#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CSMD2	114784	genome.wustl.edu	37	1	34033397	34033397	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr1:34033397C>T	ENST00000373381.4	-	53	8352	c.8176G>A	c.(8176-8178)Gat>Aat	p.D2726N		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2712	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GAGAGTACATCGAAGAGGAGC	0.512																																																0			1											53.0	48.0	50.0					1																	34033397		2203	4300	6503	33805984	SO:0001583	missense	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.8176G>A	1.37:g.34033397C>T	ENSP00000362479:p.Asp2726Asn	Somatic		Capture	Illumina GAIIx	4	33805984	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	-	p.D2726N	ENST00000373381.4	37	c.8176		1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.442087	0.25987	.	.	ENSG00000121904	ENST00000373381	T	0.24723	1.84	4.53	0.279	0.15677	.	3.061860	0.01565	U	0.020293	T	0.15565	0.0375	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.14420	-1.0473	8	.	.	.	.	4.42	0.11476	0.0:0.5365:0.1648:0.2987	.	2726	E7EUA6	.	N	2726	ENSP00000362479:D2726N	.	D	-	1	0	CSMD2	33805984	0.000000	0.05858	0.007000	0.13788	0.065000	0.16274	-0.472000	0.06623	0.088000	0.17205	0.655000	0.94253	GAT	-	NULL		0.512	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	protein_coding		C	NM_052896		33805984	-1	no_errors	ENST00000373381	ensembl	human	known	54_36p	missense	SNP		T
ZZZ3	26009	genome.wustl.edu	37	1	78098228	78098228	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr1:78098228G>A	ENST00000370801.3	-	5	1287	c.812C>T	c.(811-813)tCa>tTa	p.S271L	ZZZ3_ENST00000370798.1_Intron|ZZZ3_ENST00000476275.1_5'UTR	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	271					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S271L(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						CTGCACTTGTGAATCTGTGCA	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											134.0	128.0	130.0					1																	78098228		2203	4300	6503	77870816	SO:0001583	missense	26009			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.812C>T	1.37:g.78098228G>A	ENSP00000359837:p.Ser271Leu	Somatic		Capture	Illumina GAIIx	4	77870816	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	-	p.S271L	ENST00000370801.3	37	c.812	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213213	0.58452	.	.	ENSG00000036549	ENST00000370801	.	.	.	5.49	5.49	0.81192	.	0.512330	0.21239	N	0.077858	T	0.70824	0.3268	L	0.54323	1.7	0.80722	D	1	D;P;P	0.71674	0.998;0.9;0.939	D;P;P	0.68943	0.961;0.535;0.725	T	0.66878	-0.5812	8	.	.	.	.	19.7573	0.96299	0.0:0.0:1.0:0.0	.	271;271;271	Q8IYH5-4;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	L	271	.	.	S	-	2	0	ZZZ3	77870816	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	6.416000	0.73332	2.741000	0.93983	0.650000	0.86243	TCA	-	NULL		0.458	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	protein_coding	OTTHUMT00000026615.1	G	NM_015534		77870816	-1	no_errors	NM_015534	genbank	human	provisional	54_36p	missense	SNP	0.99	A
RGS7	6000	genome.wustl.edu	37	1	241262054	241262054	+	Silent	SNP	G	G	A	rs563733368		TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr1:241262054G>A	ENST00000407727.1	-	2	86	c.87C>T	c.(85-87)gaC>gaT	p.D29D	RGS7_ENST00000446183.2_De_novo_Start_OutOfFrame|RGS7_ENST00000366563.1_Silent_p.D29D|RGS7_ENST00000366565.1_Silent_p.D29D|RGS7_ENST00000331110.7_Silent_p.D3D|RGS7_ENST00000366564.1_Silent_p.D29D|RGS7_ENST00000366562.4_Silent_p.D29D|RGS7_ENST00000348120.2_Silent_p.D29D|RGS7_ENST00000401882.1_Silent_p.D29D			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	29					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.D29D(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			GTGCTATGACGTCTTCCATCT	0.328																																																1	Substitution - coding silent(1)	ovary(1)	1											137.0	122.0	127.0					1																	241262054		2203	4300	6503	239328677	SO:0001819	synonymous_variant	6000			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.87C>T	1.37:g.241262054G>A		Somatic		Capture	Illumina GAIIx	4	239328677	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Silent	SNP	"HMMPfam_RGS;HMMPfam_DEP;HMMPfam_G-gamma;superfamily_""Winged helix"" DNA-binding domain;superfamily_Regulator of G-protein signaling RGS;superfamily_Transducin (heterotrimeric G protein) gamma chain"	p.D29	ENST00000407727.1	37	c.87		1																																																																																			-	NULL		0.328	RGS7-204	KNOWN	basic	protein_coding	RGS7	protein_coding		G	NM_002924		239328677	-1	no_errors	NM_002924	genbank	human	validated	54_36p	silent	SNP	1	A
FAT3	120114	genome.wustl.edu	37	11	92086159	92086159	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr11:92086159C>T	ENST00000298047.6	+	1	898	c.881C>T	c.(880-882)gCg>gTg	p.A294V	FAT3_ENST00000409404.2_Missense_Mutation_p.A294V|FAT3_ENST00000525166.1_Missense_Mutation_p.A144V|FAT3_ENST00000541502.1_Missense_Mutation_p.A294V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	294	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GATGATGGAGCGAATGGAGAG	0.438										TCGA Ovarian(4;0.039)																																						0			11											137.0	128.0	131.0					11																	92086159		2030	4202	6232	91725807	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.881C>T	11.37:g.92086159C>T	ENSP00000298047:p.Ala294Val	Somatic		Capture	Illumina GAIIx	4	91725807	B5MDB0|Q96AU6	Missense_Mutation	SNP	-	p.A294V	ENST00000298047.6	37	c.881		11	.	.	.	.	.	.	.	.	.	.	C	10.46	1.357007	0.24598	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	5.2	5.2	0.72013	.	.	.	.	.	T	0.45558	0.1348	N	0.21282	0.65	0.32586	N	0.527824	B	0.26120	0.142	B	0.18561	0.022	T	0.50039	-0.8874	9	0.28530	T	0.3	.	18.075	0.89424	0.0:1.0:0.0:0.0	.	294	Q8TDW7-3	.	V	294;294;294;144	ENSP00000298047:A294V;ENSP00000387040:A294V;ENSP00000443786:A294V;ENSP00000432586:A144V	ENSP00000298047:A294V	A	+	2	0	FAT3	91725807	0.729000	0.28090	1.000000	0.80357	0.577000	0.36160	3.634000	0.54302	2.568000	0.86640	0.557000	0.71058	GCG	-	NULL		0.438	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		C	NM_001008781		91725807	1	no_errors	NM_001008781	genbank	human	validated	54_36p	missense	SNP	0.66	T
KMT2A	4297	genome.wustl.edu	37	11	118373604	118373604	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr11:118373604A>G	ENST00000389506.5	+	27	6988	c.6988A>G	c.(6988-6990)Aaa>Gaa	p.K2330E	KMT2A_ENST00000534358.1_Missense_Mutation_p.K2333E|KMT2A_ENST00000354520.4_Missense_Mutation_p.K2292E			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2330					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.K2330E(1)									TGGAATTCCTAAACTGGCCCC	0.453																																																1	Substitution - Missense(1)	ovary(1)	11											121.0	126.0	124.0					11																	118373604		2200	4296	6496	117878814	SO:0001583	missense	4297			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.6988A>G	11.37:g.118373604A>G	ENSP00000374157:p.Lys2330Glu	Somatic		Capture	Illumina GAIIx	4	117878814	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	-	p.K2330E	ENST00000389506.5	37	c.6988	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	A	16.23	3.064028	0.55432	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.83837	-1.76;-1.77;-1.72	5.19	5.19	0.71726	.	0.404263	0.30085	N	0.010447	T	0.71230	0.3315	N	0.19112	0.55	0.49213	D	0.99976	P;P	0.40970	0.734;0.734	B;B	0.35114	0.196;0.196	T	0.74057	-0.3787	10	0.40728	T	0.16	.	15.2143	0.73250	1.0:0.0:0.0:0.0	.	2333;2330	E9PQG7;Q03164	.;MLL1_HUMAN	E	2333;2330;2292;1240	ENSP00000436786:K2333E;ENSP00000374157:K2330E;ENSP00000346516:K2292E	ENSP00000346516:K2292E	K	+	1	0	MLL	117878814	1.000000	0.71417	0.932000	0.37286	0.968000	0.65278	6.211000	0.72182	2.179000	0.69175	0.460000	0.39030	AAA	-	NULL		0.453	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	protein_coding	OTTHUMT00000399085.2	A	NM_005933		117878814	1	no_errors	NM_005933	genbank	human	validated	54_36p	missense	SNP	0.81	G
NR1H4	9971	genome.wustl.edu	37	12	100930769	100930769	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr12:100930769C>T	ENST00000551379.1	+	6	933	c.905C>T	c.(904-906)aCg>aTg	p.T302M	NR1H4_ENST00000549996.1_Missense_Mutation_p.T241M|NR1H4_ENST00000392986.3_Missense_Mutation_p.T292M|NR1H4_ENST00000188403.7_Missense_Mutation_p.T298M|NR1H4_ENST00000548884.1_Missense_Mutation_p.T288M			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	302	Ligand-binding.				bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.T288M(1)		NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	CTCATTTTGACGGAAATGGCA	0.244																																																1	Substitution - Missense(1)	ovary(1)	12											68.0	81.0	77.0					12																	100930769		2191	4281	6472	99454900	SO:0001583	missense	9971			U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.905C>T	12.37:g.100930769C>T	ENSP00000447149:p.Thr302Met	Somatic		Capture	Illumina GAIIx	4	99454900	A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Missense_Mutation	SNP	HMMPfam_Hormone_recep;HMMPfam_zf-C4;superfamily_Nuclear receptor ligand-binding domain;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.T288M	ENST00000551379.1	37	c.863	CCDS55876.1	12	.	.	.	.	.	.	.	.	.	.	C	22.6	4.309455	0.81247	.	.	ENSG00000012504	ENST00000548884;ENST00000392986;ENST00000549996;ENST00000551379;ENST00000188403	D;D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82;-3.82	5.18	5.18	0.71444	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.048169	0.85682	D	0.000000	D	0.97595	0.9212	M	0.76433	2.335	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.918;1.0;1.0;0.986	D	0.98239	1.0487	10	0.87932	D	0	.	19.0423	0.93006	0.0:1.0:0.0:0.0	.	241;302;298;292;288	F8VYG8;Q96RI1;Q96RI1-4;F1DAL1;B6ZGS9	.;NR1H4_HUMAN;.;.;.	M	288;292;241;302;298	ENSP00000448506:T288M;ENSP00000376712:T292M;ENSP00000448978:T241M;ENSP00000447149:T302M;ENSP00000188403:T298M	ENSP00000188403:T298M	T	+	2	0	NR1H4	99454900	1.000000	0.71417	0.998000	0.56505	0.865000	0.49528	7.410000	0.80065	2.555000	0.86185	0.585000	0.79938	ACG	-	NULL		0.244	NR1H4-006	KNOWN	basic|CCDS	protein_coding	NR1H4	protein_coding	OTTHUMT00000409140.1	C	NM_005123		99454900	1	no_errors	NM_005123	genbank	human	provisional	54_36p	missense	SNP	1	T
ACIN1	22985	genome.wustl.edu	37	14	23549748	23549748	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr14:23549748G>C	ENST00000262710.1	-	6	1297	c.970C>G	c.(970-972)Ccc>Gcc	p.P324A	ACIN1_ENST00000605057.1_Missense_Mutation_p.P266A|ACIN1_ENST00000555053.1_Missense_Mutation_p.P324A|ACIN1_ENST00000457657.1_Missense_Mutation_p.P284A|ACIN1_ENST00000555352.1_5'Flank	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	324	Glu-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P324A(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CTTGTTTTGGGTCTCTCATCC	0.468																																																1	Substitution - Missense(1)	ovary(1)	14											254.0	213.0	227.0					14																	23549748		2203	4300	6503	22619588	SO:0001583	missense	22985			AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.970C>G	14.37:g.23549748G>C	ENSP00000262710:p.Pro324Ala	Somatic		Capture	Illumina GAIIx	4	22619588	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	-	p.P324A	ENST00000262710.1	37	c.970	CCDS9587.1	14	.	.	.	.	.	.	.	.	.	.	G	9.953	1.220761	0.22457	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.28255	2.18;1.62;2.18	4.81	0.669	0.17918	.	0.782162	0.10898	N	0.621914	T	0.16854	0.0405	N	0.24115	0.695	0.09310	N	1	B;B;B	0.27068	0.167;0.104;0.104	B;B;B	0.31101	0.124;0.058;0.058	T	0.34502	-0.9826	10	0.15066	T	0.55	1.4267	3.9613	0.09412	0.278:0.0:0.5582:0.1639	.	324;324;284	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	A	324;284;324	ENSP00000262710:P324A;ENSP00000405677:P284A;ENSP00000451328:P324A	ENSP00000262710:P324A	P	-	1	0	ACIN1	22619588	0.661000	0.27430	0.386000	0.26170	0.980000	0.70556	-0.126000	0.10563	0.243000	0.21327	0.650000	0.86243	CCC	-	NULL		0.468	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACIN1	protein_coding	OTTHUMT00000071707.3	G	NM_014977		22619588	-1	no_errors	NM_014977	genbank	human	validated	54_36p	missense	SNP	0.94	C
SNX33	257364	genome.wustl.edu	37	15	75942730	75942730	+	Silent	SNP	G	G	A			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr15:75942730G>A	ENST00000308527.5	+	1	2484	c.1287G>A	c.(1285-1287)caG>caA	p.Q429Q	IMP3_ENST00000565349.1_5'Flank|IMP3_ENST00000314852.2_5'Flank	NM_153271.1	NP_695003.1	Q8WV41	SNX33_HUMAN	sorting nexin 33	429	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|macropinocytosis (GO:0044351)|membrane tubulation (GO:0097320)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|negative regulation of endocytosis (GO:0045806)|negative regulation of protein localization to cell surface (GO:2000009)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein localization to cell surface (GO:2000010)|protein import (GO:0017038)	cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)	p.Q429Q(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	19						ATTCCTTCCAGATGGACCCCC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	15											119.0	106.0	110.0					15																	75942730		2197	4294	6491	73729785	SO:0001819	synonymous_variant	257364			AK091291	CCDS10283.1	15q23	2008-04-18	2008-03-25	2008-03-25	ENSG00000173548	ENSG00000173548			28468	protein-coding gene	gene with protein product			"""SH3 and PX domain containing 3"""	SH3PX3		16374509, 16782399, 18353773	Standard	NM_153271		Approved	MGC32065, SH3PXD3C, SNX30	uc002bau.3	Q8WV41	OTTHUMG00000142835	ENST00000308527.5:c.1287G>A	15.37:g.75942730G>A		Somatic		Capture	Illumina GAIIx	4	73729785	B1NM17	Silent	SNP	-	p.Q429	ENST00000308527.5	37	c.1287	CCDS10283.1	15																																																																																			-	NULL		0.572	SNX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX33	protein_coding	OTTHUMT00000286471.1	G	NM_153271		73729785	1	no_errors	NM_153271	genbank	human	provisional	54_36p	silent	SNP	1	A
SNX29P2	440352	genome.wustl.edu	37	16	29496932	29496932	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr16:29496932C>G	ENST00000354563.5	-	3	753	c.343G>C	c.(343-345)Gtg>Ctg	p.V115L	SNX29P2_ENST00000398878.3_lincRNA																endometrium(1)|kidney(1)	2						GGAGTGAGCACACACTCGGGA	0.537																																																0			16																																								29404433	SO:0001583	missense	0																														ENST00000354563.5:c.343G>C	16.37:g.29496932C>G	ENSP00000346572:p.Val115Leu	Somatic		Capture	Illumina GAIIx	4	29404433		Missense_Mutation	SNP	-	p.V115L	ENST00000354563.5	37	c.343		16	.	.	.	.	.	.	.	.	.	.	c	0.004	-2.380830	0.00205	.	.	ENSG00000169203	ENST00000354563;ENST00000398875;ENST00000550665	T	0.16457	2.34	.	.	.	.	.	.	.	.	T	0.03434	0.0099	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29579	-1.0007	4	0.02654	T	1	.	.	.	.	.	.	.	.	L	115;27;289	ENSP00000447597:V289L	ENSP00000346572:V115L	V	-	1	0	RP11-231C14.4	29404433	0.007000	0.16637	0.007000	0.13788	0.007000	0.05969	-2.332000	0.01109	-2.387000	0.00589	-2.332000	0.00249	GTG	-	NULL		0.537	RP11-231C14.4-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000169203	protein_coding		C			29404433	-1	no_errors	ENST00000354563	ensembl	human	known	54_36p	missense	SNP	0	G
Unknown	0	genome.wustl.edu	37	16	32438094	32438094	+	IGR	SNP	A	A	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr16:32438094A>T								RP11-17M15.2 (116218 upstream) : RP11-626K17.3 (27838 downstream)																							CTGCTGTCTTAGGCAGCCAAC	0.343																																																0			16																																								32345595	SO:0001628	intergenic_variant	647157																															16.37:g.32438094A>T		Somatic		Capture	Illumina GAIIx	4	32345595		RNA	SNP	-	NULL		37	NULL		16																																																																																			-	-	0	0.343					LOC647157			A			32345595	1	pseudogene	XR_017478	genbank	human	model	54_36p	rna	SNP	0.97	T
LLGL2	3993	genome.wustl.edu	37	17	73560554	73560568	+	In_Frame_Del	DEL	CTTCACTGTCCTCAC	CTTCACTGTCCTCAC	-			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	CTTCACTGTCCTCAC	CTTCACTGTCCTCAC	CTTCACTGTCCTCAC	-	CTTCACTGTCCTCAC	CTTCACTGTCCTCAC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr17:73560554_73560568delCTTCACTGTCCTCAC	ENST00000392550.3	+	10	1119_1133	c.1002_1016delCTTCACTGTCCTCAC	c.(1000-1017)ggcttcactgtcctcaca>gga	p.FTVLT335del	LLGL2_ENST00000375227.4_In_Frame_Del_p.FTVLT335del|LLGL2_ENST00000167462.5_In_Frame_Del_p.FTVLT335del|LLGL2_ENST00000578363.1_In_Frame_Del_p.FTVLT335del|LLGL2_ENST00000577200.1_In_Frame_Del_p.FTVLT335del	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	335					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)	p.F335_T339del(1)		NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			GTGTCATCGGCTTCACTGTCCTCACAGAGGCAGAC	0.633																																																1	Deletion - In frame(1)	ovary(1)	17																																								71072163	SO:0001651	inframe_deletion	3993			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1002_1016delCTTCACTGTCCTCAC	17.37:g.73560554_73560568delCTTCACTGTCCTCAC	ENSP00000376333:p.Phe335_Thr339del	Somatic		Capture	Illumina GAIIx	Phase_III	71072149	Q14521|Q9BR62	In_Frame_Del	DEL	HMMPfam_WD40,superfamily_WD40 repeat-like,HMMPfam_LLGL	p.LTEA338in_frame_delSQR	ENST00000392550.3	37	c.1012	CCDS32733.1	17																																																																																			(deletion:cds_exon[71072029,71072183])	HMMPfam_LLGL		0.633	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LLGL2	protein_coding	OTTHUMT00000447633.1	CTTCACTGTCCTCAC	NM_004524		71072163	1	no_errors	NM_001031803	genbank	human	reviewed	54_36p	in_frame_del	DEL	1	-
TP53	7157	genome.wustl.edu	37	17	7577498	7577498	+	Splice_Site	SNP	C	C	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr17:7577498C>T	ENST00000269305.4	-	7	972		c.e7+1		TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(29)|p.0?(8)|p.E258fs*71(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGCTCCTGACCTGGAGTCTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(29)|Whole gene deletion(8)|Deletion - Frameshift(1)	breast(5)|ovary(5)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|upper_aerodigestive_tract(2)|stomach(2)|central_nervous_system(2)|large_intestine(2)|oesophagus(2)|peritoneum(1)|biliary_tract(1)|liver(1)|urinary_tract(1)|salivary_gland(1)|lung(1)|skin(1)|pancreas(1)	17											121.0	85.0	97.0					17																	7577498		2203	4300	6503	7518223	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.782+1G>A	17.37:g.7577498C>T		Somatic		Capture	Illumina GAIIx	4	7518223	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e6+1	ENST00000269305.4	37	c.782+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989137	0.35131	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.31	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.688	0.69062	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518223	1.000000	0.71417	0.987000	0.45799	0.147000	0.21601	3.111000	0.50360	2.406000	0.81754	0.462000	0.41574	.	-	-		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Intron	7518223	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
ANKRD27	84079	genome.wustl.edu	37	19	33122333	33122333	+	Missense_Mutation	SNP	G	G	A	rs201398434		TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr19:33122333G>A	ENST00000306065.4	-	13	1342	c.1184C>T	c.(1183-1185)tCg>tTg	p.S395L		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	395					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.S395L(1)		breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					GGTGGGAGACGAAGTCATCTG	0.478																																																1	Substitution - Missense(1)	ovary(1)	19											165.0	145.0	152.0					19																	33122333		2203	4300	6503	37814173	SO:0001583	missense	84079			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.1184C>T	19.37:g.33122333G>A	ENSP00000304292:p.Ser395Leu	Somatic		Capture	Illumina GAIIx	4	37814173	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	HMMPfam_Ank;superfamily_Ankyrin repeat;HMMPfam_VPS9;superfamily_VPS9 domain (Pfam 02204)	p.S395L	ENST00000306065.4	37	c.1184	CCDS32986.1	19	.	.	.	.	.	.	.	.	.	.	G	16.85	3.236874	0.58886	.	.	ENSG00000105186	ENST00000306065	T	0.62639	0.01	5.38	5.38	0.77491	Ankyrin repeat-containing domain (1);	0.133396	0.34460	N	0.003957	T	0.57710	0.2072	N	0.20986	0.625	0.80722	D	1	D	0.58970	0.984	P	0.47645	0.553	T	0.61874	-0.6973	10	0.51188	T	0.08	-14.012	19.1212	0.93364	0.0:0.0:1.0:0.0	.	395	Q96NW4	ANR27_HUMAN	L	395	ENSP00000304292:S395L	ENSP00000304292:S395L	S	-	2	0	ANKRD27	37814173	0.993000	0.37304	0.245000	0.24217	0.262000	0.26303	6.638000	0.74309	2.504000	0.84457	0.549000	0.68633	TCG	-	NULL		0.478	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	protein_coding	OTTHUMT00000450329.1	G	NM_032139		37814173	-1	no_errors	NM_032139	genbank	human	validated	54_36p	missense	SNP	0.96	A
ZNF813	126017	genome.wustl.edu	37	19	53994554	53994554	+	Silent	SNP	G	G	A			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr19:53994554G>A	ENST00000396403.4	+	4	1196	c.1068G>A	c.(1066-1068)aaG>aaA	p.K356K	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	356					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		AACCTTTCAAGTGTAATGAGT	0.418																																																0			19											153.0	155.0	154.0					19																	53994554		2203	4299	6502	58686366	SO:0001819	synonymous_variant	126017			AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.1068G>A	19.37:g.53994554G>A		Somatic		Capture	Illumina GAIIx	4	58686366		Silent	SNP	-	p.K356	ENST00000396403.4	37	c.1068	CCDS46172.1	19																																																																																			-	NULL		0.418	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF813	protein_coding	OTTHUMT00000350638.1	G	NM_001004301		58686366	1	no_errors	NM_001004301	genbank	human	validated	54_36p	silent	SNP	0.06	A
PSMC1P10	388925	genome.wustl.edu	37	2	17566899	17566899	+	IGR	SNP	G	G	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr2:17566899G>T								RN7SKP168 (262492 upstream) : RAD51AP2 (124951 downstream)																							AGACCCCCCAGGAGACCTATG	0.512																																																0			2																																								17430380	SO:0001628	intergenic_variant	388925																															2.37:g.17566899G>T		Somatic		Capture	Illumina GAIIx	4	17430380		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.512					LOC388925			G			17430380	1	pseudogene	XR_016133	genbank	human	model	54_36p	rna	SNP	1	T
ASIC4	55515	genome.wustl.edu	37	2	220399975	220399975	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr2:220399975G>T	ENST00000347842.3	+	5	1496	c.1482G>T	c.(1480-1482)atG>atT	p.M494I	ASIC4_ENST00000358078.4_Missense_Mutation_p.M513I	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	494					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)	p.M513I(1)									AGATCTCCATGGTCAGGATCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	2											57.0	48.0	51.0					2																	220399975		2203	4300	6503	220108219	SO:0001583	missense	55515			AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1482G>T	2.37:g.220399975G>T	ENSP00000326627:p.Met494Ile	Somatic		Capture	Illumina GAIIx	4	220108219	Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	-	p.M513I	ENST00000347842.3	37	c.1539	CCDS2442.1	2	.	.	.	.	.	.	.	.	.	.	G	30	5.051350	0.93740	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	T;T	0.63255	-0.03;-0.03	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.73536	0.3599	M	0.72624	2.21	0.80722	D	1	D;P	0.54207	0.965;0.876	P;P	0.54706	0.721;0.759	T	0.75025	-0.3463	10	0.45353	T	0.12	-18.7084	18.1597	0.89704	0.0:0.0:1.0:0.0	.	494;513	Q96FT7;Q96FT7-4	ACCN4_HUMAN;.	I	494;513	ENSP00000326627:M494I;ENSP00000350786:M513I	ENSP00000326627:M494I	M	+	3	0	ACCN4	220108219	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.647000	0.83462	2.602000	0.87976	0.650000	0.86243	ATG	-	NULL		0.617	ASIC4-001	KNOWN	basic|CCDS	protein_coding	ACCN4	protein_coding	OTTHUMT00000130263.1	G	NM_018674		220108219	1	no_errors	NM_018674	genbank	human	reviewed	54_36p	missense	SNP	1	T
THADA	63892	genome.wustl.edu	37	2	43520303	43520303	+	Silent	SNP	T	T	A			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr2:43520303T>A	ENST00000405006.4	-	32	4839	c.4488A>T	c.(4486-4488)ggA>ggT	p.G1496G	THADA_ENST00000415080.2_Silent_p.G1177G|THADA_ENST00000330266.7_Intron|THADA_ENST00000405975.2_Silent_p.G1496G	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1496								p.G1496G(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TCAGCTCTGATCCTGAGATAA	0.502																																																1	Substitution - coding silent(1)	ovary(1)	2											57.0	60.0	59.0					2																	43520303		1906	4121	6027	43373807	SO:0001819	synonymous_variant	63892			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.4488A>T	2.37:g.43520303T>A		Somatic		Capture	Illumina GAIIx	4	43373807	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Silent	SNP	-	p.G1496	ENST00000405006.4	37	c.4488	CCDS46268.1	2	.	.	.	.	.	.	.	.	.	.	T	8.833	0.940272	0.18281	.	.	ENSG00000115970	ENST00000407351	.	.	.	5.46	1.55	0.23275	.	.	.	.	.	T	0.42494	0.1205	.	.	.	0.58432	D	0.99999	.	.	.	.	.	.	T	0.34179	-0.9839	4	.	.	.	-6.6876	1.2298	0.01941	0.2642:0.0912:0.1601:0.4845	.	.	.	.	V	736	.	.	D	-	2	0	THADA	43373807	0.183000	0.23186	0.771000	0.31576	0.835000	0.47333	0.247000	0.18179	0.976000	0.38417	0.529000	0.55759	GAT	-	NULL		0.502	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THADA	protein_coding	OTTHUMT00000326070.3	T	NM_022065		43373807	-1	no_errors	NM_001083953	genbank	human	validated	54_36p	silent	SNP	0.19	A
AGAP1	116987	genome.wustl.edu	37	2	236817467	236817467	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr2:236817467C>T	ENST00000304032.8	+	11	1821	c.1241C>T	c.(1240-1242)aCg>aTg	p.T414M	AGAP1_ENST00000428334.2_Missense_Mutation_p.T253M|AGAP1_ENST00000409538.1_Missense_Mutation_p.T679M|AGAP1_ENST00000336665.5_Missense_Mutation_p.T414M	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	414	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)	p.T414M(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CCCCGAGCCACGTCAGCCTGC	0.483																																																1	Substitution - Missense(1)	ovary(1)	2											90.0	80.0	83.0					2																	236817467		2203	4300	6503	236482206	SO:0001583	missense	116987			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.1241C>T	2.37:g.236817467C>T	ENSP00000307634:p.Thr414Met	Somatic		Capture	Illumina GAIIx	4	236482206	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	-	p.T414M	ENST00000304032.8	37	c.1241	CCDS33408.1	2	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704194	0.48412	.	.	ENSG00000157985	ENST00000304032;ENST00000336665;ENST00000409538;ENST00000428334	T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31	4.66	4.66	0.58398	Pleckstrin homology domain (3);	0.159471	0.42682	D	0.000668	D	0.87152	0.6106	L	0.50333	1.59	0.41965	D	0.990721	P;D	0.89917	0.769;1.0	B;D	0.91635	0.233;0.999	D	0.87013	0.2124	10	0.45353	T	0.12	.	18.4385	0.90654	0.0:1.0:0.0:0.0	.	414;414	Q9UPQ3-2;Q9UPQ3	.;AGAP1_HUMAN	M	414;414;679;253	ENSP00000307634:T414M;ENSP00000338378:T414M;ENSP00000386897:T679M;ENSP00000411824:T253M	ENSP00000307634:T414M	T	+	2	0	AGAP1	236482206	1.000000	0.71417	0.992000	0.48379	0.835000	0.47333	4.507000	0.60434	2.527000	0.85204	0.655000	0.94253	ACG	-	NULL		0.483	AGAP1-001	KNOWN	basic|CCDS	protein_coding	AGAP1	protein_coding	OTTHUMT00000257076.2	C	NM_014914		236482206	1	no_errors	NM_001037131	genbank	human	validated	54_36p	missense	SNP	1	T
SGSM1	129049	genome.wustl.edu	37	22	25240895	25240895	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr22:25240895G>A	ENST00000400359.4	+	3	102	c.95G>A	c.(94-96)cGc>cAc	p.R32H	SGSM1_ENST00000400358.4_Missense_Mutation_p.R32H	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	32						Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)	p.R32H(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						GCTGTGACACGCAAGTTTGTC	0.567																																																1	Substitution - Missense(1)	ovary(1)	22											95.0	103.0	100.0					22																	25240895		2190	4299	6489	23570895	SO:0001583	missense	129049			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.95G>A	22.37:g.25240895G>A	ENSP00000383212:p.Arg32His	Somatic		Capture	Illumina GAIIx	4	23570895	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	-	p.R32H	ENST00000400359.4	37	c.95	CCDS46674.1	22	.	.	.	.	.	.	.	.	.	.	G	34	5.337568	0.95758	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.11930	2.73;2.73	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.35307	0.0927	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.87578	0.998;0.996;0.998;0.991;0.987	T	0.02457	-1.1156	10	0.87932	D	0	-0.5464	18.4285	0.90617	0.0:0.0:1.0:0.0	.	32;7;7;32;7	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1;B9A6J4	.;.;.;SGSM1_HUMAN;.	H	7;32;32	ENSP00000383211:R32H;ENSP00000383212:R32H	ENSP00000383211:R32H	R	+	2	0	SGSM1	23570895	1.000000	0.71417	0.989000	0.46669	0.971000	0.66376	9.476000	0.97823	2.677000	0.91161	0.655000	0.94253	CGC	-	NULL		0.567	SGSM1-004	KNOWN	basic|CCDS	protein_coding	SGSM1	protein_coding	OTTHUMT00000320282.1	G	XM_059318		23570895	1	no_errors	NM_001039948	genbank	human	validated	54_36p	missense	SNP	0.97	A
MCM5	4174	genome.wustl.edu	37	22	35813848	35813848	+	Splice_Site	SNP	G	G	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr22:35813848G>T	ENST00000216122.4	+	13	1856	c.1702G>T	c.(1702-1704)Gtg>Ttg	p.V568L	MCM5_ENST00000382011.5_Splice_Site_p.V525L	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	568					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.V568L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						CTACTGCCGAGTGTGAGTCCT	0.597																																																1	Substitution - Missense(1)	ovary(1)	22											117.0	77.0	91.0					22																	35813848		2203	4300	6503	34143848	SO:0001630	splice_region_variant	4174				CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.1703+1G>T	22.37:g.35813848G>T		Somatic		Capture	Illumina GAIIx	4	34143848	O60785|Q14578|Q9BTJ4|Q9BWL8	Missense_Mutation	SNP	-	p.V568L	ENST00000216122.4	37	c.1702	CCDS13915.1	22	.	.	.	.	.	.	.	.	.	.	G	9.750	1.167103	0.21621	.	.	ENSG00000100297	ENST00000216122;ENST00000382011	T;T	0.10960	2.82;2.82	4.72	0.146	0.14833	.	0.474414	0.24150	N	0.041081	T	0.04137	0.0115	N	0.16066	0.365	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.33240	-0.9876	10	0.25751	T	0.34	-12.1046	0.6273	0.00788	0.3328:0.167:0.3293:0.171	.	568;568;525;568	B1AHB0;Q53FG5;B1AHB1;P33992	.;.;.;MCM5_HUMAN	L	568;525	ENSP00000216122:V568L;ENSP00000371441:V525L	ENSP00000216122:V568L	V	+	1	0	MCM5	34143848	0.011000	0.17503	0.973000	0.42090	0.963000	0.63663	0.108000	0.15396	0.604000	0.29930	-0.291000	0.09656	GTG	-	NULL		0.597	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM5	protein_coding	OTTHUMT00000320661.3	G		Missense_Mutation	34143848	1	no_errors	NM_006739	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
TTC38	55020	genome.wustl.edu	37	22	46677513	46677513	+	Silent	SNP	G	G	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr22:46677513G>T	ENST00000381031.3	+	7	709	c.633G>T	c.(631-633)ccG>ccT	p.P211P	TTC38_ENST00000445282.2_Silent_p.P153P	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	211						extracellular vesicular exosome (GO:0070062)		p.P211P(1)		endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						CTATTAACCCGACAGACGCAT	0.557																																																1	Substitution - coding silent(1)	ovary(1)	22											113.0	113.0	113.0					22																	46677513		2005	4183	6188	45056177	SO:0001819	synonymous_variant	55020				CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.633G>T	22.37:g.46677513G>T		Somatic		Capture	Illumina GAIIx	4	45056177	Q8WV27|Q9NWP8	Silent	SNP	-	p.P211	ENST00000381031.3	37	c.633	CCDS43030.1	22																																																																																			-	NULL		0.557	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TTC38	protein_coding	OTTHUMT00000318469.1	G	NM_017931		45056177	1	no_errors	NM_017931	genbank	human	validated	54_36p	silent	SNP	0.21	T
OXSM	54995	genome.wustl.edu	37	3	25833483	25833483	+	Silent	SNP	C	C	G			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr3:25833483C>G	ENST00000280701.3	+	2	1071	c.972C>G	c.(970-972)gcC>gcG	p.A324A	OXSM_ENST00000420173.2_Silent_p.A241A|NGLY1_ENST00000417874.2_5'Flank	NM_017897.2	NP_060367.1	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial	324					acyl-CoA metabolic process (GO:0006637)|medium-chain fatty acid biosynthetic process (GO:0051792)|short-chain fatty acid biosynthetic process (GO:0051790)	mitochondrion (GO:0005739)	3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)	p.A324A(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						GAGAAGGTGCCTTAAGGTAAA	0.438																																																1	Substitution - coding silent(1)	ovary(1)	3											70.0	74.0	73.0					3																	25833483		2203	4300	6503	25808487	SO:0001819	synonymous_variant	54995			BC008202	CCDS2643.1, CCDS46780.1	3p24.2	2010-03-19			ENSG00000151093	ENSG00000151093	2.3.1.41		26063	protein-coding gene	gene with protein product	"""beta-ketoacyl synthase"""	610324				12477932	Standard	NM_017897		Approved	KS, FLJ20604, FASN2D	uc003cdn.3	Q9NWU1	OTTHUMG00000130477	ENST00000280701.3:c.972C>G	3.37:g.25833483C>G		Somatic		Capture	Illumina GAIIx	4	25808487		Silent	SNP	HMMPfam_ketoacyl-synt;HMMPfam_Ketoacyl-synt_C;superfamily_Thiolase-like	p.A324	ENST00000280701.3	37	c.972	CCDS2643.1	3																																																																																			-	HMMPfam_Ketoacyl-synt_C		0.438	OXSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXSM	protein_coding	OTTHUMT00000252876.2	C	NM_017897		25808487	1	no_errors	NM_017897	genbank	human	reviewed	54_36p	silent	SNP	0.76	G
NEK10	152110	genome.wustl.edu	37	3	27332149	27332149	+	Missense_Mutation	SNP	C	C	T	rs370504122		TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr3:27332149C>T	ENST00000429845.2	-	20	2064	c.1702G>A	c.(1702-1704)Gta>Ata	p.V568I	NEK10_ENST00000357467.2_Intron|NEK10_ENST00000341435.5_Missense_Mutation_p.V568I			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	568	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V568I(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						ATATTCCTTACGCTGCTGTCT	0.323													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20471	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3						C	ILE/VAL	2,3132		0,2,1565	113.0	99.0	103.0		1702	4.6	1.0	3		103	0,7164		0,0,3582	no	missense	NEK10	NM_199347.2	29	0,2,5147	TT,TC,CC		0.0,0.0638,0.0194	benign	568/713	27332149	2,10296	1567	3582	5149	27307153	SO:0001583	missense	152110			AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.1702G>A	3.37:g.27332149C>T	ENSP00000395849:p.Val568Ile	Somatic		Capture	Illumina GAIIx	4	27307153	A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like);superfamily_ARM repeat	p.V568I	ENST00000429845.2	37	c.1702		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.90|12.90	2.076592|2.076592	0.36662|0.36662	6.38E-4|6.38E-4	0.0|0.0	ENSG00000163491|ENSG00000163491	ENST00000435584|ENST00000341435;ENST00000396636	.|T	.|0.39592	.|1.07	5.45|5.45	4.56|4.56	0.56223|0.56223	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.134086	.|0.48286	.|D	.|0.000198	T|T	0.26846|0.26846	0.0657|0.0657	N|N	0.16790|0.16790	0.44|0.44	0.80722|0.80722	D|D	1|1	.|B	.|0.17038	.|0.02	.|B	.|0.15052	.|0.012	T|T	0.04855|0.04855	-1.0922|-1.0922	5|10	.|0.32370	.|T	.|0.25	.|.	12.3274|12.3274	0.55020|0.55020	0.0:0.866:0.0:0.134|0.0:0.866:0.0:0.134	.|.	.|568	.|Q6ZWH5	.|NEK10_HUMAN	H|I	24|568	.|ENSP00000343847:V568I	.|ENSP00000343847:V568I	R|V	-|-	2|1	0|0	NEK10|NEK10	27307153|27307153	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.722000|0.722000	0.41435|0.41435	4.307000|4.307000	0.59123|0.59123	2.717000|2.717000	0.92951|0.92951	0.655000|0.655000	0.94253|0.94253	CGT|GTA	-	HMMPfam_Pkinase		0.323	NEK10-016	NOVEL	basic|appris_principal	protein_coding	NEK10	protein_coding	OTTHUMT00000438156.1	C	NM_152534		27307153	-1	no_errors	ENST00000341435	ensembl	human	known	54_36p	missense	SNP	1	T
DNAH1	25981	genome.wustl.edu	37	3	52388951	52388951	+	Silent	SNP	C	C	T	rs541334137		TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr3:52388951C>T	ENST00000420323.2	+	21	3834	c.3573C>T	c.(3571-3573)gaC>gaT	p.D1191D		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1191	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.D1191D(1)		cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGAGCCCGGACGAGGCCTCAC	0.547													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21309	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	3											100.0	106.0	104.0					3																	52388951		2102	4215	6317	52363991	SO:0001819	synonymous_variant	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.3573C>T	3.37:g.52388951C>T		Somatic		Capture	Illumina GAIIx	4	52363991	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	-	p.D1191	ENST00000420323.2	37	c.3573	CCDS46842.1	3																																																																																			-	NULL		0.547	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	protein_coding	OTTHUMT00000350816.1	C	NM_015512		52363991	1	no_errors	ENST00000273600	ensembl	human	known	54_36p	silent	SNP	0.8	T
IL17RB	55540	genome.wustl.edu	37	3	53883724	53883724	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr3:53883724G>A	ENST00000288167.3	+	3	137	c.128G>A	c.(127-129)gGa>gAa	p.G43E		NM_018725.3	NP_061195.2	Q9NRM6	I17RB_HUMAN	interleukin 17 receptor B	43					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|regulation of cell growth (GO:0001558)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)	p.G43E(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		CTAATCCCCGGAGACTTGAGG	0.498																																																1	Substitution - Missense(1)	ovary(1)	3											152.0	150.0	151.0					3																	53883724		2203	4300	6503	53858764	SO:0001583	missense	55540			AF212365	CCDS2874.1	3p21.1	2008-02-05		2003-07-09	ENSG00000056736	ENSG00000056736		"""Interleukins and interleukin receptors"""	18015	protein-coding gene	gene with protein product		605458	"""interleukin 17B receptor"""	IL17BR		10749887, 10815801	Standard	NM_018725		Approved	IL17RH1, EVI27, CRL4	uc003dha.3	Q9NRM6	OTTHUMG00000158280	ENST00000288167.3:c.128G>A	3.37:g.53883724G>A	ENSP00000288167:p.Gly43Glu	Somatic		Capture	Illumina GAIIx	4	53858764	Q9BPZ0|Q9NRL4|Q9NRM5	Missense_Mutation	SNP	HMMPfam_SEFIR	p.G43E	ENST00000288167.3	37	c.128	CCDS2874.1	3	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777119	0.49786	.	.	ENSG00000056736	ENST00000288167;ENST00000494338	T;T	0.22539	1.95;1.95	5.21	5.21	0.72293	.	0.000000	0.53938	D	0.000044	T	0.43787	0.1263	M	0.65975	2.015	0.40827	D	0.983553	D	0.89917	1.0	D	0.72075	0.976	T	0.34354	-0.9832	10	0.51188	T	0.08	-14.0106	14.2459	0.65988	0.0:0.0:1.0:0.0	.	43	Q9NRM6	I17RB_HUMAN	E	43	ENSP00000288167:G43E;ENSP00000418638:G43E	ENSP00000288167:G43E	G	+	2	0	IL17RB	53858764	1.000000	0.71417	0.996000	0.52242	0.279000	0.26890	4.447000	0.60020	2.419000	0.82065	0.561000	0.74099	GGA	-	NULL		0.498	IL17RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RB	protein_coding	OTTHUMT00000350563.1	G	NM_172234		53858764	1	no_errors	NM_018725	genbank	human	reviewed	54_36p	missense	SNP	1	A
HESX1	8820	genome.wustl.edu	37	3	57232945	57232945	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr3:57232945G>C	ENST00000295934.3	-	2	229	c.193C>G	c.(193-195)Cct>Gct	p.P65A	HESX1_ENST00000473921.1_Missense_Mutation_p.P65A	NM_003865.2	NP_003856.1	Q9UBX0	HESX1_HUMAN	HESX homeobox 1	65					brain development (GO:0007420)|forebrain morphogenesis (GO:0048853)|negative regulation of transcription, DNA-templated (GO:0045892)|nose development (GO:0043584)|otic vesicle formation (GO:0030916)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)	p.P65A(1)		large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0109)|Kidney(284;0.0126)		CCACTGGGAGGATTTGGGACA	0.398																																					Esophageal Squamous(84;267 1272 9034 48993 52677)											1	Substitution - Missense(1)	ovary(1)	3											161.0	181.0	174.0					3																	57232945		2203	4300	6503	57207985	SO:0001583	missense	8820			AF059734	CCDS2881.1	3p14.3	2014-06-16	2007-02-16		ENSG00000163666	ENSG00000163666		"""Homeoboxes / PRD class"""	4877	protein-coding gene	gene with protein product		601802	"""homeobox, ES cell expressed 1"""			9373136, 9620767, 7876132	Standard	NM_003865		Approved	RPX, ANF	uc003din.4	Q9UBX0	OTTHUMG00000158597	ENST00000295934.3:c.193C>G	3.37:g.57232945G>C	ENSP00000295934:p.Pro65Ala	Somatic		Capture	Illumina GAIIx	4	57207985	Q52LC5|Q99667	Missense_Mutation	SNP	-	p.P65A	ENST00000295934.3	37	c.193	CCDS2881.1	3	.	.	.	.	.	.	.	.	.	.	G	1.901	-0.453155	0.04540	.	.	ENSG00000163666	ENST00000295934;ENST00000473921;ENST00000495160	D;D;D	0.93659	-3.26;-3.11;-1.53	5.74	2.47	0.30058	.	0.465487	0.20400	N	0.093073	T	0.78304	0.4262	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.62201	-0.6904	10	0.08381	T	0.77	-4.9881	0.2538	0.00209	0.2782:0.1571:0.3036:0.2612	.	65	Q9UBX0	HESX1_HUMAN	A	65	ENSP00000295934:P65A;ENSP00000418918:P65A;ENSP00000419615:P65A	ENSP00000295934:P65A	P	-	1	0	HESX1	57207985	0.839000	0.29477	0.029000	0.17559	0.004000	0.04260	1.131000	0.31406	1.343000	0.45638	0.563000	0.77884	CCT	-	NULL		0.398	HESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HESX1	protein_coding	OTTHUMT00000351430.2	G			57207985	-1	no_errors	NM_003865	genbank	human	reviewed	54_36p	missense	SNP	0.01	C
WDR5B	54554	genome.wustl.edu	37	3	122133514	122133514	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr3:122133514C>G	ENST00000330689.4	-	1	1368	c.862G>C	c.(862-864)Gag>Cag	p.E288Q	RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000608465.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA	NM_019069.3	NP_061942.2	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	288								p.E288Q(1)		kidney(2)|large_intestine(4)|lung(2)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.0704)		TGCACAATCTCTTTAGTCTGA	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											153.0	143.0	146.0					3																	122133514		2203	4300	6503	123616204	SO:0001583	missense	54554			AK002149	CCDS3012.1	3q21.1	2013-01-09			ENSG00000196981	ENSG00000196981		"""WD repeat domain containing"""	17826	protein-coding gene	gene with protein product						10369878	Standard	NM_019069		Approved	FLJ11287	uc003efa.1	Q86VZ2	OTTHUMG00000159489	ENST00000330689.4:c.862G>C	3.37:g.122133514C>G	ENSP00000330381:p.Glu288Gln	Somatic		Capture	Illumina GAIIx	4	123616204	B2RCM9|Q9NUL4	Missense_Mutation	SNP	-	p.E288Q	ENST00000330689.4	37	c.862	CCDS3012.1	3	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259600	0.80246	.	.	ENSG00000196981	ENST00000330689	T	0.61742	0.08	4.77	4.77	0.60923	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.045885	0.85682	D	0.000000	T	0.49029	0.1533	L	0.37630	1.12	0.80722	D	1	P	0.40875	0.731	B	0.41619	0.361	T	0.37572	-0.9700	10	0.15952	T	0.53	.	15.7027	0.77555	0.0:1.0:0.0:0.0	.	288	Q86VZ2	WDR5B_HUMAN	Q	288	ENSP00000330381:E288Q	ENSP00000330381:E288Q	E	-	1	0	WDR5B	123616204	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.838000	0.75359	2.644000	0.89710	0.561000	0.74099	GAG	-	NULL		0.398	WDR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR5B	protein_coding	OTTHUMT00000355753.1	C	NM_019069		123616204	-1	no_errors	NM_019069	genbank	human	reviewed	54_36p	missense	SNP	1	G
PCDHB16	57717	genome.wustl.edu	37	5	140568232	140568232	+	IGR	SNP	C	C	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr5:140568232C>T	ENST00000361016.2	+	0	4814					NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCAATGACAACGCCCCCGCCT	0.587																																																0			5											132.0	131.0	131.0					5																	140568232		2203	4300	6503	140548416	SO:0001628	intergenic_variant	56127			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325		5.37:g.140568232C>T		Somatic		Capture	Illumina GAIIx	4	140548416	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	-	p.T447M	ENST00000361016.2	37	c.1340	CCDS4251.1	5																																																																																			-	NULL		0.587	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB9	protein_coding	OTTHUMT00000251800.1	C	NM_020957		140548416	1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_019119	genbank	human	reviewed	54_36p	missense	SNP	1	T
SH3RF2	153769	genome.wustl.edu	37	5	145442061	145442061	+	Missense_Mutation	SNP	G	G	A	rs142456711	byFrequency	TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr5:145442061G>A	ENST00000511217.1	+	9	2039	c.1987G>A	c.(1987-1989)Gga>Aga	p.G663R	SH3RF2_ENST00000359120.4_Missense_Mutation_p.G663R|SH3RF2_ENST00000511705.1_3'UTR			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	663					negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)	p.G663R(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCCACCTCCGGAAAGCCTGA	0.557																																																1	Substitution - Missense(1)	ovary(1)	5						G	ARG/GLY	2,4404	4.2+/-10.8	0,2,2201	100.0	94.0	96.0		1987	3.7	0.6	5	dbSNP_134	96	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SH3RF2	NM_152550.3	125	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	possibly-damaging	663/730	145442061	3,13003	2203	4300	6503	145422254	SO:0001583	missense	153769			AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1987G>A	5.37:g.145442061G>A	ENSP00000424497:p.Gly663Arg	Somatic		Capture	Illumina GAIIx	4	145422254	A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Missense_Mutation	SNP	-	p.G663R	ENST00000511217.1	37	c.1987	CCDS4280.1	5	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643367	0.47153	4.54E-4	1.16E-4	ENSG00000156463	ENST00000359120;ENST00000511217;ENST00000513503	T;T	0.22945	1.93;1.93	5.5	3.7	0.42460	.	0.475516	0.20472	N	0.091668	T	0.34077	0.0885	L	0.54323	1.7	0.22675	N	0.998864	D;D	0.63880	0.993;0.987	P;P	0.54856	0.762;0.636	T	0.08126	-1.0737	10	0.32370	T	0.25	-7.3513	9.6099	0.39657	0.1632:0.0:0.8368:0.0	.	154;663	Q8TEC5-2;Q8TEC5	.;SH3R2_HUMAN	R	663;663;62	ENSP00000352028:G663R;ENSP00000424497:G663R	ENSP00000352028:G663R	G	+	1	0	SH3RF2	145422254	0.977000	0.34250	0.645000	0.29479	0.315000	0.28087	2.117000	0.41939	1.314000	0.45095	0.313000	0.20887	GGA	-	NULL		0.557	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SH3RF2	protein_coding	OTTHUMT00000372804.1	G	NM_152550		145422254	1	no_errors	NM_152550	genbank	human	validated	54_36p	missense	SNP	0.64	A
MAP1B	4131	genome.wustl.edu	37	5	71490040	71490040	+	Silent	SNP	C	C	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr5:71490040C>T	ENST00000296755.7	+	5	1156	c.858C>T	c.(856-858)ggC>ggT	p.G286G		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	286					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.G286G(3)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TCATCAATGGCGGATCAGAGA	0.488																																					Melanoma(17;367 822 11631 31730 47712)											3	Substitution - coding silent(3)	large_intestine(2)|ovary(1)	5											81.0	86.0	84.0					5																	71490040		2203	4300	6503	71525796	SO:0001819	synonymous_variant	4131			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.858C>T	5.37:g.71490040C>T		Somatic		Capture	Illumina GAIIx	4	71525796	A2BDK5	Silent	SNP	HMMPfam_MAP1B_neuraxin;superfamily_Metallo-hydrolase/oxidoreductase	p.G286	ENST00000296755.7	37	c.858	CCDS4012.1	5																																																																																			-	NULL		0.488	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	protein_coding	OTTHUMT00000218561.6	C	NM_005909		71525796	1	no_errors	NM_005909	genbank	human	validated	54_36p	silent	SNP	0.97	T
KIF4B	285643	genome.wustl.edu	37	5	154395170	154395170	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr5:154395170C>A	ENST00000435029.4	+	1	1911	c.1751C>A	c.(1750-1752)aCa>aAa	p.T584K		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	584					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GAACTTCAGACAGCAAAGAAG	0.413																																																0			5											84.0	85.0	85.0					5																	154395170		2203	4300	6503	154375363	SO:0001583	missense	285643			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1751C>A	5.37:g.154395170C>A	ENSP00000387875:p.Thr584Lys	Somatic		Capture	Illumina GAIIx	4	154375363		Missense_Mutation	SNP	-	p.T584K	ENST00000435029.4	37	c.1751	CCDS47324.1	5	.	.	.	.	.	.	.	.	.	.	c	8.332	0.826788	0.16749	.	.	ENSG00000226650	ENST00000435029	T	0.67698	-0.28	1.48	1.48	0.22813	.	.	.	.	.	T	0.56863	0.2014	L	0.54323	1.7	0.30875	N	0.732084	B	0.24618	0.107	B	0.20184	0.028	T	0.55711	-0.8098	9	0.28530	T	0.3	.	8.8832	0.35387	0.0:1.0:0.0:0.0	.	584	Q2VIQ3	KIF4B_HUMAN	K	584	ENSP00000387875:T584K	ENSP00000387875:T584K	T	+	2	0	KIF4B	154375363	0.996000	0.38824	0.936000	0.37596	0.587000	0.36485	1.481000	0.35476	1.138000	0.42230	0.563000	0.77884	ACA	-	NULL		0.413	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	protein_coding	OTTHUMT00000377478.1	C			154375363	1	no_errors	NM_001099293	genbank	human	provisional	54_36p	missense	SNP	1	A
FKBP5	2289	genome.wustl.edu	37	6	35604930	35604930	+	Silent	SNP	G	G	C			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr6:35604930G>C	ENST00000539068.1	-	3	313	c.111C>G	c.(109-111)gtC>gtG	p.V37V	FKBP5_ENST00000357266.4_Silent_p.V37V|FKBP5_ENST00000536438.1_Silent_p.V37V|FKBP5_ENST00000542713.1_Silent_p.V37V|FKBP5_ENST00000540787.1_Intron	NM_001145776.1	NP_001139248.1	Q13451	FKBP5_HUMAN	FK506 binding protein 5	37					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.V37V(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|urinary_tract(2)	17						CCACTCTTTTGACAATCTAGA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	6											78.0	74.0	75.0					6																	35604930		2203	4300	6503	35712908	SO:0001819	synonymous_variant	2289			U42031	CCDS4808.1, CCDS54996.1	6p21.31	2013-01-10	2001-11-28		ENSG00000096060	ENSG00000096060		"""Tetratricopeptide (TTC) repeat domain containing"""	3721	protein-coding gene	gene with protein product		602623	"""FK506-binding protein 5"""			9001212	Standard	NM_004117		Approved	FKBP51, FKBP54, PPIase, P54, Ptg-10	uc003okx.2	Q13451	OTTHUMG00000014576	ENST00000539068.1:c.111C>G	6.37:g.35604930G>C		Somatic		Capture	Illumina GAIIx	4	35712908	F5H7R1|Q59EB8|Q5TGM6	Silent	SNP	HMMPfam_FKBP_C;HMMPfam_TPR_1;superfamily_TPR-like;superfamily_FKBP-like	p.V37	ENST00000539068.1	37	c.111	CCDS4808.1	6																																																																																			-	NULL		0.378	FKBP5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP5	protein_coding	OTTHUMT00000040309.2	G			35712908	-1	no_errors	NM_004117	genbank	human	validated	54_36p	silent	SNP	1	C
GNB2	2783	genome.wustl.edu	37	7	100275155	100275155	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr7:100275155T>C	ENST00000303210.4	+	6	784	c.302T>C	c.(301-303)aTg>aCg	p.M101T	GNB2_ENST00000436220.1_Missense_Mutation_p.M57T|GNB2_ENST00000393924.1_Missense_Mutation_p.M101T|GNB2_ENST00000427895.1_Start_Codon_SNP_p.M1T|GNB2_ENST00000424361.1_Missense_Mutation_p.M57T|GNB2_ENST00000419828.1_Start_Codon_SNP_p.M1T|GNB2_ENST00000393926.1_Missense_Mutation_p.M101T	NM_005273.3	NP_005264.2	P62879	GBB2_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2	101					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)	p.M101T(1)		endometrium(1)|lung(3)|ovary(2)|prostate(1)	7	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)				TCCTGGGTAATGACCTGTGCC	0.677																																																1	Substitution - Missense(1)	ovary(1)	7											51.0	54.0	53.0					7																	100275155		2202	4300	6502	100113091	SO:0001583	missense	2783			M16514	CCDS5703.1	7q21.3-q22.1	2013-01-10			ENSG00000172354	ENSG00000172354		"""WD repeat domain containing"""	4398	protein-coding gene	gene with protein product	"""G protein, beta-2 subunit"", ""guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 2"", ""signal-transducing guanine nucleotide-binding regulatory protein beta subunit"", ""transducin beta chain 2"""	139390				9799793	Standard	NM_005273		Approved		uc003uwb.3	P62879	OTTHUMG00000137419	ENST00000303210.4:c.302T>C	7.37:g.100275155T>C	ENSP00000305260:p.Met101Thr	Somatic		Capture	Illumina GAIIx	4	100113091	B3KPU1|P11016|P54312	Missense_Mutation	SNP	HMMPfam_WD40;superfamily_WD40 repeat-like	p.M101T	ENST00000303210.4	37	c.302	CCDS5703.1	7	.	.	.	.	.	.	.	.	.	.	.	20.9	4.071839	0.76301	.	.	ENSG00000172354	ENST00000303210;ENST00000451587;ENST00000436220;ENST00000424361;ENST00000419828;ENST00000427895;ENST00000393926;ENST00000431068;ENST00000412215;ENST00000393924	T;T;T;T;T;T;T;T;T;T	0.60548	0.49;0.49;0.49;0.49;0.18;0.18;0.49;0.49;0.49;0.49	5.17	3.94	0.45596	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);G-protein, beta subunit (1);	0.046925	0.85682	D	0.000000	T	0.70885	0.3275	M	0.72353	2.195	0.58432	D	0.999997	P	0.45011	0.848	D	0.63283	0.913	T	0.73642	-0.3918	10	0.87932	D	0	-1.6969	9.8732	0.41187	0.0:0.0:0.1718:0.8282	.	101	P62879	GBB2_HUMAN	T	101;101;57;57;1;1;101;101;101;101	ENSP00000305260:M101T;ENSP00000399904:M101T;ENSP00000401873:M57T;ENSP00000389391:M57T;ENSP00000390543:M1T;ENSP00000400286:M1T;ENSP00000377503:M101T;ENSP00000390077:M101T;ENSP00000413219:M101T;ENSP00000377501:M101T	ENSP00000305260:M101T	M	+	2	0	GNB2	100113091	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.094000	0.64523	1.958000	0.56883	0.379000	0.24179	ATG	-	HMMPfam_WD40		0.677	GNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNB2	protein_coding	OTTHUMT00000268391.2	T	NM_005273		100113091	1	no_errors	NM_005273	genbank	human	reviewed	54_36p	missense	SNP	1	C
NUP205	23165	genome.wustl.edu	37	7	135269658	135269658	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr7:135269658A>T	ENST00000285968.6	+	8	1147	c.1121A>T	c.(1120-1122)gAa>gTa	p.E374V	NUP205_ENST00000440390.2_Missense_Mutation_p.E168V	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	374					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.E374V(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TTCCTCATGGAATCTGTAGTG	0.393																																																1	Substitution - Missense(1)	ovary(1)	7											79.0	71.0	74.0					7																	135269658		2203	4300	6503	134920198	SO:0001583	missense	23165			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.1121A>T	7.37:g.135269658A>T	ENSP00000285968:p.Glu374Val	Somatic		Capture	Illumina GAIIx	4	134920198	A6H8X3|Q86YC1	Missense_Mutation	SNP	superfamily_Dihydropteroate synthetase-like	p.E374V	ENST00000285968.6	37	c.1121	CCDS34759.1	7	.	.	.	.	.	.	.	.	.	.	A	24.5	4.539527	0.85917	.	.	ENSG00000155561	ENST00000285968;ENST00000440390	T;T	0.30714	1.52;1.52	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.47395	0.1443	L	0.56769	1.78	0.80722	D	1	P	0.52692	0.955	P	0.57204	0.815	T	0.43228	-0.9404	10	0.52906	T	0.07	-16.3533	15.6385	0.76977	1.0:0.0:0.0:0.0	.	374	Q92621	NU205_HUMAN	V	374;168	ENSP00000285968:E374V;ENSP00000401983:E168V	ENSP00000285968:E374V	E	+	2	0	NUP205	134920198	1.000000	0.71417	0.676000	0.29932	0.890000	0.51754	9.339000	0.96797	2.089000	0.63090	0.482000	0.46254	GAA	-	NULL		0.393	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP205	protein_coding	OTTHUMT00000340358.1	A			134920198	1	no_errors	NM_015135	genbank	human	validated	54_36p	missense	SNP	1	T
CCDC129	223075	genome.wustl.edu	37	7	31617736	31617736	+	Silent	SNP	C	C	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr7:31617736C>T	ENST00000407970.3	+	8	896	c.858C>T	c.(856-858)ccC>ccT	p.P286P	CCDC129_ENST00000451887.2_Silent_p.P312P|CCDC129_ENST00000409210.1_Silent_p.P194P|CCDC129_ENST00000319386.3_Intron	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	286										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						TTTTTGTTCCCTTTACAAAAC	0.443																																																0			7											56.0	58.0	57.0					7																	31617736		2200	4300	6500	31584261	SO:0001819	synonymous_variant	223075			AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.858C>T	7.37:g.31617736C>T		Somatic		Capture	Illumina GAIIx	4	31584261	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Silent	SNP	-	p.P286	ENST00000407970.3	37	c.858	CCDS5435.2	7																																																																																			-	NULL		0.443	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC129	protein_coding	OTTHUMT00000318975.1	C	NM_194300		31584261	1	no_errors	NM_194300	genbank	human	validated	54_36p	silent	SNP		T
EPHA1	2041	genome.wustl.edu	37	7	143088789	143088789	+	Missense_Mutation	SNP	G	G	C	rs138715519		TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr7:143088789G>C	ENST00000275815.3	-	17	2862	c.2776C>G	c.(2776-2778)Cgc>Ggc	p.R926G	EPHA1_ENST00000458129.1_5'Flank	NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	926	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)	p.R926G(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				CGTTTCATGCGTATGGACTCG	0.587																																																1	Substitution - Missense(1)	ovary(1)	7											83.0	61.0	69.0					7																	143088789		2203	4300	6503	142798911	SO:0001583	missense	2041			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.2776C>G	7.37:g.143088789G>C	ENSP00000275815:p.Arg926Gly	Somatic		Capture	Illumina GAIIx	4	142798911	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	Ephrin_lbd;HMMPfam_Ephrin_lbd;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;SAM_1;HMMPfam_SAM_1;fn3;HMMPfam_fn3	p.R926G	ENST00000275815.3	37	c.2776	CCDS5884.1	7	.	.	.	.	.	.	.	.	.	.	G	15.48	2.847102	0.51164	.	.	ENSG00000146904	ENST00000275815	T	0.36520	1.25	4.67	4.67	0.58626	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.56097	D	0.000026	T	0.31979	0.0814	N	0.02916	-0.46	0.43740	D	0.996232	D	0.63046	0.992	P	0.62298	0.9	T	0.47509	-0.9112	10	0.87932	D	0	.	13.1547	0.59509	0.0:0.0:0.8405:0.1595	.	926	P21709	EPHA1_HUMAN	G	926	ENSP00000275815:R926G	ENSP00000275815:R926G	R	-	1	0	EPHA1	142798911	0.999000	0.42202	0.884000	0.34674	0.438000	0.31896	4.023000	0.57211	2.583000	0.87209	0.561000	0.74099	CGC	-	HMMPfam_SAM_1		0.587	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA1	protein_coding	OTTHUMT00000342154.1	G			142798911	-1	no_errors	NM_005232	genbank	human	reviewed	54_36p	missense	SNP	0.94	C
PLIN2	123	genome.wustl.edu	37	9	19116373	19116373	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chr9:19116373G>T	ENST00000276914.2	-	8	1366	c.1187C>A	c.(1186-1188)aCg>aAg	p.T396K	PLIN2_ENST00000411567.1_Missense_Mutation_p.T315K	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	396					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T396K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						GTTGAGGGGCGTGTTGTTAAC	0.488																																																1	Substitution - Missense(1)	ovary(1)	9											96.0	89.0	92.0					9																	19116373		2203	4300	6503	19106373	SO:0001583	missense	123			X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.1187C>A	9.37:g.19116373G>T	ENSP00000276914:p.Thr396Lys	Somatic		Capture	Illumina GAIIx	4	19106373	Q9BSC3	Missense_Mutation	SNP	HMMPfam_Perilipin;superfamily_Mannose-6-phosphate receptor binding protein 1 (Tip47) C-terminal domain	p.T396K	ENST00000276914.2	37	c.1187	CCDS6490.1	9	.	.	.	.	.	.	.	.	.	.	G	26.1	4.702553	0.88924	.	.	ENSG00000147872	ENST00000411567;ENST00000276914	T;T	0.07114	3.22;3.22	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.38374	0.1038	M	0.88241	2.94	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.33420	-0.9869	10	0.62326	D	0.03	.	19.769	0.96353	0.0:0.0:1.0:0.0	.	396	Q99541	PLIN2_HUMAN	K	315;396	ENSP00000415270:T315K;ENSP00000276914:T396K	ENSP00000276914:T396K	T	-	2	0	PLIN2	19106373	1.000000	0.71417	0.994000	0.49952	0.987000	0.75469	8.030000	0.88816	2.671000	0.90904	0.650000	0.86243	ACG	-	HMMPfam_Perilipin		0.488	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ADFP	protein_coding	OTTHUMT00000051835.1	G	NM_001122		19106373	-1	no_errors	NM_001122	genbank	human	reviewed	54_36p	missense	SNP	1	T
ATP11C	286410	genome.wustl.edu	37	X	138850580	138850580	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0912-01A-01W-0421-09	TCGA-13-0912-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	517f4d7f-c962-414f-8824-f2a7ae19cb6d	7b625804-4443-44a9-a106-b7b910587a34	g.chrX:138850580G>A	ENST00000327569.3	-	20	2337	c.2239C>T	c.(2239-2241)Cat>Tat	p.H747Y	ATP11C_ENST00000361648.2_Missense_Mutation_p.H747Y|ATP11C_ENST00000370543.1_Missense_Mutation_p.H747Y|ATP11C_ENST00000359686.2_Missense_Mutation_p.H747Y|ATP11C_ENST00000370557.1_Missense_Mutation_p.H744Y|ATP11C_ENST00000460773.1_5'UTR	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	747					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.H747Y(1)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					TATTCCTGATGTTCTGTCCAT	0.333																																																1	Substitution - Missense(1)	ovary(1)	X											93.0	79.0	84.0					X																	138850580		2203	4300	6503	138678246	SO:0001583	missense	286410			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.2239C>T	X.37:g.138850580G>A	ENSP00000332756:p.His747Tyr	Somatic		Capture	Illumina GAIIx	4	138678246	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	HMMPfam_Hydrolase;superfamily_HAD-like;superfamily_Calcium ATPase transduction domain A;superfamily_Metal cation-transporting ATPase ATP-binding domain N;superfamily_Calcium ATPase transmembrane domain M	p.H747Y	ENST00000327569.3	37	c.2239	CCDS14668.1	X	.	.	.	.	.	.	.	.	.	.	G	0.965	-0.702104	0.03255	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	T;T;T;T;T	0.06849	3.25;3.29;3.28;3.28;3.29	5.31	5.31	0.75309	HAD-like domain (1);	0.824253	0.11242	N	0.584568	T	0.07324	0.0185	L	0.39467	1.215	0.30493	N	0.771163	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.30179	-0.9987	10	0.02654	T	1	.	10.8276	0.46643	0.0:0.0:0.6878:0.3122	.	747;747	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	Y	744;747;747;747;747	ENSP00000359588:H744Y;ENSP00000355165:H747Y;ENSP00000332756:H747Y;ENSP00000359574:H747Y;ENSP00000352715:H747Y	ENSP00000332756:H747Y	H	-	1	0	ATP11C	138678246	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.622000	0.54217	2.204000	0.70986	0.544000	0.68410	CAT	-	NULL		0.333	ATP11C-008	KNOWN	basic|CCDS	protein_coding	ATP11C	protein_coding	OTTHUMT00000354945.1	G	NM_173694		138678246	-1	no_errors	NM_173694	genbank	human	validated	54_36p	missense	SNP	1	A
