#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
FLG	2312	genome.wustl.edu	37	1	152281309	152281309	+	Missense_Mutation	SNP	C	C	T	rs369885488	byFrequency	TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr1:152281309C>T	ENST00000368799.1	-	3	6088	c.6053G>A	c.(6052-6054)aGa>aAa	p.R2018K	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2018	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R2018K(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCTGAGTGTCTGGAGCTGTC	0.552									Ichthyosis																																							1	Substitution - Missense(1)	ovary(1)	1											636.0	519.0	558.0					1																	152281309		2203	4300	6503	150547933	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6053G>A	1.37:g.152281309C>T	ENSP00000357789:p.Arg2018Lys	Somatic		Capture	Illumina GAIIx	4	150547933	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	-	p.R2018K	ENST00000368799.1	37	c.6053	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	c	7.634	0.679400	0.14907	.	.	ENSG00000143631	ENST00000368799	T	0.07216	3.21	3.73	0.594	0.17485	.	.	.	.	.	T	0.01870	0.0059	L	0.56769	1.78	0.09310	N	1	P	0.47841	0.901	B	0.40565	0.333	T	0.31110	-0.9955	9	0.05351	T	0.99	.	5.754	0.18162	0.0:0.5025:0.3848:0.1127	.	2018	P20930	FILA_HUMAN	K	2018	ENSP00000357789:R2018K	ENSP00000357789:R2018K	R	-	2	0	FLG	150547933	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.853000	0.27777	0.024000	0.15214	-0.225000	0.12378	AGA	-	NULL		0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	C	NM_002016		150547933	-1	no_errors	NM_002016	genbank	human	provisional	54_36p	missense	SNP		T
ARHGEF11	9826	genome.wustl.edu	37	1	156909388	156909388	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr1:156909388C>T	ENST00000361409.2	-	36	4670	c.3928G>A	c.(3928-3930)Gat>Aat	p.D1310N	ARHGEF11_ENST00000315174.8_Missense_Mutation_p.D726N|ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000368194.3_Missense_Mutation_p.D1350N	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1310					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D1350N(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTTGAAGCATCTTCAGCCAGA	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											81.0	86.0	84.0					1																	156909388		2203	4300	6503	155176012	SO:0001583	missense	9826			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3928G>A	1.37:g.156909388C>T	ENSP00000354644:p.Asp1310Asn	Somatic		Capture	Illumina GAIIx	4	155176012	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	-	p.D1350N	ENST00000361409.2	37	c.4048	CCDS1162.1	1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.053444	0.36181	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.66099	-0.18;-0.19;-0.09	4.55	2.6	0.31112	.	0.138717	0.32868	N	0.005546	T	0.21468	0.0517	N	0.08118	0	0.09310	N	1	B;B;B	0.18013	0.025;0.006;0.003	B;B;B	0.17433	0.018;0.008;0.009	T	0.22312	-1.0220	10	0.52906	T	0.07	-6.1357	11.9242	0.52810	0.0:0.6619:0.3381:0.0	.	726;1310;1350	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	N	1350;1310;726	ENSP00000357177:D1350N;ENSP00000354644:D1310N;ENSP00000313470:D726N	ENSP00000313470:D726N	D	-	1	0	ARHGEF11	155176012	0.859000	0.29813	0.094000	0.20943	0.781000	0.44180	1.504000	0.35726	0.472000	0.27344	0.561000	0.74099	GAT	-	NULL		0.502	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	protein_coding	OTTHUMT00000098931.1	C	NM_198236		155176012	-1	no_errors	NM_198236	genbank	human	reviewed	54_36p	missense	SNP	0.14	T
RGS18	64407	genome.wustl.edu	37	1	192128415	192128415	+	Missense_Mutation	SNP	G	G	A	rs201783745		TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr1:192128415G>A	ENST00000367460.3	+	2	366	c.185G>A	c.(184-186)cGc>cAc	p.R62H	RGS18_ENST00000481707.1_3'UTR	NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	62					G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.R62H(1)		kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GAAGACACCCGCTCCAGTAGA	0.353																																																1	Substitution - Missense(1)	ovary(1)	1											47.0	51.0	49.0					1																	192128415		2203	4300	6503	190395038	SO:0001583	missense	64407			AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.185G>A	1.37:g.192128415G>A	ENSP00000356430:p.Arg62His	Somatic		Capture	Illumina GAIIx	4	190395038	B2RD23	Missense_Mutation	SNP	-	p.R62H	ENST00000367460.3	37	c.185	CCDS1374.1	1	.	.	.	.	.	.	.	.	.	.	G	0.777	-0.763574	0.02996	.	.	ENSG00000150681	ENST00000367460	T	0.50548	0.74	5.88	-1.3	0.09259	.	0.643725	0.18259	N	0.146710	T	0.13030	0.0316	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15178	-1.0446	10	0.29301	T	0.29	.	1.9276	0.03320	0.4129:0.2511:0.0716:0.2644	.	62	Q9NS28	RGS18_HUMAN	H	62	ENSP00000356430:R62H	ENSP00000356430:R62H	R	+	2	0	RGS18	190395038	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.066000	0.11598	-0.430000	0.07318	-0.300000	0.09419	CGC	-	NULL		0.353	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS18	protein_coding	OTTHUMT00000086382.1	G	NM_130782		190395038	1	no_errors	NM_130782	genbank	human	reviewed	54_36p	missense	SNP		A
TESK2	10420	genome.wustl.edu	37	1	45887413	45887413	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr1:45887413G>A	ENST00000372086.3	-	3	728	c.328C>T	c.(328-330)Cat>Tat	p.H110Y	TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_Missense_Mutation_p.H110Y|TESK2_ENST00000538496.1_Missense_Mutation_p.H27Y|TESK2_ENST00000341771.6_Missense_Mutation_p.H110Y|TESK2_ENST00000451835.2_Missense_Mutation_p.H110Y	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	110	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.H110Y(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					ATGTTGGGATGGGAGAGTCTA	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											283.0	258.0	266.0					1																	45887413		1906	4126	6032	45660000	SO:0001583	missense	10420			AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.328C>T	1.37:g.45887413G>A	ENSP00000361158:p.His110Tyr	Somatic		Capture	Illumina GAIIx	4	45660000	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Missense_Mutation	SNP	-	p.H110Y	ENST00000372086.3	37	c.328	CCDS41323.1	1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.630887	0.87660	.	.	ENSG00000070759	ENST00000372084;ENST00000372086;ENST00000372083;ENST00000341771;ENST00000538496;ENST00000451835	T;T;T;T;T	0.78707	-1.2;-0.74;-1.2;-0.74;-1.2	5.32	5.32	0.75619	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	D	0.92149	0.7511	H	0.95917	3.74	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94313	0.7547	10	0.87932	D	0	-18.2408	18.1306	0.89600	0.0:0.0:1.0:0.0	.	110;110;110	B4DRH9;Q96S53-3;Q96S53	.;.;TESK2_HUMAN	Y	110;110;110;110;27;110	ENSP00000361156:H110Y;ENSP00000361158:H110Y;ENSP00000343940:H110Y;ENSP00000441746:H27Y;ENSP00000397244:H110Y	ENSP00000343940:H110Y	H	-	1	0	TESK2	45660000	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.315000	0.96313	2.652000	0.90054	0.561000	0.74099	CAT	-	NULL		0.428	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK2	protein_coding	OTTHUMT00000020523.1	G	NM_007170		45660000	-1	no_errors	NM_007170	genbank	human	reviewed	54_36p	missense	SNP	1	A
IKBKE	9641	genome.wustl.edu	37	1	206653229	206653229	+	Silent	SNP	C	C	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr1:206653229C>T	ENST00000367120.3	+	11	1573	c.1200C>T	c.(1198-1200)ccC>ccT	p.P400P	IKBKE_ENST00000537984.1_Silent_p.P315P	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	400	Interaction with DDX3X.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)	p.P400P(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					TGGACGTCCCCAAGTTCGTCC	0.592											OREG0014170	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	1											41.0	40.0	40.0					1																	206653229		2203	4300	6503	204719852	SO:0001819	synonymous_variant	9641			AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.1200C>T	1.37:g.206653229C>T		Somatic	2161	Capture	Illumina GAIIx	4	204719852	D3DT78|Q3B754|Q3KR43|Q5JTS6	Silent	SNP	Pkinase;HMMPfam_Pkinase	p.P400	ENST00000367120.3	37	c.1200	CCDS30996.1	1																																																																																			-	NULL		0.592	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKE	protein_coding	OTTHUMT00000088484.1	C			204719852	1	no_errors	NM_014002	genbank	human	validated	54_36p	silent	SNP	1	T
ADAM12	8038	genome.wustl.edu	37	10	128019058	128019058	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr10:128019058C>T	ENST00000368679.4	-	2	418	c.109G>A	c.(109-111)Gga>Aga	p.G37R	ADAM12_ENST00000368676.4_Missense_Mutation_p.G37R	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	37					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.G37R(1)		biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TCAGCTCTTCCTTGGTTCCAT	0.463																																																1	Substitution - Missense(1)	ovary(1)	10											127.0	128.0	127.0					10																	128019058		2203	4300	6503	128009048	SO:0001583	missense	8038			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.109G>A	10.37:g.128019058C>T	ENSP00000357668:p.Gly37Arg	Somatic		Capture	Illumina GAIIx	4	128009048	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	"HMMPfam_Disintegrin;superfamily_Blood coagulation inhibitor (disintegrin);Reprolysin;HMMPfam_Reprolysin;Disintegrin;Blood coagulation inhibitor (disintegrin);Pep_M12B_propep;HMMPfam_Pep_M12B_propep;ADAM_CR;HMMPfam_ADAM_CR;EGF_2;HMMPfam_EGF_2;Metalloproteases (""zincins"") catalytic domain;superfamily_Metalloproteases (""zincins"") catalytic domain"	p.G37R	ENST00000368679.4	37	c.109	CCDS7653.1	10	.	.	.	.	.	.	.	.	.	.	C	9.398	1.077196	0.20227	.	.	ENSG00000148848	ENST00000368679;ENST00000368676;ENST00000448723	T;T;T	0.22539	4.73;1.95;3.71	4.93	-3.74	0.04385	.	1.543120	0.04481	N	0.377811	T	0.09024	0.0223	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.0	B;B;B;B;B	0.10450	0.005;0.003;0.003;0.003;0.001	T	0.31613	-0.9937	10	0.13470	T	0.59	.	5.8931	0.18925	0.1406:0.2915:0.0:0.568	.	37;37;37;37;37	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	R	37	ENSP00000357668:G37R;ENSP00000357665:G37R;ENSP00000391268:G37R	ENSP00000357665:G37R	G	-	1	0	ADAM12	128009048	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.588000	0.05774	-0.465000	0.06953	-0.136000	0.14681	GGA	-	HMMPfam_Pep_M12B_propep		0.463	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	protein_coding	OTTHUMT00000050961.1	C			128009048	-1	no_errors	NM_003474	genbank	human	reviewed	54_36p	missense	SNP		T
DCLRE1C	64421	genome.wustl.edu	37	10	14976407	14976407	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr10:14976407G>T	ENST00000378278.2	-	8	687	c.650C>A	c.(649-651)aCc>aAc	p.T217N	DCLRE1C_ENST00000378249.1_Missense_Mutation_p.T102N|DCLRE1C_ENST00000357717.2_Missense_Mutation_p.T102N|DCLRE1C_ENST00000396817.2_Missense_Mutation_p.T97N|DCLRE1C_ENST00000378255.1_Missense_Mutation_p.T97N|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.T97N|DCLRE1C_ENST00000378289.4_Missense_Mutation_p.T217N|DCLRE1C_ENST00000378254.1_Missense_Mutation_p.T97N|DCLRE1C_ENST00000378246.2_Missense_Mutation_p.T102N|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.T97N			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	217					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.T102N(1)|p.T217N(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						ACTAAGGTTGGTGAACAGATA	0.423								Non-homologous end-joining																																								2	Substitution - Missense(2)	ovary(2)	10											118.0	136.0	130.0					10																	14976407		2203	4300	6503	15016413	SO:0001583	missense	64421			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.650C>A	10.37:g.14976407G>T	ENSP00000367527:p.Thr217Asn	Somatic		Capture	Illumina GAIIx	4	15016413	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	HMMPfam_DRMBL;superfamily_Metallo-hydrolase/oxidoreductase	p.T217N	ENST00000378278.2	37	c.650	CCDS31149.1	10	.	.	.	.	.	.	.	.	.	.	G	18.92	3.724763	0.68959	.	.	ENSG00000152457	ENST00000378289;ENST00000453695;ENST00000378246;ENST00000357717;ENST00000378249;ENST00000396817;ENST00000378255;ENST00000378254;ENST00000378278;ENST00000378258;ENST00000418843	T;T;T;T;T;T;T;T;T;T;T	0.79653	-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-1.29	5.36	5.36	0.76844	.	0.045033	0.85682	D	0.000000	D	0.84857	0.5565	L	0.44542	1.39	0.50313	D	0.999866	P;D;D	0.89917	0.593;1.0;0.978	B;D;P	0.72625	0.395;0.978;0.733	D	0.84896	0.0839	10	0.51188	T	0.08	.	12.8674	0.57948	0.0853:0.0:0.9147:0.0	.	217;102;217	Q96SD1-4;Q96SD1-3;Q96SD1	.;.;DCR1C_HUMAN	N	217;97;102;102;102;97;97;97;217;97;71	ENSP00000367538:T217N;ENSP00000400529:T97N;ENSP00000367492:T102N;ENSP00000350349:T102N;ENSP00000367496:T102N;ENSP00000380030:T97N;ENSP00000367503:T97N;ENSP00000367502:T97N;ENSP00000367527:T217N;ENSP00000367506:T97N;ENSP00000391428:T71N	ENSP00000350349:T102N	T	-	2	0	DCLRE1C	15016413	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.365000	0.73090	2.510000	0.84645	0.650000	0.86243	ACC	-	NULL		0.423	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	protein_coding	OTTHUMT00000046934.1	G	NM_022487		15016413	-1	no_errors	NM_001033855	genbank	human	reviewed	54_36p	missense	SNP	1	T
SVIL	6840	genome.wustl.edu	37	10	29777600	29777600	+	Silent	SNP	G	G	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr10:29777600G>C	ENST00000355867.4	-	23	5030	c.4278C>G	c.(4276-4278)gtC>gtG	p.V1426V	SVIL_ENST00000538146.1_Silent_p.V218V|SVIL_ENST00000375400.3_Silent_p.V1000V|SVIL_ENST00000375398.2_Silent_p.V1426V|SVIL_ENST00000535393.1_Silent_p.V340V|PTCHD3P1_ENST00000413405.1_RNA	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1426	Interaction with NEB.				cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.V1426V(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				CCGTCAGGTTGACGCTCCGCA	0.522																																																1	Substitution - coding silent(1)	ovary(1)	10											73.0	58.0	63.0					10																	29777600		2203	4298	6501	29817606	SO:0001819	synonymous_variant	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.4278C>G	10.37:g.29777600G>C		Somatic		Capture	Illumina GAIIx	4	29817606	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	HMMPfam_VHP;superfamily_VHP Villin headpiece domain;HMMPfam_Gelsolin;superfamily_Actin depolymerizing proteins	p.V1426	ENST00000355867.4	37	c.4278	CCDS7164.1	10																																																																																			-	NULL		0.522	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	protein_coding	OTTHUMT00000047395.1	G			29817606	-1	no_errors	NM_021738	genbank	human	reviewed	54_36p	silent	SNP	1	C
GDF2	2658	genome.wustl.edu	37	10	48416469	48416469	+	Silent	SNP	G	G	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr10:48416469G>C	ENST00000249598.1	-	1	384	c.225C>G	c.(223-225)gtC>gtG	p.V75V		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	75					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.V75V(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						CCTGCGAAGGGACCCCACTCA	0.562																																																1	Substitution - coding silent(1)	ovary(1)	10											87.0	78.0	81.0					10																	48416469		2203	4300	6503	48036475	SO:0001819	synonymous_variant	2658			AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.225C>G	10.37:g.48416469G>C		Somatic		Capture	Illumina GAIIx	4	48036475	Q5VSQ9|Q9Y571	Silent	SNP	-	p.V75	ENST00000249598.1	37	c.225	CCDS7219.1	10																																																																																			-	NULL		0.562	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF2	protein_coding	OTTHUMT00000047891.1	G	NM_016204		48036475	-1	no_errors	NM_016204	genbank	human	reviewed	54_36p	silent	SNP	0.97	C
SLIT1	6585	genome.wustl.edu	37	10	98773808	98773808	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr10:98773808T>A	ENST00000266058.4	-	29	3322	c.3077A>T	c.(3076-3078)aAc>aTc	p.N1026I	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Missense_Mutation_p.N1026I	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	1026	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.N1026I(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GCAGGTGTAGTTGCCCACACC	0.607																																																1	Substitution - Missense(1)	ovary(1)	10											82.0	60.0	67.0					10																	98773808		2203	4300	6503	98763798	SO:0001583	missense	6585			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.3077A>T	10.37:g.98773808T>A	ENSP00000266058:p.Asn1026Ile	Somatic		Capture	Illumina GAIIx	4	98763798	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	HMMPfam_LRRNT;HMMPfam_LRRCT;HMMPfam_LRR_1;HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_L domain-like;superfamily_EGF/Laminin	p.N1026I	ENST00000266058.4	37	c.3077	CCDS7453.1	10	.	.	.	.	.	.	.	.	.	.	T	16.39	3.110605	0.56398	.	.	ENSG00000187122	ENST00000266058;ENST00000371070	D;D	0.87966	-2.32;-2.32	4.1	1.74	0.24563	Follistatin-like, N-terminal (1);EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.043759	0.85682	D	0.000000	D	0.91290	0.7254	M	0.75085	2.285	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.89203	0.3559	10	0.87932	D	0	.	8.149	0.31130	0.0:0.1692:0.0:0.8308	.	1026	O75093	SLIT1_HUMAN	I	1026	ENSP00000266058:N1026I;ENSP00000360109:N1026I	ENSP00000266058:N1026I	N	-	2	0	SLIT1	98763798	1.000000	0.71417	0.999000	0.59377	0.591000	0.36615	1.967000	0.40491	0.164000	0.19529	-0.263000	0.10527	AAC	-	HMMPfam_EGF		0.607	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT1	protein_coding	OTTHUMT00000049636.1	T	NM_003061		98763798	-1	no_errors	NM_003061	genbank	human	validated	54_36p	missense	SNP	1	A
C10orf90	118611	genome.wustl.edu	37	10	128114628	128114629	+	Nonsense_Mutation	DNP	TC	TC	AA	rs374088681		TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	TC	TC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr10:128114628_128114629TC>AA	ENST00000284694.7	-	8	2112_2113	c.1992_1993GA>TT	c.(1990-1995)aaGAaa>aaTTaa	p.664_665KK>N*	C10orf90_ENST00000356858.3_Nonsense_Mutation_p.617_618KK>N*|C10orf90_ENST00000480379.1_Nonsense_Mutation_p.68_69KK>N*|C10orf90_ENST00000454341.1_Nonsense_Mutation_p.567_568KK>N*|C10orf90_ENST00000544758.1_Nonsense_Mutation_p.761_762KK>N*	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	664	ALMS motif. {ECO:0000250}.|Poly-Lys.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.K664_K665>N*(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TCTTCTTTTTTCTTTTTAACTT	0.45																																																1	Complex - compound substitution(1)	ovary(1)	10																																								128104619	SO:0001587	stop_gained	118611			BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1992_1993delinsAA	10.37:g.128114628_128114629delinsAA	ENSP00000284694:p.K664_K665delinsN*	Somatic		Capture	Illumina GAIIx	4	128104618	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Nonsense_Mutation	DNP	-	p.KKK664N*	ENST00000284694.7	37	c.1993_1992	CCDS31310.1	10																																																																																			-	NULL		0.450	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf90	protein_coding		TC	NM_001004298		128104619	-1	no_errors	NM_001004298	genbank	human	validated	54_36p	nonsense	DNP	1.000:1.000	AA
CASP5	838	genome.wustl.edu	37	11	104872905	104872905	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr11:104872905C>G	ENST00000260315.3	-	5	566	c.567G>C	c.(565-567)gaG>gaC	p.E189D	CASP5_ENST00000393141.2_Missense_Mutation_p.E202D|CASP5_ENST00000526056.1_Missense_Mutation_p.E202D|CASP5_ENST00000444749.2_Missense_Mutation_p.E131D|CASP5_ENST00000531367.1_Missense_Mutation_p.E47D|CASP5_ENST00000393139.2_Missense_Mutation_p.G120R|CASP5_ENST00000418434.1_Missense_Mutation_p.E47D			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	189					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.E173D(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		GTCTGCGGTCCTCTCTCTTTT	0.463																																																1	Substitution - Missense(1)	ovary(1)	11											107.0	101.0	103.0					11																	104872905		2202	4299	6501	104378115	SO:0001583	missense	838				CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.567G>C	11.37:g.104872905C>G	ENSP00000260315:p.Glu189Asp	Somatic		Capture	Illumina GAIIx	4	104378115	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Missense_Mutation	SNP	HMMPfam_CARD;superfamily_DEATH domain;HMMPfam_Peptidase_C14;superfamily_Caspase-like	p.E173D	ENST00000260315.3	37	c.519	CCDS8328.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	2.334|2.334	-0.352745|-0.352745	0.05173|0.05173	.|.	.|.	ENSG00000137757|ENSG00000137757	ENST00000393141;ENST00000418434;ENST00000260315;ENST00000444749;ENST00000526056;ENST00000531367|ENST00000393139	T;T;T;T;T;T|T	0.02236|0.41065	4.67;4.38;4.68;4.55;4.67;4.38|1.01	4.2|4.2	-2.0|-2.0	0.07433|0.07433	Peptidase C14, caspase precursor p45, core (1);|.	1.096640|.	0.06786|.	N|.	0.786132|.	T|T	0.36082|0.36082	0.0954|0.0954	L|L	0.55990|0.55990	1.75|1.75	0.09310|0.09310	N|N	1|1	B;P;B;B|.	0.36048|.	0.382;0.534;0.295;0.22|.	B;B;B;B|.	0.38755|.	0.211;0.281;0.165;0.157|.	T|T	0.44513|0.44513	-0.9323|-0.9323	10|7	0.23302|0.66056	T|D	0.38|0.02	.|.	0.7243|0.7243	0.00946|0.00946	0.2047:0.23:0.1411:0.4242|0.2047:0.23:0.1411:0.4242	.|.	47;131;189;202|.	P51878-3;P51878-2;P51878;P51878-5|.	.;.;CASP5_HUMAN;.|.	D|R	202;47;189;131;202;47|120	ENSP00000376849:E202D;ENSP00000398130:E47D;ENSP00000260315:E189D;ENSP00000388365:E131D;ENSP00000436877:E202D;ENSP00000434471:E47D|ENSP00000376847:G120R	ENSP00000260315:E189D|ENSP00000376847:G120R	E|G	-|-	3|1	2|0	CASP5|CASP5	104378115|104378115	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.015000|0.015000	0.08874|0.08874	-3.453000|-3.453000	0.00465|0.00465	-0.016000|-0.016000	0.14127|0.14127	-0.474000|-0.474000	0.04947|0.04947	GAG|GGA	-	NULL		0.463	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	protein_coding	OTTHUMT00000109397.2	C	NM_004347		104378115	-1	no_errors	NM_004347	genbank	human	reviewed	54_36p	missense	SNP		G
AHNAK	79026	genome.wustl.edu	37	11	62293783	62293783	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr11:62293783G>C	ENST00000378024.4	-	5	8380	c.8106C>G	c.(8104-8106)atC>atG	p.I2702M	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2702					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.I2702M(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TGGGGGCTTTGATATTCATCT	0.463																																																1	Substitution - Missense(1)	ovary(1)	11											192.0	190.0	190.0					11																	62293783		2202	4299	6501	62050359	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.8106C>G	11.37:g.62293783G>C	ENSP00000367263:p.Ile2702Met	Somatic		Capture	Illumina GAIIx	4	62050359	A1A586	Missense_Mutation	SNP	HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_CheC	p.I2702M	ENST00000378024.4	37	c.8106	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	g	11.90	1.777234	0.31411	.	.	ENSG00000124942	ENST00000378024	T	0.11604	2.76	4.65	1.66	0.24008	.	.	.	.	.	T	0.14270	0.0345	M	0.78223	2.4	0.25480	N	0.987743	P	0.51351	0.944	B	0.43251	0.413	T	0.15009	-1.0452	9	0.45353	T	0.12	-1.5199	5.2691	0.15615	0.1762:0.0:0.6613:0.1625	.	2702	Q09666	AHNK_HUMAN	M	2702	ENSP00000367263:I2702M	ENSP00000367263:I2702M	I	-	3	3	AHNAK	62050359	0.000000	0.05858	0.130000	0.21974	0.779000	0.44077	-0.734000	0.04893	0.372000	0.24591	0.479000	0.44913	ATC	-	NULL		0.463	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	protein_coding	OTTHUMT00000395572.1	G	NM_024060		62050359	-1	no_errors	NM_001620	genbank	human	validated	54_36p	missense	SNP	0.4	C
CCDC88B	283234	genome.wustl.edu	37	11	64121190	64121190	+	Missense_Mutation	SNP	C	C	G	rs80109197	byFrequency	TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr11:64121190C>G	ENST00000356786.5	+	23	3881	c.3837C>G	c.(3835-3837)gaC>gaG	p.D1279E	CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000359902.2_Missense_Mutation_p.D431E|CCDC88B_ENST00000301897.4_5'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	1279						membrane (GO:0016020)		p.D1279E(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CTGCCAGGGACCAGCTTAATG	0.647													C|||	29	0.00579073	0.0053	0.0	5008	,	,		18811	0.0169		0.0	False		,,,				2504	0.0051															1	Substitution - Missense(1)	ovary(1)	11						C	GLU/ASP	6,4396	11.4+/-27.6	0,6,2195	125.0	120.0	122.0		3837	0.1	1.0	11	dbSNP_131	122	2,8592	2.2+/-6.3	0,2,4295	yes	missense	CCDC88B	NM_032251.5	45	0,8,6490	GG,GC,CC		0.0233,0.1363,0.0616	benign	1279/1477	64121190	8,12988	2201	4297	6498	63877766	SO:0001583	missense	283234			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.3837C>G	11.37:g.64121190C>G	ENSP00000349238:p.Asp1279Glu	Somatic		Capture	Illumina GAIIx	4	63877766	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases	p.D1279E	ENST00000356786.5	37	c.3837	CCDS8072.2	11	22	0.010073260073260074	7	0.014227642276422764	0	0.0	15	0.026223776223776224	0	0.0	c	8.571	0.880129	0.17467	0.001363	2.33E-4	ENSG00000168071	ENST00000377638;ENST00000356786;ENST00000359902	T;T	0.64991	-0.13;-0.13	3.11	0.051	0.14296	.	.	.	.	.	T	0.24967	0.0606	L	0.50333	1.59	0.80722	D	1	P;B;P;P	0.45044	0.849;0.041;0.565;0.849	B;B;B;B	0.39299	0.296;0.009;0.107;0.296	T	0.17745	-1.0359	9	0.66056	D	0.02	.	4.6984	0.12815	0.1741:0.5999:0.0:0.226	.	1279;1161;415;1279	B2RTU8;A6NC98-4;A6NC98-5;A6NC98	.;.;.;CC88B_HUMAN	E	1161;1279;431	ENSP00000349238:D1279E;ENSP00000352974:D431E	ENSP00000349238:D1279E	D	+	3	2	CCDC88B	63877766	0.920000	0.31207	0.961000	0.40146	0.633000	0.38033	0.139000	0.16036	-0.419000	0.07439	-2.048000	0.00412	GAC	-	NULL		0.647	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88B	protein_coding	OTTHUMT00000104845.1	C	NM_032251		63877766	1	no_errors	NM_032251	genbank	human	validated	54_36p	missense	SNP	1	G
RBM14	10432	genome.wustl.edu	37	11	66391688	66391688	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr11:66391688A>G	ENST00000310137.4	+	2	480	c.341A>G	c.(340-342)tAc>tGc	p.Y114C	RBM14_ENST00000409372.1_Missense_Mutation_p.T137A|RBM14_ENST00000461478.1_3'UTR|RBM14_ENST00000393979.3_Missense_Mutation_p.Y114C|RBM4_ENST00000503028.2_Intron|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000514361.3_Intron|RBM14_ENST00000443702.1_3'UTR|RBM14-RBM4_ENST00000511114.1_Intron|RBM14_ENST00000409738.4_Intron|RBM14-RBM4_ENST00000412278.2_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	114	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.Y114C(1)	RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						TTATCAGACTACGCGTTTGTT	0.542																																																1	Substitution - Missense(1)	ovary(1)	11											62.0	57.0	59.0					11																	66391688		2200	4295	6495	66148264	SO:0001583	missense	10432			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.341A>G	11.37:g.66391688A>G	ENSP00000311747:p.Tyr114Cys	Somatic		Capture	Illumina GAIIx	4	66148264	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	HMMPfam_RRM_1;superfamily_RNA-binding domain RBD	p.Y114C	ENST00000310137.4	37	c.341	CCDS8147.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.41|16.41	3.115148|3.115148	0.56505|0.56505	.|.	.|.	ENSG00000239306|ENSG00000239306	ENST00000409372|ENST00000310137;ENST00000393979	T|T;T	0.13196|0.76839	2.61|-1.05;-1.05	5.58|5.58	5.58|5.58	0.84498|0.84498	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.075543	.|0.56097	.|D	.|0.000036	D|D	0.82806|0.82806	0.5117|0.5117	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|D;P	.|0.69078	.|0.997;0.563	.|D;P	.|0.63192	.|0.912;0.51	D|D	0.84655|0.84655	0.0703|0.0703	7|10	0.62326|0.87932	D|D	0.03|0	-3.1805|-3.1805	13.6901|13.6901	0.62539|0.62539	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|114;114	.|Q96PK6-2;Q96PK6	.|.;RBM14_HUMAN	A|C	137|114	ENSP00000386518:T137A|ENSP00000311747:Y114C;ENSP00000377548:Y114C	ENSP00000386518:T137A|ENSP00000311747:Y114C	T|Y	+|+	1|2	0|0	RBM14|RBM14	66148264|66148264	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.245000|6.245000	0.72398|0.72398	2.129000|2.129000	0.65627|0.65627	0.533000|0.533000	0.62120|0.62120	ACG|TAC	-	HMMPfam_RRM_1		0.542	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM14	protein_coding	OTTHUMT00000277128.1	A	NM_006328		66148264	1	no_errors	NM_006328	genbank	human	validated	54_36p	missense	SNP	1	G
RBM14	10432	genome.wustl.edu	37	11	66393953	66393953	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr11:66393953A>C	ENST00000310137.4	+	3	1963	c.1824A>C	c.(1822-1824)ttA>ttC	p.L608F	RBM14_ENST00000393979.3_Nonstop_Mutation_p.*157S|RBM4_ENST00000503028.2_Intron|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000514361.3_Intron|RBM14-RBM4_ENST00000511114.1_Intron|RBM14_ENST00000409738.4_Nonstop_Mutation_p.*120S|RBM14-RBM4_ENST00000412278.2_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	608					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.L608F(1)	RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						ACCGGCGTTTAGCCGAGCTCT	0.572																																																1	Substitution - Missense(1)	ovary(1)	11											72.0	67.0	69.0					11																	66393953		2200	4295	6495	66150529	SO:0001583	missense	10432			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.1824A>C	11.37:g.66393953A>C	ENSP00000311747:p.Leu608Phe	Somatic		Capture	Illumina GAIIx	4	66150529	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	HMMPfam_RRM_1;superfamily_RNA-binding domain RBD	p.L608F	ENST00000310137.4	37	c.1824	CCDS8147.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.3|20.3	3.972891|3.972891	0.74246|0.74246	.|.	.|.	ENSG00000239306|ENSG00000239306	ENST00000310137|ENST00000393979;ENST00000409738	D|.	0.84660|.	-1.88|.	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	0.074202|.	0.52532|.	D|.	0.000069|.	T|.	0.60353|.	0.2262|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|.	0.24576|.	0.106|.	B|.	0.23574|.	0.047|.	T|.	0.59857|.	-0.7375|.	9|.	0.87932|.	D|.	0|.	-3.0953|-3.0953	9.0573|9.0573	0.36414|0.36414	0.8361:0.0:0.0:0.1639|0.8361:0.0:0.0:0.1639	.|.	608|.	Q96PK6|.	RBM14_HUMAN|.	F|S	608|157;120	ENSP00000311747:L608F|.	ENSP00000311747:L608F|.	L|X	+|+	3|2	2|0	RBM14|RBM14	66150529|66150529	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.255000|2.255000	0.43222|0.43222	2.120000|2.120000	0.65058|0.65058	0.455000|0.455000	0.32223|0.32223	TTA|TAG	-	NULL		0.572	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM14	protein_coding	OTTHUMT00000277128.1	A	NM_006328		66150529	1	no_errors	NM_006328	genbank	human	validated	54_36p	missense	SNP	1	C
TMEM126A	84233	genome.wustl.edu	37	11	85365199	85365199	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr11:85365199T>C	ENST00000304511.2	+	3	288	c.179T>C	c.(178-180)gTg>gCg	p.V60A	TMEM126A_ENST00000528105.1_5'UTR|TMEM126A_ENST00000532180.1_5'UTR	NM_032273.3	NP_115649.1	Q9H061	T126A_HUMAN	transmembrane protein 126A	60					optic nerve development (GO:0021554)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)		p.V60A(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(2)|stomach(1)	7		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				ATCTTGAATGTGACAAAGGCT	0.398																																																1	Substitution - Missense(1)	ovary(1)	11											173.0	165.0	167.0					11																	85365199		2203	4299	6502	85042847	SO:0001583	missense	84233				CCDS8268.1, CCDS58165.1	11q14.1	2011-03-25			ENSG00000171202	ENSG00000171202			25382	protein-coding gene	gene with protein product		612988				11230166	Standard	NM_032273		Approved	DKFZp586C1924, OPA7	uc001par.3	Q9H061	OTTHUMG00000166975	ENST00000304511.2:c.179T>C	11.37:g.85365199T>C	ENSP00000306887:p.Val60Ala	Somatic		Capture	Illumina GAIIx	4	85042847	B2R570|E9PI16	Missense_Mutation	SNP	-	p.V60A	ENST00000304511.2	37	c.179	CCDS8268.1	11	.	.	.	.	.	.	.	.	.	.	T	12.76	2.033099	0.35893	.	.	ENSG00000171202	ENST00000304511	T	0.49139	0.79	5.78	5.78	0.91487	.	0.108699	0.64402	D	0.000008	T	0.64994	0.2649	M	0.62088	1.915	0.80722	D	1	D	0.71674	0.998	D	0.69654	0.965	T	0.64149	-0.6475	9	.	.	.	-6.5171	15.5785	0.76414	0.0:0.0:0.0:1.0	.	60	Q9H061	T126A_HUMAN	A	60	ENSP00000306887:V60A	.	V	+	2	0	TMEM126A	85042847	1.000000	0.71417	1.000000	0.80357	0.078000	0.17371	6.036000	0.70948	2.333000	0.79357	0.533000	0.62120	GTG	-	NULL		0.398	TMEM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM126A	protein_coding	OTTHUMT00000392177.1	T	NM_032273		85042847	1	no_errors	NM_032273	genbank	human	provisional	54_36p	missense	SNP	1	C
SC5D	6309	genome.wustl.edu	37	11	121177111	121177111	+	Silent	SNP	C	C	T	rs369858836		TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr11:121177111C>T	ENST00000392789.2	+	4	597	c.360C>T	c.(358-360)gtC>gtT	p.V120V	SC5D_ENST00000264027.4_Silent_p.V120V|SC5D_ENST00000528991.1_Intron|SC5D_ENST00000534230.1_Silent_p.V120V	NM_001024956.2	NP_001020127.1	O75845	SC5D_HUMAN	sterol-C5-desaturase	120					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via lathosterol (GO:0033490)|fatty acid biosynthetic process (GO:0006633)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	C-5 sterol desaturase activity (GO:0000248)|iron ion binding (GO:0005506)|lathosterol oxidase activity (GO:0050046)	p.V120V(1)									TTGAACTTGTCGTTAGTATAA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	11						C	,	0,4406		0,0,2203	186.0	170.0	175.0		360,360	-10.3	0.0	11		175	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous,coding-synonymous	SC5DL	NM_001024956.2,NM_006918.4	,	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	,	120/300,120/300	121177111	1,13001	2203	4298	6501	120682321	SO:0001819	synonymous_variant	6309				CCDS8435.1	11q23.3	2013-03-04	2013-03-04	2013-03-04	ENSG00000109929	ENSG00000109929	1.14.21.6	"""Fatty acid hydroxylase domain containing"""	10547	protein-coding gene	gene with protein product	"""lathosterol oxidase"""	602286	"""sterol-C5-desaturase (fungal ERG3, delta-5-desaturase)-like"", ""sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, fungal)-like"", ""sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like"""	SC5DL		8976377	Standard	NM_006918		Approved		uc001pxu.3	O75845	OTTHUMG00000166068	ENST00000392789.2:c.360C>T	11.37:g.121177111C>T		Somatic		Capture	Illumina GAIIx	4	120682321	O00119|Q6GTM5|Q9UK15	Silent	SNP	HMMPfam_Sterol_desat	p.V120	ENST00000392789.2	37	c.360	CCDS8435.1	11																																																																																			-	HMMPfam_Sterol_desat		0.378	SC5D-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	SC5DL	protein_coding	OTTHUMT00000387702.1	C	NM_001024956		120682321	1	no_errors	NM_001024956	genbank	human	reviewed	54_36p	silent	SNP		T
PAH	5053	genome.wustl.edu	37	12	103288569	103288576	+	Frame_Shift_Del	DEL	CTCAAGAT	CTCAAGAT	-	rs62517167|rs142516271|rs199475570	byFrequency	TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	CTCAAGAT	CTCAAGAT	CTCAAGAT	-	CTCAAGAT	CTCAAGAT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr12:103288569_103288576delCTCAAGAT	ENST00000553106.1	-	3	761_768	c.289_296delATCTTGAG	c.(289-297)atcttgaggfs	p.ILR97fs	PAH_ENST00000551988.1_5'UTR|PAH_ENST00000307000.2_Frame_Shift_Del_p.ILR92fs	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	97	ACT. {ECO:0000255|PROSITE- ProRule:PRU01007}.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)	p.I97fs*2(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	AATGTCATGCCTCAAGATCTTGATGATG	0.399																																																1	Deletion - Frameshift(1)	ovary(1)	12	GRCh37	CM077217|CM930537	PAH	M	rs142516271|rs62517167																																			101812706	SO:0001589	frameshift_variant	5053			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.289_296delATCTTGAG	12.37:g.103288569_103288576delCTCAAGAT	ENSP00000448059:p.Ile97fs	Somatic		Capture	Illumina GAIIx	Phase_III	101812699	Q16717|Q8TC14	Frame_Shift_Del	DEL	HMMPfam_Biopterin_H,HMMPfam_ACT,superfamily_ACT-like,superfamily_Aromatic aminoacid monoxygenases catalytic and oligomerization domains	p.I97fs	ENST00000553106.1	37	c.296_289	CCDS9092.1	12																																																																																			(deletion:cds_exon[101812643,101812826])	HMMPfam_ACT		0.399	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAH	protein_coding	OTTHUMT00000406692.1	CTCAAGAT			101812706	-1	no_errors	NM_000277	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.997:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
KRT71	112802	genome.wustl.edu	37	12	52942483	52942496	+	Splice_Site	DEL	ACGGCTTCAAAGAG	ACGGCTTCAAAGAG	-			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	ACGGCTTCAAAGAG	ACGGCTTCAAAGAG	ACGGCTTCAAAGAG	-	ACGGCTTCAAAGAG	ACGGCTTCAAAGAG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr12:52942483_52942496delACGGCTTCAAAGAG	ENST00000267119.5	-	4	871_883	c.802_814delCTCTTTGAAGCCGT	c.(802-816)ctctttgaagccgta>ta	p.LFEAV268fs		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	268	Coil 1B.|Rod.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.?(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		AGACAGACTTACGGCTTCAAAGAGACACCTGAAG	0.542																																																1	Unknown(1)	ovary(1)	12																																								51228763	SO:0001630	splice_region_variant	112802			AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.813+1CTCTTTGAAGCCGT>-	12.37:g.52942483_52942496delACGGCTTCAAAGAG		Somatic		Capture	Illumina GAIIx	Phase_III	51228750	B3KVC1|Q3SY85|Q96DU2	Splice_Site	DEL	-	e4+-11	ENST00000267119.5	37	c.NULL	CCDS8831.1	12																																																																																			(deletion:intron[51228368,51228751], cds_exon[51228752,51228847])	-		0.542	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT71	protein_coding	OTTHUMT00000396487.1	ACGGCTTCAAAGAG	NM_033448	Frame_Shift_Del	51228763	-1	no_errors	NM_033448	genbank	human	provisional	54_36p	splice_site_del	DEL	0.983:0.945:0.004:0.005:0.095:0.245:0.879:0.900:0.854:0.843:0.978:0.982:0.978:0.569	-
NBEA	26960	genome.wustl.edu	37	13	36124684	36124684	+	Missense_Mutation	SNP	G	G	C	rs200705969		TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr13:36124684G>C	ENST00000400445.3	+	42	7190	c.6656G>C	c.(6655-6657)cGt>cCt	p.R2219P	NBEA_ENST00000537702.1_Missense_Mutation_p.R12P|NBEA_ENST00000540320.1_Missense_Mutation_p.R2219P|NBEA_ENST00000310336.4_Missense_Mutation_p.R2219P|NBEA_ENST00000379939.2_Missense_Mutation_p.R2216P	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2219					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.R2219P(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TTTTCAAGACGTTACCTTCTA	0.358																																																1	Substitution - Missense(1)	ovary(1)	13											95.0	90.0	92.0					13																	36124684		1845	4100	5945	35022684	SO:0001583	missense	26960			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.6656G>C	13.37:g.36124684G>C	ENSP00000383295:p.Arg2219Pro	Somatic		Capture	Illumina GAIIx	4	35022684	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	HMMPfam_Beach;HMMPfam_WD40;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_DUF1088;superfamily_WD40 repeat-like;superfamily_ARM repeat;superfamily_PH domain-like;superfamily_BEACH domain	p.R2219P	ENST00000400445.3	37	c.6656	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	G	33	5.210189	0.95069	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000543274;ENST00000537702	T;T;T;T;T	0.61742	0.09;0.1;0.1;0.09;0.08	5.69	5.69	0.88448	PH-BEACH domain (1);	0.045710	0.85682	D	0.000000	T	0.81735	0.4885	M	0.90759	3.145	0.80722	D	1	P;D	0.89917	0.775;1.0	P;D	0.80764	0.73;0.994	D	0.84909	0.0847	10	0.87932	D	0	.	19.8262	0.96618	0.0:0.0:1.0:0.0	.	2219;2216	Q8NFP9;Q5T321	NBEA_HUMAN;.	P	2219;2219;2216;2219;846;12;12	ENSP00000440951:R2219P;ENSP00000383295:R2219P;ENSP00000369271:R2216P;ENSP00000308534:R2219P;ENSP00000440233:R12P	ENSP00000308534:R2219P	R	+	2	0	NBEA	35022684	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	6.558000	0.73942	2.676000	0.91093	0.655000	0.94253	CGT	-	NULL		0.358	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	protein_coding		G	NM_015678		35022684	1	no_errors	NM_015678	genbank	human	reviewed	54_36p	missense	SNP	1	C
OR4K2	390431	genome.wustl.edu	37	14	20345353	20345353	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr14:20345353T>A	ENST00000298642.2	+	1	963	c.927T>A	c.(925-927)aaT>aaA	p.N309K		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N309K(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TAAATTTTAATAAGGCAATGC	0.353																																																1	Substitution - Missense(1)	ovary(1)	14											45.0	48.0	47.0					14																	20345353		2202	4299	6501	19415193	SO:0001583	missense	390431				CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.927T>A	14.37:g.20345353T>A	ENSP00000298642:p.Asn309Lys	Somatic		Capture	Illumina GAIIx	4	19415193	B2RNK8|Q6IFA5	Missense_Mutation	SNP	-	p.N309K	ENST00000298642.2	37	c.927	CCDS32023.1	14	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.264434	0.00262	.	.	ENSG00000165762	ENST00000298642	T	0.05786	3.39	5.25	1.78	0.24846	.	0.992252	0.08181	N	0.985470	T	0.03651	0.0104	N	0.14661	0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.48875	-0.8996	10	0.20046	T	0.44	.	3.9723	0.09458	0.0:0.5468:0.1846:0.2686	.	309	Q8NGD2	OR4K2_HUMAN	K	309	ENSP00000298642:N309K	ENSP00000298642:N309K	N	+	3	2	OR4K2	19415193	0.000000	0.05858	0.053000	0.19242	0.022000	0.10575	-0.990000	0.03732	0.147000	0.19030	-0.462000	0.05337	AAT	-	NULL		0.353	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K2	protein_coding	OTTHUMT00000409864.1	T			19415193	1	no_errors	NM_001005501	genbank	human	provisional	54_36p	missense	SNP	0	A
RNASE12	493901	genome.wustl.edu	37	14	21058549	21058549	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr14:21058549C>T	ENST00000556526.1	-	1	433	c.334G>A	c.(334-336)Gaa>Aaa	p.E112K	RP11-14J7.6_ENST00000554993.1_RNA|RNASE11_ENST00000553849.1_5'Flank|RNASE11_ENST00000555841.1_5'Flank|RNASE11_ENST00000610205.1_5'Flank|RNASE11_ENST00000398008.2_5'Flank|RP11-14J7.6_ENST00000556487.1_RNA|RNASE11_ENST00000398009.2_5'Flank|RP11-14J7.6_ENST00000554006.1_RNA|RP11-14J7.6_ENST00000553604.1_RNA|RNASE11_ENST00000432835.2_5'Flank|RNASE11_ENST00000555283.1_Intron|RP11-14J7.6_ENST00000554529.1_RNA	NM_001024822.2	NP_001019993.1	Q5GAN4	RNS12_HUMAN	ribonuclease, RNase A family, 12 (non-active)	112						extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)	p.E112K(1)		kidney(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(95;0.00238)		Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.013)		CTTGTGCCTTCAATGAGCTGA	0.458																																																1	Substitution - Missense(1)	ovary(1)	14											112.0	102.0	105.0					14																	21058549		2203	4300	6503	20128389	SO:0001583	missense	493901				CCDS32037.1	14q11.1	2012-10-05			ENSG00000258436	ENSG00000258436		"""Ribonucleases, RNase A"""	24211	protein-coding gene	gene with protein product							Standard	NM_001024822		Approved		uc001vxt.3	Q5GAN4	OTTHUMG00000170991	ENST00000556526.1:c.334G>A	14.37:g.21058549C>T	ENSP00000450580:p.Glu112Lys	Somatic		Capture	Illumina GAIIx	4	20128389		Missense_Mutation	SNP	-	p.E112K	ENST00000556526.1	37	c.334	CCDS32037.1	14	.	.	.	.	.	.	.	.	.	.	C	9.799	1.180077	0.21787	.	.	ENSG00000258436;ENSG00000206171	ENST00000556526;ENST00000382999	T;T	0.72394	-0.65;-0.65	4.91	4.02	0.46733	Ribonuclease A, domain (3);	0.720175	0.12884	N	0.431212	T	0.57257	0.2041	N	0.21583	0.68	0.09310	N	1	B	0.25351	0.124	B	0.30943	0.122	T	0.48958	-0.8988	10	0.33141	T	0.24	-25.4683	9.0693	0.36482	0.0:0.9005:0.0:0.0995	.	112	Q5GAN4	RNS12_HUMAN	K	112	ENSP00000450580:E112K;ENSP00000372460:E112K	ENSP00000372460:E112K	E	-	1	0	RNASE12;AL163195.1	20128389	0.007000	0.16637	0.034000	0.17996	0.142000	0.21351	1.951000	0.40333	1.431000	0.47355	0.655000	0.94253	GAA	-	NULL		0.458	RNASE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE12	protein_coding	OTTHUMT00000411107.1	C			20128389	-1	no_errors	NM_001024822	genbank	human	provisional	54_36p	missense	SNP		T
KIAA0247	9766	genome.wustl.edu	37	14	70177695	70177695	+	Silent	SNP	G	G	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr14:70177695G>A	ENST00000342745.4	+	6	1224	c.911G>A	c.(910-912)tGa>tAa	p.*304*		NM_014734.3	NP_055549.1	Q92537	K0247_HUMAN	KIAA0247	0						integral component of membrane (GO:0016021)		p.*304*(1)		endometrium(1)|kidney(1)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)	10				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)		AAAGAAGCATGAGGGCAGCGG	0.547																																																1	Substitution - coding silent(1)	ovary(1)	14											210.0	174.0	186.0					14																	70177695		2203	4300	6503	69247448	SO:0001819	synonymous_variant	9766			D87434	CCDS9796.1	14q24.1	2012-11-29			ENSG00000100647	ENSG00000100647			19956	protein-coding gene	gene with protein product						9039502	Standard	NM_014734		Approved		uc001xlk.3	Q92537	OTTHUMG00000171234	ENST00000342745.4:c.911G>A	14.37:g.70177695G>A		Somatic		Capture	Illumina GAIIx	4	69247448		Silent	SNP	HMMPfam_Sushi;superfamily_Complement control module/SCR domain	p.*304	ENST00000342745.4	37	c.911	CCDS9796.1	14																																																																																			-	NULL		0.547	KIAA0247-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0247	protein_coding	OTTHUMT00000412453.1	G	NM_014734		69247448	1	no_errors	NM_014734	genbank	human	validated	54_36p	silent	SNP	1	A
ESRRB	2103	genome.wustl.edu	37	14	76905830	76905830	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr14:76905830T>C	ENST00000509242.1	+	3	232	c.134T>C	c.(133-135)tTt>tCt	p.F45S	ESRRB_ENST00000556177.1_Missense_Mutation_p.F45S|ESRRB_ENST00000380887.2_Missense_Mutation_p.F45S|ESRRB_ENST00000261532.7_Missense_Mutation_p.F45S|ESRRB_ENST00000507951.1_3'UTR	NM_004452.3	NP_004443.3	O95718	ERR2_HUMAN	estrogen-related receptor beta	45					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|trophectodermal cell proliferation (GO:0001834)|trophectodermal cellular morphogenesis (GO:0001831)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.F45S(1)		endometrium(2)|large_intestine(4)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(234;0.0213)		AGCGGCGGCTTTGGCCTGGCC	0.692																																																1	Substitution - Missense(1)	ovary(1)	14											23.0	25.0	24.0					14																	76905830		2195	4282	6477	75975583	SO:0001583	missense	2103			X51417	CCDS9850.1, CCDS9850.2	14q24.3	2013-01-16				ENSG00000119715		"""Nuclear hormone receptors"""	3473	protein-coding gene	gene with protein product		602167	"""deafness, autosomal recessive 35"""	ESRL2, DFNB35		3267207, 9344655, 18179891	Standard	NM_004452		Approved	ERR2, ERRbeta, NR3B2, ERRb	uc001xsr.3	O95718		ENST00000509242.1:c.134T>C	14.37:g.76905830T>C	ENSP00000422488:p.Phe45Ser	Somatic		Capture	Illumina GAIIx	4	75975583	A2VDJ2|B6ZGU4|Q5F0P7|Q5F0P8|Q9HCB4	Missense_Mutation	SNP	HMMPfam_Hormone_recep;HMMPfam_zf-C4;superfamily_Nuclear receptor ligand-binding domain;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.F45S	ENST00000509242.1	37	c.134	CCDS9850.2	14	.	.	.	.	.	.	.	.	.	.	T	20.1	3.938108	0.73557	.	.	ENSG00000119715	ENST00000512784;ENST00000509242;ENST00000556177;ENST00000380887;ENST00000261532	D;D;D;D;D	0.92446	-3.03;-3.04;-3.01;-3.04;-3.01	5.13	3.93	0.45458	.	0.056855	0.64402	D	0.000001	T	0.80444	0.4624	N	0.03608	-0.345	0.43175	D	0.994983	B;P	0.41910	0.415;0.764	B;B	0.40199	0.103;0.322	T	0.82717	-0.0319	10	0.87932	D	0	.	7.9123	0.29798	0.4413:0.0:0.0:0.5587	.	45;50	Q5F0P7;E7EWD9	.;.	S	50;45;45;45;45	ENSP00000424992:F50S;ENSP00000422488:F45S;ENSP00000451658:F45S;ENSP00000370270:F45S;ENSP00000261532:F45S	ENSP00000261532:F45S	F	+	2	0	ESRRB	75975583	1.000000	0.71417	0.966000	0.40874	0.896000	0.52359	6.939000	0.75911	1.937000	0.56155	0.533000	0.62120	TTT	-	NULL		0.692	ESRRB-003	KNOWN	basic|CCDS	protein_coding	ESRRB	protein_coding	OTTHUMT00000360663.1	T			75975583	1	no_errors	NM_004452	genbank	human	reviewed	54_36p	missense	SNP	1	C
MGA	23269	genome.wustl.edu	37	15	41989143	41989143	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr15:41989143C>A	ENST00000570161.1	+	2	1935	c.1935C>A	c.(1933-1935)agC>agA	p.S645R	MGA_ENST00000389936.4_Missense_Mutation_p.S645R|MGA_ENST00000545763.1_Missense_Mutation_p.S645R|MGA_ENST00000219905.7_Missense_Mutation_p.S645R|MGA_ENST00000566586.1_Missense_Mutation_p.S645R			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.S645R(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CACCTGTAAGCCCTGGGAGTA	0.408																																																1	Substitution - Missense(1)	ovary(1)	15											18.0	16.0	17.0					15																	41989143		1859	4099	5958	39776435	SO:0001583	missense	23269			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.1935C>A	15.37:g.41989143C>A	ENSP00000457035:p.Ser645Arg	Somatic		Capture	Illumina GAIIx	4	39776435	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	-	p.S645R	ENST00000570161.1	37	c.1935	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	C	10.27	1.304215	0.23736	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.42513	0.97;0.97;0.97	5.21	-1.39	0.08997	.	1.671850	0.02275	N	0.068828	T	0.21347	0.0514	N	0.08118	0	0.22866	N	0.998635	B;B	0.17038	0.02;0.005	B;B	0.10450	0.005;0.002	T	0.26052	-1.0114	10	0.87932	D	0	.	0.2689	0.00229	0.2109:0.26:0.2079:0.3212	.	645;645	F5H7K2;E7ENI0	.;.	R	645	ENSP00000219905:S645R;ENSP00000374586:S645R;ENSP00000442467:S645R	ENSP00000219905:S645R	S	+	3	2	MGA	39776435	0.394000	0.25246	0.707000	0.30419	0.435000	0.31806	-0.387000	0.07361	0.037000	0.15575	0.462000	0.41574	AGC	-	NULL		0.408	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	protein_coding	OTTHUMT00000420229.1	C	NM_001164273.1		39776435	1	no_errors	NM_001080541	genbank	human	provisional	54_36p	missense	SNP	0.05	A
KLHL25	64410	genome.wustl.edu	37	15	86311340	86311340	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr15:86311340T>C	ENST00000337975.5	-	2	1976	c.1702A>G	c.(1702-1704)Atc>Gtc	p.I568V	KLHL25_ENST00000536947.1_Missense_Mutation_p.I568V|MIR1276_ENST00000408707.1_RNA|KLHL25_ENST00000559131.1_Intron	NM_022480.3	NP_071925.2	Q9H0H3	KLH25_HUMAN	kelch-like family member 25	568					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of translational initiation (GO:0006446)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)		p.I568V(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	25						ACTGTGGTGATGCAGTTCCAT	0.587																																																1	Substitution - Missense(1)	ovary(1)	15											119.0	94.0	102.0					15																	86311340		2202	4299	6501	84112344	SO:0001583	missense	64410				CCDS10339.1	15q25.3	2013-02-22	2013-02-22		ENSG00000183655	ENSG00000183655		"""Kelch-like"", ""BTB/POZ domain containing"""	25732	protein-coding gene	gene with protein product	"""ectodermal-neural cortex 2"""		"""kelch-like 25 (Drosophila)"""				Standard	XM_006720635		Approved	FLJ12587, ENC2, ENC-2	uc002bly.3	Q9H0H3	OTTHUMG00000148672	ENST00000337975.5:c.1702A>G	15.37:g.86311340T>C	ENSP00000336800:p.Ile568Val	Somatic		Capture	Illumina GAIIx	4	84112344	B2RDH2|B3KRT7	Missense_Mutation	SNP	HMMPfam_Kelch_1;superfamily_Galactose oxidase central domain;HMMPfam_BACK;HMMPfam_BTB;superfamily_POZ domain	p.I568V	ENST00000337975.5	37	c.1702	CCDS10339.1	15	.	.	.	.	.	.	.	.	.	.	T	3.359	-0.130968	0.06753	.	.	ENSG00000183655	ENST00000337975;ENST00000538153;ENST00000536947	T;T	0.75938	-0.98;-0.98	5.71	-2.54	0.06307	Kelch-type beta propeller (1);	0.386312	0.25964	N	0.027168	T	0.45796	0.1360	N	0.11106	0.095	0.38542	D	0.949241	B	0.02656	0.0	B	0.06405	0.002	T	0.47686	-0.9098	10	0.02654	T	1	.	11.7498	0.51841	0.0:0.5109:0.0:0.4891	.	568	Q9H0H3	ENC2_HUMAN	V	568;537;568	ENSP00000336800:I568V;ENSP00000444739:I568V	ENSP00000336800:I568V	I	-	1	0	KLHL25	84112344	0.998000	0.40836	0.985000	0.45067	0.612000	0.37316	0.418000	0.21230	-0.470000	0.06901	-0.464000	0.05259	ATC	-	HMMPfam_Kelch_1		0.587	KLHL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL25	protein_coding	OTTHUMT00000309023.1	T	NM_022480		84112344	-1	no_errors	NM_022480	genbank	human	validated	54_36p	missense	SNP	0.99	C
DNAH3	55567	genome.wustl.edu	37	16	20981259	20981260	+	Missense_Mutation	DNP	TA	TA	CT			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	TA	TA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr16:20981259_20981260TA>CT	ENST00000261383.3	-	52	8311_8312	c.8312_8313TA>AG	c.(8311-8313)cTA>cAG	p.L2771Q	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2771	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.L2771Q(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CCAGAGCAGCTAGTGCAGCCTC	0.599																																																2	Substitution - Missense(2)	ovary(2)	16																																								20888761	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.8312_8313delinsCT	16.37:g.20981259_20981260delinsCT	ENSP00000261383:p.Leu2771Gln	Somatic		Capture	Illumina GAIIx	4	20888760	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	DNP	-	p.L2771Q	ENST00000261383.3	37	c.8313_8312	CCDS10594.1	16																																																																																			-	NULL		0.599	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	protein_coding	OTTHUMT00000207361.1	TA	NM_017539		20888761	-1	no_errors	NM_017539	genbank	human	provisional	54_36p	missense	DNP	0.000:0.847	CT
CDRT1	374286	genome.wustl.edu	37	17	15501919	15501919	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr17:15501919G>C	ENST00000395906.3	-	8	1481	c.1482C>G	c.(1480-1482)caC>caG	p.H494Q	CDRT1_ENST00000354433.3_5'UTR|RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.H804Q|CDRT1_ENST00000583965.1_5'UTR	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	494								p.H494Q(1)|p.?(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		TAGTCCCCTGGTGACCACCGA	0.473																																																2	Substitution - Missense(1)|Unknown(1)	ovary(2)	17											39.0	44.0	42.0					17																	15501919		2190	4279	6469	15442644	SO:0001583	missense	374286			U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.1482C>G	17.37:g.15501919G>C	ENSP00000379242:p.His494Gln	Somatic		Capture	Illumina GAIIx	4	15442644	O43848|O95611	Missense_Mutation	SNP	-	p.H494Q	ENST00000395906.3	37	c.1482	CCDS45619.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.15|14.15	2.451035|2.451035	0.43531|0.43531	.|.	.|.	ENSG00000251537|ENSG00000251537	ENST00000261644;ENST00000395906|ENST00000455584	T|.	0.81415|.	-1.49|.	4.34|4.34	3.34|3.34	0.38264|0.38264	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.000000|.	0.40222|.	U|.	0.001153|.	T|T	0.81408|0.81408	0.4816|0.4816	M|M	0.93375|0.93375	3.41|3.41	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.91635|.	0.998;0.999|.	D|D	0.85912|0.85912	0.1441|0.1441	10|5	0.87932|.	D|.	0|.	.|.	12.0492|12.0492	0.53498|0.53498	0.0931:0.0:0.9069:0.0|0.0931:0.0:0.9069:0.0	.|.	494;818|.	O95170;Q59EB2|.	CDRT1_HUMAN;.|.	Q|S	524;494|819	ENSP00000379242:H494Q|.	ENSP00000261644:H524Q|.	H|T	-|-	3|2	2|0	RP11-385D13.1|RP11-385D13.1	15442644|15442644	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.444000|0.444000	0.32077|0.32077	2.010000|2.010000	0.40913|0.40913	2.144000|2.144000	0.66660|0.66660	0.555000|0.555000	0.69702|0.69702	CAC|ACC	-	NULL		0.473	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT1	protein_coding	OTTHUMT00000448127.1	G	NM_006382		15442644	-1	no_errors	NM_006382	genbank	human	provisional	54_36p	missense	SNP	0.998	C
TP53	7157	genome.wustl.edu	37	17	7577128	7577128	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr17:7577128A>C	ENST00000269305.4	-	8	999	c.810T>G	c.(808-810)ttT>ttG	p.F270L	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.F270L|TP53_ENST00000445888.2_Missense_Mutation_p.F270L|TP53_ENST00000420246.2_Missense_Mutation_p.F270L|TP53_ENST00000359597.4_Missense_Mutation_p.F270L|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	270	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F270L(9)|p.0?(8)|p.?(2)|p.G266_E271delGRNSFE(2)|p.G262_F270delGNLLGRNSF(2)|p.F270fs*72(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.S269fs*34(1)|p.F270_D281del12(1)|p.E271fs*35(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACGCACCTCAAAGCTGTTCC	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	30	Substitution - Missense(9)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(4)|Unknown(2)|Insertion - Frameshift(1)	bone(4)|stomach(3)|haematopoietic_and_lymphoid_tissue(3)|urinary_tract(3)|oesophagus(3)|large_intestine(2)|central_nervous_system(2)|biliary_tract(2)|breast(2)|ovary(2)|upper_aerodigestive_tract(1)|eye(1)|lung(1)|liver(1)	17											58.0	51.0	53.0					17																	7577128		2203	4300	6503	7517853	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.810T>G	17.37:g.7577128A>C	ENSP00000269305:p.Phe270Leu	Somatic		Capture	Illumina GAIIx	4	7517853	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.F270L	ENST00000269305.4	37	c.810	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	20.8	4.049410	0.75846	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99771	-6.71;-6.71;-6.71;-6.71;-6.71;-6.71	5.13	2.93	0.34026	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99459	0.9808	L	0.49256	1.55	0.53005	D	0.999965	D;B;D;D	0.89917	1.0;0.156;1.0;0.995	D;B;D;D	0.77557	0.99;0.098;0.986;0.984	D	0.99075	1.0835	10	0.87932	D	0	-25.5181	7.8787	0.29610	0.8288:0.0:0.1712:0.0	.	270;270;270;270	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	L	270;270;270;270;270;259;138	ENSP00000352610:F270L;ENSP00000269305:F270L;ENSP00000398846:F270L;ENSP00000391127:F270L;ENSP00000391478:F270L;ENSP00000425104:F138L	ENSP00000269305:F270L	F	-	3	2	TP53	7517853	0.653000	0.27358	1.000000	0.80357	0.899000	0.52679	0.030000	0.13688	0.430000	0.26230	0.379000	0.24179	TTT	-	HMMPfam_P53		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546		7517853	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	C
TTC25	83538	genome.wustl.edu	37	17	40095357	40095357	+	RNA	SNP	G	G	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr17:40095357G>A	ENST00000591658.1	+	0	1058							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm (GO:0005737)		p.Q330Q(1)		endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				GGAATGCCCAGATTGAGCTGG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	17											48.0	51.0	50.0					17																	40095357		2065	4201	6266	37348883			83538			AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815		"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product							Standard	XM_006722129		Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40095357G>A		Somatic		Capture	Illumina GAIIx	4	37348883	Q6NX40|Q6PJ04|Q9H0K5	Silent	SNP	HMMPfam_TPR_1;superfamily_TPR-like	p.Q330	ENST00000591658.1	37	c.990		17																																																																																			-	HMMPfam_TPR_1		0.537	TTC25-001	KNOWN	basic	processed_transcript	TTC25	processed_transcript	OTTHUMT00000449237.1	G	NM_031421		37348883	1	no_errors	ENST00000377543	ensembl	human	known	54_36p	silent	SNP	1	A
LAMA3	3909	genome.wustl.edu	37	18	21511090	21511090	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr18:21511090G>T	ENST00000313654.9	+	65	8742	c.8501G>T	c.(8500-8502)aGc>aTc	p.S2834I	LAMA3_ENST00000399516.3_Missense_Mutation_p.S2778I|LAMA3_ENST00000587184.1_Missense_Mutation_p.S1169I|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Missense_Mutation_p.S1225I	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2834	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.		S -> G (in dbSNP:rs1154233). {ECO:0000269|PubMed:15044476, ECO:0000269|PubMed:8077230, ECO:0000269|Ref.6}.		cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.S2834I(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GATAGCGGCAGCCCAATTTTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	18											99.0	102.0	101.0					18																	21511090		2203	4300	6503	19765088	SO:0001583	missense	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8501G>T	18.37:g.21511090G>T	ENSP00000324532:p.Ser2834Ile	Somatic		Capture	Illumina GAIIx	4	19765088	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	HMMPfam_Laminin_B;HMMPfam_Laminin_EGF;HMMPfam_Laminin_N;superfamily_Galactose-binding domain-like;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_I;HMMPfam_Laminin_II;HMMPfam_Laminin_G_2;superfamily_Spectrin repeat;superfamily_EGF/Laminin	p.S2834I	ENST00000313654.9	37	c.8501	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	G	2.864	-0.235453	0.05983	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.16743	2.32;2.32;2.32	5.27	1.2	0.21068	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.15349	0.0370	M	0.67953	2.075	0.09310	N	1	B;B;B;B	0.06786	0.0;0.0;0.001;0.001	B;B;B;B	0.12156	0.004;0.006;0.007;0.007	T	0.35748	-0.9776	9	0.29301	T	0.29	.	2.0697	0.03610	0.1848:0.1506:0.5092:0.1553	.	1169;1225;2778;2834	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	I	2834;2778;1225	ENSP00000324532:S2834I;ENSP00000382432:S2778I;ENSP00000269217:S1225I	ENSP00000269217:S1225I	S	+	2	0	LAMA3	19765088	0.001000	0.12720	0.001000	0.08648	0.099000	0.18886	0.799000	0.27028	-0.005000	0.14395	-0.345000	0.07892	AGC	-	HMMPfam_Laminin_G_2		0.408	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	protein_coding	OTTHUMT00000254824.3	G	NM_000227, NM_198129		19765088	1	no_errors	NM_198129	genbank	human	reviewed	54_36p	missense	SNP		T
UNC13A	23025	genome.wustl.edu	37	19	17785509	17785509	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr19:17785509C>T	ENST00000519716.2	-	3	108	c.109G>A	c.(109-111)Gcg>Acg	p.A37T	UNC13A_ENST00000428389.2_Missense_Mutation_p.A125T|UNC13A_ENST00000551649.1_Missense_Mutation_p.A37T|UNC13A_ENST00000252773.7_Missense_Mutation_p.A37T|UNC13A_ENST00000552293.1_Missense_Mutation_p.A37T|UNC13A_ENST00000550896.1_Missense_Mutation_p.A37T	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	37	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.A125T(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CCCCGCACCGCGATGGTCGTG	0.597																																																1	Substitution - Missense(1)	ovary(1)	19											103.0	104.0	104.0					19																	17785509		2108	4239	6347	17646509	SO:0001583	missense	23025			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.109G>A	19.37:g.17785509C>T	ENSP00000429562:p.Ala37Thr	Somatic		Capture	Illumina GAIIx	4	17646509	E5RHY9	Missense_Mutation	SNP	-	p.A125T	ENST00000519716.2	37	c.373	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498397	0.85069	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32;-0.32	4.93	4.93	0.64822	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	T	0.71367	0.3331	N	0.21448	0.665	0.49582	D	0.999808	D	0.89917	1.0	D	0.83275	0.996	T	0.73874	-0.3845	10	0.49607	T	0.09	-9.1024	15.6143	0.76753	0.0:1.0:0.0:0.0	.	37	Q9UPW8	UN13A_HUMAN	T	37;125;37;37;37;37	ENSP00000429562:A37T;ENSP00000400409:A125T;ENSP00000252773:A37T;ENSP00000447236:A37T;ENSP00000447572:A37T;ENSP00000446831:A37T	ENSP00000252773:A37T	A	-	1	0	UNC13A	17646509	1.000000	0.71417	0.815000	0.32552	0.965000	0.64279	5.939000	0.70179	2.288000	0.76882	0.313000	0.20887	GCG	-	NULL		0.597	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	protein_coding	OTTHUMT00000376169.2	C	XM_038604		17646509	-1	no_errors	NM_001080421	genbank	human	provisional	54_36p	missense	SNP	1	T
PSG7	5676	genome.wustl.edu	37	19	43429963	43429963	+	RNA	SNP	C	C	A	rs184492103	byFrequency	TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr19:43429963C>A	ENST00000406070.2	-	0	1301				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				GCTTTCCTTGCCAGTGGCTGA	0.473																																																0			19											195.0	198.0	197.0					19																	43429963		2201	4300	6501	48121803			5676					19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43429963C>A		Somatic		Capture	Illumina GAIIx	4	48121803	Q15232	Missense_Mutation	SNP	HMMPfam_V-set;HMMPfam_ig;superfamily_Immunoglobulin	p.G402V	ENST00000406070.2	37	c.1205		19																																																																																			-	NULL		0.473	PSG7-001	KNOWN	basic	polymorphic_pseudogene	PSG7	polymorphic_pseudogene	OTTHUMT00000321431.2	C	NM_001206650		48121803	-1	pseudogene	NM_002783	genbank	human	reviewed	54_36p	missense	SNP	0.01	A
SIGLEC6	946	genome.wustl.edu	37	19	52031043	52031043	+	Silent	SNP	T	T	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr19:52031043T>C	ENST00000425629.3	-	7	1300	c.1146A>G	c.(1144-1146)caA>caG	p.Q382Q	SIGLEC6_ENST00000474054.1_5'UTR|SIGLEC6_ENST00000436458.1_Silent_p.Q330Q|SIGLEC6_ENST00000346477.3_Silent_p.Q366Q|SIGLEC6_ENST00000343300.4_Intron|SIGLEC6_ENST00000359982.4_Intron|SIGLEC6_ENST00000391797.3_Intron	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	382					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)	p.Q355Q(1)		endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		CATCCGTGTTTTGCACTGGCT	0.488																																																1	Substitution - coding silent(1)	ovary(1)	19											183.0	181.0	181.0					19																	52031043		1943	4154	6097	56722855	SO:0001819	synonymous_variant	946			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.1146A>G	19.37:g.52031043T>C		Somatic		Capture	Illumina GAIIx	4	56722855	A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Silent	SNP	HMMPfam_I-set;HMMPfam_V-set;HMMPfam_ig;superfamily_Immunoglobulin	p.Q371	ENST00000425629.3	37	c.1113	CCDS12834.3	19																																																																																			-	NULL		0.488	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	protein_coding	OTTHUMT00000257670.3	T	NM_001245		56722855	-1	no_errors	NM_001245	genbank	human	validated	54_36p	silent	SNP		C
MUC16	94025	genome.wustl.edu	37	19	9089509	9089509	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr19:9089509A>T	ENST00000397910.4	-	1	2509	c.2306T>A	c.(2305-2307)gTt>gAt	p.V769D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	769	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.V769D(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGAGGAAAGAACGGCTGAGCT	0.488																																																1	Substitution - Missense(1)	ovary(1)	19											219.0	219.0	219.0					19																	9089509		2070	4225	6295	8950509	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.2306T>A	19.37:g.9089509A>T	ENSP00000381008:p.Val769Asp	Somatic		Capture	Illumina GAIIx	4	8950509	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	HMMPfam_SEA;superfamily_Immunoglobulin;superfamily_SEA domain	p.V769D	ENST00000397910.4	37	c.2306	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	1.000	-0.691152	0.03303	.	.	ENSG00000181143	ENST00000397910	T	0.02863	4.13	1.55	-2.56	0.06268	.	.	.	.	.	T	0.01387	0.0045	N	0.08118	0	.	.	.	B	0.06786	0.001	B	0.06405	0.002	T	0.47573	-0.9107	8	0.87932	D	0	.	0.1159	0.00060	0.3388:0.2439:0.1771:0.2401	.	769	B5ME49	.	D	769	ENSP00000381008:V769D	ENSP00000381008:V769D	V	-	2	0	MUC16	8950509	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.110000	0.10824	-0.928000	0.03761	-1.294000	0.01345	GTT	-	NULL		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	A	NM_024690		8950509	-1	no_errors	NM_024690	genbank	human	validated	54_36p	missense	SNP		T
ZNF264	9422	genome.wustl.edu	37	19	57722724	57722724	+	Missense_Mutation	SNP	G	G	A	rs147396716	byFrequency	TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr19:57722724G>A	ENST00000263095.6	+	4	673	c.259G>A	c.(259-261)Gac>Aac	p.D87N	ZNF264_ENST00000536056.1_Missense_Mutation_p.D87N	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	87					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D87N(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		TCTTTCAGGCGACAAAGGAAA	0.413													.|||	10	0.00199681	0.0076	0.0	5008	,	,		22097	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19						G	ASN/ASP	12,4394	19.1+/-41.9	0,12,2191	41.0	34.0	36.0		259	-0.8	0.0	19	dbSNP_134	36	0,8600		0,0,4300	yes	missense	ZNF264	NM_003417.4	23	0,12,6491	AA,AG,GG		0.0,0.2724,0.0923	possibly-damaging	87/628	57722724	12,12994	2203	4300	6503	62414536	SO:0001583	missense	9422			AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.259G>A	19.37:g.57722724G>A	ENSP00000263095:p.Asp87Asn	Somatic		Capture	Illumina GAIIx	4	62414536	A8K8Y9|Q9P1V0	Missense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.D87N	ENST00000263095.6	37	c.259	CCDS33127.1	19	.	.	.	.	.	.	.	.	.	.	G	8.647	0.897272	0.17686	0.002724	0.0	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.32988	1.43;1.43	2.79	-0.836	0.10770	.	.	.	.	.	T	0.19167	0.0460	L	0.38838	1.175	0.09310	N	1	B	0.21688	0.059	B	0.11329	0.006	T	0.24476	-1.0159	9	0.27082	T	0.32	.	5.2004	0.15260	0.2355:0.1717:0.5928:0.0	.	87	O43296	ZN264_HUMAN	N	87	ENSP00000263095:D87N;ENSP00000440376:D87N	ENSP00000263095:D87N	D	+	1	0	ZNF264	62414536	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-0.370000	0.07523	-0.339000	0.08401	-1.164000	0.01763	GAC	-	NULL		0.413	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF264	protein_coding	OTTHUMT00000465080.1	G			62414536	1	no_errors	NM_003417	genbank	human	validated	54_36p	missense	SNP	0.66	A
ZC3H6	376940	genome.wustl.edu	37	2	113074146	113074146	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr2:113074146G>A	ENST00000409871.1	+	6	1248	c.847G>A	c.(847-849)Gaa>Aaa	p.E283K	ZC3H6_ENST00000343936.4_Missense_Mutation_p.E283K	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	283							metal ion binding (GO:0046872)	p.E283K(1)		central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						ATACTTCCTGGAAGGGAGGTG	0.308																																																1	Substitution - Missense(1)	ovary(1)	2											46.0	43.0	44.0					2																	113074146		1803	4064	5867	112790617	SO:0001583	missense	376940			AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.847G>A	2.37:g.113074146G>A	ENSP00000386764:p.Glu283Lys	Somatic		Capture	Illumina GAIIx	4	112790617	A9JR71|Q6ZW96	Missense_Mutation	SNP	-	p.E283K	ENST00000409871.1	37	c.847	CCDS46393.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.577833	0.96565	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	T;T	0.39997	1.05;1.05	5.67	5.67	0.87782	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.52869	0.1761	N	0.20328	0.56	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53767	-0.8392	10	0.49607	T	0.09	-34.1355	20.1358	0.98028	0.0:0.0:1.0:0.0	.	283	P61129	ZC3H6_HUMAN	K	283;283;260	ENSP00000386764:E283K;ENSP00000340298:E283K	ENSP00000340298:E283K	E	+	1	0	ZC3H6	112790617	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.374000	0.97172	2.833000	0.97629	0.585000	0.79938	GAA	-	NULL		0.308	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H6	protein_coding	OTTHUMT00000330551.1	G	NM_198581		112790617	1	no_errors	NM_198581	genbank	human	validated	54_36p	missense	SNP	1	A
WDR35	57539	genome.wustl.edu	37	2	20153613	20153613	+	Missense_Mutation	SNP	C	C	T	rs200140363		TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr2:20153613C>T	ENST00000345530.3	-	13	1530	c.1415G>A	c.(1414-1416)cGa>cAa	p.R472Q	WDR35_ENST00000416055.2_Missense_Mutation_p.R37Q|WDR35_ENST00000281405.4_Missense_Mutation_p.R461Q	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	472					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)		p.R472Q(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCTTCTTTTCGAGACCGTGT	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		17087	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2											206.0	196.0	199.0					2																	20153613		2203	4300	6503	20017094	SO:0001583	missense	57539			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.1415G>A	2.37:g.20153613C>T	ENSP00000314444:p.Arg472Gln	Somatic		Capture	Illumina GAIIx	4	20017094	B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	-	p.R472Q	ENST00000345530.3	37	c.1415	CCDS33152.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	20.6	4.020374	0.75275	.	.	ENSG00000118965	ENST00000345530;ENST00000281405;ENST00000416055;ENST00000453014	T;T;T;D	0.87256	-0.09;-0.08;-0.69;-2.23	5.65	5.65	0.86999	.	0.058236	0.64402	D	0.000004	D	0.87485	0.6189	L	0.58428	1.81	0.58432	D	0.999999	B;D;P;P	0.62365	0.383;0.991;0.607;0.88	B;P;B;B	0.48677	0.063;0.586;0.107;0.34	D	0.84190	0.0444	10	0.11794	T	0.64	-10.9221	18.7155	0.91673	0.0:1.0:0.0:0.0	.	472;461;472;37	F8WB94;Q9P2L0-2;Q9P2L0;B3KR94	.;.;WDR35_HUMAN;.	Q	472;461;37;7	ENSP00000314444:R472Q;ENSP00000281405:R461Q;ENSP00000399159:R37Q;ENSP00000404409:R7Q	ENSP00000281405:R461Q	R	-	2	0	WDR35	20017094	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.803000	0.62546	2.672000	0.90937	0.561000	0.74099	CGA	-	NULL		0.378	WDR35-001	KNOWN	basic|CCDS	protein_coding	WDR35	protein_coding	OTTHUMT00000207472.2	C	NM_020779		20017094	-1	no_errors	NM_001006657	genbank	human	reviewed	54_36p	missense	SNP	1	T
APOB	338	genome.wustl.edu	37	2	21228859	21228859	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr2:21228859C>G	ENST00000233242.1	-	26	11008	c.10881G>C	c.(10879-10881)aaG>aaC	p.K3627N		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3627					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.K3627N(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTTCTGGTTCTTAGTGTTAG	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											59.0	57.0	58.0					2																	21228859		2203	4300	6503	21082364	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10881G>C	2.37:g.21228859C>G	ENSP00000233242:p.Lys3627Asn	Somatic		Capture	Illumina GAIIx	4	21082364	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	HMMPfam_Vitellogenin_N;HMMPfam_DUF1081;HMMPfam_DUF1943	p.K3627N	ENST00000233242.1	37	c.10881	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	15.93	2.978201	0.53720	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.70631	-0.5	5.61	4.73	0.59995	.	0.809387	0.11201	N	0.588776	T	0.62392	0.2424	L	0.44542	1.39	0.80722	D	1	B	0.26318	0.146	B	0.30716	0.119	T	0.63761	-0.6564	10	0.59425	D	0.04	.	5.3506	0.16034	0.0:0.7264:0.0:0.2736	.	3627	P04114	APOB_HUMAN	N	3627	ENSP00000233242:K3627N	ENSP00000233242:K3627N	K	-	3	2	APOB	21082364	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	1.544000	0.36158	2.642000	0.89623	0.561000	0.74099	AAG	-	NULL		0.488	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	C			21082364	-1	no_errors	NM_000384	genbank	human	reviewed	54_36p	missense	SNP	1	G
DNMT3A	1788	genome.wustl.edu	37	2	25469527	25469527	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr2:25469527A>G	ENST00000264709.3	-	10	1578	c.1241T>C	c.(1240-1242)tTc>tCc	p.F414S	DNMT3A_ENST00000380746.4_Missense_Mutation_p.F225S|DNMT3A_ENST00000402667.1_Missense_Mutation_p.F191S|DNMT3A_ENST00000321117.5_Missense_Mutation_p.F414S|DNMT3A_ENST00000474887.1_5'Flank	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	414					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.F414S(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAAGGCTGGAAGCCCCCCAG	0.632			"""Mis, F, N, S"""		AML																																		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	1	Substitution - Missense(1)	ovary(1)	2											50.0	50.0	50.0					2																	25469527		2202	4296	6498	25323031	SO:0001583	missense	1788				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1241T>C	2.37:g.25469527A>G	ENSP00000264709:p.Phe414Ser	Somatic		Capture	Illumina GAIIx	4	25323031	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	HMMPfam_PWWP;HMMPfam_DNA_methylase;superfamily_FYVE/PHD zinc finger;superfamily_S-adenosyl-L-methionine-dependent methyltransferases;superfamily_Tudor/PWWP/MBT	p.F414S	ENST00000264709.3	37	c.1241	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	A	26.4	4.729810	0.89390	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49	4.87	4.87	0.63330	.	0.115333	0.64402	D	0.000007	D	0.83059	0.5172	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85330	0.1089	10	0.87932	D	0	-8.727	12.4658	0.55757	1.0:0.0:0.0:0.0	.	414;225	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	S	225;414;414;191	ENSP00000370122:F225S;ENSP00000324375:F414S;ENSP00000264709:F414S;ENSP00000384237:F191S	ENSP00000264709:F414S	F	-	2	0	DNMT3A	25323031	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	8.987000	0.93497	2.050000	0.60909	0.533000	0.62120	TTC	-	NULL		0.632	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	protein_coding	OTTHUMT00000211587.1	A	NM_022552		25323031	-1	no_errors	NM_022552	genbank	human	reviewed	54_36p	missense	SNP	1	G
FSHR	2492	genome.wustl.edu	37	2	49190064	49190064	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr2:49190064G>T	ENST00000406846.2	-	10	2015	c.1896C>A	c.(1894-1896)aaC>aaA	p.N632K	FSHR_ENST00000346173.3_Missense_Mutation_p.N570K|FSHR_ENST00000541117.1_Missense_Mutation_p.N368K|FSHR_ENST00000304421.4_Missense_Mutation_p.N606K	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	632					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.N632K(2)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	CTCTGCGAAAGTTTTTGGTAA	0.463									Gonadal Dysgenesis, 46 XX																																							2	Substitution - Missense(2)	ovary(1)|lung(1)	2											80.0	82.0	81.0					2																	49190064		2203	4300	6503	49043568	SO:0001583	missense	2492	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1896C>A	2.37:g.49190064G>T	ENSP00000384708:p.Asn632Lys	Somatic		Capture	Illumina GAIIx	4	49043568	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	-	p.N632K	ENST00000406846.2	37	c.1896	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	G	11.04	1.521950	0.27211	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.35	-0.16	0.13375	.	0.373020	0.30584	N	0.009315	T	0.31358	0.0794	M	0.67953	2.075	0.34427	D	0.698132	B;B;B	0.32717	0.381;0.374;0.381	B;B;B	0.36244	0.11;0.22;0.11	T	0.22906	-1.0203	9	.	.	.	.	5.3237	0.15895	0.5896:0.0:0.2522:0.1581	.	606;570;632	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	K	632;570;606;368	ENSP00000384708:N632K;ENSP00000333908:N570K;ENSP00000306780:N606K;ENSP00000444172:N368K	.	N	-	3	2	FSHR	49043568	0.295000	0.24389	0.993000	0.49108	0.988000	0.76386	-0.335000	0.07873	0.051000	0.15978	0.655000	0.94253	AAC	-	NULL		0.463	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	protein_coding	OTTHUMT00000251367.2	G			49043568	-1	no_errors	NM_000145	genbank	human	reviewed	54_36p	missense	SNP	0.97	T
DQX1	165545	genome.wustl.edu	37	2	74746785	74746785	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr2:74746785T>A	ENST00000404568.3	-	10	1923	c.1704A>T	c.(1702-1704)gaA>gaT	p.E568D	DQX1_ENST00000393951.2_Missense_Mutation_p.E568D	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	568						nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)	p.E450D(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						GTTGCATGAGTTCTAGGAGTT	0.517																																																1	Substitution - Missense(1)	ovary(1)	2											141.0	137.0	138.0					2																	74746785		2203	4300	6503	74600293	SO:0001583	missense	165545			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.1704A>T	2.37:g.74746785T>A	ENSP00000384621:p.Glu568Asp	Somatic		Capture	Illumina GAIIx	4	74600293	Q6B017|Q8NAM8	Missense_Mutation	SNP	-	p.E450D	ENST00000404568.3	37	c.1350	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	T	16.36	3.100597	0.56183	.	.	ENSG00000144045	ENST00000393951;ENST00000404568	T;T	0.03035	4.07;4.07	5.6	3.21	0.36854	Domain of unknown function DUF1605 (1);	0.072484	0.52532	N	0.000064	T	0.01976	0.0062	N	0.13299	0.325	0.32262	N	0.570079	B	0.21821	0.061	B	0.20955	0.032	T	0.30416	-0.9979	10	0.25106	T	0.35	-15.8884	2.0047	0.03475	0.1638:0.0867:0.171:0.5786	.	568	Q8TE96	DQX1_HUMAN	D	568	ENSP00000377523:E568D;ENSP00000384621:E568D	ENSP00000377523:E568D	E	-	3	2	DQX1	74600293	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.203000	0.32284	0.917000	0.36895	0.482000	0.46254	GAA	-	NULL		0.517	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DQX1	protein_coding	OTTHUMT00000252230.3	T	NM_133637		74600293	-1	no_errors	NM_133637	genbank	human	validated	54_36p	missense	SNP	0.99	A
CCDC148	130940	genome.wustl.edu	37	2	159170270	159170270	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr2:159170270A>T	ENST00000283233.5	-	8	1214	c.901T>A	c.(901-903)Ttg>Atg	p.L301M	CCDC148_ENST00000536771.1_Missense_Mutation_p.L215M|CCDC148_ENST00000409187.1_Missense_Mutation_p.L310M	NM_138803.3	NP_620158.3	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	301								p.L301M(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						GTACTCACCAAATCATGCCTA	0.353																																																1	Substitution - Missense(1)	ovary(1)	2											99.0	100.0	99.0					2																	159170270		2203	4300	6503	158878516	SO:0001583	missense	130940				CCDS33304.1	2q24.1	2007-12-07			ENSG00000153237	ENSG00000153237			25191	protein-coding gene	gene with protein product							Standard	NM_138803		Approved	MGC125588	uc002tzq.3	Q8NFR7	OTTHUMG00000153973	ENST00000283233.5:c.901T>A	2.37:g.159170270A>T	ENSP00000283233:p.Leu301Met	Somatic		Capture	Illumina GAIIx	4	158878516	F5H839|Q3B7I3|Q3B7I4|Q3KR41|Q4ZG12|Q4ZG23|Q53TM6|Q96BN5|Q96LM2	Missense_Mutation	SNP	-	p.L301M	ENST00000283233.5	37	c.901	CCDS33304.1	2	.	.	.	.	.	.	.	.	.	.	A	17.01	3.278053	0.59758	.	.	ENSG00000153237	ENST00000283233;ENST00000375617;ENST00000409187;ENST00000536771	T;T;T	0.42131	1.39;1.39;0.98	5.25	4.2	0.49525	.	.	.	.	.	T	0.58206	0.2106	M	0.76002	2.32	0.37871	D	0.930072	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	T	0.61212	-0.7108	9	0.48119	T	0.1	-7.0146	5.1797	0.15154	0.7663:0.0:0.2337:0.0	.	215;149;149;310;301	F5H839;C9JR76;Q8NFR7-2;B8ZZV3;Q8NFR7	.;.;.;.;CC148_HUMAN	M	301;149;310;215	ENSP00000283233:L301M;ENSP00000386674:L310M;ENSP00000443740:L215M	ENSP00000283233:L301M	L	-	1	2	CCDC148	158878516	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	3.872000	0.56085	0.817000	0.34445	0.460000	0.39030	TTG	-	NULL		0.353	CCDC148-001	KNOWN	basic|CCDS	protein_coding	CCDC148	protein_coding	OTTHUMT00000333270.1	A	NM_138803		158878516	-1	no_errors	NM_138803	genbank	human	provisional	54_36p	missense	SNP	1	T
CBLN4	140689	genome.wustl.edu	37	20	54579077	54579077	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr20:54579077C>A	ENST00000064571.2	-	1	1451	c.151G>T	c.(151-153)Gac>Tac	p.D51Y		NM_080617.5	NP_542184.1	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	51					protein secretion (GO:0009306)	cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)		p.D51Y(1)		endometrium(2)|large_intestine(1)|lung(10)|ovary(3)|pancreas(1)	17			Colorectal(105;0.202)			CCCTTGGAGTCCGTGGCCGGG	0.682																																																1	Substitution - Missense(1)	ovary(1)	20											62.0	62.0	62.0					20																	54579077		2203	4300	6503	54012484	SO:0001583	missense	140689			AY358527	CCDS13448.1	20q13	2004-08-19	2004-08-19	2004-08-19	ENSG00000054803	ENSG00000054803			16231	protein-coding gene	gene with protein product		615029	"""cerebellin precursor-like 1"""	CBLNL1			Standard	NM_080617		Approved	dJ885A10.1	uc002xxa.4	Q9NTU7	OTTHUMG00000032782	ENST00000064571.2:c.151G>T	20.37:g.54579077C>A	ENSP00000064571:p.Asp51Tyr	Somatic		Capture	Illumina GAIIx	4	54012484	A8K0S5	Missense_Mutation	SNP	-	p.D51Y	ENST00000064571.2	37	c.151	CCDS13448.1	20	.	.	.	.	.	.	.	.	.	.	C	32	5.122235	0.94429	.	.	ENSG00000054803	ENST00000064571	D	0.85629	-2.01	5.16	5.16	0.70880	.	0.144833	0.64402	D	0.000005	D	0.88749	0.6521	M	0.66939	2.045	0.80722	D	1	D	0.54047	0.964	P	0.50791	0.65	D	0.90180	0.4242	10	0.87932	D	0	-29.2465	19.0208	0.92915	0.0:1.0:0.0:0.0	.	51	Q9NTU7	CBLN4_HUMAN	Y	51	ENSP00000064571:D51Y	ENSP00000064571:D51Y	D	-	1	0	CBLN4	54012484	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.550000	0.67268	2.563000	0.86464	0.655000	0.94253	GAC	-	NULL		0.682	CBLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN4	protein_coding	OTTHUMT00000079783.2	C	NM_080617		54012484	-1	no_errors	NM_080617	genbank	human	reviewed	54_36p	missense	SNP	1	A
DIDO1	11083	genome.wustl.edu	37	20	61527958	61527958	+	Missense_Mutation	SNP	C	C	T	rs376360803		TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr20:61527958C>T	ENST00000266070.4	-	7	2304	c.1979G>A	c.(1978-1980)aGt>aAt	p.S660N	DIDO1_ENST00000395340.1_Missense_Mutation_p.S660N|DIDO1_ENST00000395335.2_Missense_Mutation_p.S660N|DIDO1_ENST00000395343.1_Missense_Mutation_p.S660N	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	660					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.S660N(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TGGTGCAGCACTCATAGCCCC	0.517																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)											1	Substitution - Missense(1)	ovary(1)	20						C	ASN/SER,ASN/SER,ASN/SER,ASN/SER	0,4406		0,0,2203	90.0	103.0	99.0		1979,1979,1979,1979	3.0	0.0	20		99	1,8599		0,1,4299	no	missense,missense,missense,missense	DIDO1	NM_001193369.1,NM_001193370.1,NM_033081.2,NM_080797.3	46,46,46,46	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign	660/2241,660/1190,660/2241,660/1190	61527958	1,13005	2203	4300	6503	60998403	SO:0001583	missense	11083			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1979G>A	20.37:g.61527958C>T	ENSP00000266070:p.Ser660Asn	Somatic		Capture	Illumina GAIIx	4	60998403	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	-	p.S660N	ENST00000266070.4	37	c.1979	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	C	11.27	1.589038	0.28357	0.0	1.16E-4	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.13538	2.94;2.94;2.58;2.58	5.95	3.01	0.34805	Transcription elongation factor S-II, central domain (1);	0.260582	0.26859	N	0.022129	T	0.07188	0.0182	N	0.15975	0.35	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.08055	0.002;0.003	T	0.35500	-0.9786	10	0.23302	T	0.38	-7.2435	8.3859	0.32499	0.0:0.7012:0.0:0.2988	.	660;660	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	N	660	ENSP00000266070:S660N;ENSP00000378752:S660N;ENSP00000378749:S660N;ENSP00000378744:S660N	ENSP00000266070:S660N	S	-	2	0	DIDO1	60998403	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.451000	0.21779	0.866000	0.35629	0.655000	0.94253	AGT	-	NULL		0.517	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	protein_coding	OTTHUMT00000080091.2	C	NM_080796		60998403	-1	no_errors	NM_033081	genbank	human	reviewed	54_36p	missense	SNP		T
MYH15	22989	genome.wustl.edu	37	3	108129646	108129646	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr3:108129646C>T	ENST00000273353.3	-	32	4395	c.4339G>A	c.(4339-4341)Gtc>Atc	p.V1447I		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1447						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.V1447I(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						GCAGAGCGGACCTTCCCGAGG	0.647																																																1	Substitution - Missense(1)	ovary(1)	3											37.0	38.0	38.0					3																	108129646		2040	4195	6235	109612336	SO:0001583	missense	22989			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.4339G>A	3.37:g.108129646C>T	ENSP00000273353:p.Val1447Ile	Somatic		Capture	Illumina GAIIx	4	109612336		Missense_Mutation	SNP	-	p.V1447I	ENST00000273353.3	37	c.4339	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	C	10.72	1.430522	0.25726	.	.	ENSG00000144821	ENST00000273353	T	0.78246	-1.16	5.31	2.36	0.29203	Myosin tail (1);	.	.	.	.	T	0.68155	0.2970	N	0.22421	0.69	0.09310	N	0.999998	B	0.23442	0.085	B	0.35770	0.21	T	0.62784	-0.6781	9	0.87932	D	0	.	7.9173	0.29825	0.4034:0.5244:0.0:0.0723	.	1447	Q9Y2K3	MYH15_HUMAN	I	1447	ENSP00000273353:V1447I	ENSP00000273353:V1447I	V	-	1	0	MYH15	109612336	0.509000	0.26163	0.031000	0.17742	0.107000	0.19398	0.698000	0.25571	0.609000	0.30018	0.561000	0.74099	GTC	-	NULL		0.647	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	protein_coding	OTTHUMT00000353935.1	C	XM_036988		109612336	-1	no_errors	NM_014981	genbank	human	validated	54_36p	missense	SNP	0.88	T
HPS3	84343	genome.wustl.edu	37	3	148877927	148877927	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr3:148877927C>T	ENST00000296051.2	+	11	2107	c.1967C>T	c.(1966-1968)cCt>cTt	p.P656L	HPS3_ENST00000460120.1_Missense_Mutation_p.P491L	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	656					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)		p.P656L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			AATATTAATCCTTTAACTGCC	0.423									Hermansky-Pudlak syndrome																																							1	Substitution - Missense(1)	ovary(1)	3											145.0	146.0	146.0					3																	148877927		2203	4300	6503	150360617	SO:0001583	missense	84343	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1967C>T	3.37:g.148877927C>T	ENSP00000296051:p.Pro656Leu	Somatic		Capture	Illumina GAIIx	4	150360617	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	-	p.P656L	ENST00000296051.2	37	c.1967	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507794	0.85282	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.68765	-0.35;-0.34	5.41	5.41	0.78517	.	0.049965	0.85682	D	0.000000	T	0.81148	0.4762	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82228	-0.0561	10	0.87932	D	0	-20.096	19.5526	0.95328	0.0:1.0:0.0:0.0	.	491;656	G5E9V4;Q969F9	.;HPS3_HUMAN	L	656;491	ENSP00000296051:P656L;ENSP00000418230:P491L	ENSP00000296051:P656L	P	+	2	0	HPS3	150360617	1.000000	0.71417	0.210000	0.23637	0.965000	0.64279	6.162000	0.71874	2.701000	0.92244	0.563000	0.77884	CCT	-	NULL		0.423	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	protein_coding	OTTHUMT00000356151.1	C	NM_032383		150360617	1	no_errors	NM_032383	genbank	human	reviewed	54_36p	missense	SNP	0.58	T
GMPS	8833	genome.wustl.edu	37	3	155654195	155654195	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr3:155654195C>T	ENST00000496455.2	+	15	2211	c.1876C>T	c.(1876-1878)Caa>Taa	p.Q626*	GMPS_ENST00000295920.7_Nonsense_Mutation_p.Q527*	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	626					glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)	p.Q626*(1)		breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	GGACCCACTTCAAAAGCAGCC	0.443			T	MLL	AML																																Ovarian(153;896 1876 4149 15499 28134)		Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	1	Substitution - Nonsense(1)	ovary(1)	3											127.0	118.0	121.0					3																	155654195		1866	4101	5967	157136889	SO:0001587	stop_gained	8833			U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1876C>T	3.37:g.155654195C>T	ENSP00000419851:p.Gln626*	Somatic		Capture	Illumina GAIIx	4	157136889	A8K639|B4DXV7|F8W720	Nonsense_Mutation	SNP	HMMPfam_GATase;HMMPfam_GMP_synt_C;HMMPfam_ExsB;superfamily_Class I glutamine amidotransferase-like;superfamily_Adenine nucleotide alpha hydrolases-like;superfamily_GMP synthetase C-terminal dimerisation domain	p.Q626*	ENST00000496455.2	37	c.1876	CCDS46941.1	3	.	.	.	.	.	.	.	.	.	.	C	41	9.076957	0.99057	.	.	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-12.6304	19.4655	0.94935	0.0:1.0:0.0:0.0	.	.	.	.	X	626;527;575;626	.	ENSP00000295920:Q527X	Q	+	1	0	GMPS	157136889	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.354000	0.79424	2.580000	0.87095	0.561000	0.74099	CAA	-	HMMPfam_GMP_synt_C		0.443	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPS	protein_coding	OTTHUMT00000351260.2	C			157136889	1	no_errors	NM_003875	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
SMARCAD1	56916	genome.wustl.edu	37	4	95155254	95155254	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr4:95155254G>A	ENST00000354268.4	+	4	591	c.518G>A	c.(517-519)aGt>aAt	p.S173N	SMARCAD1_ENST00000457823.2_Missense_Mutation_p.S173N			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	173	CUE 1. {ECO:0000255|PROSITE- ProRule:PRU00468}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.S173N(1)		breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		ccacaaagaagtgacaatgat	0.343																																																1	Substitution - Missense(1)	ovary(1)	4											39.0	36.0	37.0					4																	95155254		2203	4300	6503	95374277	SO:0001583	missense	56916			AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.518G>A	4.37:g.95155254G>A	ENSP00000346217:p.Ser173Asn	Somatic		Capture	Illumina GAIIx	4	95374277	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	-	p.S173N	ENST00000354268.4	37	c.518	CCDS3639.1	4	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464260	0.43736	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000536267;ENST00000354268	T;T;T	0.17054	2.3;2.3;2.3	5.81	5.81	0.92471	Ubiquitin system component Cue (1);	0.689279	0.12737	N	0.443392	T	0.12390	0.0301	N	0.14661	0.345	0.80722	D	1	B;B	0.11235	0.002;0.004	B;B	0.09377	0.002;0.004	T	0.21075	-1.0256	10	0.24483	T	0.36	-2.0744	15.5785	0.76414	0.0:0.0:1.0:0.0	.	173;173	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	N	173	ENSP00000351947:S173N;ENSP00000415576:S173N;ENSP00000346217:S173N	ENSP00000346217:S173N	S	+	2	0	SMARCAD1	95374277	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.612000	0.36889	2.736000	0.93811	0.655000	0.94253	AGT	-	NULL		0.343	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMARCAD1	protein_coding	OTTHUMT00000253583.1	G	NM_020159		95374277	1	no_errors	NM_020159	genbank	human	validated	54_36p	missense	SNP	1	A
FASTKD3	79072	genome.wustl.edu	37	5	7867093	7867093	+	Silent	SNP	A	A	G			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr5:7867093A>G	ENST00000264669.5	-	2	1240	c.1104T>C	c.(1102-1104)ccT>ccC	p.P368P	FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000341013.6_5'Flank|MTRR_ENST00000440940.2_5'Flank|MTRR_ENST00000502509.1_Intron	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	368					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.P368P(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AGACAACTTCAGGATCCAACG	0.458																																																1	Substitution - coding silent(1)	ovary(1)	5											72.0	71.0	72.0					5																	7867093		2203	4300	6503	7920093	SO:0001819	synonymous_variant	79072			AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.1104T>C	5.37:g.7867093A>G		Somatic		Capture	Illumina GAIIx	4	7920093	Q9BVD3	Silent	SNP	HMMPfam_FAST_1;HMMPfam_FAST_2;HMMPfam_RAP	p.P368	ENST00000264669.5	37	c.1104	CCDS3873.1	5																																																																																			-	NULL		0.458	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD3	protein_coding	OTTHUMT00000253673.1	A	NM_024091		7920093	-1	no_errors	NM_024091	genbank	human	validated	54_36p	silent	SNP	0.65	G
UGT3A1	133688	genome.wustl.edu	37	5	35954511	35954511	+	Silent	SNP	C	C	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr5:35954511C>A	ENST00000274278.3	-	7	1722	c.1365G>T	c.(1363-1365)ctG>ctT	p.L455L	UGT3A1_ENST00000513233.1_5'Flank	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	455						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.L455L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCCAGCCCACCAGCCGCTGTG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	5											54.0	46.0	49.0					5																	35954511		2203	4300	6503	35990268	SO:0001819	synonymous_variant	133688				CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.1365G>T	5.37:g.35954511C>A		Somatic		Capture	Illumina GAIIx	4	35990268	G5E961|Q8IYS9|Q8NAW4|Q96DM6	Silent	SNP	-	p.L455	ENST00000274278.3	37	c.1365	CCDS3913.1	5																																																																																			-	NULL		0.607	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A1	protein_coding	OTTHUMT00000253770.2	C	NM_152404		35990268	-1	no_errors	NM_152404	genbank	human	provisional	54_36p	silent	SNP	1	A
NIPBL	25836	genome.wustl.edu	37	5	37020619	37020619	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr5:37020619A>G	ENST00000282516.8	+	26	5568	c.5069A>G	c.(5068-5070)aAa>aGa	p.K1690R	NIPBL_ENST00000448238.2_Missense_Mutation_p.K1690R	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1690					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.K1690R(1)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GAAACAGAAAAAGCAATGAAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	5											88.0	84.0	85.0					5																	37020619		2203	4300	6503	37056376	SO:0001583	missense	25836			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.5069A>G	5.37:g.37020619A>G	ENSP00000282516:p.Lys1690Arg	Somatic		Capture	Illumina GAIIx	4	37056376	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM repeat	p.K1690R	ENST00000282516.8	37	c.5069	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	A	15.56	2.869518	0.51588	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.93189	-3.18;-3.18	5.68	4.52	0.55395	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88973	0.6583	L	0.39692	1.235	0.50171	D	0.999857	B;B	0.24483	0.063;0.104	B;B	0.30782	0.056;0.12	T	0.81972	-0.0688	10	0.10902	T	0.67	.	11.64	0.51227	0.9305:0.0:0.0695:0.0	.	1690;1690	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	R	1690	ENSP00000282516:K1690R;ENSP00000406266:K1690R	ENSP00000282516:K1690R	K	+	2	0	NIPBL	37056376	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.166000	0.77553	0.988000	0.38734	0.528000	0.53228	AAA	-	NULL		0.373	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	protein_coding	OTTHUMT00000207582.1	A	NM_015384		37056376	1	no_errors	NM_133433	genbank	human	reviewed	54_36p	missense	SNP	1	G
SPINK6	404203	genome.wustl.edu	37	5	147593481	147593481	+	Silent	SNP	T	T	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr5:147593481T>C	ENST00000325630.2	+	3	346	c.90T>C	c.(88-90)tgT>tgC	p.C30C		NM_001195290.1|NM_205841.3	NP_001182219.1|NP_995313.2	Q6UWN8	ISK6_HUMAN	serine peptidase inhibitor, Kazal type 6	30	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.C30C(1)		endometrium(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTTGACTGTGGTGAGTTCC	0.458																																																1	Substitution - coding silent(1)	ovary(1)	5											136.0	109.0	118.0					5																	147593481		2203	4300	6503	147573674	SO:0001819	synonymous_variant	404203			AY358716	CCDS34268.1	5q32	2011-08-31	2005-08-17		ENSG00000178172	ENSG00000178172		"""Serine peptidase inhibitors, Kazal type"""	29486	protein-coding gene	gene with protein product	"""protease inhibitor H"""	615868	"""serine protease inhibitor, Kazal type 6"""			15060002	Standard	NM_205841		Approved	MGC21394, UNQ844, BUSI2	uc021yff.1	Q6UWN8	OTTHUMG00000163425	ENST00000325630.2:c.90T>C	5.37:g.147593481T>C		Somatic		Capture	Illumina GAIIx	4	147573674	E0X656|Q8N5P0	Silent	SNP	HMMPfam_Kazal_1;superfamily_Kazal-type serine protease inhibitors	p.C30	ENST00000325630.2	37	c.90	CCDS34268.1	5																																																																																			-	HMMPfam_Kazal_1		0.458	SPINK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPINK6	protein_coding	OTTHUMT00000373332.1	T	NM_205841		147573674	1	no_errors	NM_205841	genbank	human	validated	54_36p	silent	SNP	0.42	C
MOG	4340	genome.wustl.edu	37	6	29638162	29638162	+	Nonsense_Mutation	SNP	C	C	T	rs201832372		TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr6:29638162C>T	ENST00000376917.3	+	6	926	c.697C>T	c.(697-699)Cga>Tga	p.R233*	MOG_ENST00000533330.2_3'UTR|MOG_ENST00000396701.2_Intron|MOG_ENST00000494692.1_Intron|MOG_ENST00000490427.1_Intron|MOG_ENST00000396704.3_Intron|MOG_ENST00000483013.1_Intron|MOG_ENST00000431798.2_Intron|MOG_ENST00000416766.2_Nonsense_Mutation_p.R195*|MOG_ENST00000376902.3_3'UTR|MOG_ENST00000376898.3_Nonsense_Mutation_p.R233*|MOG_ENST00000376888.2_Nonsense_Mutation_p.R117*|MOG_ENST00000376891.4_Intron|MOG_ENST00000376894.4_Nonsense_Mutation_p.R233*	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein	233					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R233*(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						CTGGCTACATCGAAGACTAGC	0.522																																																2	Substitution - Nonsense(2)	ovary(1)|endometrium(1)	6											191.0	186.0	188.0					6																	29638162		2203	4300	6503	29746141	SO:0001587	stop_gained	4340				CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099	ENST00000376917.3:c.697C>T	6.37:g.29638162C>T	ENSP00000366115:p.Arg233*	Somatic		Capture	Illumina GAIIx	4	29746141	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Nonsense_Mutation	SNP	HMMPfam_V-set;superfamily_Immunoglobulin	p.R233*	ENST00000376917.3	37	c.697	CCDS34370.1	6	.	.	.	.	.	.	.	.	.	.	C	36	5.753847	0.96890	.	.	ENSG00000204655	ENST00000376917;ENST00000376888;ENST00000376894;ENST00000416766;ENST00000376898	.	.	.	5.68	3.88	0.44766	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.4616	0.38787	0.162:0.6821:0.1558:0.0	.	.	.	.	X	233;117;233;195;233	.	ENSP00000366085:R117X	R	+	1	2	MOG	29746141	0.298000	0.24417	0.993000	0.49108	0.997000	0.91878	0.246000	0.18160	0.718000	0.32166	0.561000	0.74099	CGA	-	NULL		0.522	MOG-001	KNOWN	basic|CCDS	protein_coding	MOG	protein_coding	OTTHUMT00000076160.3	C	NM_002433		29746141	1	no_errors	NM_002433	genbank	human	reviewed	54_36p	nonsense	SNP	0.99	T
PKHD1	5314	genome.wustl.edu	37	6	51909856	51909856	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr6:51909856G>C	ENST00000371117.3	-	25	2898	c.2623C>G	c.(2623-2625)Cct>Gct	p.P875A	PKHD1_ENST00000340994.4_Missense_Mutation_p.P875A	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	875					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.P875A(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GCTGCAGCAGGATTCACTCCA	0.428																																																1	Substitution - Missense(1)	ovary(1)	6											97.0	87.0	91.0					6																	51909856		2203	4299	6502	52017815	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2623C>G	6.37:g.51909856G>C	ENSP00000360158:p.Pro875Ala	Somatic		Capture	Illumina GAIIx	4	52017815	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	HMMPfam_TIG;superfamily_Pectin lyase-like;superfamily_E set domains;superfamily_Anthrax protective antigen	p.P875A	ENST00000371117.3	37	c.2623	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	G	9.158	1.017919	0.19355	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.86865	-1.98;-2.18	5.25	3.37	0.38596	.	0.159028	0.43919	N	0.000503	D	0.83843	0.5342	M	0.64260	1.97	0.09310	N	0.999991	D;D	0.89917	0.997;1.0	D;D	0.69654	0.942;0.965	T	0.76479	-0.2944	10	0.06099	T	0.92	.	13.5375	0.61653	0.0:0.2989:0.7011:0.0	.	875;875	P08F94-2;P08F94	.;PKHD1_HUMAN	A	875	ENSP00000360158:P875A;ENSP00000341097:P875A	ENSP00000341097:P875A	P	-	1	0	PKHD1	52017815	1.000000	0.71417	0.044000	0.18714	0.307000	0.27823	3.636000	0.54317	0.637000	0.30526	0.655000	0.94253	CCT	-	NULL		0.428	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	protein_coding	OTTHUMT00000040893.1	G	NM_138694		52017815	-1	no_errors	NM_138694	genbank	human	reviewed	54_36p	missense	SNP	0.28	C
HGF	3082	genome.wustl.edu	37	7	81336664	81336664	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr7:81336664C>A	ENST00000222390.5	-	14	1784	c.1558G>T	c.(1558-1560)Gga>Tga	p.G520*	HGF_ENST00000457544.2_Nonsense_Mutation_p.G515*	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	520	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)	p.G520*(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						AATGATCCTCCGCAGATATGT	0.378																																																1	Substitution - Nonsense(1)	ovary(1)	7											80.0	78.0	79.0					7																	81336664		2202	4300	6502	81174600	SO:0001587	stop_gained	3082				CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.1558G>T	7.37:g.81336664C>A	ENSP00000222390:p.Gly520*	Somatic		Capture	Illumina GAIIx	4	81174600	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Nonsense_Mutation	SNP	HMMPfam_Kringle;HMMPfam_Trypsin;HMMPfam_PAN_1;superfamily_Trypsin-like serine proteases;superfamily_Kringle-like;superfamily_Hairpin loop containing domain-like	p.G520*	ENST00000222390.5	37	c.1558	CCDS5597.1	7	.	.	.	.	.	.	.	.	.	.	C	38	7.221044	0.98143	.	.	ENSG00000019991	ENST00000222390;ENST00000457544	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.664	0.95886	0.0:1.0:0.0:0.0	.	.	.	.	X	520;515	.	ENSP00000222390:G520X	G	-	1	0	HGF	81174600	1.000000	0.71417	0.992000	0.48379	0.994000	0.84299	6.474000	0.73578	2.713000	0.92767	0.585000	0.79938	GGA	-	HMMPfam_Trypsin		0.378	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGF	protein_coding	OTTHUMT00000253315.2	C	NM_000601		81174600	-1	no_errors	NM_000601	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
CACNA2D1	781	genome.wustl.edu	37	7	81599244	81599244	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr7:81599244C>G	ENST00000356253.5	-	28	2552	c.2297G>C	c.(2296-2298)aGg>aCg	p.R766T	CACNA2D1_ENST00000535308.1_Intron|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.R754T			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	766					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R754T(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	ATCTAGGCTCCTTTTATAGAA	0.343																																																1	Substitution - Missense(1)	ovary(1)	7											148.0	145.0	146.0					7																	81599244		2203	4299	6502	81437180	SO:0001583	missense	781			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2297G>C	7.37:g.81599244C>G	ENSP00000348589:p.Arg766Thr	Somatic		Capture	Illumina GAIIx	4	81437180	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	HMMPfam_VWA;HMMPfam_Cache_1;HMMPfam_VWA_N;HMMPfam_VGCC_alpha2;superfamily_vWA-like	p.R754T	ENST00000356253.5	37	c.2261		7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.2|29.2	4.982221|4.982221	0.93044|0.93044	.|.	.|.	ENSG00000153956|ENSG00000153956	ENST00000443883|ENST00000356860;ENST00000284088;ENST00000356253	.|T;T	.|0.77620	.|-1.11;-1.11	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.88941|0.88941	0.6574|0.6574	M|M	0.78801|0.78801	2.425|2.425	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.78314	.|0.991	D|D	0.89310|0.89310	0.3632|0.3632	5|10	.|0.87932	.|D	.|0	-17.555|-17.555	20.0896|20.0896	0.97814|0.97814	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|754	.|P54289-2	.|.	R|T	265|754;773;766	.|ENSP00000349320:R754T;ENSP00000348589:R766T	.|ENSP00000284088:R773T	G|R	-|-	1|2	0|0	CACNA2D1|CACNA2D1	81437180|81437180	0.989000|0.989000	0.36119|0.36119	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.374000|7.374000	0.79633|0.79633	2.741000|2.741000	0.93983|0.93983	0.650000|0.650000	0.86243|0.86243	GGA|AGG	-	NULL		0.343	CACNA2D1-201	KNOWN	basic	protein_coding	CACNA2D1	protein_coding		C			81437180	-1	no_errors	NM_000722	genbank	human	reviewed	54_36p	missense	SNP	1	G
PMPCB	9512	genome.wustl.edu	37	7	102948151	102948151	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr7:102948151G>C	ENST00000249269.4	+	7	883	c.845G>C	c.(844-846)aGt>aCt	p.S282T	PMPCB_ENST00000428154.1_Missense_Mutation_p.S282T|PMPCB_ENST00000420236.2_Missense_Mutation_p.S177T	NM_004279.2	NP_004270.2	O75439	MPPB_HUMAN	peptidase (mitochondrial processing) beta	282					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.S282T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(9)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTCACAGGAAGTGAGGTAGGG	0.398																																																1	Substitution - Missense(1)	ovary(1)	7											80.0	69.0	73.0					7																	102948151		2203	4300	6503	102735387	SO:0001583	missense	9512			AF054182	CCDS5730.1	7q22.1	2007-07-30			ENSG00000105819	ENSG00000105819			9119	protein-coding gene	gene with protein product		603131				9653160	Standard	XM_005250717		Approved	MPPB, MPPP52	uc003vbl.3	O75439	OTTHUMG00000157205	ENST00000249269.4:c.845G>C	7.37:g.102948151G>C	ENSP00000249269:p.Ser282Thr	Somatic		Capture	Illumina GAIIx	4	102735387	O60416|Q96FV4	Missense_Mutation	SNP	-	p.S282T	ENST00000249269.4	37	c.845	CCDS5730.1	7	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970670	0.92919	.	.	ENSG00000105819	ENST00000249269;ENST00000428154;ENST00000420236	T;T;T	0.28454	1.61;1.61;1.61	5.92	5.92	0.95590	Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.65801	0.2726	M	0.90198	3.095	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.976;0.999;0.999;0.999;0.999;0.999;0.997	D;D;D;D;D;D;D	0.73380	0.933;0.972;0.979;0.979;0.979;0.979;0.98	T	0.71474	-0.4582	10	0.87932	D	0	.	20.3206	0.98668	0.0:0.0:1.0:0.0	.	177;177;282;282;273;282;282	E7ERZ4;B4DM90;A8K1E9;B3KM34;Q96CP5;O75439;G3V0E4	.;.;.;.;.;MPPB_HUMAN;.	T	282;282;177	ENSP00000249269:S282T;ENSP00000390035:S282T;ENSP00000410393:S177T	ENSP00000249269:S282T	S	+	2	0	PMPCB	102735387	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.301000	0.96167	2.809000	0.96659	0.655000	0.94253	AGT	-	NULL		0.398	PMPCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMPCB	protein_coding	OTTHUMT00000347913.1	G	NM_004279		102735387	1	no_errors	NM_004279	genbank	human	reviewed	54_36p	missense	SNP	1	C
CSMD3	114788	genome.wustl.edu	37	8	113364664	113364664	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr8:113364664T>C	ENST00000297405.5	-	39	6480	c.6236A>G	c.(6235-6237)gAt>gGt	p.D2079G	CSMD3_ENST00000455883.2_Missense_Mutation_p.D1975G|CSMD3_ENST00000343508.3_Missense_Mutation_p.D2039G|CSMD3_ENST00000352409.3_Missense_Mutation_p.D2009G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2079	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D2079G(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATATCCTTGATCACACTGAAA	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - Missense(1)	ovary(1)	8											96.0	88.0	90.0					8																	113364664		2203	4298	6501	113433840	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6236A>G	8.37:g.113364664T>C	ENSP00000297405:p.Asp2079Gly	Somatic		Capture	Illumina GAIIx	4	113433840	Q96PZ3	Missense_Mutation	SNP	HMMPfam_Sushi;HMMPfam_CUB;superfamily_Spermadhesin CUB domain;superfamily_Complement control module/SCR domain	p.D2079G	ENST00000297405.5	37	c.6236	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	T	21.8	4.200021	0.79015	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26	4.96	4.96	0.65561	Complement control module (2);Sushi/SCR/CCP (3);	0.221239	0.36338	N	0.002641	T	0.78253	0.4254	M	0.79693	2.465	0.54753	D	0.999987	P;B;D	0.53619	0.516;0.026;0.961	B;B;P	0.55345	0.281;0.063;0.774	T	0.81081	-0.1094	10	0.52906	T	0.07	.	15.0773	0.72087	0.0:0.0:0.0:1.0	.	1975;2079;2039	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	G	2039;2079;1349;1975;2009	ENSP00000345799:D2039G;ENSP00000297405:D2079G;ENSP00000341558:D1349G;ENSP00000412263:D1975G;ENSP00000343124:D2009G	ENSP00000297405:D2079G	D	-	2	0	CSMD3	113433840	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.977000	0.63792	2.205000	0.71048	0.533000	0.62120	GAT	-	HMMPfam_Sushi		0.368	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	T	NM_052900		113433840	-1	no_errors	NM_198123	genbank	human	validated	54_36p	missense	SNP	1	C
GSDMC	56169	genome.wustl.edu	37	8	130760777	130760777	+	Silent	SNP	G	G	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr8:130760777G>C	ENST00000276708.4	-	14	2378	c.1497C>G	c.(1495-1497)ctC>ctG	p.L499L		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	499						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)		p.L499L(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						GCAGCAACGAGAGAGTCCCAT	0.587																																																1	Substitution - coding silent(1)	ovary(1)	8											129.0	122.0	124.0					8																	130760777		2203	4300	6503	130829959	SO:0001819	synonymous_variant	56169			AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.1497C>G	8.37:g.130760777G>C		Somatic		Capture	Illumina GAIIx	4	130829959	Q5XKF3|Q6P494	Silent	SNP	-	p.L499	ENST00000276708.4	37	c.1497	CCDS6360.1	8																																																																																			-	NULL		0.587	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	protein_coding	OTTHUMT00000380586.1	G			130829959	-1	no_errors	NM_031415	genbank	human	validated	54_36p	silent	SNP		C
VCPIP1	80124	genome.wustl.edu	37	8	67577186	67577186	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr8:67577186C>A	ENST00000310421.4	-	1	2266	c.2008G>T	c.(2008-2010)Ggt>Tgt	p.G670C	C8orf44_ENST00000519561.1_5'Flank|C8orf44_ENST00000521889.1_5'Flank|C8orf44-SGK3_ENST00000519289.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	670					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)	p.G670C(1)		breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			GCGTGAGCACCATCTATATTT	0.388																																					NSCLC(179;265 2915 6144 43644)											1	Substitution - Missense(1)	ovary(1)	8											159.0	167.0	164.0					8																	67577186		2203	4300	6503	67739740	SO:0001583	missense	80124			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.2008G>T	8.37:g.67577186C>A	ENSP00000309031:p.Gly670Cys	Somatic		Capture	Illumina GAIIx	4	67739740	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	-	p.G670C	ENST00000310421.4	37	c.2008	CCDS6192.1	8	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744979	0.49151	.	.	ENSG00000175073	ENST00000310421	T	0.35421	1.31	5.25	5.25	0.73442	.	0.051121	0.85682	D	0.000000	T	0.52805	0.1757	L	0.47716	1.5	0.80722	D	1	D	0.71674	0.998	P	0.61397	0.888	T	0.54536	-0.8279	10	0.87932	D	0	-12.679	19.2059	0.93729	0.0:1.0:0.0:0.0	.	670	Q96JH7	VCIP1_HUMAN	C	670	ENSP00000309031:G670C	ENSP00000309031:G670C	G	-	1	0	VCPIP1	67739740	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.887000	0.63156	2.587000	0.87381	0.655000	0.94253	GGT	-	NULL		0.388	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCPIP1	protein_coding	OTTHUMT00000379227.1	C			67739740	-1	no_errors	NM_025054	genbank	human	validated	54_36p	missense	SNP	1	A
CPA6	57094	genome.wustl.edu	37	8	68396077	68396077	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr8:68396077T>A	ENST00000297770.4	-	8	979	c.764A>T	c.(763-765)aAa>aTa	p.K255I	CPA6_ENST00000518549.1_Missense_Mutation_p.K255I|CPA6_ENST00000297769.4_Missense_Mutation_p.K107I	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	255						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.K255I(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			TGACCTTGTTTTTCTCCAAAA	0.398																																																1	Substitution - Missense(1)	ovary(1)	8											163.0	149.0	153.0					8																	68396077		2203	4300	6503	68558631	SO:0001583	missense	57094			AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.764A>T	8.37:g.68396077T>A	ENSP00000297770:p.Lys255Ile	Somatic		Capture	Illumina GAIIx	4	68558631	Q8NEX8|Q8TDE8|Q9NRI9	Missense_Mutation	SNP	-	p.K255I	ENST00000297770.4	37	c.764	CCDS6200.1	8	.	.	.	.	.	.	.	.	.	.	T	27.2	4.810176	0.90707	.	.	ENSG00000165078	ENST00000297769;ENST00000297770;ENST00000518549	T;T;T	0.42513	0.97;0.97;3.39	5.18	5.18	0.71444	Peptidase M14, carboxypeptidase A (2);	0.047013	0.85682	D	0.000000	T	0.75686	0.3883	H	0.96633	3.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.997	D	0.84431	0.0577	10	0.87932	D	0	.	14.3144	0.66437	0.0:0.0:0.0:1.0	.	255;107;255	Q8N4T0-2;Q8N4T0-3;Q8N4T0	.;.;CBPA6_HUMAN	I	107;255;255	ENSP00000297769:K107I;ENSP00000297770:K255I;ENSP00000431112:K255I	ENSP00000297769:K107I	K	-	2	0	CPA6	68558631	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.270000	0.78493	2.076000	0.62316	0.523000	0.50628	AAA	-	NULL		0.398	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA6	protein_coding	OTTHUMT00000379296.2	T	NM_020361		68558631	-1	no_errors	NM_020361	genbank	human	validated	54_36p	missense	SNP	1	A
NCOA2	10499	genome.wustl.edu	37	8	71040732	71040732	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr8:71040732A>C	ENST00000452400.2	-	18	3798	c.3617T>G	c.(3616-3618)cTt>cGt	p.L1206R	NCOA2_ENST00000267974.4_Missense_Mutation_p.L294R	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	1206					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)	p.L1206R(1)	PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			TTGATTCATAAGTGGCTGGCG	0.383			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	1	Substitution - Missense(1)	ovary(1)	8											67.0	68.0	67.0					8																	71040732		1966	4153	6119	71203286	SO:0001583	missense	10499			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.3617T>G	8.37:g.71040732A>C	ENSP00000399968:p.Leu1206Arg	Somatic		Capture	Illumina GAIIx	4	71203286	Q14CD2	Missense_Mutation	SNP	superfamily_Nuclear receptor coactivator interlocking domain;HMMPfam_DUF1518;superfamily_HLH helix-loop-helix DNA-binding domain;HMMPfam_PAS;HMMPfam_Nuc_rec_co-act;HMMPfam_SRC-1;superfamily_PYP-like sensor domain (PAS domain)	p.L1206R	ENST00000452400.2	37	c.3617	CCDS47872.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.7|22.7	4.328715|4.328715	0.81690|0.81690	.|.	.|.	ENSG00000140396|ENSG00000140396	ENST00000452400;ENST00000267974|ENST00000518363	T;T|.	0.08807|.	4.58;3.05|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.213774|0.213774	0.47093|0.47093	D|D	0.000256|0.000256	T|T	0.71896|0.71896	0.3394|0.3394	L|L	0.61218|0.61218	1.895|1.895	0.42127|0.42127	D|D	0.991459|0.991459	D;P|.	0.55800|.	0.973;0.832|.	P;B|.	0.56823|.	0.807;0.333|.	T|T	0.73427|0.73427	-0.3986|-0.3986	10|7	0.45353|0.48119	T|T	0.12|0.1	.|.	15.5043|15.5043	0.75725|0.75725	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	294;1206|.	F8WAJ2;Q15596|.	.;NCOA2_HUMAN|.	R|V	1206;294|307	ENSP00000399968:L1206R;ENSP00000267974:L294R|.	ENSP00000267974:L294R|ENSP00000429132:L307V	L|L	-|-	2|1	0|2	NCOA2|NCOA2	71203286|71203286	1.000000|1.000000	0.71417|0.71417	0.899000|0.899000	0.35326|0.35326	0.994000|0.994000	0.84299|0.84299	8.665000|8.665000	0.91144|0.91144	2.056000|2.056000	0.61249|0.61249	0.533000|0.533000	0.62120|0.62120	CTT|TTA	-	NULL		0.383	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	protein_coding	OTTHUMT00000379696.1	A			71203286	-1	no_errors	NM_006540	genbank	human	validated	54_36p	missense	SNP	1	C
KHDRBS3	10656	genome.wustl.edu	37	8	136619243	136619243	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chr8:136619243G>A	ENST00000355849.5	+	7	1263	c.853G>A	c.(853-855)Gat>Aat	p.D285N	KHDRBS3_ENST00000520981.1_Missense_Mutation_p.D58N	NM_006558.1	NP_006549.1	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal transduction associated 3	285	Tyr-rich.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.D285N(1)		NS(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	26	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			ACAGAGTTATGATTCCTATGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	8											216.0	201.0	206.0					8																	136619243		2203	4300	6503	136688425	SO:0001583	missense	10656			AF069681	CCDS6374.1	8q24.23	2008-05-15			ENSG00000131773	ENSG00000131773			18117	protein-coding gene	gene with protein product		610421				10332027, 10564820	Standard	XR_242372		Approved	T-STAR, Etle, etoile, SALP, SLM2, SLM-2	uc003yuv.3	O75525	OTTHUMG00000164164	ENST00000355849.5:c.853G>A	8.37:g.136619243G>A	ENSP00000348108:p.Asp285Asn	Somatic		Capture	Illumina GAIIx	4	136688425	Q6NUL8|Q9UPA8	Missense_Mutation	SNP	-	p.D285N	ENST00000355849.5	37	c.853	CCDS6374.1	8	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116063	0.77323	.	.	ENSG00000131773	ENST00000355849;ENST00000524199;ENST00000520981	T;T	0.46819	0.91;0.86	6.01	6.01	0.97437	.	0.148297	0.64402	D	0.000014	T	0.49795	0.1578	L	0.54323	1.7	0.58432	D	0.999999	B	0.34290	0.447	B	0.35510	0.204	T	0.50725	-0.8794	10	0.72032	D	0.01	-25.5559	19.5093	0.95135	0.0:0.0:1.0:0.0	.	285	O75525	KHDR3_HUMAN	N	285;257;58	ENSP00000348108:D285N;ENSP00000428607:D58N	ENSP00000348108:D285N	D	+	1	0	KHDRBS3	136688425	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	8.016000	0.88706	2.861000	0.98227	0.650000	0.86243	GAT	-	NULL		0.383	KHDRBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS3	protein_coding	OTTHUMT00000377529.1	G			136688425	1	no_errors	NM_006558	genbank	human	provisional	54_36p	missense	SNP	1	A
CASK	8573	genome.wustl.edu	37	X	41446234	41446234	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chrX:41446234C>A	ENST00000378163.1	-	14	1714	c.1240G>T	c.(1240-1242)Gaa>Taa	p.E414*	CASK_ENST00000378158.1_Nonsense_Mutation_p.E414*|CASK_ENST00000378166.4_Nonsense_Mutation_p.E414*|CASK_ENST00000421587.2_Nonsense_Mutation_p.E408*|CASK_ENST00000318588.9_Nonsense_Mutation_p.E414*|CASK_ENST00000378154.1_Nonsense_Mutation_p.E414*|CASK_ENST00000361962.4_Nonsense_Mutation_p.E414*|CASK_ENST00000442742.2_Nonsense_Mutation_p.E414*			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	414	L27 2. {ECO:0000255|PROSITE- ProRule:PRU00365}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)	p.E414*(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						GAAATTTCTTCCAATACCTAA	0.264																																					NSCLC(42;104 1086 3090 27189 35040)											1	Substitution - Nonsense(1)	ovary(1)	X											75.0	68.0	70.0					X																	41446234		2202	4294	6496	41331178	SO:0001587	stop_gained	8573			AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.1240G>T	X.37:g.41446234C>A	ENSP00000367405:p.Glu414*	Somatic		Capture	Illumina GAIIx	4	41331178	A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Nonsense_Mutation	SNP	HMMPfam_Pkinase;superfamily_SH3-domain;HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_Guanylate_kin;superfamily_Protein kinase-like (PK-like);HMMPfam_SH3_2;HMMPfam_L27;superfamily_L27 domain;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.E414*	ENST00000378163.1	37	c.1240		X	.	.	.	.	.	.	.	.	.	.	C	39	7.620493	0.98393	.	.	ENSG00000147044	ENST00000421587;ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378179;ENST00000378158;ENST00000378166;ENST00000442742;ENST00000378154	.	.	.	5.33	5.33	0.75918	.	0.000000	0.52532	D	0.000075	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	18.0832	0.89449	0.0:1.0:0.0:0.0	.	.	.	.	X	408;414;414;414;29;414;414;414;414	.	ENSP00000322727:E414X	E	-	1	0	CASK	41331178	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.408000	0.80041	2.206000	0.71126	0.506000	0.49869	GAA	-	HMMPfam_L27		0.264	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	CASK	protein_coding	OTTHUMT00000056285.1	C	NM_003688		41331178	-1	no_errors	NM_003688	genbank	human	validated	54_36p	nonsense	SNP	1	A
PAGE2	203569	genome.wustl.edu	37	X	55117791	55117791	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chrX:55117791G>T	ENST00000374968.4	+	4	324	c.220G>T	c.(220-222)Gaa>Taa	p.E74*	PAGE2_ENST00000374965.1_Nonsense_Mutation_p.E57*	NM_207339.2	NP_997222.1	Q7Z2X7	PAGE2_HUMAN	P antigen family, member 2 (prostate associated)	74								p.E74*(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(2)	6						TTTTCAACAGGAACTGGCTCT	0.403																																																1	Substitution - Nonsense(1)	ovary(1)	X											75.0	80.0	78.0					X																	55117791		2171	4290	6461	55134516	SO:0001587	stop_gained	203569			BC054022	CCDS14367.1	Xp11.22	2009-06-17			ENSG00000234068	ENSG00000234068			31804	protein-coding gene	gene with protein product		300738	"""G antigen, family C, 2"""	GAGEC2		9724777	Standard	NM_207339		Approved	MGC62094, PAGE-2, CT16.4		Q7Z2X7	OTTHUMG00000021648	ENST00000374968.4:c.220G>T	X.37:g.55117791G>T	ENSP00000364107:p.Glu74*	Somatic		Capture	Illumina GAIIx	4	55134516	Q5JRK7|Q5JRK8	Nonsense_Mutation	SNP	-	p.E74*	ENST00000374968.4	37	c.220	CCDS14367.1	X	.	.	.	.	.	.	.	.	.	.	g	8.925	0.962096	0.18583	.	.	ENSG00000234068	ENST00000374968;ENST00000374965	.	.	.	1.13	1.13	0.20643	.	.	.	.	.	.	.	.	.	.	.	0.43494	A	0.995731	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	5.3082	0.15815	0.0:0.0:1.0:0.0	.	.	.	.	X	74;57	.	ENSP00000364104:E57X	E	+	1	0	PAGE2	55134516	0.024000	0.19004	0.003000	0.11579	0.018000	0.09664	1.535000	0.36061	0.862000	0.35528	0.287000	0.19450	GAA	-	NULL		0.403	PAGE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAGE2	protein_coding	OTTHUMT00000056857.1	G	NM_207339		55134516	1	no_errors	NM_207339	genbank	human	provisional	54_36p	nonsense	SNP		T
VDAC1	7416	genome.wustl.edu	37	X	80185648	80185648	+	IGR	SNP	C	C	T	rs191876027		TCGA-13-0924-01A-01W-0421-09	TCGA-13-0924-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	510dda3c-6a1f-4781-972f-c9c270608c72	ffae93da-42b4-4115-b2c7-1fad830979c6	g.chrX:80185648C>T								RNU6-493P (29285 upstream) : RNU6-995P (6284 downstream)																							CAGTAACACGCGCTTCGGAAT	0.498													c|||	2	0.000529801	0.0008	0.0	3775	,	,		14061	0.0		0.0	False		,,,				2504	0.001															0			X																																								80072304	SO:0001628	intergenic_variant	642585																															X.37:g.80185648C>T		Somatic		Capture	Illumina GAIIx	4	80072304		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.498					LOC642585			C			80072304	1	pseudogene	XR_038848	genbank	human	model	54_36p	rna	SNP	1	T
