic acid-binding proteins;superfamily_BRCA2 helical domain;superfamily_BRCA2 tower domain;BRCA2;HMMPfam_BRCA2;BRCA-2_OB1;HMMPfam_BRCA-2_OB1;BRCA-2_OB3;HMMPfam_BRCA-2_OB3;Tower;HMMPfam_Tower;BRCA-2_helical;HMMPfam_BRCA-2_helical	p.S1230fs	ENST00000380152.3	37	c.3686	CCDS9344.1	13																																																																																			(deletion:cds_exon[31808402;31813333])	HMMPfam_BRCA2		0.353	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	protein_coding	OTTHUMT00000046000.2	T	NM_000059		31810178	1	no_errors	NM_000059	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.94	-
ZBTB1	22890	genome.wustl.edu	37	14	64990179	64990179	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr14:64990179A>T	ENST00000554015.1	+	4	2388	c.1957A>T	c.(1957-1959)Atg>Ttg	p.M653L	ZBTB1_ENST00000358738.3_Intron|RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000394712.2_Missense_Mutation_p.M653L			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	653					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		TGTACGGCATATGATTTCTCA	0.418																																																0			14											194.0	148.0	162.0					14																	64990179		692	1591	2283	64059932	SO:0001583	missense	22890			AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.1957A>T	14.37:g.64990179A>T	ENSP00000451000:p.Met653Leu	Somatic		Capture	Illumina GAIIx	4	64059932	A8K6S8|Q86SW8	Missense_Mutation	SNP	-	p.M653L	ENST00000554015.1	37	c.1957	CCDS45126.1	14	.	.	.	.	.	.	.	.	.	.	A	16.87	3.243060	0.58995	.	.	ENSG00000126804	ENST00000554015;ENST00000394712	T;T	0.27256	1.68;1.68	5.47	5.47	0.80525	Zinc finger, C2H2-like (1);	228.480000	0.01240	U	0.008588	T	0.38558	0.1045	N	0.25647	0.755	0.53688	D	0.999974	P	0.39940	0.696	P	0.51170	0.661	T	0.01283	-1.1396	9	.	.	.	-11.9639	15.6149	0.76756	1.0:0.0:0.0:0.0	.	653	Q9Y2K1	ZBTB1_HUMAN	L	653	ENSP00000451000:M653L;ENSP00000378201:M653L	.	M	+	1	0	ZBTB1	64059932	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.919000	0.92770	2.091000	0.63221	0.529000	0.55759	ATG	-	NULL		0.418	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB1	protein_coding	OTTHUMT00000411912.1	A			64059932	1	no_errors	ENST00000394712	ensembl	human	known	54_36p	missense	SNP	1	T
PRC1	9055	genome.wustl.edu	37	15	91517424	91517424	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr15:91517424G>C	ENST00000361188.5	-	11	2614	c.1403C>G	c.(1402-1404)cCt>cGt	p.P468R	PRC1_ENST00000442656.2_Missense_Mutation_p.P427R|PRC1-AS1_ENST00000554388.1_RNA|PRC1-AS1_ENST00000556200.1_RNA|PRC1_ENST00000394249.3_Missense_Mutation_p.P468R|PRC1_ENST00000361919.3_Missense_Mutation_p.P468R					protein regulator of cytokinesis 1									p.P468R(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					AGGTGTTCGAGGAGCGCTGCC	0.498																																																1	Substitution - Missense(1)	ovary(1)	15											201.0	170.0	180.0					15																	91517424		2198	4298	6496	89318428	SO:0001583	missense	9055			AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.1403C>G	15.37:g.91517424G>C	ENSP00000354679:p.Pro468Arg	Somatic		Capture	Illumina GAIIx	4	89318428		Missense_Mutation	SNP	HMMPfam_MAP65_ASE1	p.P468R	ENST00000361188.5	37	c.1403	CCDS45352.1	15	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820835	0.71028	.	.	ENSG00000198901	ENST00000394249;ENST00000361919;ENST00000361188;ENST00000555455;ENST00000442656	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	5.37	5.37	0.77165	.	0.293466	0.39146	N	0.001451	T	0.54967	0.1891	M	0.71581	2.175	0.40269	D	0.978263	D;D;D;D	0.56035	0.967;0.967;0.967;0.974	P;P;P;D	0.64877	0.884;0.884;0.884;0.93	T	0.52223	-0.8604	10	0.44086	T	0.13	-9.2179	18.9064	0.92464	0.0:0.0:1.0:0.0	.	427;468;438;468	O43663-3;F8W9B5;O43663-2;O43663	.;.;.;PRC1_HUMAN	R	468;468;468;71;427	ENSP00000377793:P468R;ENSP00000354618:P468R;ENSP00000354679:P468R;ENSP00000409549:P427R	ENSP00000354679:P468R	P	-	2	0	PRC1	89318428	1.000000	0.71417	0.781000	0.31783	0.590000	0.36582	6.445000	0.73456	2.788000	0.95919	0.650000	0.86243	CCT	-	HMMPfam_MAP65_ASE1		0.498	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRC1	protein_coding	OTTHUMT00000414760.1	G	NM_003981		89318428	-1	no_errors	NM_003981	genbank	human	reviewed	54_36p	missense	SNP	0.15	C
SYT17	51760	genome.wustl.edu	37	16	19195086	19195086	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr16:19195086T>G	ENST00000355377.2	+	5	966	c.568T>G	c.(568-570)Ttc>Gtc	p.F190V	SYT17_ENST00000562711.2_Missense_Mutation_p.F186V|SYT17_ENST00000568115.1_Missense_Mutation_p.F129V|SYT17_ENST00000562034.1_Missense_Mutation_p.F129V	NM_016524.2	NP_057608.2	Q9BSW7	SYT17_HUMAN	synaptotagmin XVII	190	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)	membrane (GO:0016020)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)	p.F190V(1)		NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	17						CATGCTGCACTTCAGCACTCA	0.612																																																1	Substitution - Missense(1)	ovary(1)	16											118.0	96.0	104.0					16																	19195086		2197	4300	6497	19102587	SO:0001583	missense	51760				CCDS10575.1	16p12.3	2013-01-21			ENSG00000103528	ENSG00000103528		"""Synaptotagmins"""	24119	protein-coding gene	gene with protein product	"""B/K protein"""					10493829	Standard	NM_016524		Approved		uc002dfw.3	Q9BSW7	OTTHUMG00000131461	ENST00000355377.2:c.568T>G	16.37:g.19195086T>G	ENSP00000347538:p.Phe190Val	Somatic		Capture	Illumina GAIIx	4	19102587	O43330|Q9NZ18	Missense_Mutation	SNP	-	p.F190V	ENST00000355377.2	37	c.568	CCDS10575.1	16	.	.	.	.	.	.	.	.	.	.	t	23.9	4.470135	0.84533	.	.	ENSG00000103528	ENST00000355377	T	0.08008	3.14	5.38	5.38	0.77491	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000001	T	0.18635	0.0447	L	0.35249	1.045	0.80722	D	1	P;D	0.54207	0.913;0.965	P;D	0.63597	0.864;0.916	T	0.00738	-1.1587	10	0.87932	D	0	.	15.3867	0.74706	0.0:0.0:0.0:1.0	.	190;129	Q9BSW7;B4DJB2	SYT17_HUMAN;.	V	190	ENSP00000347538:F190V	ENSP00000347538:F190V	F	+	1	0	SYT17	19102587	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.994000	0.88315	2.026000	0.59711	0.375000	0.23000	TTC	-	NULL		0.612	SYT17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT17	protein_coding	OTTHUMT00000254286.2	T	NM_016524		19102587	1	no_errors	NM_016524	genbank	human	validated	54_36p	missense	SNP	1	G
ATP2A1	487	genome.wustl.edu	37	16	28905521	28905521	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr16:28905521G>A	ENST00000357084.3	+	10	1408	c.1141G>A	c.(1141-1143)Gag>Aag	p.E381K	ATP2A1_ENST00000536376.1_Missense_Mutation_p.E256K|ATP2A1_ENST00000395503.4_Missense_Mutation_p.E381K|ATP2A1_ENST00000565042.1_3'UTR	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	381	Interacts with phospholamban 1. {ECO:0000250}.				apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)	p.E381K(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						CCTCCTGAATGAGTTCTCCAT	0.572																																																1	Substitution - Missense(1)	ovary(1)	16											141.0	103.0	116.0					16																	28905521		2197	4300	6497	28813022	SO:0001583	missense	487				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.1141G>A	16.37:g.28905521G>A	ENSP00000349595:p.Glu381Lys	Somatic		Capture	Illumina GAIIx	4	28813022	A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	HMMPfam_Cation_ATPase_N;HMMPfam_Hydrolase;HMMPfam_Cation_ATPase_C;HMMPfam_E1-E2_ATPase;superfamily_HAD-like;superfamily_Calcium ATPase transduction domain A;superfamily_Metal cation-transporting ATPase ATP-binding domain N;superfamily_Calcium ATPase transmembrane domain M	p.E381K	ENST00000357084.3	37	c.1141	CCDS10643.1	16	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972872	0.53614	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.82984	-1.67;-1.67;-1.67	4.87	3.92	0.45320	ATPase, cation-transporting, domain N (1);ATPase, P-type, cytoplasmic domain N (1);	7.195860	0.00166	N	0.000013	D	0.82838	0.5124	L	0.51914	1.62	0.35032	D	0.758929	B;B;B	0.12630	0.002;0.006;0.001	B;B;B	0.18263	0.004;0.021;0.007	T	0.64462	-0.6402	10	0.62326	D	0.03	.	12.1791	0.54202	0.0858:0.0:0.9142:0.0	.	256;381;381	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	K	381;381;418;256	ENSP00000349595:E381K;ENSP00000378879:E381K;ENSP00000443101:E256K	ENSP00000349595:E381K	E	+	1	0	ATP2A1	28813022	1.000000	0.71417	0.931000	0.37212	0.669000	0.39330	4.502000	0.60400	1.067000	0.40740	0.501000	0.49751	GAG	-	NULL		0.572	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	ATP2A1	protein_coding	OTTHUMT00000254686.2	G	NM_004320		28813022	1	no_errors	NM_173201	genbank	human	reviewed	54_36p	missense	SNP	0.98	A
TSR1	55720	genome.wustl.edu	37	17	2236408	2236408	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr17:2236408C>G	ENST00000301364.5	-	7	2231	c.1152G>C	c.(1150-1152)aaG>aaC	p.K384N	SNORD91A_ENST00000390861.1_RNA	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	384					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.K384N(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						TAGAACTTTCCTTCAAGAAAT	0.438																																																1	Substitution - Missense(1)	ovary(1)	17											77.0	73.0	75.0					17																	2236408		2203	4300	6503	2183158	SO:0001583	missense	55720			AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.1152G>C	17.37:g.2236408C>G	ENSP00000301364:p.Lys384Asn	Somatic		Capture	Illumina GAIIx	4	2183158	Q8WUY5|Q9NVT0|Q9P2E6	Missense_Mutation	SNP	-	p.K384N	ENST00000301364.5	37	c.1152	CCDS32525.1	17	.	.	.	.	.	.	.	.	.	.	C	16.34	3.096971	0.56075	.	.	ENSG00000167721	ENST00000301364	T	0.12774	2.65	5.16	5.16	0.70880	.	0.128017	0.53938	D	0.000053	T	0.12475	0.0303	L	0.47016	1.485	0.80722	D	1	B	0.10296	0.003	B	0.14023	0.01	T	0.06917	-1.0800	10	0.27785	T	0.31	-7.9415	9.5072	0.39053	0.0:0.8407:0.0:0.1593	.	384	Q2NL82	TSR1_HUMAN	N	384	ENSP00000301364:K384N	ENSP00000301364:K384N	K	-	3	2	TSR1	2183158	0.772000	0.28567	1.000000	0.80357	0.962000	0.63368	1.157000	0.31724	2.688000	0.91661	0.650000	0.86243	AAG	-	NULL		0.438	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TSR1	protein_coding	OTTHUMT00000438180.2	C	NM_018128		2183158	-1	no_errors	NM_018128	genbank	human	validated	54_36p	missense	SNP	0.97	G
TP53	7157	genome.wustl.edu	37	17	7578555	7578555	+	Splice_Site	SNP	C	C	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr17:7578555C>A	ENST00000269305.4	-	5	565		c.e5-1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(39)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGGGAGTACTGTAGGAAGA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Unknown(39)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	ovary(9)|pancreas(6)|bone(5)|upper_aerodigestive_tract(4)|liver(4)|lung(4)|breast(4)|large_intestine(3)|central_nervous_system(3)|oesophagus(3)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|endometrium(1)|urinary_tract(1)|autonomic_ganglia(1)	17											42.0	42.0	42.0					17																	7578555		2203	4300	6503	7519280	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-1G>T	17.37:g.7578555C>A		Somatic		Capture	Illumina GAIIx	4	7519280	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e4-1	ENST00000269305.4	37	c.376-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	17.36	3.370877	0.61624	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	.	.	.	4.87	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4246	0.50003	0.0:0.9094:0.0:0.0906	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519280	1.000000	0.71417	0.999000	0.59377	0.918000	0.54935	7.639000	0.83342	1.359000	0.45940	0.655000	0.94253	.	-	-		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Intron	7519280	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
ARHGEF15	22899	genome.wustl.edu	37	17	8222704	8222704	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr17:8222704A>G	ENST00000361926.3	+	14	2371	c.2261A>G	c.(2260-2262)gAg>gGg	p.E754G	AC135178.7_ENST00000458568.1_RNA|ARHGEF15_ENST00000421050.1_Missense_Mutation_p.E754G	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	754					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E754G(1)		breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						ACCATCTATGAGGACTGTGGT	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											81.0	90.0	87.0					17																	8222704		2203	4300	6503	8163429	SO:0001583	missense	22899			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.2261A>G	17.37:g.8222704A>G	ENSP00000355026:p.Glu754Gly	Somatic		Capture	Illumina GAIIx	4	8163429	A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	HMMPfam_RhoGEF;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like	p.E754G	ENST00000361926.3	37	c.2261	CCDS11139.1	17	.	.	.	.	.	.	.	.	.	.	a	21.3	4.128069	0.77549	.	.	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	T;T	0.73575	-0.76;-0.76	5.48	5.48	0.80851	.	0.150554	0.64402	D	0.000018	T	0.81327	0.4799	L	0.58428	1.81	0.50039	D	0.999844	D;D	0.67145	0.996;0.996	P;P	0.60415	0.874;0.874	T	0.82995	-0.0180	10	0.66056	D	0.02	-25.2177	13.5563	0.61761	1.0:0.0:0.0:0.0	.	754;754	D3DTR7;O94989	.;ARHGF_HUMAN	G	754;544;754	ENSP00000355026:E754G;ENSP00000412505:E754G	ENSP00000355026:E754G	E	+	2	0	ARHGEF15	8163429	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	6.382000	0.73167	2.297000	0.77311	0.533000	0.62120	GAG	-	NULL		0.542	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	protein_coding	OTTHUMT00000226993.2	A	NM_173728		8163429	1	no_errors	NM_173728	genbank	human	reviewed	54_36p	missense	SNP	1	G
AKAP1	8165	genome.wustl.edu	37	17	55194232	55194232	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr17:55194232T>A	ENST00000337714.3	+	8	2677	c.2444T>A	c.(2443-2445)gTc>gAc	p.V815D	AKAP1_ENST00000539273.1_Missense_Mutation_p.V815D|AKAP1_ENST00000571629.1_Missense_Mutation_p.V815D|AKAP1_ENST00000572557.1_Missense_Mutation_p.V815D	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	815	Tudor. {ECO:0000255|PROSITE- ProRule:PRU00211}.				blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V815D(1)		endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					TCTGACTTTGTCACCCTGCCG	0.517																																																1	Substitution - Missense(1)	ovary(1)	17											204.0	184.0	191.0					17																	55194232		2203	4300	6503	52549231	SO:0001583	missense	8165			X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.2444T>A	17.37:g.55194232T>A	ENSP00000337736:p.Val815Asp	Somatic		Capture	Illumina GAIIx	4	52549231	A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	HMMPfam_KH_1;HMMPfam_TUDOR;superfamily_Eukaryotic type KH-domain (KH-domain type I);superfamily_Tudor/PWWP/MBT	p.V815D	ENST00000337714.3	37	c.2444	CCDS11594.1	17	.	.	.	.	.	.	.	.	.	.	T	25.9	4.687368	0.88639	.	.	ENSG00000121057	ENST00000337714;ENST00000427138;ENST00000539273	T;T	0.08896	3.04;3.04	5.27	5.27	0.74061	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.000000	0.85682	D	0.000000	T	0.24661	0.0598	L	0.55834	1.745	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00512	-1.1696	10	0.87932	D	0	-21.4299	14.374	0.66860	0.0:0.0:0.0:1.0	.	815	Q92667	AKAP1_HUMAN	D	815;857;815	ENSP00000337736:V815D;ENSP00000443139:V815D	ENSP00000337736:V815D	V	+	2	0	AKAP1	52549231	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.361000	0.79497	1.982000	0.57802	0.459000	0.35465	GTC	-	HMMPfam_TUDOR		0.517	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP1	protein_coding	OTTHUMT00000277069.1	T			52549231	1	no_errors	NM_003488	genbank	human	reviewed	54_36p	missense	SNP	1	A
HRH4	59340	genome.wustl.edu	37	18	22057426	22057426	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr18:22057426A>T	ENST00000256906.4	+	3	1173	c.1073A>T	c.(1072-1074)tAt>tTt	p.Y358F	HRH4_ENST00000426880.2_Missense_Mutation_p.Y270F	NM_001160166.1|NM_021624.3	NP_001153638.1|NP_067637.2	Q9H3N8	HRH4_HUMAN	histamine receptor H4	358					inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of MAPK cascade (GO:0043408)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)	p.Y358F(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Amitriptyline(DB00321)|Amoxapine(DB00543)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Mianserin(DB06148)|Olanzapine(DB00334)	CCTCTTTTGTATCCATTGTGT	0.363																																																1	Substitution - Missense(1)	ovary(1)	18											155.0	159.0	157.0					18																	22057426		2203	4300	6503	20311424	SO:0001583	missense	59340			AF312230	CCDS11887.1, CCDS45841.1	18q11.2	2012-08-08			ENSG00000134489	ENSG00000134489		"""GPCR / Class A : Histamine receptors"""	17383	protein-coding gene	gene with protein product		606792				11118334, 10973974	Standard	NM_021624		Approved	H4R, HH4R, AXOR35, GPCR105, GPRv53	uc002kvi.3	Q9H3N8	OTTHUMG00000131945	ENST00000256906.4:c.1073A>T	18.37:g.22057426A>T	ENSP00000256906:p.Tyr358Phe	Somatic		Capture	Illumina GAIIx	4	20311424	B0YJ19|B2KJ48|Q4G0I6|Q9GZQ0	Missense_Mutation	SNP	-	p.Y358F	ENST00000256906.4	37	c.1073	CCDS11887.1	18	.	.	.	.	.	.	.	.	.	.	A	27.3	4.816913	0.90790	.	.	ENSG00000134489	ENST00000256906;ENST00000426880	D;D	0.92911	-3.13;-3.13	5.78	5.78	0.91487	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.97065	0.9041	M	0.93375	3.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.98;1.0	D	0.98025	1.0373	10	0.87932	D	0	-19.3937	15.3026	0.73966	1.0:0.0:0.0:0.0	.	270;358	B2KJ48;Q9H3N8	.;HRH4_HUMAN	F	358;270	ENSP00000256906:Y358F;ENSP00000402526:Y270F	ENSP00000256906:Y358F	Y	+	2	0	HRH4	20311424	1.000000	0.71417	0.904000	0.35570	0.751000	0.42716	9.181000	0.94874	2.208000	0.71279	0.528000	0.53228	TAT	-	NULL		0.363	HRH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH4	protein_coding	OTTHUMT00000254904.1	A			20311424	1	no_errors	NM_021624	genbank	human	reviewed	54_36p	missense	SNP	1	T
KIAA1468	57614	genome.wustl.edu	37	18	59894532	59894532	+	Nonsense_Mutation	SNP	T	T	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr18:59894532T>G	ENST00000398130.2	+	6	1101	c.869T>G	c.(868-870)tTa>tGa	p.L290*	KIAA1468_ENST00000256858.6_Nonsense_Mutation_p.L290*	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	290								p.L290*(1)		autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				GATTTTGAATTATGGGATGAT	0.269																																																1	Substitution - Nonsense(1)	ovary(1)	18											42.0	38.0	39.0					18																	59894532		1788	4057	5845	58045512	SO:0001587	stop_gained	57614			BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.869T>G	18.37:g.59894532T>G	ENSP00000381198:p.Leu290*	Somatic		Capture	Illumina GAIIx	4	58045512		Nonsense_Mutation	SNP	-	p.L290*	ENST00000398130.2	37	c.869	CCDS11979.2	18	.	.	.	.	.	.	.	.	.	.	T	39	7.695832	0.98438	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	.	.	.	5.85	5.85	0.93711	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.6607	16.2444	0.82434	0.0:0.0:0.0:1.0	.	.	.	.	X	290	.	.	L	+	2	0	KIAA1468	58045512	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.839000	0.86812	2.233000	0.73108	0.455000	0.32223	TTA	-	NULL		0.269	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1468	protein_coding	OTTHUMT00000256187.1	T	NM_020854		58045512	1	no_errors	NM_020854	genbank	human	validated	54_36p	nonsense	SNP	1	G
ZNF429	353088	genome.wustl.edu	37	19	21713460	21713460	+	Missense_Mutation	SNP	G	G	C	rs376763417		TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr19:21713460G>C	ENST00000358491.4	+	3	408	c.200G>C	c.(199-201)cGa>cCa	p.R67P	ZNF429_ENST00000597078.1_Missense_Mutation_p.R67P|ZNF429_ENST00000594022.1_3'UTR	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	67	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R67P(1)		endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						AAGATGAAGCGACATGAAATG	0.408																																																1	Substitution - Missense(1)	ovary(1)	19											67.0	75.0	73.0					19																	21713460		2184	4297	6481	21505300	SO:0001583	missense	353088			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.200G>C	19.37:g.21713460G>C	ENSP00000351280:p.Arg67Pro	Somatic		Capture	Illumina GAIIx	4	21505300	A6NLV7|Q9BZE6	Missense_Mutation	SNP	-	p.R67P	ENST00000358491.4	37	c.200	CCDS42537.1	19	.	.	.	.	.	.	.	.	.	.	.	12.83	2.055846	0.36277	.	.	ENSG00000197013	ENST00000358491	T	0.07908	3.15	0.235	0.235	0.15431	Krueppel-associated box (1);	.	.	.	.	T	0.21145	0.0509	M	0.75884	2.315	0.24844	N	0.992442	D	0.76494	0.999	D	0.66084	0.941	T	0.06338	-1.0832	9	0.46703	T	0.11	.	6.2532	0.20859	3.0E-4:0.0:0.9997:0.0	.	67	Q86V71	ZN429_HUMAN	P	67	ENSP00000351280:R67P	ENSP00000351280:R67P	R	+	2	0	ZNF429	21505300	0.006000	0.16342	0.028000	0.17463	0.028000	0.11728	1.422000	0.34826	0.308000	0.22923	0.313000	0.20887	CGA	-	NULL		0.408	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF429	protein_coding	OTTHUMT00000463981.1	G	NM_001001415		21505300	1	no_errors	NM_001001415	genbank	human	provisional	54_36p	missense	SNP		C
ZNF285B	147711	genome.wustl.edu	37	19	44976792	44976792	+	lincRNA	SNP	A	A	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr19:44976792A>C	ENST00000591684.1	-	0	1518																											AAGCCCTATAAAAGTGAAGAG	0.478																																																0			19																																								49668632			147711																															19.37:g.44976792A>C		Somatic		Capture	Illumina GAIIx	4	49668632		RNA	SNP	-	NULL	ENST00000591684.1	37	NULL		19																																																																																			-	-		0.478	AC069278.4-001	KNOWN	basic	lincRNA	ZNF285B	lincRNA	OTTHUMT00000451599.1	A			49668632	1	pseudogene	XR_016906	genbank	human	model	54_36p	rna	SNP	0.01	C
SIX5	147912	genome.wustl.edu	37	19	46271385	46271385	+	Silent	SNP	G	G	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr19:46271385G>A	ENST00000317578.6	-	1	1099	c.718C>T	c.(718-720)Ctg>Ttg	p.L240L	AC074212.6_ENST00000590076.1_RNA|AC074212.6_ENST00000586251.1_RNA|SIX5_ENST00000560168.1_Intron|AC074212.6_ENST00000586498.1_RNA|AC074212.5_ENST00000592217.2_RNA|AC074212.5_ENST00000559756.1_RNA|AC074212.6_ENST00000591530.1_RNA	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5	240					lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.L240L(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		GTGAGCGACAGGCCGGTGAGT	0.721																																																1	Substitution - coding silent(1)	ovary(1)	19											18.0	21.0	20.0					19																	46271385		2199	4295	6494	50963225	SO:0001819	synonymous_variant	147912			L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196		ENST00000317578.6:c.718C>T	19.37:g.46271385G>A		Somatic		Capture	Illumina GAIIx	4	50963225		Silent	SNP	HMMPfam_Homeobox;superfamily_Homeodomain-like	p.L240	ENST00000317578.6	37	c.718	CCDS12673.1	19																																																																																			-	HMMPfam_Homeobox		0.721	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX5	protein_coding	OTTHUMT00000417341.3	G	NM_175875		50963225	-1	no_errors	NM_175875	genbank	human	validated	54_36p	silent	SNP	1	A
BOLL	66037	genome.wustl.edu	37	2	198631309	198631309	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr2:198631309A>C	ENST00000392296.4	-	7	808	c.499T>G	c.(499-501)Tcc>Gcc	p.S167A	AC011997.1_ENST00000409845.1_Intron|BOLL_ENST00000321801.7_Missense_Mutation_p.S179A|BOLL_ENST00000433157.1_Missense_Mutation_p.S167A|BOLL_ENST00000430004.1_Missense_Mutation_p.S167A|BOLL_ENST00000282278.8_Missense_Mutation_p.S58A	NM_033030.5	NP_149019.1	Q8N9W6	BOLL_HUMAN	boule-like RNA-binding protein	167	DAZ-like.				cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)	p.S167A(1)		central_nervous_system(1)|endometrium(2)|lung(6)|ovary(3)|prostate(1)	13						ATCACAGGGGAGCTACATACA	0.338																																																1	Substitution - Missense(1)	ovary(1)	2											69.0	73.0	71.0					2																	198631309		2203	4300	6503	198339554	SO:0001583	missense	66037				CCDS2324.1, CCDS2325.1, CCDS63081.1	2q33	2013-10-17	2013-10-17		ENSG00000152430	ENSG00000152430		"""RNA binding motif (RRM) containing"""	14273	protein-coding gene	gene with protein product		606165	"""bol (Drosophila boule homolog)-like"", ""bol, boule-like (Drosophila)"""			11390979, 16001084	Standard	NM_197970		Approved	BOULE	uc002uut.2	Q8N9W6	OTTHUMG00000132747	ENST00000392296.4:c.499T>G	2.37:g.198631309A>C	ENSP00000376116:p.Ser167Ala	Somatic		Capture	Illumina GAIIx	4	198339554	B4DZA4|Q0JW32|Q53T62|Q969U3	Missense_Mutation	SNP	-	p.S179A	ENST00000392296.4	37	c.535	CCDS2325.1	2	.	.	.	.	.	.	.	.	.	.	A	17.39	3.377246	0.61735	.	.	ENSG00000152430	ENST00000430004;ENST00000392296;ENST00000321801;ENST00000282278;ENST00000433157	T;T;T;T	0.29655	1.56;1.78;1.77;1.78	4.63	4.63	0.57726	.	0.091045	0.46145	D	0.000315	T	0.39759	0.1090	N	0.24115	0.695	0.31207	N	0.699138	D;P;D;B;B	0.64830	0.99;0.785;0.994;0.307;0.074	D;P;D;B;B	0.72982	0.979;0.488;0.923;0.116;0.029	T	0.44907	-0.9297	10	0.87932	D	0	-19.7686	12.4045	0.55432	1.0:0.0:0.0:0.0	.	58;173;179;167;173	B4DZA4;Q8N9W6-2;Q8N9W6-3;Q8N9W6;Q8N9W6-4	.;.;.;BOLL_HUMAN;.	A	167;167;179;58;167	ENSP00000397711:S167A;ENSP00000376116:S167A;ENSP00000314792:S179A;ENSP00000396099:S167A	ENSP00000282278:S58A	S	-	1	0	BOLL	198339554	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.848000	0.55903	1.948000	0.56530	0.482000	0.46254	TCC	-	NULL		0.338	BOLL-001	KNOWN	basic|CCDS	protein_coding	BOLL	protein_coding	OTTHUMT00000256107.3	A	NM_033030		198339554	-1	no_errors	NM_197970	genbank	human	validated	54_36p	missense	SNP	1	C
IFT172	26160	genome.wustl.edu	37	2	27708306	27708306	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr2:27708306G>A	ENST00000260570.3	-	2	207	c.104C>T	c.(103-105)aCa>aTa	p.T35I	IFT172_ENST00000416524.2_Missense_Mutation_p.T14I|IFT172_ENST00000359466.6_Missense_Mutation_p.T35I	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	35					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)		p.T35I(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					TCGGTCCACTGTGCAGACAGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	2											183.0	163.0	170.0					2																	27708306		2203	4300	6503	27561810	SO:0001583	missense	26160			AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.104C>T	2.37:g.27708306G>A	ENSP00000260570:p.Thr35Ile	Somatic		Capture	Illumina GAIIx	4	27561810	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	-	p.T35I	ENST00000260570.3	37	c.104	CCDS1755.1	2	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027713	0.93518	.	.	ENSG00000138002	ENST00000260570;ENST00000359466;ENST00000416524	T;T;T	0.67345	-0.26;-0.26;1.52	5.73	5.73	0.89815	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85008	0.5599	M	0.88105	2.93	0.80722	D	1	D;D;D;D;D	0.76494	0.992;0.998;0.998;0.998;0.999	P;D;D;D;D	0.75020	0.876;0.985;0.975;0.985;0.984	D	0.87282	0.2293	10	0.87932	D	0	-5.6046	18.4654	0.90752	0.0:0.0:1.0:0.0	.	35;35;35;35;35	B4E3C1;A5PKZ0;Q9UG01-2;E7EP25;Q9UG01	.;.;.;.;IF172_HUMAN	I	35;35;14	ENSP00000260570:T35I;ENSP00000352443:T35I;ENSP00000407408:T14I	ENSP00000260570:T35I	T	-	2	0	IFT172	27561810	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	6.816000	0.75247	2.707000	0.92482	0.557000	0.71058	ACA	-	NULL		0.473	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT172	protein_coding	OTTHUMT00000250213.2	G	NM_015662		27561810	-1	no_errors	NM_015662	genbank	human	validated	54_36p	missense	SNP	1	A
MPHOSPH10	10199	genome.wustl.edu	37	2	71377105	71377105	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr2:71377105A>G	ENST00000244230.2	+	11	2358	c.2006A>G	c.(2005-2007)aAg>aGg	p.K669R		NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	669	Poly-Lys.				negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)	p.K669R(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						AAGAAAAAGAAGAAAAGACAG	0.264																																																1	Substitution - Missense(1)	ovary(1)	2											46.0	46.0	46.0					2																	71377105		2198	4294	6492	71230613	SO:0001583	missense	10199			X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.2006A>G	2.37:g.71377105A>G	ENSP00000244230:p.Lys669Arg	Somatic		Capture	Illumina GAIIx	4	71230613	A0AVJ8	Missense_Mutation	SNP	-	p.K669R	ENST00000244230.2	37	c.2006	CCDS1916.1	2	.	.	.	.	.	.	.	.	.	.	A	21.2	4.112713	0.77210	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.22945	2.62;1.93	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.28234	0.0697	L	0.54323	1.7	0.58432	D	0.999999	P	0.48503	0.911	B	0.42282	0.382	T	0.02975	-1.1087	10	0.44086	T	0.13	.	14.2033	0.65719	1.0:0.0:0.0:0.0	.	669	O00566	MPP10_HUMAN	R	669;529	ENSP00000244230:K669R;ENSP00000393034:K529R	ENSP00000244230:K669R	K	+	2	0	MPHOSPH10	71230613	1.000000	0.71417	0.996000	0.52242	0.974000	0.67602	5.465000	0.66725	2.306000	0.77630	0.482000	0.46254	AAG	-	NULL		0.264	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH10	protein_coding	OTTHUMT00000251924.2	A	NM_005791		71230613	1	no_errors	NM_005791	genbank	human	reviewed	54_36p	missense	SNP	1	G
THNSL2	55258	genome.wustl.edu	37	2	88485424	88485424	+	Silent	SNP	C	C	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr2:88485424C>A	ENST00000324166.5	+	8	2928	c.1237C>A	c.(1237-1239)Cgg>Agg	p.R413R	THNSL2_ENST00000343544.4_3'UTR|THNSL2_ENST00000377254.3_Missense_Mutation_p.P362Q|THNSL2_ENST00000449349.1_Silent_p.P238P|THNSL2_ENST00000496844.1_3'UTR|THNSL2_ENST00000358591.2_Silent_p.R413R	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	413					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)	p.R413R(1)		breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						CAGCACTCCCCGGTGCTGCCT	0.617																																																1	Substitution - coding silent(1)	ovary(1)	2											15.0	18.0	17.0					2																	88485424		2116	4238	6354	88266539	SO:0001819	synonymous_variant	55258				CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.1237C>A	2.37:g.88485424C>A		Somatic		Capture	Illumina GAIIx	4	88266539	B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Missense_Mutation	SNP	-	p.P362Q	ENST00000324166.5	37	c.1085	CCDS2002.2	2	.	.	.	.	.	.	.	.	.	.	C	11.72	1.721722	0.30503	.	.	ENSG00000144115	ENST00000377254;ENST00000544063	T	0.12879	2.64	5.98	0.21	0.15231	.	.	.	.	.	T	0.08846	0.0219	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.25187	-1.0139	8	0.23302	T	0.38	.	10.6562	0.45675	0.5571:0.3746:0.0:0.0683	.	204	A8K0C1	.	Q	362;204	ENSP00000366464:P362Q	ENSP00000366464:P362Q	P	+	2	0	THNSL2	88266539	0.984000	0.35163	0.616000	0.29078	0.861000	0.49209	0.465000	0.22004	0.081000	0.16988	0.655000	0.94253	CCG	-	NULL		0.617	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THNSL2	protein_coding	OTTHUMT00000252662.1	C	NM_018271		88266539	1	no_errors	ENST00000377254	ensembl	human	known	54_36p	missense	SNP	0.976	A
Unknown	0	genome.wustl.edu	37	2	210045582	210045582	+	IGR	SNP	A	A	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr2:210045582A>G								RNA5SP117 (260194 upstream) : MAP2 (243199 downstream)																							ACTCCAACAAAATAACTTTGA	0.363																																																0			2																																								209753827	SO:0001628	intergenic_variant	402116																															2.37:g.210045582A>G		Somatic		Capture	Illumina GAIIx	4	209753827		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.363					LOC402116			A			209753827	1	pseudogene	XR_017081	genbank	human	model	54_36p	rna	SNP	1	G
NCOA3	8202	genome.wustl.edu	37	20	46277795	46277795	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr20:46277795C>G	ENST00000371998.3	+	19	3784	c.3593C>G	c.(3592-3594)cCt>cGt	p.P1198R	NCOA3_ENST00000371997.3_Missense_Mutation_p.P1193R|NCOA3_ENST00000372004.3_Missense_Mutation_p.P1198R|NCOA3_ENST00000341724.6_Missense_Mutation_p.P1128R			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1198	Acetyltransferase.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.P1198R(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						ATGGAAAACCCTACTGCTGGT	0.507																																																1	Substitution - Missense(1)	ovary(1)	20											92.0	82.0	86.0					20																	46277795		2203	4300	6503	45711202	SO:0001583	missense	8202			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3593C>G	20.37:g.46277795C>G	ENSP00000361066:p.Pro1198Arg	Somatic		Capture	Illumina GAIIx	4	45711202	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	HMMPfam_HLH;superfamily_Nuclear receptor coactivator interlocking domain;HMMPfam_DUF1518;superfamily_HLH helix-loop-helix DNA-binding domain;HMMPfam_PAS;HMMPfam_Nuc_rec_co-act;HMMPfam_SRC-1;superfamily_PYP-like sensor domain (PAS domain)	p.P1198R	ENST00000371998.3	37	c.3593	CCDS13407.1	20	.	.	.	.	.	.	.	.	.	.	C	15.97	2.988743	0.53934	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.02103	4.45;4.63;4.62;4.45	5.75	5.75	0.90469	.	0.324151	0.30840	N	0.008777	T	0.07052	0.0179	L	0.57536	1.79	0.44807	D	0.997812	B;D;B;B;P;B	0.59357	0.029;0.985;0.048;0.048;0.823;0.107	B;P;B;B;B;B	0.54499	0.01;0.754;0.012;0.012;0.32;0.027	T	0.52975	-0.8503	10	0.15952	T	0.53	-3.4982	17.7164	0.88338	0.0:1.0:0.0:0.0	.	1198;1193;1202;1198;1198;1198	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	R	1198;1128;1198;1198;1193	ENSP00000342123:P1128R;ENSP00000361073:P1198R;ENSP00000361066:P1198R;ENSP00000361065:P1193R	ENSP00000345671:P1198R	P	+	2	0	NCOA3	45711202	0.997000	0.39634	0.020000	0.16555	0.088000	0.18126	6.032000	0.70918	2.716000	0.92895	0.655000	0.94253	CCT	-	NULL		0.507	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	protein_coding	OTTHUMT00000080405.1	C	NM_006534		45711202	1	no_errors	NM_181659	genbank	human	reviewed	54_36p	missense	SNP	0.49	G
AURKA	6790	genome.wustl.edu	37	20	54948523	54948523	+	Silent	SNP	T	T	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr20:54948523T>C	ENST00000347343.2	-	7	1062	c.795A>G	c.(793-795)ggA>ggG	p.G265G	AURKA_ENST00000395911.1_Silent_p.G265G|AURKA_ENST00000395914.1_Silent_p.G265G|AURKA_ENST00000395915.3_Silent_p.G265G|AURKA_ENST00000395909.4_Silent_p.G265G|AURKA_ENST00000371356.2_Silent_p.G265G|AURKA_ENST00000312783.6_Silent_p.G265G|AURKA_ENST00000395913.3_Silent_p.G265G|AURKA_ENST00000395907.1_Silent_p.G265G	NM_003600.2	NP_003591.2	O14965	AURKA_HUMAN	aurora kinase A	265	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|anterior/posterior axis specification (GO:0009948)|centrosome localization (GO:0051642)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|negative regulation of spindle checkpoint (GO:0090233)|neuron projection extension (GO:1990138)|positive regulation of mitosis (GO:0045840)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein autophosphorylation (GO:0046777)|protein localization to centrosome (GO:0071539)|protein phosphorylation (GO:0006468)|regulation of centrosome cycle (GO:0046605)|regulation of protein stability (GO:0031647)|spindle assembly involved in female meiosis I (GO:0007057)|spindle stabilization (GO:0043146)	axon hillock (GO:0043203)|centrosome (GO:0005813)|cytosol (GO:0005829)|germinal vesicle (GO:0042585)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.G265G(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|lung(9)|ovary(2)|prostate(1)|skin(2)	22			Colorectal(105;0.202)			CTCCAGCTGATCCAAGAAGTA	0.388																																					Melanoma(34;439 1292 51416 52695)|GBM(144;1525 2517 48902 51835)|Esophageal Squamous(191;569 2880 14195 30540)											1	Substitution - coding silent(1)	ovary(1)	20											118.0	107.0	111.0					20																	54948523		2203	4300	6503	54381930	SO:0001819	synonymous_variant	6790			BC001280	CCDS13451.1	20q13	2012-07-23	2003-07-21	2003-07-23	ENSG00000087586	ENSG00000087586		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11393	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 47"", ""Aurora-A kinase"""	603072	"""serine/threonine kinase 15"", "" serine/threonine kinase 6"""	STK15, STK6		9174055, 9771714	Standard	NM_003600		Approved	BTAK, AurA, STK7, ARK1, PPP1R47, AIK	uc002xxi.1	O14965	OTTHUMG00000032796	ENST00000347343.2:c.795A>G	20.37:g.54948523T>C		Somatic		Capture	Illumina GAIIx	4	54381930	E1P5F9|O60445|O75873|Q9BQD6|Q9UPG5	Silent	SNP	Pkinase;HMMPfam_Pkinase	p.G265	ENST00000347343.2	37	c.795	CCDS13451.1	20																																																																																			-	HMMPfam_Pkinase		0.388	AURKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AURKA	protein_coding	OTTHUMT00000079804.3	T	NM_003600		54381930	-1	no_errors	NM_003600	genbank	human	reviewed	54_36p	silent	SNP	0.87	C
MYT1	4661	genome.wustl.edu	37	20	62843483	62843483	+	Silent	SNP	G	G	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr20:62843483G>A	ENST00000328439.1	+	9	1873	c.1509G>A	c.(1507-1509)acG>acA	p.T503T	MYT1_ENST00000536311.1_Silent_p.T503T|MYT1_ENST00000360149.4_Silent_p.T205T	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.T503T(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					ACCGCAACACGCACAGAAGGT	0.667																																					GBM(59;481 1041 20555 21139 33705)											1	Substitution - coding silent(1)	ovary(1)	20											107.0	101.0	103.0					20																	62843483		2203	4300	6503	62313927	SO:0001819	synonymous_variant	4661			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1509G>A	20.37:g.62843483G>A		Somatic		Capture	Illumina GAIIx	4	62313927	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Silent	SNP	HMMPfam_zf-C2HC;HMMPfam_MYT1;superfamily_CCHHC domain	p.T503	ENST00000328439.1	37	c.1509	CCDS13558.1	20																																																																																			-	HMMPfam_zf-C2HC		0.667	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	protein_coding	OTTHUMT00000080297.1	G	NM_004535		62313927	1	no_errors	NM_004535	genbank	human	reviewed	54_36p	silent	SNP	0.64	A
APOBEC3B	9582	genome.wustl.edu	37	22	39387497	39387497	+	Missense_Mutation	SNP	C	C	T	rs149274572	byFrequency	TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr22:39387497C>T	ENST00000333467.3	+	6	929	c.884C>T	c.(883-885)gCg>gTg	p.A295V	APOBEC3B_ENST00000407298.3_Missense_Mutation_p.A270V|APOBEC3B_ENST00000402182.3_Missense_Mutation_p.A295V|APOBEC3B-AS1_ENST00000513758.2_RNA	NM_001270411.1|NM_004900.4	NP_001257340.1|NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B	295					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|negative regulation of transposition (GO:0010529)	nucleus (GO:0005634)	deoxycytidine deaminase activity (GO:0047844)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A295V(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	13	Melanoma(58;0.04)					GAAGTGCGTGCGTTCCTTCAG	0.577													C|||	7	0.00139776	0.0053	0.0	5008	,	,		15307	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	22						C	VAL/ALA	21,4375		0,21,2177	111.0	110.0	110.0		884	-4.0	0.0	22	dbSNP_134	110	1,8565		0,1,4282	no	missense	APOBEC3B	NM_004900.3	64	0,22,6459	TT,TC,CC		0.0117,0.4777,0.1697	benign	295/383	39387497	22,12940	2198	4283	6481	37717443	SO:0001583	missense	9582			AK024854	CCDS13982.1, CCDS58807.1	22q13.1-q13.2	2008-05-15			ENSG00000179750	ENSG00000179750		"""Apolipoprotein B mRNA editing enzymes"""	17352	protein-coding gene	gene with protein product	"""phorbolin 3"""	607110				11863358, 10469298	Standard	NM_004900		Approved	PHRBNL, FLJ21201	uc003awo.2	Q9UH17	OTTHUMG00000151085	ENST00000333467.3:c.884C>T	22.37:g.39387497C>T	ENSP00000327459:p.Ala295Val	Somatic		Capture	Illumina GAIIx	4	37717443	B0QYD2|O95618|Q20WL1|Q5IFJ4|Q7Z2N3|Q7Z6D6|Q9UE74	Missense_Mutation	SNP	HMMPfam_APOBEC_C;HMMPfam_APOBEC_N;superfamily_Cytidine deaminase-like	p.A295V	ENST00000333467.3	37	c.884	CCDS13982.1	22	.	.	.	.	.	.	.	.	.	.	.	4.157	0.027634	0.08054	0.004777	1.17E-4	ENSG00000179750	ENST00000407298;ENST00000402182;ENST00000333467	T;T;T	0.66099	-0.19;-0.19;-0.19	2.0	-3.99	0.04069	APOBEC-like, N-terminal (1);Cytidine deaminase-like (1);	.	.	.	.	T	0.47173	0.1431	L	0.38175	1.15	0.09310	N	1	B;B	0.19073	0.033;0.01	B;B	0.09377	0.004;0.003	T	0.10042	-1.0647	9	0.49607	T	0.09	.	9.2359	0.37466	0.7252:0.1511:0.1237:0.0	.	270;295	B0QYD2;Q9UH17	.;ABC3B_HUMAN	V	270;295;295	ENSP00000385068:A270V;ENSP00000385060:A295V;ENSP00000327459:A295V	ENSP00000327459:A295V	A	+	2	0	APOBEC3B	37717443	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.248000	0.01189	-3.168000	0.00226	-1.861000	0.00560	GCG	-	HMMPfam_APOBEC_N		0.577	APOBEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3B	protein_coding	OTTHUMT00000321233.1	C	NM_004900		37717443	1	no_errors	NM_004900	genbank	human	reviewed	54_36p	missense	SNP	0.01	T
PHF21B	112885	genome.wustl.edu	37	22	45312458	45312458	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr22:45312458T>G	ENST00000313237.5	-	4	416	c.266A>C	c.(265-267)gAc>gCc	p.D89A	PHF21B_ENST00000447824.3_Missense_Mutation_p.D77A|PHF21B_ENST00000403565.1_5'UTR|PHF21B_ENST00000404079.2_Missense_Mutation_p.D77A|PHF21B_ENST00000396103.3_Missense_Mutation_p.D89A	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	89							zinc ion binding (GO:0008270)	p.D89A(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GGGTGGCCGGTCCCGGCCCGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	22											40.0	46.0	44.0					22																	45312458		2203	4299	6502	43691122	SO:0001583	missense	112885			AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.266A>C	22.37:g.45312458T>G	ENSP00000324403:p.Asp89Ala	Somatic		Capture	Illumina GAIIx	4	43691122	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	HMMPfam_PHD,superfamily_FYVE/PHD zinc finger	p.D89A	ENST00000313237.5	37	c.266	CCDS14061.1	22	.	.	.	.	.	.	.	.	.	.	T	24.4	4.525287	0.85600	.	.	ENSG00000056487	ENST00000313237;ENST00000396103;ENST00000404079;ENST00000447824;ENST00000420689	T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85	5.06	5.06	0.68205	.	0.451973	0.21489	N	0.073715	T	0.28863	0.0716	L	0.43152	1.355	0.43084	D	0.994743	P;P;P;P	0.50943	0.94;0.897;0.835;0.917	P;B;B;B	0.47044	0.535;0.402;0.227;0.37	T	0.02539	-1.1144	10	0.26408	T	0.33	-0.8524	14.8574	0.70347	0.0:0.0:0.0:1.0	.	77;89;77;89	B7Z657;Q96EK2-3;B7Z4F8;Q96EK2	.;.;.;PF21B_HUMAN	A	89;89;77;77;77	ENSP00000324403:D89A;ENSP00000379410:D89A;ENSP00000385105:D77A;ENSP00000388619:D77A;ENSP00000401294:D77A	ENSP00000324403:D89A	D	-	2	0	PHF21B	43691122	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.942000	0.75928	1.903000	0.55091	0.533000	0.62120	GAC	-	NULL		0.627	PHF21B-001	KNOWN	basic|CCDS	protein_coding	PHF21B	protein_coding	OTTHUMT00000321731.2	T	NM_138415		43691122	-1	no_errors	NM_138415	genbank	human	validated	54_36p	missense	SNP	1	G
RPS20P32	100129306	genome.wustl.edu	37	13	27591838	27591838	+	IGR	SNP	A	A	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr13:27591838A>G								GPR12 (256916 upstream) : USP12 (48454 downstream)																							AACCTTCATCACAAGGAGTTT	0.423																																																0			13																																								26489838	SO:0001628	intergenic_variant	100129306																															13.37:g.27591838A>G		Somatic		Capture	Illumina GAIIx	4	26489838		Silent	SNP	-	p.C46		37	c.138		13																																																																																			-	NULL	0	0.423					LOC100129306			A			26489838	-1	pseudogene	XM_001719801	genbank	human	model	54_36p	silent	SNP	1	G
GPR149	344758	genome.wustl.edu	37	3	154146603	154146603	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr3:154146603A>C	ENST00000389740.2	-	1	901	c.802T>G	c.(802-804)Tct>Gct	p.S268A		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	268					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S268A(1)		autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GAGCTCGGAGAGCATCCCCCA	0.672																																																1	Substitution - Missense(1)	ovary(1)	3											30.0	34.0	33.0					3																	154146603		1879	4118	5997	155629297	SO:0001583	missense	344758			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.802T>G	3.37:g.154146603A>C	ENSP00000374390:p.Ser268Ala	Somatic		Capture	Illumina GAIIx	4	155629297		Missense_Mutation	SNP	-	p.S268A	ENST00000389740.2	37	c.802	CCDS43162.1	3	.	.	.	.	.	.	.	.	.	.	A	7.461	0.644741	0.14451	.	.	ENSG00000174948	ENST00000389740	T	0.28666	1.6	4.61	1.99	0.26369	GPCR, rhodopsin-like superfamily (1);	0.387540	0.29355	N	0.012385	T	0.21427	0.0516	L	0.50333	1.59	0.27279	N	0.958158	B	0.11235	0.004	B	0.12156	0.007	T	0.26985	-1.0087	10	0.08381	T	0.77	-4.558	7.5059	0.27545	0.7207:0.1335:0.0:0.1458	.	268	Q86SP6	GP149_HUMAN	A	268	ENSP00000374390:S268A	ENSP00000374390:S268A	S	-	1	0	GPR149	155629297	0.009000	0.17119	0.867000	0.34043	0.077000	0.17291	0.928000	0.28831	0.783000	0.33636	0.533000	0.62120	TCT	-	NULL		0.672	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	protein_coding	OTTHUMT00000353430.1	A	XM_293580		155629297	-1	no_errors	NM_001038705	genbank	human	provisional	54_36p	missense	SNP	0.03	C
TBC1D5	9779	genome.wustl.edu	37	3	17279813	17279813	+	Missense_Mutation	SNP	C	C	G	rs373670416		TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr3:17279813C>G	ENST00000253692.7	-	17	3094	c.1430G>C	c.(1429-1431)aGt>aCt	p.S477T	TBC1D5_ENST00000446818.2_Missense_Mutation_p.S477T|TBC1D5_ENST00000429924.2_Missense_Mutation_p.S429T|TBC1D5_ENST00000429383.4_Missense_Mutation_p.S477T|TBC1D5_ENST00000414318.2_5'UTR	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	477						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)	p.S477T(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						GCCACCTGCACTGCCTGGAGC	0.502																																																1	Substitution - Missense(1)	ovary(1)	3											52.0	48.0	49.0					3																	17279813		2203	4300	6503	17254817	SO:0001583	missense	9779			D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.1430G>C	3.37:g.17279813C>G	ENSP00000253692:p.Ser477Thr	Somatic		Capture	Illumina GAIIx	4	17254817	A6NP25|C9JP52	Missense_Mutation	SNP	-	p.S477T	ENST00000253692.7	37	c.1430	CCDS33714.1	3	.	.	.	.	.	.	.	.	.	.	C	3.798	-0.042225	0.07452	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818;ENST00000429924	T;T;T;T	0.49139	1.41;1.41;1.36;0.79	5.78	2.62	0.31277	.	0.536322	0.23569	N	0.046766	T	0.28433	0.0703	L	0.40543	1.245	0.23913	N	0.996484	B;P;B;B	0.37914	0.049;0.611;0.104;0.104	B;B;B;B	0.26517	0.022;0.07;0.051;0.051	T	0.10154	-1.0642	10	0.23891	T	0.37	-3.2761	6.9448	0.24512	0.0:0.6598:0.1461:0.1941	.	429;477;477;477	C9J3F6;C9JP52;B9A6K1;Q92609	.;.;.;TBCD5_HUMAN	T	477;477;477;429	ENSP00000253692:S477T;ENSP00000398127:S477T;ENSP00000402935:S477T;ENSP00000411925:S429T	ENSP00000253692:S477T	S	-	2	0	TBC1D5	17254817	0.002000	0.14202	0.469000	0.27204	0.062000	0.15995	1.646000	0.37249	0.777000	0.33496	-0.315000	0.08773	AGT	-	NULL		0.502	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D5	protein_coding	OTTHUMT00000340301.3	C	NM_014744		17254817	-1	no_errors	NM_014744	genbank	human	validated	54_36p	missense	SNP	0.15	G
TNIK	23043	genome.wustl.edu	37	3	170857307	170857307	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr3:170857307C>A	ENST00000436636.2	-	14	1715	c.1371G>T	c.(1369-1371)caG>caT	p.Q457H	TNIK_ENST00000284483.8_Missense_Mutation_p.Q457H|TNIK_ENST00000470834.1_Intron|TNIK_ENST00000341852.6_Intron|TNIK_ENST00000538048.1_Missense_Mutation_p.Q457H|TNIK_ENST00000475336.1_Intron|TNIK_ENST00000460047.1_Missense_Mutation_p.Q457H|TNIK_ENST00000488470.1_Missense_Mutation_p.Q457H|TNIK_ENST00000369326.5_Intron|TNIK_ENST00000357327.5_Intron	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	457	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.Q457H(1)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			AGATCTCTAACTGTCTCTGCT	0.463																																																1	Substitution - Missense(1)	ovary(1)	3											197.0	189.0	191.0					3																	170857307		1988	4178	6166	172340001	SO:0001583	missense	23043			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.1371G>T	3.37:g.170857307C>A	ENSP00000399511:p.Gln457His	Somatic		Capture	Illumina GAIIx	4	172340001	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_CNH;superfamily_Protein kinase-like (PK-like);superfamily_YVTN repeat-like/Quinoprotein amine dehydrogenase	p.Q457H	ENST00000436636.2	37	c.1371	CCDS46956.1	3	.	.	.	.	.	.	.	.	.	.	C	8.991	0.977725	0.18812	.	.	ENSG00000154310	ENST00000436636;ENST00000538048;ENST00000284483;ENST00000460047;ENST00000488470	T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.25717	0.0626	N	0.19112	0.55	0.58432	D	0.999993	B;B;B;B	0.09022	0.002;0.002;0.002;0.001	B;B;B;B	0.09377	0.004;0.004;0.004;0.002	T	0.11372	-1.0590	10	0.08381	T	0.77	.	19.6717	0.95914	0.0:1.0:0.0:0.0	.	457;457;457;457	Q9UKE5-7;Q9UKE5-4;Q9UKE5-3;Q9UKE5	.;.;.;TNIK_HUMAN	H	457	ENSP00000399511:Q457H;ENSP00000443278:Q457H;ENSP00000284483:Q457H;ENSP00000418916:Q457H;ENSP00000418378:Q457H	ENSP00000284483:Q457H	Q	-	3	2	TNIK	172340001	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.592000	0.46171	2.648000	0.89879	0.591000	0.81541	CAG	-	NULL		0.463	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNIK	protein_coding	OTTHUMT00000352973.2	C	XM_039796		172340001	-1	no_errors	NM_015028	genbank	human	provisional	54_36p	missense	SNP	1	A
PIK3CA	5290	genome.wustl.edu	37	3	178928344	178928344	+	Silent	SNP	C	C	T	rs200934230		TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr3:178928344C>T	ENST00000263967.3	+	9	1687	c.1530C>T	c.(1528-1530)caC>caT	p.H510H		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	510					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H510H(2)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GCTATTCCCACGCAGGACTGG	0.388		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	2	Substitution - coding silent(2)	large_intestine(1)|ovary(1)	3						C		2,3776		0,2,1887	138.0	128.0	131.0		1530	0.3	1.0	3		131	0,8222		0,0,4111	no	coding-synonymous	PIK3CA	NM_006218.2		0,2,5998	TT,TC,CC		0.0,0.0529,0.0167		510/1069	178928344	2,11998	1889	4111	6000	180411038	SO:0001819	synonymous_variant	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1530C>T	3.37:g.178928344C>T		Somatic		Capture	Illumina GAIIx	4	180411038	Q14CW1|Q99762	Silent	SNP	PI3K_rbd;HMMPfam_PI3K_rbd;PI3_PI4_kinase;HMMPfam_PI3_PI4_kinase;PI3Ka;HMMPfam_PI3Ka;PI3K_C2;HMMPfam_PI3K_C2;PI3K_p85B;HMMPfam_PI3K_p85B	p.H510	ENST00000263967.3	37	c.1530	CCDS43171.1	3																																																																																			-	NULL		0.388	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	protein_coding	OTTHUMT00000348409.2	C			180411038	1	no_errors	NM_006218	genbank	human	reviewed	54_36p	silent	SNP	1	T
LAMP3	27074	genome.wustl.edu	37	3	182870292	182870292	+	Splice_Site	SNP	C	C	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr3:182870292C>G	ENST00000265598.3	-	3	1015		c.e3-1		LAMP3_ENST00000466939.1_Splice_Site	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3						cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)		p.?(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			GTGAAAAAACCTAAATCAAGT	0.453																																																1	Unknown(1)	ovary(1)	3											162.0	169.0	167.0					3																	182870292		2203	4300	6503	184352986	SO:0001630	splice_region_variant	27074			AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.760-1G>C	3.37:g.182870292C>G		Somatic		Capture	Illumina GAIIx	4	184352986	D3DNS4|O94781|Q8NEC8	Splice_Site	SNP	-	e3-1	ENST00000265598.3	37	c.760-1	CCDS3242.1	3	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004599	0.54254	.	.	ENSG00000078081	ENST00000265598;ENST00000466939	.	.	.	4.99	4.12	0.48240	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.5211	0.39135	0.0:0.9044:0.0:0.0956	.	.	.	.	.	-1	.	.	.	-	.	.	LAMP3	184352986	1.000000	0.71417	0.967000	0.41034	0.873000	0.50193	3.229000	0.51278	1.473000	0.48159	0.650000	0.86243	.	-	-		0.453	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMP3	protein_coding	OTTHUMT00000350863.1	C		Intron	184352986	-1	no_errors	NM_014398	genbank	human	validated	54_36p	splice_site	SNP	0.55	G
NEK1	4750	genome.wustl.edu	37	4	170476982	170476982	+	Missense_Mutation	SNP	C	C	T	rs201793759		TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr4:170476982C>T	ENST00000439128.2	-	17	2091	c.1451G>A	c.(1450-1452)cGt>cAt	p.R484H	NEK1_ENST00000510533.1_Intron|NEK1_ENST00000511633.1_Intron|NEK1_ENST00000512193.1_Intron|NEK1_ENST00000507142.1_Missense_Mutation_p.R484H	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	484					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.R484H(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		AAATCCTGGACGAACTCCAGG	0.413																																																1	Substitution - Missense(1)	ovary(1)	4						C	HIS/ARG,,,,HIS/ARG	1,3709		0,1,1854	103.0	98.0	100.0		1451,,,,1451	1.7	1.0	4		100	0,8188		0,0,4094	yes	missense,intron,intron,intron,missense	NEK1	NM_001199397.1,NM_001199398.1,NM_001199399.1,NM_001199400.1,NM_012224.2	29,,,,29	0,1,5948	TT,TC,CC		0.0,0.027,0.0084	benign,,,,benign	484/1287,,,,484/1259	170476982	1,11897	1855	4094	5949	170713557	SO:0001583	missense	4750			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.1451G>A	4.37:g.170476982C>T	ENSP00000408020:p.Arg484His	Somatic		Capture	Illumina GAIIx	4	170713557	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.R484H	ENST00000439128.2	37	c.1451	CCDS47162.1	4	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392102	0.25118	2.7E-4	0.0	ENSG00000137601	ENST00000439128;ENST00000507142	T;T	0.69306	-0.36;-0.39	5.67	1.72	0.24424	.	0.759582	0.11965	N	0.512390	T	0.45498	0.1345	N	0.22421	0.69	0.80722	D	1	B;B;B	0.13594	0.001;0.008;0.004	B;B;B	0.08055	0.002;0.003;0.001	T	0.16600	-1.0397	10	0.09084	T	0.74	.	7.1435	0.25570	0.1256:0.6156:0.0:0.2588	.	484;484;484	Q96PY6-5;Q96PY6-3;Q96PY6	.;.;NEK1_HUMAN	H	484	ENSP00000408020:R484H;ENSP00000424757:R484H	ENSP00000408020:R484H	R	-	2	0	NEK1	170713557	0.998000	0.40836	0.982000	0.44146	0.990000	0.78478	0.459000	0.21908	0.001000	0.14605	0.591000	0.81541	CGT	-	NULL		0.413	NEK1-001	KNOWN	basic|CCDS	protein_coding	NEK1	protein_coding	OTTHUMT00000363157.3	C			170713557	-1	no_errors	NM_012224	genbank	human	validated	54_36p	missense	SNP	1	T
EVC2	132884	genome.wustl.edu	37	4	5627605	5627616	+	In_Frame_Del	DEL	TTCCATTTGGTC	TTCCATTTGGTC	-			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	TTCCATTTGGTC	TTCCATTTGGTC	TTCCATTTGGTC	-	TTCCATTTGGTC	TTCCATTTGGTC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr4:5627605_5627616delTTCCATTTGGTC	ENST00000344408.5	-	13	1959_1970	c.1906_1917delGACCAAATGGAA	c.(1906-1917)gaccaaatggaadel	p.DQME636del	EVC2_ENST00000310917.2_In_Frame_Del_p.DQME556del|EVC2_ENST00000344938.1_In_Frame_Del_p.DQME636del	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	636					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.D636_E639del(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CCAATAGCATTTCCATTTGGTCTTCATCCAGG	0.406																																																1	Deletion - In frame(1)	ovary(1)	4																																								5678517	SO:0001651	inframe_deletion	132884			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1906_1917delGACCAAATGGAA	4.37:g.5627605_5627616delTTCCATTTGGTC	ENSP00000342144:p.Asp636_Glu639del	Somatic		Capture	Illumina GAIIx	Phase_III	5678506	Q86YT3|Q86YT4|Q8NG49	In_Frame_Del	DEL	-	p.DQME636in_frame_del	ENST00000344408.5	37	c.1917_1906	CCDS3382.2	4																																																																																			(deletion:cds_exon[5678377,5678536])	NULL		0.406	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	protein_coding	OTTHUMT00000289822.2	TTCCATTTGGTC	NM_147127		5678517	-1	no_errors	NM_147127	genbank	human	validated	54_36p	in_frame_del	DEL	0.078:0.452:0.767:0.949:0.957:0.961:0.964:0.977:0.974:0.833:0.867:0.874	-
SORBS2	8470	genome.wustl.edu	37	4	186536052	186536052	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr4:186536052T>C	ENST00000284776.7	-	17	3325	c.2816A>G	c.(2815-2817)gAa>gGa	p.E939G	SORBS2_ENST00000431808.1_Missense_Mutation_p.E939G|SORBS2_ENST00000319471.9_Missense_Mutation_p.E570G|SORBS2_ENST00000418609.1_Missense_Mutation_p.E843G|SORBS2_ENST00000355634.5_Missense_Mutation_p.E1039G|SORBS2_ENST00000498125.1_5'UTR|SORBS2_ENST00000437304.2_Missense_Mutation_p.E663G|SORBS2_ENST00000393528.3_Missense_Mutation_p.E505G|SORBS2_ENST00000449407.2_Missense_Mutation_p.E483G|SORBS2_ENST00000448662.2_Missense_Mutation_p.E500G	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	939	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)	p.E939G(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		TTCTCCGATTTCTCCGGGCTG	0.463																																					Esophageal Squamous(153;41 2433 9491 36028)											1	Substitution - Missense(1)	ovary(1)	4											152.0	163.0	159.0					4																	186536052		2203	4300	6503	186773046	SO:0001583	missense	8470				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.2816A>G	4.37:g.186536052T>C	ENSP00000284776:p.Glu939Gly	Somatic		Capture	Illumina GAIIx	4	186773046	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	-	p.E939G	ENST00000284776.7	37	c.2816	CCDS3845.1	4	.	.	.	.	.	.	.	.	.	.	T	20.6	4.025142	0.75390	.	.	ENSG00000154556	ENST00000284776;ENST00000448662;ENST00000431808;ENST00000418609;ENST00000437304;ENST00000319471;ENST00000449407;ENST00000355634;ENST00000393528;ENST00000319454;ENST00000451974	T;T;T;T;T;T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;2.56	6.16	6.16	0.99307	Src homology-3 domain (2);	0.000000	0.85682	D	0.000000	T	0.49064	0.1535	L	0.40543	1.245	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.996;1.0;1.0;1.0;0.995;1.0;1.0;0.992;0.999;1.0;1.0;0.988;0.997;0.997	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.986;0.999;0.993;0.993;0.985;0.997;0.993;0.979;0.998;0.963;0.993;0.92;0.991;0.99	T	0.47433	-0.9118	10	0.87932	D	0	-24.7823	16.8061	0.85666	0.0:0.0:0.0:1.0	.	505;500;843;331;388;530;1039;939;483;663;500;530;484;505	G3XAI0;C9JKV9;B7Z3X6;B7Z997;B3KPU4;O94875-4;B3KPQ7;O94875;E9PAS5;E9PAW4;B7Z1G5;O94875-5;O94875-3;O94875-2	.;.;.;.;.;.;.;SRBS2_HUMAN;.;.;.;.;.;.	G	939;500;939;843;663;570;483;1039;505;530;288	ENSP00000284776:E939G;ENSP00000409158:E500G;ENSP00000411764:E939G;ENSP00000397482:E843G;ENSP00000396008:E663G;ENSP00000322182:E570G;ENSP00000397262:E483G;ENSP00000347852:E1039G;ENSP00000377162:E505G;ENSP00000321983:E530G;ENSP00000401818:E288G	ENSP00000284776:E939G	E	-	2	0	SORBS2	186773046	1.000000	0.71417	1.000000	0.80357	0.245000	0.25701	6.139000	0.71728	2.367000	0.80283	0.528000	0.53228	GAA	-	NULL		0.463	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	protein_coding	OTTHUMT00000347944.3	T	NM_003603		186773046	-1	no_errors	NM_021069	genbank	human	reviewed	54_36p	missense	SNP	1	C
MTMR12	54545	genome.wustl.edu	37	5	32242202	32242202	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr5:32242202C>G	ENST00000382142.3	-	12	1302	c.1132G>C	c.(1132-1134)Gaa>Caa	p.E378Q	MTMR12_ENST00000264934.5_Missense_Mutation_p.E378Q|MTMR12_ENST00000280285.5_Missense_Mutation_p.E378Q	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	378	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)	p.E378Q(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TCCATACATTCTGTAATCTCT	0.348																																																1	Substitution - Missense(1)	ovary(1)	5											162.0	151.0	155.0					5																	32242202		2200	4299	6499	32277959	SO:0001583	missense	54545			AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.1132G>C	5.37:g.32242202C>G	ENSP00000371577:p.Glu378Gln	Somatic		Capture	Illumina GAIIx	4	32277959	Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Missense_Mutation	SNP	-	p.E378Q	ENST00000382142.3	37	c.1132	CCDS34138.1	5	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346492	0.61073	.	.	ENSG00000150712	ENST00000280285;ENST00000382142;ENST00000264934	D;D;D	0.90444	-2.67;-2.67;-2.67	5.8	5.8	0.92144	Myotubularin phosphatase domain (1);	0.057747	0.64402	D	0.000003	D	0.93455	0.7912	L	0.42744	1.35	0.47698	D	0.999497	D;D;D	0.76494	0.996;0.999;0.999	D;D;D	0.78314	0.97;0.991;0.98	D	0.93126	0.6529	10	0.51188	T	0.08	.	18.235	0.89947	0.0:1.0:0.0:0.0	.	378;378;378	Q9C0I1-3;Q9C0I1-2;Q9C0I1	.;.;MTMRC_HUMAN	Q	378	ENSP00000280285:E378Q;ENSP00000371577:E378Q;ENSP00000264934:E378Q	ENSP00000264934:E378Q	E	-	1	0	MTMR12	32277959	0.988000	0.35896	0.576000	0.28549	0.993000	0.82548	2.916000	0.48813	2.748000	0.94277	0.655000	0.94253	GAA	-	NULL		0.348	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR12	protein_coding	OTTHUMT00000366579.1	C	NM_019061		32277959	-1	no_errors	NM_001040446	genbank	human	reviewed	54_36p	missense	SNP	0.9	G
TENM2	57451	genome.wustl.edu	37	5	167617460	167617460	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr5:167617460G>T	ENST00000518659.1	+	14	2727	c.2688G>T	c.(2686-2688)tgG>tgT	p.W896C	CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000545108.1_Missense_Mutation_p.W896C|TENM2_ENST00000403607.2_Missense_Mutation_p.W720C|TENM2_ENST00000519204.1_Missense_Mutation_p.W775C|TENM2_ENST00000520394.1_Missense_Mutation_p.W664C	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	896					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.W729C(1)									AGACGGATTGGCCCGCAGTGA	0.587																																																1	Substitution - Missense(1)	ovary(1)	5											53.0	52.0	52.0					5																	167617460		1966	4150	6116	167550038	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.2688G>T	5.37:g.167617460G>T	ENSP00000429430:p.Trp896Cys	Somatic		Capture	Illumina GAIIx	4	167550038	Q9ULU2	Missense_Mutation	SNP	-	p.W896C	ENST00000518659.1	37	c.2688		5	.	.	.	.	.	.	.	.	.	.	G	10.25	1.299067	0.23650	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.88818	-1.96;-1.94;-2.05;-2.42;-2.43	5.94	2.13	0.27403	.	0.873177	0.10539	N	0.662943	T	0.77003	0.4067	N	0.08118	0	0.48571	D	0.999677	B;B;B	0.25486	0.127;0.078;0.084	B;B;B	0.30401	0.03;0.013;0.115	T	0.65302	-0.6201	10	0.37606	T	0.19	.	5.8738	0.18819	0.3403:0.0:0.5389:0.1208	.	896;896;664	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	C	896;896;775;664;720	ENSP00000429430:W896C;ENSP00000438635:W896C;ENSP00000428964:W775C;ENSP00000427874:W664C;ENSP00000384905:W720C	ENSP00000384905:W720C	W	+	3	0	ODZ2	167550038	0.102000	0.21896	0.946000	0.38457	0.533000	0.34776	-0.139000	0.10358	0.385000	0.24970	0.561000	0.74099	TGG	-	NULL		0.587	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	protein_coding	OTTHUMT00000376096.1	G	NM_001122679		167550038	1	no_errors	ENST00000388903	ensembl	human	known	54_36p	missense	SNP	1	T
MTHFD1L	25902	genome.wustl.edu	37	6	151331076	151331076	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr6:151331076G>C	ENST00000367321.3	+	21	2521	c.2247G>C	c.(2245-2247)atG>atC	p.M749I	MTHFD1L_ENST00000478643.1_3'UTR	NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	749	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)	p.M749I(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		CTCTGAAGATGCATGGAGGCG	0.478																																																1	Substitution - Missense(1)	ovary(1)	6											87.0	84.0	85.0					6																	151331076		2203	4300	6503	151372769	SO:0001583	missense	25902			BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.2247G>C	6.37:g.151331076G>C	ENSP00000356290:p.Met749Ile	Somatic		Capture	Illumina GAIIx	4	151372769	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	HMMPfam_FTHFS;HMMPfam_THF_DHG_CYH;HMMPfam_THF_DHG_CYH_C;superfamily_NAD(P)-binding Rossmann-fold domains;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Aminoacid dehydrogenase-like N-terminal domain	p.M749I	ENST00000367321.3	37	c.2247	CCDS5228.1	6	.	.	.	.	.	.	.	.	.	.	G	26.0	4.694477	0.88830	.	.	ENSG00000120254	ENST00000367321	T	0.21932	1.98	4.43	4.43	0.53597	Formate-tetrahydrofolate ligase, FTHFS, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.53948	0.1828	H	0.96518	3.835	0.80722	D	1	D;D;D	0.69078	0.97;0.997;0.997	P;D;D	0.81914	0.718;0.981;0.995	T	0.72640	-0.4232	10	0.72032	D	0.01	.	17.0632	0.86553	0.0:0.0:1.0:0.0	.	750;504;749	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	I	749	ENSP00000356290:M749I	ENSP00000356290:M749I	M	+	3	0	MTHFD1L	151372769	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.813000	0.99286	2.010000	0.58986	0.650000	0.86243	ATG	-	HMMPfam_FTHFS		0.478	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD1L	protein_coding	OTTHUMT00000042699.1	G	NM_015440		151372769	1	no_errors	NM_015440	genbank	human	validated	54_36p	missense	SNP	1	C
RIMS1	22999	genome.wustl.edu	37	6	72984124	72984124	+	Silent	SNP	G	G	A	rs374938269	byFrequency	TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr6:72984124G>A	ENST00000521978.1	+	23	3471	c.3471G>A	c.(3469-3471)ccG>ccA	p.P1157P	RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000348717.5_Intron|RIMS1_ENST00000491071.2_Intron|RIMS1_ENST00000425662.2_Intron|RIMS1_ENST00000538414.1_Intron|RIMS1_ENST00000520567.1_Intron|RIMS1_ENST00000517960.1_Intron|RIMS1_ENST00000518273.1_Silent_p.P1093P|RIMS1_ENST00000264839.7_Intron|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000401910.3_Intron|RIMS1_ENST00000522291.1_Intron	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1157					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.P1157P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				ATGCGTCTCCGGAGAATGACA	0.488													G|||	2	0.000399361	0.0015	0.0	5008	,	,		16957	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	6						G	,,,,	10,3808		0,10,1899	62.0	60.0	60.0		,,,,3471	3.6	1.0	6		60	0,8248		0,0,4124	no	intron,intron,intron,intron,coding-synonymous	RIMS1	NM_001168407.1,NM_001168408.1,NM_001168409.1,NM_001168410.1,NM_014989.4	,,,,	0,10,6023	AA,AG,GG		0.0,0.2619,0.0829	,,,,	,,,,1157/1693	72984124	10,12056	1909	4124	6033	73040845	SO:0001819	synonymous_variant	22999			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3471G>A	6.37:g.72984124G>A		Somatic		Capture	Illumina GAIIx	4	73040845	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Silent	SNP	HMMPfam_C2;HMMPfam_PDZ;superfamily_PDZ domain-like;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);superfamily_FYVE/PHD zinc finger	p.P1157	ENST00000521978.1	37	c.3471	CCDS47449.1	6																																																																																			-	NULL		0.488	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	protein_coding	OTTHUMT00000374968.1	G			73040845	1	no_errors	NM_014989	genbank	human	validated	54_36p	silent	SNP	1	A
SENP6	26054	genome.wustl.edu	37	6	76373130	76373130	+	Missense_Mutation	SNP	C	C	G	rs368687851		TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr6:76373130C>G	ENST00000447266.2	+	9	1368	c.890C>G	c.(889-891)aCt>aGt	p.T297S	SENP6_ENST00000370010.2_Missense_Mutation_p.T290S|SENP6_ENST00000370014.3_Missense_Mutation_p.T297S|SENP6_ENST00000327284.8_Missense_Mutation_p.T290S	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	297					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)	p.T297S(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				AGTAAACACACTTATTTACAG	0.328																																																1	Substitution - Missense(1)	ovary(1)	6											107.0	101.0	103.0					6																	76373130		1823	4090	5913	76429850	SO:0001583	missense	26054				CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.890C>G	6.37:g.76373130C>G	ENSP00000402527:p.Thr297Ser	Somatic		Capture	Illumina GAIIx	4	76429850	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	HMMPfam_Peptidase_C48;superfamily_Cysteine proteinases	p.T297S	ENST00000447266.2	37	c.890	CCDS47454.1	6	.	.	.	.	.	.	.	.	.	.	C	0.116	-1.131260	0.01756	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000327284;ENST00000447266;ENST00000483859;ENST00000424947	T;T;T;T;T;T	0.39787	2.9;2.93;1.64;2.96;1.06;1.64	5.24	0.593	0.17478	.	0.494197	0.21704	N	0.070370	T	0.04137	0.0115	N	0.02011	-0.69	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.32613	-0.9900	10	0.09338	T	0.73	-8.6407	5.8998	0.18960	0.5942:0.2963:0.1095:0.0	.	290;297;290	Q9GZR1-2;Q9GZR1;F8W6D9	.;SENP6_HUMAN;.	S	290;297;290;297;187;187	ENSP00000359027:T290S;ENSP00000359031:T297S;ENSP00000321820:T290S;ENSP00000402527:T297S;ENSP00000426480:T187S;ENSP00000391426:T187S	ENSP00000321820:T290S	T	+	2	0	SENP6	76429850	1.000000	0.71417	0.982000	0.44146	0.212000	0.24457	0.862000	0.27899	-0.043000	0.13513	-1.289000	0.01358	ACT	-	NULL		0.328	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP6	protein_coding	OTTHUMT00000041272.2	C	NM_015571		76429850	1	no_errors	NM_015571	genbank	human	validated	54_36p	missense	SNP	0.66	G
IGF2R	3482	genome.wustl.edu	37	6	160504993	160504993	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr6:160504993C>G	ENST00000356956.1	+	40	5993	c.5845C>G	c.(5845-5847)Cgg>Ggg	p.R1949G		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1949					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.R1949G(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	AAACAGCTACCGGACATCCAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	6											82.0	75.0	78.0					6																	160504993		2203	4300	6503	160424983	SO:0001583	missense	3482			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.5845C>G	6.37:g.160504993C>G	ENSP00000349437:p.Arg1949Gly	Somatic		Capture	Illumina GAIIx	4	160424983	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	HMMPfam_CIMR;HMMPfam_fn2;superfamily_Mannose 6-phosphate receptor domain;superfamily_Kringle-like	p.R1949G	ENST00000356956.1	37	c.5845	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	C	12.51	1.960668	0.34565	.	.	ENSG00000197081	ENST00000356956	T	0.14144	2.53	5.55	4.68	0.58851	Mannose-6-phosphate receptor, binding (1);	0.056264	0.64402	D	0.000001	T	0.13543	0.0328	M	0.81614	2.55	0.49051	D	0.99974	B	0.34349	0.45	B	0.42030	0.373	T	0.01305	-1.1390	10	0.45353	T	0.12	-40.0177	10.376	0.44081	0.2785:0.5997:0.1218:0.0	.	1949	P11717	MPRI_HUMAN	G	1949	ENSP00000349437:R1949G	ENSP00000349437:R1949G	R	+	1	2	IGF2R	160424983	1.000000	0.71417	1.000000	0.80357	0.141000	0.21300	2.389000	0.44407	1.577000	0.49804	0.655000	0.94253	CGG	-	HMMPfam_CIMR		0.453	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	protein_coding	OTTHUMT00000042931.1	C	NM_000876		160424983	1	no_errors	NM_000876	genbank	human	reviewed	54_36p	missense	SNP	0.92	G
STAG3	10734	genome.wustl.edu	37	7	99796176	99796176	+	Silent	SNP	C	C	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr7:99796176C>A	ENST00000426455.1	+	13	1730	c.1323C>A	c.(1321-1323)gcC>gcA	p.A441A	STAG3_ENST00000394018.2_Silent_p.A383A|STAG3_ENST00000317296.5_Silent_p.A441A|GATS_ENST00000543273.1_RNA|STAG3_ENST00000440830.1_3'UTR	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	441					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)		p.A441A(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAGGCCTGGCCTCTGCCGCAG	0.547																																																1	Substitution - coding silent(1)	ovary(1)	7											101.0	92.0	95.0					7																	99796176		2203	4300	6503	99634112	SO:0001819	synonymous_variant	10734			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.1323C>A	7.37:g.99796176C>A		Somatic		Capture	Illumina GAIIx	4	99634112	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Silent	SNP	HMMPfam_STAG;superfamily_ARM repeat	p.A441	ENST00000426455.1	37	c.1323	CCDS34703.1	7																																																																																			-	NULL		0.547	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STAG3	protein_coding	OTTHUMT00000338734.2	C	NM_012447		99634112	1	no_errors	NM_012447	genbank	human	validated	54_36p	silent	SNP	0.02	A
MUC3A	4584	genome.wustl.edu	37	7	100552162	100552162	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr7:100552162C>A	ENST00000319509.7	+	1	913	c.913C>A	c.(913-915)Ctc>Atc	p.L305I				Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated	1970	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)	p.L305I(1)		breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						GACCACAGCTCTCACTGAAAT	0.488																																																1	Substitution - Missense(1)	ovary(1)	7											547.0	559.0	555.0					7																	100552162		876	1991	2867	100390098	SO:0001583	missense	57876			AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.913C>A	7.37:g.100552162C>A	ENSP00000324834:p.Leu305Ile	Somatic		Capture	Illumina GAIIx	4	100390098	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	Missense_Mutation	SNP	-	p.L596I	ENST00000319509.7	37	c.1786		7	.	.	.	.	.	.	.	.	.	.	C	7.569	0.666303	0.14710	.	.	ENSG00000169894	ENST00000319509	T	0.06528	3.29	1.5	1.5	0.22942	.	.	.	.	.	T	0.02193	0.0068	N	0.08118	0	0.31640	N	0.64811	P	0.47604	0.898	B	0.34346	0.18	T	0.33266	-0.9875	8	0.20519	T	0.43	-4.271	3.8787	0.09068	0.0:0.7676:0.0:0.2324	.	1970	Q02505	MUC3A_HUMAN	I	305	ENSP00000324834:L305I	ENSP00000324834:L305I	L	+	1	0	MUC3A	100390098	0.000000	0.05858	0.002000	0.10522	0.256000	0.26092	-0.236000	0.09003	1.115000	0.41800	0.313000	0.20887	CTC	-	NULL		0.488	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	MUC3B	protein_coding	OTTHUMT00000347215.1	C	XM_001725354		100390098	1	no_start_codon	ENST00000332750	ensembl	human	known	54_36p	missense	SNP		A
SDCBPP2	100129960	genome.wustl.edu	37	8	70855349	70855349	+	IGR	SNP	A	A	T			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr8:70855349A>T								AC090574.1 (4714 upstream) : PRDM14 (108536 downstream)																							CTCTCTCAATAATACATGGGC	0.458											OREG0018816	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			8																																								71017903	SO:0001628	intergenic_variant	100129960																															8.37:g.70855349A>T		Somatic	1125	Capture	Illumina GAIIx	4	71017903		RNA	SNP	-	NULL		37	NULL		8																																																																																			-	-	0	0.458					LOC100129960			A			71017903	1	pseudogene	XR_037318	genbank	human	model	54_36p	rna	SNP	1	T
LINC01220	731223	genome.wustl.edu	37	14	75758828	75758828	+	lincRNA	SNP	G	G	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr14:75758828G>A	ENST00000558575.1	+	0	0					NR_038421.1													p.T128I(1)									CCGGAAGCTGGTTCGCTTCAT	0.547																																																1	Substitution - Missense(1)	ovary(1)	14																																								74828581			0																															14.37:g.75758828G>A		Somatic		Capture	Illumina GAIIx	4	74828581		Missense_Mutation	SNP	-	p.T128I	ENST00000558575.1	37	c.383		14	.	.	.	.	.	.	.	.	.	.	G	0.217	-1.031537	0.02029	.	.	ENSG00000119660	ENST00000238638	.	.	.	0.847	-0.261	0.12963	.	.	.	.	.	T	0.46425	0.1392	.	.	.	.	.	.	.	.	.	.	.	.	T	0.52801	-0.8527	4	0.87932	D	0	.	6.0659	0.19864	0.2378:0.0:0.7622:0.0	.	.	.	.	I	128	.	ENSP00000238638:T128I	T	-	2	0	AF111167.1	74828581	0.079000	0.21365	0.002000	0.10522	0.005000	0.04900	-0.230000	0.09083	-1.005000	0.03417	-1.786000	0.00637	ACC	-	NULL		0.547	RP11-293M10.5-001	KNOWN	basic	lincRNA	ENSG00000119660	lincRNA	OTTHUMT00000415498.1	G			74828581	-1	no_errors	ENST00000238638	ensembl	human	known	54_36p	missense	SNP	0.01	A
ARHGEF10	9639	genome.wustl.edu	37	8	1812549	1812549	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr8:1812549A>C	ENST00000398564.1	+	5	567	c.567A>C	c.(565-567)gaA>gaC	p.E189D	ARHGEF10_ENST00000349830.3_Missense_Mutation_p.E164D|ARHGEF10_ENST00000262112.6_Missense_Mutation_p.E189D|ARHGEF10_ENST00000398560.1_Missense_Mutation_p.E189D|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.E189D|ARHGEF10_ENST00000520359.1_Missense_Mutation_p.E165D			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	189					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E189D(1)		endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		AAACACCAGAAGTCACAGAAG	0.468																																																1	Substitution - Missense(1)	ovary(1)	8											145.0	125.0	132.0					8																	1812549		2203	4300	6503	1799956	SO:0001583	missense	9639			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.567A>C	8.37:g.1812549A>C	ENSP00000381571:p.Glu189Asp	Somatic		Capture	Illumina GAIIx	4	1799956	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	HMMPfam_RhoGEF;superfamily_WD40 repeat-like;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like	p.E164D	ENST00000398564.1	37	c.492		8	.	.	.	.	.	.	.	.	.	.	A	9.340	1.062746	0.19987	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398560;ENST00000398564;ENST00000262112	T;T;T;T;T;T	0.66815	0.26;0.18;0.25;-0.23;0.25;0.24	4.2	0.612	0.17591	.	.	.	.	.	T	0.53658	0.1810	L	0.54323	1.7	0.09310	N	1	P;B;B;B;B	0.38504	0.634;0.241;0.255;0.241;0.241	B;B;B;B;B	0.30495	0.116;0.116;0.078;0.116;0.116	T	0.40979	-0.9534	9	0.45353	T	0.12	-26.3221	7.3008	0.26420	0.6159:0.0:0.3841:0.0	.	189;189;189;165;164	O15013-4;O15013-6;E9PB39;O15013-7;O15013-5	.;.;.;.;.	D	164;165;189;189;189;189	ENSP00000340297:E164D;ENSP00000427909:E165D;ENSP00000431012:E189D;ENSP00000381568:E189D;ENSP00000381571:E189D;ENSP00000262112:E189D	ENSP00000262112:E189D	E	+	3	2	ARHGEF10	1799956	0.074000	0.21230	0.044000	0.18714	0.012000	0.07955	0.085000	0.14912	0.271000	0.22005	0.533000	0.62120	GAA	-	NULL		0.468	ARHGEF10-203	KNOWN	basic	protein_coding	ARHGEF10	protein_coding		A			1799956	1	no_errors	NM_014629	genbank	human	reviewed	54_36p	missense	SNP		C
LYN	4067	genome.wustl.edu	37	8	56879390	56879390	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chr8:56879390G>C	ENST00000519728.1	+	9	1203	c.907G>C	c.(907-909)Gtg>Ctg	p.V303L	LYN_ENST00000520220.2_Missense_Mutation_p.V282L|LYN_ENST00000420292.1_3'UTR	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	303	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.V303L(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	TGACAAGCTCGTGAGGCTCTA	0.552																																																1	Substitution - Missense(1)	ovary(1)	8											97.0	83.0	88.0					8																	56879390		2203	4300	6503	57041944	SO:0001583	missense	4067			M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.907G>C	8.37:g.56879390G>C	ENSP00000428924:p.Val303Leu	Somatic		Capture	Illumina GAIIx	4	57041944	A0AVQ5	Missense_Mutation	SNP	HMMPfam_SH2;HMMPfam_Pkinase_Tyr;HMMPfam_SH3_1;superfamily_SH3-domain;superfamily_Protein kinase-like (PK-like);superfamily_SH2 domain	p.V303L	ENST00000519728.1	37	c.907	CCDS6162.1	8	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385350	0.61956	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	T;T	0.17054	2.3;2.3	5.87	5.87	0.94306	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.057706	0.64402	D	0.000001	T	0.23727	0.0574	L	0.32530	0.975	0.80722	D	1	P;B	0.34780	0.468;0.095	B;B	0.43103	0.408;0.255	T	0.01238	-1.1409	10	0.52906	T	0.07	.	20.205	0.98274	0.0:0.0:1.0:0.0	.	373;303	Q6NUK7;P07948	.;LYN_HUMAN	L	303;282	ENSP00000428924:V303L;ENSP00000428424:V282L	ENSP00000428924:V303L	V	+	1	0	LYN	57041944	1.000000	0.71417	0.968000	0.41197	0.252000	0.25951	9.864000	0.99589	2.777000	0.95525	0.591000	0.81541	GTG	-	HMMPfam_Pkinase_Tyr		0.552	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYN	protein_coding	OTTHUMT00000378155.1	G	NM_002350		57041944	1	no_errors	NM_002350	genbank	human	validated	54_36p	missense	SNP	1	C
TMEM27	57393	genome.wustl.edu	37	X	15646102	15646102	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chrX:15646102G>A	ENST00000380342.3	-	6	916	c.661C>T	c.(661-663)Cct>Tct	p.P221S		NM_020665.4	NP_065716.1	Q9HBJ8	TMM27_HUMAN	transmembrane protein 27	221					positive regulation of amino acid transport (GO:0051957)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of SNARE complex assembly (GO:0035543)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)	p.P221S(1)		endometrium(3)|lung(4)|ovary(1)	8	Hepatocellular(33;0.183)					CTTCAGAGAGGGGTGAGCCTC	0.433																																																1	Substitution - Missense(1)	ovary(1)	X											121.0	94.0	103.0					X																	15646102		2203	4300	6503	15556023	SO:0001583	missense	57393			AF229179	CCDS14170.1	Xp22	2012-04-13			ENSG00000147003	ENSG00000147003			29437	protein-coding gene	gene with protein product	"""collectrin"""	300631				11278314	Standard	NM_020665		Approved	NX17	uc004cxc.2	Q9HBJ8	OTTHUMG00000021181	ENST00000380342.3:c.661C>T	X.37:g.15646102G>A	ENSP00000369699:p.Pro221Ser	Somatic		Capture	Illumina GAIIx	4	15556023	B2R9M1|Q6UW07	Missense_Mutation	SNP	-	p.P221S	ENST00000380342.3	37	c.661	CCDS14170.1	X	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440855	0.43326	.	.	ENSG00000147003	ENST00000380342	T	0.40756	1.02	5.87	5.01	0.66863	.	0.330121	0.36815	N	0.002384	T	0.20251	0.0487	N	0.12182	0.205	0.31212	N	0.698476	B	0.30709	0.291	B	0.29598	0.104	T	0.24440	-1.0160	10	0.02654	T	1	-21.0157	9.9342	0.41541	0.095:0.0:0.905:0.0	.	221	Q9HBJ8	TMM27_HUMAN	S	221	ENSP00000369699:P221S	ENSP00000369699:P221S	P	-	1	0	TMEM27	15556023	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.505000	0.45424	1.229000	0.43630	0.594000	0.82650	CCT	-	NULL		0.433	TMEM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM27	protein_coding	OTTHUMT00000055879.1	G	NM_020665		15556023	-1	no_errors	NM_020665	genbank	human	provisional	54_36p	missense	SNP	1	A
AWAT1	158833	genome.wustl.edu	37	X	69455988	69455988	+	Splice_Site	SNP	C	C	T			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chrX:69455988C>T	ENST00000374521.3	+	3	295	c.254C>T	c.(253-255)aCg>aTg	p.T85M	AWAT1_ENST00000480702.1_3'UTR	NM_001013579.2	NP_001013597.1	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	85					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)	p.T165M(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(3)|ovary(4)|skin(1)	15						TTCCCCATTACGGTAAGTATC	0.483																																																1	Substitution - Missense(1)	ovary(1)	X											135.0	113.0	121.0					X																	69455988		2203	4300	6503	69372713	SO:0001630	splice_region_variant	158833			BC039181	CCDS35321.1	Xq13.1	2010-01-25	2009-02-23	2009-02-23	ENSG00000204195	ENSG00000204195			23252	protein-coding gene	gene with protein product		300924	"""diacylglycerol O-acyltransferase 2-like 3"""	DGAT2L3		14970677, 15671038	Standard	NM_001013579		Approved		uc004dxy.3	Q58HT5	OTTHUMG00000021773	ENST00000374521.3:c.255+1C>T	X.37:g.69455988C>T		Somatic		Capture	Illumina GAIIx	Phase_III	69372713	Q5JT21|Q6IEE4	Missense_Mutation	SNP	-	p.T85M	ENST00000374521.3	37	c.254	CCDS35321.1	X	.	.	.	.	.	.	.	.	.	.	c	11.18	1.562919	0.27915	.	.	ENSG00000204195	ENST00000374521	T	0.14144	2.53	5.25	2.17	0.27698	.	0.262350	0.31909	N	0.006875	T	0.15739	0.0379	M	0.84948	2.725	0.09310	N	1	B	0.28584	0.216	B	0.21708	0.036	T	0.30851	-0.9964	10	0.72032	D	0.01	-0.7886	2.7563	0.05294	0.3799:0.3822:0.1446:0.0932	.	85	Q58HT5	AWAT1_HUMAN	M	85	ENSP00000363645:T85M	ENSP00000363645:T85M	T	+	2	0	AWAT1	69372713	0.348000	0.24861	0.253000	0.24343	0.121000	0.20230	-0.111000	0.10807	0.442000	0.26555	0.591000	0.81541	ACG	-	NULL		0.483	AWAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AWAT1	protein_coding	OTTHUMT00000057066.3	C	NM_001013579	Missense_Mutation	69372713	1	no_errors	NM_001013579	genbank	human	provisional	54_36p	missense	SNP	0.985	T
TAF1	6872	genome.wustl.edu	37	X	70627868	70627868	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chrX:70627868C>G	ENST00000373790.4	+	28	4299	c.4248C>G	c.(4246-4248)gaC>gaG	p.D1416E	TAF1_ENST00000276072.3_Missense_Mutation_p.D1437E|TAF1_ENST00000449580.1_Missense_Mutation_p.D1416E|TAF1_ENST00000423759.1_Missense_Mutation_p.D1437E	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1416	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.|Interaction with ASF1A and ASF1B.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.D1416E(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				TTGTAAAGGACTACTACAAAA	0.478																																																1	Substitution - Missense(1)	ovary(1)	X											179.0	125.0	143.0					X																	70627868		2203	4300	6503	70544593	SO:0001583	missense	6872				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.4248C>G	X.37:g.70627868C>G	ENSP00000362895:p.Asp1416Glu	Somatic		Capture	Illumina GAIIx	4	70544593	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	Bromodomain;HMMPfam_Bromodomain;TBP-binding;HMMPfam_TBP-binding;TAF(II)230 TBP-binding fragment;superfamily_TAF(II)230 TBP-binding fragment;superfamily_Bromodomain	p.D1437E	ENST00000373790.4	37	c.4311	CCDS35325.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	16.75|16.75	3.208268|3.208268	0.58343|0.58343	.|.	.|.	ENSG00000147133|ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000395779;ENST00000538124;ENST00000276072|ENST00000463163;ENST00000437147	T;T;T;T|.	0.26223|.	1.75;1.75;1.75;1.75|.	4.41|4.41	2.61|2.61	0.31194|0.31194	Bromodomain (5);Bromodomain, conserved site (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74943|0.74943	0.3783|0.3783	M|M	0.88906|0.88906	2.99|2.99	0.50467|0.50467	D|D	0.99987|0.99987	D;P;D|.	0.69078|.	0.988;0.608;0.997|.	D;P;D|.	0.73380|.	0.974;0.659;0.98|.	T|T	0.73439|0.73439	-0.3982|-0.3982	10|5	0.87932|.	D|.	0|.	.|.	8.0345|8.0345	0.30484|0.30484	0.0:0.6901:0.0:0.3099|0.0:0.6901:0.0:0.3099	.|.	1416;1416;1437|.	P21675-4;P21675;P21675-2|.	.;TAF1_HUMAN;.|.	E|S	1416;1416;1437;122;122;1437|82;71	ENSP00000362895:D1416E;ENSP00000389000:D1416E;ENSP00000406549:D1437E;ENSP00000276072:D1437E|.	ENSP00000276072:D1437E|.	D|T	+|+	3|2	2|0	TAF1|TAF1	70544593|70544593	0.984000|0.984000	0.35163|0.35163	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	0.221000|0.221000	0.17680|0.17680	0.322000|0.322000	0.23283|0.23283	0.422000|0.422000	0.28245|0.28245	GAC|ACT	-	HMMPfam_Bromodomain		0.478	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	protein_coding	OTTHUMT00000058995.2	C	NM_004606		70544593	1	no_errors	NM_004606	genbank	human	reviewed	54_36p	missense	SNP	1	G
Unknown	0	genome.wustl.edu	37	X	79817024	79817024	+	IGR	SNP	C	C	T			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chrX:79817024C>T								FAM46D (116214 upstream) : BRWD3 (109328 downstream)																							ACCTCCAGGACCACCATGAGG	0.592																																																0			X																																								79703680	SO:0001628	intergenic_variant	727874																															X.37:g.79817024C>T		Somatic		Capture	Illumina GAIIx	4	79703680		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.592					LOC727874			C			79703680	1	pseudogene	XR_042356	genbank	human	model	54_36p	rna	SNP	1	T
BCORL1	63035	genome.wustl.edu	37	X	129147148	129147148	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0890-01A-01W-0421-09	TCGA-13-0890-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	15b867fb-7a7b-4158-9abd-91870ba77eb7	29711d3a-d06a-45e5-a4a1-98527b64431f	g.chrX:129147148A>T	ENST00000218147.7	+	4	597	c.400A>T	c.(400-402)Aac>Tac	p.N134Y	BCORL1_ENST00000540052.1_Missense_Mutation_p.N134Y|BCORL1_ENST00000359304.2_Missense_Mutation_p.N134Y|BCORL1_ENST00000303743.5_Missense_Mutation_p.N134Y			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	134					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.N134Y(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CGAGGCCAGCAACAGCAGGGC	0.622																																																1	Substitution - Missense(1)	ovary(1)	X											36.0	30.0	32.0					X																	129147148		2203	4300	6503	128974829	SO:0001583	missense	63035			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.400A>T	X.37:g.129147148A>T	ENSP00000218147:p.Asn134Tyr	Somatic		Capture	Illumina GAIIx	4	128974829	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	HMMPfam_Ank;superfamily_Ankyrin repeat	p.N134Y	ENST00000218147.7	37	c.400	CCDS14616.1	X	.	.	.	.	.	.	.	.	.	.	A	12.34	1.907976	0.33721	.	.	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052	T;T;T;T	0.41065	1.01;1.37;1.01;1.01	5.01	-1.64	0.08318	.	.	.	.	.	T	0.16727	0.0402	N	0.08118	0	0.09310	N	1	B;B	0.18863	0.031;0.018	B;B	0.21360	0.034;0.019	T	0.22243	-1.0222	8	.	.	.	-0.0334	1.8462	0.03160	0.3831:0.1422:0.3399:0.1347	.	134;134	Q5H9F3-2;Q5H9F3	.;BCORL_HUMAN	Y	134	ENSP00000218147:N134Y;ENSP00000307541:N134Y;ENSP00000352253:N134Y;ENSP00000437775:N134Y	.	N	+	1	0	BCORL1	128974829	0.003000	0.15002	0.049000	0.19019	0.910000	0.53928	0.119000	0.15626	-0.446000	0.07149	0.430000	0.28490	AAC	-	NULL		0.622	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	protein_coding	OTTHUMT00000058223.1	A	NM_021946		128974829	1	no_errors	NM_021946	genbank	human	validated	54_36p	missense	SNP		T
