#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
NUF2	83540	genome.wustl.edu	37	1	163298075	163298075	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:163298075A>C	ENST00000271452.3	+	4	535	c.256A>C	c.(256-258)Agc>Cgc	p.S86R	NUF2_ENST00000367900.3_Missense_Mutation_p.S86R|NUF2_ENST00000490881.1_3'UTR|NUF2_ENST00000524800.1_Missense_Mutation_p.S86R	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	86	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.S86R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					CTTACCATTCAGCAATTTAGT	0.318																																																1	Substitution - Missense(1)	ovary(1)	1											139.0	126.0	131.0					1																	163298075		2203	4300	6503	161564699	SO:0001583	missense	83540			BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.256A>C	1.37:g.163298075A>C	ENSP00000271452:p.Ser86Arg	Somatic		Capture	Illumina GAIIx	4	161564699	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	HMMPfam_Nuf2	p.S86R	ENST00000271452.3	37	c.256	CCDS1245.1	1	.	.	.	.	.	.	.	.	.	.	A	9.000	0.979979	0.18812	.	.	ENSG00000143228	ENST00000534289;ENST00000450453;ENST00000524800;ENST00000442820;ENST00000367900;ENST00000271452	T;T;T	0.30714	1.53;1.52;1.52	4.75	2.27	0.28462	.	0.637154	0.17881	N	0.158868	T	0.04543	0.0124	N	0.08118	0	0.27166	N	0.961045	B;B;B	0.14012	0.009;0.009;0.008	B;B;B	0.12837	0.008;0.008;0.008	T	0.24728	-1.0152	9	0.41790	T	0.15	-5.1608	2.9829	0.05958	0.6243:0.0:0.1954:0.1802	.	86;86;86	E9PQC4;Q9BZD4;B1AQT4	.;NUF2_HUMAN;.	R	86	ENSP00000436888:S86R;ENSP00000356875:S86R;ENSP00000271452:S86R	ENSP00000271452:S86R	S	+	1	0	NUF2	161564699	0.991000	0.36638	1.000000	0.80357	0.992000	0.81027	1.436000	0.34980	0.956000	0.37904	0.482000	0.46254	AGC	-	HMMPfam_Nuf2		0.318	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NUF2	protein_coding	OTTHUMT00000082812.1	A	NM_145697		161564699	1	no_errors	NM_031423	genbank	human	reviewed	54_36p	missense	SNP	1	C
KLHDC7A	127707	genome.wustl.edu	37	1	18807549	18807549	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:18807549C>G	ENST00000400664.1	+	1	126	c.74C>G	c.(73-75)gCc>gGc	p.A25G		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	25						integral component of membrane (GO:0016021)		p.A25G(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GTGCTGTCAGCCGCTGCCCTG	0.642																																																1	Substitution - Missense(1)	ovary(1)	1											41.0	47.0	45.0					1																	18807549		2065	4219	6284	18680136	SO:0001583	missense	127707			AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.74C>G	1.37:g.18807549C>G	ENSP00000383505:p.Ala25Gly	Somatic		Capture	Illumina GAIIx	4	18680136	Q8N8W6	Missense_Mutation	SNP	-	p.A25G	ENST00000400664.1	37	c.74	CCDS185.2	1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.349857	0.41599	.	.	ENSG00000179023	ENST00000400664	D	0.81908	-1.55	5.82	5.82	0.92795	.	.	.	.	.	T	0.82195	0.4984	N	0.19112	0.55	0.32944	D	0.518762	D	0.59767	0.986	P	0.53266	0.722	D	0.86326	0.1695	9	0.87932	D	0	.	18.6548	0.91448	0.0:1.0:0.0:0.0	.	25	Q5VTJ3	KLD7A_HUMAN	G	25	ENSP00000383505:A25G	ENSP00000383505:A25G	A	+	2	0	KLHDC7A	18680136	1.000000	0.71417	0.027000	0.17364	0.008000	0.06430	4.894000	0.63206	2.755000	0.94549	0.591000	0.81541	GCC	-	NULL		0.642	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7A	protein_coding	OTTHUMT00000006923.3	C	NM_152375		18680136	1	no_errors	NM_152375	genbank	human	validated	54_36p	missense	SNP	0.816	G
Unknown	0	genome.wustl.edu	37	1	166246338	166246338	+	IGR	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:166246338C>T								FAM78B (110132 upstream) : RP11-479J7.2 (57782 downstream)																							GTTACTCTGTCCATATCCTAG	0.537																																																0			1																																								164512962	SO:0001628	intergenic_variant	284685																															1.37:g.166246338C>T		Somatic		Capture	Illumina GAIIx	4	164512962		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.537					LOC284685			C			164512962	-1	pseudogene	XR_017685	genbank	human	model	54_36p	rna	SNP	1	T
KDM1A	23028	genome.wustl.edu	37	1	23357064	23357064	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:23357064C>A	ENST00000356634.3	+	2	603	c.454C>A	c.(454-456)Ccc>Acc	p.P152T	KDM1A_ENST00000400181.4_Missense_Mutation_p.P152T|KDM1A_ENST00000542151.1_Missense_Mutation_p.P152T|RP1-184J9.2_ENST00000427154.1_RNA	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	152	Poly-Pro.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P152T(1)		breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						AAAGAAGCTTCCCCCACCACC	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											107.0	113.0	111.0					1																	23357064		2203	4300	6503	23229651	SO:0001583	missense	23028			AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.454C>A	1.37:g.23357064C>A	ENSP00000349049:p.Pro152Thr	Somatic		Capture	Illumina GAIIx	4	23229651	A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Missense_Mutation	SNP	HMMPfam_Amino_oxidase;HMMPfam_SWIRM;superfamily_FAD/NAD(P)-binding domain;superfamily_FAD-linked reductases C-terminal domain	p.P152T	ENST00000356634.3	37	c.454	CCDS30627.1	1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584755	0.65992	.	.	ENSG00000004487	ENST00000356634;ENST00000400181;ENST00000542151	T;T;T	0.32515	1.45;1.58;1.58	5.84	5.84	0.93424	.	0.205265	0.32175	U	0.006474	T	0.40719	0.1128	N	0.14661	0.345	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.987	T	0.28808	-1.0032	10	0.37606	T	0.19	-11.943	19.1204	0.93360	0.0:1.0:0.0:0.0	.	152;152	O60341-2;O60341	.;KDM1A_HUMAN	T	152	ENSP00000349049:P152T;ENSP00000383042:P152T;ENSP00000439072:P152T	ENSP00000349049:P152T	P	+	1	0	KDM1A	23229651	1.000000	0.71417	0.979000	0.43373	0.947000	0.59692	6.005000	0.70716	2.765000	0.95021	0.484000	0.47621	CCC	-	NULL		0.458	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AOF2	protein_coding	OTTHUMT00000008880.3	C	NM_015013		23229651	1	no_errors	NM_015013	genbank	human	reviewed	54_36p	missense	SNP	1	A
SNAP47	116841	genome.wustl.edu	37	1	227947172	227947172	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:227947172C>G	ENST00000366759.4	+	3	1523	c.1109C>G	c.(1108-1110)tCa>tGa	p.S370*	SNAP47_ENST00000366760.1_Nonsense_Mutation_p.S128*|SNAP47_ENST00000315781.5_Nonsense_Mutation_p.S370*	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	370					long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)		p.S370*(2)		endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						AAGAGCTGCTCAGTCTGGCAT	0.517																																																2	Substitution - Nonsense(2)	ovary(1)|lung(1)	1											109.0	113.0	111.0					1																	227947172		2203	4300	6503	226013795	SO:0001587	stop_gained	116841			AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.1109C>G	1.37:g.227947172C>G	ENSP00000355721:p.Ser370*	Somatic		Capture	Illumina GAIIx	4	226013795	B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Nonsense_Mutation	SNP	-	p.S370*	ENST00000366759.4	37	c.1109	CCDS1562.1	1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305939	0.81247	.	.	ENSG00000143740	ENST00000366760;ENST00000366759;ENST00000315781	.	.	.	4.96	4.05	0.47172	.	0.503679	0.20490	N	0.091309	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-25.7328	10.853	0.46782	0.0:0.9085:0.0:0.0915	.	.	.	.	X	128;370;370	.	ENSP00000314157:S370X	S	+	2	0	SNAP47	226013795	0.003000	0.15002	0.067000	0.19924	0.061000	0.15899	1.284000	0.33249	1.315000	0.45114	0.561000	0.74099	TCA	-	NULL		0.517	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAP47	protein_coding	OTTHUMT00000091961.1	C	NM_053052		226013795	1	no_errors	NM_053052	genbank	human	validated	54_36p	nonsense	SNP	0.01	G
SLC35F3	148641	genome.wustl.edu	37	1	234367294	234367294	+	Missense_Mutation	SNP	G	G	A	rs200834507	byFrequency	TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:234367294G>A	ENST00000366617.3	+	2	436	c.208G>A	c.(208-210)Gtg>Atg	p.V70M	SLC35F3_ENST00000366618.3_Missense_Mutation_p.V139M			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	70					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)		p.V139M(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			CTTCTGGGGCGTGGCGGTCGT	0.701													G|||	2	0.000399361	0.0015	0.0	5008	,	,		13267	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1											103.0	91.0	95.0					1																	234367294		2203	4299	6502	232433917	SO:0001583	missense	148641				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.208G>A	1.37:g.234367294G>A	ENSP00000355576:p.Val70Met	Somatic		Capture	Illumina GAIIx	4	232433917	Q5TDD6|Q8N9C9	Missense_Mutation	SNP	HMMPfam_DUF6;superfamily_Multidrug resistance efflux transporter EmrE	p.V139M	ENST00000366617.3	37	c.415		1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.899421	0.72754	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	T;T	0.55052	0.54;0.57	4.41	3.47	0.39725	.	0.186465	0.46758	D	0.000273	T	0.61426	0.2346	M	0.65498	2.005	0.43234	D	0.995134	D;D	0.69078	0.987;0.997	P;P	0.58873	0.502;0.847	T	0.60260	-0.7298	10	0.42905	T	0.14	-11.694	8.0544	0.30596	0.085:0.1618:0.7532:0.0	.	70;139	Q8IY50;Q8IY50-2	S35F3_HUMAN;.	M	139;70	ENSP00000355577:V139M;ENSP00000355576:V70M	ENSP00000355576:V70M	V	+	1	0	SLC35F3	232433917	1.000000	0.71417	0.992000	0.48379	0.985000	0.73830	3.400000	0.52594	1.018000	0.39521	0.313000	0.20887	GTG	-	NULL		0.701	SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	SLC35F3	protein_coding	OTTHUMT00000128322.1	G	NM_173508		232433917	1	no_errors	NM_173508	genbank	human	provisional	54_36p	missense	SNP	0.96	A
PIGV	55650	genome.wustl.edu	37	1	27121257	27121257	+	Silent	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:27121257G>T	ENST00000374145.1	+	3	1414	c.732G>T	c.(730-732)tcG>tcT	p.S244S	PIGV_ENST00000078527.4_Silent_p.S244S|PIGV_ENST00000449950.2_Intron	NM_001202554.1	NP_001189483.1	Q9NUD9	PIGV_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class V	244					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)	p.S244S(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	14		all_cancers(24;3.93e-26)|all_epithelial(13;3.96e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.26e-54)|Epithelial(14;2.85e-53)|OV - Ovarian serous cystadenocarcinoma(117;1.91e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000504)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.0222)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		TGTTTCTGTCGGTGTTCACAC	0.502																																																1	Substitution - coding silent(1)	ovary(1)	1											136.0	142.0	140.0					1																	27121257		2203	4300	6503	26993844	SO:0001819	synonymous_variant	55650			AK000484	CCDS287.1	1p36.11	2013-02-26	2006-06-28		ENSG00000060642	ENSG00000060642		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	26031	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 2"", ""dol-P-Man dependent GPI mannosyltransferase"""	610274	"""phosphatidylinositol glycan, class V"""			15623507	Standard	NM_017837		Approved	FLJ20477	uc001bmz.3	Q9NUD9	OTTHUMG00000004005	ENST00000374145.1:c.732G>T	1.37:g.27121257G>T		Somatic		Capture	Illumina GAIIx	4	26993844	D3DPL2|Q5JYG7|Q5JYG8|Q5JYG9|Q9NX26	Silent	SNP	HMMPfam_Mannosyl_trans2	p.S244	ENST00000374145.1	37	c.732	CCDS287.1	1																																																																																			-	HMMPfam_Mannosyl_trans2		0.502	PIGV-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIGV	protein_coding	OTTHUMT00000011441.1	G	NM_017837		26993844	1	no_errors	NM_017837	genbank	human	validated	54_36p	silent	SNP	0	T
OSCP1	127700	genome.wustl.edu	37	1	36883824	36883824	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:36883824G>C	ENST00000356637.5	-	11	1149	c.1086C>G	c.(1084-1086)atC>atG	p.I362M	OSCP1_ENST00000235532.5_Missense_Mutation_p.I352M|SNORA63_ENST00000364578.1_RNA|OSCP1_ENST00000433045.2_Missense_Mutation_p.I307M|OSCP1_ENST00000315643.9_Intron|OSCP1_ENST00000495222.1_5'UTR			Q8WVF1	OSCP1_HUMAN	organic solute carrier partner 1	362					transport (GO:0006810)	plasma membrane (GO:0005886)		p.I362M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	22						ACTCCCCCATGATTCGAGCCA	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											93.0	70.0	78.0					1																	36883824		2203	4300	6503	36656411	SO:0001583	missense	127700				CCDS409.1, CCDS410.1, CCDS409.2	1p34.3	2009-07-06	2009-07-06	2009-07-06	ENSG00000116885	ENSG00000116885			29971	protein-coding gene	gene with protein product	"""oxidored nitro domain containing protein"""	608854	"""chromosome 1 open reading frame 102"""	C1orf102		12477932	Standard	NM_145047		Approved	NOR1	uc001caq.3	Q8WVF1	OTTHUMG00000008139	ENST00000356637.5:c.1086C>G	1.37:g.36883824G>C	ENSP00000349052:p.Ile362Met	Somatic		Capture	Illumina GAIIx	4	36656411	A6NHM5|A6NHS9|A6NIN9|Q4AEJ0|Q8N7G2|Q8TDF1	Missense_Mutation	SNP	-	p.I362M	ENST00000356637.5	37	c.1086		1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.502652	0.64298	.	.	ENSG00000116885	ENST00000235532;ENST00000356637;ENST00000433045	T;T;T	0.39406	1.53;1.54;1.08	5.58	3.72	0.42706	.	0.000000	0.85682	D	0.000000	T	0.55049	0.1896	M	0.66506	2.035	0.80722	D	1	D;D	0.62365	0.991;0.985	P;P	0.59643	0.861;0.8	T	0.56177	-0.8022	10	0.72032	D	0.01	.	9.6916	0.40131	0.1602:0.0:0.8398:0.0	.	352;362	Q8WVF1-3;Q8WVF1	.;OSCP1_HUMAN	M	352;362;307	ENSP00000235532:I352M;ENSP00000349052:I362M;ENSP00000390820:I307M	ENSP00000235532:I352M	I	-	3	3	OSCP1	36656411	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.056000	0.64287	0.721000	0.32231	-0.145000	0.13849	ATC	-	NULL		0.557	OSCP1-010	NOVEL	not_organism_supported|basic	protein_coding	C1orf102	protein_coding	OTTHUMT00000389759.1	G	NM_145047		36656411	-1	no_errors	NM_145047	genbank	human	validated	54_36p	missense	SNP	1	C
DMBX1	127343	genome.wustl.edu	37	1	46977890	46977890	+	Silent	SNP	G	G	A	rs373688410		TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:46977890G>A	ENST00000360032.3	+	4	872	c.858G>A	c.(856-858)ccG>ccA	p.P286P	DMBX1_ENST00000371956.4_Silent_p.P291P	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1									p.P291P(1)		endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					TAGGGGGTCCGGCCCCTGCTG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	1						G	,	1,4405		0,1,2202	30.0	33.0	32.0		873,858	-10.9	0.0	1		32	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	DMBX1	NM_147192.2,NM_172225.1	,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,	291/383,286/378	46977890	1,13003	2203	4299	6502	46750477	SO:0001819	synonymous_variant	127343			AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.858G>A	1.37:g.46977890G>A		Somatic		Capture	Illumina GAIIx	4	46750477		Silent	SNP	-	p.P291	ENST00000360032.3	37	c.873	CCDS536.1	1																																																																																			-	NULL		0.657	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DMBX1	protein_coding	OTTHUMT00000021895.1	G			46750477	1	no_errors	NM_147192	genbank	human	reviewed	54_36p	silent	SNP	0.842	A
CACHD1	57685	genome.wustl.edu	37	1	65130219	65130219	+	Silent	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:65130219C>G	ENST00000371073.2	+	15	2133	c.2133C>G	c.(2131-2133)gtC>gtG	p.V711V	CACHD1_ENST00000495994.1_3'UTR|CACHD1_ENST00000290039.5_Silent_p.V660V			Q5VU97	CAHD1_HUMAN	cache domain containing 1	711					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)		p.V660V(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CCAGCCACGTCACAGATGAAT	0.443																																																1	Substitution - coding silent(1)	ovary(1)	1											129.0	114.0	119.0					1																	65130219		2203	4300	6503	64902807	SO:0001819	synonymous_variant	57685			AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.2133C>G	1.37:g.65130219C>G		Somatic		Capture	Illumina GAIIx	4	64902807	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Silent	SNP	-	p.V660	ENST00000371073.2	37	c.1980		1																																																																																			-	NULL		0.443	CACHD1-201	KNOWN	basic	protein_coding	CACHD1	protein_coding		C	NM_020925		64902807	1	no_errors	NM_020925	genbank	human	validated	54_36p	silent	SNP	1	G
ZZZ3	26009	genome.wustl.edu	37	1	78045289	78045289	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:78045289T>C	ENST00000370801.3	-	10	2480	c.2005A>G	c.(2005-2007)Aaa>Gaa	p.K669E	ZZZ3_ENST00000476275.1_5'UTR|ZZZ3_ENST00000370798.1_Missense_Mutation_p.K175E	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	669	HTH myb-type. {ECO:0000255|PROSITE- ProRule:PRU00625}.				chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K669E(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						GGAGGGTATTTGATGAGTAGC	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											183.0	177.0	179.0					1																	78045289		2203	4300	6503	77817877	SO:0001583	missense	26009			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.2005A>G	1.37:g.78045289T>C	ENSP00000359837:p.Lys669Glu	Somatic		Capture	Illumina GAIIx	4	77817877	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	-	p.K669E	ENST00000370801.3	37	c.2005	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.164087	0.78339	.	.	ENSG00000036549	ENST00000370801;ENST00000370798	T;T	0.44482	0.92;0.92	5.43	5.43	0.79202	Transcription regulator HTH, Myb-type, DNA-binding (1);Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.45357	0.1338	L	0.33293	1	0.80722	D	1	D;D;D	0.89917	0.996;0.96;1.0	D;P;D	0.85130	0.99;0.832;0.997	T	0.47407	-0.9120	10	0.52906	T	0.07	.	15.8052	0.78501	0.0:0.0:0.0:1.0	.	175;669;668	Q8IYH5-3;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	E	669;175	ENSP00000359837:K669E;ENSP00000359834:K175E	ENSP00000359834:K175E	K	-	1	0	ZZZ3	77817877	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	7.543000	0.82106	2.195000	0.70347	0.528000	0.53228	AAA	-	NULL		0.363	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	protein_coding	OTTHUMT00000026615.1	T	NM_015534		77817877	-1	no_errors	NM_015534	genbank	human	provisional	54_36p	missense	SNP	1	C
MCOLN2	255231	genome.wustl.edu	37	1	85422116	85422116	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:85422116A>G	ENST00000370608.3	-	4	630	c.563T>C	c.(562-564)cTc>cCc	p.L188P	MCOLN2_ENST00000284027.5_Missense_Mutation_p.L160P|MCOLN2_ENST00000531325.1_5'UTR	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	188					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L188P(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		TGCATTACCGAGCTCAACGTC	0.398																																																1	Substitution - Missense(1)	ovary(1)	1											213.0	194.0	200.0					1																	85422116		2203	4300	6503	85194704	SO:0001583	missense	255231			AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.563T>C	1.37:g.85422116A>G	ENSP00000359640:p.Leu188Pro	Somatic		Capture	Illumina GAIIx	4	85194704	A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	-	p.L188P	ENST00000370608.3	37	c.563	CCDS30762.1	1	.	.	.	.	.	.	.	.	.	.	A	5.181	0.218883	0.09810	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	T;T	0.54479	0.57;0.57	5.06	-9.48	0.00591	.	0.823226	0.11116	N	0.597903	T	0.13114	0.0318	N	0.08118	0	0.38858	D	0.956419	B	0.02656	0.0	B	0.01281	0.0	T	0.29212	-1.0019	10	0.36615	T	0.2	-16.023	17.2315	0.86985	0.174:0.1013:0.7248:0.0	.	188	Q8IZK6	MCLN2_HUMAN	P	188;160	ENSP00000359640:L188P;ENSP00000284027:L160P	ENSP00000284027:L160P	L	-	2	0	MCOLN2	85194704	0.118000	0.22208	0.083000	0.20561	0.006000	0.05464	-0.105000	0.10907	-2.108000	0.00839	-0.911000	0.02809	CTC	-	NULL		0.398	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	MCOLN2	protein_coding	OTTHUMT00000027567.2	A	NM_153259		85194704	-1	no_errors	NM_153259	genbank	human	reviewed	54_36p	missense	SNP	0.87	G
LRRC8D	55144	genome.wustl.edu	37	1	90400055	90400055	+	Silent	SNP	G	G	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:90400055G>C	ENST00000337338.5	+	3	1835	c.1428G>C	c.(1426-1428)ctG>ctC	p.L476L	LRRC8D_ENST00000394593.3_Silent_p.L476L	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	476					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.L476L(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		AGTTGCATCTGTTCATGCTGT	0.443																																																1	Substitution - coding silent(1)	ovary(1)	1											52.0	51.0	52.0					1																	90400055		2203	4300	6503	90172643	SO:0001819	synonymous_variant	55144			AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.1428G>C	1.37:g.90400055G>C		Somatic		Capture	Illumina GAIIx	4	90172643	D3DT29|Q6UWB2|Q9NVW3	Silent	SNP	-	p.L476	ENST00000337338.5	37	c.1428	CCDS726.1	1																																																																																			-	NULL		0.443	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8D	protein_coding	OTTHUMT00000029203.2	G	NM_018103		90172643	1	no_errors	NM_018103	genbank	human	validated	54_36p	silent	SNP	0.86	C
KIF26B	55083	genome.wustl.edu	37	1	245704147	245704147	+	Silent	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr1:245704147C>T	ENST00000407071.2	+	5	1685	c.1245C>T	c.(1243-1245)ctC>ctT	p.L415L	KIF26B_ENST00000366518.4_Silent_p.L34L	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	415					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.L415L(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			AACCACCGCTCTTTGCAACCA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	1											83.0	84.0	83.0					1																	245704147		1869	4094	5963	243770770	SO:0001819	synonymous_variant	55083			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1245C>T	1.37:g.245704147C>T		Somatic		Capture	Illumina GAIIx	4	243770770	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	-	p.L415	ENST00000407071.2	37	c.1245	CCDS44342.1	1																																																																																			-	NULL		0.557	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	protein_coding	OTTHUMT00000381037.1	C	XM_371354		243770770	1	no_errors	NM_018012	genbank	human	provisional	54_36p	silent	SNP	1	T
ADD3	120	genome.wustl.edu	37	10	111892070	111892070	+	Missense_Mutation	SNP	G	G	C	rs370817501		TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr10:111892070G>C	ENST00000356080.4	+	14	2107	c.1740G>C	c.(1738-1740)gaG>gaC	p.E580D	ADD3_ENST00000360162.3_Intron|ADD3_ENST00000277900.8_Intron	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	580						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.E580D(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		CAGATGCTGAGCAGGAATTAC	0.378																																																1	Substitution - Missense(1)	ovary(1)	10											89.0	87.0	88.0					10																	111892070		2203	4300	6503	111882060	SO:0001583	missense	120			U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.1740G>C	10.37:g.111892070G>C	ENSP00000348381:p.Glu580Asp	Somatic		Capture	Illumina GAIIx	Phase_III	111882060	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	HMMPfam_Aldolase_II,superfamily_AraD-like aldolase/epimerase	p.E580D	ENST00000356080.4	37	c.1740	CCDS7561.1	10	.	.	.	.	.	.	.	.	.	.	G	11.55	1.671067	0.29693	.	.	ENSG00000148700	ENST00000356080	T	0.17854	2.25	5.51	4.59	0.56863	.	0.543845	0.21621	N	0.071659	T	0.09992	0.0245	N	0.19112	0.55	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.17806	-1.0357	10	0.21014	T	0.42	-17.8713	7.6468	0.28325	0.0804:0.0:0.6256:0.2941	.	580	Q9UEY8	ADDG_HUMAN	D	580	ENSP00000348381:E580D	ENSP00000348381:E580D	E	+	3	2	ADD3	111882060	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.992000	0.49417	1.284000	0.44531	0.655000	0.94253	GAG	-	NULL		0.378	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD3	protein_coding	OTTHUMT00000050289.1	G	NM_019903		111882060	1	no_errors	NM_016824	genbank	human	reviewed	54_36p	missense	SNP	1	C
KIAA1217	56243	genome.wustl.edu	37	10	24762215	24762215	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr10:24762215C>T	ENST00000376454.3	+	6	935	c.905C>T	c.(904-906)tCt>tTt	p.S302F	KIAA1217_ENST00000307544.6_Missense_Mutation_p.S20F|KIAA1217_ENST00000376452.3_Missense_Mutation_p.S302F|KIAA1217_ENST00000376451.2_Missense_Mutation_p.S20F|KIAA1217_ENST00000376462.1_Missense_Mutation_p.S222F|KIAA1217_ENST00000396445.1_Missense_Mutation_p.S20F|KIAA1217_ENST00000458595.1_Missense_Mutation_p.S302F|KIAA1217_ENST00000396446.1_Missense_Mutation_p.S20F|KIAA1217_ENST00000430453.2_Missense_Mutation_p.S223F	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	302	Pro-rich. {ECO:0000255}.				embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)		p.S302F(1)		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CGCCCCGGATCTACTGCTCAT	0.537																																																1	Substitution - Missense(1)	ovary(1)	10											83.0	79.0	80.0					10																	24762215		2203	4300	6503	24802221	SO:0001583	missense	56243			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.905C>T	10.37:g.24762215C>T	ENSP00000365637:p.Ser302Phe	Somatic		Capture	Illumina GAIIx	4	24802221	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	-	p.S302F	ENST00000376454.3	37	c.905	CCDS31165.1	10	.	.	.	.	.	.	.	.	.	.	C	15.03	2.713282	0.48517	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000430453;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;0.88;0.88;0.88;0.88	5.21	5.21	0.72293	.	0.459032	0.26727	N	0.022801	T	0.76090	0.3939	M	0.64997	1.995	0.58432	D	0.999996	D;P;P;D;D;D;D;P	0.65815	0.995;0.954;0.94;0.987;0.987;0.971;0.972;0.874	P;P;P;P;P;P;P;P	0.62089	0.898;0.646;0.809;0.882;0.882;0.841;0.739;0.735	T	0.77587	-0.2532	10	0.66056	D	0.02	.	18.9385	0.92595	0.0:1.0:0.0:0.0	.	302;302;20;20;20;20;302;302	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	F	222;302;302;20;302;302;152;223;20;20;20;20;20	ENSP00000365645:S222F;ENSP00000365639:S302F;ENSP00000392625:S302F;ENSP00000365637:S302F;ENSP00000365635:S302F;ENSP00000404798:S152F;ENSP00000389680:S223F;ENSP00000302343:S20F;ENSP00000379722:S20F;ENSP00000365634:S20F;ENSP00000379723:S20F	ENSP00000302343:S20F	S	+	2	0	KIAA1217	24802221	1.000000	0.71417	0.850000	0.33497	0.010000	0.07245	5.378000	0.66190	2.723000	0.93209	0.650000	0.86243	TCT	-	NULL		0.537	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	protein_coding	OTTHUMT00000047223.2	C	NM_019590		24802221	1	no_errors	NM_019590	genbank	human	validated	54_36p	missense	SNP	0.89	T
KIAA1279	26128	genome.wustl.edu	37	10	70776166	70776166	+	Silent	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr10:70776166G>A	ENST00000361983.4	+	7	1962	c.1860G>A	c.(1858-1860)ctG>ctA	p.L620L		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	620					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)	p.L620L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						AGATGGCCCTGACTTAATCCT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	10											36.0	38.0	37.0					10																	70776166		2200	4298	6498	70446172	SO:0001819	synonymous_variant	26128			BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.1860G>A	10.37:g.70776166G>A		Somatic		Capture	Illumina GAIIx	4	70446172	A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Silent	SNP	superfamily_TPR-like	p.L620	ENST00000361983.4	37	c.1860	CCDS7284.1	10																																																																																			-	NULL		0.398	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1279	protein_coding	OTTHUMT00000048370.1	G	NM_015634		70446172	1	no_errors	NM_015634	genbank	human	validated	54_36p	silent	SNP	0.97	A
LIPJ	142910	genome.wustl.edu	37	10	90366438	90366438	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr10:90366438C>A	ENST00000371939.3	+	11	1189	c.875C>A	c.(874-876)tCt>tAt	p.S292Y		NM_001010939.2	NP_001010939.2	Q5W064	LIPJ_HUMAN	lipase, family member J	292					lipid catabolic process (GO:0016042)		hydrolase activity, acting on ester bonds (GO:0016788)	p.S292Y(1)		large_intestine(4)|lung(4)|ovary(1)	9		all_cancers(4;2.79e-10)|Prostate(4;1.68e-15)|all_epithelial(4;1.43e-09)|Colorectal(252;0.0381)|Breast(4;0.141)|Melanoma(5;0.2)|all_hematologic(4;0.222)		Colorectal(12;1.02e-05)|COAD - Colon adenocarcinoma(12;1.54e-05)		CAGACAACGTCTCCATTATAC	0.313																																																1	Substitution - Missense(1)	ovary(1)	10											66.0	66.0	66.0					10																	90366438		2203	4300	6503	90356418	SO:0001583	missense	142910			BC031219	CCDS31240.1	10q23.31	2008-02-04	2008-02-04	2007-02-27	ENSG00000204022	ENSG00000204022			21773	protein-coding gene	gene with protein product		613921	"""lipase-like, ab-hydrolase domain containing 1"", ""lipase, family member J"""	LIPL1			Standard	NM_001010939		Approved	bA425M17.2	uc001kff.3	Q5W064	OTTHUMG00000018691	ENST00000371939.3:c.875C>A	10.37:g.90366438C>A	ENSP00000361007:p.Ser292Tyr	Somatic		Capture	Illumina GAIIx	4	90356418	A8MT98|Q0P671	Missense_Mutation	SNP	-	p.S292Y	ENST00000371939.3	37	c.875	CCDS31240.1	10	.	.	.	.	.	.	.	.	.	.	C	15.57	2.871547	0.51695	.	.	ENSG00000204022	ENST00000371939;ENST00000531458	T;T	0.76186	-1.0;-1.0	5.55	5.55	0.83447	Alpha/beta hydrolase fold-1 (1);	0.887861	0.09487	N	0.795544	D	0.83261	0.5216	L	0.56769	1.78	0.33322	D	0.567394	D	0.55800	0.973	P	0.56163	0.793	D	0.83977	0.0330	10	0.87932	D	0	-25.8379	18.2688	0.90062	0.0:1.0:0.0:0.0	.	292	Q5W064	LIPJ_HUMAN	Y	292;107	ENSP00000361007:S292Y;ENSP00000434211:S107Y	ENSP00000361007:S292Y	S	+	2	0	LIPJ	90356418	0.946000	0.32159	0.767000	0.31495	0.079000	0.17450	4.883000	0.63128	2.608000	0.88229	0.655000	0.94253	TCT	-	NULL		0.313	LIPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPJ	protein_coding	OTTHUMT00000049248.2	C	XM_084377		90356418	1	no_errors	NM_001010939	genbank	human	provisional	54_36p	missense	SNP	0.33	A
TNKS2	80351	genome.wustl.edu	37	10	93567002	93567002	+	Intron	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr10:93567002G>T	ENST00000371627.4	+	2	578					NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2						multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.F65L(1)		biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				GTTGACTGTGGAATTTCTCAA	0.388																																																1	Substitution - Missense(1)	ovary(1)	10																																								93556982	SO:0001627	intron_variant	653226			AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.200-5738G>T	10.37:g.93567002G>T		Somatic		Capture	Illumina GAIIx	4	93556982	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	-	p.F65L	ENST00000371627.4	37	c.195	CCDS7417.1	10																																																																																			-	NULL		0.388	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC653226	protein_coding	OTTHUMT00000049374.1	G	NM_025235		93556982	-1	no_errors	XM_927451	genbank	human	model	54_36p	missense	SNP	1	T
FAM204A	63877	genome.wustl.edu	37	10	120085707	120085707	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr10:120085707C>A	ENST00000369183.4	-	7	761	c.502G>T	c.(502-504)Gag>Tag	p.E168*	FAM204A_ENST00000369172.4_Nonsense_Mutation_p.E168*|FAM204A_ENST00000469758.1_5'UTR	NM_022063.2	NP_071346.1	Q9H8W3	F204A_HUMAN	family with sequence similarity 204, member A	168								p.E168*(1)		kidney(1)|large_intestine(5)|lung(4)|ovary(1)	11						TCAGCCTTCTCAATATTCCAC	0.388																																																1	Substitution - Nonsense(1)	ovary(1)	10											117.0	117.0	117.0					10																	120085707		2203	4300	6503	120075697	SO:0001587	stop_gained	63877			AK023250	CCDS7605.1	10q26.12	2011-06-01	2011-06-01	2011-06-01	ENSG00000165669	ENSG00000165669			25794	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 84"""	C10orf84		12477932	Standard	NM_022063		Approved	FLJ13188, bA319I23.1	uc010qss.1	Q9H8W3	OTTHUMG00000019131	ENST00000369183.4:c.502G>T	10.37:g.120085707C>A	ENSP00000358183:p.Glu168*	Somatic		Capture	Illumina GAIIx	4	120075697	D3DRC6|Q5T373|Q9H5V5	Nonsense_Mutation	SNP	-	p.E168*	ENST00000369183.4	37	c.502	CCDS7605.1	10	.	.	.	.	.	.	.	.	.	.	C	39	7.750483	0.98468	.	.	ENSG00000165669	ENST00000369183;ENST00000369172	.	.	.	5.71	5.71	0.89125	.	0.148904	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-20.2684	20.2849	0.98532	0.0:1.0:0.0:0.0	.	.	.	.	X	168	.	ENSP00000358170:E168X	E	-	1	0	FAM204A	120075697	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.133000	0.57983	2.873000	0.98535	0.644000	0.83932	GAG	-	NULL		0.388	FAM204A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf84	protein_coding	OTTHUMT00000050596.2	C	NM_022063		120075697	-1	no_errors	NM_022063	genbank	human	validated	54_36p	nonsense	SNP	1	A
EIF2S3L	0	genome.wustl.edu	37	12	10658965	10658965	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr12:10658965C>G	ENST00000538173.1	+	1	477	c.464C>G	c.(463-465)gCt>gGt	p.A155G	EIF2S3L_ENST00000322446.3_Missense_Mutation_p.A155G			Q2VIR3	IF2GL_HUMAN		155	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.						GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation initiation factor activity (GO:0003743)	p.A155G(1)		lung(8)	8						ATGGATGCAGCTCTTCTGTTG	0.443																																																1	Substitution - Missense(1)	ovary(1)	12																																								10550232	SO:0001583	missense	0																														ENST00000538173.1:c.464C>G	12.37:g.10658965C>G	ENSP00000445077:p.Ala155Gly	Somatic		Capture	Illumina GAIIx	4	10550232	Q5I0X0|Q6KF84	Missense_Mutation	SNP	HMMPfam_GTP_EFTU,HMMPfam_GTP_EFTU_D2,superfamily_Translation proteins,superfamily_EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain,HMMPfam_eIF2_C,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.A155G	ENST00000538173.1	37	c.464		12	.	.	.	.	.	.	.	.	.	.	C	9.838	1.190328	0.21954	.	.	ENSG00000180574	ENST00000322446;ENST00000538173	T;T	0.69306	-0.39;-0.39	2.68	1.76	0.24704	.	0.000000	0.85682	D	0.000000	T	0.67040	0.2851	.	.	.	.	.	.	.	.	.	.	.	.	T	0.75283	-0.3372	6	0.87932	D	0	.	7.2619	0.26207	0.0:0.8492:0.0:0.1508	.	.	.	.	G	155	ENSP00000323063:A155G;ENSP00000445077:A155G	ENSP00000323063:A155G	A	+	2	0	AC068775.1	10550232	1.000000	0.71417	0.635000	0.29338	0.315000	0.28087	3.489000	0.53237	1.527000	0.49086	0.298000	0.19748	GCT	-	NULL		0.443	EIF2S3L-002	KNOWN	basic|appris_principal	protein_coding	ENSG00000180574	protein_coding	OTTHUMT00000400341.3	C			10550232	1	no_errors	ENST00000322446	ensembl	human	known	54_36p	missense	SNP	1	G
CD3D	915	genome.wustl.edu	37	11	118211202	118211202	+	Silent	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr11:118211202G>A	ENST00000300692.4	-	2	298	c.162C>T	c.(160-162)gaC>gaT	p.D54D	CD3D_ENST00000392884.2_Silent_p.D54D|CD3D_ENST00000529594.1_Intron	NM_000732.4	NP_000723.1	P04234	CD3D_HUMAN	CD3d molecule, delta (CD3-TCR complex)	54					cell surface receptor signaling pathway (GO:0007166)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive thymic T cell selection (GO:0045059)|regulation of immune response (GO:0050776)|T cell costimulation (GO:0031295)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	alpha-beta T cell receptor complex (GO:0042105)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	protein heterodimerization activity (GO:0046982)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.D54D(1)		large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	9	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)	Muromonab(DB00075)	GTCTTGTAATGTCTGAGAGCA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	11											225.0	166.0	186.0					11																	118211202		2200	4296	6496	117716412	SO:0001819	synonymous_variant	915			X01451	CCDS8394.1, CCDS41724.1	11q23	2014-09-17	2006-03-28		ENSG00000167286	ENSG00000167286		"""CD molecules"""	1673	protein-coding gene	gene with protein product		186790	"""CD3d antigen, delta polypeptide (TiT3 complex)"""	T3D			Standard	NM_000732		Approved		uc001pss.1	P04234	OTTHUMG00000166970	ENST00000300692.4:c.162C>T	11.37:g.118211202G>A		Somatic		Capture	Illumina GAIIx	Phase_III	117716412	A8MVP6	Silent	SNP	-	p.D54	ENST00000300692.4	37	c.162	CCDS8394.1	11	.	.	.	.	.	.	.	.	.	.	G	2.966	-0.213478	0.06140	.	.	ENSG00000167286	ENST00000534687	.	.	.	5.36	-7.87	0.01183	.	.	.	.	.	T	0.15003	0.0362	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.16482	-1.0401	4	.	.	.	1.3961	1.2215	0.01925	0.1894:0.1625:0.2532:0.3949	.	.	.	.	Y	59	.	.	H	-	1	0	CD3D	117716412	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.320000	0.00513	-2.473000	0.00528	-2.697000	0.00138	CAT	-	NULL		0.458	CD3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD3D	protein_coding	OTTHUMT00000392128.1	G	NM_000732		117716412	-1	no_errors	NM_000732	genbank	human	reviewed	54_36p	silent	SNP	0	A
NAV2	89797	genome.wustl.edu	37	11	20119198	20119198	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr11:20119198G>C	ENST00000396087.3	+	34	6364	c.6265G>C	c.(6265-6267)Gaa>Caa	p.E2089Q	NAV2_ENST00000396085.1_Missense_Mutation_p.E2033Q|NAV2_ENST00000360655.4_Missense_Mutation_p.E1966Q|NAV2_ENST00000540292.1_Missense_Mutation_p.E2020Q|NAV2_ENST00000311043.8_Missense_Mutation_p.E1094Q|NAV2_ENST00000533917.1_Missense_Mutation_p.E1094Q|NAV2_ENST00000527559.2_Missense_Mutation_p.E2018Q|NAV2_ENST00000349880.4_Missense_Mutation_p.E2030Q	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	2089					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)	p.E2089Q(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CAGCATTGGAGAAATCAAGCG	0.458																																																1	Substitution - Missense(1)	ovary(1)	11											118.0	114.0	115.0					11																	20119198		2203	4300	6503	20075774	SO:0001583	missense	89797			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.6265G>C	11.37:g.20119198G>C	ENSP00000379396:p.Glu2089Gln	Somatic		Capture	Illumina GAIIx	4	20075774	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	-	p.E2089Q	ENST00000396087.3	37	c.6265	CCDS58126.1	11	.	.	.	.	.	.	.	.	.	.	G	18.77	3.694822	0.68386	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292;ENST00000533917;ENST00000311043	T;T;T;T;T;T;T;T	0.31247	1.5;1.6;1.61;1.61;1.51;1.51;3.11;3.11	5.78	5.78	0.91487	.	0.165962	0.41938	D	0.000796	T	0.48572	0.1507	L	0.42245	1.32	0.80722	D	1	P;D;D;D	0.63880	0.928;0.961;0.993;0.969	P;P;D;P	0.65573	0.672;0.691;0.936;0.811	T	0.11941	-1.0567	9	.	.	.	.	19.9617	0.97254	0.0:0.0:1.0:0.0	.	2033;1094;2030;1966	A7E2D6;Q8IVL1-5;Q8IVL1-3;Q8IVL1-4	.;.;.;.	Q	1966;2033;2030;2089;2018;2020;1094;1094	ENSP00000353871:E1966Q;ENSP00000379394:E2033Q;ENSP00000309577:E2030Q;ENSP00000379396:E2089Q;ENSP00000435395:E2018Q;ENSP00000443489:E2020Q;ENSP00000437316:E1094Q;ENSP00000312169:E1094Q	.	E	+	1	0	NAV2	20075774	1.000000	0.71417	0.984000	0.44739	0.119000	0.20118	9.813000	0.99286	2.894000	0.99253	0.655000	0.94253	GAA	-	NULL		0.458	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	protein_coding	OTTHUMT00000324112.1	G	NM_145117		20075774	1	no_errors	NM_182964	genbank	human	validated	54_36p	missense	SNP	1	C
KBTBD4	55709	genome.wustl.edu	37	11	47597234	47597234	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr11:47597234G>T	ENST00000526005.1	-	3	760	c.607C>A	c.(607-609)Cag>Aag	p.Q203K	KBTBD4_ENST00000525720.1_Missense_Mutation_p.Q252K|KBTBD4_ENST00000430070.2_Missense_Mutation_p.Q219K|NDUFS3_ENST00000533507.1_Intron|KBTBD4_ENST00000395288.2_Missense_Mutation_p.Q203K|KBTBD4_ENST00000450908.1_5'Flank|RNU5E-10P_ENST00000363506.1_RNA|KBTBD4_ENST00000533290.1_Missense_Mutation_p.Q228K			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	203	BACK.							p.Q203K(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						GTTGGGTTCTGAGAACACGGA	0.438																																																1	Substitution - Missense(1)	ovary(1)	11											119.0	118.0	118.0					11																	47597234		2201	4298	6499	47553810	SO:0001583	missense	55709			AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.607C>A	11.37:g.47597234G>T	ENSP00000433340:p.Gln203Lys	Somatic		Capture	Illumina GAIIx	4	47553810	D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	Missense_Mutation	SNP	-	p.Q203K	ENST00000526005.1	37	c.607	CCDS7940.1	11	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726392	0.89298	.	.	ENSG00000123444	ENST00000526005;ENST00000533290;ENST00000395288;ENST00000359900;ENST00000430070;ENST00000525720	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	5.52	5.52	0.82312	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.79009	0.4374	L	0.50333	1.59	0.80722	D	1	P;P;D	0.53885	0.954;0.843;0.963	D;P;D	0.68621	0.932;0.893;0.959	T	0.78919	-0.2014	10	0.62326	D	0.03	-18.4129	19.8022	0.96513	0.0:0.0:1.0:0.0	.	219;203;228	Q9NVX7-2;Q9NVX7;B3KRH9	.;KBTB4_HUMAN;.	K	203;228;203;212;219;252	ENSP00000433340:Q203K;ENSP00000436713:Q228K;ENSP00000378703:Q203K;ENSP00000415106:Q219K;ENSP00000434477:Q252K	ENSP00000352971:Q212K	Q	-	1	0	KBTBD4	47553810	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.489000	0.81451	2.764000	0.94973	0.650000	0.86243	CAG	-	NULL		0.438	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	KBTBD4	protein_coding	OTTHUMT00000391763.1	G	NM_016506		47553810	-1	no_errors	NM_016506	genbank	human	validated	54_36p	missense	SNP	1	T
TRIM49B	283116	genome.wustl.edu	37	11	49059484	49059484	+	Silent	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr11:49059484T>C	ENST00000332682.7	+	7	1342	c.1314T>C	c.(1312-1314)tcT>tcC	p.S438S		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	438	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.S280S(1)		lung(8)	8						CTAATTGCTCTTTCTCACCTC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	11																																								49016060	SO:0001819	synonymous_variant	283116				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.1314T>C	11.37:g.49059484T>C		Somatic		Capture	Illumina GAIIx	4	49016060		Silent	SNP	-	p.S438	ENST00000332682.7	37	c.1314	CCDS55762.1	11																																																																																			-	NULL		0.443	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC283116	protein_coding		T			49016060	1	no_errors	XM_208043	genbank	human	model	54_36p	silent	SNP	0.09	C
GLYATL1	92292	genome.wustl.edu	37	11	58711130	58711130	+	5'UTR	SNP	A	A	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr11:58711130A>C	ENST00000317391.4	+	0	289				RP11-142C4.6_ENST00000533954.1_RNA|GLYATL1_ENST00000300079.5_Silent_p.R47R	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1							mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)	p.R47R(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	agagtggctgaggataatagg	0.483																																																1	Substitution - coding silent(1)	ovary(1)	11											68.0	62.0	64.0					11																	58711130		2201	4295	6496	58467706	SO:0001623	5_prime_UTR_variant	92292			AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.-52A>C	11.37:g.58711130A>C		Somatic		Capture	Illumina GAIIx	4	58467706	A6NDT0|Q7Z510|Q8NAW8	Silent	SNP	-	p.R47	ENST00000317391.4	37	c.139	CCDS55768.1	11																																																																																			-	NULL		0.483	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL1	protein_coding	OTTHUMT00000393783.1	A	NM_080661		58467706	1	no_errors	NM_080661	genbank	human	provisional	54_36p	silent	SNP	0	C
DLG2	1740	genome.wustl.edu	37	11	83497716	83497716	+	Silent	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr11:83497716T>C	ENST00000398301.2	-	12	1837	c.1644A>G	c.(1642-1644)aaA>aaG	p.K548K	DLG2_ENST00000524982.1_Intron|DLG2_ENST00000376106.3_Intron|DLG2_ENST00000330014.6_Intron|DLG2_ENST00000543673.1_Intron|DLG2_ENST00000418306.2_Intron|DLG2_ENST00000537455.1_Intron|DLG2_ENST00000376104.2_Intron|DLG2_ENST00000531015.1_Intron|DLG2_ENST00000280241.8_Intron|DLG2_ENST00000398309.2_Intron|DLG2_ENST00000532653.1_Intron			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				ACATTATTAGTTTGAGTTCTG	0.423																																																0			11											88.0	82.0	84.0					11																	83497716		1939	4144	6083	83175364	SO:0001819	synonymous_variant	1740			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000398301.2:c.1644A>G	11.37:g.83497716T>C		Somatic		Capture	Illumina GAIIx	4	83175364	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Silent	SNP	-	p.K548	ENST00000398301.2	37	c.1644		11																																																																																			-	NULL		0.423	DLG2-002	PUTATIVE	basic	protein_coding	DLG2	protein_coding	OTTHUMT00000259244.2	T	NM_001364		83175364	-1	no_errors	ENST00000398301	ensembl	human	known	54_36p	silent	SNP		C
FAT3	120114	genome.wustl.edu	37	11	92085577	92085577	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr11:92085577C>T	ENST00000298047.6	+	1	316	c.299C>T	c.(298-300)gCa>gTa	p.A100V	FAT3_ENST00000541502.1_Missense_Mutation_p.A100V|FAT3_ENST00000409404.2_Missense_Mutation_p.A100V|FAT3_ENST00000525166.1_5'Flank			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	100	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GTCATCATTGCAGATTTCTGT	0.368										TCGA Ovarian(4;0.039)																																						0			11											73.0	72.0	72.0					11																	92085577		1842	4100	5942	91725225	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.299C>T	11.37:g.92085577C>T	ENSP00000298047:p.Ala100Val	Somatic		Capture	Illumina GAIIx	4	91725225	B5MDB0|Q96AU6	Missense_Mutation	SNP	-	p.A100V	ENST00000298047.6	37	c.299		11	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065963	0.76187	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502	T;T;T	0.75050	-0.89;-0.9;0.39	5.53	5.53	0.82687	.	.	.	.	.	T	0.70996	0.3288	N	0.24115	0.695	0.44149	D	0.996943	D	0.58620	0.983	P	0.51615	0.675	T	0.74945	-0.3491	9	0.87932	D	0	.	14.4227	0.67196	0.0:0.8528:0.1472:0.0	.	100	Q8TDW7-3	.	V	100	ENSP00000298047:A100V;ENSP00000387040:A100V;ENSP00000443786:A100V	ENSP00000298047:A100V	A	+	2	0	FAT3	91725225	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.455000	0.73497	2.756000	0.94617	0.655000	0.94253	GCA	-	NULL		0.368	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		C	NM_001008781		91725225	1	no_errors	NM_001008781	genbank	human	validated	54_36p	missense	SNP	1	T
NFRKB	4798	genome.wustl.edu	37	11	129739556	129739556	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr11:129739556C>G	ENST00000446488.3	-	23	3467	c.3364G>C	c.(3364-3366)Gga>Cga	p.G1122R	NFRKB_ENST00000524746.1_Missense_Mutation_p.G1122R|NFRKB_ENST00000304521.5_Missense_Mutation_p.G1122R|NFRKB_ENST00000524794.1_Missense_Mutation_p.G1147R	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	1122					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)	p.G1147R(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		TGGACAGTTCCAGACCCACTG	0.597																																																1	Substitution - Missense(1)	ovary(1)	11											100.0	94.0	96.0					11																	129739556		2201	4297	6498	129244766	SO:0001583	missense	4798				CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.3364G>C	11.37:g.129739556C>G	ENSP00000400476:p.Gly1122Arg	Somatic		Capture	Illumina GAIIx	4	129244766	Q12869|Q15312|Q9H048	Missense_Mutation	SNP	-	p.G1147R	ENST00000446488.3	37	c.3439	CCDS44770.1	11	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717337	0.68844	.	.	ENSG00000170322	ENST00000304521;ENST00000446488;ENST00000524794;ENST00000524746	.	.	.	5.27	5.27	0.74061	.	0.133504	0.49305	D	0.000144	T	0.62672	0.2447	L	0.27053	0.805	0.43160	D	0.994944	D;D;D	0.76494	0.999;0.992;0.992	D;D;D	0.71414	0.973;0.936;0.936	T	0.66085	-0.6011	9	0.66056	D	0.02	-12.1045	12.3205	0.54981	0.0:0.9223:0.0:0.0777	.	1122;1121;1147	Q6P4R8;Q6P4R8-3;Q6P4R8-2	NFRKB_HUMAN;.;.	R	1122;1122;1147;1122	.	ENSP00000303800:G1122R	G	-	1	0	NFRKB	129244766	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.441000	0.59981	2.470000	0.83445	0.650000	0.86243	GGA	-	NULL		0.597	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFRKB	protein_coding	OTTHUMT00000386063.2	C	NM_006165		129244766	-1	no_errors	NM_006165	genbank	human	validated	54_36p	missense	SNP	0.79	G
KLRC3	3823	genome.wustl.edu	37	12	10570982	10570982	+	Silent	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr12:10570982G>A	ENST00000396439.2	-	4	491	c.447C>T	c.(445-447)aaC>aaT	p.N149N	NKG2-E_ENST00000539033.1_Silent_p.N149N|KLRC3_ENST00000381903.2_Silent_p.N149N|KLRC3_ENST00000381904.2_Silent_p.N149N	NM_002261.2	NP_002252.2	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C, member 3	149	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular defense response (GO:0006968)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.N149N(1)		large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						GACTAGAAGAGTTCTTTGAAG	0.338																																																1	Substitution - coding silent(1)	ovary(1)	12											149.0	156.0	154.0					12																	10570982		2203	4300	6503	10462249	SO:0001819	synonymous_variant	3823			L14542	CCDS31744.1, CCDS41755.1	12p13	2008-08-05			ENSG00000205810	ENSG00000205810		"""Killer cell lectin-like receptors"""	6376	protein-coding gene	gene with protein product		602892				9598306	Standard	NM_002261		Approved	NKG2-E	uc001qyi.1	Q07444	OTTHUMG00000167149	ENST00000396439.2:c.447C>T	12.37:g.10570982G>A		Somatic		Capture	Illumina GAIIx	4	10462249	Q8WXA4|Q96RL0|Q9UP04	Silent	SNP	HMMPfam_Lectin_C;superfamily_C-type lectin-like	p.N149	ENST00000396439.2	37	c.447	CCDS41755.1	12																																																																																			-	HMMPfam_Lectin_C		0.338	KLRC3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KLRC3	protein_coding	OTTHUMT00000393471.1	G	NM_002261		10462249	-1	no_errors	NM_007333	genbank	human	reviewed	54_36p	silent	SNP	0.01	A
SSH1	54434	genome.wustl.edu	37	12	109246450	109246450	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr12:109246450T>C	ENST00000326495.5	-	2	167	c.74A>G	c.(73-75)gAg>gGg	p.E25G	SSH1_ENST00000551165.1_Missense_Mutation_p.E25G|SSH1_ENST00000360239.3_5'UTR	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	25					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.E25G(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCTGCCAGCCTCCAACTACAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	12											125.0	120.0	122.0					12																	109246450		2203	4300	6503	107770579	SO:0001583	missense	54434			BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.74A>G	12.37:g.109246450T>C	ENSP00000315713:p.Glu25Gly	Somatic		Capture	Illumina GAIIx	4	107770579	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	-	p.E25G	ENST00000326495.5	37	c.74	CCDS9121.1	12	.	.	.	.	.	.	.	.	.	.	T	12.76	2.033766	0.35893	.	.	ENSG00000084112	ENST00000326495;ENST00000551165	T;T	0.15139	2.45;2.47	5.02	5.02	0.67125	.	0.925148	0.09102	N	0.848339	T	0.12092	0.0294	N	0.14661	0.345	0.80722	D	1	B;B	0.17038	0.005;0.02	B;B	0.09377	0.003;0.004	T	0.09164	-1.0687	10	0.38643	T	0.18	-10.987	11.1851	0.48650	0.0:0.0:0.0:1.0	.	25;25	Q8WYL5-2;Q8WYL5	.;SSH1_HUMAN	G	25	ENSP00000315713:E25G;ENSP00000448824:E25G	ENSP00000315713:E25G	E	-	2	0	SSH1	107770579	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	3.037000	0.49775	1.911000	0.55334	0.445000	0.29226	GAG	-	NULL		0.463	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSH1	protein_coding	OTTHUMT00000403724.1	T	NM_018984		107770579	-1	no_errors	NM_018984	genbank	human	provisional	54_36p	missense	SNP	1	C
SLC6A12	6539	genome.wustl.edu	37	12	313861	313861	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr12:313861G>T	ENST00000428720.1	-	4	961	c.218C>A	c.(217-219)gCc>gAc	p.A73D	RP11-283I3.2_ENST00000539568.1_RNA|SLC6A12_ENST00000536824.1_Missense_Mutation_p.A73D|SLC6A12_ENST00000359674.4_Missense_Mutation_p.A73D|SLC6A12_ENST00000424061.2_Missense_Mutation_p.A73D|SLC6A12_ENST00000538272.1_5'Flank|SLC6A12_ENST00000397296.2_Missense_Mutation_p.A73D	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	73					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)	p.A73D(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			GATGAAGAAGGCTCCTGCAGA	0.592																																																1	Substitution - Missense(1)	ovary(1)	12											55.0	50.0	52.0					12																	313861		2203	4300	6503	184122	SO:0001583	missense	6539			L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.218C>A	12.37:g.313861G>T	ENSP00000388184:p.Ala73Asp	Somatic		Capture	Illumina GAIIx	4	184122	A0AV52|B2R992|D3DUN8	Missense_Mutation	SNP	HMMPfam_SNF	p.A73D	ENST00000428720.1	37	c.218	CCDS8501.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.137906|4.137906	0.77775|0.77775	.|.	.|.	ENSG00000111181|ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824;ENST00000537793|ENST00000535347	T;T;T;T;T;T|T	0.80566|0.46063	-1.39;-1.39;-1.39;-1.39;-1.39;-1.39|0.88	4.59|4.59	4.59|4.59	0.56863|0.56863	.|.	0.075087|.	0.53938|.	D|.	0.000042|.	T|T	0.81069|0.81069	0.4746|0.4746	H|H	0.99682|0.99682	4.7|4.7	0.80722|0.80722	D|D	1|1	D|.	0.69078|.	0.997|.	D|.	0.70227|.	0.968|.	D|D	0.90485|0.90485	0.4463|0.4463	10|7	0.87932|0.87932	D|D	0|0	.|.	17.3747|17.3747	0.87389|0.87389	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	73|.	P48065|.	S6A12_HUMAN|.	D|T	73|34	ENSP00000352702:A73D;ENSP00000380464:A73D;ENSP00000388184:A73D;ENSP00000399136:A73D;ENSP00000444268:A73D;ENSP00000439351:A73D|ENSP00000446082:P34T	ENSP00000352702:A73D|ENSP00000446082:P34T	A|P	-|-	2|1	0|0	SLC6A12|SLC6A12	184122|184122	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.857000|0.857000	0.48899|0.48899	3.898000|3.898000	0.56281|0.56281	2.281000|2.281000	0.76405|0.76405	0.491000|0.491000	0.48974|0.48974	GCC|CCT	-	HMMPfam_SNF		0.592	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A12	protein_coding	OTTHUMT00000206671.2	G	NM_003044		184122	-1	no_errors	NM_003044	genbank	human	validated	54_36p	missense	SNP	1	T
HIST4H4	121504	genome.wustl.edu	37	12	14923900	14923900	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr12:14923900C>T	ENST00000539745.1	-	1	165	c.119G>A	c.(118-120)cGa>cAa	p.R40Q	HIST4H4_ENST00000541592.1_5'Flank	NM_175054.2	NP_778224.1	P62805	H4_HUMAN	histone cluster 4, H4	40					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.R40Q(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)	6						GCCCCCACGTCGGGCGAGACG	0.617											OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	12											54.0	54.0	54.0					12																	14923900		2203	4300	6503	14815167	SO:0001583	missense	121504			AY128653	CCDS8665.1	12p12.3	2011-01-27	2006-10-11			ENSG00000197837		"""Histones / Replication-dependent"""	20510	protein-coding gene	gene with protein product		615069	"""histone 4, H4"""			12408966	Standard	NM_175054		Approved	MGC24116	uc001rcf.4	P62805		ENST00000539745.1:c.119G>A	12.37:g.14923900C>T	ENSP00000443017:p.Arg40Gln	Somatic	698	Capture	Illumina GAIIx	4	14815167	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	-	p.R40Q	ENST00000539745.1	37	c.119	CCDS8665.1	12	.	.	.	.	.	.	.	.	.	.	C	16.14	3.037596	0.54896	.	.	ENSG00000197837	ENST00000539745	T	0.76968	-1.06	4.18	2.33	0.28932	.	0.000000	0.53938	U	0.000054	T	0.79816	0.4511	.	.	.	0.50813	D	0.999899	.	.	.	.	.	.	T	0.77869	-0.2427	7	0.87932	D	0	.	6.8119	0.23809	0.1752:0.7296:0.0:0.0952	.	.	.	.	Q	40	ENSP00000443017:R40Q	ENSP00000350767:R40Q	R	-	2	0	HIST4H4	14815167	0.990000	0.36364	0.002000	0.10522	0.012000	0.07955	2.199000	0.42715	0.521000	0.28445	0.650000	0.86243	CGA	-	NULL		0.617	HIST4H4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST4H4	protein_coding	OTTHUMT00000400844.1	C	NM_175054		14815167	-1	no_errors	NM_175054	genbank	human	reviewed	54_36p	missense	SNP	1	T
PDZRN4	29951	genome.wustl.edu	37	12	41966489	41966489	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr12:41966489G>T	ENST00000402685.2	+	10	1916	c.1908G>T	c.(1906-1908)aaG>aaT	p.K636N	PDZRN4_ENST00000298919.7_Missense_Mutation_p.K376N|PDZRN4_ENST00000539469.2_Missense_Mutation_p.K378N	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	636							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K378N(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TCAAATGCAAGATTCGAAATC	0.458																																																1	Substitution - Missense(1)	ovary(1)	12											101.0	97.0	98.0					12																	41966489		2203	4300	6503	40252756	SO:0001583	missense	29951			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1908G>T	12.37:g.41966489G>T	ENSP00000384197:p.Lys636Asn	Somatic		Capture	Illumina GAIIx	4	40252756	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	HMMPfam_PDZ;superfamily_PDZ domain-like	p.K378N	ENST00000402685.2	37	c.1134	CCDS53777.1	12	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849911	0.32699	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.72282	-0.64;3.83;3.83	4.49	2.64	0.31445	.	0.165042	0.41500	D	0.000869	T	0.63153	0.2487	L	0.34521	1.04	0.37658	D	0.922679	P;B;B	0.50156	0.932;0.391;0.024	P;B;B	0.47864	0.559;0.236;0.037	T	0.64170	-0.6470	10	0.38643	T	0.18	-39.4202	10.7634	0.46279	0.1587:0.0:0.8413:0.0	.	636;376;378	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	N	636;378;376	ENSP00000384197:K636N;ENSP00000439990:K378N;ENSP00000298919:K376N	ENSP00000298919:K376N	K	+	3	2	PDZRN4	40252756	1.000000	0.71417	0.977000	0.42913	0.995000	0.86356	2.047000	0.41269	0.601000	0.29879	0.650000	0.86243	AAG	-	NULL		0.458	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	protein_coding	OTTHUMT00000403701.1	G	NM_013377		40252756	1	no_errors	NM_013377	genbank	human	validated	54_36p	missense	SNP	1	T
MRPL42	28977	genome.wustl.edu	37	12	93881315	93881315	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr12:93881315C>G	ENST00000549982.1	+	5	423	c.262C>G	c.(262-264)Cat>Gat	p.H88D	MRPL42_ENST00000547098.1_Missense_Mutation_p.H88D|MRPL42_ENST00000361630.2_Missense_Mutation_p.H88D|MRPL42_ENST00000548545.1_Missense_Mutation_p.H88D|MRPL42_ENST00000393128.4_Missense_Mutation_p.H88D|MRPL42_ENST00000552217.1_Missense_Mutation_p.H88D	NM_014050.3|NM_172177.3	NP_054769.1|NP_751917.1	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42	88					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.H88D(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)	7						TGAAGAAACACATGATCAAGT	0.378																																																1	Substitution - Missense(1)	ovary(1)	12											128.0	116.0	120.0					12																	93881315		2203	4300	6503	92405446	SO:0001583	missense	28977			AB051626	CCDS9045.1	12q22	2014-02-12			ENSG00000198015	ENSG00000198015		"""Mitochondrial ribosomal proteins / large subunits"", ""Mitochondrial ribosomal proteins / small subunits"""	14493	protein-coding gene	gene with protein product	"""mitochondrial ribosomal protein S32"""	611847				11279123, 11042152	Standard	NM_014050		Approved	MRPS32, MRP-L31, RPML31, PTD007, HSPC204, MRPL31	uc001tcr.3	Q9Y6G3	OTTHUMG00000170157	ENST00000549982.1:c.262C>G	12.37:g.93881315C>G	ENSP00000449884:p.His88Asp	Somatic		Capture	Illumina GAIIx	4	92405446	Q6FID1|Q96Q48|Q9P0S1	Missense_Mutation	SNP	-	p.H88D	ENST00000549982.1	37	c.262	CCDS9045.1	12	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009622	0.54361	.	.	ENSG00000198015	ENST00000549982;ENST00000361630;ENST00000552217;ENST00000393128	.	.	.	4.69	3.78	0.43462	.	0.065965	0.64402	D	0.000017	T	0.67767	0.2928	M	0.70275	2.135	0.40641	D	0.981946	P;D	0.56287	0.954;0.975	P;P	0.56088	0.623;0.791	T	0.70669	-0.4808	9	0.42905	T	0.14	-26.8427	13.5123	0.61519	0.0:0.9175:0.0:0.0825	.	88;88	Q9Y6G3;A6NCI0	RM42_HUMAN;.	D	88	.	ENSP00000355202:H88D	H	+	1	0	MRPL42	92405446	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.981000	0.63819	2.298000	0.77334	0.591000	0.81541	CAT	-	NULL		0.378	MRPL42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL42	protein_coding	OTTHUMT00000407715.1	C	NM_014050		92405446	1	no_errors	NM_014050	genbank	human	reviewed	54_36p	missense	SNP	1	G
TMEM116	89894	genome.wustl.edu	37	12	112371728	112371728	+	Missense_Mutation	SNP	C	C	G	rs566186086	byFrequency	TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr12:112371728C>G	ENST00000550831.3	-	8	787	c.419G>C	c.(418-420)cGc>cCc	p.R140P	TMEM116_ENST00000437003.2_Missense_Mutation_p.R140P|TMEM116_ENST00000549537.2_Missense_Mutation_p.R46P|TMEM116_ENST00000355445.3_Missense_Mutation_p.R197P|TMEM116_ENST00000552374.2_Missense_Mutation_p.R232P|TMEM116_ENST00000354825.3_Missense_Mutation_p.R140P	NM_138341.2	NP_612350.1	Q8NCL8	TM116_HUMAN	transmembrane protein 116	140						integral component of membrane (GO:0016021)		p.R140P(1)		endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)	8						TGGGTAGAAGCGCACCCGTTG	0.498																																																1	Substitution - Missense(1)	ovary(1)	12											122.0	114.0	117.0					12																	112371728		2203	4300	6503	110856111	SO:0001583	missense	89894			AK074648	CCDS9157.1, CCDS55886.1, CCDS55887.1	12q24.13	2012-03-02			ENSG00000198270	ENSG00000198270			25084	protein-coding gene	gene with protein product						12477932	Standard	NM_001193453		Approved	FLJ90167	uc001ttd.2	Q8NCL8	OTTHUMG00000169606	ENST00000550831.3:c.419G>C	12.37:g.112371728C>G	ENSP00000450377:p.Arg140Pro	Somatic		Capture	Illumina GAIIx	4	110856111	G3V1W7|G5E985|Q6NSH5|Q8IZ66	Missense_Mutation	SNP	-	p.R140P	ENST00000550831.3	37	c.419	CCDS9157.1	12	.	.	.	.	.	.	.	.	.	.	c	3.743	-0.053160	0.07362	.	.	ENSG00000198270	ENST00000355445;ENST00000354825;ENST00000550831;ENST00000437003;ENST00000549537;ENST00000552374	T;T;T;T;T	0.47869	0.85;0.84;0.84;0.84;0.83	4.7	2.79	0.32731	.	0.888263	0.09726	N	0.763822	T	0.44159	0.1280	L	0.47716	1.5	0.09310	N	1	D;D;D;D	0.58268	0.982;0.977;0.96;0.977	P;P;P;P	0.49528	0.578;0.614;0.593;0.614	T	0.24190	-1.0167	10	0.34782	T	0.22	0.0661	3.2808	0.06915	0.3152:0.4681:0.0:0.2167	.	46;197;232;140	G3V1Z3;G5E985;G3V1W7;Q8NCL8	.;.;.;TM116_HUMAN	P	197;140;140;140;46;232	ENSP00000347620:R197P;ENSP00000346883:R140P;ENSP00000450377:R140P;ENSP00000395861:R140P;ENSP00000447731:R232P	ENSP00000346883:R140P	R	-	2	0	TMEM116	110856111	0.106000	0.21978	0.171000	0.22900	0.060000	0.15804	1.556000	0.36288	0.540000	0.28808	0.467000	0.42956	CGC	-	NULL		0.498	TMEM116-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	TMEM116	protein_coding	OTTHUMT00000405026.3	C	NM_138341		110856111	-1	no_errors	NM_138341	genbank	human	provisional	54_36p	missense	SNP	0.06	G
PARP4	143	genome.wustl.edu	37	13	25051839	25051839	+	Splice_Site	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr13:25051839C>G	ENST00000381989.3	-	14	1894	c.1789G>C	c.(1789-1791)Gat>Cat	p.D597H		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	597					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.D597H(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		ATTGTCCTACCTTCAACCTTT	0.299																																																1	Substitution - Missense(1)	ovary(1)	13											48.0	53.0	51.0					13																	25051839		2199	4290	6489	23949839	SO:0001630	splice_region_variant	143			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.1789+1G>C	13.37:g.25051839C>G		Somatic		Capture	Illumina GAIIx	4	23949839	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	HMMPfam_BRCT;HMMPfam_VWA;HMMPfam_PARP;HMMPfam_VIT;superfamily_Domain of poly(ADP-ribose) polymerase;superfamily_BRCT domain;superfamily_vWA-like;superfamily_ADP-ribosylation	p.D597H	ENST00000381989.3	37	c.1789	CCDS9307.1	13	.	.	.	.	.	.	.	.	.	.	C	15.32	2.799603	0.50208	.	.	ENSG00000102699	ENST00000381989	T	0.02032	4.49	3.98	3.98	0.46160	.	0.400514	0.24065	U	0.041874	T	0.06234	0.0161	L	0.32530	0.975	0.30627	N	0.75793	D	0.89917	1.0	D	0.85130	0.997	T	0.11299	-1.0593	9	.	.	.	-18.7299	11.4848	0.50348	0.0:1.0:0.0:0.0	.	597	Q9UKK3	PARP4_HUMAN	H	597	ENSP00000371419:D597H	.	D	-	1	0	PARP4	23949839	1.000000	0.71417	0.998000	0.56505	0.883000	0.51084	1.263000	0.33004	2.059000	0.61396	0.644000	0.83932	GAT	-	NULL		0.299	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	protein_coding	OTTHUMT00000044189.1	C	NM_006437	Missense_Mutation	23949839	-1	no_errors	NM_006437	genbank	human	reviewed	54_36p	missense	SNP	1	G
RNASE2	6036	genome.wustl.edu	37	14	21424039	21424039	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr14:21424039T>C	ENST00000304625.2	+	2	199	c.109T>C	c.(109-111)Tgg>Cgg	p.W37R		NM_002934.2	NP_002925.1	P10153	RNAS2_HUMAN	ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)	37				W -> R (in Ref. 10; AA sequence). {ECO:0000305}.	chemotaxis (GO:0006935)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)|ribonuclease activity (GO:0004540)	p.W37R(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	17	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)		CTGGGCTCAATGGTTTGAAAC	0.448																																																1	Substitution - Missense(1)	ovary(1)	14											86.0	81.0	83.0					14																	21424039		2203	4300	6503	20493879	SO:0001583	missense	6036			X55988	CCDS9561.1	14q11.2	2014-03-13			ENSG00000169385	ENSG00000169385		"""Ribonucleases, RNase A"""	10045	protein-coding gene	gene with protein product		131410		RNS2		1577491, 2734298	Standard	NM_002934		Approved	EDN	uc001vyl.1	P10153	OTTHUMG00000029607	ENST00000304625.2:c.109T>C	14.37:g.21424039T>C	ENSP00000303276:p.Trp37Arg	Somatic		Capture	Illumina GAIIx	4	20493879	Q52M39|Q9H2B7|Q9UCG7	Missense_Mutation	SNP	HMMPfam_RnaseA;superfamily_RNase A-like	p.W37R	ENST00000304625.2	37	c.109	CCDS9561.1	14	.	.	.	.	.	.	.	.	.	.	t	14.60	2.584516	0.46110	.	.	ENSG00000169385	ENST00000304625	T	0.72394	-0.65	2.78	2.78	0.32641	Ribonuclease A, domain (4);	1.760720	0.03567	U	0.227943	T	0.80999	0.4732	L	0.55990	1.75	0.32371	N	0.555904	D	0.89917	1.0	D	0.91635	0.999	T	0.68413	-0.5415	10	0.52906	T	0.07	.	7.369	0.26790	0.0:0.0:0.0:1.0	.	37	P10153	RNAS2_HUMAN	R	37	ENSP00000303276:W37R	ENSP00000303276:W37R	W	+	1	0	RNASE2	20493879	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	2.774000	0.47694	1.519000	0.48950	0.374000	0.22700	TGG	-	HMMPfam_RnaseA		0.448	RNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE2	protein_coding	OTTHUMT00000073799.2	T			20493879	1	no_errors	NM_002934	genbank	human	validated	54_36p	missense	SNP	0.95	C
MYH6	4624	genome.wustl.edu	37	14	23856750	23856750	+	Silent	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr14:23856750C>G	ENST00000356287.3	-	31	4667	c.4638G>C	c.(4636-4638)ctG>ctC	p.L1546L	MIR208A_ENST00000362287.1_RNA|MYH6_ENST00000405093.3_Silent_p.L1546L			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1546					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.L1546L(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CTGCCTCCTCCAGGGCTGACT	0.607																																																1	Substitution - coding silent(1)	ovary(1)	14											88.0	68.0	75.0					14																	23856750		2203	4300	6503	22926590	SO:0001819	synonymous_variant	4624			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.4638G>C	14.37:g.23856750C>G		Somatic		Capture	Illumina GAIIx	4	22926590	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Prefoldin;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.L1546	ENST00000356287.3	37	c.4638	CCDS9600.1	14																																																																																			-	HMMPfam_Myosin_tail_1		0.607	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	protein_coding	OTTHUMT00000071796.3	C			22926590	-1	no_errors	NM_002471	genbank	human	validated	54_36p	silent	SNP	1	G
GPHN	10243	genome.wustl.edu	37	14	67525489	67525489	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr14:67525489T>A	ENST00000315266.5	+	10	2152	c.1031T>A	c.(1030-1032)aTc>aAc	p.I344N	GPHN_ENST00000478722.1_Missense_Mutation_p.I377N|GPHN_ENST00000305960.9_Missense_Mutation_p.I313N|GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000459628.1_Missense_Mutation_p.I359N|GPHN_ENST00000543237.1_Missense_Mutation_p.I390N	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	344	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)	p.I377N(1)		large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		GGGACAGAAATCATCAATTAC	0.393			T	MLL	AL																																		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	1	Substitution - Missense(1)	ovary(1)	14											168.0	161.0	163.0					14																	67525489		2203	4300	6503	66595242	SO:0001583	missense	10243			AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.1031T>A	14.37:g.67525489T>A	ENSP00000312771:p.Ile344Asn	Somatic		Capture	Illumina GAIIx	4	66595242	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	HMMPfam_MoCF_biosynth;superfamily_Molybdenum cofactor biosynthesis proteins;HMMPfam_MoeA_N;superfamily_MoeA N-terminal region -like;HMMPfam_MoeA_C;superfamily_MoeA C-terminal domain-like	p.I377N	ENST00000315266.5	37	c.1130	CCDS32103.1	14	.	.	.	.	.	.	.	.	.	.	T	24.5	4.542686	0.85917	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000459628;ENST00000543237;ENST00000305960	.	.	.	5.59	5.59	0.84812	MoeA, N-terminal and linker domain (2);	0.000000	0.85682	D	0.000000	T	0.61602	0.2360	L	0.28400	0.85	0.80722	D	1	B;P;B;B;D	0.65815	0.244;0.522;0.288;0.452;0.995	B;B;B;B;P	0.62560	0.135;0.254;0.213;0.135;0.904	T	0.56697	-0.7936	9	0.19147	T	0.46	-7.5868	15.7679	0.78141	0.0:0.0:0.0:1.0	.	313;390;344;377;359	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2;G3V582	.;.;GEPH_HUMAN;.;.	N	344;377;359;390;313	.	ENSP00000303019:I313N	I	+	2	0	GPHN	66595242	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.671000	0.83941	2.128000	0.65567	0.460000	0.39030	ATC	-	HMMPfam_MoeA_N		0.393	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	GPHN	protein_coding	OTTHUMT00000074299.2	T	NM_020806		66595242	1	no_errors	NM_020806	genbank	human	reviewed	54_36p	missense	SNP	1	A
PNMA1	9240	genome.wustl.edu	37	14	74179713	74179713	+	Silent	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr14:74179713G>A	ENST00000316836.3	-	1	1415	c.630C>T	c.(628-630)gcC>gcT	p.A210A		NM_006029.4	NP_006020.4	Q8ND90	PNMA1_HUMAN	paraneoplastic Ma antigen 1	210					inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)		p.A210A(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|urinary_tract(2)	13				BRCA - Breast invasive adenocarcinoma(234;0.00331)|KIRC - Kidney renal clear cell carcinoma(182;0.0797)		taacatcagcggcggggcctc	0.552																																																1	Substitution - coding silent(1)	ovary(1)	14											54.0	61.0	59.0					14																	74179713		2203	4300	6503	73249466	SO:0001819	synonymous_variant	9240			AF037364	CCDS9818.1	14q24.3	2012-02-09	2012-02-09		ENSG00000176903	ENSG00000176903		"""Paraneoplastic Ma antigens"""	9158	protein-coding gene	gene with protein product		604010	"""paraneoplastic antigen MA1"""			10050892	Standard	NM_006029		Approved	MA1	uc001xor.1	Q8ND90	OTTHUMG00000169183	ENST00000316836.3:c.630C>T	14.37:g.74179713G>A		Somatic		Capture	Illumina GAIIx	4	73249466	A8K4L5|O95144|Q8NG07	Silent	SNP	superfamily_Globin-like	p.A210	ENST00000316836.3	37	c.630	CCDS9818.1	14																																																																																			-	NULL		0.552	PNMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA1	protein_coding	OTTHUMT00000402774.1	G	NM_006029		73249466	-1	no_errors	NM_006029	genbank	human	validated	54_36p	silent	SNP	0.33	A
BATF	10538	genome.wustl.edu	37	14	75991531	75991531	+	Splice_Site	SNP	G	G	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr14:75991531G>C	ENST00000286639.6	+	2	426	c.168G>C	c.(166-168)ctG>ctC	p.L56L	BATF_ENST00000555504.1_Intron|BATF_ENST00000555795.1_3'UTR	NM_006399.3	NP_006390.1	Q16520	BATF_HUMAN	basic leucine zipper transcription factor, ATF-like	56	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hematopoietic stem cell differentiation (GO:0060218)|isotype switching (GO:0045190)|lymphoid progenitor cell differentiation (GO:0002320)|myeloid dendritic cell differentiation (GO:0043011)|T-helper 17 cell differentiation (GO:0072539)|T-helper 17 cell lineage commitment (GO:0072540)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L56L(1)		large_intestine(1)|ovary(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.028)		CCCTGCACCTGGTAAGTGTTC	0.522																																																1	Substitution - coding silent(1)	ovary(1)	14											81.0	64.0	70.0					14																	75991531		2203	4300	6503	75061284	SO:0001630	splice_region_variant	10538			AF016898	CCDS9843.1	14q24	2013-01-10				ENSG00000156127		"""basic leucine zipper proteins"""	958	protein-coding gene	gene with protein product	"""activating transcription factor B"", ""SF-HT-activated gene 2"""	612476				8570175, 8630063	Standard	NM_006399		Approved	B-ATF, SFA-2, BATF1	uc001xrr.3	Q16520		ENST00000286639.6:c.168+1G>C	14.37:g.75991531G>C		Somatic		Capture	Illumina GAIIx	4	75061284		Silent	SNP	superfamily_A DNA-binding domain in eukaryotic transcription factors;HMMPfam_bZIP_1	p.L56	ENST00000286639.6	37	c.168	CCDS9843.1	14																																																																																			-	HMMPfam_bZIP_1		0.522	BATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BATF	protein_coding	OTTHUMT00000413669.1	G	NM_006399	Silent	75061284	1	no_errors	NM_006399	genbank	human	reviewed	54_36p	silent	SNP	1	C
RPS6KA5	9252	genome.wustl.edu	37	14	91386568	91386568	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr14:91386568G>C	ENST00000261991.3	-	7	961	c.788C>G	c.(787-789)tCc>tGc	p.S263C	RPS6KA5_ENST00000536315.2_Missense_Mutation_p.S184C|RPS6KA5_ENST00000418736.2_Missense_Mutation_p.S263C	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	263	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S263C(1)		endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		CTCAGCTTGGGAATTTTTTTC	0.358																																																1	Substitution - Missense(1)	ovary(1)	14											87.0	93.0	91.0					14																	91386568		2203	4298	6501	90456321	SO:0001583	missense	9252			AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.788C>G	14.37:g.91386568G>C	ENSP00000261991:p.Ser263Cys	Somatic		Capture	Illumina GAIIx	4	90456321	O95316|Q96AF7	Missense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_Pkinase_C;superfamily_Protein kinase-like (PK-like)	p.S263C	ENST00000261991.3	37	c.788	CCDS9893.1	14	.	.	.	.	.	.	.	.	.	.	G	19.74	3.883684	0.72410	.	.	ENSG00000100784	ENST00000261991;ENST00000536315;ENST00000418736	T;T;T	0.27720	1.65;1.65;1.65	5.31	5.31	0.75309	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.117980	0.64402	D	0.000012	T	0.57007	0.2024	M	0.72624	2.21	0.80722	D	1	D;D	0.89917	0.998;1.0	P;D	0.73708	0.852;0.981	T	0.60316	-0.7287	10	0.72032	D	0.01	.	18.9634	0.92685	0.0:0.0:1.0:0.0	.	263;263	O75582-2;O75582	.;KS6A5_HUMAN	C	263;184;263	ENSP00000261991:S263C;ENSP00000442803:S184C;ENSP00000402787:S263C	ENSP00000261991:S263C	S	-	2	0	RPS6KA5	90456321	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.978000	0.93450	2.469000	0.83416	0.650000	0.86243	TCC	-	HMMPfam_Pkinase		0.358	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA5	protein_coding	OTTHUMT00000411442.2	G	NM_004755		90456321	-1	no_errors	NM_004755	genbank	human	validated	54_36p	missense	SNP	1	C
SNHG14	104472715	genome.wustl.edu	37	15	25310209	25310209	+	RNA	DEL	G	G	-			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr15:25310209delG	ENST00000549804.2	+	0	538				SNHG14_ENST00000551077.1_RNA|SNORD116-7_ENST00000384404.1_RNA|SNORD116-5_ENST00000384462.1_RNA|SNORD116-6_ENST00000384711.1_RNA					small nucleolar RNA host gene 14 (non-protein coding)																		AACATTCCTTGGAAAAGCTGA	0.473																																																0			15											201.0	179.0	185.0					15																	25310209		876	1991	2867	22861302			100033418					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25310209delG		Somatic		Capture	Illumina GAIIx	Phase_III	22861302		RNA	DEL	-	NULL	ENST00000549804.2	37	NULL		15																																																																																			(deletion:rna[22861265,22861362])	-		0.473	SNHG14-012	KNOWN	non_canonical_other|basic	antisense	SNORD116-6	processed_transcript	OTTHUMT00000408278.2	G			22861302	1	no_errors	NR_003321	genbank	human	provisional	54_36p	rna	DEL	0.998	-
SEPT1	1731	genome.wustl.edu	37	16	30390845	30390845	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr16:30390845G>C	ENST00000571393.1	-	9	857	c.671C>G	c.(670-672)cCt>cGt	p.P224R	SEPT1_ENST00000605106.1_Missense_Mutation_p.P229R|SEPT1_ENST00000321367.3_Missense_Mutation_p.P271R			Q8WYJ6	SEPT1_HUMAN	septin 1	224	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)	p.P224R(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			GACTGCAAAAGGGATGCTTTC	0.632																																																1	Substitution - Missense(1)	ovary(1)	16											66.0	57.0	60.0					16																	30390845		2197	4300	6497	30298346	SO:0001583	missense	1731			AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984	ENST00000571393.1:c.671C>G	16.37:g.30390845G>C	ENSP00000460441:p.Pro224Arg	Somatic		Capture	Illumina GAIIx	4	30298346	B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Missense_Mutation	SNP	HMMPfam_Septin;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.P224R	ENST00000571393.1	37	c.671		16	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960452	0.92791	.	.	ENSG00000180096	ENST00000321367	.	.	.	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000010	D	0.90051	0.6893	H	0.96604	3.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92868	0.6312	9	0.87932	D	0	.	18.6739	0.91521	0.0:0.0:1.0:0.0	.	224	Q8WYJ6	SEPT1_HUMAN	R	224	.	ENSP00000324511:P224R	P	-	2	0	SEPT1	30298346	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	9.840000	0.99478	2.722000	0.93159	0.655000	0.94253	CCT	-	HMMPfam_Septin		0.632	SEPT1-201	KNOWN	basic	protein_coding	SEPT1	protein_coding		G	NM_052838		30298346	-1	no_errors	NM_052838	genbank	human	reviewed	54_36p	missense	SNP	1	C
CES3	23491	genome.wustl.edu	37	16	66998354	66998354	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr16:66998354G>T	ENST00000303334.4	+	5	726	c.655G>T	c.(655-657)Gac>Tac	p.D219Y	CES3_ENST00000394037.1_Missense_Mutation_p.D219Y|RP11-361L15.4_ENST00000566869.1_RNA	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	219						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)	p.D219Y(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		CTTCGGGGGTGACCTCAACTG	0.587																																																1	Substitution - Missense(1)	ovary(1)	16											97.0	100.0	99.0					16																	66998354		2200	4300	6500	65555855	SO:0001583	missense	23491			AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.655G>T	16.37:g.66998354G>T	ENSP00000304782:p.Asp219Tyr	Somatic		Capture	Illumina GAIIx	4	65555855	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Missense_Mutation	SNP	HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases	p.D219Y	ENST00000303334.4	37	c.655	CCDS10826.1	16	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107061	0.77096	.	.	ENSG00000172828	ENST00000303334;ENST00000394037	T;T	0.79749	-1.3;-1.3	4.13	-0.621	0.11564	Carboxylesterase, type B (1);	0.529435	0.15921	N	0.238114	D	0.92126	0.7504	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89720	0.3918	10	0.87932	D	0	.	8.5325	0.33344	0.3637:0.0:0.6363:0.0	.	219	Q6UWW8	EST3_HUMAN	Y	219	ENSP00000304782:D219Y;ENSP00000377602:D219Y	ENSP00000304782:D219Y	D	+	1	0	CES3	65555855	0.932000	0.31603	0.001000	0.08648	0.814000	0.46013	1.111000	0.31159	-0.173000	0.10761	0.655000	0.94253	GAC	-	HMMPfam_COesterase		0.587	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CES3	protein_coding	OTTHUMT00000268848.1	G	NM_024922		65555855	1	no_errors	NM_024922	genbank	human	validated	54_36p	missense	SNP	0.886	T
NFAT5	10725	genome.wustl.edu	37	16	69602440	69602440	+	Intron	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr16:69602440G>A	ENST00000354436.2	+	1	391				MIR1538_ENST00000411177.1_RNA|NFAT5_ENST00000567239.1_Missense_Mutation_p.G39E|NFAT5_ENST00000349945.1_5'UTR|NFAT5_ENST00000566899.1_Intron|NFAT5_ENST00000393742.2_Intron|NFAT5_ENST00000432919.1_Missense_Mutation_p.G39E	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive						cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G39E(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CATAGAGCTGGACTATTGGAA	0.343																																																1	Substitution - Missense(1)	ovary(1)	16											86.0	80.0	82.0					16																	69602440		1835	4090	5925	68159941	SO:0001627	intron_variant	10725			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.73+2163G>A	16.37:g.69602440G>A		Somatic		Capture	Illumina GAIIx	4	68159941	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	-	p.G39E	ENST00000354436.2	37	c.116	CCDS10881.1	16	.	.	.	.	.	.	.	.	.	.	G	15.95	2.984902	0.53934	.	.	ENSG00000102908	ENST00000432919;ENST00000426654	T;T	0.25579	1.79;1.79	5.76	5.76	0.90799	.	.	.	.	.	T	0.13841	0.0335	N	0.08118	0	0.80722	D	1	B;B	0.27823	0.19;0.19	B;B	0.28139	0.086;0.086	T	0.13737	-1.0498	9	0.09590	T	0.72	.	15.4766	0.75485	0.0:0.0:1.0:0.0	.	39;39	A2RRB4;E9PHR7	.;.	E	39	ENSP00000396538:G39E;ENSP00000413126:G39E	ENSP00000413126:G39E	G	+	2	0	NFAT5	68159941	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.489000	0.60309	2.733000	0.93635	0.467000	0.42956	GGA	-	NULL		0.343	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	protein_coding	OTTHUMT00000268952.2	G	NM_138714		68159941	1	no_errors	NM_138713	genbank	human	reviewed	54_36p	missense	SNP	1	A
SUPT6H	6830	genome.wustl.edu	37	17	27000471	27000471	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr17:27000471G>A	ENST00000314616.6	+	2	335	c.52G>A	c.(52-54)Gat>Aat	p.D18N	AC010761.13_ENST00000578819.1_RNA|SUPT6H_ENST00000347486.4_Missense_Mutation_p.D18N	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	18	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D18N(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					AGAATACAATGATGAAGGCGA	0.493																																																1	Substitution - Missense(1)	ovary(1)	17											89.0	84.0	86.0					17																	27000471		2203	4300	6503	24024598	SO:0001583	missense	6830			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.52G>A	17.37:g.27000471G>A	ENSP00000319104:p.Asp18Asn	Somatic		Capture	Illumina GAIIx	4	24024598	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	HMMPfam_SH2;HMMPfam_S1;superfamily_Nucleic acid-binding proteins;superfamily_SH2 domain	p.D18N	ENST00000314616.6	37	c.52	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	G	12.90	2.076597	0.36662	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.75	4.76	0.60689	.	0.149195	0.64402	D	0.000018	T	0.27594	0.0678	N	0.08118	0	0.32563	N	0.530893	B	0.17667	0.023	B	0.14023	0.01	T	0.27020	-1.0086	9	0.40728	T	0.16	-14.4731	11.0059	0.47633	0.0:0.2844:0.5911:0.1245	.	18	Q7KZ85	SPT6H_HUMAN	N	18	.	ENSP00000319104:D18N	D	+	1	0	SUPT6H	24024598	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.609000	0.61148	1.390000	0.46547	0.655000	0.94253	GAT	-	NULL		0.493	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	protein_coding	OTTHUMT00000446422.2	G	NM_003170		24024598	1	no_errors	NM_003170	genbank	human	validated	54_36p	missense	SNP	0.99	A
PNMT	5409	genome.wustl.edu	37	17	37826360	37826360	+	Silent	SNP	A	A	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr17:37826360A>T	ENST00000269582.2	+	3	885	c.567A>T	c.(565-567)ccA>ccT	p.P189P	PNMT_ENST00000394246.1_Silent_p.P91P	NM_002686.3	NP_002677.1	P11086	PNMT_HUMAN	phenylethanolamine N-methyltransferase	189					catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|epinephrine biosynthetic process (GO:0042418)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phenylethanolamine N-methyltransferase activity (GO:0004603)	p.P189P(1)		NS(1)|breast(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8	all_cancers(6;6.59e-85)|all_epithelial(6;2.89e-103)|Breast(7;1.05e-86)|Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;3.87e-45)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CTGTGAGCCCAGATCTTGCCA	0.682																																																1	Substitution - coding silent(1)	ovary(1)	17											37.0	37.0	37.0					17																	37826360		2203	4300	6503	35079886	SO:0001819	synonymous_variant	5409				CCDS11343.1	17q	2010-04-16			ENSG00000141744	ENSG00000141744	2.1.1.28		9160	protein-coding gene	gene with protein product		171190		PENT		3372503	Standard	NM_002686		Approved		uc002hsi.2	P11086	OTTHUMG00000133209	ENST00000269582.2:c.567A>T	17.37:g.37826360A>T		Somatic		Capture	Illumina GAIIx	4	35079886		Silent	SNP	HMMPfam_NNMT_PNMT_TEMT;superfamily_S-adenosyl-L-methionine-dependent methyltransferases	p.P189	ENST00000269582.2	37	c.567	CCDS11343.1	17																																																																																			-	HMMPfam_NNMT_PNMT_TEMT		0.682	PNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMT	protein_coding	OTTHUMT00000256923.2	A	NM_002686		35079886	1	no_errors	NM_002686	genbank	human	reviewed	54_36p	silent	SNP	0.99	T
TP53	7157	genome.wustl.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	G	A	rs121913344		TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr17:7577022G>A	ENST00000269305.4	-	8	1105	c.916C>T	c.(916-918)Cga>Tga	p.R306*	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Nonsense_Mutation_p.R306*|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.R306*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R306*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R306*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	306	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R306*(133)|p.0?(8)|p.?(3)|p.R306fs*39(2)|p.K305fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTACCTCGCTTAGTGCTC	0.562	R306*(HCC1937_BREAST)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(MFE296_ENDOMETRIUM)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	147	Substitution - Nonsense(133)|Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	large_intestine(39)|breast(21)|upper_aerodigestive_tract(15)|ovary(11)|central_nervous_system(10)|oesophagus(10)|stomach(8)|lung(8)|endometrium(6)|bone(4)|pancreas(3)|haematopoietic_and_lymphoid_tissue(3)|biliary_tract(3)|kidney(2)|NS(2)|urinary_tract(1)|liver(1)	17	GRCh37	CM971506	TP53	M	rs121913344						120.0	106.0	110.0					17																	7577022		2203	4300	6503	7517747	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.916C>T	17.37:g.7577022G>A	ENSP00000269305:p.Arg306*	Somatic		Capture	Illumina GAIIx	4	7517747	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R306*	ENST00000269305.4	37	c.916	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782988	0.90282	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	3.21	0.36854	.	1.348720	0.05032	N	0.474808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4785	0.44678	0.0:0.0:0.6334:0.3666	.	.	.	.	X	306;306;306;306;306;295;174	.	ENSP00000269305:R306X	R	-	1	2	TP53	7517747	1.000000	0.71417	0.970000	0.41538	0.345000	0.29048	2.280000	0.43443	0.735000	0.32537	0.561000	0.74099	CGA	-	NULL		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7517747	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
RAB37	326624	genome.wustl.edu	37	17	72741493	72741493	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr17:72741493G>T	ENST00000392613.5	+	9	671	c.615G>T	c.(613-615)caG>caT	p.Q205H	RAB37_ENST00000528438.1_Missense_Mutation_p.Q178H|RAB37_ENST00000392610.1_3'UTR|MIR3615_ENST00000585285.1_RNA|RAB37_ENST00000392614.4_Missense_Mutation_p.Q210H|RAB37_ENST00000402449.4_Missense_Mutation_p.Q198H|RAB37_ENST00000340415.3_3'UTR|RAB37_ENST00000392615.5_Missense_Mutation_p.Q173H|RAB37_ENST00000392612.3_Missense_Mutation_p.Q168H	NM_001006638.2	NP_001006639.1	Q96AX2	RAB37_HUMAN	RAB37, member RAS oncogene family	205					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|secretory granule (GO:0030141)	GTP binding (GO:0005525)	p.Q198H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	12						CCAGCTTCCAGATCCGAGACT	0.607																																																1	Substitution - Missense(1)	ovary(1)	17											51.0	54.0	53.0					17																	72741493		2203	4300	6503	70253088	SO:0001583	missense	326624			BC040547	CCDS11703.1, CCDS32722.1, CCDS54161.1, CCDS54162.1	17q25.2	2008-02-05			ENSG00000172794	ENSG00000172794		"""RAB, member RAS oncogene"""	30268	protein-coding gene	gene with protein product		609956				10722846	Standard	NM_175738		Approved		uc002jlk.3	Q96AX2	OTTHUMG00000134282	ENST00000392613.5:c.615G>T	17.37:g.72741493G>T	ENSP00000376389:p.Gln205His	Somatic		Capture	Illumina GAIIx	4	70253088	A8MXF5|A8MYT0|Q8IWA7	Missense_Mutation	SNP	-	p.Q205H	ENST00000392613.5	37	c.615	CCDS32722.1	17	.	.	.	.	.	.	.	.	.	.	G	15.98	2.993496	0.54041	.	.	ENSG00000172794	ENST00000402449;ENST00000469248;ENST00000528438;ENST00000392615;ENST00000392614;ENST00000392613;ENST00000392612	T;T;T;T;T;T	0.64085	-0.04;-0.07;0.28;-0.08;-0.05;0.28	5.25	5.25	0.73442	.	0.127775	0.53938	D	0.000048	T	0.50429	0.1615	L	0.29908	0.895	0.80722	D	1	B;B;B;B;B	0.16166	0.016;0.006;0.01;0.016;0.006	B;B;B;B;B	0.17433	0.014;0.008;0.008;0.018;0.008	T	0.49606	-0.8922	10	0.59425	D	0.04	.	12.167	0.54135	0.0835:0.0:0.9165:0.0	.	168;173;210;198;205	A8MXF5;A8MZI4;A8MYT0;Q96AX2-2;Q96AX2	.;.;.;.;RAB37_HUMAN	H	198;198;178;173;210;205;168	ENSP00000383934:Q198H;ENSP00000432086:Q178H;ENSP00000376391:Q173H;ENSP00000376390:Q210H;ENSP00000376389:Q205H;ENSP00000376388:Q168H	ENSP00000376388:Q168H	Q	+	3	2	RAB37	70253088	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.000000	0.70678	2.606000	0.88127	0.655000	0.94253	CAG	-	NULL		0.607	RAB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB37	protein_coding	OTTHUMT00000258872.2	G	NM_175738		70253088	1	no_errors	NM_001006638	genbank	human	validated	54_36p	missense	SNP	1	T
KATNAL2	83473	genome.wustl.edu	37	18	44589402	44589402	+	Silent	SNP	A	A	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr18:44589402A>G	ENST00000245121.5	+	6	587	c.393A>G	c.(391-393)gaA>gaG	p.E131E	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Silent_p.E203E	NM_031303.2	NP_112593.2			katanin p60 subunit A-like 2									p.E131E(1)		central_nervous_system(2)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	27						CAACCAGTGAACTTGCCTTGA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	18											143.0	126.0	132.0					18																	44589402		2203	4300	6503	42843400	SO:0001819	synonymous_variant	83473			BC034999	CCDS32828.1	18q21.1	2010-04-21			ENSG00000167216	ENSG00000167216		"""ATPases / AAA-type"""	25387	protein-coding gene	gene with protein product		614697				12477932	Standard	NM_031303		Approved	MGC33211, DKFZP667C165	uc002lco.3	Q8IYT4		ENST00000245121.5:c.393A>G	18.37:g.44589402A>G		Somatic		Capture	Illumina GAIIx	4	42843400		Silent	SNP	-	p.E131	ENST00000245121.5	37	c.393	CCDS32828.1	18																																																																																			-	NULL		0.458	KATNAL2-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	KATNAL2	protein_coding	OTTHUMT00000446138.2	A	NM_031303		42843400	1	no_errors	NM_031303	genbank	human	provisional	54_36p	silent	SNP	0.98	G
AP1M2	10053	genome.wustl.edu	37	19	10689606	10689606	+	Missense_Mutation	SNP	C	C	G	rs369863783		TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr19:10689606C>G	ENST00000250244.6	-	8	932	c.850G>C	c.(850-852)Gag>Cag	p.E284Q	AP1M2_ENST00000590923.1_Missense_Mutation_p.E286Q	NM_005498.4	NP_005489.2	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	284	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein targeting (GO:0006605)|regulation of defense response to virus by virus (GO:0050690)|vesicle targeting (GO:0006903)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)		p.E284Q(1)		endometrium(4)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	9			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			GAGAACTTCTCAATGACAGAC	0.488																																																1	Substitution - Missense(1)	ovary(1)	19											50.0	52.0	51.0					19																	10689606		1919	4142	6061	10550606	SO:0001583	missense	10053			AF020797	CCDS45964.1	19p13.2	2008-10-07				ENSG00000129354			558	protein-coding gene	gene with protein product		607309				10338135	Standard	NM_005498		Approved	HSMU1B, mu2, AP1-mu2	uc002mpc.3	Q9Y6Q5		ENST00000250244.6:c.850G>C	19.37:g.10689606C>G	ENSP00000250244:p.Glu284Gln	Somatic		Capture	Illumina GAIIx	4	10550606	B2RDV5|Q9BSI8	Missense_Mutation	SNP	-	p.E284Q	ENST00000250244.6	37	c.850	CCDS45964.1	19	.	.	.	.	.	.	.	.	.	.	c	18.64	3.667188	0.67814	.	.	ENSG00000129354	ENST00000250244	T	0.19938	2.11	5.12	5.12	0.69794	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	M	0.82517	2.595	0.80722	D	1	B;D	0.89917	0.313;1.0	B;D	0.75484	0.124;0.986	T	0.52793	-0.8528	10	0.48119	T	0.1	-38.6452	16.1027	0.81194	0.0:1.0:0.0:0.0	.	286;284	Q9Y6Q5-2;Q9Y6Q5	.;AP1M2_HUMAN	Q	284	ENSP00000250244:E284Q	ENSP00000250244:E284Q	E	-	1	0	AP1M2	10550606	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.529000	0.81952	2.401000	0.81631	0.555000	0.69702	GAG	-	NULL		0.488	AP1M2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP1M2	protein_coding	OTTHUMT00000452034.1	C			10550606	-1	no_errors	NM_005498	genbank	human	reviewed	54_36p	missense	SNP	1	G
EMR3	84658	genome.wustl.edu	37	19	14772798	14772798	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr19:14772798T>G	ENST00000253673.5	-	4	432	c.332A>C	c.(331-333)aAt>aCt	p.N111T	EMR3_ENST00000344373.4_Intron|EMR3_ENST00000443157.2_Intron|EMR3_ENST00000599900.1_5'UTR	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	111	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.N111T(1)		NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						CTCATTGGAATTACTGAATTG	0.373																																																1	Substitution - Missense(1)	ovary(1)	19											192.0	152.0	165.0					19																	14772798		2203	4300	6503	14633798	SO:0001583	missense	84658			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.332A>C	19.37:g.14772798T>G	ENSP00000253673:p.Asn111Thr	Somatic		Capture	Illumina GAIIx	4	14633798		Missense_Mutation	SNP	HMMPfam_GPS;HMMPfam_7tm_2;HMMPfam_EGF_CA;superfamily_EGF/Laminin;superfamily_Family A G protein-coupled receptor-like	p.N111T	ENST00000253673.5	37	c.332	CCDS12315.1	19	.	.	.	.	.	.	.	.	.	.	T	11.48	1.651347	0.29336	.	.	ENSG00000131355	ENST00000253673	D	0.92752	-3.1	4.12	3.08	0.35506	EGF-like calcium-binding (2);	.	.	.	.	D	0.89842	0.6832	L	0.55481	1.735	0.09310	N	0.999999	B	0.32968	0.392	B	0.41135	0.348	T	0.78705	-0.2100	9	0.23302	T	0.38	.	7.3786	0.26843	0.0:0.0:0.2235:0.7765	.	111	Q9BY15	EMR3_HUMAN	T	111	ENSP00000253673:N111T	ENSP00000253673:N111T	N	-	2	0	EMR3	14633798	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.249000	0.08842	0.609000	0.30018	0.416000	0.27883	AAT	-	HMMPfam_EGF_CA		0.373	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR3	protein_coding	OTTHUMT00000466488.1	T	NM_032571		14633798	-1	no_errors	NM_032571	genbank	human	reviewed	54_36p	missense	SNP		G
ZNF723P	646864	genome.wustl.edu	37	19	23041016	23041016	+	IGR	SNP	T	T	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr19:23041016T>G								ZNF99 (74107 upstream) : CTD-2579N5.3 (48871 downstream)																							CAACCCTTACTAAACATAAGA	0.323																																																0			19																																								22832856	SO:0001628	intergenic_variant	646864																															19.37:g.23041016T>G		Somatic		Capture	Illumina GAIIx	4	22832856		Silent	SNP	-	p.T470		37	c.1410		19																																																																																			-	NULL	0	0.323					LOC646864			T			22832856	1	no_errors	XM_001726885	genbank	human	model	54_36p	silent	SNP		G
ARHGAP33	115703	genome.wustl.edu	37	19	36277857	36277857	+	Missense_Mutation	SNP	G	G	A	rs201575965	byFrequency	TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr19:36277857G>A	ENST00000007510.4	+	20	2629	c.2485G>A	c.(2485-2487)Ggc>Agc	p.G829S	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.G668S|AC002398.5_ENST00000433059.1_lincRNA|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.G693S			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	829					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)	p.G668S(1)		endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						TCTCAGCCCCGGCCGGAGCCT	0.692													G|||	3	0.000599042	0.0	0.0029	5008	,	,		9481	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19											12.0	16.0	15.0					19																	36277857		2201	4285	6486	40969697	SO:0001583	missense	115703			AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.2485G>A	19.37:g.36277857G>A	ENSP00000007510:p.Gly829Ser	Somatic		Capture	Illumina GAIIx	Phase_III	40969697	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	HMMPfam_RhoGAP,HMMPfam_SH3_1,superfamily_SH3-domain,superfamily_GTPase activation domain GAP,superfamily_PX domain	p.G668S	ENST00000007510.4	37	c.2002		19	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	G	0.004	-2.342314	0.00222	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.11169	2.91;2.8;2.96	3.56	-2.67	0.06059	.	1.328920	0.05012	N	0.471059	T	0.02848	0.0085	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.38564	-0.9655	10	0.06891	T	0.86	.	5.3825	0.16199	0.6391:0.0:0.2085:0.1524	.	829;693;668	O14559;O14559-10;O14559-11	RHG33_HUMAN;.;.	S	829;668;693	ENSP00000007510:G829S;ENSP00000320038:G668S;ENSP00000368227:G693S	ENSP00000007510:G829S	G	+	1	0	ARHGAP33	40969697	0.000000	0.05858	0.015000	0.15790	0.028000	0.11728	-0.179000	0.09768	-0.510000	0.06523	-0.137000	0.14449	GGC	-	NULL		0.692	ARHGAP33-201	KNOWN	basic	protein_coding	SNX26	protein_coding		G	NM_052948		40969697	1	no_errors	NM_052948	genbank	human	reviewed	54_36p	missense	SNP	0.117	A
PRODH2	58510	genome.wustl.edu	37	19	36290978	36290978	+	Missense_Mutation	SNP	G	G	A	rs376496955		TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr19:36290978G>A	ENST00000301175.3	-	11	1590	c.1573C>T	c.(1573-1575)Cgg>Tgg	p.R525W	AC002398.5_ENST00000433059.1_lincRNA	NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	525			R -> Q (in dbSNP:rs3761097).		proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)	p.R525W(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGCAGCCGCCGCCACAGTTCT	0.617																																																1	Substitution - Missense(1)	ovary(1)	19						G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	31.0	25.0	27.0		1573	-1.2	0.6	19		27	0,8600		0,0,4300	no	missense	PRODH2	NM_021232.1	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	525/537	36290978	1,13005	2203	4300	6503	40982818	SO:0001583	missense	58510			U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.1573C>T	19.37:g.36290978G>A	ENSP00000301175:p.Arg525Trp	Somatic		Capture	Illumina GAIIx	4	40982818		Missense_Mutation	SNP	-	p.R525W	ENST00000301175.3	37	c.1573	CCDS12478.1	19	.	.	.	.	.	.	.	.	.	.	G	15.31	2.796935	0.50208	2.27E-4	0.0	ENSG00000250799	ENST00000301175	T	0.33865	1.39	5.26	-1.21	0.09524	.	.	.	.	.	T	0.60090	0.2242	M	0.92833	3.35	0.40237	D	0.977911	D	0.89917	1.0	P	0.60609	0.877	T	0.68262	-0.5455	9	0.87932	D	0	.	10.5512	0.45090	0.0:0.122:0.255:0.623	.	525	Q9UF12	PROD2_HUMAN	W	525	ENSP00000301175:R525W	ENSP00000301175:R525W	R	-	1	2	PRODH2	40982818	0.005000	0.15991	0.641000	0.29422	0.509000	0.34042	0.187000	0.16998	-0.181000	0.10619	-0.188000	0.12872	CGG	-	NULL		0.617	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRODH2	protein_coding	OTTHUMT00000452552.2	G	NM_021232		40982818	-1	no_errors	NM_021232	genbank	human	reviewed	54_36p	missense	SNP	0.004	A
XRCC1	7515	genome.wustl.edu	37	19	44057035	44057035	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr19:44057035C>G	ENST00000262887.5	-	8	1284	c.737G>C	c.(736-738)aGg>aCg	p.R246T	XRCC1_ENST00000543982.1_Missense_Mutation_p.R215T|L34079.3_ENST00000597119.1_RNA			P18887	XRCC1_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 1	246					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|hippocampus development (GO:0021766)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to organic substance (GO:0010033)|single strand break repair (GO:0000012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)	p.R246T(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Prostate(69;0.0153)				ATCCAACTTCCTCTTCCCTTT	0.527								Other BER factors																																								1	Substitution - Missense(1)	ovary(1)	19											130.0	131.0	131.0					19																	44057035		2203	4300	6503	48748875	SO:0001583	missense	7515			M36089	CCDS12624.1	19q13.2	2014-09-17				ENSG00000073050			12828	protein-coding gene	gene with protein product		194360		RCC		2247054	Standard	NM_006297		Approved		uc002owt.2	P18887		ENST00000262887.5:c.737G>C	19.37:g.44057035C>G	ENSP00000262887:p.Arg246Thr	Somatic		Capture	Illumina GAIIx	4	48748875	Q6IBS4|Q9HCB1	Missense_Mutation	SNP	superfamily_Galactose-binding domain-like,superfamily_BRCT domain,BRCT,HMMPfam_BRCT,XRCC1_N,HMMPfam_XRCC1_N	p.R246T	ENST00000262887.5	37	c.737	CCDS12624.1	19	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822077	0.71028	.	.	ENSG00000073050	ENST00000458471;ENST00000262887;ENST00000543982;ENST00000538738	T;T	0.03272	3.99;4.0	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.16811	0.0404	M	0.69823	2.125	0.47153	D	0.999331	D;P	0.76494	0.999;0.956	D;B	0.80764	0.994;0.444	T	0.00022	-1.2339	10	0.56958	D	0.05	-32.2596	14.9933	0.71406	0.0:1.0:0.0:0.0	.	215;246	F5H8D7;P18887	.;XRCC1_HUMAN	T	260;246;215;246	ENSP00000262887:R246T;ENSP00000443671:R215T	ENSP00000262887:R246T	R	-	2	0	XRCC1	48748875	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.326000	0.52037	2.683000	0.91414	0.655000	0.94253	AGG	-	NULL		0.527	XRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC1	protein_coding	OTTHUMT00000463194.1	C	NM_006297		48748875	-1	no_errors	NM_006297	genbank	human	reviewed	54_36p	missense	SNP	1	G
ZNF677	342926	genome.wustl.edu	37	19	53740664	53740664	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr19:53740664G>T	ENST00000598513.1	-	5	1466	c.1316C>A	c.(1315-1317)gCt>gAt	p.A439D	ZNF677_ENST00000333952.4_Missense_Mutation_p.A439D	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	439					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A439D(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		TTGGATAAAAGCCCTGCCACA	0.378																																																1	Substitution - Missense(1)	ovary(1)	19											47.0	45.0	46.0					19																	53740664		2203	4300	6503	58432476	SO:0001583	missense	342926			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1316C>A	19.37:g.53740664G>T	ENSP00000469391:p.Ala439Asp	Somatic		Capture	Illumina GAIIx	4	58432476		Missense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.A439D	ENST00000598513.1	37	c.1316	CCDS12861.1	19	.	.	.	.	.	.	.	.	.	.	G	10.90	1.482546	0.26598	.	.	ENSG00000197928	ENST00000333952	T	0.14266	2.52	2.21	1.12	0.20585	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.022480	0.07860	N	0.966104	T	0.16128	0.0388	M	0.62723	1.935	0.09310	N	1	B	0.25351	0.124	B	0.19391	0.025	T	0.30880	-0.9963	10	0.87932	D	0	.	8.3517	0.32305	0.0:0.5587:0.4412:0.0	.	439	Q86XU0	ZN677_HUMAN	D	439	ENSP00000334394:A439D	ENSP00000334394:A439D	A	-	2	0	ZNF677	58432476	0.000000	0.05858	0.042000	0.18584	0.731000	0.41821	-1.359000	0.02602	0.471000	0.27319	0.655000	0.94253	GCT	-	HMMPfam_zf-C2H2		0.378	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF677	protein_coding	OTTHUMT00000464189.1	G	NM_182609		58432476	-1	no_errors	NM_182609	genbank	human	provisional	54_36p	missense	SNP	0.02	T
ZIM2	23619	genome.wustl.edu	37	19	57286127	57286127	+	Nonsense_Mutation	SNP	G	G	A	rs144796320	byFrequency	TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr19:57286127G>A	ENST00000391708.3	-	12	2055	c.1513C>T	c.(1513-1515)Cga>Tga	p.R505*	AC006115.3_ENST00000597946.1_RNA|AC006115.3_ENST00000595954.1_RNA|AC006115.3_ENST00000594400.1_RNA|ZIM2_ENST00000599935.1_Nonsense_Mutation_p.R505*|ZIM2_ENST00000221722.5_Nonsense_Mutation_p.R505*|ZIM2_ENST00000593711.1_Nonsense_Mutation_p.R505*|ZIM2_ENST00000601070.1_Nonsense_Mutation_p.R505*	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	505					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R505*(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		TATGAGGGTCGGCCGAAACAT	0.438																																																1	Substitution - Nonsense(1)	ovary(1)	19						G	stop/ARG,stop/ARG,stop/ARG	0,4406		0,0,2203	110.0	103.0	105.0		1513,1513,1513	2.8	0.1	19	dbSNP_134	105	2,8598	2.2+/-6.3	0,2,4298	no	stop-gained,stop-gained,stop-gained	ZIM2	NM_001146326.1,NM_001146327.1,NM_015363.4	,,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,	505/528,505/528,505/528	57286127	2,13004	2203	4300	6503	61977939	SO:0001587	stop_gained	23619			AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.1513C>T	19.37:g.57286127G>A	ENSP00000375589:p.Arg505*	Somatic		Capture	Illumina GAIIx	4	61977939	Q2M3K1	Nonsense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.R505*	ENST00000391708.3	37	c.1513	CCDS33123.1	19	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029319	0.93518	0.0	2.33E-4	ENSG00000198300	ENST00000391708;ENST00000221722	.	.	.	4.96	2.77	0.32553	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	9.9099	0.41399	0.1719:0.0:0.8281:0.0	.	.	.	.	X	505	.	ENSP00000221722:R505X	R	-	1	2	ZIM2	61977939	0.000000	0.05858	0.111000	0.21465	0.038000	0.13279	-0.539000	0.06113	1.320000	0.45209	0.655000	0.94253	CGA	-	HMMPfam_zf-C2H2		0.438	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIM2	protein_coding	OTTHUMT00000416094.2	G			61977939	-1	no_errors	NM_015363	genbank	human	provisional	54_36p	nonsense	SNP		A
C3	718	genome.wustl.edu	37	19	6684793	6684793	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr19:6684793G>T	ENST00000245907.6	-	31	4114	c.4022C>A	c.(4021-4023)aCc>aAc	p.T1341N		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1341					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.T1341N(1)		breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TACCGACAAGGTGCCTTGGCC	0.542																																																1	Substitution - Missense(1)	ovary(1)	19											215.0	179.0	191.0					19																	6684793		2203	4300	6503	6635793	SO:0001583	missense	718			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4022C>A	19.37:g.6684793G>T	ENSP00000245907:p.Thr1341Asn	Somatic		Capture	Illumina GAIIx	4	6635793	A7E236	Missense_Mutation	SNP	HMMPfam_ANATO;superfamily_Anaphylotoxins (complement system);HMMPfam_NTR;HMMPfam_A2M;HMMPfam_A2M_N;superfamily_Terpenoid cyclases/Protein prenyltransferases;superfamily_TIMP-like;HMMPfam_A2M_recep;superfamily_Alpha-macroglobulin receptor domain;HMMPfam_A2M_N_2;HMMPfam_A2M_comp	p.T1341N	ENST00000245907.6	37	c.4022	CCDS32883.1	19	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750556	0.69533	.	.	ENSG00000125730	ENST00000245907	T	0.35048	1.33	5.31	5.31	0.75309	.	0.497977	0.22730	N	0.056332	T	0.61850	0.2380	M	0.89904	3.07	0.38270	D	0.942115	D	0.76494	0.999	D	0.78314	0.991	T	0.66089	-0.6010	10	0.31617	T	0.26	.	8.537	0.33368	0.1667:0.0:0.8333:0.0	.	1341	P01024	CO3_HUMAN	N	1341	ENSP00000245907:T1341N	ENSP00000245907:T1341N	T	-	2	0	C3	6635793	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.158000	0.58150	2.645000	0.89757	0.585000	0.79938	ACC	-	NULL		0.542	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	protein_coding	OTTHUMT00000317636.2	G	NM_000064		6635793	-1	no_errors	NM_000064	genbank	human	reviewed	54_36p	missense	SNP	1	T
PEG3	5178	genome.wustl.edu	37	19	57325432	57325432	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr19:57325432C>T	ENST00000326441.9	-	10	4741	c.4378G>A	c.(4378-4380)Gac>Aac	p.D1460N	PEG3_ENST00000593695.1_Missense_Mutation_p.D1334N|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.D1460N|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.D1336N|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1460	Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.D1460N(1)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCTTCTGGGTCTTCAATACCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	19											111.0	101.0	104.0					19																	57325432		2203	4300	6503	62017244	SO:0001583	missense	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4378G>A	19.37:g.57325432C>T	ENSP00000326581:p.Asp1460Asn	Somatic		Capture	Illumina GAIIx	4	62017244	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	HMMPfam_SCAN;HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.D1460N	ENST00000326441.9	37	c.4378	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341997	0.81911	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02709	4.19;4.19	4.07	4.07	0.47477	.	0.000000	0.47852	D	0.000210	T	0.05410	0.0143	L	0.27053	0.805	.	.	.	D;D;D	0.62365	0.991;0.991;0.991	P;P;P	0.58013	0.831;0.831;0.831	T	0.48917	-0.8992	9	0.31617	T	0.26	-33.8222	12.0647	0.53581	0.0:1.0:0.0:0.0	.	1336;1460;1395	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	N	1460	ENSP00000326581:D1460N;ENSP00000403051:D1460N	ENSP00000326581:D1460N	D	-	1	0	ZIM2	62017244	0.961000	0.32948	1.000000	0.80357	0.929000	0.56500	2.188000	0.42612	2.555000	0.86185	0.650000	0.86243	GAC	-	NULL		0.562	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	protein_coding	OTTHUMT00000416099.2	C			62017244	-1	no_errors	NM_006210	genbank	human	provisional	54_36p	missense	SNP	0.99	T
TBC1D8	11138	genome.wustl.edu	37	2	101706739	101706739	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr2:101706739T>C	ENST00000376840.4	-	2	214	c.215A>G	c.(214-216)cAg>cGg	p.Q72R	TBC1D8_ENST00000409318.1_Missense_Mutation_p.Q72R			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	72					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.Q72R(1)		breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						AGAATAAACCTGGGAGCCGGG	0.493																																																1	Substitution - Missense(1)	ovary(1)	2											60.0	59.0	60.0					2																	101706739		1882	4106	5988	101073171	SO:0001583	missense	11138			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.215A>G	2.37:g.101706739T>C	ENSP00000366036:p.Gln72Arg	Somatic		Capture	Illumina GAIIx	4	101073171	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	-	p.Q72R	ENST00000376840.4	37	c.215	CCDS46375.1	2	.	.	.	.	.	.	.	.	.	.	T	20.6	4.021009	0.75275	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.21734	1.99;3.93	5.61	4.38	0.52667	.	.	.	.	.	T	0.41650	0.1168	M	0.72894	2.215	0.32467	N	0.543361	P;D	0.63046	0.59;0.992	B;D	0.63113	0.258;0.911	T	0.53947	-0.8366	9	0.59425	D	0.04	-11.2305	11.9214	0.52793	0.0:0.0:0.2573:0.7427	.	72;72	B7Z6L4;O95759	.;TBCD8_HUMAN	R	72	ENSP00000366036:Q72R;ENSP00000386856:Q72R	ENSP00000366036:Q72R	Q	-	2	0	TBC1D8	101073171	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.324000	0.52022	2.145000	0.66743	0.482000	0.46254	CAG	-	NULL		0.493	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	protein_coding	OTTHUMT00000376092.1	T	NM_007063		101073171	-1	no_errors	NM_001102426	genbank	human	validated	54_36p	missense	SNP	1	C
RNF149	284996	genome.wustl.edu	37	2	101911618	101911618	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr2:101911618C>T	ENST00000295317.3	-	2	593	c.486G>A	c.(484-486)atG>atA	p.M162I		NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	162	PA.				cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.M162I(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						GATAGCTAATCATAATGACCA	0.373																																					Colon(25;331 612 6521 7355 31028)											1	Substitution - Missense(1)	ovary(1)	2											101.0	95.0	97.0					2																	101911618		2203	4300	6503	101278050	SO:0001583	missense	284996			AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.486G>A	2.37:g.101911618C>T	ENSP00000295317:p.Met162Ile	Somatic		Capture	Illumina GAIIx	4	101278050	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	-	p.M162I	ENST00000295317.3	37	c.486	CCDS2051.1	2	.	.	.	.	.	.	.	.	.	.	C	28.2	4.900064	0.92035	.	.	ENSG00000163162	ENST00000295317	T	0.07567	3.18	5.33	5.33	0.75918	Protease-associated domain, PA (1);	0.068682	0.64402	N	0.000015	T	0.29355	0.0731	M	0.83774	2.66	0.80722	D	1	D	0.56968	0.978	P	0.57620	0.824	T	0.03443	-1.1036	10	0.52906	T	0.07	.	19.0467	0.93022	0.0:1.0:0.0:0.0	.	162	Q8NC42	RN149_HUMAN	I	162	ENSP00000295317:M162I	ENSP00000295317:M162I	M	-	3	0	RNF149	101278050	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	7.664000	0.83830	2.490000	0.84030	0.591000	0.81541	ATG	-	NULL		0.373	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF149	protein_coding	OTTHUMT00000253180.2	C	NM_173647		101278050	-1	no_errors	NM_173647	genbank	human	provisional	54_36p	missense	SNP	1	T
POTEF	728378	genome.wustl.edu	37	2	130832770	130832770	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr2:130832770G>A	ENST00000409914.2	-	17	2674	c.2275C>T	c.(2275-2277)Cag>Tag	p.Q759*	POTEF_ENST00000357462.5_Nonsense_Mutation_p.Q759*	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	759	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.Q759*(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CTTTTGCTCTGGGCCTCCTTG	0.587																																																1	Substitution - Nonsense(1)	ovary(1)	2											53.0	51.0	51.0					2																	130832770		2202	4287	6489	130549240	SO:0001587	stop_gained	728378			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2275C>T	2.37:g.130832770G>A	ENSP00000386786:p.Gln759*	Somatic		Capture	Illumina GAIIx	4	130549240	A6NC34	Nonsense_Mutation	SNP	-	p.Q759*	ENST00000409914.2	37	c.2275	CCDS46409.1	2	.	.	.	.	.	.	.	.	.	.	.	20.8	4.042832	0.75732	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	.	.	.	X	759	.	ENSP00000350052:Q759X	Q	-	1	0	POTEF	130549240	1.000000	0.71417	0.100000	0.21137	0.101000	0.19017	3.701000	0.54793	0.119000	0.18210	0.121000	0.15741	CAG	-	NULL		0.587	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	protein_coding	OTTHUMT00000331889.2	G	NM_001099771		130549240	-1	no_errors	NM_001099771	genbank	human	validated	54_36p	nonsense	SNP	1	A
POTEJ	653781	genome.wustl.edu	37	2	131379121	131379121	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr2:131379121C>A	ENST00000409602.1	+	5	941	c.889C>A	c.(889-891)Caa>Aaa	p.Q297K	RNU6-848P_ENST00000515948.1_RNA	NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	297					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						TGTATCTTCTCAAGATCTATC	0.383																																																0			2																																								131095591	SO:0001583	missense	653781				CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.889C>A	2.37:g.131379121C>A	ENSP00000387176:p.Gln297Lys	Somatic		Capture	Illumina GAIIx	4	131095591		Missense_Mutation	SNP	-	p.Q297K	ENST00000409602.1	37	c.889	CCDS59432.1	2	.	.	.	.	.	.	.	.	.	.	.	3.550	-0.091924	0.07053	.	.	ENSG00000222038	ENST00000409602	T	0.61627	0.09	0.906	-1.8	0.07907	.	.	.	.	.	T	0.32852	0.0843	N	0.11364	0.135	0.09310	N	1	.	.	.	.	.	.	T	0.26326	-1.0106	7	0.87932	D	0	.	2.4006	0.04400	0.0:0.4142:0.3246:0.2611	.	.	.	.	K	297	ENSP00000387176:Q297K	ENSP00000387176:Q297K	Q	+	1	0	POTEJ	131095591	0.038000	0.19896	0.003000	0.11579	0.047000	0.14425	-0.494000	0.06451	-0.643000	0.05473	0.184000	0.17185	CAA	-	NULL		0.383	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LOC653781	protein_coding	OTTHUMT00000333665.1	C	XM_929706		131095591	1	no_errors	XM_929706	genbank	human	model	54_36p	missense	SNP	0	A
ITGA4	3676	genome.wustl.edu	37	2	182360592	182360592	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr2:182360592G>T	ENST00000397033.2	+	14	1898	c.1468G>T	c.(1468-1470)Gga>Tga	p.G490*		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	490					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)	p.G490*(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	TGTTGAAAATGGATGGCCTTC	0.393																																																1	Substitution - Nonsense(1)	ovary(1)	2											194.0	173.0	180.0					2																	182360592		1915	4141	6056	182068837	SO:0001587	stop_gained	3676				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1468G>T	2.37:g.182360592G>T	ENSP00000380227:p.Gly490*	Somatic		Capture	Illumina GAIIx	4	182068837	D3DPG4|Q7Z4L6	Nonsense_Mutation	SNP	HMMPfam_Integrin_alpha,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_Integrin domains,superfamily_Integrin alpha N-terminal domain	p.G490*	ENST00000397033.2	37	c.1468	CCDS42788.1	2	.	.	.	.	.	.	.	.	.	.	G	38	7.232903	0.98154	.	.	ENSG00000115232	ENST00000425522;ENST00000397033;ENST00000233573	.	.	.	5.8	5.8	0.92144	.	0.272836	0.38778	N	0.001574	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	20.0586	0.97663	0.0:0.0:1.0:0.0	.	.	.	.	X	490	.	ENSP00000233573:G490X	G	+	1	0	ITGA4	182068837	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.444000	0.66587	2.741000	0.93983	0.650000	0.86243	GGA	-	HMMPfam_Integrin_alpha2		0.393	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA4	protein_coding	OTTHUMT00000334427.1	G			182068837	1	no_errors	NM_000885	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
TNS1	7145	genome.wustl.edu	37	2	218749882	218749882	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr2:218749882C>A	ENST00000171887.4	-	14	1199	c.747G>T	c.(745-747)aaG>aaT	p.K249N	TNS1_ENST00000419504.1_Missense_Mutation_p.K249N|TNS1_ENST00000310858.6_Missense_Mutation_p.K280N|TNS1_ENST00000430930.1_Missense_Mutation_p.K249N	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	249	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.K249N(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGTGGTAGCACTTCAGCTGGG	0.612																																																1	Substitution - Missense(1)	ovary(1)	2											98.0	81.0	86.0					2																	218749882		2203	4300	6503	218458127	SO:0001583	missense	7145			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.747G>T	2.37:g.218749882C>A	ENSP00000171887:p.Lys249Asn	Somatic		Capture	Illumina GAIIx	4	218458127	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	-	p.K249N	ENST00000171887.4	37	c.747	CCDS2407.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.86|16.86	3.238864|3.238864	0.58995|0.58995	.|.	.|.	ENSG00000079308|ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903;ENST00000413554;ENST00000310858|ENST00000453356	D;D;D;D;D;D|.	0.86164|.	-2.08;-2.08;-2.08;-2.08;-2.08;-2.08|.	4.74|4.74	1.75|1.75	0.24633|0.24633	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75649|0.75649	0.3878|0.3878	M|M	0.88775|0.88775	2.98|2.98	0.53688|0.53688	D|D	0.999976|0.999976	D;D;D;D;D;D|.	0.89917|.	1.0;0.997;0.999;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.91635|.	0.999;0.978;0.993;0.999;0.998;0.998|.	T|T	0.76222|0.76222	-0.3038|-0.3038	10|5	0.72032|.	D|.	0.01|.	.|.	9.3384|9.3384	0.38065|0.38065	0.0:0.6693:0.0:0.3307|0.0:0.6693:0.0:0.3307	.|.	249;303;280;249;249;249|.	B2RU35;A1L0S7;Q6IPI5;Q9HBL0;E9PGF5;E9PF55|.	.;.;.;TENS1_HUMAN;.;.|.	N|L	249;249;249;374;317;280|25	ENSP00000171887:K249N;ENSP00000408724:K249N;ENSP00000406016:K249N;ENSP00000405460:K374N;ENSP00000400383:K317N;ENSP00000308321:K280N|.	ENSP00000171887:K249N|.	K|V	-|-	3|1	2|0	TNS1|TNS1	218458127|218458127	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.948000|0.948000	0.59901|0.59901	1.477000|1.477000	0.35431|0.35431	0.614000|0.614000	0.30107|0.30107	-0.251000|-0.251000	0.11542|0.11542	AAG|GTG	-	NULL		0.612	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	protein_coding	OTTHUMT00000256672.2	C	NM_022648		218458127	-1	no_errors	NM_022648	genbank	human	reviewed	54_36p	missense	SNP	1	A
USP40	55230	genome.wustl.edu	37	2	234431861	234431861	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr2:234431861C>G	ENST00000427112.2	-	15	2188	c.2153G>C	c.(2152-2154)aGa>aCa	p.R718T	USP40_ENST00000251722.6_Missense_Mutation_p.R718T|USP40_ENST00000450966.1_Missense_Mutation_p.R730T			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	718					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.R730T(1)		breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		GCTTCCATTTCTGAGCCCTTG	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											148.0	140.0	143.0					2																	234431861		1889	4124	6013	234096600	SO:0001583	missense	55230			AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.2153G>C	2.37:g.234431861C>G	ENSP00000387898:p.Arg718Thr	Somatic		Capture	Illumina GAIIx	4	234096600	Q6NX38|Q70EL0	Missense_Mutation	SNP	-	p.E650Q	ENST00000427112.2	37	c.1948	CCDS46547.1	2	.	.	.	.	.	.	.	.	.	.	C	2.031	-0.422457	0.04734	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112;ENST00000452724	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.64	0.151	0.14888	.	0.826783	0.11288	N	0.579546	T	0.32010	0.0815	L	0.48362	1.52	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.11329	0.003;0.006	T	0.25537	-1.0129	10	0.36615	T	0.2	.	6.2646	0.20919	0.0:0.3923:0.1772:0.4306	.	718;730	Q9NVE5;Q9NVE5-3	UBP40_HUMAN;.	T	730;718;718;13	ENSP00000415434:R730T;ENSP00000251722:R718T;ENSP00000387898:R718T;ENSP00000408853:R13T	ENSP00000251722:R718T	R	-	2	0	USP40	234096600	0.000000	0.05858	0.001000	0.08648	0.192000	0.23643	-0.357000	0.07651	0.079000	0.16929	-0.812000	0.03155	AGA	-	NULL		0.443	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	USP40	protein_coding	OTTHUMT00000397235.1	C	XM_114294		234096600	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_018218	genbank	human	validated	54_36p	missense	SNP	0.02	G
ALLC	55821	genome.wustl.edu	37	2	3743355	3743356	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	GG	GG	GG	TT	GG	GG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr2:3743355_3743356GG>TT	ENST00000252505.3	+	8	722_723	c.560_561GG>TT	c.(559-561)tGG>tTT	p.W187F	ALLC_ENST00000471711.1_3'UTR	NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	206					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		CAAAAAGACTGGACTGCAACTG	0.441										HNSCC(21;0.051)																																						0			2																																								3721231	SO:0001583	missense	55821			AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	Exception_encountered	2.37:g.3743355_3743356delinsTT	ENSP00000252505:p.Trp187Phe	Somatic		Capture	Illumina GAIIx	4	3721230	Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	DNP	-	p.W187F	ENST00000252505.3	37	c.560_561	CCDS46223.1	2																																																																																			-	NULL		0.441	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALLC	protein_coding	OTTHUMT00000322855.1	GG			3721231	1	no_errors	NM_018436	genbank	human	validated	54_36p	missense	DNP	1.000:0.995	TT
PASK	23178	genome.wustl.edu	37	2	242076663	242076663	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr2:242076663C>T	ENST00000405260.1	-	7	1591	c.893G>A	c.(892-894)aGg>aAg	p.R298K	PASK_ENST00000539818.1_Missense_Mutation_p.R82K|PASK_ENST00000358649.4_Missense_Mutation_p.R298K|PASK_ENST00000403638.3_Missense_Mutation_p.R298K|PASK_ENST00000234040.4_Missense_Mutation_p.R298K|PASK_ENST00000544142.1_Missense_Mutation_p.R112K	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	298					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)	p.R298K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		TCCAACAGACCTCTGAATCTT	0.562																																																1	Substitution - Missense(1)	ovary(1)	2											75.0	75.0	75.0					2																	242076663		2203	4300	6503	241725336	SO:0001583	missense	23178			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.893G>A	2.37:g.242076663C>T	ENSP00000384016:p.Arg298Lys	Somatic		Capture	Illumina GAIIx	4	241725336	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	HMMPfam_Pkinase,superfamily_Protein kinase-like (PK-like),HMMPfam_PAS,superfamily_PYP-like sensor domain (PAS domain)	p.R298K	ENST00000405260.1	37	c.893	CCDS2545.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.84|19.84	3.901526|3.901526	0.72754|0.72754	.|.	.|.	ENSG00000115687|ENSG00000115687	ENST00000433589|ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638;ENST00000415234	.|T;T;T;T;T;T;T	.|0.70045	.|-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	5.26|5.26	4.19|4.19	0.49359|0.49359	.|.	.|0.000000	.|0.56097	.|D	.|0.000033	T|T	0.78597|0.78597	0.4308|0.4308	M|M	0.72118|0.72118	2.19|2.19	0.21147|0.21147	N|N	0.99977|0.99977	.|D;D;D;D;D	.|0.89917	.|0.999;1.0;1.0;0.989;0.999	.|D;D;D;P;D	.|0.83275	.|0.991;0.996;0.996;0.898;0.991	T|T	0.68481|0.68481	-0.5397|-0.5397	5|10	.|0.49607	.|T	.|0.09	.|.	11.7346|11.7346	0.51757|0.51757	0.0:0.8997:0.0:0.1003|0.0:0.8997:0.0:0.1003	.|.	.|263;112;298;298;298	.|B7Z7R6;F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.|.;.;.;.;PASK_HUMAN	S|K	113|298;112;298;298;82;298;82	.|ENSP00000234040:R298K;ENSP00000441374:R112K;ENSP00000384016:R298K;ENSP00000351475:R298K;ENSP00000443083:R82K;ENSP00000384438:R298K;ENSP00000400734:R82K	.|ENSP00000234040:R298K	G|R	-|-	1|2	0|0	PASK|PASK	241725336|241725336	0.996000|0.996000	0.38824|0.38824	0.992000|0.992000	0.48379|0.48379	0.916000|0.916000	0.54674|0.54674	1.840000|1.840000	0.39230|0.39230	2.453000|2.453000	0.82957|0.82957	0.467000|0.467000	0.42956|0.42956	GGT|AGG	-	NULL		0.562	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	protein_coding	OTTHUMT00000323753.1	C	NM_015148		241725336	-1	no_errors	NM_015148	genbank	human	validated	54_36p	missense	SNP	0.996	T
DEFB125	245938	genome.wustl.edu	37	20	76997	76997	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr20:76997C>T	ENST00000382410.2	+	2	410	c.410C>T	c.(409-411)tCt>tTt	p.S137F	DEFB125_ENST00000608838.1_3'UTR	NM_153325.2	NP_697020.2	Q8N687	DB125_HUMAN	defensin, beta 125	137					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.S137F(1)		central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.156)			ATGCCACCATCTGAGACTGCT	0.433																																																1	Substitution - Missense(1)	ovary(1)	20											237.0	217.0	224.0					20																	76997		2203	4300	6503	24997	SO:0001583	missense	245938			AA935636	CCDS12989.2	20p13	2008-07-17			ENSG00000178591	ENSG00000178591		"""Defensins, beta"""	18105	protein-coding gene	gene with protein product	"""beta defensin 25"""					11854508	Standard	NM_153325		Approved	DEFB-25	uc002wcw.3	Q8N687	OTTHUMG00000031614	ENST00000382410.2:c.410C>T	20.37:g.76997C>T	ENSP00000371847:p.Ser137Phe	Somatic		Capture	Illumina GAIIx	4	24997	A1A502|Q7Z7B9	Missense_Mutation	SNP	-	p.S137F	ENST00000382410.2	37	c.410	CCDS12989.2	20	.	.	.	.	.	.	.	.	.	.	.	8.888	0.953272	0.18431	.	.	ENSG00000178591	ENST00000382410	T	0.13538	2.58	0.361	0.361	0.16107	.	.	.	.	.	T	0.10380	0.0254	N	0.14661	0.345	0.09310	N	1	P	0.39520	0.676	P	0.45558	0.485	T	0.29941	-0.9995	8	0.66056	D	0.02	.	.	.	.	.	137	Q8N687	DB125_HUMAN	F	137	ENSP00000371847:S137F	ENSP00000371847:S137F	S	+	2	0	DEFB125	24997	0.001000	0.12720	0.002000	0.10522	0.003000	0.03518	0.736000	0.26130	0.406000	0.25560	0.411000	0.27672	TCT	-	NULL		0.433	DEFB125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB125	protein_coding	OTTHUMT00000077426.2	C	NM_153325		24997	1	no_errors	NM_153325	genbank	human	reviewed	54_36p	missense	SNP		T
DEFB118	117285	genome.wustl.edu	37	20	29960710	29960710	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr20:29960710C>T	ENST00000253381.2	+	2	142	c.109C>T	c.(109-111)Caa>Taa	p.Q37*		NM_054112.2	NP_473453.1	Q96PH6	DB118_HUMAN	defensin, beta 118	37					cell-matrix adhesion (GO:0007160)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)		p.Q37*(1)		breast(1)|endometrium(1)|lung(7)|ovary(3)|pancreas(1)|prostate(1)	14	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CTGCAGGAAACAATGCAAAGA	0.428																																																1	Substitution - Nonsense(1)	ovary(1)	20											112.0	102.0	105.0					20																	29960710		2203	4300	6503	29424371	SO:0001587	stop_gained	117285			AF347073	CCDS13177.1	20q11.21	2008-02-01	2002-05-09	2002-05-10	ENSG00000131068	ENSG00000131068		"""Defensins, beta"""	16196	protein-coding gene	gene with protein product		607650	"""chromosome 20 open reading frame 63"""	C20orf63		11564719, 15033915	Standard	NM_054112		Approved	dJ1018D12.3, DEFB-18, ESC42	uc002wvr.3	Q96PH6	OTTHUMG00000032161	ENST00000253381.2:c.109C>T	20.37:g.29960710C>T	ENSP00000253381:p.Gln37*	Somatic		Capture	Illumina GAIIx	4	29424371	Q17RC4|Q8N691|Q9NUH0	Nonsense_Mutation	SNP	-	p.Q37*	ENST00000253381.2	37	c.109	CCDS13177.1	20	.	.	.	.	.	.	.	.	.	.	C	9.054	0.992898	0.18966	.	.	ENSG00000131068	ENST00000253381	.	.	.	3.82	-4.14	0.03892	.	2.659000	0.01510	N	0.017885	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-22.9178	10.0205	0.42039	0.7154:0.1768:0.1078:0.0	.	.	.	.	X	37	.	ENSP00000253381:Q37X	Q	+	1	0	DEFB118	29424371	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-1.003000	0.03682	-0.814000	0.04352	-1.014000	0.02459	CAA	-	NULL		0.428	DEFB118-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB118	protein_coding	OTTHUMT00000078501.2	C	NM_054112		29424371	1	no_errors	NM_054112	genbank	human	provisional	54_36p	nonsense	SNP	0.01	T
KIAA1755	85449	genome.wustl.edu	37	20	36869648	36869648	+	Silent	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr20:36869648G>A	ENST00000279024.4	-	3	1156	c.885C>T	c.(883-885)ggC>ggT	p.G295G		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	295								p.G295G(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				CACTGGATGTGCCTGCCTCCC	0.532																																																1	Substitution - coding silent(1)	ovary(1)	20											104.0	109.0	107.0					20																	36869648		2203	4300	6503	36303062	SO:0001819	synonymous_variant	85449			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.885C>T	20.37:g.36869648G>A		Somatic		Capture	Illumina GAIIx	4	36303062	Q9C0A8	Silent	SNP	-	p.G295	ENST00000279024.4	37	c.885	CCDS33467.1	20																																																																																			-	NULL		0.532	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	protein_coding	OTTHUMT00000079144.3	G	NM_001029864		36303062	-1	no_errors	NM_001029864	genbank	human	predicted	54_36p	silent	SNP		A
ZBED4	9889	genome.wustl.edu	37	22	50279381	50279381	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr22:50279381C>A	ENST00000216268.5	+	2	2548	c.2071C>A	c.(2071-2073)Cag>Aag	p.Q691K		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	691						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q691K(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		CTTGAAACCTCAGTACTCCCT	0.443																																																1	Substitution - Missense(1)	ovary(1)	22											111.0	116.0	114.0					22																	50279381		2203	4300	6503	48665385	SO:0001583	missense	9889			AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.2071C>A	22.37:g.50279381C>A	ENSP00000216268:p.Gln691Lys	Somatic		Capture	Illumina GAIIx	4	48665385	B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	HMMPfam_zf-BED;HMMPfam_hATC	p.Q691K	ENST00000216268.5	37	c.2071	CCDS33677.1	22	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314293	0.81358	.	.	ENSG00000100426	ENST00000216268	T	0.45668	0.89	5.36	5.36	0.76844	.	0.065867	0.64402	D	0.000006	T	0.51550	0.1681	L	0.56396	1.775	0.80722	D	1	P	0.49185	0.92	P	0.50570	0.644	T	0.41197	-0.9522	10	0.25106	T	0.35	-28.2004	19.0818	0.93186	0.0:1.0:0.0:0.0	.	691	O75132	ZBED4_HUMAN	K	691	ENSP00000216268:Q691K	ENSP00000216268:Q691K	Q	+	1	0	ZBED4	48665385	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.361000	0.79497	2.492000	0.84095	0.655000	0.94253	CAG	-	NULL		0.443	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED4	protein_coding	OTTHUMT00000317408.2	C	NM_014838		48665385	1	no_errors	NM_014838	genbank	human	validated	54_36p	missense	SNP	1	A
CD200R1L	344807	genome.wustl.edu	37	3	112546240	112546240	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr3:112546240T>C	ENST00000398214.1	-	3	629	c.404A>G	c.(403-405)cAt>cGt	p.H135R	CD200R1L_ENST00000488794.1_Missense_Mutation_p.H114R|CD200R1L_ENST00000448932.1_Missense_Mutation_p.H114R	NM_001008784.2	NP_001008784.2	Q6Q8B3	MO2R2_HUMAN	CD200 receptor 1-like	135	Ig-like C2-type.					integral component of membrane (GO:0016021)		p.H135R(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(2)	19						ATATCCACGATGGAAATTCCC	0.448																																																1	Substitution - Missense(1)	ovary(1)	3											119.0	115.0	116.0					3																	112546240		2203	4300	6503	114028930	SO:0001583	missense	344807			AY284976	CCDS43131.1, CCDS56267.1	3q13.2	2014-05-15	2008-10-08		ENSG00000206531	ENSG00000206531		"""Immunoglobulin superfamily / C2-set domain containing"""	24665	protein-coding gene	gene with protein product	"""CD200 receptor 2"""						Standard	NM_001008784		Approved	CD200RLa, CD200R2	uc003dzi.1	Q6Q8B3	OTTHUMG00000159283	ENST00000398214.1:c.404A>G	3.37:g.112546240T>C	ENSP00000381272:p.His135Arg	Somatic		Capture	Illumina GAIIx	4	114028930	Q6WHB7	Missense_Mutation	SNP	-	p.H135R	ENST00000398214.1	37	c.404	CCDS43131.1	3	.	.	.	.	.	.	.	.	.	.	T	3.664	-0.068894	0.07228	.	.	ENSG00000206531	ENST00000398214;ENST00000488794;ENST00000448932	T;T;T	0.08807	3.05;3.05;3.05	4.19	-1.36	0.09085	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.625110	0.03015	N	0.149924	T	0.09247	0.0228	L	0.50333	1.59	0.09310	N	1	B	0.21753	0.06	B	0.14023	0.01	T	0.37979	-0.9682	10	0.23302	T	0.38	.	7.6153	0.28154	0.0:0.4046:0.0:0.5954	.	135	Q6Q8B3	MO2R2_HUMAN	R	135;114;114	ENSP00000381272:H135R;ENSP00000418413:H114R;ENSP00000415132:H114R	ENSP00000381272:H135R	H	-	2	0	CD200R1L	114028930	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	-0.837000	0.04377	-0.321000	0.08627	-0.263000	0.10527	CAT	-	NULL		0.448	CD200R1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD200R1L	protein_coding	OTTHUMT00000354365.1	T	NM_001008784		114028930	-1	no_errors	NM_001008784	genbank	human	validated	54_36p	missense	SNP		C
Unknown	0	genome.wustl.edu	37	3	195724960	195724960	+	IGR	SNP	T	T	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr3:195724960T>A								SDHAP1 (7810 upstream) : TFRC (51194 downstream)																							ACGAAGGCCCTGAAAGTAGTG	0.388																																																0			3																																								197209357	SO:0001628	intergenic_variant	100131360																															3.37:g.195724960T>A		Somatic		Capture	Illumina GAIIx	4	197209357		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.388					LOC100131360			T			197209357	1	pseudogene	XR_037733	genbank	human	model	54_36p	rna	SNP	0.96	A
ITPR1	3708	genome.wustl.edu	37	3	4714842	4714842	+	Silent	SNP	A	A	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr3:4714842A>C	ENST00000443694.2	+	18	2182	c.2182A>C	c.(2182-2184)Agg>Cgg	p.R728R	ITPR1_ENST00000456211.2_Silent_p.R728R|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Silent_p.R743R|ITPR1_ENST00000357086.4_Silent_p.R743R|ITPR1_ENST00000423119.2_Silent_p.R743R|ITPR1_ENST00000302640.8_Silent_p.R728R			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	743					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.R728R(1)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CCTCTTTGCGAGGATGTGTCT	0.532																																																1	Substitution - coding silent(1)	ovary(1)	3											42.0	46.0	45.0					3																	4714842		2067	4219	6286	4689842	SO:0001819	synonymous_variant	3708			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.2182A>C	3.37:g.4714842A>C		Somatic		Capture	Illumina GAIIx	4	4689842	E7EPX7|E9PDE9|Q14660|Q99897	Silent	SNP	-	p.R743	ENST00000443694.2	37	c.2227	CCDS54551.1	3																																																																																			-	NULL		0.532	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	protein_coding	OTTHUMT00000337982.3	A	NM_002222		4689842	1	no_errors	NM_001099952	genbank	human	validated	54_36p	silent	SNP	0.316	C
ZNF619	285267	genome.wustl.edu	37	3	40528383	40528383	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr3:40528383G>A	ENST00000314686.5	+	6	739	c.334G>A	c.(334-336)Gga>Aga	p.G112R	ZNF619_ENST00000429348.2_Missense_Mutation_p.G128R|ZNF619_ENST00000447116.2_Missense_Mutation_p.G168R|ZNF619_ENST00000522736.1_Missense_Mutation_p.G119R|ZNF619_ENST00000521353.1_Missense_Mutation_p.G168R|ZNF619_ENST00000432264.2_Missense_Mutation_p.G128R|ZNF619_ENST00000456778.1_Missense_Mutation_p.G84R|ZNF619_ENST00000520737.1_3'UTR			Q8N2I2	ZN619_HUMAN	zinc finger protein 619	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G112R(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		GATAGTGGAGGGACTGCTGAT	0.438																																																1	Substitution - Missense(1)	ovary(1)	3											65.0	66.0	66.0					3																	40528383		2203	4300	6503	40503387	SO:0001583	missense	285267			AK075245	CCDS46801.1, CCDS46802.1, CCDS46803.1	3p21.33	2013-01-08			ENSG00000177873	ENSG00000177873		"""Zinc fingers, C2H2-type"", ""-"""	26910	protein-coding gene	gene with protein product							Standard	NM_001145083		Approved	FLJ90764	uc011azb.2	Q8N2I2	OTTHUMG00000131391	ENST00000314686.5:c.334G>A	3.37:g.40528383G>A	ENSP00000322529:p.Gly112Arg	Somatic		Capture	Illumina GAIIx	4	40503387	B4E271|C9JRN5|D4PHA2|E9PCD9	Missense_Mutation	SNP	-	p.G112R	ENST00000314686.5	37	c.334		3	.	.	.	.	.	.	.	.	.	.	G	9.678	1.148629	0.21288	.	.	ENSG00000177873	ENST00000314686;ENST00000447116;ENST00000429348;ENST00000456778;ENST00000522736;ENST00000521353;ENST00000432264	T;T;T;T;T;T;T	0.05996	3.36;3.5;3.59;3.45;3.37;3.5;3.59	2.69	1.72	0.24424	.	.	.	.	.	T	0.02610	0.0079	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B;B	0.12013	0.001;0.001;0.005;0.005;0.001;0.001	B;B;B;B;B;B	0.09377	0.001;0.001;0.004;0.002;0.001;0.001	T	0.48592	-0.9022	9	0.17832	T	0.49	.	6.7853	0.23670	0.167:0.0:0.833:0.0	.	84;128;168;70;119;112	B4E271;C9JRN5;E9PCD9;B7Z9B3;Q17RW3;Q8N2I2	.;.;.;.;.;ZN619_HUMAN	R	112;168;128;84;119;168;128	ENSP00000322529:G112R;ENSP00000411132:G168R;ENSP00000398024:G128R;ENSP00000397232:G84R;ENSP00000428004:G119R;ENSP00000430705:G168R;ENSP00000388710:G128R	ENSP00000322529:G112R	G	+	1	0	ZNF619	40503387	0.000000	0.05858	0.003000	0.11579	0.157000	0.22087	0.034000	0.13776	0.414000	0.25790	0.563000	0.77884	GGA	-	NULL		0.438	ZNF619-001	KNOWN	basic	protein_coding	ZNF619	protein_coding	OTTHUMT00000254180.2	G	NM_173656		40503387	1	no_errors	NM_173656	genbank	human	validated	54_36p	missense	SNP		A
LARS2	23395	genome.wustl.edu	37	3	45518043	45518043	+	Silent	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr3:45518043C>T	ENST00000415258.1	+	9	1083	c.942C>T	c.(940-942)atC>atT	p.I314I	LARS2_ENST00000414984.1_Silent_p.I271I|LARS2_ENST00000265537.3_Silent_p.I314I			Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	314					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)	p.I314I(1)		endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	ACGTGGCCATCTCGCCCAGCC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	3											83.0	80.0	81.0					3																	45518043		2203	4300	6503	45493047	SO:0001819	synonymous_variant	23395			AJ312685	CCDS2728.1	3p21.3	2012-10-26			ENSG00000011376	ENSG00000011376	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	17095	protein-coding gene	gene with protein product	"""leucine tRNA ligase 2, mitochondrial"""	604544				20194621, 15123417	Standard	NM_015340		Approved	KIAA0028, LEURS, MGC26121	uc003cop.1	Q15031	OTTHUMG00000133177	ENST00000415258.1:c.942C>T	3.37:g.45518043C>T		Somatic		Capture	Illumina GAIIx	4	45493047		Silent	SNP	HMMPfam_tRNA-synt_1;superfamily_ValRS/IleRS/LeuRS editing domain;superfamily_Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases;HMMPfam_Anticodon_1;HMMPfam_tRNA-synt_1g;superfamily_Nucleotidylyl transferase	p.I314	ENST00000415258.1	37	c.942	CCDS2728.1	3																																																																																			-	NULL		0.572	LARS2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LARS2	protein_coding	OTTHUMT00000345001.1	C	NM_015340		45493047	1	no_errors	NM_015340	genbank	human	reviewed	54_36p	silent	SNP	1	T
USP19	10869	genome.wustl.edu	37	3	49153262	49153262	+	Silent	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr3:49153262C>T	ENST00000398888.2	-	10	1596	c.1278G>A	c.(1276-1278)gaG>gaA	p.E426E	USP19_ENST00000434032.2_Silent_p.E527E|USP19_ENST00000398892.3_Silent_p.E466E|USP19_ENST00000453664.1_Silent_p.E517E|USP19_ENST00000417901.1_Silent_p.E529E|USP19_ENST00000398898.2_Silent_p.E466E|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000398896.1_Silent_p.E234E	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	426					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)	p.E514E(1)		NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ATTTATCCTTCTCCACAGCCC	0.612																																																1	Substitution - coding silent(1)	ovary(1)	3											83.0	86.0	85.0					3																	49153262		2045	4180	6225	49128266	SO:0001819	synonymous_variant	10869			AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.1278G>A	3.37:g.49153262C>T		Somatic		Capture	Illumina GAIIx	4	49128266	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Silent	SNP	-	p.E426	ENST00000398888.2	37	c.1278	CCDS43090.1	3	.	.	.	.	.	.	.	.	.	.	C	5.134	0.210307	0.09757	.	.	ENSG00000172046	ENST00000425298	.	.	.	6.17	6.17	0.99709	.	0.176869	0.52532	D	0.000080	D	0.82365	0.5021	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.82721	-0.0317	6	0.87932	D	0	-30.802	20.4745	0.99168	0.0:1.0:0.0:0.0	.	.	.	.	K	514	.	ENSP00000412679:E514K	E	-	1	0	USP19	49128266	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.916000	0.39986	2.941000	0.99782	0.655000	0.94253	GAA	-	NULL		0.612	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USP19	protein_coding	OTTHUMT00000257721.1	C	NM_006677		49128266	-1	no_errors	NM_006677	genbank	human	provisional	54_36p	silent	SNP	1	T
USP4	7375	genome.wustl.edu	37	3	49362402	49362402	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr3:49362402T>G	ENST00000265560.4	-	5	604	c.558A>C	c.(556-558)aaA>aaC	p.K186N	USP4_ENST00000415188.1_Missense_Mutation_p.K186N|USP4_ENST00000351842.4_Missense_Mutation_p.K186N|USP4_ENST00000416417.1_Missense_Mutation_p.K186N	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	186	Necessary for interaction with SART3. {ECO:0000269|PubMed:20595234}.|Ubiquitin-like 1.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.K186N(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		TGCTCATGTATTTGTTCCAGA	0.532																																																1	Substitution - Missense(1)	ovary(1)	3											187.0	185.0	186.0					3																	49362402		2203	4300	6503	49337406	SO:0001583	missense	7375			U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.558A>C	3.37:g.49362402T>G	ENSP00000265560:p.Lys186Asn	Somatic		Capture	Illumina GAIIx	4	49337406	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	HMMPfam_UCH;HMMPfam_DUF1055;superfamily_Cysteine proteinases	p.K186N	ENST00000265560.4	37	c.558	CCDS2793.1	3	.	.	.	.	.	.	.	.	.	.	T	22.9	4.345697	0.82022	.	.	ENSG00000114316	ENST00000351842;ENST00000265560;ENST00000416417;ENST00000415188	T;T;T	0.32988	1.94;2.04;1.43	5.51	0.339	0.15979	.	0.177620	0.51477	D	0.000095	T	0.40171	0.1106	M	0.71206	2.165	0.44462	D	0.997395	D;P	0.55605	0.972;0.944	P;P	0.52514	0.701;0.657	T	0.32428	-0.9907	10	0.56958	D	0.05	-15.4384	9.9363	0.41552	0.0:0.365:0.0:0.635	.	186;186	Q13107-2;Q13107	.;UBP4_HUMAN	N	186	ENSP00000341028:K186N;ENSP00000265560:K186N;ENSP00000400623:K186N	ENSP00000265560:K186N	K	-	3	2	USP4	49337406	0.981000	0.34729	1.000000	0.80357	0.997000	0.91878	0.099000	0.15210	0.081000	0.16988	0.402000	0.26972	AAA	-	HMMPfam_DUF1055		0.532	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP4	protein_coding	OTTHUMT00000346069.1	T	NM_199443		49337406	-1	no_errors	NM_003363	genbank	human	validated	54_36p	missense	SNP	1	G
ITIH4	3700	genome.wustl.edu	37	3	52863234	52863234	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr3:52863234G>T	ENST00000266041.4	-	2	248	c.152C>A	c.(151-153)aCg>aAg	p.T51K	RP5-966M1.6_ENST00000468472.1_3'UTR|ITIH4_ENST00000485816.1_Missense_Mutation_p.T51K|RP5-966M1.6_ENST00000513520.1_5'Flank|ITIH4_ENST00000346281.5_Missense_Mutation_p.T51K|ITIH4_ENST00000434759.3_Intron|ITIH4_ENST00000406595.1_Missense_Mutation_p.T51K	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	51	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.T51K(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		GGTGACGACCGTGTGGGCAAA	0.552																																																1	Substitution - Missense(1)	ovary(1)	3											151.0	132.0	138.0					3																	52863234		2203	4300	6503	52838274	SO:0001583	missense	3700			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.152C>A	3.37:g.52863234G>T	ENSP00000266041:p.Thr51Lys	Somatic		Capture	Illumina GAIIx	4	52838274	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Missense_Mutation	SNP	-	p.T51K	ENST00000266041.4	37	c.152	CCDS2865.1	3	.	.	.	.	.	.	.	.	.	.	G	21.2	4.110706	0.77210	.	.	ENSG00000055955	ENST00000266041;ENST00000346281;ENST00000485816;ENST00000406595;ENST00000538421	T;T;T;T	0.26373	1.74;1.74;1.74;1.74	5.4	5.4	0.78164	Vault protein inter-alpha-trypsin (2);Vault protein inter-alpha-trypsin, metazoa (1);	0.000000	0.64402	D	0.000002	T	0.56949	0.2020	M	0.85373	2.75	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.63269	-0.6675	10	0.72032	D	0.01	-20.2445	16.9554	0.86258	0.0:0.0:1.0:0.0	.	51;51;51	E9PGN5;B7ZKJ8;Q14624	.;.;ITIH4_HUMAN	K	51	ENSP00000266041:T51K;ENSP00000340520:T51K;ENSP00000417824:T51K;ENSP00000384425:T51K	ENSP00000266041:T51K	T	-	2	0	ITIH4	52838274	1.000000	0.71417	0.952000	0.39060	0.352000	0.29268	3.808000	0.55598	2.518000	0.84900	0.655000	0.94253	ACG	-	NULL		0.552	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITIH4	protein_coding	OTTHUMT00000317715.1	G	NM_002218		52838274	-1	no_errors	NM_002218	genbank	human	validated	54_36p	missense	SNP	1	T
TCTEX1D2	255758	genome.wustl.edu	37	3	196018207	196018207	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr3:196018207G>C	ENST00000325318.5	-	5	555	c.420C>G	c.(418-420)ttC>ttG	p.F140L	RP11-447L10.1_ENST00000431391.1_Intron|TCTEX1D2_ENST00000491186.1_5'UTR	NM_152773.4	NP_689986.2	Q8WW35	TC1D2_HUMAN	Tctex1 domain containing 2	140								p.F140L(2)		breast(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	7	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		TTCAGTAGTAGAAACAGCCAA	0.318																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	3											72.0	76.0	74.0					3																	196018207		2203	4300	6503	197502604	SO:0001583	missense	255758			BC021177	CCDS33929.1	3q29	2010-07-19			ENSG00000213123	ENSG00000213123			28482	protein-coding gene	gene with protein product						12477932	Standard	NM_152773		Approved	MGC33212	uc003fwi.3	Q8WW35	OTTHUMG00000155672	ENST00000325318.5:c.420C>G	3.37:g.196018207G>C	ENSP00000324323:p.Phe140Leu	Somatic		Capture	Illumina GAIIx	4	197502604	A6NCN5	Missense_Mutation	SNP	-	p.F140L	ENST00000325318.5	37	c.420	CCDS33929.1	3	.	.	.	.	.	.	.	.	.	.	G	15.06	2.721762	0.48728	.	.	ENSG00000213123	ENST00000325318	T	0.27720	1.65	5.28	5.28	0.74379	.	0.105285	0.40469	U	0.001095	T	0.38639	0.1048	M	0.74546	2.27	0.47994	D	0.999565	B	0.17852	0.024	B	0.26614	0.071	T	0.30149	-0.9988	10	0.72032	D	0.01	-6.8512	14.2969	0.66318	0.0:0.0:1.0:0.0	.	140	Q8WW35	TC1D2_HUMAN	L	140	ENSP00000324323:F140L	ENSP00000324323:F140L	F	-	3	2	TCTEX1D2	197502604	1.000000	0.71417	1.000000	0.80357	0.541000	0.35023	4.433000	0.59929	2.756000	0.94617	0.655000	0.94253	TTC	-	NULL		0.318	TCTEX1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTEX1D2	protein_coding	OTTHUMT00000341166.1	G	NM_152773		197502604	-1	no_errors	NM_152773	genbank	human	provisional	54_36p	missense	SNP	1	C
DCAF16	54876	genome.wustl.edu	37	4	17805173	17805173	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr4:17805173T>C	ENST00000382247.1	-	3	1652	c.592A>G	c.(592-594)Act>Gct	p.T198A	DCAF16_ENST00000507768.1_5'Flank|DCAF16_ENST00000536863.1_Missense_Mutation_p.T198A	NM_017741.3	NP_060211.3	Q9NXF7	DCA16_HUMAN	DDB1 and CUL4 associated factor 16	198					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)		p.T198A(1)		cervix(1)|endometrium(1)|lung(2)|ovary(1)	5						TAAGAATAAGTAGTGTTGATG	0.393																																																1	Substitution - Missense(1)	ovary(1)	4											204.0	192.0	196.0					4																	17805173		2203	4300	6503	17414271	SO:0001583	missense	54876			AK000287	CCDS3423.1	4p15.32	2009-07-17	2009-07-17	2009-07-17	ENSG00000163257	ENSG00000163257		"""DDB1 and CUL4 associated factors"""	25987	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 30"""	C4orf30		12477932	Standard	XM_005248169		Approved	FLJ20280	uc003gpn.3	Q9NXF7	OTTHUMG00000128536	ENST00000382247.1:c.592A>G	4.37:g.17805173T>C	ENSP00000371682:p.Thr198Ala	Somatic		Capture	Illumina GAIIx	4	17414271	B3KPB7	Missense_Mutation	SNP	-	p.T198A	ENST00000382247.1	37	c.592	CCDS3423.1	4	.	.	.	.	.	.	.	.	.	.	T	8.936	0.964540	0.18583	.	.	ENSG00000163257	ENST00000382247;ENST00000536863	T;T	0.35789	1.29;1.29	4.04	4.04	0.47022	.	.	.	.	.	T	0.35799	0.0944	N	0.08118	0	0.25494	N	0.987619	D	0.60575	0.988	D	0.65010	0.931	T	0.15694	-1.0428	9	0.87932	D	0	-7.4524	9.6727	0.40021	0.0:0.0:0.0:1.0	.	198	Q9NXF7	DCA16_HUMAN	A	198	ENSP00000371682:T198A;ENSP00000445736:T198A	ENSP00000371682:T198A	T	-	1	0	DCAF16	17414271	1.000000	0.71417	1.000000	0.80357	0.548000	0.35241	1.239000	0.32719	2.061000	0.61500	0.454000	0.30748	ACT	-	NULL		0.393	DCAF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf30	protein_coding	OTTHUMT00000250371.1	T	NM_017741		17414271	-1	no_errors	NM_017741	genbank	human	predicted	54_36p	missense	SNP	0.998	C
UGT2A3	79799	genome.wustl.edu	37	4	69817092	69817092	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr4:69817092G>C	ENST00000251566.4	-	1	417	c.387C>G	c.(385-387)atC>atG	p.I129M	UGT2A3_ENST00000420231.2_5'Flank	NM_024743.3	NP_079019.3	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A3	129					cellular glucuronidation (GO:0052695)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.I129M(1)		NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TCTGATTGTAGATAAAGCTCT	0.378																																																1	Substitution - Missense(1)	ovary(1)	4											64.0	65.0	65.0					4																	69817092		2203	4300	6503	69851681	SO:0001583	missense	79799				CCDS3525.1	4q13.2	2010-12-14			ENSG00000135220	ENSG00000135220		"""UDP glucuronosyltransferases"""	28528	protein-coding gene	gene with protein product							Standard	NM_024743		Approved	FLJ21934	uc003hef.2	Q6UWM9	OTTHUMG00000129408	ENST00000251566.4:c.387C>G	4.37:g.69817092G>C	ENSP00000251566:p.Ile129Met	Somatic		Capture	Illumina GAIIx	4	69851681	Q9H6S4	Missense_Mutation	SNP	HMMPfam_UDPGT;superfamily_UDP-Glycosyltransferase/glycogen phosphorylase	p.I129M	ENST00000251566.4	37	c.387	CCDS3525.1	4	.	.	.	.	.	.	.	.	.	.	G	15.73	2.920297	0.52653	.	.	ENSG00000135220	ENST00000251566	T	0.61859	0.07	4.74	-2.89	0.05665	.	0.351072	0.25587	N	0.029647	T	0.44456	0.1294	N	0.12961	0.28	0.33897	D	0.638074	P	0.44776	0.843	P	0.53062	0.717	T	0.54689	-0.8256	10	0.66056	D	0.02	.	6.4629	0.21966	0.4949:0.2493:0.2557:0.0	.	129	Q6UWM9	UD2A3_HUMAN	M	129	ENSP00000251566:I129M	ENSP00000251566:I129M	I	-	3	3	UGT2A3	69851681	0.000000	0.05858	0.001000	0.08648	0.601000	0.36947	-1.153000	0.03169	-0.609000	0.05724	0.591000	0.81541	ATC	-	HMMPfam_UDPGT		0.378	UGT2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2A3	protein_coding	OTTHUMT00000251564.1	G	NM_024743		69851681	-1	no_errors	NM_024743	genbank	human	validated	54_36p	missense	SNP		C
TRMT44	152992	genome.wustl.edu	37	4	8465728	8465728	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr4:8465728C>T	ENST00000389737.4	+	7	1220	c.1220C>T	c.(1219-1221)cCc>cTc	p.P407L	TRMT44_ENST00000513449.2_Missense_Mutation_p.P166L	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	407					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.P15L(1)									GCAATCACACCCAATGATAAG	0.443																																																1	Substitution - Missense(1)	ovary(1)	4											225.0	197.0	207.0					4																	8465728		2203	4300	6503	8516628	SO:0001583	missense	152992			AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1220C>T	4.37:g.8465728C>T	ENSP00000374387:p.Pro407Leu	Somatic		Capture	Illumina GAIIx	Phase_III	8516628	Q8NA95	Missense_Mutation	SNP	-	p.P15L	ENST00000389737.4	37	c.44	CCDS3402.2	4	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415548	0.83449	.	.	ENSG00000155275	ENST00000513449;ENST00000389737;ENST00000285635	T;T	0.44083	0.93;0.93	4.04	4.04	0.47022	.	0.000000	0.85682	D	0.000000	T	0.73071	0.3540	M	0.93241	3.395	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.82299	-0.0526	10	0.72032	D	0.01	-15.0146	16.7502	0.85483	0.0:1.0:0.0:0.0	.	407;166	Q8IYL2;Q8IYL2-2	TRM44_HUMAN;.	L	166;407;15	ENSP00000424643:P166L;ENSP00000374387:P407L	ENSP00000285635:P15L	P	+	2	0	METTL19	8516628	1.000000	0.71417	0.103000	0.21229	0.260000	0.26232	6.509000	0.73725	2.251000	0.74343	0.563000	0.77884	CCC	-	NULL		0.443	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C4orf23	protein_coding	OTTHUMT00000359197.2	C	NM_152544		8516628	1	no_errors	NM_152544	genbank	human	predicted	54_36p	missense	SNP	0.661	T
NPFFR2	10886	genome.wustl.edu	37	4	73013323	73013323	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr4:73013323T>C	ENST00000308744.6	+	4	1461	c.1363T>C	c.(1363-1365)Tgc>Cgc	p.C455R	NPFFR2_ENST00000395999.1_Missense_Mutation_p.C356R|NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000358749.3_Missense_Mutation_p.C353R|NPFFR2_ENST00000344413.5_3'UTR	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	455					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)	p.C455R(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			GCTCCAGCTCTGCCAAAAAAG	0.448																																																1	Substitution - Missense(1)	ovary(1)	4											68.0	74.0	72.0					4																	73013323		2203	4300	6503	73232187	SO:0001583	missense	10886			AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.1363T>C	4.37:g.73013323T>C	ENSP00000307822:p.Cys455Arg	Somatic		Capture	Illumina GAIIx	4	73232187	Q96RV1|Q9NR49	Missense_Mutation	SNP	-	p.C455R	ENST00000308744.6	37	c.1363	CCDS3551.1	4	.	.	.	.	.	.	.	.	.	.	T	12.89	2.072877	0.36566	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.36340	1.26;1.26;1.26	5.83	4.66	0.58398	.	0.211888	0.34110	N	0.004255	T	0.44871	0.1314	M	0.75085	2.285	0.80722	D	1	P;P	0.46784	0.86;0.884	P;B	0.47044	0.535;0.41	T	0.47169	-0.9138	10	0.51188	T	0.08	.	11.0397	0.47823	0.0:0.0728:0.0:0.9272	.	356;455	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	R	455;356;353	ENSP00000307822:C455R;ENSP00000379321:C356R;ENSP00000351599:C353R	ENSP00000307822:C455R	C	+	1	0	NPFFR2	73232187	1.000000	0.71417	0.997000	0.53966	0.574000	0.36063	5.062000	0.64326	2.225000	0.72522	0.533000	0.62120	TGC	-	NULL		0.448	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	NPFFR2	protein_coding	OTTHUMT00000252170.2	T	NM_004885		73232187	1	no_errors	NM_004885	genbank	human	reviewed	54_36p	missense	SNP	1	C
LOC440040	440040	genome.wustl.edu	37	11	49598081	49598081	+	RNA	SNP	T	T	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr11:49598081T>A	ENST00000527477.1	+	0	685																											GGCTGTGAGATAAGGGATTCC	0.517																																																0			11																																								49554657			0																															11.37:g.49598081T>A		Somatic		Capture	Illumina GAIIx	4	49554657		Missense_Mutation	SNP	HMMPfam_ANF_receptor;superfamily_SSF53822	p.I95K	ENST00000527477.1	37	c.284		11																																																																																			-	NULL		0.517	RP11-707M1.1-003	KNOWN	basic	processed_transcript	ENSG00000205035	pseudogene	OTTHUMT00000391378.2	T			49554657	1	no_start_codon:no_stop_codon	ENST00000357667	ensembl	human	novel	54_36p	missense	SNP	1	A
LOC440040	440040	genome.wustl.edu	37	11	49598084	49598084	+	RNA	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr11:49598084G>A	ENST00000527477.1	+	0	688																											TGTGAGATAAGGGATTCCTGC	0.517																																																0			11																																								49554660			0																															11.37:g.49598084G>A		Somatic		Capture	Illumina GAIIx	4	49554660		Missense_Mutation	SNP	HMMPfam_ANF_receptor;superfamily_SSF53822	p.R96K	ENST00000527477.1	37	c.287		11																																																																																			-	NULL		0.517	RP11-707M1.1-003	KNOWN	basic	processed_transcript	ENSG00000205035	pseudogene	OTTHUMT00000391378.2	G			49554660	1	no_start_codon:no_stop_codon	ENST00000357667	ensembl	human	novel	54_36p	missense	SNP	1	A
EPB41L4A	64097	genome.wustl.edu	37	5	111497189	111497189	+	IGR	SNP	G	G	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr5:111497189G>C	ENST00000261486.5	-	0	4707				EPB41L4A_ENST00000507810.1_Intron|SNORA13_ENST00000458790.1_RNA|EPB41L4A-AS1_ENST00000413221.2_lincRNA	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		GTCAGCCTTTGTGTTGCCCAT	0.433																																																0			5											108.0	98.0	101.0					5																	111497189		876	1991	2867	111525088	SO:0001628	intergenic_variant	654322			AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902		5.37:g.111497189G>C		Somatic		Capture	Illumina GAIIx	4	111525088	A4FUI6	RNA	SNP	-	NULL	ENST00000261486.5	37	NULL	CCDS43350.1	5																																																																																			-	-		0.433	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA13	protein_coding	OTTHUMT00000370969.1	G			111525088	1	no_errors	NR_002922	genbank	human	provisional	54_36p	rna	SNP	1	C
TRPC7	57113	genome.wustl.edu	37	5	135692447	135692447	+	Missense_Mutation	SNP	T	T	A	rs565522086		TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr5:135692447T>A	ENST00000513104.1	-	2	911	c.629A>T	c.(628-630)gAc>gTc	p.D210V	TRPC7_ENST00000355180.3_Missense_Mutation_p.D210V|TRPC7_ENST00000426057.2_Missense_Mutation_p.D210V	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	210					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCTGAAGGAGTCTTTCCGCTG	0.602													T|||	1	0.000199681	0.0008	0.0	5008	,	,		19986	0.0		0.0	False		,,,				2504	0.0															0			5											57.0	63.0	61.0					5																	135692447		2157	4269	6426	135720346	SO:0001583	missense	57113			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.629A>T	5.37:g.135692447T>A	ENSP00000426070:p.Asp210Val	Somatic		Capture	Illumina GAIIx	4	135720346	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	-	p.D209V	ENST00000513104.1	37	c.626	CCDS47267.2	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.9|22.9	4.346766|4.346766	0.82022|0.82022	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193|ENST00000352189;ENST00000378459;ENST00000502753	D;D;D|.	0.85171|.	-1.95;-1.95;-1.95|.	5.26|5.26	5.26|5.26	0.73747|0.73747	Transient receptor potential II (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83529|0.83529	0.5274|0.5274	M|M	0.90595|0.90595	3.13|3.13	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	0.999;0.998;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.998;0.957;1.0;0.999|.	D|D	0.87004|0.87004	0.2118|0.2118	10|5	0.87932|.	D|.	0|.	-31.9821|-31.9821	15.3565|15.3565	0.74431|0.74431	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	210;210;210;210|.	Q8IWP7;F5H5U9;Q70T25;Q9HCX4|.	.;.;.;TRPC7_HUMAN|.	V|S	210|209	ENSP00000347312:D210V;ENSP00000441628:D210V;ENSP00000426070:D210V|.	ENSP00000265193:D210V|.	D|R	-|-	2|3	0|2	TRPC7|TRPC7	135720346|135720346	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	7.868000|7.868000	0.87116|0.87116	2.205000|2.205000	0.71048|0.71048	0.528000|0.528000	0.53228|0.53228	GAC|AGA	-	NULL		0.602	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	protein_coding	OTTHUMT00000366975.1	T	NM_020389		135720346	-1	no_errors	ENST00000265193	ensembl	human	known	54_36p	missense	SNP	1	A
PCDHGC4	56098	genome.wustl.edu	37	5	140864973	140864973	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr5:140864973A>T	ENST00000306593.1	+	1	233	c.233A>T	c.(232-234)gAt>gTt	p.D78V	PCDHGA7_ENST00000518325.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000398587.2_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	78	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D78V(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCGTGTGGATTTGGACAGC	0.572																																																1	Substitution - Missense(1)	ovary(1)	5											76.0	71.0	73.0					5																	140864973		2203	4300	6503	140845157	SO:0001583	missense	56098			AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.233A>T	5.37:g.140864973A>T	ENSP00000306918:p.Asp78Val	Somatic		Capture	Illumina GAIIx	4	140845157	Q495T2|Q9Y5C3	Missense_Mutation	SNP	-	p.D78V	ENST00000306593.1	37	c.233	CCDS4262.1	5	.	.	.	.	.	.	.	.	.	.	A	20.2	3.941549	0.73557	.	.	ENSG00000242419	ENST00000306593	T	0.48522	0.81	4.75	4.75	0.60458	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.69106	0.3074	M	0.84433	2.695	0.44316	D	0.99719	D;D	0.89917	0.979;1.0	P;D	0.79784	0.846;0.993	T	0.74160	-0.3755	9	0.87932	D	0	.	10.5288	0.44965	0.9215:0.0:0.0785:0.0	.	78;78	Q9Y5F7-2;Q9Y5F7	.;PCDGL_HUMAN	V	78	ENSP00000306918:D78V	ENSP00000306918:D78V	D	+	2	0	PCDHGC4	140845157	0.986000	0.35501	1.000000	0.80357	0.998000	0.95712	3.037000	0.49775	1.984000	0.57885	0.459000	0.35465	GAT	-	NULL		0.572	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC4	protein_coding	OTTHUMT00000251820.1	A	NM_018928		140845157	1	no_errors	NM_018928	genbank	human	reviewed	54_36p	missense	SNP	1	T
FBXO38	81545	genome.wustl.edu	37	5	147820791	147820791	+	Missense_Mutation	SNP	G	G	A	rs145662452		TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr5:147820791G>A	ENST00000340253.5	+	21	3547	c.3379G>A	c.(3379-3381)Gat>Aat	p.D1127N	FBXO38_ENST00000296701.6_Missense_Mutation_p.D882N|FBXO38_ENST00000394370.3_Missense_Mutation_p.D1052N|FBXO38_ENST00000513826.1_Missense_Mutation_p.D882N			Q6PIJ6	FBX38_HUMAN	F-box protein 38	1127					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.D1127N(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTGAAGACGATGAAGAAAG	0.413																																																1	Substitution - Missense(1)	ovary(1)	5						G	ASN/ASP,ASN/ASP	2,4404	4.2+/-10.8	0,2,2201	175.0	149.0	158.0		3154,3379	5.5	1.0	5	dbSNP_134	158	0,8600		0,0,4300	no	missense,missense	FBXO38	NM_030793.3,NM_205836.1	23,23	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging	1052/1114,1127/1189	147820791	2,13004	2203	4300	6503	147800984	SO:0001583	missense	81545			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.3379G>A	5.37:g.147820791G>A	ENSP00000342023:p.Asp1127Asn	Somatic		Capture	Illumina GAIIx	4	147800984	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	-	p.D1127N	ENST00000340253.5	37	c.3379		5	.	.	.	.	.	.	.	.	.	.	G	33	5.244100	0.95272	4.54E-4	0.0	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.38077	1.16;1.24;1.22;1.24	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.48077	0.1480	L	0.29908	0.895	0.39137	D	0.961972	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.982;0.989;0.998	T	0.28170	-1.0052	10	0.19147	T	0.46	-21.9904	18.3358	0.90287	0.0:0.0:1.0:0.0	.	882;1052;1127	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	N	1127;882;1052;882	ENSP00000342023:D1127N;ENSP00000296701:D882N;ENSP00000377895:D1052N;ENSP00000426410:D882N	ENSP00000296701:D882N	D	+	1	0	FBXO38	147800984	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.328000	0.96403	2.750000	0.94351	0.591000	0.81541	GAT	-	NULL		0.413	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	FBXO38	protein_coding	OTTHUMT00000252185.2	G	NM_030793		147800984	1	no_errors	NM_205836	genbank	human	validated	54_36p	missense	SNP	1	A
KIF4B	285643	genome.wustl.edu	37	5	154394117	154394117	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr5:154394117G>A	ENST00000435029.4	+	1	858	c.698G>A	c.(697-699)cGc>cAc	p.R233H		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	233	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.R233H(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGCAGCTTTCGCTCCAAGCTG	0.458																																																1	Substitution - Missense(1)	ovary(1)	5											102.0	100.0	101.0					5																	154394117		2203	4300	6503	154374310	SO:0001583	missense	285643			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.698G>A	5.37:g.154394117G>A	ENSP00000387875:p.Arg233His	Somatic		Capture	Illumina GAIIx	4	154374310		Missense_Mutation	SNP	-	p.R233H	ENST00000435029.4	37	c.698	CCDS47324.1	5	.	.	.	.	.	.	.	.	.	.	g	9.413	1.080958	0.20309	.	.	ENSG00000226650	ENST00000435029	T	0.72942	-0.7	1.73	0.812	0.18744	Kinesin, motor domain (4);	.	.	.	.	T	0.51092	0.1654	N	0.25957	0.775	0.26988	N	0.965205	B	0.09022	0.002	B	0.13407	0.009	T	0.32455	-0.9906	9	0.15952	T	0.53	.	6.2361	0.20764	0.1823:0.0:0.8177:0.0	.	233	Q2VIQ3	KIF4B_HUMAN	H	233	ENSP00000387875:R233H	ENSP00000387875:R233H	R	+	2	0	KIF4B	154374310	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	1.239000	0.32719	0.293000	0.22520	0.655000	0.94253	CGC	-	NULL		0.458	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	protein_coding	OTTHUMT00000377478.1	G			154374310	1	no_errors	NM_001099293	genbank	human	provisional	54_36p	missense	SNP	0.97	A
FNDC9	408263	genome.wustl.edu	37	5	156768104	156768104	+	IGR	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr5:156768104C>G	ENST00000312349.4	-	0	2125				CYFIP2_ENST00000442283.2_Missense_Mutation_p.H155Q|CYFIP2_ENST00000318218.6_Missense_Mutation_p.T896S|CYFIP2_ENST00000522463.1_Missense_Mutation_p.T675S|CYFIP2_ENST00000541131.1_Missense_Mutation_p.T796S|CYFIP2_ENST00000347377.6_Missense_Mutation_p.T871S|CYFIP2_ENST00000435847.2_Missense_Mutation_p.T570S|CYFIP2_ENST00000377576.3_Missense_Mutation_p.T871S|CYFIP2_ENST00000521420.1_Missense_Mutation_p.T845S	NM_001001343.3	NP_001001343.2	Q8TBE3	FNDC9_HUMAN	fibronectin type III domain containing 9							integral component of membrane (GO:0016021)		p.T896S(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	9						ATTCCTTTCACCCAAGAACCA	0.468																																																1	Substitution - Missense(1)	ovary(1)	5											131.0	125.0	127.0					5																	156768104		1913	4133	6046	156700682	SO:0001628	intergenic_variant	26999			BC022570	CCDS4337.1	5q33.3	2013-02-11	2011-01-25	2011-01-25	ENSG00000172568	ENSG00000172568		"""Fibronectin type III domain containing"""	33547	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 40"""	C5orf40			Standard	NM_001001343		Approved	MGC27121	uc003lwu.2	Q8TBE3	OTTHUMG00000130248		5.37:g.156768104C>G		Somatic		Capture	Illumina GAIIx	4	156700682	A8K0Y6	Missense_Mutation	SNP	-	p.T871S	ENST00000312349.4	37	c.2612	CCDS4337.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.571|9.571	1.121027|1.121027	0.20877|0.20877	.|.	.|.	ENSG00000055163|ENSG00000055163	ENST00000442283|ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T|T;T;T;T;T;T;T	0.20881|0.20738	2.04|2.05;2.05;2.05;2.05;2.05;2.05;2.05	5.05|5.05	5.05|5.05	0.67936|0.67936	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.08802|0.08802	0.0218|0.0218	N|N	0.01729|0.01729	-0.75|-0.75	0.36262|0.36262	D|D	0.854617|0.854617	.|B;B;B;B;B;B	.|0.18013	.|0.0;0.0;0.0;0.0;0.0;0.025	.|B;B;B;B;B;B	.|0.22880	.|0.002;0.004;0.004;0.001;0.004;0.042	T|T	0.14420|0.14420	-1.0473|-1.0473	7|10	0.30078|0.02654	T|T	0.28|1	-31.9782|-31.9782	18.4176|18.4176	0.90575|0.90575	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|735;675;845;871;871;896	.|A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.|.;.;.;.;.;CYFP2_HUMAN	Q|S	155|896;675;845;871;871;796;570	ENSP00000390948:H155Q|ENSP00000325817:T896S;ENSP00000428009:T675S;ENSP00000430904:T845S;ENSP00000313567:T871S;ENSP00000366799:T871S;ENSP00000444645:T796S;ENSP00000403793:T570S	ENSP00000390948:H155Q|ENSP00000325817:T896S	H|T	+|+	3|2	2|0	CYFIP2|CYFIP2	156700682|156700682	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.910000|0.910000	0.53928|0.53928	7.776000|7.776000	0.85560|0.85560	2.342000|2.342000	0.79632|0.79632	0.313000|0.313000	0.20887|0.20887	CAC|ACC	-	NULL		0.468	FNDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP2	protein_coding	OTTHUMT00000252573.2	C	NM_001001343		156700682	1	no_errors	ENST00000347377	ensembl	human	known	54_36p	missense	SNP	1	G
C6	729	genome.wustl.edu	37	5	41159314	41159314	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr5:41159314T>G	ENST00000263413.3	-	12	1990	c.1726A>C	c.(1726-1728)Acc>Ccc	p.T576P	C6_ENST00000475349.1_5'Flank|C6_ENST00000337836.5_Missense_Mutation_p.T576P	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	576	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.T576P(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GCATCACAGGTACTCCAGGAA	0.512																																																1	Substitution - Missense(1)	ovary(1)	5											82.0	84.0	83.0					5																	41159314		2203	4300	6503	41195071	SO:0001583	missense	729			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1726A>C	5.37:g.41159314T>G	ENSP00000263413:p.Thr576Pro	Somatic		Capture	Illumina GAIIx	Phase_III	41195071		Missense_Mutation	SNP	HMMPfam_Sushi,TSP_1,HMMPfam_TSP_1,MACPF,HMMPfam_MACPF,Ldl_recept_a,HMMPfam_Ldl_recept_a,Kazal_2,HMMPfam_Kazal_2,Sushi	p.T576P	ENST00000263413.3	37	c.1726	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	T	0.400	-0.918756	0.02396	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.16743	2.32;2.32	5.23	-10.5	0.00291	.	1.192650	0.05535	N	0.564680	T	0.03827	0.0108	N	0.03194	-0.395	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.20974	-1.0259	10	0.02654	T	1	4.6407	2.6946	0.05130	0.3378:0.2807:0.2856:0.096	.	576	P13671	CO6_HUMAN	P	576	ENSP00000338861:T576P;ENSP00000263413:T576P	ENSP00000263413:T576P	T	-	1	0	C6	41195071	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-1.616000	0.02053	-2.393000	0.00584	-0.341000	0.08007	ACC	-	HMMPfam_TSP_1		0.512	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	protein_coding	OTTHUMT00000211592.1	T			41195071	-1	no_errors	NM_000065	genbank	human	reviewed	54_36p	missense	SNP	0.001	G
GCNT4	51301	genome.wustl.edu	37	5	74325000	74325000	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr5:74325000G>C	ENST00000322348.4	-	1	1724	c.863C>G	c.(862-864)tCc>tGc	p.S288C		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	288					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)	p.S288C(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		TGCTTCCTTGGAGATGTTTGT	0.373																																																1	Substitution - Missense(1)	ovary(1)	5											71.0	71.0	71.0					5																	74325000		2203	4300	6503	74360756	SO:0001583	missense	51301			AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.863C>G	5.37:g.74325000G>C	ENSP00000317027:p.Ser288Cys	Somatic		Capture	Illumina GAIIx	4	74360756		Missense_Mutation	SNP	HMMPfam_Branch	p.S288C	ENST00000322348.4	37	c.863	CCDS4026.1	5	.	.	.	.	.	.	.	.	.	.	.	15.29	2.789305	0.49997	.	.	ENSG00000176928	ENST00000322348	T	0.09163	3.01	6.06	5.19	0.71726	.	0.343916	0.34435	N	0.003980	T	0.21427	0.0516	L	0.54323	1.7	0.40063	D	0.975927	D	0.55172	0.97	P	0.52758	0.708	T	0.00961	-1.1499	10	0.56958	D	0.05	-16.3041	15.1526	0.72713	0.0671:0.0:0.9329:0.0	.	288	Q9P109	GCNT4_HUMAN	C	288	ENSP00000317027:S288C	ENSP00000317027:S288C	S	-	2	0	GCNT4	74360756	1.000000	0.71417	1.000000	0.80357	0.360000	0.29518	4.906000	0.63293	1.578000	0.49821	0.650000	0.86243	TCC	-	HMMPfam_Branch		0.373	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT4	protein_coding	OTTHUMT00000254040.1	G	NM_016591		74360756	-1	no_errors	NM_016591	genbank	human	validated	54_36p	missense	SNP	1	C
DOCK2	1794	genome.wustl.edu	37	5	169435500	169435500	+	Splice_Site	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr5:169435500G>T	ENST00000256935.8	+	31	3152		c.e31-1		DOCK2_ENST00000523351.1_Splice_Site|DOCK2_ENST00000520908.1_Splice_Site|DOCK2_ENST00000540750.1_Splice_Site	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.?(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCATTTACAGCTGTGGAACA	0.443																																																1	Unknown(1)	ovary(1)	5											95.0	89.0	91.0					5																	169435500		2203	4300	6503	169368078	SO:0001630	splice_region_variant	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3073-1G>T	5.37:g.169435500G>T		Somatic		Capture	Illumina GAIIx	4	169368078	Q2M3I0|Q96AK7	Splice_Site	SNP	-	e31-1	ENST00000256935.8	37	c.3073-1	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910483	0.72983	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9357	0.97140	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK2	169368078	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.715000	0.92844	0.655000	0.94253	.	-	-		0.443	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	G	NM_004946	Intron	169368078	1	no_errors	NM_004946	genbank	human	validated	54_36p	splice_site	SNP	1	T
OR5AK3P	81228	genome.wustl.edu	37	11	56738825	56738825	+	IGR	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr11:56738825T>C								AP000479.1 (93271 upstream) : OR5AK2 (17521 downstream)														p.F101L(1)									TGTGATACAATTCTTAGTTTA	0.388																																																1	Substitution - Missense(1)	ovary(1)	11																																								56495401	SO:0001628	intergenic_variant	81228																															11.37:g.56738825T>C		Somatic		Capture	Illumina GAIIx	4	56495401		Missense_Mutation	SNP	-	p.F101L		37	c.301		11																																																																																			-	NULL	0	0.388					OR5AK3P			T			56495401	1	no_errors	ENST00000326876	ensembl	human	known	54_36p	missense	SNP	0.09	C
KIF13A	63971	genome.wustl.edu	37	6	17788078	17788078	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr6:17788078C>G	ENST00000259711.6	-	27	3395	c.3290G>C	c.(3289-3291)aGg>aCg	p.R1097T	KIF13A_ENST00000378814.5_Missense_Mutation_p.R1084T|KIF13A_ENST00000378816.5_Missense_Mutation_p.R1097T|KIF13A_ENST00000378843.2_Missense_Mutation_p.R1084T|KIF13A_ENST00000378826.2_Missense_Mutation_p.R1097T	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1097					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R1097T(1)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			ATCTGACCACCTCTCCCTTAC	0.373																																																1	Substitution - Missense(1)	ovary(1)	6											290.0	266.0	273.0					6																	17788078		1898	4125	6023	17896057	SO:0001583	missense	63971			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.3290G>C	6.37:g.17788078C>G	ENSP00000259711:p.Arg1097Thr	Somatic		Capture	Illumina GAIIx	4	17896057	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	-	p.R1097T	ENST00000259711.6	37	c.3290	CCDS47381.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.0|23.0	4.364924|4.364924	0.82463|0.82463	.|.	.|.	ENSG00000137177|ENSG00000137177	ENST00000358380|ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816;ENST00000506044	.|T;T;T;T;T;T	.|0.72051	.|-0.59;1.81;-0.62;-0.59;-0.59;-0.59	5.9|5.9	5.03|5.03	0.67393|0.67393	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75568|0.75568	0.3867|0.3867	L|L	0.53249|0.53249	1.67|1.67	0.47476|0.47476	D|D	0.999436|0.999436	.|P;D;P;D	.|0.89917	.|0.928;1.0;0.941;0.997	.|P;D;P;P	.|0.70716	.|0.693;0.97;0.856;0.897	T|T	0.79945|0.79945	-0.1589|-0.1589	5|10	.|0.87932	.|D	.|0	.|.	15.256|15.256	0.73585|0.73585	0.0:0.9327:0.0:0.0673|0.0:0.9327:0.0:0.0673	.|.	.|1084;1097;1097;1084	.|Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.|.;.;KI13A_HUMAN;.	R|T	491|1084;101;1097;1097;1084;1097;95	.|ENSP00000368091:R1084T;ENSP00000425616:R101T;ENSP00000259711:R1097T;ENSP00000368103:R1097T;ENSP00000368120:R1084T;ENSP00000368093:R1097T	.|ENSP00000259711:R1097T	G|R	-|-	1|2	0|0	KIF13A|KIF13A	17896057|17896057	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.653000|2.653000	0.46691|0.46691	1.499000|1.499000	0.48617|0.48617	0.563000|0.563000	0.77884|0.77884	GGT|AGG	-	NULL		0.373	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	protein_coding	OTTHUMT00000039954.4	C			17896057	-1	no_errors	NM_022113	genbank	human	validated	54_36p	missense	SNP	1	G
HIST1H2BH	8345	genome.wustl.edu	37	6	26251910	26251910	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr6:26251910C>T	ENST00000356350.2	+	1	32	c.32C>T	c.(31-33)cCg>cTg	p.P11L	HIST1H3F_ENST00000446824.2_5'Flank	NM_003524.2	NP_003515.1	Q93079	H2B1H_HUMAN	histone cluster 1, H2bh	11					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P11L(1)		NS(3)|breast(2)|large_intestine(1)|lung(3)|ovary(3)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	17						GCTCCCGCCCCGAAGAAGGGC	0.527																																																1	Substitution - Missense(1)	ovary(1)	6											86.0	79.0	82.0					6																	26251910		2203	4300	6503	26359889	SO:0001583	missense	8345			Z80781	CCDS4601.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000197459	ENSG00000275713		"""Histones / Replication-dependent"""	4755	protein-coding gene	gene with protein product		602806	"""H2B histone family, member J"", ""histone 1, H2bh"""	H2BFJ		9119399, 12408966	Standard	NM_003524		Approved	H2B/j	uc003nhh.3	Q93079	OTTHUMG00000014447	ENST00000356350.2:c.32C>T	6.37:g.26251910C>T	ENSP00000348706:p.Pro11Leu	Somatic		Capture	Illumina GAIIx	4	26359889	B2R541|Q4VB74	Missense_Mutation	SNP	-	p.P11L	ENST00000356350.2	37	c.32	CCDS4601.1	6	.	.	.	.	.	.	.	.	.	.	.	17.06	3.293429	0.60086	.	.	ENSG00000197459	ENST00000356350	T	0.22743	1.94	4.52	3.65	0.41850	Histone-fold (2);	.	.	.	.	T	0.16257	0.0391	M	0.83312	2.635	0.41539	D	0.9885	B	0.17038	0.02	B	0.01281	0.0	T	0.10109	-1.0644	9	0.87932	D	0	.	12.4046	0.55432	0.0:0.9162:0.0:0.0838	.	11	Q93079	H2B1H_HUMAN	L	11	ENSP00000348706:P11L	ENSP00000348706:P11L	P	+	2	0	HIST1H2BH	26359889	0.437000	0.25593	0.053000	0.19242	0.016000	0.09150	3.026000	0.49689	1.215000	0.43411	0.655000	0.94253	CCG	-	NULL		0.527	HIST1H2BH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BH	protein_coding	OTTHUMT00000040110.1	C	NM_003524		26359889	1	no_errors	NM_003524	genbank	human	reviewed	54_36p	missense	SNP	1	T
EFHC1	114327	genome.wustl.edu	37	6	52317602	52317602	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr6:52317602T>A	ENST00000371068.5	+	4	793	c.690T>A	c.(688-690)gaT>gaA	p.D230E	EFHC1_ENST00000433625.2_Missense_Mutation_p.D139E|EFHC1_ENST00000538167.1_Missense_Mutation_p.D211E	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	230						axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)	p.D230E(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					CAGACTTTGATCAACTCAAGC	0.398																																																1	Substitution - Missense(1)	ovary(1)	6											154.0	147.0	149.0					6																	52317602		2203	4300	6503	52425561	SO:0001583	missense	114327			AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.690T>A	6.37:g.52317602T>A	ENSP00000360107:p.Asp230Glu	Somatic		Capture	Illumina GAIIx	4	52425561	B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Missense_Mutation	SNP	-	p.D230E	ENST00000371068.5	37	c.690	CCDS4942.1	6	.	.	.	.	.	.	.	.	.	.	T	23.9	4.469182	0.84533	.	.	ENSG00000096093	ENST00000371068;ENST00000433625;ENST00000538167	T;T;T	0.68624	-0.13;-0.34;-0.34	6.01	-0.392	0.12442	.	0.084947	0.85682	D	0.000000	T	0.65439	0.2691	M	0.79475	2.455	0.33509	D	0.590867	D;D;P	0.71674	0.998;0.974;0.803	P;P;B	0.61874	0.895;0.742;0.298	T	0.65047	-0.6263	10	0.32370	T	0.25	-13.4637	10.3406	0.43875	0.0:0.5797:0.0:0.4203	.	211;139;230	F5GZD8;B7Z2S4;Q5JVL4	.;.;EFHC1_HUMAN	E	230;139;211	ENSP00000360107:D230E;ENSP00000416492:D139E;ENSP00000444521:D211E	ENSP00000360107:D230E	D	+	3	2	EFHC1	52425561	0.997000	0.39634	0.998000	0.56505	0.997000	0.91878	0.297000	0.19101	-0.035000	0.13691	0.533000	0.62120	GAT	-	NULL		0.398	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHC1	protein_coding	OTTHUMT00000040905.2	T	NM_018100		52425561	1	no_errors	NM_018100	genbank	human	validated	54_36p	missense	SNP	1	A
THEMIS	387357	genome.wustl.edu	37	6	128222021	128222021	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr6:128222021C>A	ENST00000368248.2	-	1	205	c.57G>T	c.(55-57)agG>agT	p.R19S	THEMIS_ENST00000543064.1_Missense_Mutation_p.R19S|THEMIS_ENST00000368250.1_5'UTR|THEMIS_ENST00000537166.1_Intron	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	19	CABIT 1.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R19S(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						TTTCTAGAACCCTGGGTAGGG	0.438																																																1	Substitution - Missense(1)	ovary(1)	6											197.0	194.0	195.0					6																	128222021		2203	4300	6503	128263714	SO:0001583	missense	387357			AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.57G>T	6.37:g.128222021C>A	ENSP00000357231:p.Arg19Ser	Somatic		Capture	Illumina GAIIx	4	128263714	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	-	p.R19S	ENST00000368248.2	37	c.57	CCDS34534.1	6	.	.	.	.	.	.	.	.	.	.	C	18.82	3.705136	0.68615	.	.	ENSG00000172673	ENST00000543064;ENST00000368248	T;T	0.14893	2.47;2.47	5.55	-1.63	0.08345	.	0.000000	0.85682	D	0.000000	T	0.26304	0.0642	M	0.80982	2.52	0.80722	D	1	D;D	0.76494	0.977;0.999	P;D	0.85130	0.73;0.997	T	0.21211	-1.0252	10	0.87932	D	0	-3.5157	9.7792	0.40639	0.0:0.4213:0.0:0.5787	.	19;19	F5H1J9;Q8N1K5	.;THMS1_HUMAN	S	19	ENSP00000439594:R19S;ENSP00000357231:R19S	ENSP00000357231:R19S	R	-	3	2	THEMIS	128263714	0.963000	0.33076	0.968000	0.41197	0.961000	0.63080	-0.187000	0.09656	-0.151000	0.11176	0.591000	0.81541	AGG	-	NULL		0.438	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	C6orf190	protein_coding		C	NM_001010923		128263714	-1	no_errors	NM_001010923	genbank	human	validated	54_36p	missense	SNP	0.94	A
ZNF800	168850	genome.wustl.edu	37	7	127014462	127014462	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr7:127014462G>A	ENST00000393313.1	-	5	1519	c.928C>T	c.(928-930)Cat>Tat	p.H310Y	ZNF800_ENST00000393312.1_Missense_Mutation_p.H310Y|ZNF800_ENST00000265827.3_Missense_Mutation_p.H310Y|ZNF800_ENST00000485577.1_5'Flank			Q2TB10	ZN800_HUMAN	zinc finger protein 800	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H310Y(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(8)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	32						AGTCCTCTATGAACTTCATCA	0.373																																																2	Substitution - Missense(2)	ovary(2)	7											97.0	95.0	96.0					7																	127014462		2203	4300	6503	126801698	SO:0001583	missense	168850			AF218032	CCDS5795.1	7q31.33	2008-05-02			ENSG00000048405	ENSG00000048405		"""Zinc fingers, C2H2-type"""	27267	protein-coding gene	gene with protein product						12477932	Standard	NM_176814		Approved		uc003vly.1	Q2TB10	OTTHUMG00000023456	ENST00000393313.1:c.928C>T	7.37:g.127014462G>A	ENSP00000376989:p.His310Tyr	Somatic		Capture	Illumina GAIIx	4	126801698	Q9HBN0	Missense_Mutation	SNP	-	p.H310Y	ENST00000393313.1	37	c.928	CCDS5795.1	7	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138096	0.56936	.	.	ENSG00000048405	ENST00000393313;ENST00000265827;ENST00000393312	D;D;D	0.85955	-2.05;-2.05;-2.05	5.68	5.68	0.88126	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	D	0.87857	0.6283	L	0.27053	0.805	0.27194	N	0.960336	D;D	0.69078	0.997;0.997	D;D	0.79108	0.992;0.992	D	0.86258	0.1653	8	.	.	.	-0.7997	18.7799	0.91928	0.0:0.0:1.0:0.0	.	213;310	B7Z4V7;Q2TB10	.;ZN800_HUMAN	Y	310	ENSP00000376989:H310Y;ENSP00000265827:H310Y;ENSP00000376988:H310Y	.	H	-	1	0	ZNF800	126801698	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.230000	0.95299	2.685000	0.91497	0.650000	0.86243	CAT	-	NULL		0.373	ZNF800-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZNF800	protein_coding	OTTHUMT00000141823.1	G	NM_176814		126801698	-1	no_errors	NM_176814	genbank	human	validated	54_36p	missense	SNP	1	A
ZNF716	441234	genome.wustl.edu	37	7	57529739	57529739	+	3'UTR	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr7:57529739C>A	ENST00000420713.1	+	0	1684					NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.?(1)		breast(1)|kidney(1)|lung(20)|ovary(2)	24						GAGAATGTGGCCAATTCTTTA	0.328																																																1	Unknown(1)	ovary(1)	7																																								57533681	SO:0001624	3_prime_UTR_variant	441234			AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.*84C>A	7.37:g.57529739C>A		Somatic		Capture	Illumina GAIIx	4	57533681		Silent	SNP	-	p.G486	ENST00000420713.1	37	c.1458	CCDS55112.1	7																																																																																			-	NULL		0.328	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF716	protein_coding	OTTHUMT00000345309.1	C	NM_001159279		57533681	1	no_stop_codon	ENST00000331425	ensembl	human	known	54_36p	silent	SNP	0.399	A
GTF2IRD2B	389524	genome.wustl.edu	37	7	74563753	74563753	+	Silent	SNP	G	G	A	rs202156190	byFrequency	TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr7:74563753G>A	ENST00000312575.7	+	16	1675	c.1500G>A	c.(1498-1500)tcG>tcA	p.S500S	GTF2IRD2B_ENST00000418185.2_Silent_p.S47S	NM_001003795.2	NP_001003795.1	Q6EKJ0	GTD2B_HUMAN	GTF2I repeat domain containing 2B	500					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S500S(1)		endometrium(1)|ovary(2)|prostate(1)	4						tcttaggctcgtcagacaccg	0.488																																																1	Substitution - coding silent(1)	ovary(1)	7											2.0	1.0	1.0					7																	74563753		845	1893	2738	74201689	SO:0001819	synonymous_variant	389524			AY312850	CCDS34659.1	7q11.23	2014-05-06			ENSG00000174428	ENSG00000174428			33125	protein-coding gene	gene with protein product		608900				15100712	Standard	XM_005277580		Approved		uc003ubt.3	Q6EKJ0	OTTHUMG00000181534	ENST00000312575.7:c.1500G>A	7.37:g.74563753G>A		Somatic		Capture	Illumina GAIIx	4	74201689	B2RNE9|Q69GU6|Q8N979|Q9H739	Silent	SNP	-	p.S500	ENST00000312575.7	37	c.1500	CCDS34659.1	7																																																																																			-	NULL		0.488	GTF2IRD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2IRD2B	protein_coding	OTTHUMT00000342728.1	G	NM_001003795		74201689	1	no_errors	NM_001003795	genbank	human	reviewed	54_36p	silent	SNP	0.02	A
PCLO	27445	genome.wustl.edu	37	7	82764557	82764557	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr7:82764557G>T	ENST00000333891.9	-	3	2646	c.2309C>A	c.(2308-2310)tCa>tAa	p.S770*	PCLO_ENST00000423517.2_Nonsense_Mutation_p.S770*	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.S716*(1)|p.S770*(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGTTGCTGATGATGAAGATAC	0.463																																																2	Substitution - Nonsense(2)	ovary(2)	7											202.0	183.0	189.0					7																	82764557		1913	4132	6045	82602493	SO:0001587	stop_gained	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.2309C>A	7.37:g.82764557G>T	ENSP00000334319:p.Ser770*	Somatic		Capture	Illumina GAIIx	4	82602493		Nonsense_Mutation	SNP	-	p.S770*	ENST00000333891.9	37	c.2309	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	41	8.629078	0.98892	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	.	.	.	5.83	2.04	0.26737	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999976	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.3901	0.38367	0.2775:0.0:0.7225:0.0	.	.	.	.	X	716;770;770	.	ENSP00000334319:S770X	S	-	2	0	PCLO	82602493	0.000000	0.05858	0.000000	0.03702	0.287000	0.27160	0.436000	0.21526	0.103000	0.17682	0.591000	0.81541	TCA	-	NULL		0.463	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	G	NM_014510		82602493	-1	no_errors	NM_033026	genbank	human	validated	54_36p	nonsense	SNP	0.01	T
PCLO	27445	genome.wustl.edu	37	7	82784253	82784253	+	Silent	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr7:82784253C>T	ENST00000333891.9	-	2	2041	c.1704G>A	c.(1702-1704)caG>caA	p.Q568Q	PCLO_ENST00000423517.2_Silent_p.Q568Q	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.Q568Q(1)|p.Q514Q(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTGTTGGTGGCTGCAGAGGTT	0.502																																																2	Substitution - coding silent(2)	ovary(2)	7											339.0	340.0	339.0					7																	82784253		2007	4170	6177	82622189	SO:0001819	synonymous_variant	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1704G>A	7.37:g.82784253C>T		Somatic		Capture	Illumina GAIIx	4	82622189		Silent	SNP	-	p.Q568	ENST00000333891.9	37	c.1704	CCDS47630.1	7																																																																																			-	NULL		0.502	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	C	NM_014510		82622189	-1	no_errors	NM_033026	genbank	human	validated	54_36p	silent	SNP	0.03	T
ABCB4	5244	genome.wustl.edu	37	7	87068987	87068987	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr7:87068987T>C	ENST00000265723.4	-	14	1838	c.1727A>G	c.(1726-1728)gAt>gGt	p.D576G	ABCB4_ENST00000545634.1_Missense_Mutation_p.D576G|ABCB4_ENST00000453593.1_Missense_Mutation_p.D576G|ABCB4_ENST00000358400.3_Missense_Mutation_p.D576G|ABCB4_ENST00000359206.3_Missense_Mutation_p.D576G	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	576	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.D576G(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	ACTGACCTTATCCAGAGCTGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	7											136.0	120.0	125.0					7																	87068987		2203	4300	6503	86906923	SO:0001583	missense	5244			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.1727A>G	7.37:g.87068987T>C	ENSP00000265723:p.Asp576Gly	Somatic		Capture	Illumina GAIIx	4	86906923	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	HMMPfam_ABC_membrane;HMMPfam_ABC_tran;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain	p.D576G	ENST00000265723.4	37	c.1727	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248167	0.80024	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56;-1.56	5.55	4.4	0.53042	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.85128	0.5626	L	0.35288	1.05	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.993	D;D;D	0.71414	0.952;0.973;0.94	D	0.85616	0.1261	10	0.87932	D	0	-19.8113	11.3834	0.49771	0.0:0.071:0.0:0.929	.	576;576;576	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	G	576	ENSP00000352135:D576G;ENSP00000351172:D576G;ENSP00000265723:D576G;ENSP00000392983:D576G;ENSP00000437465:D576G	ENSP00000265723:D576G	D	-	2	0	ABCB4	86906923	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.297000	0.72757	0.935000	0.37341	0.533000	0.62120	GAT	-	HMMPfam_ABC_tran		0.498	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	protein_coding	OTTHUMT00000336083.1	T	NM_000443		86906923	-1	no_errors	NM_018849	genbank	human	reviewed	54_36p	missense	SNP	1	C
CTAGE4	100128553	genome.wustl.edu	37	7	143882794	143882794	+	Missense_Mutation	SNP	C	C	T	rs545239580	byFrequency	TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr7:143882794C>T	ENST00000486333.1	+	1	2236	c.2198C>T	c.(2197-2199)tCt>tTt	p.S733F		NM_198495.2	NP_940897.2	Q8IX94	CTGE4_HUMAN	CTAGE family, member 4	733	Pro-rich.					integral component of membrane (GO:0016021)		p.S733F(1)		endometrium(1)|ovary(2)	3						TTTGGAGCTTCTCGAGGTTAT	0.512																																																1	Substitution - Missense(1)	ovary(1)	7											1.0	1.0	1.0					7																	143882794		134	463	597	143513727	SO:0001583	missense	100128553			AF338232	CCDS55176.1	7q35	2009-10-15			ENSG00000225932	ENSG00000225932			24772	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 4"""	608910				12839582, 11149944	Standard	NM_198495		Approved	FLJ43692, cTAGE-4	uc010lpc.3	Q8IX94	OTTHUMG00000157997	ENST00000486333.1:c.2198C>T	7.37:g.143882794C>T	ENSP00000419539:p.Ser733Phe	Somatic		Capture	Illumina GAIIx	4	143513727	A8K871|O95046	RNA	SNP	-	NULL	ENST00000486333.1	37	NULL	CCDS55176.1	7	.	.	.	.	.	.	.	.	.	.	.	6.035	0.374874	0.11409	.	.	ENSG00000225932	ENST00000486333	T	0.38560	1.13	.	.	.	.	.	.	.	.	T	0.53916	0.1826	M	0.73962	2.25	0.09310	N	1	D	0.67145	0.996	D	0.68621	0.959	T	0.48843	-0.8999	7	0.72032	D	0.01	.	.	.	.	.	733	Q8IX94	CTGE4_HUMAN	F	733	ENSP00000419539:S733F	ENSP00000419539:S733F	S	+	2	0	CTAGE4	143513727	0.999000	0.42202	0.158000	0.22627	0.160000	0.22226	0.934000	0.28910	-1.351000	0.02197	-1.360000	0.01215	TCT	-	-		0.512	CTAGE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTAGE4	protein_coding	OTTHUMT00000349970.1	C	NM_198495		143513727	1	no_errors	XR_038147	genbank	human	model	54_36p	rna	SNP	0.91	T
VPS13B	157680	genome.wustl.edu	37	8	100287354	100287354	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr8:100287354C>A	ENST00000358544.2	+	19	2807	c.2696C>A	c.(2695-2697)tCt>tAt	p.S899Y	VPS13B_ENST00000357162.2_Missense_Mutation_p.S899Y|VPS13B_ENST00000395996.1_Missense_Mutation_p.S899Y	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	899					protein transport (GO:0015031)			p.S899Y(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CAGGGTCCTTCTGACACTAAA	0.378																																					Colon(161;2205 2542 7338 31318)											1	Substitution - Missense(1)	ovary(1)	8											88.0	86.0	87.0					8																	100287354		2203	4300	6503	100356530	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.2696C>A	8.37:g.100287354C>A	ENSP00000351346:p.Ser899Tyr	Somatic		Capture	Illumina GAIIx	4	100356530	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	-	p.S899Y	ENST00000358544.2	37	c.2696	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	C	23.7	4.446266	0.84101	.	.	ENSG00000132549	ENST00000357162;ENST00000358544;ENST00000395996	T;T;T	0.70869	-0.52;-0.52;-0.22	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000001	T	0.78541	0.4299	L	0.29908	0.895	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;0.999;0.998	D;D;D;P	0.87578	0.998;0.998;0.996;0.904	T	0.80491	-0.1359	10	0.72032	D	0.01	.	19.5442	0.95284	0.0:1.0:0.0:0.0	.	899;899;899;899	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3	.;.;VP13B_HUMAN;.	Y	899	ENSP00000349685:S899Y;ENSP00000351346:S899Y;ENSP00000379318:S899Y	ENSP00000349685:S899Y	S	+	2	0	VPS13B	100356530	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.179000	0.77665	2.614000	0.88457	0.591000	0.81541	TCT	-	NULL		0.378	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	protein_coding	OTTHUMT00000277138.1	C	NM_184042		100356530	1	no_errors	NM_017890	genbank	human	reviewed	54_36p	missense	SNP	1	A
PPP1R3B	79660	genome.wustl.edu	37	8	8998433	8998433	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr8:8998433C>A	ENST00000310455.3	-	2	879	c.729G>T	c.(727-729)atG>atT	p.M243I	PPP1R3B_ENST00000519699.1_Missense_Mutation_p.M243I|RP11-10A14.3_ENST00000522057.1_RNA|RP11-10A14.3_ENST00000520017.1_RNA	NM_001201329.1|NM_024607.3	NP_001188258.1|NP_078883.2	Q86XI6	PPR3B_HUMAN	protein phosphatase 1, regulatory subunit 3B	243					glycogen metabolic process (GO:0005977)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)	glycogen granule (GO:0042587)|intracellular membrane-bounded organelle (GO:0043231)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase regulator activity (GO:0019888)	p.M243I(1)		endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	12				COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)		GGGGCTTGGTCATTCCCTGGG	0.502																																																1	Substitution - Missense(1)	ovary(1)	8											185.0	179.0	181.0					8																	8998433		2203	4300	6503	9035843	SO:0001583	missense	79660			AK024067	CCDS5973.1	8p23.1	2012-04-17	2011-10-04		ENSG00000173281	ENSG00000173281		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14942	protein-coding gene	gene with protein product	"""PP1 subunit R4"", ""hepatic glycogen-targeting subunit, G(L)"""	610541	"""protein phosphatase 1, regulatory (inhibitor) subunit 3B"""			11948623, 17555403	Standard	NM_024607		Approved	GL, FLJ14005, PPP1R4	uc003wsn.4	Q86XI6	OTTHUMG00000129329	ENST00000310455.3:c.729G>T	8.37:g.8998433C>A	ENSP00000308318:p.Met243Ile	Somatic		Capture	Illumina GAIIx	4	9035843	B3KTV3|Q9H812	Missense_Mutation	SNP	HMMPfam_CBM_21	p.M243I	ENST00000310455.3	37	c.729	CCDS5973.1	8	.	.	.	.	.	.	.	.	.	.	C	0.530	-0.858454	0.02610	.	.	ENSG00000173281	ENST00000310455;ENST00000519699	T;T	0.41065	1.01;1.01	5.71	-4.12	0.03916	.	1.585610	0.03424	N	0.206711	T	0.20047	0.0482	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07927	-1.0747	10	0.37606	T	0.19	-0.1007	3.0077	0.06034	0.146:0.3745:0.3151:0.1645	.	243	Q86XI6	PPR3B_HUMAN	I	243	ENSP00000308318:M243I;ENSP00000428642:M243I	ENSP00000308318:M243I	M	-	3	0	PPP1R3B	9035843	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.321000	0.00513	-1.338000	0.02233	0.561000	0.74099	ATG	-	NULL		0.502	PPP1R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3B	protein_coding	OTTHUMT00000251472.1	C	NM_024607		9035843	-1	no_errors	NM_024607	genbank	human	validated	54_36p	missense	SNP		A
NAT2	10	genome.wustl.edu	37	8	18258187	18258187	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr8:18258187T>C	ENST00000286479.3	+	2	781	c.674T>C	c.(673-675)tTg>tCg	p.L225S	NAT2_ENST00000520116.1_Missense_Mutation_p.L95S	NM_000015.2	NP_000006.2	P11245	ARY2_HUMAN	N-acetyltransferase 2 (arylamine N-acetyltransferase)	225					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	arylamine N-acetyltransferase activity (GO:0004060)	p.L225S(1)		kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(2)	12				Colorectal(111;0.0531)|COAD - Colon adenocarcinoma(73;0.21)	Acetaminophen(DB00316)|Clonazepam(DB01068)|Dapsone(DB00250)|Ezogabine(DB04953)|Isoniazid(DB00951)|Sulfamethoxazole(DB01015)	TTTTGTTCCTTGCAGACCCCA	0.383									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																																							1	Substitution - Missense(1)	ovary(1)	8											78.0	81.0	80.0					8																	18258187		2203	4300	6503	18302467	SO:0001583	missense	10	Familial Cancer Database	incl.: Familial Head and Neck Cancer	D90042	CCDS6008.1	8p22	2012-01-18			ENSG00000156006	ENSG00000156006	2.3.1.5		7646	protein-coding gene	gene with protein product		612182		AAC2		7773298	Standard	NM_000015		Approved		uc003wyw.1	P11245	OTTHUMG00000130826	ENST00000286479.3:c.674T>C	8.37:g.18258187T>C	ENSP00000286479:p.Leu225Ser	Somatic		Capture	Illumina GAIIx	4	18302467	O43637|O60654|O60655|Q13146|Q16697|Q2MLE4|Q2MLF5|Q2MLG8|Q2MLJ6|Q2MLK4|Q2MLK6|Q2MLN7|Q6LET4|Q86XS0|Q86XS1|Q96KY8|Q96T64|Q96T65|Q9H220	Missense_Mutation	SNP	HMMPfam_Acetyltransf_2,superfamily_Cysteine proteinases	p.L225S	ENST00000286479.3	37	c.674	CCDS6008.1	8	.	.	.	.	.	.	.	.	.	.	T	15.20	2.764053	0.49574	.	.	ENSG00000156006	ENST00000286479;ENST00000520116	T;T	0.02015	4.5;4.5	2.86	2.86	0.33363	.	0.085278	0.47093	D	0.000258	T	0.14527	0.0351	M	0.93241	3.395	0.44214	D	0.997042	D	0.89917	1.0	D	0.87578	0.998	T	0.00258	-1.1871	10	0.87932	D	0	.	7.5312	0.27685	0.0:0.0:0.0:1.0	.	225	A4Z6T7	.	S	225;95	ENSP00000286479:L225S;ENSP00000428416:L95S	ENSP00000286479:L225S	L	+	2	0	NAT2	18302467	0.995000	0.38212	1.000000	0.80357	0.775000	0.43874	3.646000	0.54396	1.546000	0.49388	0.358000	0.22013	TTG	-	HMMPfam_Acetyltransf_2		0.383	NAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT2	protein_coding	OTTHUMT00000253380.1	T	NM_000015		18302467	1	no_errors	NM_000015	genbank	human	reviewed	54_36p	missense	SNP	1	C
DOCK5	80005	genome.wustl.edu	37	8	25136102	25136102	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr8:25136102T>C	ENST00000276440.7	+	5	286	c.242T>C	c.(241-243)aTt>aCt	p.I81T	DOCK5_ENST00000481100.1_Missense_Mutation_p.I81T	NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	81					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.I81T(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GAAACCGTGATTCCTGGCGAG	0.537																																					Pancreas(145;34 1887 3271 10937 30165)											1	Substitution - Missense(1)	ovary(1)	8											137.0	114.0	122.0					8																	25136102		2203	4300	6503	25192019	SO:0001583	missense	80005				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.242T>C	8.37:g.25136102T>C	ENSP00000276440:p.Ile81Thr	Somatic		Capture	Illumina GAIIx	4	25192019	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	superfamily_SH3-domain;superfamily_ARM repeat;HMMPfam_SH3_1	p.I81T	ENST00000276440.7	37	c.242	CCDS6047.1	8	.	.	.	.	.	.	.	.	.	.	T	14.97	2.695697	0.48202	.	.	ENSG00000147459	ENST00000481100;ENST00000276440	T;T	0.59224	0.28;0.28	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.57621	0.2066	M	0.68317	2.08	0.48571	D	0.999672	B	0.11235	0.004	B	0.15484	0.013	T	0.54262	-0.8320	10	0.44086	T	0.13	.	14.5614	0.68140	0.0:0.0:0.0:1.0	.	81	Q9H7D0	DOCK5_HUMAN	T	81	ENSP00000429737:I81T;ENSP00000276440:I81T	ENSP00000276440:I81T	I	+	2	0	DOCK5	25192019	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.977000	0.70492	2.324000	0.78689	0.533000	0.62120	ATT	-	NULL		0.537	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK5	protein_coding	OTTHUMT00000254955.2	T	NM_024940		25192019	1	no_errors	NM_024940	genbank	human	validated	54_36p	missense	SNP	1	C
ADRA1A	148	genome.wustl.edu	37	8	26721719	26721719	+	Missense_Mutation	SNP	G	G	C	rs569147612		TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr8:26721719G>C	ENST00000519229.1	-	1	774	c.768C>G	c.(766-768)caC>caG	p.H256Q	ADRA1A_ENST00000380581.2_Missense_Mutation_p.H256Q|ADRA1A_ENST00000380587.1_Missense_Mutation_p.H256Q|ADRA1A_ENST00000354550.4_Missense_Mutation_p.H256Q|ADRA1A_ENST00000358857.5_Missense_Mutation_p.H256Q|ADRA1A_ENST00000380586.1_Missense_Mutation_p.H256Q|ADRA1A_ENST00000380572.3_Missense_Mutation_p.H256Q|ADRA1A_ENST00000380582.3_Missense_Mutation_p.H256Q|ADRA1A_ENST00000380573.3_Missense_Mutation_p.H256Q|ADRA1A_ENST00000276393.4_Missense_Mutation_p.H256Q			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	332					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)	p.H256Q(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	TCACTGAGAAGTGCGTCTTGG	0.607																																																1	Substitution - Missense(1)	ovary(1)	8											55.0	50.0	52.0					8																	26721719		2203	4300	6503	26777636	SO:0001583	missense	148			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.768C>G	8.37:g.26721719G>C	ENSP00000430793:p.His256Gln	Somatic		Capture	Illumina GAIIx	4	26777636	Q9NPY0	Missense_Mutation	SNP	HMMPfam_7tm_1,superfamily_Family A G protein-coupled receptor-like	p.H256Q	ENST00000519229.1	37	c.768		8	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469545	0.43839	.	.	ENSG00000120907	ENST00000380586;ENST00000380587;ENST00000380582;ENST00000380581;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573;ENST00000380572;ENST00000358857	D;D;D;D;D;D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37;-2.37;-2.37;-2.37;-2.37;-2.37	5.27	3.45	0.39498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000156	D	0.88797	0.6534	L	0.38649	1.16	0.42954	D	0.994385	D;P;P;D;D;D	0.64830	0.964;0.94;0.952;0.964;0.994;0.99	P;P;P;P;P;P	0.59221	0.749;0.681;0.786;0.681;0.854;0.837	D	0.88194	0.2879	10	0.48119	T	0.1	.	10.9021	0.47058	0.2149:0.0:0.7851:0.0	.	256;256;256;256;256;256	P35348-9;P35348-8;P35348;P35348-4;P35348-3;B0ZBD3	.;.;ADA1A_HUMAN;.;.;.	Q	256	ENSP00000369960:H256Q;ENSP00000369961:H256Q;ENSP00000369956:H256Q;ENSP00000369955:H256Q;ENSP00000430793:H256Q;ENSP00000346557:H256Q;ENSP00000276393:H256Q;ENSP00000369947:H256Q;ENSP00000369946:H256Q;ENSP00000351725:H256Q	ENSP00000276393:H256Q	H	-	3	2	ADRA1A	26777636	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	1.032000	0.30178	1.349000	0.45751	0.563000	0.77884	CAC	-	HMMPfam_7tm_1		0.607	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	ADRA1A	protein_coding	OTTHUMT00000376207.1	G	NM_033303		26777636	-1	no_errors	NM_033303	genbank	human	reviewed	54_36p	missense	SNP	0.987	C
ZFHX4	79776	genome.wustl.edu	37	8	77768157	77768157	+	Silent	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr8:77768157C>T	ENST00000521891.2	+	10	9448	c.9000C>T	c.(8998-9000)ggC>ggT	p.G3000G	ZFHX4_ENST00000050961.6_Silent_p.G2955G|ZFHX4_ENST00000518282.1_Silent_p.G2974G|ZFHX4_ENST00000455469.2_Silent_p.G2955G	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2955					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G2984G(3)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCAATCAAGGCGGAACGGAAG	0.468										HNSCC(33;0.089)																																						3	Substitution - coding silent(3)	ovary(1)|large_intestine(1)|endometrium(1)	8											45.0	44.0	44.0					8																	77768157		1913	4126	6039	77930712	SO:0001819	synonymous_variant	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9000C>T	8.37:g.77768157C>T		Somatic		Capture	Illumina GAIIx	4	77930712	G3V138|Q18PS0|Q6ZN20	Silent	SNP	-	p.G2955	ENST00000521891.2	37	c.8865	CCDS47878.2	8																																																																																			-	NULL		0.468	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	protein_coding	OTTHUMT00000379197.2	C	NM_024721		77930712	1	no_errors	NM_024721	genbank	human	validated	54_36p	silent	SNP	0.977	T
DENND3	22898	genome.wustl.edu	37	8	142176356	142176356	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr8:142176356C>T	ENST00000262585.2	+	12	1659	c.1381C>T	c.(1381-1383)Cac>Tac	p.H461Y	DENND3_ENST00000519811.1_Missense_Mutation_p.H541Y|DENND3_ENST00000424248.1_Missense_Mutation_p.H409Y	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	461					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.H461Y(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			GAAGTCCTCGCACCTGCATGT	0.552																																																1	Substitution - Missense(1)	ovary(1)	8											124.0	133.0	130.0					8																	142176356		2203	4300	6503	142245538	SO:0001583	missense	22898			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.1381C>T	8.37:g.142176356C>T	ENSP00000262585:p.His461Tyr	Somatic		Capture	Illumina GAIIx	4	142245538	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	HMMPfam_DENN;HMMPfam_WD40;HMMPfam_dDENN;superfamily_WD40 repeat-like	p.H461Y	ENST00000262585.2	37	c.1381	CCDS34947.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.144|0.144	-1.098824|-1.098824	0.01843|0.01843	.|.	.|.	ENSG00000105339|ENSG00000105339	ENST00000518668|ENST00000262585;ENST00000424248;ENST00000519811	.|T;T;T	.|0.13538	.|2.95;2.58;2.96	5.12|5.12	-0.202|-0.202	0.13208|0.13208	.|.	.|1.464360	.|0.03885	.|N	.|0.277673	T|T	0.06142|0.06142	0.0159|0.0159	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.25955	.|0.138;0.098;0.059	.|B;B;B	.|0.18263	.|0.015;0.021;0.009	T|T	0.27400|0.27400	-1.0075|-1.0075	5|10	.|0.02654	.|T	.|1	-23.384|-23.384	8.4889|8.4889	0.33089|0.33089	0.0:0.4475:0.3535:0.199|0.0:0.4475:0.3535:0.199	.|.	.|541;409;461	.|E9PF32;A2RUS2-2;A2RUS2	.|.;.;DEND3_HUMAN	V|Y	465|461;409;541	.|ENSP00000262585:H461Y;ENSP00000410594:H409Y;ENSP00000428714:H541Y	.|ENSP00000262585:H461Y	A|H	+|+	2|1	0|0	DENND3|DENND3	142245538|142245538	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-1.376000|-1.376000	0.02561|0.02561	-0.040000|-0.040000	0.13580|0.13580	0.561000|0.561000	0.74099|0.74099	GCA|CAC	-	NULL		0.552	DENND3-201	KNOWN	basic|CCDS	protein_coding	DENND3	protein_coding		C	NM_014957		142245538	1	no_errors	NM_014957	genbank	human	validated	54_36p	missense	SNP		T
RP11-1396O13.13	0	genome.wustl.edu	37	4	9388913	9388913	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr4:9388913T>A	ENST00000508324.1	-	2	100	c.101A>T	c.(100-102)gAt>gTt	p.D34V															p.D34V(1)		breast(2)|lung(7)	9						CAGCGTCACATCTCTGTACAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	4																																								8998011	SO:0001583	missense	0																														ENST00000508324.1:c.101A>T	4.37:g.9388913T>A	ENSP00000421652:p.Asp34Val	Somatic		Capture	Illumina GAIIx	4	8998011		Missense_Mutation	SNP	-	p.D34V	ENST00000508324.1	37	c.101		4	.	.	.	.	.	.	.	.	.	.	.	8.938	0.965001	0.18583	.	.	ENSG00000219492	ENST00000508324	T	0.02837	4.14	0.892	0.892	0.19230	.	.	.	.	.	T	0.06188	0.0160	.	.	.	0.39579	D	0.969402	.	.	.	.	.	.	T	0.34601	-0.9822	6	0.87932	D	0	.	6.1009	0.20047	0.0:0.0:0.0:1.0	.	.	.	.	V	34	ENSP00000421652:D34V	ENSP00000421652:D34V	D	-	2	0	RP11-1396O13.13	8998011	0.267000	0.24122	0.682000	0.30024	0.134000	0.20937	0.846000	0.27682	0.692000	0.31613	0.076000	0.15429	GAT	-	NULL		0.433	RP11-1396O13.13-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ENSG00000219492	protein_coding	OTTHUMT00000359605.2	T			8998011	-1	no_stop_codon	ENST00000402465	ensembl	human	known	54_36p	missense	SNP	0.96	A
PALM2	114299	genome.wustl.edu	37	9	112687348	112687348	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr9:112687348C>A	ENST00000374531.2	+	6	460	c.386C>A	c.(385-387)tCc>tAc	p.S129Y	PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.S127Y|PALM2_ENST00000483909.1_Missense_Mutation_p.S127Y|PALM2_ENST00000448454.2_Missense_Mutation_p.S129Y|AKAP2_ENST00000555236.1_Missense_Mutation_p.S127Y|AKAP2_ENST00000510514.5_Missense_Mutation_p.S127Y|PALM2_ENST00000314527.4_Missense_Mutation_p.S127Y|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.S127Y	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2	129					regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)		p.S129Y(1)|p.S127Y(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						CAGGGTTTCTCCAGTACGGAT	0.463																																																2	Substitution - Missense(2)	ovary(2)	9											230.0	196.0	208.0					9																	112687348		2203	4300	6503	111727169	SO:0001583	missense	445815			AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.386C>A	9.37:g.112687348C>A	ENSP00000363656:p.Ser129Tyr	Somatic		Capture	Illumina GAIIx	4	111727169	A9Z1X9|Q8N9D5|Q96DU1	Missense_Mutation	SNP	-	p.S127Y	ENST00000374531.2	37	c.380	CCDS35099.1	9	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216873	0.79352	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654;ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978	ENST00000374531;ENST00000448454;ENST00000483909;ENST00000314527;ENST00000497711;ENST00000374530;ENST00000413420;ENST00000302798;ENST00000555236;ENST00000510514	T;T;T;T;T;T;T;T;T;T	0.32515	2.25;2.31;2.25;2.31;1.45;2.13;2.31;2.13;2.13;2.13	5.42	5.42	0.78866	.	0.865894	0.09880	N	0.743803	T	0.45637	0.1352	L	0.29908	0.895	0.36265	D	0.854774	D;D;P;D	0.61697	0.99;0.99;0.6;0.975	D;D;P;P	0.63192	0.912;0.912;0.505;0.596	T	0.48885	-0.8995	10	0.87932	D	0	-0.1798	16.7371	0.85449	0.0:1.0:0.0:0.0	.	127;127;129;129	Q9Y2D5-6;Q9Y2D5-4;Q8IXS6;D3YTA4	.;.;PALM2_HUMAN;.	Y	129;129;127;127;113;127;127;127;127;127	ENSP00000363656:S129Y;ENSP00000400206:S129Y;ENSP00000417525:S127Y;ENSP00000323805:S127Y;ENSP00000419747:S113Y;ENSP00000363654:S127Y;ENSP00000397839:S127Y;ENSP00000305861:S127Y;ENSP00000451476:S127Y;ENSP00000421522:S127Y	ENSP00000305861:S127Y	S	+	2	0	PALM2-AKAP2;PALM2;AKAP2	111727169	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.124000	0.57924	2.695000	0.91970	0.655000	0.94253	TCC	-	NULL		0.463	PALM2-002	KNOWN	basic|CCDS	protein_coding	PALM2-AKAP2	protein_coding	OTTHUMT00000053604.1	C	NM_001037293		111727169	1	no_errors	NM_007203	genbank	human	validated	54_36p	missense	SNP	0.99	A
DMRT3	58524	genome.wustl.edu	37	9	990732	990732	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr9:990732C>A	ENST00000190165.2	+	2	1184	c.1146C>A	c.(1144-1146)agC>agA	p.S382R		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	382					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S382R(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		GCCAGTCGAGCCCCTTTTTGC	0.582																																																1	Substitution - Missense(1)	ovary(1)	9											55.0	49.0	51.0					9																	990732		2203	4300	6503	980732	SO:0001583	missense	58524			AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.1146C>A	9.37:g.990732C>A	ENSP00000190165:p.Ser382Arg	Somatic		Capture	Illumina GAIIx	4	980732	Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Missense_Mutation	SNP	HMMPfam_DM;superfamily_Cysteine-rich DNA binding domain (DM domain);HMMPfam_DMA;superfamily_UBA-like	p.S382R	ENST00000190165.2	37	c.1146	CCDS6443.1	9	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608224	0.46527	.	.	ENSG00000064218	ENST00000190165	T	0.26957	1.7	5.01	4.11	0.48088	.	0.230969	0.44285	D	0.000473	T	0.30572	0.0769	L	0.29908	0.895	0.44055	D	0.996797	D	0.67145	0.996	P	0.56788	0.806	T	0.05007	-1.0912	10	0.87932	D	0	-25.9007	10.1969	0.43060	0.0:0.7885:0.0:0.2115	.	382	Q9NQL9	DMRT3_HUMAN	R	382	ENSP00000190165:S382R	ENSP00000190165:S382R	S	+	3	2	DMRT3	980732	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	1.060000	0.30530	1.110000	0.41699	-0.258000	0.10820	AGC	-	NULL		0.582	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT3	protein_coding	OTTHUMT00000051490.1	C	NM_021240		980732	1	no_errors	NM_021240	genbank	human	validated	54_36p	missense	SNP	1	A
PIGO	84720	genome.wustl.edu	37	9	35091323	35091323	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr9:35091323C>T	ENST00000378617.3	-	7	2955	c.2561G>A	c.(2560-2562)cGc>cAc	p.R854H	PIGO_ENST00000341666.3_Missense_Mutation_p.R854H|PIGO_ENST00000361778.2_Intron|PIGO_ENST00000298004.5_Intron	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	854					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.R854H(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AAGGCTGATGCGCTCCGCATG	0.547																																																1	Substitution - Missense(1)	ovary(1)	9											100.0	93.0	95.0					9																	35091323		2203	4300	6503	35081323	SO:0001583	missense	84720			AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.2561G>A	9.37:g.35091323C>T	ENSP00000367880:p.Arg854His	Somatic		Capture	Illumina GAIIx	4	35081323	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Missense_Mutation	SNP	HMMPfam_Phosphodiest;superfamily_Alkaline phosphatase-like	p.R854H	ENST00000378617.3	37	c.2561	CCDS6575.1	9	.	.	.	.	.	.	.	.	.	.	C	20.7	4.027958	0.75390	.	.	ENSG00000165282	ENST00000378617;ENST00000341666	T;T	0.55930	0.49;0.49	5.44	5.44	0.79542	.	0.178213	0.49916	D	0.000137	T	0.60971	0.2310	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.64410	0.925	T	0.60342	-0.7282	10	0.46703	T	0.11	-31.0701	19.4628	0.94924	0.0:1.0:0.0:0.0	.	854	Q8TEQ8	PIGO_HUMAN	H	854	ENSP00000367880:R854H;ENSP00000339382:R854H	ENSP00000339382:R854H	R	-	2	0	PIGO	35081323	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.465000	0.73538	2.837000	0.97791	0.655000	0.94253	CGC	-	NULL		0.547	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGO	protein_coding	OTTHUMT00000052284.1	C	NM_032634		35081323	-1	no_errors	NM_032634	genbank	human	reviewed	54_36p	missense	SNP	1	T
SECISBP2	79048	genome.wustl.edu	37	9	91943768	91943768	+	Silent	SNP	A	A	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr9:91943768A>G	ENST00000375807.3	+	5	839	c.768A>G	c.(766-768)agA>agG	p.R256R	SECISBP2_ENST00000470305.1_3'UTR|SECISBP2_ENST00000339901.4_Silent_p.R183R|SECISBP2_ENST00000534113.2_Silent_p.R188R	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	256					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)	p.R256R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						CTCTTCTAAGAGAAGTAGTAA	0.408																																																1	Substitution - coding silent(1)	ovary(1)	9											56.0	54.0	55.0					9																	91943768		2203	4300	6503	91133588	SO:0001819	synonymous_variant	79048			AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.768A>G	9.37:g.91943768A>G		Somatic		Capture	Illumina GAIIx	4	91133588	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Silent	SNP	-	p.R256	ENST00000375807.3	37	c.768	CCDS6683.1	9																																																																																			-	NULL		0.408	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SECISBP2	protein_coding	OTTHUMT00000052990.3	A	NM_024077		91133588	1	no_errors	NM_024077	genbank	human	reviewed	54_36p	silent	SNP	0.17	G
HIATL1	84641	genome.wustl.edu	37	9	97200742	97200742	+	Silent	SNP	G	G	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr9:97200742G>A	ENST00000375344.3	+	4	596	c.327G>A	c.(325-327)agG>agA	p.R109R	HIATL1_ENST00000428393.2_Silent_p.R44R	NM_032558.2	NP_115947.2	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1	109					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.R109R(1)		endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	11		Acute lymphoblastic leukemia(62;0.136)				TGTGGGGGAGGAAGCCCTTTC	0.517																																					Pancreas(77;1260 1915 1973 10423)											1	Substitution - coding silent(1)	ovary(1)	9											70.0	67.0	68.0					9																	97200742		2203	4297	6500	96240563	SO:0001819	synonymous_variant	84641			AK027659	CCDS6710.2	9q22.32	2009-12-04			ENSG00000148110	ENSG00000148110			23376	protein-coding gene	gene with protein product							Standard	XM_005252277		Approved	FLJ14753	uc004aur.3	Q5SR56	OTTHUMG00000020265	ENST00000375344.3:c.327G>A	9.37:g.97200742G>A		Somatic		Capture	Illumina GAIIx	4	96240563	B4DUE6|E9PD58|Q3KQT4|Q53GU5|Q8WU95|Q96SM4	Silent	SNP	-	p.R109	ENST00000375344.3	37	c.327	CCDS6710.2	9																																																																																			-	NULL		0.517	HIATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIATL1	protein_coding	OTTHUMT00000053184.1	G	NM_032558		96240563	1	no_errors	NM_032558	genbank	human	validated	54_36p	silent	SNP	1	A
HSPA5	3309	genome.wustl.edu	37	9	128001074	128001074	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chr9:128001074C>A	ENST00000324460.6	-	6	1232	c.1029G>T	c.(1027-1029)caG>caT	p.Q343H	RP11-65N13.8_ENST00000468244.1_RNA	NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	343					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)	p.Q343H(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	CCAACACTTTCTGGACGGGCT	0.393										Prostate(1;0.17)																																						1	Substitution - Missense(1)	ovary(1)	9											72.0	71.0	71.0					9																	128001074		2203	4300	6503	127040895	SO:0001583	missense	3309				CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1029G>T	9.37:g.128001074C>A	ENSP00000324173:p.Gln343His	Somatic		Capture	Illumina GAIIx	4	127040895	B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	HMMPfam_HSP70;superfamily_Heat shock protein 70kD (HSP70) peptide-binding domain;superfamily_Heat shock protein 70kD (HSP70) C-terminal subdomain;superfamily_Actin-like ATPase domain	p.Q343H	ENST00000324460.6	37	c.1029	CCDS6863.1	9	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278129	0.59758	.	.	ENSG00000044574	ENST00000324460	T	0.01043	5.41	4.23	4.23	0.50019	.	0.000000	0.85682	D	0.000000	T	0.02193	0.0068	L	0.60845	1.875	0.80722	D	1	B	0.20164	0.042	B	0.23150	0.044	T	0.51172	-0.8739	10	0.87932	D	0	-25.2689	15.61	0.76707	0.0:1.0:0.0:0.0	.	343	P11021	GRP78_HUMAN	H	343	ENSP00000324173:Q343H	ENSP00000324173:Q343H	Q	-	3	2	HSPA5	127040895	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.814000	0.86154	1.883000	0.54544	0.563000	0.77884	CAG	-	HMMPfam_HSP70		0.393	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA5	protein_coding	OTTHUMT00000054062.1	C			127040895	-1	no_errors	NM_005347	genbank	human	validated	54_36p	missense	SNP	1	A
BMX	660	genome.wustl.edu	37	X	15540592	15540592	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chrX:15540592A>C	ENST00000357607.2	+	7	822	c.634A>C	c.(634-636)Agt>Cgt	p.S212R	BMX_ENST00000342014.6_Missense_Mutation_p.S212R|BMX_ENST00000348343.6_Missense_Mutation_p.S212R			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	212					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)	p.S212R(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					TTCAAGTACCAGTCTAGCGCA	0.443																																																1	Substitution - Missense(1)	ovary(1)	X											134.0	112.0	119.0					X																	15540592		2203	4300	6503	15450513	SO:0001583	missense	660			AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.634A>C	X.37:g.15540592A>C	ENSP00000350224:p.Ser212Arg	Somatic		Capture	Illumina GAIIx	4	15450513	A6NIH9|O60564|Q12871	Missense_Mutation	SNP	SH2;HMMPfam_SH2;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;BTK;HMMPfam_BTK;PH;HMMPfam_PH;Protein kinase-like (PK-like);superfamily_Protein kinase-like (PK-like);PH domain-like;superfamily_PH domain-like;SH2 domain;superfamily_SH2 domain	p.S212R	ENST00000357607.2	37	c.634	CCDS14168.1	X	.	.	.	.	.	.	.	.	.	.	A	1.583	-0.531158	0.04112	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	T;T;T	0.75821	-0.97;-0.97;-0.97	0.235	0.235	0.15431	.	0.426324	0.23384	N	0.048765	T	0.50718	0.1632	N	0.08118	0	0.09310	N	1	P	0.39520	0.676	B	0.39706	0.307	T	0.50092	-0.8868	9	0.87932	D	0	.	.	.	.	.	212	P51813	BMX_HUMAN	R	212	ENSP00000350224:S212R;ENSP00000308774:S212R;ENSP00000340082:S212R	ENSP00000340082:S212R	S	+	1	0	BMX	15450513	0.247000	0.23920	0.025000	0.17156	0.053000	0.15095	0.011000	0.13264	0.245000	0.21373	0.242000	0.17961	AGT	-	NULL		0.443	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	BMX	protein_coding	OTTHUMT00000055877.1	A	NM_001721		15450513	1	no_errors	NM_001721	genbank	human	validated	54_36p	missense	SNP		C
MAP3K15	389840	genome.wustl.edu	37	X	19380909	19380910	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	AG	AG	AG	-	AG	AG	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chrX:19380909_19380910delAG	ENST00000338883.4	-	26	3624_3625	c.3625_3626delCT	c.(3625-3627)ctafs	p.L1209fs	MAP3K15_ENST00000359173.3_Frame_Shift_Del_p.L644fs|MAP3K15_ENST00000469203.2_Frame_Shift_Del_p.L1041fs|MAP3K15_ENST00000518578.1_5'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	1209							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.L684fs*33(1)		NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					TTTCTGTTCTAGAGTTTGCCGC	0.327																																																1	Deletion - Frameshift(1)	ovary(1)	X																																								19290831	SO:0001589	frameshift_variant	389840			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.3625_3626delCT	X.37:g.19380911_19380912delAG	ENSP00000345629:p.Leu1209fs	Somatic		Capture	Illumina GAIIx	4	19290830	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Frame_Shift_Del	DEL	Pkinase;HMMPfam_Pkinase	p.L684fs	ENST00000338883.4	37	c.2051_2050		X																																																																																			(deletion:cds_exon[19290777;19290889])	NULL		0.327	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	protein_coding		AG	NM_001001671		19290831	-1	no_errors	NM_001001671	genbank	human	validated	54_36p	frame_shift_del	DEL	0.287:0.230	-
CCNB3	85417	genome.wustl.edu	37	X	50051868	50051868	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chrX:50051868G>T	ENST00000376042.1	+	6	997	c.699G>T	c.(697-699)aaG>aaT	p.K233N	CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.K233N			Q8WWL7	CCNB3_HUMAN	cyclin B3	233					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)		p.K233N(2)		breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					CCTTAAAGAAGAAGATGTGTG	0.438																																																2	Substitution - Missense(2)	ovary(2)	X											74.0	69.0	70.0					X																	50051868		2203	4299	6502	50068608	SO:0001583	missense	85417			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.699G>T	X.37:g.50051868G>T	ENSP00000365210:p.Lys233Asn	Somatic		Capture	Illumina GAIIx	4	50068608	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	Cyclin_C;HMMPfam_Cyclin_C;Cyclin_N;HMMPfam_Cyclin_N	p.K233N	ENST00000376042.1	37	c.699	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	G	16.48	3.133828	0.56828	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.37235	1.21;1.21	3.61	0.661	0.17874	.	694.678000	0.00166	N	0.000000	T	0.34250	0.0891	M	0.61703	1.905	0.09310	N	1	B	0.21225	0.053	B	0.19666	0.026	T	0.08722	-1.0708	9	.	.	.	.	1.4601	0.02394	0.1315:0.2042:0.4371:0.2272	.	233	Q8WWL7	CCNB3_HUMAN	N	233	ENSP00000365210:K233N;ENSP00000276014:K233N	.	K	+	3	2	CCNB3	50068608	0.211000	0.23529	0.022000	0.16811	0.357000	0.29423	0.184000	0.16939	0.013000	0.14918	0.594000	0.82650	AAG	-	NULL		0.438	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	protein_coding	OTTHUMT00000056558.1	G			50068608	1	no_errors	NM_033031	genbank	human	reviewed	54_36p	missense	SNP	0.14	T
SH3BGRL	6451	genome.wustl.edu	37	X	80532536	80532536	+	Silent	SNP	A	A	G			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chrX:80532536A>G	ENST00000373212.5	+	2	357	c.99A>G	c.(97-99)ggA>ggG	p.G33G	SH3BGRL_ENST00000481106.1_3'UTR	NM_003022.2	NP_003013.1	O75368	SH3L1_HUMAN	SH3 domain binding glutamate-rich protein like	33					positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)	p.G33G(1)		endometrium(1)|lung(2)|ovary(1)	4		all_lung(315;5.94e-05)				ACAAAATAGGATTTGAAGAAA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	X											55.0	52.0	53.0					X																	80532536		2203	4300	6503	80419192	SO:0001819	synonymous_variant	6451			AF042081	CCDS14449.1	Xq13.3	2014-02-19	2014-02-19		ENSG00000131171	ENSG00000131171			10823	protein-coding gene	gene with protein product		300190	"""SH3 domain binding glutamic acid-rich protein like"""			9642120	Standard	NM_003022		Approved	MGC117402	uc004eef.3	O75368	OTTHUMG00000021910	ENST00000373212.5:c.99A>G	X.37:g.80532536A>G		Somatic		Capture	Illumina GAIIx	4	80419192	Q3SYL1|Q5JT50|Q6FIE8|Q9H0N8	Silent	SNP	-	p.G33	ENST00000373212.5	37	c.99	CCDS14449.1	X																																																																																			-	NULL		0.398	SH3BGRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BGRL	protein_coding	OTTHUMT00000057350.1	A	NM_003022		80419192	1	no_errors	NM_003022	genbank	human	validated	54_36p	silent	SNP	1	G
TSPAN6	7105	genome.wustl.edu	37	X	99888435	99888435	+	Silent	SNP	A	A	C			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chrX:99888435A>C	ENST00000373020.4	-	5	663	c.552T>G	c.(550-552)acT>acG	p.T184T	TSPAN6_ENST00000496771.1_5'UTR	NM_001278740.1|NM_001278741.1|NM_003270.2	NP_001265669.1|NP_001265670.1|NP_003261.1	O43657	TSN6_HUMAN	tetraspanin 6	184					negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of viral-induced cytoplasmic pattern recognition receptor signaling pathway (GO:0039532)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)	p.T184T(1)		endometrium(2)|kidney(3)|large_intestine(6)|ovary(1)	12						CTCTCTGTGGAGTACAATCTT	0.343																																																1	Substitution - coding silent(1)	ovary(1)	X											82.0	76.0	78.0					X																	99888435		2203	4300	6503	99775091	SO:0001819	synonymous_variant	7105			AF043906	CCDS14470.1, CCDS76001.1	Xq22	2013-02-14	2005-03-21	2005-03-21	ENSG00000000003	ENSG00000000003		"""Tetraspanins"""	11858	protein-coding gene	gene with protein product		300191	"""transmembrane 4 superfamily member 6"""	TM4SF6		9782095	Standard	NM_003270		Approved	T245, TSPAN-6	uc004ega.1	O43657	OTTHUMG00000022002	ENST00000373020.4:c.552T>G	X.37:g.99888435A>C		Somatic		Capture	Illumina GAIIx	4	99775091	Q54A42|Q6IAN9	Silent	SNP	HMMPfam_Tetraspannin;superfamily_Tetraspanin	p.T184	ENST00000373020.4	37	c.552	CCDS14470.1	X																																																																																			-	HMMPfam_Tetraspannin		0.343	TSPAN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN6	protein_coding	OTTHUMT00000057483.1	A			99775091	-1	no_errors	NM_003270	genbank	human	reviewed	54_36p	silent	SNP	0.29	C
NRK	203447	genome.wustl.edu	37	X	105132358	105132358	+	Silent	SNP	C	C	T			TCGA-13-1488-01A-01W-0549-09	TCGA-13-1488-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	886a8c10-63cf-4cb2-83d2-5a99bbda193d	ddb528a6-2be1-48e9-8a52-fc7dcbbb8201	g.chrX:105132358C>T	ENST00000243300.9	+	5	627	c.324C>T	c.(322-324)tcC>tcT	p.S108S	NRK_ENST00000428173.2_Silent_p.S108S|NRK_ENST00000536164.1_Silent_p.S108S	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	108	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.S108S(1)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						ACATTGTGTCCTTCTATGGAG	0.398										HNSCC(51;0.14)																																						1	Substitution - coding silent(1)	ovary(1)	X											111.0	91.0	98.0					X																	105132358		1897	4100	5997	105019014	SO:0001819	synonymous_variant	203447			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.324C>T	X.37:g.105132358C>T		Somatic		Capture	Illumina GAIIx	4	105019014	Q32ND6|Q5H9K2|Q6ZMP2	Silent	SNP	HMMPfam_Pkinase;superfamily_p53-like transcription factors;superfamily_Protein kinase-like (PK-like);Pkinase;CNH;HMMPfam_CNH	p.S108	ENST00000243300.9	37	c.324		X																																																																																			-	HMMPfam_Pkinase		0.398	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	protein_coding	OTTHUMT00000106480.6	C	NM_198465		105019014	1	no_errors	ENST00000243300	ensembl	human	known	54_36p	silent	SNP	0.98	T
