#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CROCC	9696	genome.wustl.edu	37	1	17295772	17295772	+	Silent	SNP	G	G	A	rs201557362	byFrequency	TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr1:17295772G>A	ENST00000375541.5	+	32	5307	c.5238G>A	c.(5236-5238)cgG>cgA	p.R1746R		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.R1746R(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ACAGCACCCGGGACAAGAACC	0.667																																																1	Substitution - coding silent(1)	ovary(1)	1											27.0	29.0	28.0					1																	17295772		2203	4300	6503	17168359	SO:0001819	synonymous_variant	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.5238G>A	1.37:g.17295772G>A		Somatic		Capture	Illumina GAIIx	Phase_III	17168359		Silent	SNP	-	p.R1746	ENST00000375541.5	37	c.5238	CCDS30616.1	1																																																																																			-	NULL		0.667	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	protein_coding	OTTHUMT00000006249.2	G	NM_014675		17168359	1	no_errors	NM_014675	genbank	human	validated	54_36p	silent	SNP	0.998	A
SLC27A3	11000	genome.wustl.edu	37	1	153750720	153750720	+	Silent	SNP	C	C	A	rs146826727		TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr1:153750720C>A	ENST00000368661.3	+	5	1451	c.1386C>A	c.(1384-1386)cgC>cgA	p.R462R	SLC27A3_ENST00000484014.1_3'UTR|SLC27A3_ENST00000271857.2_Silent_p.R543R	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	462					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)	p.R462R(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TTGTGCGGCGCTTCGGGCCCC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	1											56.0	63.0	61.0					1																	153750720		2203	4300	6503	152017344	SO:0001819	synonymous_variant	11000			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.1386C>A	1.37:g.153750720C>A		Somatic		Capture	Illumina GAIIx	4	152017344	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Silent	SNP	-	p.R462	ENST00000368661.3	37	c.1386	CCDS1053.1	1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.365838	0.24684	.	.	ENSG00000143554	ENST00000458027	.	.	.	5.13	1.96	0.26148	.	.	.	.	.	T	0.38241	0.1033	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23691	-1.0181	4	.	.	.	-22.2156	6.1032	0.20059	0.4413:0.4669:0.0:0.0917	.	.	.	.	D	167	.	.	A	+	2	0	SLC27A3	152017344	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	1.761000	0.38440	0.723000	0.32274	0.462000	0.41574	GCT	-	NULL		0.637	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A3	protein_coding		C	NM_024330		152017344	1	no_errors	NM_024330	genbank	human	provisional	54_36p	silent	SNP	1	A
PPP1R15B	84919	genome.wustl.edu	37	1	204380342	204380342	+	Silent	SNP	C	C	A			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr1:204380342C>A	ENST00000367188.4	-	1	577	c.198G>T	c.(196-198)ctG>ctT	p.L66L	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	66					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)	p.L66L(1)		breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			GCTGGGAGAGCAGTTTCGTCC	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											67.0	72.0	71.0					1																	204380342		2203	4300	6503	202646965	SO:0001819	synonymous_variant	84919			AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.198G>T	1.37:g.204380342C>A		Somatic		Capture	Illumina GAIIx	4	202646965	Q53GQ4|Q658M2|Q6P156|Q96SN1	Silent	SNP	-	p.L66	ENST00000367188.4	37	c.198	CCDS1445.1	1																																																																																			-	NULL		0.562	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15B	protein_coding	OTTHUMT00000087974.1	C	NM_032833		202646965	-1	no_errors	NM_032833	genbank	human	validated	54_36p	silent	SNP	0.75	A
COL16A1	1307	genome.wustl.edu	37	1	32146505	32146505	+	Splice_Site	SNP	C	C	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr1:32146505C>T	ENST00000373672.3	-	39	3127		c.e39+1		COL16A1_ENST00000373668.3_Splice_Site|COL16A1_ENST00000271069.6_Splice_Site	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1						cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.?(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TTGGAACTCACCTTCTCTCCT	0.607																																					Colon(143;498 1786 21362 25193 36625)											1	Unknown(1)	ovary(1)	1											97.0	106.0	103.0					1																	32146505		1958	4147	6105	31919092	SO:0001630	splice_region_variant	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2610+1G>A	1.37:g.32146505C>T		Somatic		Capture	Illumina GAIIx	4	31919092	Q16593|Q59F89|Q71RG9	Splice_Site	SNP	-	e38+1	ENST00000373672.3	37	c.2610+1	CCDS41297.1	1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.811068	0.32053	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000458715;ENST00000373668	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9126	0.79482	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL16A1	31919092	1.000000	0.71417	0.998000	0.56505	0.162000	0.22319	4.336000	0.59304	2.566000	0.86566	0.643000	0.83706	.	-	-		0.607	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	protein_coding	OTTHUMT00000011057.2	C	NM_001856	Intron	31919092	-1	no_errors	NM_001856	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
LURAP1	541468	genome.wustl.edu	37	1	46669204	46669204	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr1:46669204G>C	ENST00000371980.3	+	1	199	c.106G>C	c.(106-108)Gag>Cag	p.E36Q	POMGNT1_ENST00000396420.3_Intron|POMGNT1_ENST00000371992.1_Intron	NM_001013615.2	NP_001013633.1	Q96LR2	LURA1_HUMAN	leucine rich adaptor protein 1	36					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)		p.E36Q(1)									AGGCGAGTGTGAGCTGGGAAC	0.672																																																1	Substitution - Missense(1)	ovary(1)	1											36.0	39.0	38.0					1																	46669204		2203	4300	6503	46441791	SO:0001583	missense	541468			AK057892	CCDS30703.1	1p34.1	2012-02-01	2012-02-01	2012-02-01	ENSG00000171357	ENSG00000171357			32327	protein-coding gene	gene with protein product	"""leucine repeat adaptor protein 35a"""		"""chromosome 1 open reading frame 190"""	C1orf190		21048106	Standard	NM_001013615		Approved	FLJ25163, LRAP35a	uc010oma.2	Q96LR2	OTTHUMG00000007605	ENST00000371980.3:c.106G>C	1.37:g.46669204G>C	ENSP00000361048:p.Glu36Gln	Somatic		Capture	Illumina GAIIx	4	46441791		Missense_Mutation	SNP	-	p.E36Q	ENST00000371980.3	37	c.106	CCDS30703.1	1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.498156	0.44455	.	.	ENSG00000171357	ENST00000371980	.	.	.	4.91	4.91	0.64330	.	2.088720	0.01480	N	0.016626	T	0.45994	0.1370	N	0.22421	0.69	0.27274	N	0.958278	P	0.48503	0.911	P	0.49999	0.628	T	0.51498	-0.8698	9	0.19590	T	0.45	-14.7556	15.6296	0.76893	0.0:0.0:1.0:0.0	.	36	Q96LR2	LP35A_HUMAN	Q	36	.	ENSP00000361048:E36Q	E	+	1	0	C1orf190	46441791	1.000000	0.71417	0.974000	0.42286	0.236000	0.25371	4.154000	0.58125	2.542000	0.85734	0.563000	0.77884	GAG	-	NULL		0.672	LURAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf190	protein_coding	OTTHUMT00000020154.1	G	NM_001013615		46441791	1	no_errors	NM_001013615	genbank	human	validated	54_36p	missense	SNP	0.99	C
FAF1	11124	genome.wustl.edu	37	1	50941337	50941337	+	Silent	SNP	G	G	C			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr1:50941337G>C	ENST00000396153.2	-	18	2119	c.1668C>G	c.(1666-1668)tcC>tcG	p.S556S	FAF1_ENST00000371778.4_Silent_p.S556S|FAF1_ENST00000545823.1_Silent_p.S314S	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	556					apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.S556S(1)		breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		CTTGCTCTAAGGACAGCCGGA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	1											32.0	32.0	32.0					1																	50941337		2203	4300	6503	50713925	SO:0001819	synonymous_variant	11124			AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.1668C>G	1.37:g.50941337G>C		Somatic		Capture	Illumina GAIIx	4	50713925	Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Silent	SNP	HMMPfam_UBX;superfamily_UBA-like;superfamily_Ubiquitin-like	p.S556	ENST00000396153.2	37	c.1668	CCDS554.1	1																																																																																			-	NULL		0.542	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAF1	protein_coding	OTTHUMT00000021807.1	G	NM_007051		50713925	-1	no_errors	NM_007051	genbank	human	reviewed	54_36p	silent	SNP	1	C
PGM1	5236	genome.wustl.edu	37	1	64102039	64102039	+	Silent	SNP	C	C	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr1:64102039C>T	ENST00000371084.3	+	6	1221	c.1008C>T	c.(1006-1008)ccC>ccT	p.P336P	PGM1_ENST00000540265.1_Silent_p.P139P|PGM1_ENST00000371083.4_Silent_p.P354P	NM_002633.2	NP_002624.2	P36871	PGM1_HUMAN	phosphoglucomutase 1	336					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)	p.P336P(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20						GGAGCATGCCCACGAGTGGTG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											134.0	117.0	123.0					1																	64102039		2203	4300	6503	63874627	SO:0001819	synonymous_variant	5236			BC019920	CCDS625.1, CCDS53323.1, CCDS53324.1	1p22.1	2012-10-02			ENSG00000079739	ENSG00000079739	5.4.2.2		8905	protein-coding gene	gene with protein product		171900				4517931, 1530890	Standard	NM_002633		Approved		uc010ooz.2	P36871	OTTHUMG00000008968	ENST00000371084.3:c.1008C>T	1.37:g.64102039C>T		Somatic		Capture	Illumina GAIIx	4	63874627	B2R5N9|B4DPV0|Q16105|Q16106|Q5BKZ9|Q6NW22|Q86U74|Q96J40|Q9NTY4	Silent	SNP	superfamily_Phosphoglucomutase first 3 domains;superfamily_Phosphoglucomutase C-terminal domain;HMMPfam_PGM_PMM_IV;HMMPfam_PGM_PMM_I;HMMPfam_PGM_PMM_II;HMMPfam_PGM_PMM_III	p.P336	ENST00000371084.3	37	c.1008	CCDS625.1	1																																																																																			-	HMMPfam_PGM_PMM_III		0.562	PGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGM1	protein_coding	OTTHUMT00000024868.1	C	NM_002633		63874627	1	no_errors	NM_002633	genbank	human	provisional	54_36p	silent	SNP	1	T
OR2L8	391190	genome.wustl.edu	37	1	248112938	248112938	+	Missense_Mutation	SNP	G	G	C	rs572027464		TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr1:248112938G>C	ENST00000357191.3	+	1	779	c.779G>C	c.(778-780)cGt>cCt	p.R260P	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R260P(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			ACTTATCTACGTCCAAGATCC	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											124.0	93.0	104.0					1																	248112938		2203	4297	6500	246179561	SO:0001583	missense	391190			BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.779G>C	1.37:g.248112938G>C	ENSP00000349719:p.Arg260Pro	Somatic		Capture	Illumina GAIIx	4	246179561	Q6IF03	Missense_Mutation	SNP	-	p.R260P	ENST00000357191.3	37	c.779	CCDS31101.1	1	.	.	.	.	.	.	.	.	.	.	.	8.778	0.927567	0.18056	.	.	ENSG00000196936	ENST00000357191	T	0.38240	1.15	1.8	-0.293	0.12835	GPCR, rhodopsin-like superfamily (1);	1.357770	0.05838	U	0.618874	T	0.58750	0.2144	M	0.89715	3.055	0.09310	N	1	D	0.62365	0.991	P	0.60886	0.88	T	0.41215	-0.9521	10	0.46703	T	0.11	.	4.437	0.11555	0.5955:0.0:0.4045:0.0	.	260	Q8NGY9	OR2L8_HUMAN	P	260	ENSP00000349719:R260P	ENSP00000349719:R260P	R	+	2	0	OR2L8	246179561	0.000000	0.05858	0.056000	0.19401	0.385000	0.30292	-1.472000	0.02341	0.109000	0.17891	0.485000	0.47835	CGT	-	NULL		0.478	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L8	protein_coding	OTTHUMT00000096853.2	G			246179561	1	no_errors	NM_001001963	genbank	human	provisional	54_36p	missense	SNP		C
PALD1	27143	genome.wustl.edu	37	10	72291152	72291152	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr10:72291152T>A	ENST00000263563.6	+	5	843	c.575T>A	c.(574-576)cTc>cAc	p.L192H		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	192						cytosol (GO:0005829)		p.L192H(1)									CATGAGAACCTCCAGGGCCTT	0.612																																																1	Substitution - Missense(1)	ovary(1)	10											96.0	80.0	85.0					10																	72291152		2203	4300	6503	71961158	SO:0001583	missense	27143			AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.575T>A	10.37:g.72291152T>A	ENSP00000263563:p.Leu192His	Somatic		Capture	Illumina GAIIx	4	71961158	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	superfamily_(Phosphotyrosine protein) phosphatases II	p.L192H	ENST00000263563.6	37	c.575	CCDS31215.1	10	.	.	.	.	.	.	.	.	.	.	T	22.7	4.326634	0.81690	.	.	ENSG00000107719	ENST00000263563;ENST00000373214	T	0.30448	1.53	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.59972	0.2233	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.67461	-0.5665	10	0.87932	D	0	-29.4712	15.23	0.73381	0.0:0.0:0.0:1.0	.	192	Q9ULE6	PALD_HUMAN	H	192	ENSP00000263563:L192H	ENSP00000263563:L192H	L	+	2	0	KIAA1274	71961158	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	7.848000	0.86902	2.210000	0.71456	0.533000	0.62120	CTC	-	NULL		0.612	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1274	protein_coding	OTTHUMT00000048515.2	T	NM_014431		71961158	1	no_errors	NM_014431	genbank	human	validated	54_36p	missense	SNP	1	A
BAG3	9531	genome.wustl.edu	37	10	121436366	121436366	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr10:121436366G>A	ENST00000369085.3	+	4	1606	c.1300G>A	c.(1300-1302)Ggg>Agg	p.G434R		NM_004281.3	NP_004272.2	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	434	BAG. {ECO:0000255|PROSITE- ProRule:PRU00369}.				brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of apoptotic process (GO:0043066)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|Z disc (GO:0030018)		p.G434R(1)		endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(5)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	20		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		GAAGGTACAGGGGCTGGAGCA	0.522																																																1	Substitution - Missense(1)	ovary(1)	10											46.0	50.0	48.0					10																	121436366		2203	4300	6503	121426356	SO:0001583	missense	9531			AF095193	CCDS7615.1	10q25.2-q26.2	2014-09-17			ENSG00000151929	ENSG00000151929			939	protein-coding gene	gene with protein product		603883				9873016, 18094623	Standard	XM_005270287		Approved		uc001lem.3	O95817	OTTHUMG00000019155	ENST00000369085.3:c.1300G>A	10.37:g.121436366G>A	ENSP00000358081:p.Gly434Arg	Somatic		Capture	Illumina GAIIx	4	121426356	A8K5L8|Q3B763|Q9NT20|Q9P120	Missense_Mutation	SNP	HMMPfam_WW;superfamily_WW domain;HMMPfam_BAG;superfamily_BAG domain	p.G434R	ENST00000369085.3	37	c.1300	CCDS7615.1	10	.	.	.	.	.	.	.	.	.	.	G	16.18	3.050046	0.55218	.	.	ENSG00000151929	ENST00000369085	D	0.86694	-2.16	5.73	4.82	0.62117	BAG domain (3);	0.361011	0.34460	N	0.003943	T	0.79405	0.4440	N	0.04508	-0.205	0.32579	N	0.528779	B;B	0.29571	0.249;0.249	P;P	0.51135	0.66;0.66	T	0.75736	-0.3213	10	0.15952	T	0.53	-17.112	2.8257	0.05484	0.1595:0.1444:0.5466:0.1495	.	434;434	O95817;Q53GY1	BAG3_HUMAN;.	R	434	ENSP00000358081:G434R	ENSP00000358081:G434R	G	+	1	0	BAG3	121426356	0.974000	0.33945	0.998000	0.56505	0.989000	0.77384	2.074000	0.41529	1.551000	0.49450	0.655000	0.94253	GGG	-	HMMPfam_BAG		0.522	BAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG3	protein_coding	OTTHUMT00000050662.1	G	NM_004281		121426356	1	no_errors	NM_004281	genbank	human	reviewed	54_36p	missense	SNP	0.31	A
SLC17A6	57084	genome.wustl.edu	37	11	22397548	22397548	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr11:22397548C>A	ENST00000263160.3	+	10	1632	c.1195C>A	c.(1195-1197)Ctg>Atg	p.L399M		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	399					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.L399V(1)|p.L399M(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						GGAAGCCACACTGCTCCTGGT	0.388																																																2	Substitution - Missense(2)	ovary(1)|kidney(1)	11											161.0	165.0	164.0					11																	22397548		2203	4300	6503	22354124	SO:0001583	missense	57084			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1195C>A	11.37:g.22397548C>A	ENSP00000263160:p.Leu399Met	Somatic		Capture	Illumina GAIIx	4	22354124	A6NKS2	Missense_Mutation	SNP	HMMPfam_MFS_1;superfamily_MFS general substrate transporter	p.L399M	ENST00000263160.3	37	c.1195	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	C	17.00	3.276832	0.59758	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.59083	0.29	6.17	-0.244	0.13031	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.53318	0.1789	L	0.43152	1.355	0.45690	D	0.998602	B	0.32893	0.389	B	0.42959	0.403	T	0.53858	-0.8379	10	0.62326	D	0.03	.	11.0429	0.47842	0.0:0.6473:0.0:0.3527	.	399	Q9P2U8	VGLU2_HUMAN	M	399;287	ENSP00000263160:L399M	ENSP00000263160:L399M	L	+	1	2	SLC17A6	22354124	0.039000	0.19947	0.149000	0.22428	0.845000	0.48019	0.510000	0.22723	-0.050000	0.13356	-0.140000	0.14226	CTG	-	HMMPfam_MFS_1		0.388	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	protein_coding	OTTHUMT00000387671.1	C	NM_020346		22354124	1	no_errors	NM_020346	genbank	human	validated	54_36p	missense	SNP	0.93	A
OR5AS1	219447	genome.wustl.edu	37	11	55798688	55798688	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr11:55798688G>C	ENST00000313555.1	+	1	794	c.794G>C	c.(793-795)aGc>aCc	p.S265T		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S265T(1)		endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					CCCACCACTAGCTATTCCCTA	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											102.0	87.0	92.0					11																	55798688		2201	4296	6497	55555264	SO:0001583	missense	219447			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.794G>C	11.37:g.55798688G>C	ENSP00000324111:p.Ser265Thr	Somatic		Capture	Illumina GAIIx	4	55555264	Q6IFB8	Missense_Mutation	SNP	-	p.S265T	ENST00000313555.1	37	c.794	CCDS31516.1	11	.	.	.	.	.	.	.	.	.	.	G	8.251	0.808965	0.16537	.	.	ENSG00000181785	ENST00000313555	T	0.00115	8.71	5.14	2.99	0.34606	GPCR, rhodopsin-like superfamily (1);	0.389671	0.18794	U	0.130989	T	0.00144	0.0004	L	0.29908	0.895	0.09310	N	1	P	0.47484	0.896	P	0.48952	0.596	T	0.41305	-0.9516	10	0.56958	D	0.05	.	2.6933	0.05127	0.2698:0.0:0.5065:0.2237	.	265	Q8N127	O5AS1_HUMAN	T	265	ENSP00000324111:S265T	ENSP00000324111:S265T	S	+	2	0	OR5AS1	55555264	0.000000	0.05858	0.919000	0.36401	0.070000	0.16714	-0.157000	0.10085	1.154000	0.42482	0.579000	0.79373	AGC	-	NULL		0.413	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AS1	protein_coding	OTTHUMT00000391538.1	G	NM_001001921		55555264	1	no_errors	NM_001001921	genbank	human	provisional	54_36p	missense	SNP	0.01	C
OR5B2	390190	genome.wustl.edu	37	11	58190045	58190045	+	Silent	SNP	C	C	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr11:58190045C>T	ENST00000302581.2	-	1	741	c.690G>A	c.(688-690)aaG>aaA	p.K230K		NM_001005566.2	NP_001005566.1	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B, member 2	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K230K(1)		NS(2)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TTTGGTGTCCCTTAGCTGAAT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	11											104.0	97.0	99.0					11																	58190045		2201	4295	6496	57946621	SO:0001819	synonymous_variant	390190			AB065852	CCDS31550.1	11q12.1	2012-08-09			ENSG00000172365	ENSG00000172365		"""GPCR / Class A : Olfactory receptors"""	8323	protein-coding gene	gene with protein product							Standard	NM_001005566		Approved	OST073	uc010rkg.2	Q96R09	OTTHUMG00000167517	ENST00000302581.2:c.690G>A	11.37:g.58190045C>T		Somatic		Capture	Illumina GAIIx	4	57946621	B2RNJ6|B9EGY7|Q6IEV7|Q8NGF5	Silent	SNP	-	p.K230	ENST00000302581.2	37	c.690	CCDS31550.1	11																																																																																			-	NULL		0.413	OR5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B2	protein_coding	OTTHUMT00000394887.2	C	NM_001005566		57946621	-1	no_errors	NM_001005566	genbank	human	provisional	54_36p	silent	SNP	0.01	T
RNF169	254225	genome.wustl.edu	37	11	74546864	74546864	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr11:74546864A>G	ENST00000299563.4	+	6	1229	c.1216A>G	c.(1216-1218)Atc>Gtc	p.I406V		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	406					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)	p.I406V(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						AAGTCCTCTCATCATCAAATC	0.483																																																1	Substitution - Missense(1)	ovary(1)	11											138.0	142.0	141.0					11																	74546864		1993	4166	6159	74224512	SO:0001583	missense	254225			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.1216A>G	11.37:g.74546864A>G	ENSP00000299563:p.Ile406Val	Somatic		Capture	Illumina GAIIx	4	74224512	Q6N015	Missense_Mutation	SNP	-	p.I406V	ENST00000299563.4	37	c.1216	CCDS41691.1	11	.	.	.	.	.	.	.	.	.	.	A	16.70	3.196042	0.58126	.	.	ENSG00000166439	ENST00000299563	T	0.58060	0.36	5.99	5.99	0.97316	.	0.046002	0.85682	D	0.000000	T	0.62913	0.2467	M	0.79475	2.455	0.80722	D	1	P	0.47604	0.898	P	0.47891	0.56	T	0.68674	-0.5346	10	0.72032	D	0.01	-18.3951	14.4413	0.67321	1.0:0.0:0.0:0.0	.	406	Q8NCN4	RN169_HUMAN	V	406	ENSP00000299563:I406V	ENSP00000299563:I406V	I	+	1	0	RNF169	74224512	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.734000	0.68580	2.296000	0.77279	0.533000	0.62120	ATC	-	NULL		0.483	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF169	protein_coding	OTTHUMT00000384741.1	A	XM_495886		74224512	1	no_errors	NM_001098638	genbank	human	validated	54_36p	missense	SNP	1	G
NOX4	50507	genome.wustl.edu	37	11	89223629	89223629	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr11:89223629C>A	ENST00000263317.4	-	2	388	c.150G>T	c.(148-150)ttG>ttT	p.L50F	NOX4_ENST00000527956.1_Missense_Mutation_p.L26F|NOX4_ENST00000528341.1_Intron|NOX4_ENST00000531342.1_Missense_Mutation_p.L50F|NOX4_ENST00000375979.3_Missense_Mutation_p.L50F|NOX4_ENST00000532825.1_Missense_Mutation_p.L26F|NOX4_ENST00000534731.1_Missense_Mutation_p.L50F|NOX4_ENST00000527626.1_5'UTR|NOX4_ENST00000413594.2_Missense_Mutation_p.L71F|NOX4_ENST00000424319.1_Missense_Mutation_p.L26F|NOX4_ENST00000525196.1_Missense_Mutation_p.L50F|NOX4_ENST00000393282.2_Missense_Mutation_p.L50F|NOX4_ENST00000535633.1_Missense_Mutation_p.L26F|NOX4_ENST00000542487.1_Missense_Mutation_p.L26F|NOX4_ENST00000343727.5_Missense_Mutation_p.L26F			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	50					bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)	p.L50F(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				TACTTACCCCCAACATCTGGT	0.438																																																1	Substitution - Missense(1)	ovary(1)	11											131.0	125.0	127.0					11																	89223629		2201	4299	6500	88863277	SO:0001583	missense	50507			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.150G>T	11.37:g.89223629C>A	ENSP00000263317:p.Leu50Phe	Somatic		Capture	Illumina GAIIx	4	88863277	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	HMMPfam_FAD_binding_8;HMMPfam_NAD_binding_6;HMMPfam_Ferric_reduct;superfamily_Ferredoxin reductase-like C-terminal NADP-linked domain;superfamily_Riboflavin synthase domain-like	p.L50F	ENST00000263317.4	37	c.150	CCDS8285.1	11	.	.	.	.	.	.	.	.	.	.	C	15.31	2.796935	0.50208	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000413594;ENST00000531342;ENST00000375979;ENST00000393282	D;D;D;D;D;D;D;D;D;D;D;D	0.96073	-3.82;-3.82;-3.82;-3.81;-3.82;-3.74;-3.9;-3.82;-3.82;-3.86;-3.32;-3.14	5.1	1.47	0.22746	.	0.000000	0.64402	D	0.000012	D	0.96700	0.8923	M	0.84082	2.675	0.43050	D	0.99465	P;D;D;D;P;B	0.69078	0.892;0.995;0.997;0.997;0.73;0.441	B;D;D;D;B;B	0.75484	0.248;0.969;0.986;0.986;0.119;0.132	D	0.94646	0.7835	9	.	.	.	-9.0866	5.3341	0.15947	0.0:0.4683:0.0:0.5317	.	26;50;50;50;50;50	E9PMY6;E9PI95;Q9NPH5-3;Q9NPH5-4;Q9NPH5-6;Q9NPH5	.;.;.;.;.;NOX4_HUMAN	F	26;26;26;50;50;50;26;26;26;71;50;50;50	ENSP00000412446:L26F;ENSP00000440172:L26F;ENSP00000344747:L26F;ENSP00000436892:L50F;ENSP00000436716:L50F;ENSP00000263317:L50F;ENSP00000434924:L26F;ENSP00000433797:L26F;ENSP00000439373:L26F;ENSP00000405705:L71F;ENSP00000435039:L50F;ENSP00000365146:L50F	.	L	-	3	2	NOX4	88863277	1.000000	0.71417	0.996000	0.52242	0.470000	0.32858	0.873000	0.28052	0.443000	0.26582	0.313000	0.20887	TTG	-	NULL		0.438	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	protein_coding	OTTHUMT00000394054.1	C	NM_016931		88863277	-1	no_errors	NM_016931	genbank	human	reviewed	54_36p	missense	SNP	1	A
TAS2R43	259289	genome.wustl.edu	37	12	11243973	11243973	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr12:11243973G>C	ENST00000531678.1	-	1	939	c.856C>G	c.(856-858)Cta>Gta	p.L286V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	286					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.L286V(1)		endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		GTCTGCTTTAGCTTCTTGTTT	0.413																																																1	Substitution - Missense(1)	ovary(1)	12											129.0	107.0	114.0					12																	11243973		1925	4126	6051	11135240	SO:0001583	missense	259289			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.856C>G	12.37:g.11243973G>C	ENSP00000431719:p.Leu286Val	Somatic		Capture	Illumina GAIIx	4	11135240	P59546|Q645X4	Missense_Mutation	SNP	-	p.L286V	ENST00000531678.1	37	c.856	CCDS53749.1	12	.	.	.	.	.	.	.	.	.	.	-	10.80	1.452769	0.26074	.	.	ENSG00000255374	ENST00000531678	T	0.01725	4.67	2.54	0.186	0.15105	.	.	.	.	.	T	0.11580	0.0282	H	0.95079	3.62	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.11641	-1.0579	9	0.87932	D	0	.	2.6001	0.04864	0.1812:0.0:0.5377:0.281	.	286	P59537	T2R43_HUMAN	V	286	ENSP00000431719:L286V	ENSP00000431719:L286V	L	-	1	2	TAS2R43	11135240	0.536000	0.26378	0.077000	0.20336	0.051000	0.14879	0.657000	0.24963	0.166000	0.19597	0.195000	0.17529	CTA	-	NULL		0.413	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	protein_coding	OTTHUMT00000383561.1	G	NM_176884		11135240	-1	no_errors	NM_176884	genbank	human	provisional	54_36p	missense	SNP	0.01	C
NT5DC3	51559	genome.wustl.edu	37	12	104208741	104208741	+	Missense_Mutation	SNP	G	G	A	rs368049739		TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr12:104208741G>A	ENST00000392876.3	-	2	407	c.367C>T	c.(367-369)Cgg>Tgg	p.R123W		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	123						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.R48W(1)		NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						AGAAGGTCCCGTGCAGCATTA	0.458																																																1	Substitution - Missense(1)	ovary(1)	12						G	TRP/ARG	0,4406		0,0,2203	168.0	157.0	161.0		367	5.9	1.0	12		161	1,8599		0,1,4299	no	missense	NT5DC3	NM_001031701.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	123/549	104208741	1,13005	2203	4300	6503	102732871	SO:0001583	missense	51559			AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.367C>T	12.37:g.104208741G>A	ENSP00000376615:p.Arg123Trp	Somatic		Capture	Illumina GAIIx	4	102732871	Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	-	p.R123W	ENST00000392876.3	37	c.367	CCDS41824.1	12	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799593	0.90538	0.0	1.16E-4	ENSG00000111696	ENST00000392876	T	0.23552	1.9	5.87	5.87	0.94306	HAD-like domain (1);	0.000000	0.85682	D	0.000000	T	0.56834	0.2012	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.61138	-0.7123	10	0.72032	D	0.01	-34.9703	15.3178	0.74095	0.0:0.0:0.8602:0.1398	.	123	Q86UY8	NT5D3_HUMAN	W	123	ENSP00000376615:R123W	ENSP00000376615:R123W	R	-	1	2	NT5DC3	102732871	0.997000	0.39634	0.992000	0.48379	0.919000	0.55068	2.528000	0.45624	2.941000	0.99782	0.655000	0.94253	CGG	-	NULL		0.458	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5DC3	protein_coding	OTTHUMT00000347118.2	G	NM_016575		102732871	-1	no_errors	NM_001031701	genbank	human	validated	54_36p	missense	SNP	1	A
ACSM4	341392	genome.wustl.edu	37	12	7463142	7463142	+	Silent	SNP	C	C	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr12:7463142C>T	ENST00000399422.4	+	3	468	c.420C>T	c.(418-420)atC>atT	p.I140I		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	140					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						CAGGGATCATCTTCATGCCGG	0.562																																																0			12											26.0	27.0	27.0					12																	7463142		2054	4199	6253	7354409	SO:0001819	synonymous_variant	341392				CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.420C>T	12.37:g.7463142C>T		Somatic		Capture	Illumina GAIIx	4	7354409	A8MTI6	Silent	SNP	-	p.I140	ENST00000399422.4	37	c.420	CCDS44825.1	12																																																																																			-	NULL		0.562	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ACSM4	protein_coding	OTTHUMT00000337866.2	C	NM_001080454		7354409	1	no_errors	NM_001080454	genbank	human	inferred	54_36p	silent	SNP	0.86	T
FGD6	55785	genome.wustl.edu	37	12	95478360	95478360	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr12:95478360C>G	ENST00000343958.4	-	20	4393	c.4170G>C	c.(4168-4170)gaG>gaC	p.E1390D		NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	1390	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.E1390D(1)		breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						ACTCGGAATTCTCATCTTTAA	0.353																																																1	Substitution - Missense(1)	ovary(1)	12											98.0	106.0	103.0					12																	95478360		2203	4300	6503	94002491	SO:0001583	missense	55785			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.4170G>C	12.37:g.95478360C>G	ENSP00000344446:p.Glu1390Asp	Somatic		Capture	Illumina GAIIx	4	94002491	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	-	p.E1390D	ENST00000343958.4	37	c.4170	CCDS31878.1	12	.	.	.	.	.	.	.	.	.	.	C	12.97	2.096529	0.36952	.	.	ENSG00000180263	ENST00000343958	T	0.75589	-0.95	4.98	0.847	0.18961	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.45606	D	0.000342	T	0.60945	0.2308	L	0.41632	1.29	0.80722	D	1	B	0.15719	0.014	B	0.22152	0.038	T	0.51260	-0.8728	10	0.51188	T	0.08	-9.4326	5.8791	0.18846	0.0:0.3513:0.3947:0.254	.	1390	Q6ZV73	FGD6_HUMAN	D	1390	ENSP00000344446:E1390D	ENSP00000344446:E1390D	E	-	3	2	FGD6	94002491	0.018000	0.18449	0.993000	0.49108	0.758000	0.43043	-0.024000	0.12435	0.117000	0.18138	0.491000	0.48974	GAG	-	NULL		0.353	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD6	protein_coding	OTTHUMT00000407600.1	C	NM_018351		94002491	-1	no_errors	NM_018351	genbank	human	validated	54_36p	missense	SNP	0.99	G
GPR133	283383	genome.wustl.edu	37	12	131488816	131488816	+	Silent	SNP	C	C	A			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr12:131488816C>A	ENST00000261654.5	+	11	1789	c.1230C>A	c.(1228-1230)atC>atA	p.I410I	GPR133_ENST00000535015.1_Silent_p.I442I|GPR133_ENST00000376682.4_Silent_p.I96I	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	410					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I410I(1)		NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TCATCCAGATCCCCCACGAGG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	12											70.0	61.0	64.0					12																	131488816		2203	4300	6503	130054769	SO:0001819	synonymous_variant	283383			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1230C>A	12.37:g.131488816C>A		Somatic		Capture	Illumina GAIIx	4	130054769	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Silent	SNP	HMMPfam_GPS;HMMPfam_7tm_2;superfamily_Concanavalin A-like lectins/glucanases;superfamily_Family A G protein-coupled receptor-like	p.I410	ENST00000261654.5	37	c.1230	CCDS9272.1	12																																																																																			-	NULL		0.612	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR133	protein_coding	OTTHUMT00000399356.1	C	NM_198827		130054769	1	no_errors	NM_198827	genbank	human	validated	54_36p	silent	SNP	0.01	A
TUBA3C	7278	genome.wustl.edu	37	13	19751364	19751364	+	Silent	SNP	C	C	T	rs527372781	byFrequency	TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr13:19751364C>T	ENST00000400113.3	-	4	863	c.759G>A	c.(757-759)acG>acA	p.T253T		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	253					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.T253T(2)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TCTGGAATTCCGTCAAGTCCA	0.612													C|||	4	0.000798722	0.0	0.0	5008	,	,		18879	0.0		0.0	False		,,,				2504	0.0041															2	Substitution - coding silent(2)	ovary(2)	13											148.0	131.0	137.0					13																	19751364		2203	4300	6503	18649364	SO:0001819	synonymous_variant	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.759G>A	13.37:g.19751364C>T		Somatic		Capture	Illumina GAIIx	4	18649364	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	HMMPfam_Tubulin;HMMPfam_Tubulin_C;superfamily_Tubulin nucleotide-binding domain-like;superfamily_Tubulin C-terminal domain-like	p.T253	ENST00000400113.3	37	c.759	CCDS9284.1	13																																																																																			-	HMMPfam_Tubulin_C		0.612	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	protein_coding	OTTHUMT00000044007.2	C	NM_006001		18649364	-1	no_errors	NM_006001	genbank	human	reviewed	54_36p	silent	SNP	0.96	T
Unknown	0	genome.wustl.edu	37	15	20433866	20433866	+	IGR	SNP	C	C	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr15:20433866C>G								RP11-173D3.1 (80660 upstream) : CHEK2P2 (54130 downstream)																							TTTGTTTCCTCACATTAGTAT	0.478																																																0			15																																								18693880	SO:0001628	intergenic_variant	646090																															15.37:g.20433866C>G		Somatic		Capture	Illumina GAIIx	4	18693880		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.478					LOC646090			C			18693880	-1	pseudogene	XR_017120	genbank	human	model	54_36p	rna	SNP		G
ZNF770	54989	genome.wustl.edu	37	15	35274048	35274048	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr15:35274048G>A	ENST00000356321.4	-	3	1932	c.1588C>T	c.(1588-1590)Cct>Tct	p.P530S		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	530					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.P530S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		GATGCATAAGGACTCTTTTCA	0.363																																																1	Substitution - Missense(1)	ovary(1)	15											75.0	77.0	76.0					15																	35274048		2201	4297	6498	33061340	SO:0001583	missense	54989			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.1588C>T	15.37:g.35274048G>A	ENSP00000348673:p.Pro530Ser	Somatic		Capture	Illumina GAIIx	4	33061340	Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.P530S	ENST00000356321.4	37	c.1588	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	G	9.870	1.198582	0.22121	.	.	ENSG00000198146	ENST00000356321	T	0.13901	2.55	5.1	4.17	0.49024	Zinc finger, C2H2 (1);	0.263175	0.29133	N	0.013050	T	0.13457	0.0326	L	0.27053	0.805	0.31892	N	0.617073	D	0.55605	0.972	P	0.48304	0.573	T	0.05683	-1.0870	10	0.72032	D	0.01	-7.8507	10.0737	0.42347	0.0:0.2762:0.5815:0.1423	.	530	Q6IQ21	ZN770_HUMAN	S	530	ENSP00000348673:P530S	ENSP00000348673:P530S	P	-	1	0	ZNF770	33061340	1.000000	0.71417	0.991000	0.47740	0.909000	0.53808	4.184000	0.58323	1.351000	0.45789	0.467000	0.42956	CCT	-	NULL		0.363	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	protein_coding	OTTHUMT00000251896.2	G	NM_014106		33061340	-1	no_errors	NM_014106	genbank	human	validated	54_36p	missense	SNP	1	A
BRD4	23476	genome.wustl.edu	37	19	15379765	15379765	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr19:15379765C>T	ENST00000263377.2	-	3	595	c.374G>A	c.(373-375)tGt>tAt	p.C125Y	BRD4_ENST00000371835.4_Missense_Mutation_p.C125Y|BRD4_ENST00000360016.5_Missense_Mutation_p.C125Y	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	125	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)	p.C125Y(2)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GTCCTGGATACATTCCTGAGC	0.443			T	C15orf55	lethal midline carcinoma of young people																																		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	2	Substitution - Missense(2)	ovary(2)	19											170.0	152.0	158.0					19																	15379765		2203	4300	6503	15240765	SO:0001583	missense	23476			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.374G>A	19.37:g.15379765C>T	ENSP00000263377:p.Cys125Tyr	Somatic		Capture	Illumina GAIIx	4	15240765	O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	HMMPfam_Bromodomain;superfamily_Bromodomain	p.C125Y	ENST00000263377.2	37	c.374	CCDS12328.1	19	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617952	0.87359	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.28666	1.6;1.6;1.6	5.25	5.25	0.73442	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.64402	D	0.000003	T	0.51736	0.1692	L	0.51853	1.615	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	T	0.53027	-0.8496	10	0.87932	D	0	-6.8729	17.6218	0.88084	0.0:1.0:0.0:0.0	.	125;125;125	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	Y	125	ENSP00000263377:C125Y;ENSP00000360901:C125Y;ENSP00000353112:C125Y	ENSP00000263377:C125Y	C	-	2	0	BRD4	15240765	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.455000	0.83008	0.655000	0.94253	TGT	-	HMMPfam_Bromodomain		0.443	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BRD4	protein_coding	OTTHUMT00000465800.3	C	NM_058243		15240765	-1	no_errors	NM_058243	genbank	human	reviewed	54_36p	missense	SNP	1	T
KIRREL2	84063	genome.wustl.edu	37	19	36351230	36351230	+	Silent	SNP	A	A	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr19:36351230A>G	ENST00000360202.5	+	6	903	c.705A>G	c.(703-705)ccA>ccG	p.P235P	NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000592409.1_Silent_p.P235P|KIRREL2_ENST00000262625.7_Silent_p.P235P|KIRREL2_ENST00000347900.6_Silent_p.P185P	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	235	Ig-like C2-type 3.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)		p.P235P(1)		breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTGCTTCGCCACACACTGTGC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	19											77.0	62.0	67.0					19																	36351230		2203	4300	6503	41043070	SO:0001819	synonymous_variant	84063			AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.705A>G	19.37:g.36351230A>G		Somatic		Capture	Illumina GAIIx	4	41043070	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Silent	SNP	HMMPfam_I-set;HMMPfam_V-set;HMMPfam_C2-set_2;superfamily_Immunoglobulin	p.P235	ENST00000360202.5	37	c.705	CCDS12481.1	19																																																																																			-	HMMPfam_I-set		0.607	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL2	protein_coding	OTTHUMT00000452561.1	A	NM_032123		41043070	1	no_errors	NM_199180	genbank	human	validated	54_36p	silent	SNP	1	G
CYP2F1	1572	genome.wustl.edu	37	19	41627882	41627882	+	Silent	SNP	C	C	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr19:41627882C>T	ENST00000331105.2	+	6	738	c.666C>T	c.(664-666)agC>agT	p.S222S		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	222					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.S222S(1)		central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						TCTTCCCGAGCCTCCTGGACT	0.597																																																1	Substitution - coding silent(1)	ovary(1)	19											73.0	75.0	74.0					19																	41627882		2202	4299	6501	46319722	SO:0001819	synonymous_variant	1572			J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.666C>T	19.37:g.41627882C>T		Somatic		Capture	Illumina GAIIx	4	46319722	A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Silent	SNP	-	p.S222	ENST00000331105.2	37	c.666	CCDS12572.1	19																																																																																			-	NULL		0.597	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2F1	protein_coding	OTTHUMT00000394527.2	C			46319722	1	no_errors	NM_000774	genbank	human	reviewed	54_36p	silent	SNP	0	T
CIC	23152	genome.wustl.edu	37	19	42796462	42796474	+	Frame_Shift_Del	DEL	GTGCAGTCAGCGG	GTGCAGTCAGCGG	-	rs367725186|rs148075505		TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	GTGCAGTCAGCGG	GTGCAGTCAGCGG	GTGCAGTCAGCGG	-	GTGCAGTCAGCGG	GTGCAGTCAGCGG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr19:42796462_42796474delGTGCAGTCAGCGG	ENST00000575354.2	+	13	3059_3071	c.3019_3031delGTGCAGTCAGCGG	c.(3019-3033)gtgcagtcagcgggcfs	p.VQSAG1007fs	CIC_ENST00000160740.3_Frame_Shift_Del_p.VQSAG1007fs|CIC_ENST00000572681.2_Frame_Shift_Del_p.VQSAG1916fs	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	1007	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V1007fs*28(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				AATCACCTATGTGCAGTCAGCGGGCGGGCACGC	0.648			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	1	Deletion - Frameshift(1)	ovary(1)	19																																								47488314	SO:0001589	frameshift_variant	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.3019_3031delGTGCAGTCAGCGG	19.37:g.42796462_42796474delGTGCAGTCAGCGG	ENSP00000458663:p.Val1007fs	Somatic		Capture	Illumina GAIIx	4	47488302	Q7LGI1|Q9UEG5|Q9Y6T1	Frame_Shift_Del	DEL	HMMPfam_HMG_box;superfamily_HMG-box	p.V1007fs	ENST00000575354.2	37	c.3019_3031	CCDS12601.1	19																																																																																			(deletion:cds_exon[47488292;47488458])	NULL		0.648	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIC	protein_coding	OTTHUMT00000438532.2	GTGCAGTCAGCGG			47488314	1	no_errors	NM_015125	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.997:0.998:0.974:0.690:0.757	-
MYH14	79784	genome.wustl.edu	37	19	50805001	50805001	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr19:50805001G>T	ENST00000596571.1	+	37	5430	c.5430G>T	c.(5428-5430)caG>caT	p.Q1810H	MYH14_ENST00000440075.2_Missense_Mutation_p.Q1851H|MYH14_ENST00000262269.8_Missense_Mutation_p.Q1851H|MYH14_ENST00000425460.1_Missense_Mutation_p.Q1818H|MYH14_ENST00000376970.2_Missense_Mutation_p.Q1843H|MYH14_ENST00000601313.1_Missense_Mutation_p.Q1851H|MYH14_ENST00000598205.1_Missense_Mutation_p.Q1818H			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1810					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TGGAACGGCAGATCCAGGAGC	0.627																																																0			19											38.0	45.0	43.0					19																	50805001		2057	4207	6264	55496813	SO:0001583	missense	79784			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.5430G>T	19.37:g.50805001G>T	ENSP00000472819:p.Gln1810His	Somatic		Capture	Illumina GAIIx	4	55496813	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	-	p.Q1818H	ENST00000596571.1	37	c.5454	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534255	0.64972	.	.	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03	4.08	0.807	0.18714	Myosin tail (1);	.	.	.	.	D	0.90034	0.6888	M	0.77616	2.38	0.35672	D	0.813354	D;B;D	0.89917	1.0;0.337;1.0	D;B;D	0.97110	0.999;0.346;1.0	D	0.89504	0.3766	9	0.62326	D	0.03	.	7.4346	0.27148	0.3136:0.0:0.6864:0.0	.	1851;1810;1818	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	H	1851;1843;1818;1594;1851	ENSP00000406273:Q1851H;ENSP00000366169:Q1843H;ENSP00000407879:Q1818H;ENSP00000262269:Q1851H	ENSP00000262269:Q1851H	Q	+	3	2	MYH14	55496813	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.881000	0.56152	0.491000	0.27793	0.591000	0.81541	CAG	-	NULL		0.627	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	protein_coding	OTTHUMT00000464710.2	G	NM_024729		55496813	1	no_errors	NM_001077186	genbank	human	reviewed	54_36p	missense	SNP	1	T
RNF144A	9781	genome.wustl.edu	37	2	7137070	7137070	+	Silent	SNP	A	A	C			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr2:7137070A>C	ENST00000320892.6	+	3	455	c.13A>C	c.(13-15)Agg>Cgg	p.R5R	RNF144A_ENST00000467276.1_Intron	NM_014746.3	NP_055561.2	P50876	R144A_HUMAN	ring finger protein 144A	5					protein ubiquitination (GO:0016567)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R5R(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)	25	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		GACCACAACAAGGTACCGGCC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	2											89.0	82.0	84.0					2																	7137070		2203	4300	6503	7054521	SO:0001819	synonymous_variant	9781			D79983	CCDS1657.1	2p25.2	2008-02-05	2007-08-20	2007-08-20	ENSG00000151692	ENSG00000151692		"""RING-type (C3HC4) zinc fingers"""	20457	protein-coding gene	gene with protein product			"""ring finger protein 144"""	RNF144		8724849, 10431818	Standard	NM_014746		Approved	UBCE7IP4, KIAA0161	uc002qys.3	P50876	OTTHUMG00000090353	ENST00000320892.6:c.13A>C	2.37:g.7137070A>C		Somatic		Capture	Illumina GAIIx	4	7054521	D6W4Y6|Q585H5	Silent	SNP	-	p.R5	ENST00000320892.6	37	c.13	CCDS1657.1	2																																																																																			-	NULL		0.607	RNF144A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF144A	protein_coding	OTTHUMT00000206725.2	A	NM_014746		7054521	1	no_errors	NM_014746	genbank	human	reviewed	54_36p	silent	SNP	1	C
NDUFS1	4719	genome.wustl.edu	37	2	207003288	207003288	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr2:207003288A>C	ENST00000233190.6	-	13	1579	c.1313T>G	c.(1312-1314)cTc>cGc	p.L438R	NDUFS1_ENST00000423725.1_Missense_Mutation_p.L381R|NDUFS1_ENST00000455934.2_Missense_Mutation_p.L452R|NDUFS1_ENST00000440274.1_Missense_Mutation_p.L402R|NDUFS1_ENST00000449699.1_Missense_Mutation_p.L438R|NDUFS1_ENST00000457011.1_Missense_Mutation_p.L322R|NDUFS1_ENST00000432169.1_Missense_Mutation_p.L327R	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	438					apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.L438R(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGTGTAAGTGAGGTCCACTGG	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											107.0	107.0	107.0					2																	207003288		2203	4300	6503	206711533	SO:0001583	missense	4719				CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.1313T>G	2.37:g.207003288A>C	ENSP00000233190:p.Leu438Arg	Somatic		Capture	Illumina GAIIx	4	206711533	B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Missense_Mutation	SNP	HMMPfam_Fer2;superfamily_2Fe-2S ferredoxin-like;HMMPfam_Molybdopterin;HMMPfam_DUF1982;superfamily_Formate dehydrogenase/DMSO reductase domains 1-3;superfamily_4Fe-4S ferredoxins	p.L438R	ENST00000233190.6	37	c.1313	CCDS2366.1	2	.	.	.	.	.	.	.	.	.	.	A	23.2	4.390115	0.82902	.	.	ENSG00000023228	ENST00000233190;ENST00000423725;ENST00000457011;ENST00000440274;ENST00000455934;ENST00000449699;ENST00000432169	D;D;D;D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49	5.05	5.05	0.67936	Molybdopterin oxidoreductase (1);	0.063640	0.64402	D	0.000006	D	0.95921	0.8672	H	0.94542	3.55	0.80722	D	1	D;D;D;D	0.89917	0.967;1.0;1.0;1.0	D;D;D;D	0.91635	0.929;0.999;0.999;0.999	D	0.97019	0.9742	10	0.72032	D	0.01	-17.2628	15.0165	0.71588	1.0:0.0:0.0:0.0	.	327;402;452;438	B4DPG1;E7ENF3;B4DJA0;P28331	.;.;.;NDUS1_HUMAN	R	438;381;322;402;452;438;327	ENSP00000233190:L438R;ENSP00000397760:L381R;ENSP00000400976:L322R;ENSP00000409766:L402R;ENSP00000392709:L452R;ENSP00000399912:L438R;ENSP00000409689:L327R	ENSP00000233190:L438R	L	-	2	0	NDUFS1	206711533	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.138000	0.94501	2.132000	0.65825	0.472000	0.43445	CTC	-	HMMPfam_Molybdopterin		0.413	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFS1	protein_coding	OTTHUMT00000256391.4	A	NM_005006		206711533	-1	no_errors	NM_005006	genbank	human	reviewed	54_36p	missense	SNP	1	C
NCOA6	23054	genome.wustl.edu	37	20	33328652	33328652	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr20:33328652G>T	ENST00000374796.2	-	12	7978	c.5408C>A	c.(5407-5409)tCc>tAc	p.S1803Y	NCOA6_ENST00000359003.2_Missense_Mutation_p.S1803Y			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1803	EP300/CRSP3-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.S1803Y(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GTTGCCAGAGGACCCTGGACT	0.488																																																1	Substitution - Missense(1)	ovary(1)	20											79.0	78.0	78.0					20																	33328652		2203	4300	6503	32792313	SO:0001583	missense	23054			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.5408C>A	20.37:g.33328652G>T	ENSP00000363929:p.Ser1803Tyr	Somatic		Capture	Illumina GAIIx	4	32792313	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	-	p.S1803Y	ENST00000374796.2	37	c.5408	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430343	0.62844	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.26223	1.75;1.75	5.65	4.7	0.59300	.	0.280434	0.31531	N	0.007485	T	0.15998	0.0385	N	0.19112	0.55	0.33858	D	0.633442	B	0.30406	0.278	B	0.31337	0.128	T	0.19095	-1.0316	10	0.52906	T	0.07	-7.4797	7.2237	0.26003	0.0836:0.0:0.7484:0.168	.	1803	Q14686	NCOA6_HUMAN	Y	1803	ENSP00000363929:S1803Y;ENSP00000351894:S1803Y	ENSP00000351894:S1803Y	S	-	2	0	NCOA6	32792313	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.428000	0.59894	1.621000	0.50320	0.655000	0.94253	TCC	-	NULL		0.488	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	protein_coding	OTTHUMT00000078811.2	G	NM_014071		32792313	-1	no_errors	NM_014071	genbank	human	reviewed	54_36p	missense	SNP	1	T
RPL32	6161	genome.wustl.edu	37	3	12880849	12880849	+	Splice_Site	SNP	T	T	A			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr3:12880849T>A	ENST00000429711.2	-	3	376	c.277A>T	c.(277-279)Aaa>Taa	p.K93*	RPL32_ENST00000396957.1_Splice_Site_p.K93*|RPL32_ENST00000273223.6_Splice_Site_p.K111*|RPL32_ENST00000396953.2_Splice_Site_p.K93*|RPL32_ENST00000435983.1_Splice_Site_p.K93*|SNORA7A_ENST00000384765.1_RNA	NM_000994.3	NP_000985.1	P62910	RL32_HUMAN	ribosomal protein L32	93					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.K93*(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						CCAACTCACTTGTTGCACATC	0.483																																																1	Substitution - Nonsense(1)	ovary(1)	3											99.0	103.0	102.0					3																	12880849		2203	4300	6503	12855849	SO:0001630	splice_region_variant	6161			CA436299, CF124158, CR608027	CCDS2614.1	3q13.3-q21	2011-04-06			ENSG00000144713	ENSG00000144713		"""L ribosomal proteins"""	10336	protein-coding gene	gene with protein product						9284913	Standard	NM_001007073		Approved	L32	uc003bxl.3	P62910	OTTHUMG00000129804	ENST00000429711.2:c.278+1A>T	3.37:g.12880849T>A		Somatic		Capture	Illumina GAIIx	4	12855849	B2R4Q3|P02433	Nonsense_Mutation	SNP	-	p.K93*	ENST00000429711.2	37	c.277	CCDS2614.1	3	.	.	.	.	.	.	.	.	.	.	T	36	5.947103	0.97134	.	.	ENSG00000144713	ENST00000429711;ENST00000396957;ENST00000273223;ENST00000435983;ENST00000396953;ENST00000457131	.	.	.	3.95	3.95	0.45737	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.2242	10.8168	0.46580	0.0:0.0:0.0:1.0	.	.	.	.	X	93;93;111;93;93;93	.	ENSP00000339064:K111X	K	-	1	0	RPL32	12855849	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.609000	0.82925	1.633000	0.50488	0.383000	0.25322	AAA	-	NULL		0.483	RPL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL32	protein_coding	OTTHUMT00000252032.2	T	NM_000994	Nonsense_Mutation	12855849	-1	no_errors	NM_000994	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
DTX3L	151636	genome.wustl.edu	37	3	122288092	122288092	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr3:122288092A>C	ENST00000296161.4	+	3	1345	c.1156A>C	c.(1156-1158)Aaa>Caa	p.K386Q	DTX3L_ENST00000383661.3_Intron	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	386					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K386Q(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		TGCCCACTATAAACTTTTAGA	0.358																																																1	Substitution - Missense(1)	ovary(1)	3											58.0	61.0	60.0					3																	122288092		2203	4300	6503	123770782	SO:0001583	missense	151636				CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.1156A>C	3.37:g.122288092A>C	ENSP00000296161:p.Lys386Gln	Somatic		Capture	Illumina GAIIx	4	123770782	B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;superfamily_RING/U-box	p.K386Q	ENST00000296161.4	37	c.1156	CCDS3015.1	3	.	.	.	.	.	.	.	.	.	.	A	10.26	1.302135	0.23736	.	.	ENSG00000163840	ENST00000296161	T	0.35236	1.32	5.65	0.397	0.16314	.	0.466390	0.20339	N	0.094278	T	0.26231	0.0640	M	0.61703	1.905	0.80722	D	1	D	0.56521	0.976	B	0.39706	0.307	T	0.13098	-1.0522	10	0.56958	D	0.05	-32.5155	1.9577	0.03379	0.5782:0.1372:0.1523:0.1323	.	386	Q8TDB6	DTX3L_HUMAN	Q	386	ENSP00000296161:K386Q	ENSP00000296161:K386Q	K	+	1	0	DTX3L	123770782	0.014000	0.17966	0.978000	0.43139	0.050000	0.14768	0.809000	0.27168	0.526000	0.28541	0.533000	0.62120	AAA	-	NULL		0.358	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX3L	protein_coding	OTTHUMT00000355966.1	A	NM_138287		123770782	1	no_errors	NM_138287	genbank	human	validated	54_36p	missense	SNP	0.3	C
MCF2L2	23101	genome.wustl.edu	37	3	182933853	182933862	+	Frame_Shift_Del	DEL	TGCTGAATCT	TGCTGAATCT	-			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	TGCTGAATCT	TGCTGAATCT	TGCTGAATCT	-	TGCTGAATCT	TGCTGAATCT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr3:182933853_182933862delTGCTGAATCT	ENST00000328913.3	-	22	2688_2697	c.2391_2400delAGATTCAGCA	c.(2389-2400)aaagattcagcafs	p.KDSA797fs	MCF2L2_ENST00000473233.1_Frame_Shift_Del_p.KDSA797fs	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	797	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S799L(1)|p.K797fs*12(1)		breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CAGTTGAGAATGCTGAATCTTTGGTTCTCT	0.438																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|breast(1)	3																																								184416556	SO:0001589	frameshift_variant	23101			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.2391_2400delAGATTCAGCA	3.37:g.182933853_182933862delTGCTGAATCT	ENSP00000328118:p.Lys797fs	Somatic		Capture	Illumina GAIIx	4	184416547	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Frame_Shift_Del	DEL	-	p.K797fs	ENST00000328913.3	37	c.2400_2391	CCDS3243.1	3																																																																																			(deletion:cds_exon[184416451;184416576])	NULL		0.438	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	protein_coding	OTTHUMT00000350868.1	TGCTGAATCT	NM_015078		184416556	-1	no_errors	NM_015078	genbank	human	validated	54_36p	frame_shift_del	DEL	0.195:0.202:0.201:0.226:0.283:0.282:0.286:0.324:0.404:0.438	-
ZNF852	285346	genome.wustl.edu	37	3	44541190	44541190	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr3:44541190C>T	ENST00000436261.1	-	4	1239	c.1079G>A	c.(1078-1080)tGt>tAt	p.C360Y	ZNF852_ENST00000489411.1_5'UTR			Q6ZMS4	ZN852_HUMAN	zinc finger protein 852	360						nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.C310Y(1)		endometrium(2)|kidney(1)|lung(5)	8						GGCTTTCCCACATTCACTACA	0.408																																																1	Substitution - Missense(1)	ovary(1)	3																																								44516194	SO:0001583	missense	285346			BC014381		3p21.32	2013-01-08			ENSG00000178917	ENSG00000178917		"""Zinc fingers, C2H2-type"", ""-"""	27713	protein-coding gene	gene with protein product							Standard	NM_001287349		Approved		uc011azx.2	Q6ZMS4	OTTHUMG00000156453	ENST00000436261.1:c.1079G>A	3.37:g.44541190C>T	ENSP00000389841:p.Cys360Tyr	Somatic		Capture	Illumina GAIIx	4	44516194	B4DLD7	Missense_Mutation	SNP	-	p.C361Y	ENST00000436261.1	37	c.1082		3	.	.	.	.	.	.	.	.	.	.	c	18.06	3.539040	0.65085	.	.	ENSG00000178917	ENST00000436261;ENST00000313378	D	0.85861	-2.04	3.43	3.43	0.39272	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.91865	0.7425	.	.	.	0.43766	D	0.996287	D	0.89917	1.0	D	0.97110	1.0	D	0.92994	0.6417	8	0.66056	D	0.02	.	14.4883	0.67631	0.0:1.0:0.0:0.0	.	326	Q6ZMS4	ZN852_HUMAN	Y	360	ENSP00000389841:C360Y	ENSP00000322569:C360Y	C	-	2	0	ZNF852	44516194	1.000000	0.71417	0.995000	0.50966	0.813000	0.45954	7.570000	0.82390	1.866000	0.54105	0.305000	0.20034	TGT	-	NULL		0.408	ZNF852-001	KNOWN	basic|appris_principal	protein_coding	LOC285346	protein_coding	OTTHUMT00000344244.1	C	XM_001717402		44516194	-1	no_errors	XM_001717544	genbank	human	model	54_36p	missense	SNP	1	T
KIF15	56992	genome.wustl.edu	37	3	44867872	44867872	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr3:44867872G>C	ENST00000326047.4	+	22	2855	c.2706G>C	c.(2704-2706)ttG>ttC	p.L902F	KIF15_ENST00000425755.1_Missense_Mutation_p.L537F	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	902					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.L902F(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TTTAGAATTTGATGGAGCTTC	0.338																																																1	Substitution - Missense(1)	ovary(1)	3											74.0	78.0	77.0					3																	44867872		2203	4299	6502	44842876	SO:0001583	missense	56992			AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.2706G>C	3.37:g.44867872G>C	ENSP00000324020:p.Leu902Phe	Somatic		Capture	Illumina GAIIx	4	44842876	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	HMMPfam_Kinesin;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_BAG domain	p.L902F	ENST00000326047.4	37	c.2706	CCDS33744.1	3	.	.	.	.	.	.	.	.	.	.	G	18.50	3.638430	0.67130	.	.	ENSG00000163808	ENST00000326047;ENST00000481166;ENST00000396031;ENST00000425755	T;T;T	0.61510	0.1;0.1;0.1	5.38	5.38	0.77491	.	0.000000	0.40728	N	0.001030	T	0.71307	0.3324	M	0.64997	1.995	0.47584	D	0.999462	D	0.89917	1.0	D	0.73708	0.981	T	0.69997	-0.4993	10	0.42905	T	0.14	.	13.3216	0.60436	0.0:0.0:0.8417:0.1583	.	902	Q9NS87	KIF15_HUMAN	F	902;674;901;537	ENSP00000324020:L902F;ENSP00000425499:L674F;ENSP00000389982:L537F	ENSP00000324020:L902F	L	+	3	2	KIF15	44842876	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.023000	0.30065	2.704000	0.92352	0.586000	0.80456	TTG	-	NULL		0.338	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF15	protein_coding	OTTHUMT00000343831.2	G			44842876	1	no_errors	NM_020242	genbank	human	validated	54_36p	missense	SNP	1	C
ATRIP	84126	genome.wustl.edu	37	3	48502013	48502013	+	Silent	SNP	A	A	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr3:48502013A>G	ENST00000320211.3	+	8	1673	c.1560A>G	c.(1558-1560)ggA>ggG	p.G520G	ATRIP_ENST00000412052.1_Silent_p.G427G|ATRIP_ENST00000346691.4_Silent_p.G520G|ATRIP_ENST00000357105.6_Silent_p.G393G	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	520					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G520G(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TTAGTGATGGAGATATGACCT	0.547								Other conserved DNA damage response genes																																								1	Substitution - coding silent(1)	ovary(1)	3											91.0	91.0	91.0					3																	48502013		2203	4300	6503	48477017	SO:0001819	synonymous_variant	84126			AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.1560A>G	3.37:g.48502013A>G		Somatic		Capture	Illumina GAIIx	4	48477017	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Silent	SNP	-	p.G520	ENST00000320211.3	37	c.1560	CCDS2768.1	3																																																																																			-	NULL		0.547	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRIP	protein_coding	OTTHUMT00000257507.2	A	NM_130384		48477017	1	no_errors	NM_130384	genbank	human	reviewed	54_36p	silent	SNP		G
NISCH	11188	genome.wustl.edu	37	3	52522321	52522321	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr3:52522321G>A	ENST00000479054.1	+	17	2885	c.2813G>A	c.(2812-2814)cGc>cAc	p.R938H	NISCH_ENST00000345716.4_Missense_Mutation_p.R938H			Q9Y2I1	NISCH_HUMAN	nischarin	938					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)	p.R938H(1)		NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	TGTCGCAACCGCAACAGCTTC	0.642																																																1	Substitution - Missense(1)	ovary(1)	3											106.0	98.0	101.0					3																	52522321		2203	4300	6503	52497361	SO:0001583	missense	11188			AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.2813G>A	3.37:g.52522321G>A	ENSP00000418232:p.Arg938His	Somatic		Capture	Illumina GAIIx	4	52497361	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	-	p.R938H	ENST00000479054.1	37	c.2813	CCDS33767.1	3	.	.	.	.	.	.	.	.	.	.	G	21.4	4.145531	0.77888	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000414197	T;T	0.09255	3.0;3.0	5.21	5.21	0.72293	.	0.195954	0.43260	D	0.000597	T	0.24928	0.0605	L	0.32530	0.975	0.35228	D	0.776651	D	0.89917	1.0	D	0.72075	0.976	T	0.14699	-1.0463	10	0.72032	D	0.01	-29.6115	18.7518	0.91819	0.0:0.0:1.0:0.0	.	938	Q9Y2I1	NISCH_HUMAN	H	938;938;282	ENSP00000418232:R938H;ENSP00000339958:R938H	ENSP00000339958:R938H	R	+	2	0	NISCH	52497361	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.668000	0.61568	2.434000	0.82447	0.462000	0.41574	CGC	-	NULL		0.642	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NISCH	protein_coding	OTTHUMT00000351357.1	G	NM_007184		52497361	1	no_errors	NM_007184	genbank	human	validated	54_36p	missense	SNP	1	A
ABHD6	57406	genome.wustl.edu	37	3	58279479	58279479	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr3:58279479A>G	ENST00000478253.1	+	10	1502	c.1001A>G	c.(1000-1002)aAg>aGg	p.K334R	ABHD6_ENST00000295962.4_Missense_Mutation_p.K334R			Q9BV23	ABHD6_HUMAN	abhydrolase domain containing 6	334					long term synaptic depression (GO:0060292)|negative regulation of cell migration (GO:0030336)|regulation of endocannabinoid signaling pathway (GO:2000124)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acylglycerol lipase activity (GO:0047372)	p.K334R(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	16				BRCA - Breast invasive adenocarcinoma(55;0.000225)|KIRC - Kidney renal clear cell carcinoma(284;0.0471)|Kidney(284;0.0589)|OV - Ovarian serous cystadenocarcinoma(275;0.209)		GACAACAACAAGAAGCTGGAC	0.542																																																1	Substitution - Missense(1)	ovary(1)	3											69.0	61.0	63.0					3																	58279479		2203	4300	6503	58254519	SO:0001583	missense	57406			AF225418	CCDS2887.1	3p21.2	2006-03-10			ENSG00000163686	ENSG00000163686		"""Abhydrolase domain containing"""	21398	protein-coding gene	gene with protein product							Standard	NM_020676		Approved		uc003djs.4	Q9BV23	OTTHUMG00000159150	ENST00000478253.1:c.1001A>G	3.37:g.58279479A>G	ENSP00000420315:p.Lys334Arg	Somatic		Capture	Illumina GAIIx	4	58254519	B2R7Y9|Q6ZMF7	Missense_Mutation	SNP	-	p.K334R	ENST00000478253.1	37	c.1001	CCDS2887.1	3	.	.	.	.	.	.	.	.	.	.	A	22.9	4.343722	0.82022	.	.	ENSG00000163686	ENST00000478253;ENST00000295962	T;T	0.81078	-1.45;-1.45	5.84	5.84	0.93424	.	0.273316	0.43919	D	0.000505	D	0.86772	0.6013	M	0.72479	2.2	0.48975	D	0.999735	D	0.64830	0.994	P	0.59221	0.854	D	0.86122	0.1569	10	0.37606	T	0.19	-18.6008	15.0652	0.71989	1.0:0.0:0.0:0.0	.	334	Q9BV23	ABHD6_HUMAN	R	334	ENSP00000420315:K334R;ENSP00000295962:K334R	ENSP00000295962:K334R	K	+	2	0	ABHD6	58254519	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.427000	0.52785	2.228000	0.72767	0.533000	0.62120	AAG	-	NULL		0.542	ABHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD6	protein_coding	OTTHUMT00000353511.1	A	NM_020676		58254519	1	no_errors	NM_020676	genbank	human	validated	54_36p	missense	SNP	1	G
IGHV3OR16-8	388255	genome.wustl.edu	37	16	33020848	33020848	+	RNA	SNP	C	C	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr16:33020848C>T	ENST00000565407.2	+	0	256				RP11-19N8.2_ENST00000567619.1_RNA					immunoglobulin heavy variable 3/OR16-8 (non-functional)									p.R86*(1)									TGTGAAGGGCCGATTCACCAT	0.517																																																1	Substitution - Nonsense(1)	ovary(1)	16											218.0	185.0	196.0					16																	33020848		1969	4152	6121	32928349			0			Z29605		16p11.2	2013-05-22	2008-09-11		ENSG00000271130	ENSG00000271130		"""Immunoglobulins / IGH orphons"""	5643	other	immunoglobulin gene			"""immunoglobulin heavy variable 3/OR16-8"""				Standard			Approved	IGHV3/OR16-8			OTTHUMG00000176449		16.37:g.33020848C>T		Somatic		Capture	Illumina GAIIx	4	32928349		Nonsense_Mutation	SNP	-	p.R67*	ENST00000565407.2	37	c.199		16																																																																																			-	NULL		0.517	IGHV3OR16-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000214613	IG_V_gene	OTTHUMT00000432095.2	C			32928349	1	no_start_codon:no_stop_codon	ENST00000398668	ensembl	human	known	54_36p	nonsense	SNP	0.99	T
ODAM	54959	genome.wustl.edu	37	4	71066250	71066250	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr4:71066250T>G	ENST00000396094.2	+	6	508	c.460T>G	c.(460-462)Tgg>Ggg	p.W154G		NM_017855.3	NP_060325.3	A1E959	ODAM_HUMAN	odontogenic, ameloblast asssociated	154	Gln-rich.				biomineral tissue development (GO:0031214)|odontogenesis of dentin-containing tooth (GO:0042475)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|fibril (GO:0043205)|nucleus (GO:0005634)		p.W154G(1)|p.W154R(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(3)|skin(2)	20						GGTCCTACCCTGGGAACAACC	0.378																																																2	Substitution - Missense(2)	ovary(1)|NS(1)	4											111.0	96.0	101.0					4																	71066250		2203	4300	6503	71100839	SO:0001583	missense	54959			AK000520	CCDS3536.2	4q13.3	2010-11-23			ENSG00000109205	ENSG00000109205			26043	protein-coding gene	gene with protein product		614843				14647039	Standard	NM_017855		Approved	APin, FLJ20513	uc003hfc.3	A1E959	OTTHUMG00000129406	ENST00000396094.2:c.460T>G	4.37:g.71066250T>G	ENSP00000379401:p.Trp154Gly	Somatic		Capture	Illumina GAIIx	4	71100839	Q8WWE5|Q9NWZ9	Missense_Mutation	SNP	-	p.W154G	ENST00000396094.2	37	c.460	CCDS3536.2	4	.	.	.	.	.	.	.	.	.	.	T	16.76	3.212826	0.58452	.	.	ENSG00000109205	ENST00000396094;ENST00000510709;ENST00000514097	T;T	0.48836	0.8;0.8	5.1	3.93	0.45458	.	0.000000	0.41605	D	0.000844	T	0.48804	0.1520	L	0.58101	1.795	0.28005	N	0.935125	P	0.52061	0.95	P	0.50708	0.648	T	0.49194	-0.8965	10	0.59425	D	0.04	4.2725	6.1009	0.20047	0.0:0.1156:0.0:0.8844	.	154	A1E959	ODAM_HUMAN	G	154;140;107	ENSP00000379401:W154G;ENSP00000426106:W107G	ENSP00000379401:W154G	W	+	1	0	ODAM	71100839	0.986000	0.35501	1.000000	0.80357	0.782000	0.44232	2.021000	0.41020	2.144000	0.66660	0.533000	0.62120	TGG	-	NULL		0.378	ODAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODAM	protein_coding	OTTHUMT00000251562.1	T	NM_017855		71100839	1	no_errors	NM_017855	genbank	human	validated	54_36p	missense	SNP	0.99	G
ITK	3702	genome.wustl.edu	37	5	156638376	156638376	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr5:156638376G>C	ENST00000422843.3	+	3	474	c.322G>C	c.(322-324)Gaa>Caa	p.E108Q	CTB-4E7.1_ENST00000519375.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	108	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.E108Q(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	GGCCCTTAAAGAAGGTAATTA	0.483			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	1	Substitution - Missense(1)	ovary(1)	5											90.0	87.0	88.0					5																	156638376		2203	4300	6503	156570954	SO:0001583	missense	3702			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.322G>C	5.37:g.156638376G>C	ENSP00000398655:p.Glu108Gln	Somatic		Capture	Illumina GAIIx	4	156570954	B2R752|Q32ML7	Missense_Mutation	SNP	SH2;HMMPfam_SH2;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;SH3_1;HMMPfam_SH3_1;BTK;HMMPfam_BTK;PH;HMMPfam_PH	p.E108Q	ENST00000422843.3	37	c.322	CCDS4336.1	5	.	.	.	.	.	.	.	.	.	.	G	19.10	3.762067	0.69763	.	.	ENSG00000113263	ENST00000422843	D	0.93189	-3.18	5.8	4.93	0.64822	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.206056	0.51477	D	0.000082	D	0.89781	0.6814	L	0.35542	1.07	0.48135	D	0.999594	P	0.47106	0.89	P	0.44477	0.451	D	0.88841	0.3312	10	0.38643	T	0.18	.	13.2282	0.59927	0.0772:0.0:0.9228:0.0	.	108	Q08881	ITK_HUMAN	Q	108	ENSP00000398655:E108Q	ENSP00000398655:E108Q	E	+	1	0	ITK	156570954	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.897000	0.69831	2.735000	0.93741	0.655000	0.94253	GAA	-	HMMPfam_PH		0.483	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	protein_coding	OTTHUMT00000252569.2	G			156570954	1	no_errors	NM_005546	genbank	human	reviewed	54_36p	missense	SNP	1	C
GABRA1	2554	genome.wustl.edu	37	5	161318058	161318058	+	Splice_Site	SNP	T	T	A			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr5:161318058T>A	ENST00000428797.2	+	9	1211		c.e9+2		GABRA1_ENST00000444819.1_Splice_Site|GABRA1_ENST00000420560.1_Splice_Site|GABRA1_ENST00000393943.4_Splice_Site|GABRA1_ENST00000437025.2_Splice_Site|GABRA1_ENST00000023897.6_Splice_Site	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1						gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.?(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTGTCTTTGGTAAGTCCCAAT	0.383																																																1	Unknown(1)	ovary(1)	5											98.0	99.0	99.0					5																	161318058		2203	4300	6503	161250636	SO:0001630	splice_region_variant	2554				CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.856+2T>A	5.37:g.161318058T>A		Somatic		Capture	Illumina GAIIx	4	161250636	D3DQK6|Q8N629	Splice_Site	SNP	-	e7+2	ENST00000428797.2	37	c.856+2	CCDS4357.1	5	.	.	.	.	.	.	.	.	.	.	T	25.5	4.640877	0.87859	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6517	0.77099	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	GABRA1	161250636	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.903000	0.87398	2.105000	0.64084	0.528000	0.53228	.	-	-		0.383	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA1	protein_coding	OTTHUMT00000252702.2	T	NM_000806.5	Intron	161250636	1	no_errors	NM_000806	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
SLIT3	6586	genome.wustl.edu	37	5	168212925	168212925	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr5:168212925A>T	ENST00000519560.1	-	12	1557	c.1138T>A	c.(1138-1140)Tcc>Acc	p.S380T	SLIT3_ENST00000404867.3_Missense_Mutation_p.S380T|SLIT3_ENST00000332966.8_Missense_Mutation_p.S380T	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	380					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.S380T(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGCTGTAGGGACACCAGCCCA	0.502																																					Ovarian(29;311 847 10864 17279 24903)											1	Substitution - Missense(1)	ovary(1)	5											156.0	130.0	139.0					5																	168212925		2203	4300	6503	168145503	SO:0001583	missense	6586			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1138T>A	5.37:g.168212925A>T	ENSP00000430333:p.Ser380Thr	Somatic		Capture	Illumina GAIIx	4	168145503	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	-	p.S380T	ENST00000519560.1	37	c.1138	CCDS4369.1	5	.	.	.	.	.	.	.	.	.	.	A	15.17	2.753538	0.49362	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.62105	0.05;0.05;0.05	5.8	5.8	0.92144	.	0.200986	0.53938	D	0.000045	T	0.63082	0.2481	L	0.56396	1.775	0.80722	D	1	P;P;B	0.52577	0.954;0.928;0.023	B;P;B	0.45610	0.385;0.487;0.029	T	0.63097	-0.6713	10	0.33141	T	0.24	.	15.1822	0.72968	1.0:0.0:0.0:0.0	.	380;380;380	O75094-2;O75094-3;O75094	.;.;SLIT3_HUMAN	T	380	ENSP00000430333:S380T;ENSP00000332164:S380T;ENSP00000384890:S380T	ENSP00000332164:S380T	S	-	1	0	SLIT3	168145503	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.581000	0.82535	2.240000	0.73641	0.529000	0.55759	TCC	-	NULL		0.502	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	protein_coding	OTTHUMT00000252792.4	A	NM_003062		168145503	-1	no_errors	NM_003062	genbank	human	validated	54_36p	missense	SNP	1	T
GPR98	84059	genome.wustl.edu	37	5	89925239	89925239	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr5:89925239C>G	ENST00000405460.2	+	9	1818	c.1722C>G	c.(1720-1722)atC>atG	p.I574M		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	574					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.I574M(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AAGAAGGCATCTTAAATATAT	0.383																																																1	Substitution - Missense(1)	ovary(1)	5											85.0	80.0	82.0					5																	89925239		1865	4093	5958	89960995	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.1722C>G	5.37:g.89925239C>G	ENSP00000384582:p.Ile574Met	Somatic		Capture	Illumina GAIIx	4	89960995	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	HMMPfam_GPS;HMMPfam_Calx-beta;HMMPfam_EPTP;superfamily_Concanavalin A-like lectins/glucanases;superfamily_Phosphoglucomutase first 3 domains	p.I574M	ENST00000405460.2	37	c.1722	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.52|17.52	3.411054|3.411054	0.62399|0.62399	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043|ENST00000504142	T|.	0.29397|.	1.57|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.059285|.	0.64402|.	D|.	0.000001|.	T|T	0.64735|0.64735	0.2625|0.2625	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	D|.	0.65815|.	0.995|.	P|.	0.62184|.	0.899|.	T|T	0.65788|0.65788	-0.6083|-0.6083	10|5	0.87932|.	D|.	0|.	.|.	7.2069|7.2069	0.25911|0.25911	0.0:0.7951:0.0:0.2049|0.0:0.7951:0.0:0.2049	.|.	574|.	Q8WXG9|.	GPR98_HUMAN|.	M|V	574|163	ENSP00000384582:I574M|.	ENSP00000296619:I574M|.	I|L	+|+	3|1	3|0	GPR98|GPR98	89960995|89960995	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.907000|0.907000	0.53573|0.53573	0.441000|0.441000	0.21611|0.21611	2.603000|2.603000	0.88011|0.88011	0.655000|0.655000	0.94253|0.94253	ATC|CTT	-	NULL		0.383	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	C	NM_032119		89960995	1	no_errors	NM_032119	genbank	human	reviewed	54_36p	missense	SNP	1	G
RNF130	55819	genome.wustl.edu	37	5	179405232	179405232	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr5:179405232C>G	ENST00000261947.4	-	5	1217	c.819G>C	c.(817-819)caG>caC	p.Q273H	RNF130_ENST00000521389.1_Missense_Mutation_p.Q273H|RNF130_ENST00000522208.2_Missense_Mutation_p.Q273H	NM_001280801.1	NP_001267730.1			ring finger protein 130									p.Q273H(1)		breast(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	17	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGACATCATTCTGCTTATAGC	0.398																																					GBM(24;432 554 38471 39699 51728)											1	Substitution - Missense(1)	ovary(1)	5											140.0	123.0	129.0					5																	179405232		2203	4300	6503	179337838	SO:0001583	missense	55819			AF155650	CCDS4451.1, CCDS64340.1	5q35.3	2013-01-09			ENSG00000113269	ENSG00000113269		"""RING-type (C3HC4) zinc fingers"""	18280	protein-coding gene	gene with protein product						10806348	Standard	NM_018434		Approved	GP, G1RZFP, GOLIATH	uc003mll.1	Q86XS8	OTTHUMG00000130909	ENST00000261947.4:c.819G>C	5.37:g.179405232C>G	ENSP00000261947:p.Gln273His	Somatic		Capture	Illumina GAIIx	4	179337838		Missense_Mutation	SNP	-	p.Q273H	ENST00000261947.4	37	c.819		5	.	.	.	.	.	.	.	.	.	.	C	17.96	3.516640	0.64634	.	.	ENSG00000113269	ENST00000522208;ENST00000521389;ENST00000261947	T;T;T	0.43294	0.95;0.95;0.95	5.78	3.94	0.45596	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.064398	0.64402	D	0.000005	T	0.41351	0.1155	N	0.16790	0.44	0.41925	D	0.99053	D;D	0.57571	0.98;0.98	P;P	0.60236	0.871;0.519	T	0.40213	-0.9575	10	0.59425	D	0.04	.	9.7862	0.40677	0.0:0.7498:0.1277:0.1225	.	290;273	Q59EL1;Q86XS8	.;GOLI_HUMAN	H	273	ENSP00000429509:Q273H;ENSP00000430237:Q273H;ENSP00000261947:Q273H	ENSP00000261947:Q273H	Q	-	3	2	RNF130	179337838	0.988000	0.35896	1.000000	0.80357	0.964000	0.63967	0.217000	0.17603	1.533000	0.49186	0.655000	0.94253	CAG	-	NULL		0.398	RNF130-003	PUTATIVE	basic|exp_conf	protein_coding	RNF130	protein_coding	OTTHUMT00000374205.1	C	NM_018434		179337838	-1	no_errors	NM_018434	genbank	human	reviewed	54_36p	missense	SNP	1	G
JARID2	3720	genome.wustl.edu	37	6	15487600	15487600	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr6:15487600G>T	ENST00000341776.2	+	6	977	c.733G>T	c.(733-735)Gag>Tag	p.E245*	JARID2_ENST00000541660.1_Nonsense_Mutation_p.E207*|JARID2_ENST00000397311.3_Nonsense_Mutation_p.E73*	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	245					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E245*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				CAAAAGCAAAGAGGCCACTCC	0.547																																																1	Substitution - Nonsense(1)	ovary(1)	6											108.0	97.0	100.0					6																	15487600		2203	4300	6503	15595579	SO:0001587	stop_gained	3720			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.733G>T	6.37:g.15487600G>T	ENSP00000341280:p.Glu245*	Somatic		Capture	Illumina GAIIx	Phase_III	15595579	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Nonsense_Mutation	SNP	HMMPfam_ARID,HMMPfam_JmjN,HMMPfam_zf-C5HC2,HMMPfam_JmjC,superfamily_ARID-like,superfamily_RING/U-box	p.E245*	ENST00000341776.2	37	c.733	CCDS4533.1	6	.	.	.	.	.	.	.	.	.	.	G	42	9.256349	0.99117	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	.	.	.	5.3	5.3	0.74995	.	0.167363	0.51477	D	0.000097	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-21.8355	19.3085	0.94175	0.0:0.0:1.0:0.0	.	.	.	.	X	109;245;73;207	.	ENSP00000341280:E245X	E	+	1	0	JARID2	15595579	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.513000	0.81739	2.625000	0.88918	0.655000	0.94253	GAG	-	NULL		0.547	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JARID2	protein_coding	OTTHUMT00000039926.1	G	NM_004973		15595579	1	no_errors	NM_004973	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
SLC18B1	116843	genome.wustl.edu	37	6	133100448	133100448	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr6:133100448C>G	ENST00000275227.4	-	7	850	c.754G>C	c.(754-756)Ggc>Cgc	p.G252R	SLC18B1_ENST00000367918.1_Intron|SLC18B1_ENST00000538764.1_Missense_Mutation_p.G126R	NM_052831.2	NP_439896.1	Q6NT16	S18B1_HUMAN	solute carrier family 18, subfamily B, member 1	252					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.G252R(1)									TCGAGGAAGCCAAAACACGAG	0.448																																																1	Substitution - Missense(1)	ovary(1)	6											157.0	137.0	144.0					6																	133100448		2203	4300	6503	133142141	SO:0001583	missense	116843			AK124442	CCDS5163.1	6q22.3-q23.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000146409	ENSG00000146409		"""Solute carriers"""	21573	protein-coding gene	gene with protein product		613361	"""chromosome 6 open reading frame 192"""	C6orf192		19697161	Standard	XM_006715328		Approved	dJ55C23.6	uc003qdw.1	Q6NT16	OTTHUMG00000015595	ENST00000275227.4:c.754G>C	6.37:g.133100448C>G	ENSP00000275227:p.Gly252Arg	Somatic		Capture	Illumina GAIIx	4	133142141	A8K1K3|B3KW77|Q6ISF2	Missense_Mutation	SNP	-	p.G252R	ENST00000275227.4	37	c.754	CCDS5163.1	6	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686519	0.88639	.	.	ENSG00000146409	ENST00000275227;ENST00000538764	T;T	0.59638	0.25;0.25	5.07	5.07	0.68467	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.145278	0.64402	D	0.000006	T	0.73118	0.3546	M	0.80183	2.485	0.80722	D	1	D;D	0.76494	0.999;0.98	D;D	0.76575	0.988;0.961	T	0.76369	-0.2984	10	0.87932	D	0	-10.4917	16.2101	0.82150	0.0:1.0:0.0:0.0	.	126;252	B7Z1S5;Q6NT16	.;CF192_HUMAN	R	252;126	ENSP00000275227:G252R;ENSP00000444098:G126R	ENSP00000275227:G252R	G	-	1	0	C6orf192	133142141	1.000000	0.71417	0.966000	0.40874	0.975000	0.68041	6.354000	0.73036	2.746000	0.94184	0.561000	0.74099	GGC	-	NULL		0.448	SLC18B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf192	protein_coding	OTTHUMT00000042273.1	C	NM_052831		133142141	-1	no_errors	NM_052831	genbank	human	validated	54_36p	missense	SNP	1	G
RSPO2	340419	genome.wustl.edu	37	8	108970482	108970482	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr8:108970482C>T	ENST00000276659.5	-	5	1062	c.442G>A	c.(442-444)Ggt>Agt	p.G148S	RSPO2_ENST00000378439.2_Missense_Mutation_p.G84S|RSPO2_ENST00000517781.1_Missense_Mutation_p.G84S|RSPO2_ENST00000517939.1_Missense_Mutation_p.G81S	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	148	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.G148S(1)	EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			CTCCAATGACCAACTTCACAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	8											108.0	105.0	106.0					8																	108970482		2203	4300	6503	109039658	SO:0001583	missense	340419			AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.442G>A	8.37:g.108970482C>T	ENSP00000276659:p.Gly148Ser	Somatic		Capture	Illumina GAIIx	4	109039658	B3KVP0|Q4G0U4|Q8N6X6	Missense_Mutation	SNP	superfamily_Growth factor receptor domain;superfamily_TSP-1 type 1 repeat	p.G148S	ENST00000276659.5	37	c.442	CCDS6307.1	8	.	.	.	.	.	.	.	.	.	.	C	17.13	3.310107	0.60414	.	.	ENSG00000147655	ENST00000517939;ENST00000517781;ENST00000378439;ENST00000276659;ENST00000521502;ENST00000521757	D;D;D;D;D;D	0.90676	-2.71;-2.71;-2.71;-1.99;-1.99;-2.71	5.81	5.81	0.92471	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.89238	0.6658	N	0.05619	-0.005	0.80722	D	1	D;P	0.89917	1.0;0.873	D;P	0.91635	0.999;0.543	D	0.83418	0.0031	10	0.06494	T	0.89	-2.6947	20.4375	0.99097	0.0:1.0:0.0:0.0	.	148;84	Q6UXX9;Q6UXX9-3	RSPO2_HUMAN;.	S	81;84;84;148;81;81	ENSP00000428940:G81S;ENSP00000427937:G84S;ENSP00000367698:G84S;ENSP00000276659:G148S;ENSP00000428614:G81S;ENSP00000430485:G81S	ENSP00000276659:G148S	G	-	1	0	RSPO2	109039658	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.711000	0.68400	2.906000	0.99361	0.655000	0.94253	GGT	-	NULL		0.368	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPO2	protein_coding	OTTHUMT00000380830.1	C	NM_178565		109039658	-1	no_errors	NM_178565	genbank	human	validated	54_36p	missense	SNP	1	T
ASH2L	9070	genome.wustl.edu	37	8	37964573	37964573	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr8:37964573C>G	ENST00000343823.6	+	3	599	c.290C>G	c.(289-291)aCt>aGt	p.T97S	ASH2L_ENST00000521652.1_Missense_Mutation_p.T3S|ASH2L_ENST00000250635.7_Missense_Mutation_p.T3S|ASH2L_ENST00000428278.2_Missense_Mutation_p.T3S|ASH2L_ENST00000545394.1_Intron	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	97	DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)	p.T97S(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				GTGATGGATACTCAGGCGGGC	0.453																																																1	Substitution - Missense(1)	ovary(1)	8											141.0	125.0	130.0					8																	37964573		2203	4300	6503	38083730	SO:0001583	missense	9070			AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.290C>G	8.37:g.37964573C>G	ENSP00000340896:p.Thr97Ser	Somatic		Capture	Illumina GAIIx	4	38083730	A8K7C3|D3DSW9|O60659|O60660|Q96B62	Missense_Mutation	SNP	HMMPfam_SPRY	p.T97S	ENST00000343823.6	37	c.290	CCDS6101.1	8	.	.	.	.	.	.	.	.	.	.	C	17.16	3.318444	0.60524	.	.	ENSG00000129691	ENST00000343823;ENST00000250635;ENST00000517719;ENST00000428278;ENST00000521652	T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95	5.13	4.25	0.50352	.	0.153863	0.64402	D	0.000015	T	0.16514	0.0397	L	0.40543	1.245	0.80722	D	1	B;B	0.26147	0.143;0.075	B;B	0.24155	0.051;0.027	T	0.05321	-1.0892	10	0.29301	T	0.29	.	9.6342	0.39798	0.1406:0.785:0.0:0.0745	.	3;97	Q9UBL3-2;Q9UBL3	.;ASH2L_HUMAN	S	97;3;111;3;3	ENSP00000340896:T97S;ENSP00000250635:T3S;ENSP00000428877:T111S;ENSP00000395310:T3S;ENSP00000430259:T3S	ENSP00000250635:T3S	T	+	2	0	ASH2L	38083730	0.716000	0.27956	0.956000	0.39512	0.996000	0.88848	2.770000	0.47662	1.137000	0.42214	0.557000	0.71058	ACT	-	NULL		0.453	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASH2L	protein_coding	OTTHUMT00000376749.4	C	NM_004674		38083730	1	no_errors	NM_004674	genbank	human	validated	54_36p	missense	SNP	0.99	G
SLCO5A1	81796	genome.wustl.edu	37	8	70673987	70673987	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr8:70673987A>G	ENST00000260126.4	-	3	1737	c.1031T>C	c.(1030-1032)aTt>aCt	p.I344T	SLCO5A1_ENST00000528658.1_5'UTR|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.I344T|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.I344T	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	344						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.I344T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			CCAGTTTCCAATGAAACGAGG	0.348																																																1	Substitution - Missense(1)	ovary(1)	8											65.0	66.0	66.0					8																	70673987		2203	4300	6503	70836541	SO:0001583	missense	81796			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1031T>C	8.37:g.70673987A>G	ENSP00000260126:p.Ile344Thr	Somatic		Capture	Illumina GAIIx	4	70836541	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	HMMPfam_OATP;HMMPfam_Kazal_2;superfamily_Kazal-type serine protease inhibitors;superfamily_MFS general substrate transporter	p.I344T	ENST00000260126.4	37	c.1031	CCDS6205.1	8	.	.	.	.	.	.	.	.	.	.	A	22.9	4.346104	0.82022	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.52057	0.68;0.68;0.68	4.9	4.9	0.64082	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.108809	0.64402	D	0.000007	T	0.62332	0.2419	L	0.59912	1.85	0.47949	D	0.999552	P;D;P;P	0.63046	0.931;0.992;0.88;0.835	P;P;P;P	0.62491	0.699;0.903;0.765;0.574	T	0.66685	-0.5861	10	0.87932	D	0	.	14.8095	0.69982	1.0:0.0:0.0:0.0	.	344;344;344;344	B4DR09;E9PKK5;Q9H2Y9;G3V1C0	.;.;SO5A1_HUMAN;.	T	344	ENSP00000260126:I344T;ENSP00000434422:I344T;ENSP00000431611:I344T	ENSP00000260126:I344T	I	-	2	0	SLCO5A1	70836541	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.287000	0.95975	1.969000	0.57287	0.377000	0.23210	ATT	-	HMMPfam_OATP		0.348	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO5A1	protein_coding	OTTHUMT00000381990.3	A	NM_030958		70836541	-1	no_errors	NM_030958	genbank	human	reviewed	54_36p	missense	SNP	1	G
FAM135B	51059	genome.wustl.edu	37	8	139164044	139164044	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr8:139164044T>C	ENST00000395297.1	-	13	2844	c.2674A>G	c.(2674-2676)Agg>Ggg	p.R892G		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	892								p.R892G(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GATCTGGTCCTGGGGTTTTCA	0.468										HNSCC(54;0.14)																																						2	Substitution - Missense(2)	ovary(2)	8											128.0	123.0	125.0					8																	139164044		2203	4300	6503	139233226	SO:0001583	missense	51059			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.2674A>G	8.37:g.139164044T>C	ENSP00000378710:p.Arg892Gly	Somatic		Capture	Illumina GAIIx	4	139233226	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	-	p.R892G	ENST00000395297.1	37	c.2674	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	T	11.97	1.798760	0.31777	.	.	ENSG00000147724	ENST00000395297	T	0.15834	2.39	5.33	-10.7	0.00240	.	1.594030	0.02860	N	0.130137	T	0.07683	0.0193	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.13980	-1.0489	10	0.22109	T	0.4	0.0296	7.5238	0.27643	0.0929:0.4981:0.2777:0.1313	.	892;892;892	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	G	892	ENSP00000378710:R892G	ENSP00000276737:R892G	R	-	1	2	FAM135B	139233226	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.251000	0.02882	-1.992000	0.00975	-1.027000	0.02421	AGG	-	NULL		0.468	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	protein_coding	OTTHUMT00000313590.3	T	NM_015912		139233226	-1	no_errors	NM_015912	genbank	human	validated	54_36p	missense	SNP		C
MAGEH1	28986	genome.wustl.edu	37	X	55479307	55479307	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chrX:55479307C>T	ENST00000342972.1	+	1	770	c.500C>T	c.(499-501)gCa>gTa	p.A167V	hsa-mir-4536-2_ENST00000583537.1_RNA	NM_014061.3	NP_054780.2	Q9H213	MAGH1_HUMAN	melanoma antigen family H, 1	167	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)		p.A167V(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|skin(2)	15						GGGCCCCGAGCACACGTGGAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	X											98.0	94.0	95.0					X																	55479307		2203	4300	6503	55496032	SO:0001583	missense	28986			AF320912	CCDS14369.1	Xp11.22	2008-02-05			ENSG00000187601	ENSG00000187601			24092	protein-coding gene	gene with protein product		300548				12414813, 9485030	Standard	NM_014061		Approved	APR1	uc004dum.3	Q9H213	OTTHUMG00000021655	ENST00000342972.1:c.500C>T	X.37:g.55479307C>T	ENSP00000343706:p.Ala167Val	Somatic		Capture	Illumina GAIIx	4	55496032	B2R8V9|Q5JRJ3|Q9Y5M2	Missense_Mutation	SNP	HMMPfam_MAGE	p.A167V	ENST00000342972.1	37	c.500	CCDS14369.1	X	.	.	.	.	.	.	.	.	.	.	.	12.94	2.088483	0.36855	.	.	ENSG00000187601	ENST00000342972	T	0.06933	3.24	3.17	3.17	0.36434	.	0.000000	0.33792	N	0.004542	T	0.23727	0.0574	M	0.73217	2.22	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.00909	-1.1518	10	0.87932	D	0	-2.8977	8.9766	0.35939	0.0:1.0:0.0:0.0	.	167	Q9H213	MAGH1_HUMAN	V	167	ENSP00000343706:A167V	ENSP00000343706:A167V	A	+	2	0	MAGEH1	55496032	0.885000	0.30320	0.265000	0.24526	0.005000	0.04900	2.657000	0.46724	1.850000	0.53721	0.597000	0.82753	GCA	-	HMMPfam_MAGE		0.507	MAGEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEH1	protein_coding	OTTHUMT00000056868.1	C	NM_014061		55496032	1	no_errors	NM_014061	genbank	human	reviewed	54_36p	missense	SNP	0.95	T
NLGN3	54413	genome.wustl.edu	37	X	70387453	70387453	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chrX:70387453C>G	ENST00000358741.3	+	7	1809	c.1506C>G	c.(1504-1506)taC>taG	p.Y502*	NLGN3_ENST00000536169.1_Nonsense_Mutation_p.Y462*|NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000374051.3_Nonsense_Mutation_p.Y482*	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	502					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.Y482*(1)		biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					CGCCTACCTACTTCTACGCCT	0.562																																					Esophageal Squamous(103;760 1488 16849 22250 40351)											1	Substitution - Nonsense(1)	ovary(1)	X											90.0	74.0	79.0					X																	70387453		2203	4300	6503	70304178	SO:0001587	stop_gained	54413			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.1506C>G	X.37:g.70387453C>G	ENSP00000351591:p.Tyr502*	Somatic		Capture	Illumina GAIIx	4	70304178	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Nonsense_Mutation	SNP	HMMPfam_COesterase;superfamily_alpha/beta-Hydrolases	p.Y482*	ENST00000358741.3	37	c.1446	CCDS55441.1	X	.	.	.	.	.	.	.	.	.	.	C	37	6.289743	0.97444	.	.	ENSG00000196338	ENST00000536169;ENST00000374051;ENST00000395855;ENST00000358741	.	.	.	4.66	0.626	0.17670	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2745	0.43501	0.0:0.6682:0.0:0.3318	.	.	.	.	X	462;482;462;502	.	ENSP00000351591:Y502X	Y	+	3	2	NLGN3	70304178	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	2.594000	0.46189	0.100000	0.17581	-0.312000	0.09012	TAC	-	HMMPfam_COesterase		0.562	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	protein_coding	OTTHUMT00000057121.1	C	NM_018977		70304178	1	no_errors	NM_018977	genbank	human	validated	54_36p	nonsense	SNP	1	G
MFAP3L	9848	genome.wustl.edu	37	4	170926925	170926950	+	Frame_Shift_Del	DEL	GTGCTGTTAGTCACACTCTTAGCGGT	GTGCTGTTAGTCACACTCTTAGCGGT	GTTAGTTA	rs547471341|rs576708271		TCGA-13-0897-01A-01W-0421-09	TCGA-13-0897-10A-01W-0421-09	GTGCTGTTAGTCACACTCTTAGCGGT	GTGCTGTTAGTCACACTCTTAGCGGT	GTGCTGTTAGTCACACTCTTAGCGGT	GTTAGTTA	GTGCTGTTAGTCACACTCTTAGCGGT	GTGCTGTTAGTCACACTCTTAGCGGT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	f48ed68f-a833-4b78-971a-3c746c563d24	79248f7f-c436-4ccd-9859-2f5676e0c942	g.chr4:170926925_170926950delGTGCTGTTAGTCACACTCTTAGCGGT	ENST00000361618.3	-	2	386_411	c.79_104delACCGCTAAGAGTGTGACTAACAGCAC	c.(79-105)accgctaagagtgtgactaacagcactfs	p.TAKSVTNST27fs	MFAP3L_ENST00000393704.3_5'Flank|MFAP3L_ENST00000393702.3_Frame_Shift_Del_p.TAKSVTNST27fs|MFAP3L_ENST00000506110.1_Frame_Shift_Del_p.TAKSVTNST27fs	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	27						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		GCCATTTAAAGTGCTGTTAGTCACACTCTTAGCGGTGGCTAGAGTG	0.456																																																0			4																																								171163525	SO:0001589	frameshift_variant	9848			AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.79_104delACCGCTAAGAGTGTGACTAACAGCAC	4.37:g.170926925_170926950delGTGCTGTTAGTCACACTCTTAGCGGT	ENSP00000354583:p.Thr27fs	Somatic		Capture	Illumina GAIIx	Phase_III	171163500	A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	In_Frame_Del	DEL	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408	p.KSVTNST29in_frame_del	ENST00000361618.3	37	c.104_84	CCDS34103.1	4																																																																																			(deletion:cds_exon[171163306,171163603])	NULL		0.456	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP3L	protein_coding	OTTHUMT00000363043.2	GTGCTGTTAGTCACACTCTTAGCGGT	NM_021647		171163525	-1	no_errors	NM_021647	genbank	human	validated	54_36p	in_frame_del	DEL	1.000:1.000:1.000:0.998:0.944:0.668:0.633:0.579:0.285:0.317:0.303:0.216:0.167:0.080:0.025:0.015:0.010:0.004:0.006:0.020:0.160	GTTAGTTA
