#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTS16	170690	hgsc.bcm.edu	37	5	5318277	5318277	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr5:5318277A>G	ENST00000274181.7	+	22	3580	c.3442A>G	c.(3442-3444)Acg>Gcg	p.T1148A		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1148	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T1148A(1)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						AGGCGTTCAGACGAGGTCCGT	0.667																																																1	Substitution - Missense(1)	ovary(1)	5											38.0	46.0	43.0					5																	5318277		2096	4198	6294	5371277	SO:0001583	missense	170690			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3442A>G	5.37:g.5318277A>G	ENSP00000274181:p.Thr1148Ala	Somatic		WXS	SOLID	Phase_IV	5371277	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	A	8.731	0.916653	0.17907	.	.	ENSG00000145536	ENST00000274181	T	0.54675	0.56	4.83	3.66	0.41972	.	0.718574	0.13238	N	0.403062	T	0.44644	0.1303	M	0.66939	2.045	0.22552	N	0.998995	B	0.12013	0.005	B	0.06405	0.002	T	0.29274	-1.0017	10	0.15952	T	0.53	.	5.638	0.17548	0.8037:0.0:0.1963:0.0	.	1148	Q8TE57	ATS16_HUMAN	A	1148	ENSP00000274181:T1148A	ENSP00000274181:T1148A	T	+	1	0	ADAMTS16	5371277	0.054000	0.20591	0.954000	0.39281	0.206000	0.24218	0.596000	0.24044	1.941000	0.56285	0.460000	0.39030	ACG		0.667	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
ATG9B	285973	hgsc.bcm.edu	37	7	150720191	150720191	+	Silent	SNP	C	C	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr7:150720191C>A	ENST00000377974.2	-	4	837	c.762G>T	c.(760-762)ccG>ccT	p.P254P	ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000605938.1_Silent_p.P254P|ATG9B_ENST00000605952.1_Silent_p.P254P|ATG9B_ENST00000444312.1_5'UTR			Q674R7	ATG9B_HUMAN	autophagy related 9B	254					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)		p.P254P(2)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCTGTGGAACGGCCCAGGTC	0.517																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	7											237.0	241.0	240.0					7																	150720191		2008	4185	6193	150351124	SO:0001819	synonymous_variant	285973			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.762G>T	7.37:g.150720191C>A		Somatic		WXS	SOLID	Phase_IV	150351124	A1A5D3|Q6JRW5|Q8N8I8	Silent	SNP	ENST00000377974.2	37																																																																																					0.517	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173681	
C1orf95	375057	hgsc.bcm.edu	37	1	226736749	226736749	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:226736749C>G	ENST00000366788.3	+	1	249	c.144C>G	c.(142-144)taC>taG	p.Y48*	C1orf95_ENST00000366789.4_Nonsense_Mutation_p.Y48*	NM_001003665.3	NP_001003665.1	Q69YW2	STUM_HUMAN	chromosome 1 open reading frame 95	48						integral component of membrane (GO:0016021)		p.Y48*(1)		large_intestine(1)|lung(4)|ovary(3)	8	Breast(184;0.133)	Prostate(94;0.0885)		GBM - Glioblastoma multiforme(131;0.113)		CCATCCCCTACATGCCCTTCC	0.731																																																1	Substitution - Nonsense(1)	ovary(1)	1											28.0	31.0	30.0					1																	226736749		2201	4300	6501	224803372	SO:0001587	stop_gained	375057			AF035308	CCDS31044.1	1q42.12	2012-06-26			ENSG00000203685	ENSG00000203685			30491	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001003665		Approved	DKFZp761P211	uc021pjw.1	Q69YW2	OTTHUMG00000037583	ENST00000366788.3:c.144C>G	1.37:g.226736749C>G	ENSP00000355752:p.Tyr48*	Somatic		WXS	SOLID	Phase_IV	224803372	A6NGL2	Nonsense_Mutation	SNP	ENST00000366788.3	37	CCDS31044.1	.	.	.	.	.	.	.	.	.	.	C	36	5.968521	0.97156	.	.	ENSG00000203685	ENST00000366788;ENST00000366789	.	.	.	3.4	3.4	0.38934	.	0.281127	0.29093	N	0.013179	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	14.3053	14.5988	0.68424	0.0:1.0:0.0:0.0	.	.	.	.	X	48	.	ENSP00000355752:Y48X	Y	+	3	2	C1orf95	224803372	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	1.298000	0.33412	1.717000	0.51406	0.305000	0.20034	TAC		0.731	C1orf95-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091634.1	NM_001003665	
CCDC67	159989	hgsc.bcm.edu	37	11	93103253	93103253	+	Silent	SNP	G	G	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr11:93103253G>A	ENST00000298050.3	+	6	547	c.447G>A	c.(445-447)aaG>aaA	p.K149K		NM_181645.3	NP_857596.2	Q05D60	DEUP1_HUMAN	coiled-coil domain containing 67	149					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)	cytoplasm (GO:0005737)|deuterosome (GO:0098536)		p.K141K(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				TTAGAGCAAAGTCAAGAGAAT	0.303																																																1	Substitution - coding silent(1)	ovary(1)	11											51.0	49.0	50.0					11																	93103253		1800	4054	5854	92742901	SO:0001819	synonymous_variant	159989			AK058122	CCDS44707.1	11q21	2014-02-20				ENSG00000165325			26344	protein-coding gene	gene with protein product						24240477	Standard	NM_181645		Approved	FLJ25393	uc001pdq.3	Q05D60		ENST00000298050.3:c.447G>A	11.37:g.93103253G>A		Somatic		WXS	SOLID	Phase_IV	92742901	Q8NEF1|Q96LL7	Silent	SNP	ENST00000298050.3	37	CCDS44707.1																																																																																				0.303	CCDC67-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_181645	
CIDEC	63924	hgsc.bcm.edu	37	3	9911605	9911605	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr3:9911605G>C	ENST00000336832.2	-	5	654	c.515C>G	c.(514-516)tCc>tGc	p.S172C	CIDEC_ENST00000455015.1_Missense_Mutation_p.S98C|CIDEC_ENST00000383817.1_Intron|CIDEC_ENST00000443115.1_Intron|CIDEC_ENST00000423850.1_Missense_Mutation_p.S98C|CIDEC_ENST00000430427.1_Missense_Mutation_p.S182C	NM_001199552.1|NM_001199623.1|NM_022094.3	NP_001186481.1|NP_001186552.1|NP_071377.2	Q96AQ7	CIDEC_HUMAN	cell death-inducing DFFA-like effector c	172					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|lipid particle organization (GO:0034389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)|nucleus (GO:0005634)		p.S172F(1)|p.S172C(1)		breast(2)|central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	8	Medulloblastoma(99;0.227)					CAGATCATAGGAAAGGGAGTA	0.512																																																2	Substitution - Missense(2)	ovary(1)|skin(1)	3											86.0	78.0	81.0					3																	9911605		2203	4300	6503	9886605	SO:0001583	missense	63924				CCDS2587.1, CCDS56239.1, CCDS74897.1	3p25	2004-07-26			ENSG00000187288	ENSG00000187288			24229	protein-coding gene	gene with protein product		612120				12429024	Standard	NM_001199623		Approved	CIDE-3, FLJ20871, Fsp27	uc021wsw.1	Q96AQ7	OTTHUMG00000128522	ENST00000336832.2:c.515C>G	3.37:g.9911605G>C	ENSP00000338642:p.Ser172Cys	Somatic		WXS	SOLID	Phase_IV	9886605	C9JMN7|Q67DW9|Q9GZY9	Missense_Mutation	SNP	ENST00000336832.2	37	CCDS2587.1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.657233	0.67586	.	.	ENSG00000187288	ENST00000336832;ENST00000455015;ENST00000423850;ENST00000430427	D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.92427	0.7596	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.93095	0.6503	10	0.87932	D	0	-41.4572	17.7515	0.88435	0.0:0.0:1.0:0.0	.	172;182	Q96AQ7;C9JMN7	CIDEC_HUMAN;.	C	172;98;98;182	ENSP00000338642:S172C;ENSP00000392975:S98C;ENSP00000400649:S98C;ENSP00000408631:S182C	ENSP00000338642:S172C	S	-	2	0	CIDEC	9886605	1.000000	0.71417	0.998000	0.56505	0.325000	0.28411	9.294000	0.96088	2.783000	0.95769	0.655000	0.94253	TCC		0.512	CIDEC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250334.1	NM_022094	
CYC1	1537	hgsc.bcm.edu	37	8	145151526	145151527	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr8:145151526_145151527delCT	ENST00000318911.4	+	5	724_725	c.651_652delCT	c.(649-654)ggctacfs	p.Y218fs	SHARPIN_ENST00000533948.1_5'Flank	NM_001916.3	NP_001907	P08574	CY1_HUMAN	cytochrome c-1	218					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to glucagon (GO:0033762)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|respiratory chain (GO:0070469)	electron transporter, transferring electrons from CoQH2-cytochrome c reductase complex and cytochrome c oxidase complex activity (GO:0045155)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.Y218fs*38(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	15	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;8.71e-40)|all cancers(56;3e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGCTCACGGGCTACTGCGAGCC	0.594											OREG0019052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Deletion - Frameshift(1)	ovary(1)	8																																								145223515	SO:0001589	frameshift_variant	1537			BC001006	CCDS6415.1	8q24	2011-07-04			ENSG00000179091	ENSG00000179091		"""Mitochondrial respiratory chain complex / Complex III"""	2579	protein-coding gene	gene with protein product		123980					Standard	NM_001916		Approved	UQCR4	uc003zaz.4	P08574	OTTHUMG00000165242	ENST00000318911.4:c.651_652delCT	8.37:g.145151526_145151527delCT	ENSP00000317159:p.Tyr218fs	Somatic	1692	WXS	SOLID	Phase_IV	145223514	Q5U062|Q6FHS7	Frame_Shift_Del	DEL	ENST00000318911.4	37	CCDS6415.1																																																																																				0.594	CYC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382895.1	NM_001916	
DHX29	54505	hgsc.bcm.edu	37	5	54592136	54592141	+	In_Frame_Del	DEL	CTTTGT	CTTTGT	-			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	CTTTGT	CTTTGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr5:54592136_54592141delCTTTGT	ENST00000251636.5	-	4	560_565	c.412_417delACAAAG	c.(412-417)acaaagdel	p.TK138del	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	138						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)	p.T138_K139delTK(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				CTTCAATGTCCTTTGTCTTAAATGAA	0.345																																																1	Deletion - In frame(1)	ovary(1)	5																																								54627898	SO:0001651	inframe_deletion	54505			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.412_417delACAAAG	5.37:g.54592136_54592141delCTTTGT	ENSP00000251636:p.Thr138_Lys139del	Somatic		WXS	SOLID	Phase_IV	54627893	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	In_Frame_Del	DEL	ENST00000251636.5	37	CCDS34158.1																																																																																				0.345	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	
EGFR	1956	hgsc.bcm.edu	37	7	55241677	55241677	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr7:55241677G>C	ENST00000275493.2	+	18	2302	c.2125G>C	c.(2125-2127)Gaa>Caa	p.E709Q	EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Missense_Mutation_p.E664Q|EGFR_ENST00000454757.2_Missense_Mutation_p.E656Q	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	709			E -> A (found in a lung cancer sample; more sensitive to gefitinib than wild- type). {ECO:0000269|PubMed:15623594, ECO:0000269|PubMed:16533793}.|E -> G (found in a lung cancer sample; constitutively activated kinase with higher levels of basal autophosphorylation; more sensitive to gefitinib than wild-type). {ECO:0000269|PubMed:15623594}.|E -> K (found in a lung cancer sample). {ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.E709K(16)|p.E709H(2)|p.E709fs*1(1)|p.E709Q(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GATCTTGAAGGAAACTGAATT	0.567		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	20	Substitution - Missense(19)|Deletion - Frameshift(1)	lung(15)|upper_aerodigestive_tract(2)|prostate(2)|ovary(1)	7											88.0	91.0	90.0					7																	55241677		2203	4300	6503	55209171	SO:0001583	missense	1956	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2125G>C	7.37:g.55241677G>C	ENSP00000275493:p.Glu709Gln	Somatic		WXS	SOLID	Phase_IV	55209171	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.924598	0.92319	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.62232	0.04;0.04;0.04	5.83	5.83	0.93111	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.78483	0.4290	M	0.71581	2.175	0.80722	D	1	D;D	0.67145	0.993;0.996	P;D	0.66084	0.86;0.941	T	0.79761	-0.1667	10	0.87932	D	0	.	18.672	0.91514	0.0:0.0:1.0:0.0	.	664;709	Q504U8;P00533	.;EGFR_HUMAN	Q	664;579;709;656	ENSP00000415559:E664Q;ENSP00000275493:E709Q;ENSP00000395243:E656Q	ENSP00000275493:E709Q	E	+	1	0	EGFR	55209171	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.833000	0.99426	2.745000	0.94114	0.563000	0.77884	GAA		0.567	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
EPS15L1	58513	hgsc.bcm.edu	37	19	16552987	16552987	+	Splice_Site	SNP	A	A	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr19:16552987A>G	ENST00000248070.6	-	2	215		c.e2+1		EPS15L1_ENST00000455140.2_Splice_Site|EPS15L1_ENST00000594975.1_Splice_Site|EPS15L1_ENST00000535753.2_Splice_Site|CTD-2013N17.4_ENST00000587343.1_RNA|EPS15L1_ENST00000597937.1_Splice_Site	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1						endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						AGCTAAACTTACCTGCTTGTA	0.428																																																1	Unknown(1)	ovary(1)	19											76.0	72.0	73.0					19																	16552987		2203	4300	6503	16413987	SO:0001630	splice_region_variant	58513			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.75+1T>C	19.37:g.16552987A>G		Somatic		WXS	SOLID	Phase_IV	16413987	A2RRF3|A5PL29|B4DKA3	Splice_Site	SNP	ENST00000248070.6	37	CCDS32944.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.011284	0.75046	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7524	0.69536	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EPS15L1	16413987	1.000000	0.71417	0.995000	0.50966	0.813000	0.45954	6.079000	0.71291	2.090000	0.63153	0.533000	0.62120	.		0.428	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	Intron
HAUS8	93323	hgsc.bcm.edu	37	19	17169444	17169444	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr19:17169444delT	ENST00000253669.5	-	8	750	c.560delA	c.(559-561)aagfs	p.K187fs	HAUS8_ENST00000593360.1_Frame_Shift_Del_p.K126fs|HAUS8_ENST00000448593.2_Frame_Shift_Del_p.K186fs			Q9BT25	HAUS8_HUMAN	HAUS augmin-like complex, subunit 8	187					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.K187T(1)|p.K187fs*9(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	12						TTTCTGTAGCTTCTCCTTCTC	0.453																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|kidney(1)	19											70.0	64.0	66.0					19																	17169444		2203	4300	6503	17030444	SO:0001589	frameshift_variant	93323			BC004398	CCDS32948.1, CCDS46009.1	19p13.11	2013-10-11	2009-04-20	2009-04-20	ENSG00000131351	ENSG00000131351		"""HAUS augmin-like complex subunits"""	30532	protein-coding gene	gene with protein product		613434	"""HEC1/NDC80 interacting, centrosome associated 1"""	HICE1		19427217	Standard	XM_005260154		Approved	MGC20533, NY-SAR-48	uc002nfe.3	Q9BT25		ENST00000253669.5:c.560delA	19.37:g.17169444delT	ENSP00000253669:p.Lys187fs	Somatic		WXS	SOLID	Phase_IV	17030444	B4DJA7|C9JBZ4|Q49AC4|Q86WF0|Q96FX3	Frame_Shift_Del	DEL	ENST00000253669.5	37	CCDS32948.1																																																																																				0.453	HAUS8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463015.1	NM_001011699	
ITGA2B	3674	hgsc.bcm.edu	37	17	42455065	42455065	+	Splice_Site	SNP	C	C	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr17:42455065C>T	ENST00000262407.5	-	21	2219		c.e21+1		ITGA2B_ENST00000353281.4_Splice_Site	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.?(1)		biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	AGCAGCCTCACCTGGGCGTTC	0.537																																																1	Unknown(1)	ovary(1)	17											76.0	64.0	68.0					17																	42455065		2203	4300	6503	39810591	SO:0001630	splice_region_variant	3674				CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.2187+1G>A	17.37:g.42455065C>T		Somatic		WXS	SOLID	Phase_IV	39810591	B2RCY8|O95366|Q14443|Q17R67	Splice_Site	SNP	ENST00000262407.5	37	CCDS32665.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.575729	0.65878	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8102	0.69989	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITGA2B	39810591	1.000000	0.71417	0.844000	0.33320	0.197000	0.23852	5.314000	0.65804	2.560000	0.86352	0.561000	0.74099	.		0.537	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439823.1		Intron
JAKMIP2	9832	hgsc.bcm.edu	37	5	146997488	146997488	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr5:146997488G>A	ENST00000265272.5	-	19	2799	c.2332C>T	c.(2332-2334)Cag>Tag	p.Q778*	JAKMIP2_ENST00000507386.1_Nonsense_Mutation_p.Q757*|JAKMIP2_ENST00000333010.6_Nonsense_Mutation_p.Q736*	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	778						Golgi apparatus (GO:0005794)		p.Q778*(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGCTTGCTGTAAGAGCTCC	0.493																																																1	Substitution - Nonsense(1)	ovary(1)	5											123.0	101.0	108.0					5																	146997488		2203	4300	6503	146977681	SO:0001587	stop_gained	9832			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.2332C>T	5.37:g.146997488G>A	ENSP00000265272:p.Gln778*	Somatic		WXS	SOLID	Phase_IV	146977681	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Nonsense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	G	44	11.059922	0.99510	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	.	.	.	5.72	5.72	0.89469	.	0.057447	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	20.2626	0.98452	0.0:0.0:1.0:0.0	.	.	.	.	X	757;778;736;757	.	ENSP00000265272:Q778X	Q	-	1	0	JAKMIP2	146977681	1.000000	0.71417	0.989000	0.46669	0.977000	0.68977	9.476000	0.97823	2.873000	0.98535	0.563000	0.77884	CAG		0.493	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
JAKMIP2	9832	hgsc.bcm.edu	37	5	147040528	147040528	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr5:147040528G>A	ENST00000265272.5	-	3	1077	c.610C>T	c.(610-612)Cgg>Tgg	p.R204W	JAKMIP2_ENST00000507386.1_Missense_Mutation_p.R204W|JAKMIP2_ENST00000333010.6_Missense_Mutation_p.R162W	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	204						Golgi apparatus (GO:0005794)		p.R204W(2)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAATATCCCGCTCCGACTCC	0.507																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	5											135.0	127.0	130.0					5																	147040528		2203	4300	6503	147020721	SO:0001583	missense	9832			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.610C>T	5.37:g.147040528G>A	ENSP00000265272:p.Arg204Trp	Somatic		WXS	SOLID	Phase_IV	147020721	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404067	0.62288	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.38240	1.15;1.15;1.15	5.13	3.17	0.36434	.	0.000000	0.85682	D	0.000000	T	0.57125	0.2032	M	0.73962	2.25	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.76575	0.988;0.988;0.988;0.988	T	0.62863	-0.6764	10	0.87932	D	0	.	11.8289	0.52283	0.0:0.0:0.4596:0.5404	.	162;204;204;204	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	W	204;204;162;204	ENSP00000421398:R204W;ENSP00000265272:R204W;ENSP00000328989:R162W	ENSP00000265272:R204W	R	-	1	2	JAKMIP2	147020721	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	2.454000	0.44979	1.465000	0.48006	0.655000	0.94253	CGG		0.507	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
KCNH5	27133	hgsc.bcm.edu	37	14	63453857	63453857	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr14:63453857C>A	ENST00000322893.7	-	5	750	c.482G>T	c.(481-483)aGt>aTt	p.S161I	KCNH5_ENST00000394968.1_Missense_Mutation_p.S103I|KCNH5_ENST00000394964.2_Missense_Mutation_p.S103I|KCNH5_ENST00000420622.2_Missense_Mutation_p.S161I	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	161					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.S161I(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		CTGCAAAACACTTCGGCTATT	0.383																																																1	Substitution - Missense(1)	ovary(1)	14											138.0	128.0	131.0					14																	63453857		2203	4300	6503	62523610	SO:0001583	missense	27133			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.482G>T	14.37:g.63453857C>A	ENSP00000321427:p.Ser161Ile	Somatic		WXS	SOLID	Phase_IV	62523610	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.268704	0.59540	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968;ENST00000394964	D;D;D;D	0.98968	-5.28;-5.12;-5.11;-5.11	5.71	5.71	0.89125	.	0.041576	0.85682	D	0.000000	D	0.97748	0.9261	L	0.52573	1.65	0.49389	D	0.999785	B;P;B;P	0.44478	0.286;0.488;0.12;0.836	B;B;B;B	0.44044	0.106;0.24;0.119;0.439	D	0.98132	1.0431	10	0.52906	T	0.07	.	19.85	0.96736	0.0:1.0:0.0:0.0	.	103;103;161;161	Q86XI1;Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;.;KCNH5_HUMAN	I	161;161;103;103	ENSP00000321427:S161I;ENSP00000395439:S161I;ENSP00000378419:S103I;ENSP00000378415:S103I	ENSP00000321427:S161I	S	-	2	0	KCNH5	62523610	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.837000	0.62796	2.697000	0.92050	0.563000	0.77884	AGT		0.383	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
KLHL29	114818	hgsc.bcm.edu	37	2	23926096	23926097	+	Frame_Shift_Ins	INS	-	-	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr2:23926096_23926097insT	ENST00000486442.1	+	12	2863_2864	c.2146_2147insT	c.(2146-2148)ctgfs	p.L716fs		NM_052920.1	NP_443152.1	Q96CT2	KLH29_HUMAN	kelch-like family member 29	716								p.P496fs*51(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|lung(1)|ovary(3)	10						GGTGGCCCCTCTGCCCAAGGCA	0.619																																																2	Insertion - Frameshift(2)	ovary(2)	2																																								23779601	SO:0001589	frameshift_variant	114818				CCDS54335.1	2p23.3	2013-09-27	2013-02-22	2007-01-09	ENSG00000119771	ENSG00000119771		"""Kelch-like"", ""BTB/POZ domain containing"""	29404	protein-coding gene	gene with protein product			"""kelch repeat and BTB (POZ) domain containing 9"", ""kelch-like 29 (Drosophila)"""	KBTBD9		11572484	Standard	NM_052920		Approved	KIAA1921	uc010ykg.2	Q96CT2	OTTHUMG00000151899	ENST00000486442.1:c.2147dupT	2.37:g.23926097_23926097dupT	ENSP00000420659:p.Leu716fs	Somatic		WXS	SOLID	Phase_IV	23779600	Q8N388|Q96BF0|Q96PW7	Frame_Shift_Ins	INS	ENST00000486442.1	37	CCDS54335.1																																																																																				0.619	KLHL29-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324315.3	NM_052920	
METTL12	751071	hgsc.bcm.edu	37	11	62433355	62433356	+	Frame_Shift_Ins	INS	-	-	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr11:62433355_62433356insC	ENST00000532971.1	+	2	261_262	c.4_5insC	c.(4-6)gccfs	p.A2fs	C11orf48_ENST00000524958.1_5'Flank|SNORA57_ENST00000383870.1_RNA|C11orf48_ENST00000525675.1_5'Flank|RP11-831H9.11_ENST00000528405.1_5'Flank|C11orf48_ENST00000532208.1_Intron|C11orf48_ENST00000354588.3_Intron|C11orf48_ENST00000431002.2_Intron|METTL12_ENST00000398922.2_3'UTR	NM_001043229.1	NP_001036694.1	A8MUP2	MET12_HUMAN	methyltransferase like 12	2						mitochondrion (GO:0005739)	methyltransferase activity (GO:0008168)	p.A3fs*25(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	6						TCTCCAGATGGCCGCGCTGCGT	0.614																																																1	Insertion - Frameshift(1)	ovary(1)	11																																								62189932	SO:0001589	frameshift_variant	751071			BC041359	CCDS41657.1	11q12.3	2013-09-30			ENSG00000214756	ENSG00000214756			33113	protein-coding gene	gene with protein product							Standard	NM_001043229		Approved	U99HG	uc001nuh.3	A8MUP2	OTTHUMG00000167545	ENST00000532971.1:c.6dupC	11.37:g.62433357_62433357dupC	ENSP00000431287:p.Ala2fs	Somatic		WXS	SOLID	Phase_IV	62189931	B7Z4C1	Frame_Shift_Ins	INS	ENST00000532971.1	37	CCDS41657.1																																																																																				0.614	METTL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394990.1	NM_001043229	
MYBPC2	4606	hgsc.bcm.edu	37	19	50961918	50961919	+	Frame_Shift_Ins	INS	-	-	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr19:50961918_50961919insC	ENST00000357701.5	+	21	2464_2465	c.2413_2414insC	c.(2413-2415)gccfs	p.A805fs		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	805	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.R806fs*154(1)		breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CCCGACCGGAGCCAGAATCCTC	0.668																																																1	Insertion - Frameshift(1)	ovary(1)	19																																								55653731	SO:0001589	frameshift_variant	4606				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2415dupC	19.37:g.50961920_50961920dupC	ENSP00000350332:p.Ala805fs	Somatic		WXS	SOLID	Phase_IV	55653730	A1L4G9	Frame_Shift_Ins	INS	ENST00000357701.5	37	CCDS46152.1																																																																																				0.668	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
NFKBID	84807	hgsc.bcm.edu	37	19	36381371	36381371	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr19:36381371C>G	ENST00000396901.1	-	10	1201	c.628G>C	c.(628-630)Gtt>Ctt	p.V210L	NFKBID_ENST00000606253.1_Missense_Mutation_p.V210L|NFKBID_ENST00000340950.2_Missense_Mutation_p.V47L|NFKBID_ENST00000352614.2_Missense_Mutation_p.V362L	NM_139239.1	NP_640332.1	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta	210					inflammatory response (GO:0006954)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|positive regulation of thymocyte apoptotic process (GO:0070245)	nucleus (GO:0005634)		p.V210L(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	14						AAGTGCAGAACTGTCTTGTTG	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											80.0	86.0	84.0					19																	36381371		2057	4183	6240	41073211	SO:0001583	missense	84807			AF385434	CCDS42552.1	19q13.12	2013-01-10				ENSG00000167604		"""Ankyrin repeat domain containing"""	15671	protein-coding gene	gene with protein product						12477932	Standard	NM_139239		Approved	TA-NFKBH, IkappaBNS	uc002oci.1	Q8NI38		ENST00000396901.1:c.628G>C	19.37:g.36381371C>G	ENSP00000380109:p.Val210Leu	Somatic		WXS	SOLID	Phase_IV	41073211	Q8NI39|Q9BRG9	Missense_Mutation	SNP	ENST00000396901.1	37	CCDS42552.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.894530	0.52121	.	.	ENSG00000167604	ENST00000352614;ENST00000396901;ENST00000340950	T;T;T	0.64438	-0.1;-0.1;-0.1	4.77	3.73	0.42828	Ankyrin repeat-containing domain (4);	0.140938	0.47455	D	0.000239	T	0.41236	0.1150	N	0.11818	0.18	0.39234	D	0.963734	B;B;B	0.32101	0.356;0.048;0.141	B;B;B	0.31686	0.104;0.134;0.041	T	0.37911	-0.9685	10	0.39692	T	0.17	-13.3233	9.8832	0.41247	0.0:0.8959:0.0:0.1041	.	362;210;47	Q8NI38-2;Q8NI38;Q8NI38-3	.;IKBD_HUMAN;.	L	362;210;47	ENSP00000252985:V362L;ENSP00000380109:V210L;ENSP00000343093:V47L	ENSP00000343093:V47L	V	-	1	0	NFKBID	41073211	0.988000	0.35896	0.291000	0.24904	0.957000	0.61999	4.942000	0.63547	0.962000	0.38057	0.462000	0.41574	GTT		0.592	NFKBID-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452927.3	NM_032721	
PLA2G15	23659	hgsc.bcm.edu	37	16	68293421	68293422	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr16:68293421_68293422delGT	ENST00000219345.5	+	6	1183_1184	c.1100_1101delGT	c.(1099-1101)agtfs	p.S367fs	PLA2G15_ENST00000413021.2_Frame_Shift_Del_p.S273fs|RP11-96D1.7_ENST00000563175.1_RNA|PLA2G15_ENST00000566188.1_3'UTR|PLA2G15_ENST00000444212.2_Frame_Shift_Del_p.S167fs|RP11-96D1.7_ENST00000569843.1_RNA	NM_012320.3	NP_036452.1	Q8NCC3	PAG15_HUMAN	phospholipase A2, group XV	367					ceramide metabolic process (GO:0006672)|fatty acid catabolic process (GO:0009062)|phosphatidylcholine metabolic process (GO:0046470)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)|O-acyltransferase activity (GO:0008374)|phospholipid binding (GO:0005543)	p.A368fs*>45(1)		kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	12						AACTTGAAGAGTGCCCTGCAGT	0.594																																																1	Deletion - Frameshift(1)	ovary(1)	16																																								66850923	SO:0001589	frameshift_variant	23659			AB017494	CCDS10864.1	16q22.1	2008-09-19	2008-09-19	2008-09-19	ENSG00000103066	ENSG00000103066			17163	protein-coding gene	gene with protein product		609362	"""lysophospholipase 3 (lysosomal phospholipase A2)"""	LYPLA3		10092508, 16973413	Standard	XM_005255886		Approved	LLPL, GXVPLA2	uc002evr.3	Q8NCC3	OTTHUMG00000137554	ENST00000219345.5:c.1100_1101delGT	16.37:g.68293421_68293422delGT	ENSP00000219345:p.Ser367fs	Somatic		WXS	SOLID	Phase_IV	66850922	B3KMF3|B4DUD1|Q53GZ1|Q9NPQ6|Q9UG04|Q9Y2B3	Frame_Shift_Del	DEL	ENST00000219345.5	37	CCDS10864.1																																																																																				0.594	PLA2G15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268888.2	NM_012320	
RBM12B	389677	hgsc.bcm.edu	37	8	94746145	94746145	+	Frame_Shift_Del	DEL	C	C	-			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr8:94746145delC	ENST00000399300.2	-	3	2707	c.2494delG	c.(2494-2496)gagfs	p.E833fs	RBM12B_ENST00000520961.1_Intron|RBM12B_ENST00000517700.1_Frame_Shift_Del_p.E713fs|RP11-10N23.4_ENST00000517998.1_RNA	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	833							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E832fs*55(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			AAATCTTCCTCCTGGGGGCTC	0.542																																																1	Deletion - Frameshift(1)	ovary(1)	8											50.0	51.0	50.0					8																	94746145		1831	4081	5912	94815321	SO:0001589	frameshift_variant	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2494delG	8.37:g.94746145delC	ENSP00000382239:p.Glu833fs	Somatic		WXS	SOLID	Phase_IV	94815321	A8MYB5	Frame_Shift_Del	DEL	ENST00000399300.2	37	CCDS43755.1																																																																																				0.542	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390	
SEC63	11231	hgsc.bcm.edu	37	6	108214774	108214774	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr6:108214774delT	ENST00000369002.4	-	16	1765	c.1586delA	c.(1585-1587)aagfs	p.K530fs		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	530	SEC63 1.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.K529fs*4(1)		endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TAAAGGTTTCTTTTTTTTTGA	0.368																																																1	Deletion - Frameshift(1)	ovary(1)	6											118.0	123.0	121.0					6																	108214774		2202	4300	6502	108321467	SO:0001589	frameshift_variant	11231			BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.1586delA	6.37:g.108214774delT	ENSP00000357998:p.Lys530fs	Somatic		WXS	SOLID	Phase_IV	108321467	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Frame_Shift_Del	DEL	ENST00000369002.4	37	CCDS5061.1																																																																																				0.368	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4	NM_007214	
SEMA5A	9037	hgsc.bcm.edu	37	5	9066612	9066612	+	Silent	SNP	C	C	T	rs200621236		TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr5:9066612C>T	ENST00000382496.5	-	17	2885	c.2220G>A	c.(2218-2220)ccG>ccA	p.P740P		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	740	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)	p.P740P(1)		biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CCAGCAAATTCGGATCAGCCA	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17878	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	5											162.0	155.0	157.0					5																	9066612		2203	4300	6503	9119612	SO:0001819	synonymous_variant	9037			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2220G>A	5.37:g.9066612C>T		Somatic		WXS	SOLID	Phase_IV	9119612	D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	37	CCDS3875.1																																																																																				0.562	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
SFI1	9814	hgsc.bcm.edu	37	22	32013014	32013014	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr22:32013014G>T	ENST00000400288.2	+	31	3567	c.3462G>T	c.(3460-3462)gaG>gaT	p.E1154D	SFI1_ENST00000540643.1_Missense_Mutation_p.E1099D|SFI1_ENST00000443326.1_Missense_Mutation_p.E1072D|SFI1_ENST00000474741.1_Intron|SFI1_ENST00000432498.1_Missense_Mutation_p.E1123D|SFI1_ENST00000400289.1_Missense_Mutation_p.E1072D|SFI1_ENST00000443011.1_Missense_Mutation_p.E1001D|SFI1_ENST00000414585.1_Missense_Mutation_p.R1000M	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	1154					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.E1154D(1)		NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						CTGAACTTGAGGAGATCCAGC	0.562																																																1	Substitution - Missense(1)	ovary(1)	22											87.0	94.0	92.0					22																	32013014		2113	4224	6337	30343014	SO:0001583	missense	9814			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.3462G>T	22.37:g.32013014G>T	ENSP00000383145:p.Glu1154Asp	Somatic		WXS	SOLID	Phase_IV	30343014	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	37	CCDS43004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.18|18.18	3.566065|3.566065	0.65651|0.65651	.|.	.|.	ENSG00000198089|ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000421060;ENST00000443011;ENST00000400289;ENST00000400288|ENST00000414585	T;T;T;T;T;T|T	0.11277|0.11712	2.95;2.95;2.79;2.79;2.79;2.95|2.75	5.45|5.45	2.25|2.25	0.28309|0.28309	.|.	0.166785|.	0.41500|.	D|.	0.000861|.	T|T	0.07052|0.07052	0.0179|0.0179	N|N	0.08118|0.08118	0|0	0.21147|0.21147	N|N	0.999775|0.999775	D;D;D;D;D;D;D|.	0.89917|.	1.0;0.998;0.999;0.999;0.987;1.0;0.996|.	D;D;D;D;P;D;D|.	0.87578|.	0.998;0.99;0.972;0.983;0.809;0.998;0.987|.	T|T	0.34502|0.34502	-0.9826|-0.9826	10|7	0.51188|0.87932	T|D	0.08|0	.|.	8.543|8.543	0.33404|0.33404	0.2406:0.0:0.7594:0.0|0.2406:0.0:0.7594:0.0	.|.	1099;1060;1001;737;1072;1123;1154|.	A8K8P3-9;A8K8P3-10;D3YTJ2;B7ZBE1;A8K8P3-3;A8K8P3-2;A8K8P3|.	.;.;.;.;.;.;SFI1_HUMAN|.	D|M	1123;1099;1072;903;1001;1072;1154|1000	ENSP00000402679:E1123D;ENSP00000443025:E1099D;ENSP00000416469:E1072D;ENSP00000401199:E1001D;ENSP00000383146:E1072D;ENSP00000383145:E1154D|ENSP00000397148:R1000M	ENSP00000383145:E1154D|ENSP00000397148:R1000M	E|R	+|+	3|2	2|0	SFI1|SFI1	30343014|30343014	0.998000|0.998000	0.40836|0.40836	0.996000|0.996000	0.52242|0.52242	0.682000|0.682000	0.39822|0.39822	1.167000|1.167000	0.31847|0.31847	1.313000|1.313000	0.45069|0.45069	0.563000|0.563000	0.77884|0.77884	GAG|AGG		0.562	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775	
SPRED2	200734	hgsc.bcm.edu	37	2	65559174	65559174	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr2:65559174A>G	ENST00000356388.4	-	4	574	c.385T>C	c.(385-387)Tca>Cca	p.S129P	SPRED2_ENST00000443619.2_Missense_Mutation_p.S126P|SPRED2_ENST00000474228.1_5'UTR	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	129					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)	p.S129P(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						GTGGAAGATGACGTTGTTGAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	2											100.0	93.0	95.0					2																	65559174		2203	4300	6503	65412678	SO:0001583	missense	200734			AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.385T>C	2.37:g.65559174A>G	ENSP00000348753:p.Ser129Pro	Somatic		WXS	SOLID	Phase_IV	65412678	A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Missense_Mutation	SNP	ENST00000356388.4	37	CCDS33211.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.681820	0.88542	.	.	ENSG00000198369	ENST00000356388;ENST00000443619;ENST00000452315;ENST00000421087	T;T;T;T	0.78246	-1.16;-1.15;-1.15;-0.14	6.17	4.98	0.66077	.	0.168831	0.53938	D	0.000046	D	0.82683	0.5090	M	0.78801	2.425	0.80722	D	1	B;D	0.62365	0.004;0.991	B;P	0.53689	0.008;0.732	T	0.80841	-0.1202	10	0.22109	T	0.4	-8.8168	13.7691	0.63012	0.8725:0.1275:0.0:0.0	.	126;129	E9PEP0;Q7Z698	.;SPRE2_HUMAN	P	129;126;144;61	ENSP00000348753:S129P;ENSP00000393697:S126P;ENSP00000390595:S144P;ENSP00000407627:S61P	ENSP00000348753:S129P	S	-	1	0	SPRED2	65412678	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	6.555000	0.73928	2.371000	0.80710	0.533000	0.62120	TCA		0.333	SPRED2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327632.1		
ZFHX3	463	hgsc.bcm.edu	37	16	72827204	72827204	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr16:72827204A>C	ENST00000268489.5	-	9	10049	c.9377T>G	c.(9376-9378)cTc>cGc	p.L3126R	RP5-991G20.4_ENST00000569195.1_RNA|ZFHX3_ENST00000397992.5_Missense_Mutation_p.L2212R	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3126					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L3126R(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GAGGCCCGGGAGCAACACAGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	16											97.0	104.0	101.0					16																	72827204		2198	4300	6498	71384705	SO:0001583	missense	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.9377T>G	16.37:g.72827204A>C	ENSP00000268489:p.Leu3126Arg	Somatic		WXS	SOLID	Phase_IV	71384705	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	A	10.88	1.475044	0.26511	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.77489	-1.1;-1.07	5.84	5.84	0.93424	.	0.000000	0.45126	D	0.000390	D	0.86276	0.5894	L	0.60455	1.87	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.87498	0.2431	10	0.87932	D	0	.	16.2167	0.82231	1.0:0.0:0.0:0.0	.	3126	Q15911	ZFHX3_HUMAN	R	3126;2212	ENSP00000268489:L3126R;ENSP00000438926:L2212R	ENSP00000268489:L3126R	L	-	2	0	ZFHX3	71384705	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.297000	0.96120	2.231000	0.72958	0.533000	0.62120	CTC		0.562	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ADAMTS14	140766	hgsc.bcm.edu	37	10	72500808	72500808	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr10:72500808A>T	ENST00000373207.1	+	12	1814	c.1814A>T	c.(1813-1815)gAg>gTg	p.E605V	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.E608V	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	605	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E608V(1)		NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						AACAGCGAGGAGTGCCCTGGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	10											90.0	75.0	80.0					10																	72500808		2203	4300	6503	72170814	SO:0001583	missense	140766			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.1814A>T	10.37:g.72500808A>T	ENSP00000362303:p.Glu605Val	Somatic		WXS	SOLID	Phase_IV	72170814	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	A	18.68	3.676379	0.67928	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.03831	3.79;3.79	5.27	4.11	0.48088	.	0.132116	0.49916	D	0.000138	T	0.15392	0.0371	L	0.59967	1.855	0.42764	D	0.993811	D;B;D	0.60160	0.987;0.242;0.961	D;B;P	0.65684	0.937;0.314;0.868	T	0.00360	-1.1790	10	0.59425	D	0.04	.	11.9673	0.53042	0.8547:0.1453:0.0:0.0	.	538;605;608	Q8WXS8-2;Q8WXS8;Q5T4G1	.;ATS14_HUMAN;.	V	608;605	ENSP00000362304:E608V;ENSP00000362303:E605V	ENSP00000362303:E605V	E	+	2	0	ADAMTS14	72170814	1.000000	0.71417	0.998000	0.56505	0.956000	0.61745	6.911000	0.75746	0.986000	0.38683	0.533000	0.62120	GAG		0.602	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
AHCYL1	10768	hgsc.bcm.edu	37	1	110560608	110560608	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:110560608C>T	ENST00000369799.5	+	11	1460	c.1093C>T	c.(1093-1095)Cgg>Tgg	p.R365W	AHCYL1_ENST00000359172.3_Missense_Mutation_p.R318W|AHCYL1_ENST00000393614.4_Missense_Mutation_p.R318W	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	365	NAD binding. {ECO:0000250}.				mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)	p.R365W(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		TGAAGTCATCCGGCAAGTCGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											166.0	152.0	157.0					1																	110560608		2203	4300	6503	110362131	SO:0001583	missense	10768			U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.1093C>T	1.37:g.110560608C>T	ENSP00000358814:p.Arg365Trp	Somatic		WXS	SOLID	Phase_IV	110362131	B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Missense_Mutation	SNP	ENST00000369799.5	37	CCDS818.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747747	0.69533	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	T;T;T	0.78126	-1.15;-1.14;-1.14	6.02	5.09	0.68999	S-adenosyl-L-homocysteine hydrolase, NAD binding (1);	0.000000	0.85682	D	0.000000	T	0.73528	0.3598	M	0.86651	2.83	0.80722	D	1	B	0.33807	0.426	B	0.29716	0.106	T	0.78999	-0.1982	10	0.72032	D	0.01	0.1747	16.5388	0.84380	0.1316:0.8684:0.0:0.0	.	365	O43865	SAHH2_HUMAN	W	365;318;318	ENSP00000358814:R365W;ENSP00000352092:R318W;ENSP00000377238:R318W	ENSP00000352092:R318W	R	+	1	2	AHCYL1	110362131	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.814000	0.48010	1.503000	0.48686	0.650000	0.86243	CGG		0.413	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032243.1		
ADORA3	140	hgsc.bcm.edu	37	1	112033360	112033360	+	Silent	SNP	C	C	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:112033360C>T	ENST00000369716.4	-	2	508	c.375G>A	c.(373-375)ggG>ggA	p.G125G	ADORA3_ENST00000369717.4_Silent_p.G44G|RNU6-792P_ENST00000363490.1_RNA	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor	250					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)	p.G125G(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	ATAGAATGCACCCAGGGAGCC	0.448																																																1	Substitution - coding silent(1)	ovary(1)	1											101.0	95.0	97.0					1																	112033360		2203	4300	6503	111834883	SO:0001819	synonymous_variant	140			BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.375G>A	1.37:g.112033360C>T		Somatic		WXS	SOLID	Phase_IV	111834883	A2A3P4|Q6UWU0|Q9BYZ1	Silent	SNP	ENST00000369716.4	37	CCDS838.1																																																																																				0.448	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	NM_000677, NM_020683	
BCL7A	605	hgsc.bcm.edu	37	12	122492854	122492854	+	Intron	SNP	A	A	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr12:122492854A>C	ENST00000261822.4	+	5	767				BCL7A_ENST00000538010.1_Silent_p.R195R	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A						negative regulation of transcription, DNA-templated (GO:0045892)			p.R195R(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		GAGGTCTCAGAGGGGCAGCCA	0.557			T	MYC	BNHL						OREG0022214	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(17;197 467 16477 23242 44349)		Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	1	Substitution - coding silent(1)	ovary(1)	12											71.0	76.0	74.0					12																	122492854		2203	4300	6503	120977237	SO:0001627	intron_variant	605			X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.561+22A>C	12.37:g.122492854A>C		Somatic	1519	WXS	SOLID	Phase_IV	120977237	B4DJN6|B7ZB21|Q13843|Q14CT7	Silent	SNP	ENST00000261822.4	37	CCDS53841.1																																																																																				0.557	BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000401712.1		
C6	729	hgsc.bcm.edu	37	5	41154096	41154096	+	Silent	SNP	C	C	T	rs367874720		TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr5:41154096C>T	ENST00000263413.3	-	15	2370	c.2106G>A	c.(2104-2106)acG>acA	p.T702T	C6_ENST00000337836.5_Silent_p.T702T	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	702	C5b-binding domain.|CCP 2.|Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.T702T(2)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TGATGCACTCCGTCCCTGCAA	0.403																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	5						C	,	1,4405	2.1+/-5.4	0,1,2202	94.0	85.0	88.0		2106,2106	-4.7	0.0	5		88	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	C6	NM_000065.2,NM_001115131.1	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	702/935,702/935	41154096	1,13005	2203	4300	6503	41189853	SO:0001819	synonymous_variant	729			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.2106G>A	5.37:g.41154096C>T		Somatic		WXS	SOLID	Phase_IV	41189853		Silent	SNP	ENST00000263413.3	37	CCDS3936.1																																																																																				0.403	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
CLCA4	22802	hgsc.bcm.edu	37	1	87036838	87036838	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:87036838T>A	ENST00000370563.3	+	8	1303	c.1261T>A	c.(1261-1263)Tct>Act	p.S421T	CLCA4_ENST00000263723.5_Missense_Mutation_p.S134T|CLCA4_ENST00000496322.1_3'UTR|RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	421	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)	p.S421T(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		CACTGCAAGTTCTTGTATTGA	0.443																																																1	Substitution - Missense(1)	ovary(1)	1											277.0	264.0	268.0					1																	87036838		1957	4149	6106	86809426	SO:0001583	missense	22802			AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.1261T>A	1.37:g.87036838T>A	ENSP00000359594:p.Ser421Thr	Somatic		WXS	SOLID	Phase_IV	86809426	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	ENST00000370563.3	37	CCDS41355.1	.	.	.	.	.	.	.	.	.	.	T	12.99	2.104787	0.37145	.	.	ENSG00000016602	ENST00000370563;ENST00000263723	T;T	0.13538	2.58;2.58	6.17	-7.53	0.01336	von Willebrand factor, type A (3);	2.223410	0.01193	N	0.007371	T	0.03608	0.0103	L	0.46947	1.48	0.09310	N	1	B	0.14012	0.009	B	0.21360	0.034	T	0.42666	-0.9438	10	0.32370	T	0.25	-0.0342	6.5236	0.22289	0.2436:0.0:0.1957:0.5607	.	421	Q14CN2	CLCA4_HUMAN	T	421;134	ENSP00000359594:S421T;ENSP00000263723:S134T	ENSP00000263723:S134T	S	+	1	0	CLCA4	86809426	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.105000	0.01339	-0.607000	0.05738	-0.438000	0.05819	TCT		0.443	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128	
CADM3	57863	hgsc.bcm.edu	37	1	159169647	159169647	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:159169647C>A	ENST00000368125.4	+	8	1216	c.1059C>A	c.(1057-1059)caC>caA	p.H353Q	CTA-134P22.2_ENST00000609696.1_RNA|CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Missense_Mutation_p.H387Q|CADM3_ENST00000497636.1_3'UTR	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	353					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.H387Q(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					TCCTTGGCCACTACTTGATCC	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											120.0	93.0	102.0					1																	159169647		2203	4300	6503	157436271	SO:0001583	missense	57863			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.1059C>A	1.37:g.159169647C>A	ENSP00000357107:p.His353Gln	Somatic		WXS	SOLID	Phase_IV	157436271	Q8IZQ9|Q9NVJ5|Q9UJP1	Missense_Mutation	SNP	ENST00000368125.4	37	CCDS44251.1	.	.	.	.	.	.	.	.	.	.	C	8.016	0.758569	0.15846	.	.	ENSG00000162706	ENST00000368124;ENST00000368125	T;T	0.54279	0.59;0.58	4.63	3.71	0.42584	Neurexin/syndecan/glycophorin C (1);	0.065599	0.56097	D	0.000039	T	0.30293	0.0760	L	0.46157	1.445	0.33845	D	0.631932	P;P	0.45827	0.456;0.867	B;B	0.41917	0.277;0.37	T	0.07309	-1.0779	10	0.30854	T	0.27	.	13.5759	0.61875	0.0:0.9139:0.0:0.0861	.	353;387	Q8N126;Q8N126-2	CADM3_HUMAN;.	Q	387;353	ENSP00000357106:H387Q;ENSP00000357107:H353Q	ENSP00000357106:H387Q	H	+	3	2	CADM3	157436271	0.964000	0.33143	0.997000	0.53966	0.172000	0.22775	0.128000	0.15810	0.583000	0.29574	-1.094000	0.02160	CAC		0.572	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189	
CNPY3	10695	hgsc.bcm.edu	37	6	42905541	42905541	+	Silent	SNP	C	C	T	rs373936858		TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr6:42905541C>T	ENST00000372836.4	+	4	830	c.459C>T	c.(457-459)aaC>aaT	p.N153N	RP3-475N16.1_ENST00000450671.1_RNA|CNPY3_ENST00000394142.3_3'UTR	NM_006586.3	NP_006577.2	Q9BT09	CNPY3_HUMAN	canopy FGF signaling regulator 3	153	Saposin B-type.				innate immune response (GO:0045087)|toll-like receptor signaling pathway (GO:0002224)	endoplasmic reticulum lumen (GO:0005788)		p.N153N(1)		central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)	6	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			AGCTGTGGAACGAGACTTCTG	0.562													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20197	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	6						C		2,4404	4.2+/-10.8	0,2,2201	208.0	180.0	189.0		459	-2.4	1.0	6		189	0,8600		0,0,4300	no	coding-synonymous	CNPY3	NM_006586.3		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		153/279	42905541	2,13004	2203	4300	6503	43013519	SO:0001819	synonymous_variant	10695			U80744	CCDS4875.1	6p21.1	2013-09-19	2013-07-23	2007-10-22	ENSG00000137161	ENSG00000137161		"""Trinucleotide (CAG) repeat containing"""	11968	protein-coding gene	gene with protein product		610774	"""trinucleotide repeat containing 5"", ""canopy 3 homolog (zebrafish)"""	TNRC5		9225980	Standard	NM_006586		Approved	CAG4A	uc003ota.4	Q9BT09	OTTHUMG00000014708	ENST00000372836.4:c.459C>T	6.37:g.42905541C>T		Somatic		WXS	SOLID	Phase_IV	43013519	O15412|Q0P6I2|Q8NF54|Q8WTU8|Q9P0F2	Silent	SNP	ENST00000372836.4	37	CCDS4875.1																																																																																				0.562	CNPY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040564.1	NM_006586	
DLEC1	9940	hgsc.bcm.edu	37	3	38158122	38158122	+	Silent	SNP	G	G	A	rs114701641	byFrequency	TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr3:38158122G>A	ENST00000308059.6	+	28	4056	c.4035G>A	c.(4033-4035)tcG>tcA	p.S1345S	DLEC1_ENST00000346219.3_Silent_p.S1345S|DLEC1_ENST00000452631.2_Silent_p.S1348S					deleted in lung and esophageal cancer 1									p.S1345S(3)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		CCAGTTCATCGGAATTCAGCC	0.627													G|||	78	0.0155751	0.0325	0.0144	5008	,	,		17800	0.0069		0.0139	False		,,,				2504	0.0041															3	Substitution - coding silent(3)	pancreas(2)|ovary(1)	3						G	,	100,3792		0,100,1846	62.0	61.0	61.0		4035,4035	-9.6	0.0	3	dbSNP_132	61	133,8139		0,133,4003	yes	coding-synonymous,coding-synonymous	DLEC1	NM_007335.2,NM_007337.2	,	0,233,5849	AA,AG,GG		1.6078,2.5694,1.9155	,	1345/1756,1345/1779	38158122	233,11931	1946	4136	6082	38133126	SO:0001819	synonymous_variant	9940			AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.4035G>A	3.37:g.38158122G>A		Somatic		WXS	SOLID	Phase_IV	38133126		Silent	SNP	ENST00000308059.6	37	CCDS2672.2																																																																																				0.627	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
TMEM150C	441027	hgsc.bcm.edu	37	4	83423918	83423918	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr4:83423918C>T	ENST00000515780.2	-	5	401	c.197G>A	c.(196-198)tGt>tAt	p.C66Y	TMEM150C_ENST00000508701.1_Missense_Mutation_p.C66Y|TMEM150C_ENST00000449862.2_Missense_Mutation_p.C66Y			B9EJG8	T150C_HUMAN	transmembrane protein 150C	66						integral component of membrane (GO:0016021)		p.C66Y(1)		ovary(1)	1						ACTAAACACACAGCTTGCAGG	0.358																																																1	Substitution - Missense(1)	ovary(1)	4											66.0	62.0	63.0					4																	83423918		1879	4099	5978	83642942	SO:0001583	missense	441027			BC147027	CCDS47087.1	4q21.22	2010-06-25			ENSG00000249242	ENSG00000249242			37263	protein-coding gene	gene with protein product							Standard	NM_001080506		Approved	FLJ12993	uc003hmy.1	B9EJG8	OTTHUMG00000161083	ENST00000515780.2:c.197G>A	4.37:g.83423918C>T	ENSP00000420919:p.Cys66Tyr	Somatic		WXS	SOLID	Phase_IV	83642942	B7Z4J5|B7Z4L3|B7Z692|B7Z6X6	Missense_Mutation	SNP	ENST00000515780.2	37	CCDS47087.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195175	0.58017	.	.	ENSG00000249242	ENST00000449862;ENST00000515780;ENST00000508701;ENST00000454948	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.77	5.77	0.91146	.	.	.	.	.	T	0.72382	0.3453	M	0.81682	2.555	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.83275	0.996;0.995	T	0.72228	-0.4354	9	0.48119	T	0.1	-6.0583	19.9915	0.97366	0.0:1.0:0.0:0.0	.	66;66	B9EJG8-2;B9EJG8	.;T150C_HUMAN	Y	66	ENSP00000403438:C66Y;ENSP00000420919:C66Y;ENSP00000421812:C66Y;ENSP00000414988:C66Y	ENSP00000403438:C66Y	C	-	2	0	TMEM150C	83642942	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	6.536000	0.73842	2.723000	0.93209	0.655000	0.94253	TGT		0.358	TMEM150C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363685.2	NM_001080506	
GPR19	2842	hgsc.bcm.edu	37	12	12814170	12814170	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr12:12814170G>C	ENST00000540510.1	-	2	1405	c.1213C>G	c.(1213-1215)Ccc>Gcc	p.P405A	GPR19_ENST00000332427.2_Missense_Mutation_p.P405A			P46093	GPR4_HUMAN	G protein-coupled receptor 19	0					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P405A(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		GAGTTAATGGGCCAAGCAAGC	0.363																																																1	Substitution - Missense(1)	ovary(1)	12											83.0	77.0	79.0					12																	12814170		2203	4300	6503	12705437	SO:0001583	missense	2842				CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.1213C>G	12.37:g.12814170G>C	ENSP00000441832:p.Pro405Ala	Somatic		WXS	SOLID	Phase_IV	12705437	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000540510.1	37	CCDS8652.1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.800377	0.70567	.	.	ENSG00000183150	ENST00000540510;ENST00000332427	T;T	0.69435	-0.4;-0.4	5.64	5.64	0.86602	.	0.058339	0.64402	D	0.000001	T	0.66636	0.2809	L	0.27053	0.805	0.80722	D	1	D	0.58268	0.982	P	0.51170	0.661	T	0.70880	-0.4752	10	0.87932	D	0	-26.0629	19.3003	0.94141	0.0:0.0:1.0:0.0	.	405	Q15760	GPR19_HUMAN	A	405	ENSP00000441832:P405A;ENSP00000333744:P405A	ENSP00000333744:P405A	P	-	1	0	GPR19	12705437	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.946000	0.87746	2.658000	0.90341	0.650000	0.86243	CCC		0.363	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400662.1	NM_006143	
GPT2	84706	hgsc.bcm.edu	37	16	46931607	46931607	+	Silent	SNP	C	C	T	rs371230832	byFrequency	TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr16:46931607C>T	ENST00000340124.4	+	3	403	c.291C>T	c.(289-291)gaC>gaT	p.D97D	GPT2_ENST00000440783.2_5'UTR	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	97					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)	p.D97D(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	ACATCGGGGACGCCCAGGCTA	0.612													C|||	2	0.000399361	0.0	0.0014	5008	,	,		15995	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	16						C	,	2,4404	4.2+/-10.8	0,2,2201	55.0	58.0	57.0		,291	-1.9	1.0	16		57	0,8600		0,0,4300	no	utr-5,coding-synonymous	GPT2	NM_001142466.1,NM_133443.2	,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,	,97/524	46931607	2,13004	2203	4300	6503	45489108	SO:0001819	synonymous_variant	84706				CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.291C>T	16.37:g.46931607C>T		Somatic		WXS	SOLID	Phase_IV	45489108	Q8N9E2	Silent	SNP	ENST00000340124.4	37	CCDS10725.1																																																																																				0.612	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255741.2		
IQCF1	132141	hgsc.bcm.edu	37	3	51929103	51929103	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr3:51929103G>A	ENST00000310914.5	-	4	483	c.421C>T	c.(421-423)Cgc>Tgc	p.R141C		NM_152397.2	NP_689610.2	Q8N6M8	IQCF1_HUMAN	IQ motif containing F1	141	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.							p.R141C(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TAGCGTCTGCGGATGCGCCAC	0.612																																																1	Substitution - Missense(1)	ovary(1)	3											91.0	84.0	87.0					3																	51929103		2203	4300	6503	51904143	SO:0001583	missense	132141			BC029595	CCDS2836.1	3p21.31	2008-02-05			ENSG00000173389	ENSG00000173389			28607	protein-coding gene	gene with protein product						12477932	Standard	NM_152397		Approved	MGC39725	uc003dbv.3	Q8N6M8	OTTHUMG00000156908	ENST00000310914.5:c.421C>T	3.37:g.51929103G>A	ENSP00000307958:p.Arg141Cys	Somatic		WXS	SOLID	Phase_IV	51904143	Q8N711	Missense_Mutation	SNP	ENST00000310914.5	37	CCDS2836.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.663283	0.29515	.	.	ENSG00000173389	ENST00000310914	T	0.65732	-0.17	4.75	2.95	0.34219	.	0.221444	0.32488	N	0.006039	T	0.55114	0.1900	M	0.68593	2.085	0.09310	N	0.999998	B	0.33379	0.41	B	0.30646	0.118	T	0.54132	-0.8339	10	0.72032	D	0.01	-19.5588	7.5131	0.27585	0.1963:0.0:0.8037:0.0	.	141	Q8N6M8	IQCF1_HUMAN	C	141	ENSP00000307958:R141C	ENSP00000307958:R141C	R	-	1	0	IQCF1	51904143	0.135000	0.22499	0.003000	0.11579	0.458000	0.32498	2.112000	0.41892	0.722000	0.32252	0.549000	0.68633	CGC		0.612	IQCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346568.1	NM_152397	
KIAA1614	57710	hgsc.bcm.edu	37	1	180886093	180886093	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:180886093G>T	ENST00000367588.4	+	2	909	c.854G>T	c.(853-855)gGc>gTc	p.G285V		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	285								p.G285V(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						GAGGCTCTGGGCGCTGGGAGC	0.627																																																1	Substitution - Missense(1)	ovary(1)	1											76.0	92.0	87.0					1																	180886093		2083	4218	6301	179152716	SO:0001583	missense	57710			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.854G>T	1.37:g.180886093G>T	ENSP00000356560:p.Gly285Val	Somatic		WXS	SOLID	Phase_IV	179152716	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.495580	0.26774	.	.	ENSG00000135835	ENST00000367588	T	0.16073	2.37	4.45	1.49	0.22878	.	0.619063	0.13498	N	0.383474	T	0.27349	0.0671	L	0.51422	1.61	0.28336	N	0.921557	D	0.61080	0.989	P	0.59487	0.858	T	0.34129	-0.9841	9	0.56958	D	0.05	-3.291	7.7644	0.28972	0.2814:0.0:0.7186:0.0	.	285	Q5VZ46	K1614_HUMAN	V	285	ENSP00000356560:G285V	ENSP00000356560:G285V	G	+	2	0	KIAA1614	179152716	0.005000	0.15991	0.326000	0.25389	0.111000	0.19643	0.690000	0.25451	0.513000	0.28278	0.467000	0.42956	GGC		0.627	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531	
MAP4	4134	hgsc.bcm.edu	37	3	48040304	48040304	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr3:48040304T>A	ENST00000360240.6	-	2	565	c.47A>T	c.(46-48)gAc>gTc	p.D16V	MAP4_ENST00000426837.2_Missense_Mutation_p.D16V|MAP4_ENST00000439356.1_Missense_Mutation_p.D16V|MAP4_ENST00000434267.1_Missense_Mutation_p.D16V|MAP4_ENST00000395734.3_Missense_Mutation_p.D16V|MAP4_ENST00000383737.4_Missense_Mutation_p.D16V	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	16					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.D16V(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TCCCTCAATGTCTGGAGATGG	0.458																																																1	Substitution - Missense(1)	ovary(1)	3											169.0	151.0	157.0					3																	48040304		2203	4300	6503	48015308	SO:0001583	missense	4134				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.47A>T	3.37:g.48040304T>A	ENSP00000353375:p.Asp16Val	Somatic		WXS	SOLID	Phase_IV	48015308	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	ENST00000360240.6	37	CCDS33750.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.52|15.52	2.859015|2.859015	0.51376|0.51376	.|.	.|.	ENSG00000047849|ENSG00000047849	ENST00000383737;ENST00000395734;ENST00000426837;ENST00000360240;ENST00000434267;ENST00000439356|ENST00000423088	T;T;T;T;T;T|.	0.31510|.	1.49;1.49;1.49;1.49;1.49;1.49|.	4.56|4.56	4.56|4.56	0.56223|0.56223	.|.	.|.	.|.	.|.	.|.	T|T	0.34803|0.34803	0.0910|0.0910	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	P;B;P;B|.	0.34909|.	0.475;0.018;0.467;0.242|.	B;B;B;B|.	0.35971|.	0.107;0.018;0.215;0.143|.	T|T	0.17501|0.17501	-1.0367|-1.0367	9|5	0.87932|.	D|.	0|.	-9.5307|-9.5307	10.4866|10.4866	0.44726|0.44726	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	16;16;16;16|.	C9JFC3;Q86V26;P27816-6;P27816|.	.;.;.;MAP4_HUMAN|.	V|S	16|23	ENSP00000373243:D16V;ENSP00000379083:D16V;ENSP00000407602:D16V;ENSP00000353375:D16V;ENSP00000402767:D16V;ENSP00000397414:D16V|.	ENSP00000353375:D16V|.	D|T	-|-	2|1	0|0	MAP4|MAP4	48015308|48015308	0.969000|0.969000	0.33509|0.33509	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	2.115000|2.115000	0.41921|0.41921	2.050000|2.050000	0.60909|0.60909	0.383000|0.383000	0.25322|0.25322	GAC|ACA		0.458	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375	
S100A7L2	645922	hgsc.bcm.edu	37	1	153410740	153410740	+	Silent	SNP	T	T	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:153410740T>C	ENST00000368725.2	-	2	98	c.99A>G	c.(97-99)ggA>ggG	p.G33G		NM_001045479.1	NP_001038944.2	Q5SY68	S1A7B_HUMAN	S100 calcium binding protein A7-like 2	22	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)	p.G22G(1)		NS(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TACCATCATCTCCACTGTATT	0.473																																																1	Substitution - coding silent(1)	ovary(1)	1											180.0	147.0	158.0					1																	153410740		2203	4300	6503	151677364	SO:0001819	synonymous_variant	645922					1q21.3	2013-01-10			ENSG00000197364	ENSG00000197364		"""EF-hand domain containing"""	21655	protein-coding gene	gene with protein product							Standard	NM_001045479		Approved	s100a7b	uc010pdx.2	Q5SY68	OTTHUMG00000013129	ENST00000368725.2:c.99A>G	1.37:g.153410740T>C		Somatic		WXS	SOLID	Phase_IV	151677364		Silent	SNP	ENST00000368725.2	37																																																																																					0.473	S100A7L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000036797.2	NM_001045479	
PKP1	5317	hgsc.bcm.edu	37	1	201291239	201291239	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:201291239G>A	ENST00000352845.3	+	9	1544	c.1544G>A	c.(1543-1545)aGc>aAc	p.S515N	PKP1_ENST00000367324.3_Missense_Mutation_p.S494N|PKP1_ENST00000263946.3_Missense_Mutation_p.S515N			Q13835	PKP1_HUMAN	plakophilin 1	515					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)	p.S494N(1)		NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						GGCTGCTTCAGCAACAAGAGC	0.637																																																1	Substitution - Missense(1)	ovary(1)	1											84.0	68.0	73.0					1																	201291239		2203	4300	6503	199557862	SO:0001583	missense	5317			X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.1544G>A	1.37:g.201291239G>A	ENSP00000295597:p.Ser515Asn	Somatic		WXS	SOLID	Phase_IV	199557862	O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	37	CCDS30966.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478873	0.44044	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.75260	-0.92;-0.92;-0.92	5.16	5.16	0.70880	Armadillo-like helical (1);Armadillo-type fold (1);	0.163320	0.64402	D	0.000002	T	0.59335	0.2186	N	0.21097	0.63	0.42929	D	0.994319	B;B;B	0.19445	0.036;0.021;0.034	B;B;B	0.23018	0.043;0.013;0.012	T	0.57791	-0.7750	10	0.44086	T	0.13	-21.6465	8.3521	0.32307	0.14:0.0:0.86:0.0	.	102;494;515	Q14BN3;Q13835-2;Q13835	.;.;PKP1_HUMAN	N	494;515;515	ENSP00000356293:S494N;ENSP00000263946:S515N;ENSP00000295597:S515N	ENSP00000263946:S515N	S	+	2	0	PKP1	199557862	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.452000	0.80683	2.397000	0.81536	0.655000	0.94253	AGC		0.637	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299	
SGTA	6449	hgsc.bcm.edu	37	19	2762579	2762579	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr19:2762579C>G	ENST00000221566.2	-	7	722	c.561G>C	c.(559-561)gaG>gaC	p.E187D		NM_003021.3	NP_003012.1	O43765	SGTA_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha	187					viral process (GO:0016032)	cytoplasm (GO:0005737)		p.E187D(1)		endometrium(2)|large_intestine(2)|lung(2)|ovary(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGGGTCCAGCTCCAGAGCCT	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											138.0	129.0	132.0					19																	2762579		2203	4300	6503	2713579	SO:0001583	missense	6449			AJ223828	CCDS12094.1	19p13	2013-01-10	2003-11-24	2003-11-26		ENSG00000104969		"""Tetratricopeptide (TTC) repeat domain containing"""	10819	protein-coding gene	gene with protein product		603419	"""small glutamine-rich tetratricopeptide repeat (TPR)-containing"""	SGT		9740675, 12735788	Standard	NM_003021		Approved		uc002lwi.1	O43765		ENST00000221566.2:c.561G>C	19.37:g.2762579C>G	ENSP00000221566:p.Glu187Asp	Somatic		WXS	SOLID	Phase_IV	2713579	D6W610|Q6FIA9|Q9BTZ9	Missense_Mutation	SNP	ENST00000221566.2	37	CCDS12094.1	.	.	.	.	.	.	.	.	.	.	C	9.421	1.083074	0.20309	.	.	ENSG00000104969	ENST00000221566	T	0.69685	-0.42	4.25	3.2	0.36748	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.108890	0.64402	D	0.000008	T	0.53899	0.1825	L	0.52126	1.63	0.46678	D	0.999152	B	0.02656	0.0	B	0.08055	0.003	T	0.43261	-0.9402	10	0.23891	T	0.37	-17.4186	6.1706	0.20414	0.1876:0.7155:0.0:0.0968	.	187	O43765	SGTA_HUMAN	D	187	ENSP00000221566:E187D	ENSP00000221566:E187D	E	-	3	2	SGTA	2713579	1.000000	0.71417	0.998000	0.56505	0.402000	0.30811	1.297000	0.33400	0.763000	0.33175	0.655000	0.94253	GAG		0.632	SGTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451448.2	NM_003021	
SLC24A4	123041	hgsc.bcm.edu	37	14	92949084	92949084	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr14:92949084T>A	ENST00000532405.1	+	13	1542	c.1316T>A	c.(1315-1317)gTc>gAc	p.V439D	SLC24A4_ENST00000351924.5_Missense_Mutation_p.V403D|SLC24A4_ENST00000531433.1_Missense_Mutation_p.V420D|SLC24A4_ENST00000393265.2_Missense_Mutation_p.V375D|SLC24A4_ENST00000298877.1_Missense_Mutation_p.V422D			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	439					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.V422D(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		CTCCTGTGCGTCACCATTCCC	0.587																																					NSCLC(10;315 435 10383 28450 38798)											1	Substitution - Missense(1)	ovary(1)	14											129.0	108.0	115.0					14																	92949084		2203	4300	6503	92018837	SO:0001583	missense	123041			AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1316T>A	14.37:g.92949084T>A	ENSP00000431840:p.Val439Asp	Somatic		WXS	SOLID	Phase_IV	92018837	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Missense_Mutation	SNP	ENST00000532405.1	37	CCDS9903.2	.	.	.	.	.	.	.	.	.	.	T	14.97	2.693410	0.48202	.	.	ENSG00000140090	ENST00000393265;ENST00000531433;ENST00000532405;ENST00000298877;ENST00000351924;ENST00000318079	T;T;T;T;T	0.69435	-0.38;0.02;0.03;-0.38;-0.4	5.74	4.59	0.56863	.	0.363088	0.33732	N	0.004619	T	0.60779	0.2295	L	0.59436	1.845	0.44579	D	0.997544	B;B;B	0.25312	0.042;0.042;0.123	B;B;B	0.29598	0.104;0.104;0.049	T	0.59123	-0.7513	10	0.54805	T	0.06	.	6.7164	0.23306	0.0:0.1383:0.1302:0.7315	.	420;375;439	Q8NFF2-3;Q8NFF2-2;Q8NFF2	.;.;NCKX4_HUMAN	D	375;420;439;422;403;291	ENSP00000376948:V375D;ENSP00000433302:V420D;ENSP00000431840:V439D;ENSP00000298877:V422D;ENSP00000337789:V403D	ENSP00000298877:V422D	V	+	2	0	SLC24A4	92018837	0.999000	0.42202	0.793000	0.32043	0.910000	0.53928	4.003000	0.57061	1.002000	0.39104	0.459000	0.35465	GTC		0.587	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1	NM_153646	
SLC2A11	66035	hgsc.bcm.edu	37	22	24217312	24217312	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr22:24217312C>A	ENST00000345044.6	+	4	558	c.290C>A	c.(289-291)tCc>tAc	p.S97Y	SLC2A11_ENST00000467660.1_3'UTR|SLC2A11_ENST00000405847.1_Missense_Mutation_p.S97Y|SLC2A11_ENST00000398356.2_Missense_Mutation_p.S104Y|SLC2A11_ENST00000316185.8_Missense_Mutation_p.S100Y|AP000350.10_ENST00000433835.3_Missense_Mutation_p.S62Y			Q9BYW1	GTR11_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 11	97					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.S104Y(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	12						AGGAAGAAGTCCCTCCTGGTG	0.512																																																1	Substitution - Missense(1)	ovary(1)	22											80.0	75.0	77.0					22																	24217312		2203	4300	6503	22547312	SO:0001583	missense	66035			AJ271290	CCDS13818.1, CCDS33616.1, CCDS46673.1, CCDS74828.1	22q11.23	2013-05-22			ENSG00000133460	ENSG00000133460		"""Solute carriers"""	14239	protein-coding gene	gene with protein product		610367					Standard	NM_001024938		Approved	GLUT11, GLUT10	uc002zyp.4	Q9BYW1	OTTHUMG00000166469	ENST00000345044.6:c.290C>A	22.37:g.24217312C>A	ENSP00000342542:p.Ser97Tyr	Somatic		WXS	SOLID	Phase_IV	22547312	E9PH55|Q542Y4|Q6ICJ5|Q8WXF9|Q8WYM4	Missense_Mutation	SNP	ENST00000345044.6	37	CCDS46673.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.41|16.41	3.116080|3.116080	0.56505|0.56505	.|.	.|.	ENSG00000251357|ENSG00000133460;ENSG00000133460;ENSG00000133460;ENSG00000133460;ENSG00000133460;ENSG00000133460;ENSG00000133460;ENSG00000251357	ENST00000421180|ENST00000345044;ENST00000398356;ENST00000398363;ENST00000398359;ENST00000405847;ENST00000407566;ENST00000316185;ENST00000433835	.|T;T;T;T	.|0.58797	.|0.31;0.31;0.31;0.31	3.68|3.68	2.53|2.53	0.30540|0.30540	.|Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.|0.372260	.|0.27270	.|N	.|0.020126	T|T	0.75102|0.75102	0.3804|0.3804	M|M	0.86805|0.86805	2.84|2.84	0.36971|0.36971	D|D	0.893843|0.893843	.|D;D;D;D;D;D	.|0.69078	.|0.994;0.997;0.997;0.994;0.997;0.997	.|D;D;D;D;D;D	.|0.70227	.|0.942;0.968;0.946;0.968;0.968;0.968	T|T	0.82118|0.82118	-0.0615|-0.0615	5|10	.|0.87932	.|D	.|0	.|.	10.6016|10.6016	0.45371|0.45371	0.0:0.8015:0.1985:0.0|0.0:0.8015:0.1985:0.0	.|.	.|100;104;100;97;104;104	.|B4E2T0;E7ENI4;Q9BYW1-3;Q9BYW1;E9PH55;Q6P4C1	.|.;.;.;GTR11_HUMAN;.;.	T|Y	73|97;104;97;104;97;104;100;62	.|ENSP00000342542:S97Y;ENSP00000381399:S104Y;ENSP00000384987:S97Y;ENSP00000326748:S100Y	.|ENSP00000400325:S62Y	P|S	+|+	1|2	0|0	AP000350.10|AP000350.10;SLC2A11	22547312|22547312	0.991000|0.991000	0.36638|0.36638	1.000000|1.000000	0.80357|0.80357	0.869000|0.869000	0.49853|0.49853	2.213000|2.213000	0.42844|0.42844	2.034000|2.034000	0.60081|0.60081	0.508000|0.508000	0.49915|0.49915	CCC|TCC		0.512	SLC2A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319889.3	NM_030807	
SOX30	11063	hgsc.bcm.edu	37	5	157053432	157053432	+	Silent	SNP	C	C	T	rs537052698		TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr5:157053432C>T	ENST00000265007.6	-	5	2519	c.2178G>A	c.(2176-2178)ccG>ccA	p.P726P	SOX30_ENST00000311371.5_3'UTR|SOX30_ENST00000519442.1_Silent_p.P421P	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	726					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.P726P(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAGTTGATGTCGGGGCTGTGA	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		16983	0.001		0.0	False		,,,				2504	0.0				Esophageal Squamous(31;525 799 19355 21125 41744)											1	Substitution - coding silent(1)	ovary(1)	5											97.0	92.0	94.0					5																	157053432		2203	4300	6503	156986010	SO:0001819	synonymous_variant	11063			AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.2178G>A	5.37:g.157053432C>T		Somatic		WXS	SOLID	Phase_IV	156986010	O94995|Q8IYX6	Silent	SNP	ENST00000265007.6	37	CCDS4339.1																																																																																				0.428	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252571.2	NM_007017	
TAGAP	117289	hgsc.bcm.edu	37	6	159460322	159460322	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr6:159460322G>C	ENST00000367066.3	-	8	938	c.607C>G	c.(607-609)Cgg>Ggg	p.R203G	RP1-111C20.4_ENST00000607796.1_RNA|TAGAP_ENST00000326965.6_Missense_Mutation_p.R25G|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA|TAGAP_ENST00000338313.5_Missense_Mutation_p.R203G	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	203	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R203G(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AGGTTGGGCCGGGGGAGCTTA	0.498																																																1	Substitution - Missense(1)	ovary(1)	6											67.0	67.0	67.0					6																	159460322		2203	4300	6503	159380310	SO:0001583	missense	117289			AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.607C>G	6.37:g.159460322G>C	ENSP00000356033:p.Arg203Gly	Somatic		WXS	SOLID	Phase_IV	159380310	Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	ENST00000367066.3	37	CCDS5261.1	.	.	.	.	.	.	.	.	.	.	G	6.453	0.451663	0.12223	.	.	ENSG00000164691	ENST00000367066;ENST00000326965;ENST00000338313	T;T;T	0.19938	2.11;2.11;2.11	5.87	0.31	0.15825	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.556823	0.17586	N	0.168933	T	0.08358	0.0208	M	0.71871	2.18	0.20703	N	0.999868	B;B	0.25743	0.006;0.133	B;B	0.25140	0.013;0.058	T	0.24261	-1.0165	10	0.56958	D	0.05	-2.5662	5.0628	0.14566	0.0786:0.0976:0.2336:0.5903	.	203;203	Q8N103-4;Q8N103	.;TAGAP_HUMAN	G	203;25;203	ENSP00000356033:R203G;ENSP00000322650:R25G;ENSP00000340217:R203G	ENSP00000322650:R25G	R	-	1	2	TAGAP	159380310	0.008000	0.16893	0.004000	0.12327	0.018000	0.09664	1.150000	0.31639	0.088000	0.17205	-0.152000	0.13540	CGG		0.498	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042890.1	NM_054114	
TG	7038	hgsc.bcm.edu	37	8	133894179	133894179	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr8:133894179G>A	ENST00000220616.4	+	6	750	c.710G>A	c.(709-711)tGt>tAt	p.C237Y	TG_ENST00000377869.1_Missense_Mutation_p.C237Y	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	237	Thyroglobulin type-1 3. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.C237Y(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TATTGCCACTGTGCTGACAGC	0.522																																																1	Substitution - Missense(1)	ovary(1)	8											109.0	94.0	99.0					8																	133894179		2203	4300	6503	133963361	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.710G>A	8.37:g.133894179G>A	ENSP00000220616:p.Cys237Tyr	Somatic		WXS	SOLID	Phase_IV	133963361	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.636274	0.87760	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	D;D	0.99470	-5.96;-5.96	5.58	5.58	0.84498	Thyroglobulin type-1 (3);	0.000000	0.64402	D	0.000001	D	0.99542	0.9836	M	0.82716	2.605	0.53688	D	0.999971	D	0.89917	1.0	D	0.87578	0.998	D	0.98572	1.0646	10	0.87932	D	0	.	18.5709	0.91135	0.0:0.0:1.0:0.0	.	237	P01266	THYG_HUMAN	Y	237	ENSP00000367100:C237Y;ENSP00000220616:C237Y	ENSP00000220616:C237Y	C	+	2	0	TG	133963361	1.000000	0.71417	0.992000	0.48379	0.921000	0.55340	8.791000	0.91849	2.640000	0.89533	0.563000	0.77884	TGT		0.522	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
TIMD4	91937	hgsc.bcm.edu	37	5	156381495	156381495	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr5:156381495A>T	ENST00000274532.2	-	2	387	c.331T>A	c.(331-333)Tgc>Agc	p.C111S	TIMD4_ENST00000407087.3_Missense_Mutation_p.C111S	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4	111	Ig-like V-type.					integral component of membrane (GO:0016021)		p.C111S(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATGCGGCAGCAGTACACACCG	0.502																																																1	Substitution - Missense(1)	ovary(1)	5											91.0	83.0	86.0					5																	156381495		2203	4300	6503	156314073	SO:0001583	missense	91937			BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.331T>A	5.37:g.156381495A>T	ENSP00000274532:p.Cys111Ser	Somatic		WXS	SOLID	Phase_IV	156314073	B5MCL9	Missense_Mutation	SNP	ENST00000274532.2	37	CCDS4332.1	.	.	.	.	.	.	.	.	.	.	a	22.4	4.279510	0.80692	.	.	ENSG00000145850	ENST00000274532;ENST00000407087	T;T	0.63255	-0.03;-0.03	5.54	5.54	0.83059	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000010	D	0.83202	0.5203	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87125	0.2193	10	0.72032	D	0.01	-17.6249	15.3381	0.74273	1.0:0.0:0.0:0.0	.	111;111	B5MCL9;Q96H15	.;TIMD4_HUMAN	S	111	ENSP00000274532:C111S;ENSP00000385973:C111S	ENSP00000274532:C111S	C	-	1	0	TIMD4	156314073	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	5.056000	0.64287	2.111000	0.64477	0.533000	0.62120	TGC		0.502	TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252568.1	NM_138379	
TMEM177	80775	hgsc.bcm.edu	37	2	120439259	120439259	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr2:120439259A>C	ENST00000424086.1	+	2	1303	c.830A>C	c.(829-831)aAc>aCc	p.N277T	TMEM177_ENST00000409951.1_Intron|TMEM177_ENST00000272521.6_Missense_Mutation_p.N277T|TMEM177_ENST00000496203.1_Intron|TMEM177_ENST00000401466.1_Missense_Mutation_p.N277T	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	277						integral component of membrane (GO:0016021)		p.N277T(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					CCCAGCGGGAACATCGTCCCC	0.582																																																1	Substitution - Missense(1)	ovary(1)	2											65.0	62.0	63.0					2																	120439259		2203	4300	6503	120155729	SO:0001583	missense	80775			BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.830A>C	2.37:g.120439259A>C	ENSP00000402661:p.Asn277Thr	Somatic		WXS	SOLID	Phase_IV	120155729	Q9BT20	Missense_Mutation	SNP	ENST00000424086.1	37	CCDS2128.1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.202204	0.58234	.	.	ENSG00000144120	ENST00000401466;ENST00000424086;ENST00000272521	T;T;T	0.50001	0.76;0.76;0.76	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.69682	0.3138	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.75010	-0.3468	10	0.87932	D	0	-19.3115	12.6703	0.56864	1.0:0.0:0.0:0.0	.	277	Q53S58	TM177_HUMAN	T	277	ENSP00000385966:N277T;ENSP00000402661:N277T;ENSP00000272521:N277T	ENSP00000272521:N277T	N	+	2	0	TMEM177	120155729	1.000000	0.71417	0.876000	0.34364	0.320000	0.28249	8.556000	0.90697	1.964000	0.57103	0.448000	0.29417	AAC		0.582	TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330673.1	NM_030577	
CGGBP1	8545	hgsc.bcm.edu	37	3	88190160	88190160	+	De_novo_Start_OutOfFrame	SNP	A	A	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr3:88190160A>C	ENST00000462901.1	-	0	243				ZNF654_ENST00000309495.5_Missense_Mutation_p.K567T			Q9UFW8	CGBP1_HUMAN	CGG triplet repeat binding protein 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)	p.K567T(1)|p.?(1)		kidney(1)|large_intestine(2)|lung(2)	5		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)		GCACAAAAGAAATGTCAGACA	0.358																																																2	Substitution - Missense(1)|Unknown(1)	ovary(2)	3											64.0	60.0	61.0					3																	88190160		1859	4096	5955	88272850			55279			AJ000258	CCDS43111.1	3p12-p11.1	2008-07-18			ENSG00000163320	ENSG00000163320			1888	protein-coding gene	gene with protein product	"""p20-CGG binding protein"""	603363				9201980, 14667814	Standard	NM_001195308		Approved	p20-CGGBP, CGGBP	uc003dqt.3	Q9UFW8	OTTHUMG00000159009	ENST00000462901.1:c.-269T>G	3.37:g.88190160A>C		Somatic		WXS	SOLID	Phase_IV	88272850	D3DU38|O15183	Missense_Mutation	SNP	ENST00000462901.1	37	CCDS43111.1	.	.	.	.	.	.	.	.	.	.	a	13.75	2.329561	0.41297	.	.	ENSG00000175105	ENST00000309495	T	0.13089	2.62	5.3	5.3	0.74995	.	.	.	.	.	T	0.17023	0.0409	N	0.20986	0.625	0.35309	D	0.783755	D	0.57257	0.979	P	0.53102	0.718	T	0.18808	-1.0325	9	0.34782	T	0.22	.	14.4396	0.67306	1.0:0.0:0.0:0.0	.	567	Q8IZM8	ZN654_HUMAN	T	567	ENSP00000312141:K567T	ENSP00000312141:K567T	K	+	2	0	ZNF654	88272850	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.245000	0.58734	1.989000	0.58080	0.520000	0.50463	AAA		0.358	CGGBP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353159.1	NM_001008390	
CDH5	1003	hgsc.bcm.edu	37	16	66420737	66420737	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr16:66420737A>C	ENST00000341529.3	+	3	384	c.236A>C	c.(235-237)aAt>aCt	p.N79T	CDH5_ENST00000563425.2_Missense_Mutation_p.N79T	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	79	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)	p.N79T(1)		central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	AGTCGCAAGAATGCCAAGTAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	16											70.0	56.0	61.0					16																	66420737		2202	4300	6502	64978238	SO:0001583	missense	1003			X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.236A>C	16.37:g.66420737A>C	ENSP00000344115:p.Asn79Thr	Somatic		WXS	SOLID	Phase_III	64978238	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	ENST00000341529.3	37	CCDS10804.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.39|13.39	2.222822|2.222822	0.39300|0.39300	.|.	.|.	ENSG00000179776|ENSG00000179776	ENST00000539262|ENST00000341529;ENST00000379531	.|T	.|0.51325	.|0.71	6.08|6.08	4.98|4.98	0.66077|0.66077	.|Cadherin (3);	.|.	.|.	.|.	.|.	T|T	0.48077|0.48077	0.1480|0.1480	M|M	0.64676|0.64676	1.99|1.99	0.80722|0.80722	D|D	1|1	.|B	.|0.18310	.|0.027	.|B	.|0.29077	.|0.098	T|T	0.41910|0.41910	-0.9482|-0.9482	6|9	0.02654|0.45353	T|T	1|0.12	.|.	11.7466|11.7466	0.51823|0.51823	0.8678:0.0:0.0:0.1322|0.8678:0.0:0.0:0.1322	.|.	.|79	.|P33151	.|CADH5_HUMAN	L|T	1|79	.|ENSP00000344115:N79T	ENSP00000437691:M1L|ENSP00000344115:N79T	M|N	+|+	1|2	0|0	CDH5|CDH5	64978238|64978238	0.999000|0.999000	0.42202|0.42202	0.798000|0.798000	0.32154|0.32154	0.273000|0.273000	0.26683|0.26683	4.349000|4.349000	0.59385|0.59385	1.103000|1.103000	0.41568|0.41568	0.533000|0.533000	0.62120|0.62120	ATG|AAT		0.537	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
ID1	3397	hgsc.bcm.edu	37	20	30193489	30193489	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr20:30193489A>G	ENST00000376112.3	+	1	404	c.299A>G	c.(298-300)gAc>gGc	p.D100G	MIR3193_ENST00000578262.1_RNA|ID1_ENST00000376105.3_Missense_Mutation_p.D100G	NM_002165.3	NP_002156.2	P41134	ID1_HUMAN	inhibitor of DNA binding 1, dominant negative helix-loop-helix protein	100	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				angiogenesis (GO:0001525)|blood vessel endothelial cell migration (GO:0043534)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|collagen metabolic process (GO:0032963)|endothelial cell morphogenesis (GO:0001886)|heart development (GO:0007507)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein destabilization (GO:0031648)|regulation of angiogenesis (GO:0045765)|regulation of MAPK cascade (GO:0043408)|response to antibiotic (GO:0046677)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D100G(1)		endometrium(2)|ovary(1)|pancreas(1)	4	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.99e-05)|all cancers(5;0.000169)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			CACGTCATCGACTACATCAGG	0.617																																					NSCLC(123;1618 1779 21803 28680 33854)											1	Substitution - Missense(1)	ovary(1)	20											40.0	41.0	41.0					20																	30193489		2202	4300	6502	29657150	SO:0001583	missense	3397				CCDS13185.1, CCDS13186.1	20q11	2013-05-21			ENSG00000125968	ENSG00000125968		"""Basic helix-loop-helix proteins"""	5360	protein-coding gene	gene with protein product	"""DNA-binding protein inhibitor ID-1"""	600349				8294468	Standard	NM_002165		Approved	dJ857M17.1.2, bHLHb24	uc002wwg.2	P41134	OTTHUMG00000032181	ENST00000376112.3:c.299A>G	20.37:g.30193489A>G	ENSP00000365280:p.Asp100Gly	Somatic		WXS	SOLID	Phase_III	29657150	A8K537|E1P5L4|O00651|O00652|Q16371|Q16377|Q5TE66|Q5TE67|Q969Z7|Q9H0Z5|Q9H109	Missense_Mutation	SNP	ENST00000376112.3	37	CCDS13185.1	.	.	.	.	.	.	.	.	.	.	A	31	5.069411	0.93950	.	.	ENSG00000125968	ENST00000376112;ENST00000376105	D;D	0.98192	-4.78;-4.78	4.97	4.97	0.65823	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98510	0.9503	M	0.64080	1.96	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99564	1.0969	10	0.87932	D	0	-11.7612	13.9213	0.63933	1.0:0.0:0.0:0.0	.	100;100	P41134-2;P41134	.;ID1_HUMAN	G	100	ENSP00000365280:D100G;ENSP00000365273:D100G	ENSP00000365273:D100G	D	+	2	0	ID1	29657150	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.079000	0.94032	2.209000	0.71365	0.533000	0.62120	GAC		0.617	ID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078550.1	NM_002165	
SYNE2	23224	hgsc.bcm.edu	37	14	64516515	64516515	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr14:64516515C>T	ENST00000344113.4	+	47	7776	c.7564C>T	c.(7564-7566)Ctc>Ttc	p.L2522F	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.L2555F|SYNE2_ENST00000358025.3_Missense_Mutation_p.L2522F	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2522					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.L2522F(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ATATTGTGTCCTCAGAGATTT	0.373																																																1	Substitution - Missense(1)	ovary(1)	14											76.0	73.0	74.0					14																	64516515		1840	4090	5930	63586268	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.7564C>T	14.37:g.64516515C>T	ENSP00000341781:p.Leu2522Phe	Somatic		WXS	SOLID	Phase_III	63586268	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	9.909	1.208967	0.22205	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.57907	1.02;1.02;0.37	5.68	4.72	0.59763	.	0.244723	0.28908	N	0.013754	T	0.50718	0.1632	L	0.27053	0.805	0.33159	D	0.546752	D;D	0.63046	0.986;0.992	P;P	0.62813	0.809;0.907	T	0.54417	-0.8297	10	0.21540	T	0.41	.	7.4393	0.27174	0.3004:0.4765:0.2231:0.0	.	2522;2522	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	F	2522;2522;2555;2555	ENSP00000350719:L2522F;ENSP00000341781:L2522F;ENSP00000452570:L2555F	ENSP00000261678:L2555F	L	+	1	0	SYNE2	63586268	0.668000	0.27493	0.156000	0.22583	0.350000	0.29205	1.118000	0.31246	2.698000	0.92095	0.585000	0.79938	CTC		0.373	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
ABCB4	5244	hgsc.bcm.edu	37	7	87056076	87056076	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr7:87056076G>C	ENST00000265723.4	-	16	2165	c.2054C>G	c.(2053-2055)aCc>aGc	p.T685S	ABCB4_ENST00000358400.3_Missense_Mutation_p.T685S|ABCB4_ENST00000359206.3_Missense_Mutation_p.T685S|ABCB4_ENST00000545634.1_Missense_Mutation_p.T685S|ABCB4_ENST00000453593.1_Missense_Mutation_p.T685S	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	685					cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.T685S(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	AAGTCCATCGGTTTCCACATC	0.348																																																1	Substitution - Missense(1)	ovary(1)	7											97.0	95.0	96.0					7																	87056076		2203	4300	6503	86894012	SO:0001583	missense	5244			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2054C>G	7.37:g.87056076G>C	ENSP00000265723:p.Thr685Ser	Somatic		WXS	SOLID	Phase_IV	86894012	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.935575	0.00484	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.86627	-2.08;-2.15;-2.12;-2.15;-2.08	4.92	-0.202	0.13208	.	3.446160	0.01562	N	0.020174	T	0.75627	0.3875	N	0.16903	0.455	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.61043	-0.7142	10	0.12430	T	0.62	-1.1634	5.5971	0.17333	0.0685:0.2249:0.4926:0.214	.	685;685;685	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	S	685	ENSP00000352135:T685S;ENSP00000351172:T685S;ENSP00000265723:T685S;ENSP00000392983:T685S;ENSP00000437465:T685S	ENSP00000265723:T685S	T	-	2	0	ABCB4	86894012	0.000000	0.05858	0.008000	0.14137	0.000000	0.00434	-0.637000	0.05459	-0.241000	0.09681	-0.940000	0.02684	ACC		0.348	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
ADAM30	11085	hgsc.bcm.edu	37	1	120437576	120437576	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:120437576T>C	ENST00000369400.1	-	1	1542	c.1384A>G	c.(1384-1386)Aat>Gat	p.N462D		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	462	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.N462D(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		TCACATTCATTTCCTTCCTGC	0.468																																																1	Substitution - Missense(1)	ovary(1)	1											148.0	131.0	137.0					1																	120437576		2203	4300	6503	120239099	SO:0001583	missense	11085			AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.1384A>G	1.37:g.120437576T>C	ENSP00000358407:p.Asn462Asp	Somatic		WXS	SOLID	Phase_IV	120239099	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	ENST00000369400.1	37	CCDS907.1	.	.	.	.	.	.	.	.	.	.	T	18.92	3.725204	0.68959	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.10960	2.82	4.97	4.97	0.65823	Blood coagulation inhibitor, Disintegrin (5);	0.270220	0.26007	N	0.026920	T	0.09069	0.0224	L	0.39514	1.22	0.09310	N	1	P	0.46220	0.874	P	0.53760	0.734	T	0.04781	-1.0927	10	0.66056	D	0.02	.	11.0032	0.47618	0.0:0.0:0.0:1.0	.	462	Q9UKF2	ADA30_HUMAN	D	462	ENSP00000358407:N462D	ENSP00000358407:N462D	N	-	1	0	ADAM30	120239099	0.009000	0.17119	0.073000	0.20177	0.397000	0.30659	2.086000	0.41643	2.090000	0.63153	0.460000	0.39030	AAT		0.468	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	NM_021794	
ANKRD17	26057	hgsc.bcm.edu	37	4	73956580	73956580	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr4:73956580G>C	ENST00000358602.4	-	29	6881	c.6765C>G	c.(6763-6765)agC>agG	p.S2255R	ANKRD17_ENST00000330838.6_Missense_Mutation_p.S2004R|ANKRD17_ENST00000509867.2_Missense_Mutation_p.S2142R	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	2255					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S2255R(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CAAACAATGTGCTAAAGGGCC	0.443																																																1	Substitution - Missense(1)	ovary(1)	4											217.0	223.0	221.0					4																	73956580		2203	4300	6503	74175444	SO:0001583	missense	26057			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.6765C>G	4.37:g.73956580G>C	ENSP00000351416:p.Ser2255Arg	Somatic		WXS	SOLID	Phase_IV	74175444	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	G	12.12	1.842032	0.32513	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.80994	-1.44;-1.44;-0.75	5.65	5.65	0.86999	.	0.150425	0.45361	D	0.000374	T	0.79293	0.4421	L	0.57536	1.79	0.36775	D	0.884028	P;P;P;P	0.40476	0.718;0.718;0.596;0.596	B;B;B;B	0.41036	0.277;0.346;0.143;0.1	D	0.84862	0.0820	10	0.87932	D	0	.	13.4114	0.60944	0.0811:0.0:0.9189:0.0	.	2254;2004;2255;2142	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	R	2255;1662;2004;2142;639	ENSP00000351416:S2255R;ENSP00000332265:S2004R;ENSP00000427151:S2142R	ENSP00000332265:S2004R	S	-	3	2	ANKRD17	74175444	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.375000	0.59549	2.668000	0.90789	0.655000	0.94253	AGC		0.443	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
BICC1	80114	hgsc.bcm.edu	37	10	60549146	60549146	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr10:60549146A>C	ENST00000373886.3	+	7	729	c.725A>C	c.(724-726)aAa>aCa	p.K242T		NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	242					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K242T(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						GTATCATTTAAACAGCGTTCC	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											140.0	134.0	136.0					10																	60549146		2203	4300	6503	60219152	SO:0001583	missense	80114			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.725A>C	10.37:g.60549146A>C	ENSP00000362993:p.Lys242Thr	Somatic		WXS	SOLID	Phase_IV	60219152		Missense_Mutation	SNP	ENST00000373886.3	37	CCDS31206.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.612604	0.87258	.	.	ENSG00000122870	ENST00000373886	T	0.29397	1.57	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.50973	0.1647	L	0.55481	1.735	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.45775	-0.9238	10	0.42905	T	0.14	-18.0414	15.9023	0.79387	1.0:0.0:0.0:0.0	.	242	Q9H694	BICC1_HUMAN	T	242	ENSP00000362993:K242T	ENSP00000362993:K242T	K	+	2	0	BICC1	60219152	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.210000	0.77924	2.153000	0.67306	0.533000	0.62120	AAA		0.393	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044	
CIT	11113	hgsc.bcm.edu	37	12	120198851	120198851	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr12:120198851G>C	ENST00000261833.7	-	19	2239	c.2187C>G	c.(2185-2187)gaC>gaG	p.D729E	CIT_ENST00000392521.2_Missense_Mutation_p.D771E|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	729					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.D772E(1)		breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TTATCTGATTGTCCAACACCT	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											129.0	117.0	121.0					12																	120198851		2203	4300	6503	118683234	SO:0001583	missense	11113			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.2187C>G	12.37:g.120198851G>C	ENSP00000261833:p.Asp729Glu	Somatic		WXS	SOLID	Phase_IV	118683234	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	CCDS9192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.725|6.725	0.502471|0.502471	0.12822|0.12822	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392521;ENST00000261833|ENST00000392520	T;T|.	0.76709|.	-1.04;0.16|.	5.99|5.99	5.01|5.01	0.66863|0.66863	.|.	0.056241|.	0.64402|.	D|.	0.000002|.	T|T	0.16257|0.16257	0.0391|0.0391	N|N	0.01576|0.01576	-0.805|-0.805	0.33787|0.33787	D|D	0.624932|0.624932	B;B;B|.	0.06786|.	0.0;0.001;0.0|.	B;B;B|.	0.04013|.	0.0;0.001;0.001|.	T|T	0.25293|0.25293	-1.0136|-1.0136	10|5	0.02654|.	T|.	1|.	.|.	8.8123|8.8123	0.34974|0.34974	0.0772:0.0:0.6872:0.2356|0.0772:0.0:0.6872:0.2356	.|.	771;729;262|.	Q2M5E1;O14578;O14578-3|.	.;CTRO_HUMAN;.|.	E|R	771;729|357	ENSP00000376306:D771E;ENSP00000261833:D729E|.	ENSP00000261833:D729E|.	D|T	-|-	3|2	2|0	CIT|CIT	118683234|118683234	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	1.560000|1.560000	0.36331|0.36331	1.377000|1.377000	0.46286|0.46286	0.655000|0.655000	0.94253|0.94253	GAC|ACA		0.478	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
CNGA1	1259	hgsc.bcm.edu	37	4	47945300	47945300	+	Nonsense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr4:47945300G>C	ENST00000514170.1	-	8	666	c.347C>G	c.(346-348)tCa>tGa	p.S116*	CNGA1_ENST00000420489.2_Nonsense_Mutation_p.S116*|CNGA1_ENST00000544810.1_Nonsense_Mutation_p.S116*|CNGA1_ENST00000358519.4_Nonsense_Mutation_p.S116*|CNGA1_ENST00000402813.3_Nonsense_Mutation_p.S185*			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	116					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.S116*(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						TTTATCATCTGACTTGCTGAA	0.313																																																1	Substitution - Nonsense(1)	ovary(1)	4											32.0	29.0	30.0					4																	47945300		1750	3946	5696	47640057	SO:0001587	stop_gained	1259			M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.347C>G	4.37:g.47945300G>C	ENSP00000426862:p.Ser116*	Somatic		WXS	SOLID	Phase_IV	47640057	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Nonsense_Mutation	SNP	ENST00000514170.1	37	CCDS43226.1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137172	0.56936	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489;ENST00000504722	.	.	.	4.82	3.98	0.46160	.	1.293600	0.05088	N	0.484795	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	7.8756	0.29592	0.1912:0.0:0.8088:0.0	.	.	.	.	X	185;116;116;116;116;116	.	ENSP00000351320:S116X	S	-	2	0	CNGA1	47640057	0.010000	0.17322	0.996000	0.52242	0.584000	0.36387	1.631000	0.37092	1.175000	0.42826	0.655000	0.94253	TCA		0.313	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372070.2	NM_000087	
CORO2B	10391	hgsc.bcm.edu	37	15	69011494	69011494	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr15:69011494C>A	ENST00000566799.1	+	10	1121	c.1092C>A	c.(1090-1092)taC>taA	p.Y364*	CORO2B_ENST00000543950.1_Nonsense_Mutation_p.Y359*|CORO2B_ENST00000261861.5_Nonsense_Mutation_p.Y359*|CORO2B_ENST00000540068.1_Nonsense_Mutation_p.Y359*			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	364					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)	p.Y364*(1)		kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						CAGATTCCTACCAGGAAGACA	0.572																																																1	Substitution - Nonsense(1)	ovary(1)	15											107.0	104.0	105.0					15																	69011494		2200	4298	6498	66798548	SO:0001587	stop_gained	10391			AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.1092C>A	15.37:g.69011494C>A	ENSP00000454783:p.Tyr364*	Somatic		WXS	SOLID	Phase_IV	66798548	A8K0W3|O94767|Q8TAN1	Nonsense_Mutation	SNP	ENST00000566799.1	37	CCDS10229.2	.	.	.	.	.	.	.	.	.	.	C	36	5.731451	0.96856	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	.	.	.	5.46	4.54	0.55810	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-33.1983	12.7023	0.57041	0.0:0.92:0.0:0.08	.	.	.	.	X	364;359;359	.	ENSP00000261861:Y364X	Y	+	3	2	CORO2B	66798548	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	1.754000	0.38369	1.309000	0.44985	0.313000	0.20887	TAC		0.572	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006091	
CSMD3	114788	hgsc.bcm.edu	37	8	113702186	113702186	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr8:113702186T>A	ENST00000297405.5	-	14	2310	c.2066A>T	c.(2065-2067)gAa>gTa	p.E689V	CSMD3_ENST00000343508.3_Missense_Mutation_p.E649V|CSMD3_ENST00000455883.2_Missense_Mutation_p.E585V|CSMD3_ENST00000352409.3_Missense_Mutation_p.E689V	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	689	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E689V(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AAACTGGCATTCAAACCTTAA	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - Missense(1)	ovary(1)	8											169.0	173.0	172.0					8																	113702186		2203	4300	6503	113771362	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2066A>T	8.37:g.113702186T>A	ENSP00000297405:p.Glu689Val	Somatic		WXS	SOLID	Phase_IV	113771362	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.082856	0.76642	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21	4.96	4.96	0.65561	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.78991	0.4371	M	0.61703	1.905	0.44402	D	0.997317	D;D;D	0.89917	0.995;1.0;0.983	D;D;D	0.91635	0.98;0.999;0.915	T	0.79230	-0.1889	10	0.44086	T	0.13	.	14.9156	0.70795	0.0:0.0:0.0:1.0	.	585;689;649	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	V	649;689;29;585;689	ENSP00000345799:E649V;ENSP00000297405:E689V;ENSP00000341558:E29V;ENSP00000412263:E585V;ENSP00000343124:E689V	ENSP00000297405:E689V	E	-	2	0	CSMD3	113771362	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.997000	0.88414	1.987000	0.57996	0.397000	0.26171	GAA		0.373	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
SPECC1	92521	hgsc.bcm.edu	37	17	20107793	20107793	+	Missense_Mutation	SNP	C	C	G	rs374473392		TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr17:20107793C>G	ENST00000261503.5	+	4	482	c.431C>G	c.(430-432)aCg>aGg	p.T144R	SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395529.3_Missense_Mutation_p.T144R|SPECC1_ENST00000395522.2_Missense_Mutation_p.T63R|SPECC1_ENST00000395525.3_Missense_Mutation_p.T63R|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395530.2_Missense_Mutation_p.T63R|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000395527.4_Missense_Mutation_p.T144R	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	144					cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.T144R(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		CCCACTCCTACGAAACACCTG	0.522																																																1	Substitution - Missense(1)	ovary(1)	17											127.0	130.0	129.0					17																	20107793		2203	4300	6503	20048385	SO:0001583	missense	92521			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.431C>G	17.37:g.20107793C>G	ENSP00000261503:p.Thr144Arg	Somatic		WXS	SOLID	Phase_IV	20048385	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739625	0.49045	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.64618	-0.11;2.89;2.92;2.92	4.73	3.75	0.43078	.	0.239400	0.50627	D	0.000112	T	0.70928	0.3280	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.987	D;D;D;P	0.71414	0.963;0.973;0.973;0.596	T	0.67158	-0.5741	10	0.22109	T	0.4	-8.5692	11.1428	0.48413	0.0:0.9061:0.0:0.0939	.	63;63;144;144	Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;CYTSB_HUMAN	R	144;144;144;63;63;63	ENSP00000261503:T144R;ENSP00000378900:T144R;ENSP00000378893:T63R;ENSP00000378896:T63R	ENSP00000261503:T144R	T	+	2	0	SPECC1	20048385	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	5.466000	0.66731	1.293000	0.44690	0.591000	0.81541	ACG		0.522	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
EIF4A2	1974	hgsc.bcm.edu	37	3	186505322	186505322	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr3:186505322G>C	ENST00000323963.5	+	9	1012	c.948G>C	c.(946-948)atG>atC	p.M316I	EIF4A2_ENST00000356531.5_Missense_Mutation_p.M221I|SNORA63_ENST00000363450.1_RNA|SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363548.1_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.M317I|SNORA81_ENST00000408493.2_RNA|SNORD2_ENST00000459163.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	316	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.M316I(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		ATGTTATCATGAGGGAATTCC	0.373			T	BCL6	NHL																																		Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	1	Substitution - Missense(1)	ovary(1)	3											154.0	149.0	150.0					3																	186505322		2203	4300	6503	187988016	SO:0001583	missense	1974			D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.948G>C	3.37:g.186505322G>C	ENSP00000326381:p.Met316Ile	Somatic		WXS	SOLID	Phase_IV	187988016	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	ENST00000323963.5	37	CCDS3282.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.712540	0.68730	.	.	ENSG00000156976	ENST00000323963;ENST00000440191;ENST00000356531	T;T;T	0.73363	-0.74;-0.74;-0.74	5.12	5.12	0.69794	Helicase, C-terminal (3);	0.069576	0.85682	D	0.000000	T	0.55033	0.1895	N	0.02751	-0.505	0.80722	D	1	B;B;B;B	0.29301	0.167;0.241;0.05;0.062	B;B;B;B	0.30495	0.045;0.116;0.066;0.109	T	0.61884	-0.6971	10	0.87932	D	0	-14.218	16.4407	0.83900	0.0:0.0:1.0:0.0	.	172;221;317;316	B4DJX6;Q9NZE6;Q14240-2;Q14240	.;.;.;IF4A2_HUMAN	I	316;317;221	ENSP00000326381:M316I;ENSP00000398370:M317I;ENSP00000348925:M221I	ENSP00000326381:M316I	M	+	3	0	EIF4A2	187988016	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.301000	0.78850	2.826000	0.97356	0.563000	0.77884	ATG		0.373	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
FAM47B	170062	hgsc.bcm.edu	37	X	34962068	34962068	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chrX:34962068C>A	ENST00000329357.5	+	1	1156	c.1120C>A	c.(1120-1122)Ctc>Atc	p.L374I		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	374								p.L374I(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AACCGAGGAACTCACCAAGCC	0.537																																																1	Substitution - Missense(1)	ovary(1)	X											46.0	44.0	44.0					X																	34962068		2202	4300	6502	34871989	SO:0001583	missense	170062			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1120C>A	X.37:g.34962068C>A	ENSP00000328307:p.Leu374Ile	Somatic		WXS	SOLID	Phase_IV	34871989	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	C	7.148	0.583135	0.13749	.	.	ENSG00000189132	ENST00000329357	T	0.13657	2.57	0.719	-0.292	0.12839	.	.	.	.	.	T	0.09335	0.0230	L	0.38175	1.15	0.09310	N	1	P	0.39424	0.673	B	0.37144	0.242	T	0.24693	-1.0153	8	0.38643	T	0.18	.	.	.	.	.	374	Q8NA70	FA47B_HUMAN	I	374	ENSP00000328307:L374I	ENSP00000328307:L374I	L	+	1	0	FAM47B	34871989	0.002000	0.14202	0.014000	0.15608	0.006000	0.05464	0.128000	0.15810	-0.195000	0.10382	-0.488000	0.04728	CTC		0.537	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
ARHGEF40	55701	hgsc.bcm.edu	37	14	21544978	21544978	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr14:21544978C>G	ENST00000298694.4	+	8	2090	c.1963C>G	c.(1963-1965)Cca>Gca	p.P655A	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.P655A			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	655						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P655A(1)		large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						AGTGGCCAAGCCAGAGGAGCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	14											51.0	51.0	51.0					14																	21544978		2203	4300	6503	20614818	SO:0001583	missense	55701				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.1963C>G	14.37:g.21544978C>G	ENSP00000298694:p.Pro655Ala	Somatic		WXS	SOLID	Phase_IV	20614818	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	37	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826739	0.71143	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.02121	4.5;4.44	5.76	5.76	0.90799	.	0.000000	0.50627	D	0.000103	T	0.04770	0.0129	M	0.63843	1.955	0.35948	D	0.833712	P	0.51791	0.948	B	0.43701	0.428	T	0.47182	-0.9137	10	0.36615	T	0.2	.	15.4576	0.75327	0.0:1.0:0.0:0.0	.	655	Q8TER5	ARH40_HUMAN	A	655	ENSP00000298694:P655A;ENSP00000298693:P655A	ENSP00000298693:P655A	P	+	1	0	ARHGEF40	20614818	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	1.823000	0.39062	2.715000	0.92844	0.561000	0.74099	CCA		0.562	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
FBLN5	10516	hgsc.bcm.edu	37	14	92403371	92403371	+	Nonsense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr14:92403371G>C	ENST00000342058.4	-	4	892	c.299C>G	c.(298-300)tCa>tGa	p.S100*	FBLN5_ENST00000556154.1_Nonsense_Mutation_p.S105*|FBLN5_ENST00000267620.10_Nonsense_Mutation_p.S141*	NM_006329.3	NP_006320.2	Q9UBX5	FBLN5_HUMAN	fibulin 5	100					cell-matrix adhesion (GO:0007160)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|protein localization to cell surface (GO:0034394)|regulation of cell growth (GO:0001558)|regulation of removal of superoxide radicals (GO:2000121)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein C-terminus binding (GO:0008022)	p.S100*(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	28		all_cancers(154;0.0722)				GTTTGGAGCTGAGAGTGGTGG	0.557																																																1	Substitution - Nonsense(1)	ovary(1)	14											114.0	108.0	110.0					14																	92403371		2203	4300	6503	91473124	SO:0001587	stop_gained	10516			AJ133490	CCDS9898.1	14q31	2014-09-17				ENSG00000140092		"""Fibulins"""	3602	protein-coding gene	gene with protein product		604580				10640802	Standard	NM_006329		Approved	EVEC, UP50, DANCE, ARMD3	uc001xzx.4	Q9UBX5		ENST00000342058.4:c.299C>G	14.37:g.92403371G>C	ENSP00000345008:p.Ser100*	Somatic		WXS	SOLID	Phase_IV	91473124	O75966|Q6IAL4|Q6UWA3	Nonsense_Mutation	SNP	ENST00000342058.4	37	CCDS9898.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365872	0.82463	.	.	ENSG00000140092	ENST00000267620;ENST00000342058;ENST00000556154	.	.	.	5.58	5.58	0.84498	.	0.517425	0.20403	N	0.093016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	19.5675	0.95401	0.0:0.0:1.0:0.0	.	.	.	.	X	141;100;105	.	ENSP00000267620:S197X	S	-	2	0	FBLN5	91473124	0.816000	0.29132	0.024000	0.17045	0.332000	0.28634	5.351000	0.66022	2.640000	0.89533	0.561000	0.74099	TCA		0.557	FBLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411787.1		
HMCN1	83872	hgsc.bcm.edu	37	1	186076037	186076037	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:186076037A>T	ENST00000271588.4	+	70	11021	c.10792A>T	c.(10792-10794)Aca>Tca	p.T3598S	HMCN1_ENST00000367492.2_Missense_Mutation_p.T3598S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3598	Ig-like C2-type 34.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.T3598S(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGGAAGATATACATGTCTGGC	0.333																																																1	Substitution - Missense(1)	ovary(1)	1											188.0	188.0	188.0					1																	186076037		2203	4300	6503	184342660	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10792A>T	1.37:g.186076037A>T	ENSP00000271588:p.Thr3598Ser	Somatic		WXS	SOLID	Phase_IV	184342660	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	18.82	3.704659	0.68615	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.79352	-1.26;-1.26	5.38	5.38	0.77491	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.142752	0.64402	D	0.000007	T	0.80031	0.4549	L	0.42686	1.345	0.37987	D	0.933783	D	0.54207	0.965	D	0.62955	0.909	T	0.78537	-0.2166	10	0.22706	T	0.39	.	9.8489	0.41043	0.9233:0.0:0.0767:0.0	.	3598	Q96RW7	HMCN1_HUMAN	S	3598	ENSP00000271588:T3598S;ENSP00000356462:T3598S	ENSP00000271588:T3598S	T	+	1	0	HMCN1	184342660	0.994000	0.37717	0.241000	0.24154	0.865000	0.49528	5.594000	0.67557	2.042000	0.60477	0.397000	0.26171	ACA		0.333	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HRH1	3269	hgsc.bcm.edu	37	3	11300790	11300790	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr3:11300790G>T	ENST00000397056.1	+	3	258	c.67G>T	c.(67-69)Gcc>Tcc	p.A23S	HRH1_ENST00000438284.2_Missense_Mutation_p.A23S|HRH1_ENST00000431010.2_Missense_Mutation_p.A23S	NM_000861.3|NM_001098211.1	NP_000852.1|NP_001091681.1	P35367	HRH1_HUMAN	histamine receptor H1	23					cellular response to histamine (GO:0071420)|eosinophil chemotaxis (GO:0048245)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|inositol phosphate-mediated signaling (GO:0048016)|memory (GO:0007613)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|regulation of vascular permeability (GO:0043114)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|histamine receptor activity (GO:0004969)	p.A23S(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25					Aceprometazine(DB01615)|Alcaftadine(DB06766)|Alimemazine(DB01246)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Antazoline(DB08799)|Aripiprazole(DB01238)|Asenapine(DB06216)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzatropine(DB00245)|Bepotastine(DB04890)|Betahistine(DB06698)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlorcyclizine(DB08936)|Chloropyramine(DB08800)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clemastine(DB00283)|Clofedanol(DB04837)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Dimetindene(DB08801)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Escitalopram(DB01175)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Iloperidone(DB04946)|Imipramine(DB00458)|Isothipendyl(DB08802)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Loxapine(DB00408)|Maprotiline(DB00934)|Meclizine(DB00737)|Mepyramine(DB06691)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Paliperidone(DB01267)|Phenindamine(DB01619)|Pheniramine(DB01620)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)	GACCACTATGGCCAGCCCCCA	0.577																																																1	Substitution - Missense(1)	ovary(1)	3											72.0	63.0	66.0					3																	11300790		2203	4300	6503	11275790	SO:0001583	missense	3269				CCDS2604.1	3p25	2012-11-12			ENSG00000196639	ENSG00000196639		"""GPCR / Class A : Histamine receptors"""	5182	protein-coding gene	gene with protein product		600167				8003029	Standard	NM_001098211		Approved		uc010hds.3	P35367	OTTHUMG00000129719	ENST00000397056.1:c.67G>T	3.37:g.11300790G>T	ENSP00000380247:p.Ala23Ser	Somatic		WXS	SOLID	Phase_IV	11275790	A8K047|Q6P9E5	Missense_Mutation	SNP	ENST00000397056.1	37	CCDS2604.1	.	.	.	.	.	.	.	.	.	.	G	10.31	1.315697	0.23908	.	.	ENSG00000196639	ENST00000438284;ENST00000431010;ENST00000397056	T;T;T	0.34667	1.35;1.35;1.35	5.91	4.08	0.47627	.	0.627824	0.15180	N	0.276177	T	0.20210	0.0486	L	0.32530	0.975	0.09310	N	1	B	0.26195	0.144	B	0.17979	0.02	T	0.27020	-1.0086	10	0.06494	T	0.89	-12.1901	5.4802	0.16719	0.1602:0.1742:0.6656:0.0	.	23	P35367	HRH1_HUMAN	S	23	ENSP00000406705:A23S;ENSP00000397028:A23S;ENSP00000380247:A23S	ENSP00000380247:A23S	A	+	1	0	HRH1	11275790	0.001000	0.12720	0.359000	0.25824	0.850000	0.48378	0.068000	0.14531	1.468000	0.48064	0.655000	0.94253	GCC		0.577	HRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251928.2		
HRG	3273	hgsc.bcm.edu	37	3	186389431	186389431	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr3:186389431T>G	ENST00000232003.4	+	4	491	c.411T>G	c.(409-411)aaT>aaG	p.N137K		NM_000412.2	NP_000403.1	P04196	HRG_HUMAN	histidine-rich glycoprotein	137	Cystatin 2.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|defense response to fungus (GO:0050832)|fibrinolysis (GO:0042730)|heme export (GO:0097037)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel remodeling (GO:2000504)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of immune response to tumor cell (GO:0002839)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet activation (GO:0010543)|regulation of protein complex assembly (GO:0043254)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|response to organic cyclic compound (GO:0014070)	blood microparticle (GO:0072562)|endolysosome (GO:0036019)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|phagolysosome membrane (GO:0061474)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heme binding (GO:0020037)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|immunoglobulin binding (GO:0019865)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)	p.N137K(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(12)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)		CACTGGCCAATACCAAAGATA	0.433																																																1	Substitution - Missense(1)	ovary(1)	3											94.0	93.0	93.0					3																	186389431		2203	4300	6503	187872125	SO:0001583	missense	3273				CCDS3280.1	3q27	2008-07-18			ENSG00000113905	ENSG00000113905			5181	protein-coding gene	gene with protein product	"""histidine-proline rich glycoprotein"", ""thrombophilia due to elevated HRG"""	142640				1678514	Standard	NM_000412		Approved	HRGP, HPRG	uc003fqq.3	P04196	OTTHUMG00000156578	ENST00000232003.4:c.411T>G	3.37:g.186389431T>G	ENSP00000232003:p.Asn137Lys	Somatic		WXS	SOLID	Phase_IV	187872125	B9EK35|D3DNU7	Missense_Mutation	SNP	ENST00000232003.4	37	CCDS3280.1	.	.	.	.	.	.	.	.	.	.	T	10.72	1.428757	0.25726	.	.	ENSG00000113905	ENST00000232003	T	0.17213	2.29	5.41	-1.65	0.08291	Proteinase inhibitor I25, cystatin (1);Thioredoxin-like fold (1);	0.000000	0.52532	D	0.000065	T	0.28699	0.0711	L	0.61218	1.895	0.25151	N	0.990423	D	0.89917	1.0	D	0.69654	0.965	T	0.13255	-1.0516	10	0.27082	T	0.32	-30.1843	9.2212	0.37377	0.0:0.5312:0.0:0.4688	.	137	P04196	HRG_HUMAN	K	137	ENSP00000232003:N137K	ENSP00000232003:N137K	N	+	3	2	HRG	187872125	0.007000	0.16637	0.853000	0.33588	0.134000	0.20937	-0.466000	0.06672	-0.112000	0.11979	0.459000	0.35465	AAT		0.433	HRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344655.1	NM_000412	
HUS1	3364	hgsc.bcm.edu	37	7	48018046	48018046	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr7:48018046G>T	ENST00000258774.5	-	3	348	c.325C>A	c.(325-327)Cac>Aac	p.H109N	HUS1_ENST00000432325.1_Missense_Mutation_p.H88N	NM_004507.3	NP_004498.1	O60921	HUS1_HUMAN	HUS1 checkpoint homolog (S. pombe)	109					cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|embryo development (GO:0009790)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)|response to UV (GO:0009411)	checkpoint clamp complex (GO:0030896)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.H109N(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|prostate(1)	13		Breast(660;0.00139)				CAGGGAAAGTGTTTATTAGTC	0.443								Direct reversal of damage;Other conserved DNA damage response genes																													Ovarian(103;466 1517 21788 34610 43890)											1	Substitution - Missense(1)	ovary(1)	7											88.0	80.0	83.0					7																	48018046		2203	4300	6503	47984571	SO:0001583	missense	3364			Y16893	CCDS34635.1	7p13-p12	2008-08-08	2001-11-28		ENSG00000136273	ENSG00000136273			5309	protein-coding gene	gene with protein product	"""hus1+-like protein"""	603760	"""HUS1 (S. pombe) checkpoint homolog"""			9878245, 9524127	Standard	NM_004507		Approved		uc003tod.2	O60921	OTTHUMG00000155645	ENST00000258774.5:c.325C>A	7.37:g.48018046G>T	ENSP00000258774:p.His109Asn	Somatic		WXS	SOLID	Phase_IV	47984571	B4DFI9	Missense_Mutation	SNP	ENST00000258774.5	37	CCDS34635.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.757028	0.49468	.	.	ENSG00000136273	ENST00000258774;ENST00000432325;ENST00000432627;ENST00000446009	T;T;T;T	0.10477	2.87;2.87;2.87;2.87	5.31	4.43	0.53597	.	0.098576	0.64402	D	0.000001	T	0.11024	0.0269	L	0.49126	1.545	0.54753	D	0.999983	B	0.09022	0.002	B	0.18561	0.022	T	0.09100	-1.0690	10	0.17832	T	0.49	-13.9888	11.6024	0.51010	0.0866:0.0:0.9134:0.0	.	109	O60921	HUS1_HUMAN	N	109;88;88;88	ENSP00000258774:H109N;ENSP00000416588:H88N;ENSP00000404855:H88N;ENSP00000398806:H88N	ENSP00000258774:H109N	H	-	1	0	HUS1	47984571	1.000000	0.71417	0.722000	0.30670	0.995000	0.86356	5.224000	0.65288	1.247000	0.43917	0.655000	0.94253	CAC		0.443	HUS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340952.1	NM_004507	
ITGA4	3676	hgsc.bcm.edu	37	2	182386920	182386920	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr2:182386920C>A	ENST00000397033.2	+	18	2355	c.1925C>A	c.(1924-1926)cCc>cAc	p.P642H		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	642					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)	p.P642H(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	ATTTTTAGGCCCCATGAAAAT	0.308																																																1	Substitution - Missense(1)	ovary(1)	2											88.0	80.0	82.0					2																	182386920		1805	4073	5878	182095165	SO:0001583	missense	3676				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1925C>A	2.37:g.182386920C>A	ENSP00000380227:p.Pro642His	Somatic		WXS	SOLID	Phase_IV	182095165	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.111593	0.77210	.	.	ENSG00000115232	ENST00000397033	T	0.45668	0.89	5.78	5.78	0.91487	Integrin alpha-2 (1);	0.112285	0.64402	D	0.000011	T	0.60983	0.2311	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.50162	-0.8860	10	0.15952	T	0.53	.	20.0011	0.97409	0.0:1.0:0.0:0.0	.	464;642	Q59H74;P13612	.;ITA4_HUMAN	H	642	ENSP00000380227:P642H	ENSP00000380227:P642H	P	+	2	0	ITGA4	182095165	0.998000	0.40836	1.000000	0.80357	0.886000	0.51366	4.085000	0.57657	2.727000	0.93392	0.585000	0.79938	CCC		0.308	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1		
ITGAL	3683	hgsc.bcm.edu	37	16	30507430	30507430	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr16:30507430G>A	ENST00000356798.6	+	14	1696	c.1516G>A	c.(1516-1518)Gaa>Aaa	p.E506K	ITGAL_ENST00000568012.1_3'UTR|ITGAL_ENST00000358164.5_Missense_Mutation_p.E423K|ITGAL_ENST00000433423.2_Intron|RP11-297C4.1_ENST00000563751.1_RNA	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	506					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)	p.E506K(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GGGGTTTGAAGAAGTCTCAGA	0.532																																					NSCLC(110;1462 1641 3311 33990 49495)											1	Substitution - Missense(1)	ovary(1)	16											73.0	73.0	73.0					16																	30507430		2197	4300	6497	30414931	SO:0001583	missense	3683				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1516G>A	16.37:g.30507430G>A	ENSP00000349252:p.Glu506Lys	Somatic		WXS	SOLID	Phase_IV	30414931	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.424316	0.43020	.	.	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.11063	2.81;2.81	5.94	-3.08	0.05347	.	1.812460	0.02606	N	0.101552	T	0.04272	0.0118	N	0.02011	-0.69	0.09310	N	1	B;B	0.15141	0.012;0.001	B;B	0.12837	0.008;0.002	T	0.40590	-0.9555	10	0.56958	D	0.05	.	5.166	0.15086	0.4697:0.2704:0.2598:0.0	.	423;506	Q96HB1;P20701	.;ITAL_HUMAN	K	506;423	ENSP00000349252:E506K;ENSP00000350886:E423K	ENSP00000349252:E506K	E	+	1	0	ITGAL	30414931	0.000000	0.05858	0.000000	0.03702	0.556000	0.35491	-0.040000	0.12104	-0.061000	0.13110	0.563000	0.77884	GAA		0.532	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
KEL	3792	hgsc.bcm.edu	37	7	142651611	142651611	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr7:142651611C>T	ENST00000355265.2	-	7	1150	c.676G>A	c.(676-678)Gac>Aac	p.D226N	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	226					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.D226N(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					TCTGGCTGGTCTATCTGGGCA	0.557																																																1	Substitution - Missense(1)	ovary(1)	7											173.0	157.0	163.0					7																	142651611		2203	4300	6503	142361733	SO:0001583	missense	3792			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.676G>A	7.37:g.142651611C>T	ENSP00000347409:p.Asp226Asn	Somatic		WXS	SOLID	Phase_IV	142361733	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414857	0.62511	.	.	ENSG00000197993	ENST00000355265	T	0.75821	-0.97	5.77	4.88	0.63580	Peptidase M13 (1);	0.323755	0.26311	N	0.025114	D	0.85274	0.5659	M	0.79926	2.475	0.48288	D	0.999626	D	0.69078	0.997	D	0.70016	0.967	D	0.86811	0.1998	10	0.72032	D	0.01	-8.3737	12.2075	0.54361	0.1706:0.8294:0.0:0.0	.	226	P23276	KELL_HUMAN	N	226	ENSP00000347409:D226N	ENSP00000347409:D226N	D	-	1	0	KEL	142361733	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	1.167000	0.31847	1.442000	0.47568	0.585000	0.79938	GAC		0.557	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
KLC3	147700	hgsc.bcm.edu	37	19	45851969	45851969	+	Missense_Mutation	SNP	C	C	T	rs372026834		TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr19:45851969C>T	ENST00000391946.2	+	6	947	c.845C>T	c.(844-846)aCg>aTg	p.T282M	KLC3_ENST00000470402.1_Missense_Mutation_p.T296M|KLC3_ENST00000585434.1_Missense_Mutation_p.T281M	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	282					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)	p.T282M(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CGGGAGCAGACGCTGGGCCCT	0.652																																																1	Substitution - Missense(1)	ovary(1)	19						C	MET/THR	1,3961		0,1,1980	21.0	27.0	25.0		845	2.1	0.9	19		25	1,8275		0,1,4137	no	missense	KLC3	NM_177417.2	81	0,2,6117	TT,TC,CC		0.0121,0.0252,0.0163	probably-damaging	282/505	45851969	2,12236	1981	4138	6119	50543809	SO:0001583	missense	147700			AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.845C>T	19.37:g.45851969C>T	ENSP00000375810:p.Thr282Met	Somatic		WXS	SOLID	Phase_IV	50543809	A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Missense_Mutation	SNP	ENST00000391946.2	37	CCDS12660.2	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771772	0.69992	2.52E-4	1.21E-4	ENSG00000104892	ENST00000391946;ENST00000470402	T;T	0.76316	-1.01;-1.01	3.14	2.1	0.27182	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.065041	0.64402	D	0.000015	T	0.74779	0.3761	M	0.65320	2	0.58432	D	0.999998	D;D;D	0.56746	0.971;0.971;0.977	B;B;P	0.46659	0.388;0.388;0.523	T	0.75465	-0.3308	10	0.72032	D	0.01	-13.8253	8.4861	0.33071	0.0:0.8788:0.0:0.1212	.	281;296;282	Q6P597-2;Q6P597-3;Q6P597	.;.;KLC3_HUMAN	M	282;296	ENSP00000375810:T282M;ENSP00000436019:T296M	ENSP00000375810:T282M	T	+	2	0	KLC3	50543809	1.000000	0.71417	0.946000	0.38457	0.991000	0.79684	5.779000	0.68948	0.903000	0.36546	0.561000	0.74099	ACG		0.652	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289776.1	NM_145275	
LAMA2	3908	hgsc.bcm.edu	37	6	129475728	129475728	+	Missense_Mutation	SNP	G	G	T	rs367649718		TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr6:129475728G>T	ENST00000421865.2	+	8	1155	c.1106G>T	c.(1105-1107)cGt>cTt	p.R369L		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	369	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.R369L(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TTGAATATACGTGGAAAGTAC	0.388																																																1	Substitution - Missense(1)	ovary(1)	6											92.0	92.0	92.0					6																	129475728		2203	4300	6503	129517421	SO:0001583	missense	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.1106G>T	6.37:g.129475728G>T	ENSP00000400365:p.Arg369Leu	Somatic		WXS	SOLID	Phase_IV	129517421	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	g	6.804	0.517363	0.13005	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.34072	1.38	6.06	2.37	0.29283	EGF-like, laminin (3);	0.479957	0.22257	N	0.062465	T	0.04907	0.0132	N	0.15975	0.35	0.25098	N	0.99081	B;B	0.13145	0.007;0.0	B;B	0.16289	0.015;0.001	T	0.42396	-0.9454	10	0.10636	T	0.68	.	4.3752	0.11267	0.5978:0.0:0.1975:0.2046	.	369;369	A6NF00;P24043	.;LAMA2_HUMAN	L	369	ENSP00000400365:R369L	ENSP00000346769:R369L	R	+	2	0	LAMA2	129517421	0.951000	0.32395	0.994000	0.49952	0.934000	0.57294	1.741000	0.38238	0.166000	0.19597	-0.285000	0.09966	CGT		0.388	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
LRRN3	54674	hgsc.bcm.edu	37	7	110763276	110763276	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr7:110763276A>C	ENST00000422987.3	+	2	1279	c.448A>C	c.(448-450)Aac>Cac	p.N150H	IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000489381.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.N150H|LRRN3_ENST00000451085.1_Missense_Mutation_p.N150H	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	150					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N150H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		TATTAATCACAACTTGCTTTC	0.378																																																1	Substitution - Missense(1)	ovary(1)	7											83.0	88.0	87.0					7																	110763276		2203	4300	6503	110550512	SO:0001583	missense	54674			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.448A>C	7.37:g.110763276A>C	ENSP00000412417:p.Asn150His	Somatic		WXS	SOLID	Phase_IV	110550512	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	A	18.08	3.544092	0.65198	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987;ENST00000421101	T;T;T;T	0.67345	-0.26;-0.26;-0.26;3.46	6.16	6.16	0.99307	.	0.000000	0.64402	D	0.000004	D	0.90003	0.6879	H	0.99156	4.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94044	0.7312	10	0.87932	D	0	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	150	Q9H3W5	LRRN3_HUMAN	H	150	ENSP00000312001:N150H;ENSP00000397312:N150H;ENSP00000412417:N150H;ENSP00000407927:N150H	ENSP00000312001:N150H	N	+	1	0	LRRN3	110550512	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.367000	0.80283	0.528000	0.53228	AAC		0.378	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
NEU1	4758	hgsc.bcm.edu	37	6	31827960	31827960	+	Missense_Mutation	SNP	G	G	A	rs190549838		TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr6:31827960G>A	ENST00000375631.4	-	5	1009	c.880C>T	c.(880-882)Cgc>Tgc	p.R294C		NM_000434.3	NP_000425.1	Q99519	NEUR1_HUMAN	sialidase 1 (lysosomal sialidase)	294			R -> S (in SIALIDOSIS; type 1; mild mutation as residual activity is still measurable). {ECO:0000269|PubMed:11063730}.		glycosphingolipid metabolic process (GO:0006687)|lipid catabolic process (GO:0016042)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)	p.R294C(1)		kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10					Oseltamivir(DB00198)	TCATAGCTGCGGAGGACAATT	0.572																																																1	Substitution - Missense(1)	ovary(1)	6	GRCh37	CM004863	NEU1	M	rs190549838						100.0	86.0	91.0					6																	31827960		1510	2709	4219	31935939	SO:0001583	missense	4758			AF040958	CCDS4723.1	6p21	2012-10-02			ENSG00000204386	ENSG00000204386	3.2.1.18		7758	protein-coding gene	gene with protein product		608272		NEU		9054950	Standard	NM_000434		Approved		uc003nxq.4	Q99519	OTTHUMG00000031284	ENST00000375631.4:c.880C>T	6.37:g.31827960G>A	ENSP00000364782:p.Arg294Cys	Somatic		WXS	SOLID	Phase_IV	31935939		Missense_Mutation	SNP	ENST00000375631.4	37	CCDS4723.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747690	0.49257	.	.	ENSG00000204386	ENST00000375631	D	0.84589	-1.87	5.1	5.1	0.69264	Neuraminidase (2);	0.220094	0.48767	D	0.000166	D	0.89856	0.6836	M	0.88775	2.98	0.58432	D	0.999993	D	0.76494	0.999	D	0.63192	0.912	D	0.88849	0.3318	10	0.38643	T	0.18	-16.2273	9.7176	0.40284	0.0922:0.0:0.9078:0.0	.	294	Q99519	NEUR1_HUMAN	C	294	ENSP00000364782:R294C	ENSP00000364782:R294C	R	-	1	0	NEU1	31935939	1.000000	0.71417	1.000000	0.80357	0.019000	0.09904	5.867000	0.69597	2.814000	0.96858	0.563000	0.77884	CGC		0.572	NEU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076616.2		
NHS	4810	hgsc.bcm.edu	37	X	17743957	17743957	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chrX:17743957T>G	ENST00000380060.3	+	6	2006	c.1668T>G	c.(1666-1668)agT>agG	p.S556R	NHS_ENST00000398097.3_Missense_Mutation_p.S400R	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	577					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.S556R(1)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					ACAAATTAAGTGAGAGGGGAA	0.572																																																1	Substitution - Missense(1)	ovary(1)	X											70.0	58.0	62.0					X																	17743957		2203	4300	6503	17653878	SO:0001583	missense	4810				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.1668T>G	X.37:g.17743957T>G	ENSP00000369400:p.Ser556Arg	Somatic		WXS	SOLID	Phase_IV	17653878	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	T	4.701	0.130297	0.08981	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.48201	0.82;0.82	5.86	0.939	0.19506	.	0.552403	0.23805	N	0.044398	T	0.36441	0.0967	L	0.52573	1.65	0.31169	N	0.703477	B;B;B;B	0.26258	0.145;0.045;0.145;0.145	B;B;B;B	0.26202	0.045;0.024;0.045;0.067	T	0.34004	-0.9846	10	0.20519	T	0.43	-0.1183	8.8354	0.35109	0.0:0.2917:0.0:0.7083	.	577;398;400;556	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	R	556;400;398	ENSP00000369400:S556R;ENSP00000381170:S400R	ENSP00000369397:S398R	S	+	3	2	NHS	17653878	0.848000	0.29623	0.823000	0.32752	0.831000	0.47069	0.100000	0.15231	0.036000	0.15547	0.486000	0.48141	AGT		0.572	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270	
NOTCH2	4853	hgsc.bcm.edu	37	1	120493457	120493457	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:120493457T>C	ENST00000256646.2	-	15	2588	c.2369A>G	c.(2368-2370)tAt>tGt	p.Y790C		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	790	EGF-like 20; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.Y790C(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGGCAGTTATAGCCTGTAGA	0.403			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																														Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	1	Substitution - Missense(1)	ovary(1)	1											148.0	136.0	140.0					1																	120493457		2203	4300	6503	120294980	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.2369A>G	1.37:g.120493457T>C	ENSP00000256646:p.Tyr790Cys	Somatic		WXS	SOLID	Phase_IV	120294980	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	T	13.46	2.243758	0.39697	.	.	ENSG00000134250	ENST00000256646;ENST00000539617	D	0.91631	-2.88	6.06	-0.799	0.10901	EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.498082	0.14973	U	0.287693	D	0.84995	0.5596	L	0.36672	1.1	0.25979	N	0.982392	P;P;P	0.48764	0.909;0.915;0.512	P;P;B	0.56474	0.799;0.799;0.432	T	0.77747	-0.2472	10	0.46703	T	0.11	.	6.2548	0.20867	0.3568:0.0:0.2458:0.3973	.	751;790;790	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	C	790;751	ENSP00000256646:Y790C	ENSP00000256646:Y790C	Y	-	2	0	NOTCH2	120294980	0.005000	0.15991	0.889000	0.34880	0.988000	0.76386	0.195000	0.17155	-0.078000	0.12730	0.533000	0.62120	TAT		0.403	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NPR3	4883	hgsc.bcm.edu	37	5	32784951	32784951	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr5:32784951A>T	ENST00000265074.8	+	7	1819	c.1476A>T	c.(1474-1476)ttA>ttT	p.L492F	NPR3_ENST00000434067.2_Missense_Mutation_p.L276F|NPR3_ENST00000415167.2_Missense_Mutation_p.L491F|NPR3_ENST00000415685.2_Missense_Mutation_p.L275F	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	492					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)	p.L492F(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	TGGGGGCTTTACTAGGAGCTG	0.433																																																1	Substitution - Missense(1)	ovary(1)	5											150.0	157.0	155.0					5																	32784951		1889	4116	6005	32820708	SO:0001583	missense	4883				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.1476A>T	5.37:g.32784951A>T	ENSP00000265074:p.Leu492Phe	Somatic		WXS	SOLID	Phase_IV	32820708	A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	ENST00000265074.8	37	CCDS56357.1	.	.	.	.	.	.	.	.	.	.	A	13.13	2.146398	0.37923	.	.	ENSG00000113389	ENST00000434067;ENST00000415685;ENST00000265074;ENST00000415167	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.23	1.5	0.22942	.	0.213009	0.39759	N	0.001279	T	0.23572	0.0570	N	0.12182	0.205	0.40070	D	0.976	B;B;B	0.15473	0.006;0.013;0.013	B;B;B	0.13407	0.004;0.009;0.009	T	0.04005	-1.0985	10	0.29301	T	0.29	-5.8567	4.9225	0.13876	0.5815:0.0:0.2913:0.1272	.	275;492;491	E7EPG9;P17342;Q60I31	.;ANPRC_HUMAN;.	F	276;275;492;491	ENSP00000388408:L276F;ENSP00000402490:L275F;ENSP00000265074:L492F;ENSP00000398028:L491F	ENSP00000265074:L492F	L	+	3	2	NPR3	32820708	1.000000	0.71417	0.993000	0.49108	0.730000	0.41778	0.769000	0.26604	0.033000	0.15463	0.254000	0.18369	TTA		0.433	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908	
NRAP	4892	hgsc.bcm.edu	37	10	115402786	115402786	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr10:115402786C>G	ENST00000359988.3	-	12	1366	c.1122G>C	c.(1120-1122)aaG>aaC	p.K374N	NRAP_ENST00000360478.3_Intron|NRAP_ENST00000369360.3_Intron|NRAP_ENST00000369358.4_Missense_Mutation_p.K374N	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.K374N(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CCAGATCCTTCTTATACTCCA	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											179.0	157.0	165.0					10																	115402786		2203	4300	6503	115392776	SO:0001583	missense	4892				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.1122G>C	10.37:g.115402786C>G	ENSP00000353078:p.Lys374Asn	Somatic		WXS	SOLID	Phase_IV	115392776		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.312618	0.81358	.	.	ENSG00000197893	ENST00000369358;ENST00000359988;ENST00000369350;ENST00000369343	T;T	0.41400	1.0;1.0	5.76	4.86	0.63082	.	0.044787	0.85682	D	0.000000	T	0.67316	0.2880	M	0.85373	2.75	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.68943	0.947;0.961	T	0.74562	-0.3624	10	0.87932	D	0	.	15.2392	0.73455	0.0:0.9324:0.0:0.0676	.	374;374	A0AVL2;Q86VF7	.;NRAP_HUMAN	N	374;374;103;103	ENSP00000358365:K374N;ENSP00000353078:K374N	ENSP00000353078:K374N	K	-	3	2	NRAP	115392776	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.525000	0.53502	1.578000	0.49821	0.650000	0.86243	AAG		0.393	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
NXF3	56000	hgsc.bcm.edu	37	X	102338570	102338570	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chrX:102338570C>G	ENST00000395065.3	-	4	503	c.402G>C	c.(400-402)caG>caC	p.Q134H	NXF3_ENST00000425644.1_5'UTR|NXF3_ENST00000425463.2_Missense_Mutation_p.Q45H	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	134	RRM.				mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)	p.Q134H(1)		NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						TGCATTCATTCTGAATCAAAT	0.458																																																1	Substitution - Missense(1)	ovary(1)	X											133.0	122.0	126.0					X																	102338570		2203	4300	6503	102225226	SO:0001583	missense	56000			AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.402G>C	X.37:g.102338570C>G	ENSP00000378504:p.Gln134His	Somatic		WXS	SOLID	Phase_IV	102225226	B4DYS7|Q5H9I1|Q9H1A9	Missense_Mutation	SNP	ENST00000395065.3	37	CCDS14503.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.925|8.925	0.962058|0.962058	0.18583|0.18583	.|.	.|.	ENSG00000147206|ENSG00000147206	ENST00000427570|ENST00000395065;ENST00000425463	.|T;T	.|0.55413	.|0.52;0.52	3.78|3.78	2.9|2.9	0.33743|0.33743	.|Nuclear RNA export factor Tap, RNA-binding domain (2);Nucleotide-binding, alpha-beta plait (1);	.|0.058286	.|0.64402	.|D	.|0.000001	T|T	0.61426|0.61426	0.2346|0.2346	M|M	0.68952|0.68952	2.095|2.095	0.37795|0.37795	D|D	0.927492|0.927492	.|D;B	.|0.76494	.|0.999;0.155	.|D;P	.|0.66084	.|0.941;0.461	T|T	0.61691|0.61691	-0.7011|-0.7011	5|10	.|0.17832	.|T	.|0.49	-1.6863|-1.6863	7.7249|7.7249	0.28755|0.28755	0.2497:0.7503:0.0:0.0|0.2497:0.7503:0.0:0.0	.|.	.|134;134	.|B4DYI1;Q9H4D5	.|.;NXF3_HUMAN	Q|H	11|134;45	.|ENSP00000378504:Q134H;ENSP00000404347:Q45H	.|ENSP00000378504:Q134H	E|Q	-|-	1|3	0|2	NXF3|NXF3	102225226|102225226	1.000000|1.000000	0.71417|0.71417	0.049000|0.049000	0.19019|0.19019	0.001000|0.001000	0.01503|0.01503	3.305000|3.305000	0.51873|0.51873	0.952000|0.952000	0.37798|0.37798	-0.224000|-0.224000	0.12420|0.12420	GAA|CAG		0.458	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052	
OR5M9	390162	hgsc.bcm.edu	37	11	56230141	56230141	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr11:56230141A>T	ENST00000279791.1	-	1	736	c.737T>A	c.(736-738)gTt>gAt	p.V246D		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V246D(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					AAACATAGAAACAGCCGTCAA	0.522																																																1	Substitution - Missense(1)	ovary(1)	11											55.0	51.0	52.0					11																	56230141		2201	4296	6497	55986717	SO:0001583	missense	390162			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.737T>A	11.37:g.56230141A>T	ENSP00000279791:p.Val246Asp	Somatic		WXS	SOLID	Phase_IV	55986717	Q6IEW5|Q96RB9	Missense_Mutation	SNP	ENST00000279791.1	37	CCDS31531.1	.	.	.	.	.	.	.	.	.	.	A	13.74	2.327014	0.41197	.	.	ENSG00000150269	ENST00000279791	T	0.00367	7.78	4.39	4.39	0.52855	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39985	N	0.001219	T	0.01905	0.0060	H	0.98466	4.24	0.44611	D	0.997581	D	0.89917	1.0	D	0.97110	1.0	T	0.02484	-1.1152	10	0.87932	D	0	-14.7169	11.8504	0.52407	1.0:0.0:0.0:0.0	.	246	Q8NGP3	OR5M9_HUMAN	D	246	ENSP00000279791:V246D	ENSP00000279791:V246D	V	-	2	0	OR5M9	55986717	0.247000	0.23920	0.634000	0.29324	0.014000	0.08584	4.479000	0.60236	1.754000	0.51921	0.443000	0.29094	GTT		0.522	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743	
PFDN5	5204	hgsc.bcm.edu	37	12	53690060	53690060	+	Splice_Site	SNP	G	G	C	rs111445381		TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr12:53690060G>C	ENST00000551018.1	+	3	484		c.e3+1		PFDN5_ENST00000351500.3_Intron|PFDN5_ENST00000334478.4_Splice_Site|PFDN5_ENST00000550846.1_Intron|RP11-680A11.5_ENST00000550263.1_RNA	NM_002624.3	NP_002615.2	Q99471	PFD5_HUMAN	prefoldin subunit 5						'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|protein folding (GO:0006457)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	transcription corepressor activity (GO:0003714)	p.?(1)		kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)	8						GACGAGTTCTGTATCCTTTCC	0.493																																																1	Unknown(1)	ovary(1)	12											80.0	74.0	76.0					12																	53690060		2203	4300	6503	51976327	SO:0001630	splice_region_variant	5204			D89667	CCDS8853.1, CCDS8854.1	12q13.13	2008-05-14	2006-02-24						8869	protein-coding gene	gene with protein product		604899	"""prefoldin 5"""			9630229, 9792694	Standard	NM_002624		Approved	PFD5, MM-1	uc001scl.3	Q99471	OTTHUMG00000169675	ENST00000551018.1:c.207+1G>C	12.37:g.53690060G>C		Somatic		WXS	SOLID	Phase_IV	51976327	A8K9A8|Q54AA8|Q9C083|Q9C084	Splice_Site	SNP	ENST00000551018.1	37	CCDS8853.1	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908500	0.72868	.	.	ENSG00000123349	ENST00000551018;ENST00000334478	.	.	.	5.32	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2114	0.54381	0.0:0.1717:0.8283:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PFDN5	51976327	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.891000	0.87319	1.358000	0.45922	0.462000	0.41574	.		0.493	PFDN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405368.2		Intron
PPFIA1	8500	hgsc.bcm.edu	37	11	70170996	70170996	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr11:70170996G>A	ENST00000253925.7	+	4	625	c.410G>A	c.(409-411)cGg>cAg	p.R137Q	AP000487.6_ENST00000528607.1_RNA|CTA-797E19.2_ENST00000526017.1_RNA|PPFIA1_ENST00000389547.3_Missense_Mutation_p.R137Q	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	137					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)	p.R137Q(1)		breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			AGGCATGAGCGGTCTCTTAGG	0.448																																																1	Substitution - Missense(1)	ovary(1)	11											146.0	153.0	151.0					11																	70170996		2200	4294	6494	69848644	SO:0001583	missense	8500			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.410G>A	11.37:g.70170996G>A	ENSP00000253925:p.Arg137Gln	Somatic		WXS	SOLID	Phase_IV	69848644	A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	G	34	5.328947	0.95733	.	.	ENSG00000131626	ENST00000253925;ENST00000389547;ENST00000530746	T;T;T	0.37584	1.19;1.19;1.19	5.17	4.25	0.50352	.	0.152719	0.41938	D	0.000798	T	0.46502	0.1396	N	0.24115	0.695	0.50039	D	0.999846	D;D	0.89917	0.999;1.0	D;D	0.79108	0.971;0.992	T	0.51348	-0.8717	10	0.59425	D	0.04	.	16.0166	0.80443	0.0:0.1351:0.8649:0.0	.	137;137	Q13136;Q13136-2	LIPA1_HUMAN;.	Q	137	ENSP00000253925:R137Q;ENSP00000374198:R137Q;ENSP00000432722:R137Q	ENSP00000253925:R137Q	R	+	2	0	PPFIA1	69848644	1.000000	0.71417	0.185000	0.23176	0.979000	0.70002	7.679000	0.84048	1.287000	0.44583	0.650000	0.86243	CGG		0.448	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626	
PTCHD3	374308	hgsc.bcm.edu	37	10	27687473	27687473	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr10:27687473T>G	ENST00000438700.3	-	4	2171	c.2054A>C	c.(2053-2055)aAa>aCa	p.K685T		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	685					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.K685T(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						ATAGACATTTTTTTCAAAAAT	0.303																																																1	Substitution - Missense(1)	ovary(1)	10											36.0	37.0	37.0					10																	27687473		2198	4290	6488	27727479	SO:0001583	missense	374308			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.2054A>C	10.37:g.27687473T>G	ENSP00000417658:p.Lys685Thr	Somatic		WXS	SOLID	Phase_IV	27727479	I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	T	0.016	-1.529733	0.00951	.	.	ENSG00000182077	ENST00000438700	D	0.85013	-1.93	4.09	1.65	0.23941	.	1.469460	0.03793	N	0.263183	T	0.77198	0.4095	L	0.29908	0.895	0.09310	N	1	B	0.12630	0.006	B	0.12837	0.008	T	0.58329	-0.7655	10	0.16420	T	0.52	-0.4404	8.2988	0.32001	0.0:0.1755:0.0:0.8245	.	685	Q3KNS1	PTHD3_HUMAN	T	685	ENSP00000417658:K685T	ENSP00000417658:K685T	K	-	2	0	PTCHD3	27727479	0.094000	0.21725	0.015000	0.15790	0.002000	0.02628	0.809000	0.27168	0.620000	0.30215	-0.388000	0.06559	AAA		0.303	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
SIN3A	25942	hgsc.bcm.edu	37	15	75682046	75682046	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr15:75682046G>A	ENST00000394947.3	-	16	3282	c.2968C>T	c.(2968-2970)Cat>Tat	p.H990Y	SIN3A_ENST00000360439.4_Missense_Mutation_p.H990Y|SIN3A_ENST00000394949.4_Missense_Mutation_p.H990Y	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A									p.H990Y(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						ATGTAGGCATGAATGGTGAAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	15											231.0	172.0	192.0					15																	75682046		2197	4294	6491	73469099	SO:0001583	missense	25942			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.2968C>T	15.37:g.75682046G>A	ENSP00000378402:p.His990Tyr	Somatic		WXS	SOLID	Phase_IV	73469099		Missense_Mutation	SNP	ENST00000394947.3	37	CCDS10279.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829543	0.90955	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.47528	0.84;0.84;0.84	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.67674	0.2918	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64445	-0.6406	10	0.42905	T	0.14	-24.0968	18.9999	0.92829	0.0:0.0:1.0:0.0	.	990	Q96ST3	SIN3A_HUMAN	Y	990	ENSP00000378402:H990Y;ENSP00000378403:H990Y;ENSP00000353622:H990Y	ENSP00000353622:H990Y	H	-	1	0	SIN3A	73469099	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	9.790000	0.99075	2.742000	0.94016	0.650000	0.86243	CAT		0.478	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
SLC8A1	6546	hgsc.bcm.edu	37	2	40656621	40656621	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr2:40656621C>A	ENST00000403092.1	-	2	833	c.800G>T	c.(799-801)cGa>cTa	p.R267L	SLC8A1_ENST00000332839.4_Missense_Mutation_p.R267L|SLC8A1_ENST00000405269.1_Missense_Mutation_p.R267L|SLC8A1_ENST00000406785.2_Missense_Mutation_p.R267L|SLC8A1_ENST00000408028.2_Missense_Mutation_p.R267L|SLC8A1_ENST00000406391.2_Missense_Mutation_p.R267L|SLC8A1_ENST00000542756.1_Missense_Mutation_p.R267L|SLC8A1_ENST00000405901.3_Missense_Mutation_p.R267L|SLC8A1_ENST00000402441.1_Missense_Mutation_p.R267L|SLC8A1_ENST00000542024.1_Missense_Mutation_p.R267L			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	267	Calmodulin-binding. {ECO:0000255}.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.R267L(2)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CTTGCCAGCTCGATACCTCTT	0.433																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	2											152.0	151.0	151.0					2																	40656621		2203	4300	6503	40510125	SO:0001583	missense	6546				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.800G>T	2.37:g.40656621C>A	ENSP00000384763:p.Arg267Leu	Somatic		WXS	SOLID	Phase_IV	40510125	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.160500	0.57368	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.34472	1.39;1.43;1.43;1.43;1.39;1.39;1.43;1.36;1.39;1.39	5.96	5.09	0.68999	.	0.178064	0.51477	D	0.000100	T	0.63307	0.2500	M	0.85859	2.78	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.996;1.0;1.0;0.999	D;D;D;D;D	0.85130	0.996;0.995;0.996;0.997;0.991	T	0.69221	-0.5202	10	0.66056	D	0.02	.	12.9583	0.58442	0.0:0.9223:0.0:0.0777	.	267;267;267;267;267	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	L	267	ENSP00000383886:R267L;ENSP00000440727:R267L;ENSP00000384763:R267L;ENSP00000385678:R267L;ENSP00000385188:R267L;ENSP00000385535:R267L;ENSP00000332931:R267L;ENSP00000384908:R267L;ENSP00000385811:R267L;ENSP00000443515:R267L	ENSP00000332931:R267L	R	-	2	0	SLC8A1	40510125	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	7.663000	0.83820	1.540000	0.49301	0.655000	0.94253	CGA		0.433	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
SLFN5	162394	hgsc.bcm.edu	37	17	33591527	33591527	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr17:33591527A>T	ENST00000299977.4	+	4	1612	c.1464A>T	c.(1462-1464)ttA>ttT	p.L488F	SLFN5_ENST00000542451.1_Intron	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	488					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)	p.L488F(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		CTGGGAGGTTATGCATCACCC	0.448																																																1	Substitution - Missense(1)	ovary(1)	17											121.0	112.0	115.0					17																	33591527		2203	4300	6503	30615640	SO:0001583	missense	162394			BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.1464A>T	17.37:g.33591527A>T	ENSP00000299977:p.Leu488Phe	Somatic		WXS	SOLID	Phase_IV	30615640	Q08AF2|Q8WU54|Q96A82	Missense_Mutation	SNP	ENST00000299977.4	37	CCDS32619.1	.	.	.	.	.	.	.	.	.	.	a	17.94	3.511228	0.64522	.	.	ENSG00000166750	ENST00000299977	T	0.02345	4.33	3.36	-0.194	0.13240	.	0.578409	0.13047	N	0.418056	T	0.06234	0.0161	M	0.63843	1.955	0.09310	N	0.999997	D	0.58620	0.983	P	0.53401	0.725	T	0.28933	-1.0028	10	0.41790	T	0.15	.	5.962	0.19305	0.3711:0.0:0.6289:0.0	.	488	Q08AF3	SLFN5_HUMAN	F	488	ENSP00000299977:L488F	ENSP00000299977:L488F	L	+	3	2	SLFN5	30615640	0.745000	0.28261	0.008000	0.14137	0.650000	0.38633	0.026000	0.13599	-0.144000	0.11314	0.533000	0.62120	TTA		0.448	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448649.2	NM_144975	
SMC1B	27127	hgsc.bcm.edu	37	22	45748333	45748333	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr22:45748333G>C	ENST00000357450.4	-	22	3422	c.3423C>G	c.(3421-3423)caC>caG	p.H1141Q	SMC1B_ENST00000404354.3_Intron	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	1141	Ala/Asp-rich (DA-box).				meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.H1143Q(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GACCTTACCTGTGCACAGCAA	0.443																																																1	Substitution - Missense(1)	ovary(1)	22											74.0	73.0	74.0					22																	45748333		1908	4110	6018	44126997	SO:0001583	missense	27127			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.3423C>G	22.37:g.45748333G>C	ENSP00000350036:p.His1141Gln	Somatic		WXS	SOLID	Phase_IV	44126997	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	ENST00000357450.4	37	CCDS43027.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031895	0.75504	.	.	ENSG00000077935	ENST00000357450	T	0.65549	-0.16	6.17	1.52	0.23074	.	0.090318	0.48767	D	0.000179	T	0.64349	0.2590	L	0.59912	1.85	0.80722	D	1	D	0.57257	0.979	P	0.54026	0.74	T	0.65038	-0.6265	10	0.56958	D	0.05	.	8.4322	0.32764	0.1878:0.111:0.7013:0.0	.	1141	Q8NDV3-3	.	Q	1141	ENSP00000350036:H1141Q	ENSP00000350036:H1141Q	H	-	3	2	SMC1B	44126997	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.612000	0.61169	0.948000	0.37687	0.655000	0.94253	CAC		0.443	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322256.2	NM_148674	
TAF1	6872	hgsc.bcm.edu	37	X	70679490	70679490	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chrX:70679490T>G	ENST00000373790.4	+	36	5201	c.5150T>G	c.(5149-5151)cTt>cGt	p.L1717R	TAF1_ENST00000276072.3_Missense_Mutation_p.L1738R|TAF1_ENST00000461764.1_3'UTR|TAF1_ENST00000423759.1_Missense_Mutation_p.L1740R|TAF1_ENST00000449580.1_Missense_Mutation_p.L1751R	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1717	Asp/Glu-rich (acidic tail).|Protein kinase 2.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.L1717R(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GAGGATTTGCTTATGTCTGAA	0.453																																																1	Substitution - Missense(1)	ovary(1)	X											233.0	175.0	195.0					X																	70679490		2203	4300	6503	70596215	SO:0001583	missense	6872				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.5150T>G	X.37:g.70679490T>G	ENSP00000362895:p.Leu1717Arg	Somatic		WXS	SOLID	Phase_IV	70596215	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.05|19.05	3.751279|3.751279	0.69533|0.69533	.|.	.|.	ENSG00000147133|ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000395779;ENST00000276072|ENST00000437147	T;T;T;T|T	0.11385|0.29142	2.91;2.78;2.95;2.91|1.58	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.34048|0.34048	0.0884|0.0884	L|L	0.38175|0.38175	1.15|1.15	0.58432|0.58432	D|D	0.999995|0.999995	D;D;D;D|.	0.76494|.	0.999;0.997;0.995;0.997|.	D;D;D;D|.	0.85130|.	0.997;0.994;0.986;0.994|.	T|T	0.05402|0.05402	-1.0887|-1.0887	10|8	0.25751|0.28530	T|T	0.34|0.3	.|.	13.8026|13.8026	0.63212|0.63212	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	407;1751;1717;1738|.	A5CVC9;P21675-4;P21675;P21675-2|.	.;.;TAF1_HUMAN;.|.	R|V	1717;1751;1740;459;1738|406	ENSP00000362895:L1717R;ENSP00000389000:L1751R;ENSP00000406549:L1740R;ENSP00000276072:L1738R|ENSP00000406517:L406V	ENSP00000276072:L1738R|ENSP00000406517:L406V	L|L	+|+	2|1	0|2	TAF1|TAF1	70596215|70596215	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.278000|7.278000	0.78587|0.78587	1.832000|1.832000	0.53329|0.53329	0.430000|0.430000	0.28490|0.28490	CTT|TTA		0.453	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
THBS3	7059	hgsc.bcm.edu	37	1	155174662	155174662	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr1:155174662C>G	ENST00000368378.3	-	4	650	c.630G>C	c.(628-630)gaG>gaC	p.E210D	RP11-263K19.4_ENST00000453136.1_RNA|THBS3_ENST00000486260.1_5'UTR|THBS3_ENST00000541990.1_Intron|RP11-263K19.4_ENST00000422665.1_RNA|THBS3_ENST00000541576.1_5'Flank|THBS3_ENST00000457183.2_Intron|RP11-263K19.4_ENST00000430312.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	210					bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.E210D(1)		breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGTGGATGGACTCGTCCCCTT	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											176.0	142.0	154.0					1																	155174662		2203	4300	6503	153441286	SO:0001583	missense	7059			L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.630G>C	1.37:g.155174662C>G	ENSP00000357362:p.Glu210Asp	Somatic		WXS	SOLID	Phase_IV	153441286	B1AVR8|B4DQ20|Q8WV34	Missense_Mutation	SNP	ENST00000368378.3	37	CCDS1099.1	.	.	.	.	.	.	.	.	.	.	C	11.62	1.693784	0.30052	.	.	ENSG00000169231	ENST00000368378	T	0.81330	-1.48	5.13	-0.12	0.13539	.	0.409718	0.26421	N	0.024465	T	0.42086	0.1187	N	0.19112	0.55	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.002;0.002	T	0.12167	-1.0558	10	0.23302	T	0.38	-22.919	5.7485	0.18134	0.0:0.5111:0.261:0.228	.	210;210;210	Q53FK6;Q2HIZ0;P49746	.;.;TSP3_HUMAN	D	210	ENSP00000357362:E210D	ENSP00000357362:E210D	E	-	3	2	THBS3	153441286	0.009000	0.17119	0.978000	0.43139	0.995000	0.86356	-0.973000	0.03798	-0.082000	0.12640	0.643000	0.83706	GAG		0.537	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112	
TNIK	23043	hgsc.bcm.edu	37	3	170946006	170946006	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr3:170946006C>G	ENST00000436636.2	-	3	472	c.128G>C	c.(127-129)cGt>cCt	p.R43P	TNIK_ENST00000341852.6_Missense_Mutation_p.R43P|TNIK_ENST00000460047.1_Missense_Mutation_p.R43P|TNIK_ENST00000475336.1_Missense_Mutation_p.R43P|TNIK_ENST00000369326.5_Missense_Mutation_p.R43P|TNIK_ENST00000284483.8_Missense_Mutation_p.R43P|TNIK_ENST00000357327.5_Missense_Mutation_p.R43P|TNIK_ENST00000538048.1_Missense_Mutation_p.R43P|TNIK_ENST00000470834.1_Missense_Mutation_p.R43P|TNIK_ENST00000488470.1_Missense_Mutation_p.R43P	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	43	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R43P(1)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			TTTGACATGACGACCCTGTGA	0.393																																																1	Substitution - Missense(1)	ovary(1)	3											107.0	104.0	105.0					3																	170946006		1895	4105	6000	172428700	SO:0001583	missense	23043			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.128G>C	3.37:g.170946006C>G	ENSP00000399511:p.Arg43Pro	Somatic		WXS	SOLID	Phase_IV	172428700	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	ENST00000436636.2	37	CCDS46956.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.863117	0.91511	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834	T;T;T;T;T;T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69	5.92	5.92	0.95590	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.59542	0.2201	M	0.88310	2.945	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D;D	0.79784	0.958;0.988;0.974;0.972;0.988;0.988;0.974;0.993	T	0.65348	-0.6190	10	0.87932	D	0	.	17.8186	0.88643	0.0:1.0:0.0:0.0	.	43;43;43;43;43;43;43;43	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	P	43	ENSP00000399511:R43P;ENSP00000358332:R43P;ENSP00000443278:R43P;ENSP00000345352:R43P;ENSP00000284483:R43P;ENSP00000418156:R43P;ENSP00000349880:R43P;ENSP00000418916:R43P;ENSP00000418378:R43P;ENSP00000419990:R43P	ENSP00000284483:R43P	R	-	2	0	TNIK	172428700	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.610000	0.74178	2.818000	0.97014	0.655000	0.94253	CGT		0.393	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2	XM_039796	
TP53	7157	hgsc.bcm.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	17	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	7517845	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His	Somatic		WXS	SOLID	Phase_IV	7517845	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
UBLCP1	134510	hgsc.bcm.edu	37	5	158705261	158705261	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr5:158705261G>A	ENST00000296786.6	+	9	1026	c.700G>A	c.(700-702)Gtt>Att	p.V234I		NM_145049.3	NP_659486.2	Q8WVY7	UBCP1_HUMAN	ubiquitin-like domain containing CTD phosphatase 1	234	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.|Phosphatase.					nucleolus (GO:0005730)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)	p.V234I(1)		endometrium(1)|kidney(3)|large_intestine(4)|ovary(1)	9	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCCTCTTGGTGTTATATGGGG	0.338																																																1	Substitution - Missense(1)	ovary(1)	5											85.0	87.0	86.0					5																	158705261		2203	4300	6503	158637839	SO:0001583	missense	134510			AK057996	CCDS4345.1	5q33.3	2010-06-21			ENSG00000164332	ENSG00000164332	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	28110	protein-coding gene	gene with protein product	"""CTD phosphatase-like with ubiquitin domain 1"""	609867				15883030	Standard	NM_145049		Approved	MGC10067, CPUB1	uc003lxq.2	Q8WVY7	OTTHUMG00000130305	ENST00000296786.6:c.700G>A	5.37:g.158705261G>A	ENSP00000296786:p.Val234Ile	Somatic		WXS	SOLID	Phase_IV	158637839	D3DQJ7|Q96DK5	Missense_Mutation	SNP	ENST00000296786.6	37	CCDS4345.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607428	0.66558	.	.	ENSG00000164332	ENST00000296786	T	0.16196	2.36	5.44	5.44	0.79542	HAD-superfamily hydrolase, subfamily IIID (1);NLI interacting factor (3);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.17238	0.0414	L	0.43923	1.385	0.80722	D	1	P	0.38250	0.624	B	0.35859	0.212	T	0.02574	-1.1139	10	0.26408	T	0.33	-2.71	17.8054	0.88600	0.0:0.0:1.0:0.0	.	234	Q8WVY7	UBCP1_HUMAN	I	234	ENSP00000296786:V234I	ENSP00000296786:V234I	V	+	1	0	UBLCP1	158637839	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.416000	0.97383	2.697000	0.92050	0.655000	0.94253	GTT		0.338	UBLCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252650.2	NM_145049	
ELP4	26610	hgsc.bcm.edu	37	11	31671663	31671663	+	Splice_Site	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr11:31671663G>C	ENST00000350638.5	+	9	1072	c.1037G>C	c.(1036-1038)gGa>gCa	p.G346A	Z83001.1_ENST00000429821.1_RNA|ELP4_ENST00000379163.5_Splice_Site_p.G347A|ELP4_ENST00000395934.2_Splice_Site_p.G346A	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	346					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)	p.G346A(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					TTTCCACAAGGATTGATTCAT	0.303																																																1	Substitution - Missense(1)	ovary(1)	11											44.0	42.0	42.0					11																	31671663		1786	4056	5842	31628239	SO:0001630	splice_region_variant	26610			AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.1037-1G>C	11.37:g.31671663G>C		Somatic		WXS	SOLID	Phase_III	31628239	B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	ENST00000350638.5	37	CCDS7875.2	.	.	.	.	.	.	.	.	.	.	G	13.34	2.206734	0.39003	.	.	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	D;D;D	0.83755	-1.76;-1.76;-1.76	5.59	4.67	0.58626	.	0.000000	0.85682	D	0.000000	D	0.92538	0.7630	M	0.91510	3.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93904	0.7191	9	.	.	.	.	14.3765	0.66881	0.0712:0.0:0.9288:0.0	.	347;346;346	B4E3W0;G5E9D4;Q96EB1	.;.;ELP4_HUMAN	A	346;347;346	ENSP00000298937:G346A;ENSP00000368461:G347A;ENSP00000379267:G346A	.	G	+	2	0	ELP4	31628239	1.000000	0.71417	0.987000	0.45799	0.683000	0.39861	8.247000	0.89830	1.362000	0.46000	0.585000	0.79938	GGA		0.303	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286640.1	NM_019040	Missense_Mutation
MCM10	55388	hgsc.bcm.edu	37	10	13217624	13217624	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr10:13217624G>T	ENST00000484800.2	+	6	813	c.710G>T	c.(709-711)aGt>aTt	p.S237I	MCM10_ENST00000378694.1_Missense_Mutation_p.S236I|MCM10_ENST00000378714.3_Missense_Mutation_p.S236I			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	237					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.S237I(1)		central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						ACCCCAGGAAGTTCTGGGGAA	0.517																																																1	Substitution - Missense(1)	ovary(1)	10											132.0	132.0	132.0					10																	13217624		2203	4300	6503	13257630	SO:0001583	missense	55388			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.710G>T	10.37:g.13217624G>T	ENSP00000418268:p.Ser237Ile	Somatic		WXS	SOLID	Phase_III	13257630	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.727257	0.30593	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.16324	2.36;2.36;2.35	5.42	-5.14	0.02875	.	1.310580	0.04451	N	0.372627	T	0.14141	0.0342	L	0.54323	1.7	0.09310	N	1	B;B;B	0.31054	0.306;0.071;0.042	B;B;B	0.25759	0.063;0.059;0.027	T	0.31833	-0.9929	10	0.36615	T	0.2	-16.8414	6.9107	0.24333	0.4578:0.207:0.3352:0.0	.	236;236;237	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	I	236;237;237;236	ENSP00000367986:S236I;ENSP00000418268:S237I;ENSP00000367966:S236I	ENSP00000354945:S237I	S	+	2	0	MCM10	13257630	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.089000	0.11180	-0.651000	0.05415	-0.137000	0.14449	AGT		0.517	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
NCOR2	9612	hgsc.bcm.edu	37	12	124904572	124904572	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr12:124904572G>T	ENST00000405201.1	-	13	1413	c.1413C>A	c.(1411-1413)taC>taA	p.Y471*	NCOR2_ENST00000429285.2_Nonsense_Mutation_p.Y470*|NCOR2_ENST00000356219.3_Nonsense_Mutation_p.Y471*|NCOR2_ENST00000404621.1_Nonsense_Mutation_p.Y470*|NCOR2_ENST00000404121.2_Nonsense_Mutation_p.Y41*|NCOR2_ENST00000397355.1_Nonsense_Mutation_p.Y471*			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	471	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Y471*(1)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TCTTAGTCAGGTAGTAATAGA	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	12											99.0	106.0	104.0					12																	124904572		2009	4171	6180	123470525	SO:0001587	stop_gained	9612			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1413C>A	12.37:g.124904572G>T	ENSP00000384018:p.Tyr471*	Somatic		WXS	SOLID	Phase_III	123470525	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Nonsense_Mutation	SNP	ENST00000405201.1	37	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	G	38	7.218913	0.98143	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234;ENST00000420698	.	.	.	4.52	4.52	0.55395	.	0.356240	0.27266	N	0.020143	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.6039	17.6457	0.88148	0.0:0.0:1.0:0.0	.	.	.	.	X	471;470;471;471;471;41;470;471;471	.	ENSP00000348551:Y471X	Y	-	3	2	NCOR2	123470525	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.436000	0.80404	2.255000	0.74692	0.561000	0.74099	TAC		0.567	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
OR4E2	26686	hgsc.bcm.edu	37	14	22133308	22133308	+	Silent	SNP	A	A	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr14:22133308A>C	ENST00000408935.1	+	1	12	c.12A>C	c.(10-12)ctA>ctC	p.L4L		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L4L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		TGGACAGTCTAAACCAAACAA	0.348																																																1	Substitution - coding silent(1)	ovary(1)	14											114.0	100.0	104.0					14																	22133308		1851	4090	5941	21203148	SO:0001819	synonymous_variant	26686				CCDS41916.1	14q11.2	2013-09-23			ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	8297	protein-coding gene	gene with protein product							Standard	NM_001001912		Approved		uc010tmd.2	Q8NGC2	OTTHUMG00000168979	ENST00000408935.1:c.12A>C	14.37:g.22133308A>C		Somatic		WXS	SOLID	Phase_III	21203148	Q6IET6|Q96R62	Missense_Mutation	SNP	ENST00000408935.1	37	CCDS41916.1																																																																																				0.348	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401874.1		
PSTPIP1	9051	hgsc.bcm.edu	37	15	77310554	77310554	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0900-01B-01W-0490-10	TCGA-13-0900-10A-01W-0490-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	0d36bcdc-91c8-43f4-ba4a-29f890054f31	13bb514e-753a-43ac-9abb-f5df53bf08a1	g.chr15:77310554G>C	ENST00000558012.1	+	2	591	c.102G>C	c.(100-102)aaG>aaC	p.K34N	PSTPIP1_ENST00000559295.1_Missense_Mutation_p.K34N|PSTPIP1_ENST00000379595.3_Missense_Mutation_p.K34N|PSTPIP1_ENST00000267939.5_Missense_Mutation_p.K33N	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	34	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)		p.K34N(1)		breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						ATGGCAGGAAGATGTGCAAAG	0.627																																																1	Substitution - Missense(1)	ovary(1)	15											32.0	39.0	36.0					15																	77310554		2152	4241	6393	75097609	SO:0001583	missense	9051			U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.102G>C	15.37:g.77310554G>C	ENSP00000452746:p.Lys34Asn	Somatic		WXS	SOLID	Phase_III	75097609	B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	ENST00000558012.1	37	CCDS45312.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.743810	0.49151	.	.	ENSG00000140368	ENST00000379595;ENST00000267939	T;T	0.18810	2.19;2.38	4.35	4.35	0.52113	Fps/Fes/Fer/CIP4 homology (3);Prismane-like (1);	0.178684	0.43579	D	0.000553	T	0.30198	0.0757	L	0.36672	1.1	0.44247	D	0.997094	P;D;D;P	0.57257	0.593;0.958;0.979;0.773	B;P;P;P	0.54856	0.32;0.762;0.76;0.449	T	0.07102	-1.0790	10	0.72032	D	0.01	-53.0302	16.0206	0.80486	0.0:0.0:1.0:0.0	.	34;33;34;34	O43586-2;C9K004;B4E1Z9;O43586	.;.;.;PPIP1_HUMAN	N	34;33	ENSP00000368914:K34N;ENSP00000267939:K33N	ENSP00000267939:K33N	K	+	3	2	PSTPIP1	75097609	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.729000	0.54999	2.137000	0.66172	0.491000	0.48974	AAG		0.627	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419373.2	NM_003978	
