#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
DENND2D	79961	genome.wustl.edu	37	1	111742270	111742270	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr1:111742270G>T	ENST00000357640.4	-	2	447	c.218C>A	c.(217-219)cCt>cAt	p.P73H	DENND2D_ENST00000369752.5_Missense_Mutation_p.P70H|CHI3L2_ENST00000445067.2_5'Flank|DENND2D_ENST00000473682.1_5'UTR	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	73	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.P73H(1)		breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		GGTGATTATAGGCTCGTAATC	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											119.0	125.0	123.0					1																	111742270		2203	4300	6503	111543793	SO:0001583	missense	79961				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.218C>A	1.37:g.111742270G>T	ENSP00000350266:p.Pro73His	Somatic		Capture	Illumina GAIIx	4	111543793	Q5T5V6|Q9BSU0	Missense_Mutation	SNP	-	p.P73H	ENST00000357640.4	37	c.218	CCDS831.1	1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.947048	0.73672	.	.	ENSG00000162777	ENST00000357640;ENST00000369752	T;T	0.61392	0.11;0.11	5.93	5.93	0.95920	uDENN (3);	0.054688	0.85682	D	0.000000	T	0.77177	0.4092	M	0.87682	2.9	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80174	-0.1492	10	0.87932	D	0	-18.668	17.825	0.88662	0.0:0.0:1.0:0.0	.	70;73	Q9H6A0-2;Q9H6A0	.;DEN2D_HUMAN	H	73;70	ENSP00000350266:P73H;ENSP00000358767:P70H	ENSP00000350266:P73H	P	-	2	0	DENND2D	111543793	1.000000	0.71417	0.998000	0.56505	0.352000	0.29268	7.376000	0.79658	2.797000	0.96272	0.655000	0.94253	CCT	-	NULL		0.527	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND2D	protein_coding	OTTHUMT00000034456.1	G	NM_024901		111543793	-1	no_errors	NM_024901	genbank	human	provisional	54_36p	missense	SNP	1	T
MOV10	4343	genome.wustl.edu	37	1	113232556	113232556	+	Silent	SNP	G	G	A	rs138014327		TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr1:113232556G>A	ENST00000413052.2	+	5	1062	c.672G>A	c.(670-672)tcG>tcA	p.S224S	MOV10_ENST00000357443.2_Silent_p.S224S|MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369644.1_Silent_p.S168S|MOV10_ENST00000369645.1_Silent_p.S224S	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	224					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.S224S(2)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		CTGGGGAGTCGGGTTCAGAAG	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		18338	0.0		0.0	False		,,,				2504	0.001															2	Substitution - coding silent(2)	ovary(1)|skin(1)	1						G	,	1,4405	2.1+/-5.4	0,1,2202	73.0	76.0	75.0		672,672	-10.5	0.0	1	dbSNP_134	75	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	MOV10	NM_001130079.1,NM_020963.3	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	224/1004,224/1004	113232556	1,13005	2203	4300	6503	113034079	SO:0001819	synonymous_variant	4343			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.672G>A	1.37:g.113232556G>A		Somatic		Capture	Illumina GAIIx	4	113034079	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Silent	SNP	-	p.S224	ENST00000413052.2	37	c.672	CCDS853.1	1																																																																																			-	NULL		0.592	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOV10	protein_coding	OTTHUMT00000032906.1	G	NM_020963		113034079	1	no_errors	NM_020963	genbank	human	validated	54_36p	silent	SNP		A
HIST2H2AB	317772	genome.wustl.edu	37	1	149859164	149859164	+	Silent	SNP	G	G	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr1:149859164G>T	ENST00000331128.3	-	1	302	c.303C>A	c.(301-303)gtC>gtA	p.V101V	BOLA1_ENST00000369153.2_5'Flank|HIST2H2BE_ENST00000369155.2_5'Flank	NM_175065.2	NP_778235.1	Q8IUE6	H2A2B_HUMAN	histone cluster 2, H2ab	101						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V101V(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GGGCAATGGTGACACCCCCGA	0.552																																																1	Substitution - coding silent(1)	ovary(1)	1											113.0	105.0	108.0					1																	149859164		2203	4300	6503	148125788	SO:0001819	synonymous_variant	317772			AY131972	CCDS938.1	1q21.2	2011-01-27	2006-10-11		ENSG00000184270	ENSG00000184270		"""Histones / Replication-dependent"""	20508	protein-coding gene	gene with protein product		615014	"""histone 2, H2ab"""			12408966	Standard	NM_175065		Approved		uc001ete.3	Q8IUE6	OTTHUMG00000012085	ENST00000331128.3:c.303C>A	1.37:g.149859164G>T		Somatic		Capture	Illumina GAIIx	4	148125788		Silent	SNP	-	p.V101	ENST00000331128.3	37	c.303	CCDS938.1	1																																																																																			-	NULL		0.552	HIST2H2AB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2AB	protein_coding	OTTHUMT00000033440.1	G	NM_175065		148125788	-1	no_errors	NM_175065	genbank	human	reviewed	54_36p	silent	SNP	1	T
FLG2	388698	genome.wustl.edu	37	1	152328934	152328934	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr1:152328934T>A	ENST00000388718.5	-	3	1400	c.1328A>T	c.(1327-1329)gAa>gTa	p.E443V	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	443	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.E443V(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TACATGTTGTTCGAACCCAGA	0.448																																																1	Substitution - Missense(1)	ovary(1)	1											169.0	161.0	164.0					1																	152328934		2203	4300	6503	150595558	SO:0001583	missense	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1328A>T	1.37:g.152328934T>A	ENSP00000373370:p.Glu443Val	Somatic		Capture	Illumina GAIIx	4	150595558	Q9H4U1	Missense_Mutation	SNP	-	p.E443V	ENST00000388718.5	37	c.1328	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	T	7.373	0.627210	0.14257	.	.	ENSG00000143520	ENST00000388718	T	0.19532	2.14	2.88	-2.47	0.06442	.	.	.	.	.	T	0.02970	0.0088	N	0.22421	0.69	0.09310	N	1	P	0.38978	0.652	B	0.30251	0.113	T	0.33777	-0.9855	9	0.31617	T	0.26	.	7.3158	0.26499	0.0:0.6944:0.0:0.3056	.	443	Q5D862	FILA2_HUMAN	V	443	ENSP00000373370:E443V	ENSP00000373370:E443V	E	-	2	0	FLG2	150595558	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.692000	0.05127	-0.939000	0.03709	-0.366000	0.07423	GAA	-	NULL		0.448	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	protein_coding	OTTHUMT00000034018.5	T	NM_001014342		150595558	-1	no_errors	NM_001014342	genbank	human	provisional	54_36p	missense	SNP		A
IQGAP3	128239	genome.wustl.edu	37	1	156521875	156521875	+	Silent	SNP	G	G	C			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr1:156521875G>C	ENST00000361170.2	-	14	1471	c.1461C>G	c.(1459-1461)gcC>gcG	p.A487A		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	487					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.A487A(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ATTTCAGCAGGGCATCGAAGT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	1											94.0	75.0	81.0					1																	156521875		2203	4300	6503	154788499	SO:0001819	synonymous_variant	128239			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.1461C>G	1.37:g.156521875G>C		Somatic		Capture	Illumina GAIIx	4	154788499	Q5T3H8	Silent	SNP	-	p.A487	ENST00000361170.2	37	c.1461	CCDS1144.1	1																																																																																			-	NULL		0.542	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	protein_coding	OTTHUMT00000080657.1	G	NM_178229		154788499	-1	no_errors	NM_178229	genbank	human	validated	54_36p	silent	SNP	0.95	C
FCRL1	115350	genome.wustl.edu	37	1	157773774	157773774	+	Silent	SNP	G	G	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr1:157773774G>A	ENST00000368176.3	-	3	247	c.180C>T	c.(178-180)gcC>gcT	p.A60A	FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000491942.1_Silent_p.A60A|FCRL1_ENST00000358292.3_Silent_p.A60A	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	60	Ig-like C2-type 1.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A60A(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CTGGGCCCAAGGCCCGGGTGT	0.577																																					GBM(54;482 1003 11223 30131 35730)											1	Substitution - coding silent(1)	ovary(1)	1											80.0	84.0	83.0					1																	157773774		2203	4300	6503	156040398	SO:0001819	synonymous_variant	115350			BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.180C>T	1.37:g.157773774G>A		Somatic		Capture	Illumina GAIIx	4	156040398	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Silent	SNP	-	p.A60	ENST00000368176.3	37	c.180	CCDS1170.1	1																																																																																			-	NULL		0.577	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	protein_coding	OTTHUMT00000051401.1	G	NM_052938		156040398	-1	no_errors	NM_052938	genbank	human	provisional	54_36p	silent	SNP		A
ACKR1	2532	genome.wustl.edu	37	1	159175594	159175607	+	Frame_Shift_Del	DEL	GCACTCGCAGCTCT	GCACTCGCAGCTCT	-	rs200879437|rs529272627|rs563566546	byFrequency	TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	GCACTCGCAGCTCT	GCACTCGCAGCTCT	GCACTCGCAGCTCT	-	GCACTCGCAGCTCT	GCACTCGCAGCTCT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr1:159175594_159175607delGCACTCGCAGCTCT	ENST00000368122.2	+	2	1044_1057	c.365_378delGCACTCGCAGCTCT	c.(364-378)agcactcgcagctctfs	p.STRSS122fs	CTA-134P22.2_ENST00000609696.1_RNA|DARC_ENST00000368121.2_Frame_Shift_Del_p.STRSS124fs|DARC_ENST00000537147.1_Frame_Shift_Del_p.STRSS122fs	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		122					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.T123fs*3(1)|p.S124R(1)		large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					GGGCTAGGTAGCACTCGCAGCTCTGCCCTGTGTA	0.65																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|lung(1)	1																																								157442231	SO:0001589	frameshift_variant	2532																														ENST00000368122.2:c.365_378delGCACTCGCAGCTCT	1.37:g.159175594_159175607delGCACTCGCAGCTCT	ENSP00000357104:p.Ser122fs	Somatic		Capture	Illumina GAIIx	4	157442218	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Frame_Shift_Del	DEL	-	p.T123fs	ENST00000368122.2	37	c.365_378	CCDS1183.1	1																																																																																			(deletion:cds_exon[157441875;157442864])	NULL		0.650	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARC	protein_coding	OTTHUMT00000090338.2	GCACTCGCAGCTCT			157442231	1	no_errors	NM_002036	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
EPHB2	2048	genome.wustl.edu	37	1	23240153	23240153	+	Silent	SNP	C	C	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr1:23240153C>A	ENST00000400191.3	+	17	2976	c.2958C>A	c.(2956-2958)ggC>ggA	p.G986G	EPHB2_ENST00000374632.3_3'UTR|EPHB2_ENST00000374630.3_3'UTR|EPHB2_ENST00000374627.1_3'UTR	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	986					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)	p.G986G(1)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CACTGCAGGGCCAGCCACTCG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	1											22.0	27.0	25.0					1																	23240153		1567	3580	5147	23112740	SO:0001819	synonymous_variant	2048			AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.2958C>A	1.37:g.23240153C>A		Somatic		Capture	Illumina GAIIx	4	23112740	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Silent	SNP	HMMPfam_Ephrin_lbd,HMMPfam_Pkinase_Tyr,HMMPfam_SAM_1,HMMPfam_fn3,superfamily_Fibronectin type III,superfamily_Galactose-binding domain-like,superfamily_Growth factor receptor domain,superfamily_SAM/Pointed domain,superfamily_Protein kinase-like (PK-like)	p.G986	ENST00000400191.3	37	c.2958		1																																																																																			-	NULL		0.617	EPHB2-001	KNOWN	basic	protein_coding	EPHB2	protein_coding	OTTHUMT00000008060.2	C	NM_017449		23112740	1	no_errors	ENST00000374630	ensembl	human	known	54_36p	silent	SNP	0.661	A
ENAH	55740	genome.wustl.edu	37	1	225702312	225702312	+	Silent	SNP	T	T	G			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr1:225702312T>G	ENST00000366844.3	-	7	1655	c.1204A>C	c.(1204-1206)Agg>Cgg	p.R402R	ENAH_ENST00000284563.6_Silent_p.R649R|ENAH_ENST00000366843.2_Silent_p.R402R	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	402	EVH2 block A.|EVH2.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)	p.R402R(1)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		GACACTTTCCTAAGTTTTGCT	0.368																																																1	Substitution - coding silent(1)	ovary(1)	1											47.0	50.0	49.0					1																	225702312		2200	4289	6489	223768935	SO:0001819	synonymous_variant	55740			AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.1204A>C	1.37:g.225702312T>G		Somatic		Capture	Illumina GAIIx	4	223768935	D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	Silent	SNP	HMMPfam_WH1;HMMPfam_VASP_tetra;superfamily_PH domain-like	p.R402	ENST00000366844.3	37	c.1204	CCDS31041.1	1																																																																																			-	NULL		0.368	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENAH	protein_coding	OTTHUMT00000357426.2	T	NM_018212		223768935	-1	no_errors	NM_001008493	genbank	human	validated	54_36p	silent	SNP	0.99	G
KIF26B	55083	genome.wustl.edu	37	1	245809581	245809584	+	Splice_Site	DEL	AAGT	AAGT	-			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	AAGT	AAGT	AAGT	-	AAGT	AAGT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr1:245809581_245809584delAAGT	ENST00000407071.2	+	10	2697_2698	c.2257_2258delAAGT	c.(2257-2259)aag>g	p.K753fs	KIF26B_ENST00000366518.4_Splice_Site_p.K372fs	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	753	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CATTCCATACAAGTAAGTGACTCT	0.52																																																0			1																																								243876207	SO:0001630	splice_region_variant	55083			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.2258+1AAGT>-	1.37:g.245809585_245809588delAAGT		Somatic		Capture	Illumina GAIIx	4	243876204	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Frame_Shift_Del	DEL	-	p.K753fs	ENST00000407071.2	37	c.2257_2258	CCDS44342.1	1																																																																																			(deletion:cds_exon[243876046;243876205]; intron[243876206;243914157])	NULL		0.520	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	protein_coding	OTTHUMT00000381037.1	AAGT	XM_371354	Frame_Shift_Del	243876207	1	no_errors	NM_018012	genbank	human	provisional	54_36p	frame_shift_del	DEL	1.000:1.000	-
SPOCD1	90853	genome.wustl.edu	37	1	32265458	32265458	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr1:32265458G>C	ENST00000360482.2	-	6	1864	c.1735C>G	c.(1735-1737)Cca>Gca	p.P579A	SPOCD1_ENST00000373648.2_Missense_Mutation_p.P520A|SPOCD1_ENST00000257100.3_Missense_Mutation_p.P72A|SPOCD1_ENST00000533231.1_Missense_Mutation_p.P579A	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	579					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)			p.P579A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		GCCTCCATTGGGCCACTCTGT	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											56.0	56.0	56.0					1																	32265458		2203	4300	6503	32038045	SO:0001583	missense	90853			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.1735C>G	1.37:g.32265458G>C	ENSP00000353670:p.Pro579Ala	Somatic		Capture	Illumina GAIIx	4	32038045	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	-	p.P579A	ENST00000360482.2	37	c.1735	CCDS347.1	1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.938507	0.52972	.	.	ENSG00000134668	ENST00000257100;ENST00000360482;ENST00000373648;ENST00000533231;ENST00000528791	T;T;T;T	0.47528	0.84;1.77;0.88;1.79	3.95	2.05	0.26809	.	.	.	.	.	T	0.28732	0.0712	L	0.27053	0.805	0.09310	N	1	B;B	0.23891	0.093;0.056	B;B	0.19666	0.026;0.012	T	0.20174	-1.0283	9	0.16896	T	0.51	0.0439	5.4537	0.16578	0.1176:0.2415:0.6409:0.0	.	579;579	Q6ZMY3-2;Q6ZMY3	.;SPOC1_HUMAN	A	72;579;520;579;72	ENSP00000257100:P72A;ENSP00000353670:P579A;ENSP00000362752:P520A;ENSP00000435851:P579A	ENSP00000257100:P72A	P	-	1	0	SPOCD1	32038045	0.002000	0.14202	0.001000	0.08648	0.320000	0.28249	0.895000	0.28363	0.612000	0.30071	0.551000	0.68910	CCA	-	NULL		0.622	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCD1	protein_coding	OTTHUMT00000381912.1	G	NM_144569		32038045	-1	no_errors	NM_144569	genbank	human	provisional	54_36p	missense	SNP		C
ANK3	288	genome.wustl.edu	37	10	61831615	61831615	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr10:61831615G>C	ENST00000280772.2	-	37	9215	c.9024C>G	c.(9022-9024)caC>caG	p.H3008Q	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3008					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.H3008Q(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TAGAATTAAAGTGCTGTGTCT	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											52.0	54.0	53.0					10																	61831615		2203	4300	6503	61501621	SO:0001583	missense	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.9024C>G	10.37:g.61831615G>C	ENSP00000280772:p.His3008Gln	Somatic		Capture	Illumina GAIIx	4	61501621	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	HMMPfam_Death;HMMPfam_ZU5;HMMPfam_Ank;superfamily_Ankyrin repeat;superfamily_DEATH domain	p.H3008Q	ENST00000280772.2	37	c.9024	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	G	6.484	0.457506	0.12342	.	.	ENSG00000151150	ENST00000280772	T	0.62364	0.03	5.54	3.64	0.41730	.	0.328233	0.22130	N	0.064214	T	0.34542	0.0901	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.10520	-1.0626	10	0.19147	T	0.46	.	5.1782	0.15146	0.1953:0.2176:0.5871:0.0	.	3008	Q12955	ANK3_HUMAN	Q	3008	ENSP00000280772:H3008Q	ENSP00000280772:H3008Q	H	-	3	2	ANK3	61501621	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.165000	0.31822	1.355000	0.45865	0.462000	0.41574	CAC	-	NULL		0.393	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	protein_coding	OTTHUMT00000048201.4	G	NM_020987		61501621	-1	no_errors	NM_020987	genbank	human	reviewed	54_36p	missense	SNP	0.14	C
KAT6B	23522	genome.wustl.edu	37	10	76789435	76789435	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr10:76789435G>T	ENST00000287239.4	+	18	5342	c.4853G>T	c.(4852-4854)aGt>aTt	p.S1618I	KAT6B_ENST00000372714.1_Missense_Mutation_p.S1326I|KAT6B_ENST00000372725.1_Missense_Mutation_p.S1326I|KAT6B_ENST00000372711.1_Missense_Mutation_p.S1435I|KAT6B_ENST00000372724.1_Missense_Mutation_p.S1326I	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1618	Interaction with RUNX1 and RUNX2.|Ser-rich.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.S1618I(1)									AACAGCCCAAGTGTCCCTGCT	0.552																																																1	Substitution - Missense(1)	ovary(1)	10											172.0	143.0	153.0					10																	76789435		2203	4300	6503	76459441	SO:0001583	missense	23522			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.4853G>T	10.37:g.76789435G>T	ENSP00000287239:p.Ser1618Ile	Somatic		Capture	Illumina GAIIx	4	76459441	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	"PHD;HMMPfam_PHD;MOZ_SAS;HMMPfam_MOZ_SAS;FYVE/PHD zinc finger;superfamily_FYVE/PHD zinc finger;""Winged helix"" DNA-binding domain;superfamily_""Winged helix"" DNA-binding domain;Acyl-CoA N-acyltransferases (Nat);superfamily_Acyl-CoA N-acyltransferases (Nat)"	p.S1618I	ENST00000287239.4	37	c.4853	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	G	8.446	0.852070	0.17034	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	T;T;T;T;T	0.78816	-1.2;-1.2;-1.21;-1.2;-1.2	4.7	3.73	0.42828	.	0.119652	0.38058	N	0.001824	T	0.57242	0.2040	N	0.08118	0	0.33942	D	0.643332	P;B;B	0.49090	0.919;0.144;0.417	B;B;B	0.43052	0.406;0.118;0.239	T	0.69446	-0.5143	10	0.87932	D	0	-8.0448	6.1539	0.20326	0.1332:0.1912:0.6756:0.0	.	1435;1326;1618	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	I	1326;1326;1618;1326;1435	ENSP00000361810:S1326I;ENSP00000361809:S1326I;ENSP00000287239:S1618I;ENSP00000361799:S1326I;ENSP00000361796:S1435I	ENSP00000287239:S1618I	S	+	2	0	KAT6B	76459441	0.686000	0.27661	0.998000	0.56505	0.985000	0.73830	2.447000	0.44917	2.154000	0.67381	0.563000	0.77884	AGT	-	NULL		0.552	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYST4	protein_coding	OTTHUMT00000048771.1	G	NM_012330		76459441	1	no_errors	NM_012330	genbank	human	validated	54_36p	missense	SNP	0.94	T
ALG9	79796	genome.wustl.edu	37	11	111724117	111724117	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr11:111724117C>T	ENST00000531154.1	-	8	840	c.368G>A	c.(367-369)gGa>gAa	p.G123E	ALG9_ENST00000398006.2_Missense_Mutation_p.G123E|ALG9_ENST00000524880.1_3'UTR|ALG9_ENST00000527228.1_5'UTR	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	294					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)	p.G123E(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		AAGATCAGGTCCATGAGGAGT	0.393																																																1	Substitution - Missense(1)	ovary(1)	11											94.0	79.0	84.0					11																	111724117		1885	4108	5993	111229327	SO:0001583	missense	79796				CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.368G>A	11.37:g.111724117C>T	ENSP00000435517:p.Gly123Glu	Somatic		Capture	Illumina GAIIx	4	111229327	Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Nonsense_Mutation	SNP	-	p.W294*	ENST00000531154.1	37	c.882	CCDS41714.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.292508	0.95546	.	.	ENSG00000086848	ENST00000531154;ENST00000398006;ENST00000428306	T;T	0.63580	-0.05;-0.05	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.81278	0.4789	M	0.79258	2.445	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.991;1.0;0.999	T	0.80659	-0.1284	10	0.56958	D	0.05	-14.7141	20.5407	0.99260	0.0:1.0:0.0:0.0	.	123;294;527;294	B4DQI3;Q9H6U8-3;B4DYW0;Q9H6U8	.;.;.;ALG9_HUMAN	E	123;123;527	ENSP00000435517:G123E;ENSP00000381090:G123E	ENSP00000381090:G123E	G	-	2	0	ALG9	111229327	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.796000	0.85898	2.865000	0.98341	0.655000	0.94253	GGA	-	NULL		0.393	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALG9	protein_coding	OTTHUMT00000391485.1	C	NM_024740		111229327	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_024740	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
HIPK3	10114	genome.wustl.edu	37	11	33358691	33358692	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	GA	GA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr11:33358691_33358692GA>TT	ENST00000303296.4	+	4	1597_1598	c.1292_1293GA>TT	c.(1291-1293)aGA>aTT	p.R431I	HIPK3_ENST00000379016.3_Missense_Mutation_p.R431I|HIPK3_ENST00000525975.1_Missense_Mutation_p.R431I|HIPK3_ENST00000456517.1_Missense_Mutation_p.R431I|HIPK3_ENST00000534262.1_3'UTR	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	431	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R431I(1)		endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						AAATCCACAAGATTTTTTTGCA	0.312																																																1	Substitution - Missense(1)	ovary(1)	11																																								33315268	SO:0001583	missense	10114			AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	Exception_encountered	11.37:g.33358691_33358692delinsTT	ENSP00000304226:p.Arg431Ile	Somatic		Capture	Illumina GAIIx	4	33315267	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	DNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.R431I	ENST00000303296.4	37	c.1292_1293	CCDS7884.1	11																																																																																			-	HMMPfam_Pkinase		0.312	HIPK3-001	KNOWN	basic|CCDS	protein_coding	HIPK3	protein_coding	OTTHUMT00000255358.1	GA	NM_005734		33315268	1	no_errors	NM_005734	genbank	human	validated	54_36p	missense	DNP	1.000:1.000	TT
PEX16	9409	genome.wustl.edu	37	11	45935878	45935878	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr11:45935878G>A	ENST00000378750.5	-	7	926	c.683C>T	c.(682-684)cCg>cTg	p.P228L	PEX16_ENST00000532554.1_5'UTR|PEX16_ENST00000532681.1_Missense_Mutation_p.P133L|PEX16_ENST00000241041.3_Missense_Mutation_p.P228L			Q9Y5Y5	PEX16_HUMAN	peroxisomal biogenesis factor 16	228	Interaction with PEX19.				ER-dependent peroxisome organization (GO:0032581)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)|protein localization to endoplasmic reticulum (GO:0070972)|protein targeting to peroxisome (GO:0006625)|protein to membrane docking (GO:0022615)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)	p.P228L(1)		large_intestine(2)|lung(2)|ovary(2)|skin(1)	7				GBM - Glioblastoma multiforme(35;0.223)		GTGCAGCAGCGGCCGGGCAAT	0.652																																																1	Substitution - Missense(1)	ovary(1)	11											39.0	47.0	44.0					11																	45935878		2203	4299	6502	45892454	SO:0001583	missense	9409			AF118240	CCDS7917.1, CCDS31472.1	11p	2007-12-14			ENSG00000121680	ENSG00000121680			8857	protein-coding gene	gene with protein product		603360				9922452	Standard	NM_057174		Approved		uc001nbt.3	Q9Y5Y5	OTTHUMG00000167005	ENST00000378750.5:c.683C>T	11.37:g.45935878G>A	ENSP00000368024:p.Pro228Leu	Somatic		Capture	Illumina GAIIx	4	45892454	Q9BWB9	Missense_Mutation	SNP	HMMPfam_Pex16	p.P228L	ENST00000378750.5	37	c.683	CCDS31472.1	11	.	.	.	.	.	.	.	.	.	.	G	28.7	4.942584	0.92526	.	.	ENSG00000121680	ENST00000241041;ENST00000378750;ENST00000532681;ENST00000533151;ENST00000525192	T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.81800	0.4899	M	0.89840	3.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85099	0.0956	10	0.87932	D	0	-36.6756	19.6428	0.95764	0.0:0.0:1.0:0.0	.	228;228	Q9Y5Y5;Q9Y5Y5-2	PEX16_HUMAN;.	L	228;228;133;124;133	ENSP00000241041:P228L;ENSP00000368024:P228L;ENSP00000434654:P133L;ENSP00000433045:P124L;ENSP00000431309:P133L	ENSP00000241041:P228L	P	-	2	0	PEX16	45892454	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	9.219000	0.95173	2.645000	0.89757	0.549000	0.68633	CCG	-	HMMPfam_Pex16		0.652	PEX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX16	protein_coding	OTTHUMT00000392398.1	G	NM_057174		45892454	-1	no_errors	NM_057174	genbank	human	reviewed	54_36p	missense	SNP	1	A
OR5B21	219968	genome.wustl.edu	37	11	58275168	58275168	+	Silent	SNP	A	A	G			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr11:58275168A>G	ENST00000360374.2	-	1	410	c.411T>C	c.(409-411)ggT>ggC	p.G137G		NM_001005218.1	NP_001005218.1	A6NL26	OR5BL_HUMAN	olfactory receptor, family 5, subfamily B, member 21	137						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G137G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GGGCACACACACCTGCTGTCA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	11											121.0	97.0	105.0					11																	58275168		2201	4295	6496	58031744	SO:0001819	synonymous_variant	219968				CCDS31552.1	11q12.1	2012-08-09			ENSG00000198283	ENSG00000198283		"""GPCR / Class A : Olfactory receptors"""	19616	protein-coding gene	gene with protein product							Standard	NM_001005218		Approved		uc010rki.2	A6NL26	OTTHUMG00000167519	ENST00000360374.2:c.411T>C	11.37:g.58275168A>G		Somatic		Capture	Illumina GAIIx	4	58031744		Silent	SNP	-	p.G137	ENST00000360374.2	37	c.411	CCDS31552.1	11																																																																																			-	NULL		0.537	OR5B21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B21	protein_coding	OTTHUMT00000394891.1	A	NM_001005218		58031744	-1	no_errors	NM_001005218	genbank	human	provisional	54_36p	silent	SNP		G
SNX19	399979	genome.wustl.edu	37	11	130785048	130785048	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr11:130785048C>A	ENST00000265909.4	-	1	1356	c.787G>T	c.(787-789)Gta>Tta	p.V263L	SNX19_ENST00000530356.1_Intron|SNX19_ENST00000533214.1_Missense_Mutation_p.V263L|SNX19_ENST00000539184.1_Intron|SNX19_ENST00000528555.1_Intron|SNX19_ENST00000533318.1_Intron	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	263	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.V263L(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		CCCACGAGTACAAGGTGGATC	0.552																																																1	Substitution - Missense(1)	ovary(1)	11											82.0	85.0	84.0					11																	130785048		2201	4297	6498	130290258	SO:0001583	missense	399979			D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.787G>T	11.37:g.130785048C>A	ENSP00000265909:p.Val263Leu	Somatic		Capture	Illumina GAIIx	4	130290258	E9PKB9|Q8IV55	Missense_Mutation	SNP	HMMPfam_PX;HMMPfam_PXA;HMMPfam_Nexin_C;superfamily_PX domain	p.V263L	ENST00000265909.4	37	c.787	CCDS31721.1	11	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.457839	0.01071	.	.	ENSG00000120451	ENST00000265909;ENST00000533214	T;T	0.11385	3.24;2.78	5.58	-6.53	0.01866	Phox-associated domain (2);PX-associated, sorting nexin 13 (1);	1.189490	0.05759	N	0.604638	T	0.04588	0.0125	N	0.21142	0.635	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.12837	0.008;0.008	T	0.41928	-0.9481	10	0.02654	T	1	-0.1183	3.5024	0.07677	0.0804:0.2641:0.2425:0.413	.	263;263	E9PKB9;Q92543	.;SNX19_HUMAN	L	263	ENSP00000265909:V263L;ENSP00000435390:V263L	ENSP00000265909:V263L	V	-	1	0	SNX19	130290258	0.002000	0.14202	0.001000	0.08648	0.312000	0.27988	-0.482000	0.06544	-1.347000	0.02208	-0.355000	0.07637	GTA	-	HMMPfam_PXA		0.552	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX19	protein_coding	OTTHUMT00000385649.1	C	NM_014758		130290258	-1	no_errors	NM_014758	genbank	human	validated	54_36p	missense	SNP		A
SLC38A1	81539	genome.wustl.edu	37	12	46594968	46594968	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr12:46594968T>C	ENST00000398637.5	-	13	1610	c.916A>G	c.(916-918)Aaa>Gaa	p.K306E	SLC38A1_ENST00000552197.1_Missense_Mutation_p.K306E|SLC38A1_ENST00000546893.1_Missense_Mutation_p.K306E|SLC38A1_ENST00000549049.1_Missense_Mutation_p.K306E|SLC38A1_ENST00000549633.1_5'UTR|SLC38A1_ENST00000439706.1_Missense_Mutation_p.K306E	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	306					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)	p.K306E(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			ATCTGCATTTTTTTCTGTGAT	0.294																																																1	Substitution - Missense(1)	ovary(1)	12											53.0	49.0	50.0					12																	46594968		1805	4072	5877	44881235	SO:0001583	missense	81539			AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.916A>G	12.37:g.46594968T>C	ENSP00000381634:p.Lys306Glu	Somatic		Capture	Illumina GAIIx	4	44881235	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	-	p.K306E	ENST00000398637.5	37	c.916	CCDS41774.1	12	.	.	.	.	.	.	.	.	.	.	T	23.5	4.420152	0.83559	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197	T;T;T;T;T	0.02395	4.31;4.31;4.31;4.31;4.31	5.67	5.67	0.87782	.	0.161948	0.43579	D	0.000552	T	0.08758	0.0217	L	0.49455	1.56	0.37836	D	0.928874	P;P;P	0.47604	0.898;0.486;0.741	P;B;P	0.53035	0.716;0.185;0.507	T	0.02942	-1.1091	10	0.87932	D	0	-14.7293	15.92	0.79556	0.0:0.0:0.0:1.0	.	306;306;306	B5MEC5;F8VX04;Q9H2H9	.;.;S38A1_HUMAN	E	306	ENSP00000449607:K306E;ENSP00000398142:K306E;ENSP00000381634:K306E;ENSP00000447853:K306E;ENSP00000449756:K306E	ENSP00000381634:K306E	K	-	1	0	SLC38A1	44881235	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.837000	0.62796	2.159000	0.67721	0.455000	0.32223	AAA	-	NULL		0.294	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A1	protein_coding	OTTHUMT00000404218.2	T			44881235	-1	no_errors	NM_001077484	genbank	human	validated	54_36p	missense	SNP	1	C
ERBB3	2065	genome.wustl.edu	37	12	56487166	56487166	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr12:56487166G>A	ENST00000267101.3	+	12	1752	c.1312G>A	c.(1312-1314)Gtc>Atc	p.V438I	ERBB3_ENST00000553131.1_5'Flank|ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000415288.2_Missense_Mutation_p.V379I	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	438					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.V438I(1)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GAACTTGAATGTCACATCTCT	0.453																																																1	Substitution - Missense(1)	ovary(1)	12											101.0	105.0	104.0					12																	56487166		2203	4300	6503	54773433	SO:0001583	missense	2065			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1312G>A	12.37:g.56487166G>A	ENSP00000267101:p.Val438Ile	Somatic		Capture	Illumina GAIIx	4	54773433	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	superfamily_Growth factor receptor domain;superfamily_Protein kinase-like (PK-like);superfamily_L domain-like;Recep_L_domain;HMMPfam_Recep_L_domain;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;Furin-like;HMMPfam_Furin-like	p.V438I	ENST00000267101.3	37	c.1312	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	G	5.854	0.341715	0.11069	.	.	ENSG00000065361	ENST00000267101;ENST00000415288	T;T	0.39229	1.09;1.09	5.16	3.14	0.36123	EGF receptor, L domain (1);	0.518768	0.17370	N	0.176711	T	0.12008	0.0292	N	0.00823	-1.155	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.24728	-1.0152	10	0.02654	T	1	.	9.0894	0.36601	0.1623:0.0:0.8377:0.0	.	438;438	B4DGQ7;P21860	.;ERBB3_HUMAN	I	438;379	ENSP00000267101:V438I;ENSP00000408340:V379I	ENSP00000267101:V438I	V	+	1	0	ERBB3	54773433	0.343000	0.24818	0.982000	0.44146	0.997000	0.91878	0.736000	0.26130	0.542000	0.28846	0.655000	0.94253	GTC	-	HMMPfam_Recep_L_domain		0.453	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	protein_coding	OTTHUMT00000407619.3	G			54773433	1	no_errors	NM_001982	genbank	human	reviewed	54_36p	missense	SNP	0.82	A
RB1	5925	genome.wustl.edu	37	13	49033967	49033967	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr13:49033967C>A	ENST00000267163.4	+	20	2242	c.2104C>A	c.(2104-2106)Caa>Aaa	p.Q702K		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	702	Domain B.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(12)|p.Q702*(2)|p.Q702K(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GCATTTGGACCAAGTAAGAAA	0.398		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	30	Whole gene deletion(15)|Unknown(12)|Substitution - Nonsense(2)|Substitution - Missense(1)	bone(10)|breast(6)|haematopoietic_and_lymphoid_tissue(4)|urinary_tract(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|central_nervous_system(1)|endometrium(1)|lung(1)|ovary(1)|liver(1)	13	GRCh37	CM030513	RB1	M							71.0	64.0	67.0					13																	49033967		2203	4300	6503	47931968	SO:0001583	missense	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2104C>A	13.37:g.49033967C>A	ENSP00000267163:p.Gln702Lys	Somatic		Capture	Illumina GAIIx	4	47931968	A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	RB_B;HMMPfam_RB_B;RB_A;HMMPfam_RB_A;Rb_C;HMMPfam_Rb_C	p.Q702K	ENST00000267163.4	37	c.2104	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	29.4	5.002429	0.93227	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.94184	-3.37	5.48	5.48	0.80851	Retinoblastoma-associated protein, B-box (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	D	0.97642	0.9227	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98358	1.0547	10	0.87932	D	0	-8.7392	19.3477	0.94372	0.0:1.0:0.0:0.0	.	702	P06400	RB_HUMAN	K	681;702	ENSP00000267163:Q702K	ENSP00000267163:Q702K	Q	+	1	0	RB1	47931968	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.487000	0.81328	2.581000	0.87130	0.585000	0.79938	CAA	-	HMMPfam_RB_B		0.398	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	C			47931968	1	no_errors	NM_000321	genbank	human	reviewed	54_36p	missense	SNP	1	A
PCDH9	5101	genome.wustl.edu	37	13	66879068	66879068	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr13:66879068G>A	ENST00000377865.2	-	4	3567	c.3433C>T	c.(3433-3435)Cct>Tct	p.P1145S	PCDH9_ENST00000456367.1_Missense_Mutation_p.P1111S|PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000544246.1_Missense_Mutation_p.P1145S|PCDH9_ENST00000328454.5_Missense_Mutation_p.P1111S			Q9HC56	PCDH9_HUMAN	protocadherin 9	1145					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P1145S(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		AAGCCAGGAGGCATCCAGCAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	13											113.0	98.0	103.0					13																	66879068		2203	4300	6503	65777069	SO:0001583	missense	5101			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3433C>T	13.37:g.66879068G>A	ENSP00000367096:p.Pro1145Ser	Somatic		Capture	Illumina GAIIx	4	65777069	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	HMMPfam_Cadherin;HMMPfam_Cadherin_2;HMMPfam_Protocadherin;superfamily_Cadherin-like	p.P1145S	ENST00000377865.2	37	c.3433	CCDS9444.1	13	.	.	.	.	.	.	.	.	.	.	G	23.8	4.463547	0.84425	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	D;D;D;D	0.91237	-2.81;-2.81;-2.7;-2.7	6.16	6.16	0.99307	.	0.000000	0.48767	D	0.000168	D	0.92182	0.7521	M	0.66439	2.03	0.53005	D	0.999968	P;P;P	0.47302	0.86;0.893;0.86	B;P;B	0.45881	0.373;0.496;0.373	D	0.92262	0.5818	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	1103;1111;1145	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	S	1145;1145;1111;1111	ENSP00000442186:P1145S;ENSP00000367096:P1145S;ENSP00000401699:P1111S;ENSP00000332060:P1111S	ENSP00000332060:P1111S	P	-	1	0	PCDH9	65777069	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	CCT	-	NULL		0.507	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH9	protein_coding	OTTHUMT00000276387.1	G	NM_203487		65777069	-1	no_errors	NM_203487	genbank	human	reviewed	54_36p	missense	SNP	1	A
RALGAPA1	253959	genome.wustl.edu	37	14	36008822	36008822	+	3'UTR	SNP	T	T	C			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr14:36008822T>C	ENST00000389698.3	-	0	6599				RALGAPA1_ENST00000258840.6_3'UTR|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.M2060V	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)						activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.M2060V(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CGAGGAGACATTGGAGAGGCC	0.527																																																1	Substitution - Missense(1)	ovary(1)	14											109.0	103.0	105.0					14																	36008822		2203	4300	6503	35078573	SO:0001624	3_prime_UTR_variant	253959			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.*98A>G	14.37:g.36008822T>C		Somatic		Capture	Illumina GAIIx	4	35078573	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	-	p.M2060V	ENST00000389698.3	37	c.6178	CCDS32065.1	14	.	.	.	.	.	.	.	.	.	.	T	13.54	2.269065	0.40095	.	.	ENSG00000174373	ENST00000307138;ENST00000554259	D;D	0.96491	-3.29;-4.03	5.53	5.53	0.82687	.	0.000000	0.64402	D	0.000013	D	0.90872	0.7132	N	0.22421	0.69	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	D	0.86331	0.1698	10	0.11794	T	0.64	-13.5443	11.0945	0.48137	0.1381:0.0:0.0:0.8619	.	2060	Q6GYQ0-2	.	V	2060;699	ENSP00000302647:M2060V;ENSP00000451133:M699V	ENSP00000302647:M2060V	M	-	1	0	RALGAPA1	35078573	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.758000	0.68776	2.220000	0.72140	0.459000	0.35465	ATG	-	NULL		0.527	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	GARNL1	protein_coding	OTTHUMT00000409829.1	T	XM_210022		35078573	-1	no_errors	NM_194301	genbank	human	provisional	54_36p	missense	SNP	1	C
NID2	22795	genome.wustl.edu	37	14	52534882	52534882	+	Splice_Site	SNP	C	C	G			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr14:52534882C>G	ENST00000216286.5	-	2	228		c.e2-1		NID2_ENST00000541773.1_Splice_Site	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)						basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.?(1)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					TGGTGCCCACCTGGGAGAGGA	0.572																																																1	Unknown(1)	ovary(1)	14											41.0	52.0	48.0					14																	52534882		2203	4299	6502	51604632	SO:0001630	splice_region_variant	22795			AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.229-1G>C	14.37:g.52534882C>G		Somatic		Capture	Illumina GAIIx	4	51604632	A8K6I7|B4DU19|O43710	Splice_Site	SNP	-	e2-1	ENST00000216286.5	37	c.229-1	CCDS9706.1	14	.	.	.	.	.	.	.	.	.	.	C	23.4	4.412620	0.83340	.	.	ENSG00000087303	ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8528	0.92240	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NID2	51604632	1.000000	0.71417	0.996000	0.52242	0.877000	0.50540	7.268000	0.78473	2.447000	0.82792	0.563000	0.77884	.	-	-		0.572	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID2	protein_coding	OTTHUMT00000276888.1	C		Intron	51604632	-1	no_errors	NM_007361	genbank	human	validated	54_36p	splice_site	SNP	1	G
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	C	C	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chrUnknown:0C>A								None (None upstream) : None (None downstream)																								0.0																																																0			7																																								141838407	SO:0001628	intergenic_variant	0																															Unknown.37:g.0C>A		Somatic		Capture	Illumina GAIIx	4	141838407		Missense_Mutation	SNP	-	p.T89N		37	c.266		7																																																																																			-	NULL	0	0					uc003vyo.2			C			141838407	1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390371	ensembl	human	known	54_36p	missense	SNP		A
snoU13	0	genome.wustl.edu	37	4	142219015	142219015	+	RNA	SNP	C	C	G			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr4:142219015C>G	ENST00000459515.1	-	0	17																											tcattatgctcatgaactaca	0.318																																																0			4																																								142438465			0																															4.37:g.142219015C>G		Somatic		Capture	Illumina GAIIx	4	142438465		RNA	SNP	-	NULL	ENST00000459515.1	37	NULL		4																																																																																			-	-		0.318	snoU13.199-201	NOVEL	basic	snoRNA	ENSG00000208891	snoRNA		C			142438465	-1	pseudogene	ENST00000386156	ensembl	human	novel	54_36p	rna	SNP		G
PDIA3	2923	genome.wustl.edu	37	15	44058127	44058127	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr15:44058127G>T	ENST00000300289.5	+	7	910	c.762G>T	c.(760-762)ttG>ttT	p.L254F	PDIA3_ENST00000538521.1_Missense_Mutation_p.L234F	NM_005313.4	NP_005304.3	P30101	PDIA3_HUMAN	protein disulfide isomerase family A, member 3	254					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein N-linked glycosylation via asparagine (GO:0018279)|protein retention in ER lumen (GO:0006621)|proteolysis (GO:0006508)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|phospholipase C activity (GO:0004629)|poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)	p.L254F(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(2)|skin(1)	17		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		ATAAAGATTTGATACAGGGCA	0.348																																																1	Substitution - Missense(1)	ovary(1)	15											109.0	109.0	109.0					15																	44058127		2198	4295	6493	41845419	SO:0001583	missense	2923				CCDS10101.1	15q15	2009-11-20	2005-06-29	2005-03-03	ENSG00000167004	ENSG00000167004	5.3.4.1	"""Protein disulfide isomerases"""	4606	protein-coding gene	gene with protein product		602046	"""glucose regulated protein, 58kDa"", ""protein disulfide isomerase-associated 3"""	GRP58		8974399	Standard	NM_005313		Approved	P58, ERp61, ERp57, ERp60, GRP57, PI-PLC, HsT17083	uc001zsu.3	P30101	OTTHUMG00000044444	ENST00000300289.5:c.762G>T	15.37:g.44058127G>T	ENSP00000300289:p.Leu254Phe	Somatic		Capture	Illumina GAIIx	4	41845419	Q13453|Q14255|Q8IYF8|Q9UMU7	Missense_Mutation	SNP	-	p.L254F	ENST00000300289.5	37	c.762	CCDS10101.1	15	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768387	0.49680	.	.	ENSG00000167004	ENST00000300289;ENST00000538826;ENST00000537673;ENST00000538521	T;T	0.31247	1.5;1.5	5.74	3.55	0.40652	Thioredoxin-like fold (1);	0.124780	0.53938	D	0.000050	T	0.23846	0.0577	L	0.31207	0.915	0.49798	D	0.99982	B;B	0.19935	0.004;0.04	B;B	0.16722	0.007;0.016	T	0.07731	-1.0757	10	0.54805	T	0.06	.	13.474	0.61297	0.148:0.0:0.852:0.0	.	234;254	G5EA52;P30101	.;PDIA3_HUMAN	F	254;229;28;234	ENSP00000300289:L254F;ENSP00000438260:L234F	ENSP00000300289:L254F	L	+	3	2	PDIA3	41845419	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.028000	0.57246	1.438000	0.47492	0.563000	0.77884	TTG	-	NULL		0.348	PDIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA3	protein_coding	OTTHUMT00000103532.3	G	NM_005313		41845419	1	no_errors	NM_005313	genbank	human	reviewed	54_36p	missense	SNP	1	T
VWA3A	146177	genome.wustl.edu	37	16	22144237	22144237	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr16:22144237A>G	ENST00000389398.5	+	20	1985	c.1889A>G	c.(1888-1890)tAc>tGc	p.Y630C	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	630	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		CTCAGTGCCTACATGGCTGAG	0.637																																																0			16											39.0	42.0	41.0					16																	22144237		2062	4203	6265	22051738	SO:0001583	missense	146177			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.1889A>G	16.37:g.22144237A>G	ENSP00000374049:p.Tyr630Cys	Somatic		Capture	Illumina GAIIx	4	22051738	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	-	p.Y437C	ENST00000389398.5	37	c.1310	CCDS45441.1	16	.	.	.	.	.	.	.	.	.	.	A	16.95	3.263097	0.59431	.	.	ENSG00000175267	ENST00000389398;ENST00000299840	T	0.08634	3.07	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000001	T	0.28134	0.0694	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.01178	-1.1427	10	0.66056	D	0.02	.	14.146	0.65351	1.0:0.0:0.0:0.0	.	630;254	A6NCI4;A6NCI4-2	VWA3A_HUMAN;.	C	630;253	ENSP00000374049:Y630C	ENSP00000299840:Y253C	Y	+	2	0	VWA3A	22051738	1.000000	0.71417	0.996000	0.52242	0.543000	0.35085	5.722000	0.68485	2.018000	0.59344	0.528000	0.53228	TAC	-	NULL		0.637	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3A	protein_coding	OTTHUMT00000430052.1	A			22051738	1	no_errors	NM_173615	genbank	human	validated	54_36p	missense	SNP	0.96	G
CD2BP2	10421	genome.wustl.edu	37	16	30364555	30364555	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr16:30364555C>G	ENST00000305596.3	-	6	1037	c.862G>C	c.(862-864)Gag>Cag	p.E288Q	CD2BP2_ENST00000569466.1_Missense_Mutation_p.E288Q|RP11-347C12.10_ENST00000563252.1_lincRNA	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	288	GYF. {ECO:0000255|PROSITE- ProRule:PRU00101}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)	p.E288Q(1)		breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						CCCGTGTTCTCCCACTTATAT	0.562																																																1	Substitution - Missense(1)	ovary(1)	16											150.0	131.0	137.0					16																	30364555		2197	4300	6497	30272056	SO:0001583	missense	10421			AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.862G>C	16.37:g.30364555C>G	ENSP00000304903:p.Glu288Gln	Somatic		Capture	Illumina GAIIx	4	30272056	B2RDX2|Q9ULP2	Missense_Mutation	SNP	-	p.E288Q	ENST00000305596.3	37	c.862	CCDS10675.1	16	.	.	.	.	.	.	.	.	.	.	c	20.4	3.977071	0.74360	.	.	ENSG00000169217	ENST00000305596	T	0.30981	1.51	5.14	4.14	0.48551	GYF (4);	0.201635	0.47093	D	0.000253	T	0.36054	0.0953	L	0.42245	1.32	0.58432	D	0.999992	D	0.53619	0.961	P	0.53450	0.726	T	0.03193	-1.1062	10	0.15952	T	0.53	11.9704	14.5553	0.68097	0.0:0.8531:0.1469:0.0	.	288	O95400	CD2B2_HUMAN	Q	288	ENSP00000304903:E288Q	ENSP00000304903:E288Q	E	-	1	0	CD2BP2	30272056	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.634000	0.54302	2.370000	0.80446	0.655000	0.94253	GAG	-	NULL		0.562	CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2BP2	protein_coding	OTTHUMT00000255528.1	C	NM_006110		30272056	-1	no_errors	NM_006110	genbank	human	reviewed	54_36p	missense	SNP	1	G
KARS	3735	genome.wustl.edu	37	16	75663370	75663370	+	Silent	SNP	C	C	T	rs374568114		TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr16:75663370C>T	ENST00000302445.3	-	12	1533	c.1494G>A	c.(1492-1494)gcG>gcA	p.A498A	KARS_ENST00000319410.5_Silent_p.A526A|KARS_ENST00000568378.1_Intron	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase	498					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)	p.A498A(1)		kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	GCTCAGTATACGCATTGCATA	0.517																																																1	Substitution - coding silent(1)	ovary(1)	16						G	,	0,4396		0,0,2198	180.0	179.0	179.0		1578,1494	3.8	1.0	16		179	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous	KARS	NM_001130089.1,NM_005548.2	,	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	,	526/626,498/598	75663370	1,12995	2198	4300	6498	74220871	SO:0001819	synonymous_variant	3735			AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.1494G>A	16.37:g.75663370C>T		Somatic		Capture	Illumina GAIIx	4	74220871	A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Silent	SNP	HMMPfam_tRNA-synt_2;HMMPfam_tRNA_anti;superfamily_Nucleic acid-binding proteins;superfamily_Class II aaRS and biotin synthetases	p.A498	ENST00000302445.3	37	c.1494	CCDS10923.1	16																																																																																			-	HMMPfam_tRNA-synt_2		0.517	KARS-001	KNOWN	basic|CCDS	protein_coding	KARS	protein_coding	OTTHUMT00000269023.1	C	NM_005548		74220871	-1	no_errors	NM_005548	genbank	human	reviewed	54_36p	silent	SNP	1	T
BRCA1	672	genome.wustl.edu	37	17	41243753	41243754	+	Frame_Shift_Ins	INS	-	-	TT	rs80357767		TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	-	-	-	TT	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA;Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr17:41243753_41243754insTT	ENST00000357654.3	-	10	3912_3913	c.3794_3795insAA	c.(3793-3795)aatfs	p.N1265fs	BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000346315.3_Frame_Shift_Ins_p.N1265fs|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000471181.2_Frame_Shift_Ins_p.N1265fs|BRCA1_ENST00000354071.3_Frame_Shift_Ins_p.N1265fs|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_Frame_Shift_Ins_p.N969fs|BRCA1_ENST00000493795.1_Frame_Shift_Ins_p.N1218fs|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000591534.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1265					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.N1265fs*4(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CATTTAAGCTATTCTTCAATGA	0.391			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	1	Insertion - Frameshift(1)	ovary(1)	17	GRCh37	CD961841	BRCA1	D	rs80357767																																			38497280	SO:0001589	frameshift_variant	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.3793_3794dupAA	17.37:g.41243754_41243755dupTT	ENSP00000350283:p.Asn1265fs	Somatic		Capture	Illumina GAIIx	4	38497279	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Frame_Shift_Ins	INS	superfamily_BRCT domain;superfamily_RING/U-box;BRCT;HMMPfam_BRCT;zf-C3HC4;HMMPfam_zf-C3HC4	p.N1265fs	ENST00000357654.3	37	c.3795_3794	CCDS11453.1	17																																																																																			-	NULL		0.391	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	protein_coding	OTTHUMT00000348798.2	-	NM_007294		38497280	-1	no_errors	NM_007294	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.024:0.006	TT
TP53	7157	genome.wustl.edu	37	17	7574003	7574003	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr17:7574003G>A	ENST00000269305.4	-	10	1213	c.1024C>T	c.(1024-1026)Cga>Tga	p.R342*	TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Nonsense_Mutation_p.R342*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	342	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> L (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R342*(70)|p.0?(8)|p.R342fs*3(8)|p.?(1)|p.R342_N345delRELN(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCAGCTCTCGGAACATCTCG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	89	Substitution - Nonsense(70)|Whole gene deletion(8)|Deletion - Frameshift(7)|Insertion - Frameshift(2)|Deletion - In frame(1)|Unknown(1)	breast(16)|upper_aerodigestive_tract(11)|large_intestine(9)|central_nervous_system(9)|ovary(7)|lung(6)|skin(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|pancreas(4)|bone(4)|stomach(2)|urinary_tract(2)|oesophagus(2)|kidney(1)|peritoneum(1)|endometrium(1)	17	GRCh37	CM004908	TP53	M							62.0	48.0	53.0					17																	7574003		2203	4300	6503	7514728	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1024C>T	17.37:g.7574003G>A	ENSP00000269305:p.Arg342*	Somatic		Capture	Illumina GAIIx	4	7514728	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R342*	ENST00000269305.4	37	c.1024	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.061927	0.97246	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.43	3.43	0.39272	.	0.217683	0.37906	N	0.001893	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-0.3792	6.4477	0.21885	0.0845:0.0:0.5925:0.323	.	.	.	.	X	342;342;331	.	ENSP00000269305:R342X	R	-	1	2	TP53	7514728	0.820000	0.29190	0.702000	0.30337	0.859000	0.49053	2.169000	0.42434	0.657000	0.30906	0.561000	0.74099	CGA	-	HMMPfam_P53_tetramer		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7514728	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	0.4	A
WDR45B	56270	genome.wustl.edu	37	17	80574440	80574440	+	Silent	SNP	C	C	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr17:80574440C>A	ENST00000392325.4	-	9	1082	c.888G>T	c.(886-888)ccG>ccT	p.P296P	WDR45B_ENST00000571835.1_5'UTR	NM_019613.3	NP_062559.2	Q5MNZ6	WIPI3_HUMAN	WD repeat domain 45B	296								p.P296P(1)									CACAAATGCACGGAGAGCCTG	0.527																																																1	Substitution - coding silent(1)	ovary(1)	17											126.0	124.0	124.0					17																	80574440		2203	4300	6503	78167729	SO:0001819	synonymous_variant	56270			AF091083	CCDS11815.2	17q25.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000141580	ENSG00000141580		"""WD repeat domain containing"""	25072	protein-coding gene	gene with protein product		609226	"""WDR45-like"""	WDR45L		12477932	Standard	NM_019613		Approved	WIPI3	uc002kfq.3	Q5MNZ6	OTTHUMG00000150146	ENST00000392325.4:c.888G>T	17.37:g.80574440C>A		Somatic		Capture	Illumina GAIIx	4	78167729	O95328|Q2MCP6|Q6IBN2	Silent	SNP	-	p.P296	ENST00000392325.4	37	c.888	CCDS11815.2	17																																																																																			-	NULL		0.527	WDR45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR45L	protein_coding	OTTHUMT00000316536.1	C	NM_019613		78167729	-1	no_errors	NM_019613	genbank	human	reviewed	54_36p	silent	SNP	0.79	A
HAUS1	115106	genome.wustl.edu	37	18	43708080	43708080	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr18:43708080A>T	ENST00000282058.6	+	9	906	c.826A>T	c.(826-828)Atg>Ttg	p.M276L	HAUS1_ENST00000588704.1_3'UTR|HAUS1_ENST00000585518.1_3'UTR	NM_138443.3	NP_612452.1	Q96CS2	HAUS1_HUMAN	HAUS augmin-like complex, subunit 1	276					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.M276L(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	7						AGTAGACATGATGGAACTGTG	0.338																																					NSCLC(79;183 1423 5813 15597 38427)											1	Substitution - Missense(1)	ovary(1)	18											102.0	87.0	92.0					18																	43708080		2203	4298	6501	41962078	SO:0001583	missense	115106			AY360137	CCDS11928.1	18q21.1	2013-10-11	2009-04-20	2009-04-20	ENSG00000152240	ENSG00000152240		"""HAUS augmin-like complex subunits"""	25174	protein-coding gene	gene with protein product		608775	"""coiled-coil domain containing 5 (spindle associated)"""	CCDC5		19427217	Standard	NR_026978		Approved	HEI-C, HsT1461, FLJ40084	uc002lbu.3	Q96CS2	OTTHUMG00000132638	ENST00000282058.6:c.826A>T	18.37:g.43708080A>T	ENSP00000282058:p.Met276Leu	Somatic		Capture	Illumina GAIIx	4	41962078	B2RDM7|Q8N837	Missense_Mutation	SNP	-	p.M276L	ENST00000282058.6	37	c.826	CCDS11928.1	18	.	.	.	.	.	.	.	.	.	.	A	12.54	1.968460	0.34754	.	.	ENSG00000152240	ENST00000282058	.	.	.	5.06	5.06	0.68205	.	0.295393	0.41294	D	0.000912	T	0.55114	0.1900	L	0.51422	1.61	0.43835	D	0.996419	B	0.13594	0.008	B	0.10450	0.005	T	0.53222	-0.8469	9	0.39692	T	0.17	-34.9525	11.4884	0.50367	1.0:0.0:0.0:0.0	.	276	Q96CS2	HAUS1_HUMAN	L	276	.	ENSP00000282058:M276L	M	+	1	0	HAUS1	41962078	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	3.399000	0.52586	2.026000	0.59711	0.477000	0.44152	ATG	-	NULL		0.338	HAUS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC5	protein_coding	OTTHUMT00000255885.1	A	NM_138443		41962078	1	no_errors	NM_138443	genbank	human	validated	54_36p	missense	SNP	1	T
ZNF101	94039	genome.wustl.edu	37	19	19790934	19790934	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr19:19790934G>T	ENST00000592502.1	+	4	1246	c.1136G>T	c.(1135-1137)aGt>aTt	p.S379I	ZNF101_ENST00000415784.2_Missense_Mutation_p.S259I			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	379					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S379I(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						GGGTGGTGCAGTTCCCTCCGA	0.378																																																1	Substitution - Missense(1)	ovary(1)	19											83.0	80.0	81.0					19																	19790934		2203	4300	6503	19651934	SO:0001583	missense	94039			AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.1136G>T	19.37:g.19790934G>T	ENSP00000468049:p.Ser379Ile	Somatic		Capture	Illumina GAIIx	4	19651934	C9JU83|Q0VDG9	Missense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.S379I	ENST00000592502.1	37	c.1136	CCDS32971.1	19	.	.	.	.	.	.	.	.	.	.	G	7.670	0.686701	0.14973	.	.	ENSG00000181896	ENST00000318110;ENST00000415440;ENST00000415784	T;T	0.32023	1.47;1.47	0.235	0.235	0.15431	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32285	0.0824	M	0.88704	2.975	0.09310	N	1	P	0.34724	0.465	B	0.23852	0.049	T	0.25187	-1.0139	8	.	.	.	.	6.2532	0.20859	3.0E-4:0.0:0.9997:0.0	.	379	Q8IZC7	ZN101_HUMAN	I	379;379;259	ENSP00000319716:S379I;ENSP00000400952:S259I	.	S	+	2	0	ZNF101	19651934	0.000000	0.05858	0.021000	0.16686	0.021000	0.10359	-1.147000	0.03188	0.308000	0.22923	0.313000	0.20887	AGT	-	HMMPfam_zf-C2H2		0.378	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF101	protein_coding	OTTHUMT00000460559.1	G	NM_033204		19651934	1	no_errors	NM_033204	genbank	human	provisional	54_36p	missense	SNP		T
MAP3K19	80122	genome.wustl.edu	37	2	135749115	135749115	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr2:135749115T>C	ENST00000375845.3	-	6	640	c.610A>G	c.(610-612)Agc>Ggc	p.S204G	MAP3K19_ENST00000392918.3_Missense_Mutation_p.S204G|MAP3K19_ENST00000375844.3_Missense_Mutation_p.S204G|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000392917.3_Missense_Mutation_p.S204G|MAP3K19_ENST00000358371.4_Missense_Mutation_p.S91G|MAP3K19_ENST00000392915.1_Missense_Mutation_p.S221G	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	204							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S204G(1)									ACCTTGATGCTTCGGCCACTG	0.353																																																1	Substitution - Missense(1)	ovary(1)	2											96.0	99.0	98.0					2																	135749115		2203	4300	6503	135465585	SO:0001583	missense	80122			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.610A>G	2.37:g.135749115T>C	ENSP00000365005:p.Ser204Gly	Somatic		Capture	Illumina GAIIx	4	135465585	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.S204G	ENST00000375845.3	37	c.610	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	T	9.263	1.043733	0.19748	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000392915	T;T;T;T;T;T	0.71934	-0.56;-0.51;-0.57;-0.61;-0.52;1.82	4.0	4.0	0.46444	.	0.376195	0.19457	N	0.113789	T	0.60919	0.2306	L	0.40543	1.245	0.80722	D	1	B;B;B;B;B;B;B	0.31290	0.164;0.318;0.187;0.135;0.318;0.135;0.255	B;B;B;B;B;B;B	0.32762	0.123;0.106;0.106;0.109;0.152;0.109;0.071	T	0.63377	-0.6651	10	0.56958	D	0.05	.	9.5007	0.39015	0.0:0.0:0.0:1.0	.	204;204;91;204;221;204;204	B7ZMH9;Q56UN5-2;Q56UN5-3;Q56UN5-4;A8MWG7;Q56UN5-5;Q56UN5	.;.;.;.;.;.;YSK4_HUMAN	G	204;91;204;204;204;221	ENSP00000365005:S204G;ENSP00000351140:S91G;ENSP00000365004:S204G;ENSP00000376650:S204G;ENSP00000376649:S204G;ENSP00000376647:S221G	ENSP00000351140:S91G	S	-	1	0	YSK4	135465585	0.481000	0.25941	0.260000	0.24451	0.005000	0.04900	1.090000	0.30902	1.806000	0.52798	0.482000	0.46254	AGC	-	NULL		0.353	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YSK4	protein_coding	OTTHUMT00000158244.1	T	NM_025052		135465585	-1	no_errors	NM_025052	genbank	human	validated	54_36p	missense	SNP	0.96	C
SCN1A	6323	genome.wustl.edu	37	2	166900452	166900452	+	Silent	SNP	G	G	A	rs146520391		TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr2:166900452G>A	ENST00000303395.4	-	11	1769	c.1770C>T	c.(1768-1770)ttC>ttT	p.F590F	AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000375405.3_Silent_p.F590F|SCN1A_ENST00000409050.1_Silent_p.F590F|SCN1A_ENST00000423058.2_Silent_p.F590F|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	590					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.F590F(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CATCATCTGCGAAGTCGTTCT	0.517																																																1	Substitution - coding silent(1)	ovary(1)	2						G	,,,	2,4404	4.2+/-10.8	0,2,2201	147.0	134.0	138.0		1770,1770,1770,1770	3.0	1.0	2	dbSNP_134	138	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SCN1A	NM_001165963.1,NM_001165964.1,NM_001202435.1,NM_006920.4	,,,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,,,	590/2010,590/1982,590/2010,590/1999	166900452	2,13004	2203	4300	6503	166608698	SO:0001819	synonymous_variant	6323			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.1770C>T	2.37:g.166900452G>A		Somatic		Capture	Illumina GAIIx	4	166608698	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	HMMPfam_IQ;HMMPfam_Ion_trans;HMMPfam_Na_trans_assoc;superfamily_EF-hand;superfamily_Voltage-gated potassium channels	p.F590	ENST00000303395.4	37	c.1770	CCDS54413.1	2																																																																																			-	NULL		0.517	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	protein_coding	OTTHUMT00000102661.1	G	NM_006920		166608698	-1	no_errors	NM_006920	genbank	human	validated	54_36p	silent	SNP	1	A
C2orf16	84226	genome.wustl.edu	37	2	27804344	27804344	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr2:27804344G>C	ENST00000408964.2	+	1	4956	c.4905G>C	c.(4903-4905)caG>caC	p.Q1635H	AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000413371.2_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000355467.4_5'Flank|ZNF512_ENST00000379717.1_5'Flank|ZNF512_ENST00000416005.2_5'Flank|ZNF512_ENST00000556601.1_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1635	27 X 8 AA approximative tandem repeat of P-S-E-R-S-H-H-S.|Arg-rich.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					GTCCCTCTCAGAGGAGCCATC	0.572																																																0			2											118.0	118.0	118.0					2																	27804344		1871	4103	5974	27657848	SO:0001583	missense	84226			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.4905G>C	2.37:g.27804344G>C	ENSP00000386190:p.Gln1635His	Somatic		Capture	Illumina GAIIx	4	27657848	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	-	p.Q1635H	ENST00000408964.2	37	c.4905	CCDS42666.1	2	.	.	.	.	.	.	.	.	.	.	G	9.246	1.039555	0.19669	.	.	ENSG00000221843	ENST00000408964	T	0.05319	3.46	3.0	0.993	0.19825	.	.	.	.	.	T	0.04363	0.0120	N	0.22421	0.69	0.09310	N	1	P	0.42941	0.794	B	0.38616	0.277	T	0.38650	-0.9651	9	0.66056	D	0.02	.	5.4381	0.16492	0.1278:0.2074:0.6648:0.0	.	1635	Q68DN1	CB016_HUMAN	H	1635	ENSP00000386190:Q1635H	ENSP00000386190:Q1635H	Q	+	3	2	C2orf16	27657848	0.012000	0.17670	0.046000	0.18839	0.075000	0.17131	0.258000	0.18387	0.093000	0.17368	0.313000	0.20887	CAG	-	NULL		0.572	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	protein_coding	OTTHUMT00000353292.1	G	NM_032266		27657848	1	no_errors	NM_032266	genbank	human	validated	54_36p	missense	SNP	0.01	C
INHA	3623	genome.wustl.edu	37	2	220440019	220440019	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr2:220440019G>C	ENST00000243786.2	+	2	1052	c.872G>C	c.(871-873)tGt>tCt	p.C291S		NM_002191.3	NP_002182.1	P05111	INHA_HUMAN	inhibin, alpha	291					cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|erythrocyte differentiation (GO:0030218)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|ovarian follicle development (GO:0001541)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|regulation of cell cycle (GO:0051726)|regulation of cell proliferation (GO:0042127)|response to external stimulus (GO:0009605)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|inhibin A complex (GO:0043512)|inhibin-betaglycan-ActRII complex (GO:0034673)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|receptor binding (GO:0005102)	p.C291S(1)|p.C291Y(1)		large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10		Renal(207;0.0183)		Epithelial(149;4.58e-07)|all cancers(144;4.31e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		TTCCACTACTGTCATGGTGGT	0.612																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	2											168.0	164.0	166.0					2																	220440019		2203	4300	6503	220148263	SO:0001583	missense	3623				CCDS2444.1	2q35	2013-09-19			ENSG00000123999	ENSG00000123999			6065	protein-coding gene	gene with protein product		147380				3345731	Standard	NM_002191		Approved		uc002vmk.2	P05111	OTTHUMG00000059237	ENST00000243786.2:c.872G>C	2.37:g.220440019G>C	ENSP00000243786:p.Cys291Ser	Somatic		Capture	Illumina GAIIx	4	220148263	A8K8H5	Missense_Mutation	SNP	HMMPfam_TGF_beta;superfamily_Cystine-knot cytokines	p.C291S	ENST00000243786.2	37	c.872	CCDS2444.1	2	.	.	.	.	.	.	.	.	.	.	G	19.32	3.804310	0.70682	.	.	ENSG00000123999	ENST00000243786	D	0.99830	-7.01	5.48	4.6	0.57074	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.093959	0.85682	D	0.000000	D	0.99873	0.9940	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96304	0.9223	9	.	.	.	-12.04	16.3326	0.83048	0.0:0.1322:0.8678:0.0	.	291	P05111	INHA_HUMAN	S	291	ENSP00000243786:C291S	.	C	+	2	0	INHA	220148263	1.000000	0.71417	0.985000	0.45067	0.900000	0.52787	8.772000	0.91757	1.291000	0.44653	0.561000	0.74099	TGT	-	HMMPfam_TGF_beta		0.612	INHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHA	protein_coding	OTTHUMT00000131425.1	G			220148263	1	no_errors	NM_002191	genbank	human	reviewed	54_36p	missense	SNP	1	C
HAO1	54363	genome.wustl.edu	37	20	7921060	7921060	+	Missense_Mutation	SNP	G	G	A	rs148371109		TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr20:7921060G>A	ENST00000378789.3	-	1	61	c.10C>T	c.(10-12)Cgg>Tgg	p.R4W		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	4	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)	p.R4W(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						CAAATTAGCCGGGGGAGCATT	0.348																																																1	Substitution - Missense(1)	ovary(1)	20						G	TRP/ARG	0,4406		0,0,2203	76.0	81.0	79.0		10	4.3	0.1	20	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	no	missense	HAO1	NM_017545.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	4/371	7921060	1,13005	2203	4300	6503	7869060	SO:0001583	missense	54363			AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.10C>T	20.37:g.7921060G>A	ENSP00000368066:p.Arg4Trp	Somatic		Capture	Illumina GAIIx	4	7869060	Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	HMMPfam_FMN_dh;superfamily_FMN-linked oxidoreductases	p.R4W	ENST00000378789.3	37	c.10	CCDS13100.1	20	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919789	0.73098	0.0	1.16E-4	ENSG00000101323	ENST00000378789	T	0.32023	1.47	5.4	4.34	0.51931	.	0.340357	0.33834	N	0.004513	T	0.28366	0.0701	L	0.37697	1.125	0.09310	N	0.999997	D;D	0.60160	0.987;0.987	P;P	0.46825	0.528;0.528	T	0.16630	-1.0396	10	0.72032	D	0.01	8.9612	10.4096	0.44285	0.0:0.0:0.6848:0.3152	.	4;4	A8K058;Q9UJM8	.;HAOX1_HUMAN	W	4	ENSP00000368066:R4W	ENSP00000368066:R4W	R	-	1	2	HAO1	7869060	0.999000	0.42202	0.092000	0.20876	0.608000	0.37181	3.663000	0.54518	2.685000	0.91497	0.561000	0.74099	CGG	-	NULL		0.348	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAO1	protein_coding	OTTHUMT00000077926.2	G			7869060	-1	no_errors	NM_017545	genbank	human	reviewed	54_36p	missense	SNP	0.05	A
DLGAP4	22839	genome.wustl.edu	37	20	35060447	35060447	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr20:35060447G>C	ENST00000373907.2	+	2	526	c.327G>C	c.(325-327)gaG>gaC	p.E109D	DLGAP4_ENST00000339266.5_Missense_Mutation_p.E109D|DLGAP4_ENST00000373913.3_Missense_Mutation_p.E109D|DLGAP4_ENST00000401952.2_Missense_Mutation_p.E109D			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	109					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)		p.E109D(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				ACCAGTTTGAGAAGCAGCTGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	20											77.0	77.0	77.0					20																	35060447		2203	4300	6503	34493861	SO:0001583	missense	22839			AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.327G>C	20.37:g.35060447G>C	ENSP00000363014:p.Glu109Asp	Somatic		Capture	Illumina GAIIx	4	34493861	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	-	p.E109D	ENST00000373907.2	37	c.327		20	.	.	.	.	.	.	.	.	.	.	G	13.64	2.297803	0.40694	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.53	3.57	0.40892	.	0.100236	0.64402	N	0.000002	T	0.19565	0.0470	L	0.59967	1.855	0.50813	D	0.999893	P	0.42078	0.77	B	0.36959	0.237	T	0.01894	-1.1252	10	0.42905	T	0.14	.	9.767	0.40567	0.0727:0.0:0.7872:0.1401	.	109	Q9Y2H0-1	.	D	109	ENSP00000363023:E109D;ENSP00000384954:E109D;ENSP00000363014:E109D;ENSP00000341633:E109D	ENSP00000341633:E109D	E	+	3	2	DLGAP4	34493861	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.067000	0.57527	0.683000	0.31428	0.561000	0.74099	GAG	-	NULL		0.647	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	protein_coding	OTTHUMT00000079025.2	G	NM_014902		34493861	1	no_errors	NM_014902	genbank	human	reviewed	54_36p	missense	SNP	1	C
C21orf62	56245	genome.wustl.edu	37	21	34166553	34166553	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr21:34166553C>A	ENST00000536776.1	-	2	320	c.180G>T	c.(178-180)atG>atT	p.M60I	C21orf62_ENST00000490358.1_Missense_Mutation_p.M60I|C21orf49_ENST00000382375.4_Intron|C21orf49_ENST00000382378.1_Intron|C21orf49_ENST00000477513.1_Intron|C21orf49_ENST00000453404.1_Intron|C21orf62_ENST00000487113.1_Missense_Mutation_p.M60I|C21orf49_ENST00000382377.3_Intron|C21orf62_ENST00000479548.1_Missense_Mutation_p.M60I	NM_001162495.2|NM_001162496.2|NM_019596.5	NP_001155967.2|NP_001155968.2|NP_062542.5	Q9NYP8	CU062_HUMAN	chromosome 21 open reading frame 62	60								p.M60I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	6		Myeloproliferative disorder(46;0.0255)				TACAGTTGCACATCAGGTTGG	0.537																																																1	Substitution - Missense(1)	ovary(1)	21											132.0	132.0	132.0					21																	34166553		2107	4217	6324	33088423	SO:0001583	missense	56245			AF231922	CCDS42919.1, CCDS42919.2	21q22.1	2011-02-24			ENSG00000205929	ENSG00000205929			1305	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 120"""	C21orf120			Standard	NM_001162495		Approved	B37, PRED81	uc011adu.2	Q9NYP8	OTTHUMG00000163477	ENST00000536776.1:c.180G>T	21.37:g.34166553C>A	ENSP00000444950:p.Met60Ile	Somatic		Capture	Illumina GAIIx	4	33088423	A8K4L8	Missense_Mutation	SNP	-	p.M60I	ENST00000536776.1	37	c.180	CCDS42919.2	21	.	.	.	.	.	.	.	.	.	.	C	11.88	1.769415	0.31320	.	.	ENSG00000205929	ENST00000536776;ENST00000490358;ENST00000487113;ENST00000382373;ENST00000479548	.	.	.	5.37	3.54	0.40534	.	0.337163	0.25344	N	0.031342	T	0.39937	0.1097	L	0.54323	1.7	0.29085	N	0.882457	B	0.06786	0.001	B	0.09377	0.004	T	0.31392	-0.9945	9	0.33940	T	0.23	-8.7023	8.6363	0.33950	0.0:0.7409:0.1293:0.1299	.	60	Q9NYP8	CU062_HUMAN	I	60;60;60;107;60	.	ENSP00000371810:M107I	M	-	3	0	C21orf62	33088423	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	2.497000	0.45354	0.625000	0.30304	0.462000	0.41574	ATG	-	NULL		0.537	C21orf62-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf62	protein_coding	OTTHUMT00000139598.5	C	NM_019596		33088423	-1	no_errors	NM_019596	genbank	human	validated	54_36p	missense	SNP	1	A
CBY1	25776	genome.wustl.edu	37	22	39064131	39064131	+	Silent	SNP	G	G	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr22:39064131G>A	ENST00000216029.3	+	2	206	c.72G>A	c.(70-72)ctG>ctA	p.L24L	RP3-508I15.9_ENST00000444381.1_RNA|RP3-508I15.9_ENST00000422408.2_RNA|RP3-508I15.9_ENST00000431924.2_RNA|RP3-508I15.10_ENST00000423346.1_RNA	NM_015373.3	NP_056188.1	Q9Y3M2	CBY1_HUMAN	chibby homolog 1 (Drosophila)	24					cardiac muscle cell differentiation (GO:0055007)|cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein localization (GO:0008104)	ciliary basal body (GO:0036064)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	beta-catenin binding (GO:0008013)|identical protein binding (GO:0042802)	p.L24L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	Melanoma(58;0.04)					TCTCCAACCTGCATTCTGTGA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	22											90.0	87.0	88.0					22																	39064131		2203	4300	6503	37394077	SO:0001819	synonymous_variant	25776			BK005534	CCDS13974.1, CCDS74861.1	22q12	2014-02-06	2007-01-26	2007-01-26	ENSG00000100211	ENSG00000100211			1307	protein-coding gene	gene with protein product	"""chibby CTNNB1-mediated transcription inhibitor"""	607757	"""chromosome 22 open reading frame 2"", ""PKD2 interactor, golgi and endoplasmic reticulum associated 1"""	C22orf2, PGEA1		10591208, 15194699	Standard	NM_015373		Approved	PIGEA14, PIGEA-14, Chibby, Cby	uc003awb.4	Q9Y3M2	OTTHUMG00000150990	ENST00000216029.3:c.72G>A	22.37:g.39064131G>A		Somatic		Capture	Illumina GAIIx	4	37394077	B2R4S2|Q66GT6|Q9UIK9	Silent	SNP	-	p.L24	ENST00000216029.3	37	c.72	CCDS13974.1	22																																																																																			-	NULL		0.542	CBY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBY1	protein_coding	OTTHUMT00000320832.1	G	NM_015373		37394077	1	no_errors	NM_001002880	genbank	human	reviewed	54_36p	silent	SNP	0.99	A
MCAT	27349	genome.wustl.edu	37	22	43533166	43533166	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr22:43533166G>T	ENST00000290429.6	-	3	695	c.650C>A	c.(649-651)tCt>tAt	p.S217Y	MCAT_ENST00000327555.5_Intron	NM_173467.4	NP_775738.3	Q8IVS2	FABD_HUMAN	malonyl CoA:ACP acyltransferase (mitochondrial)	217					fatty acid biosynthetic process (GO:0006633)|metabolic process (GO:0008152)	mitochondrion (GO:0005739)	[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)	p.S217Y(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	11		Ovarian(80;0.0694)				TATGCCTAAAGACTTGCAGTG	0.532											OREG0026613	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	22											187.0	174.0	178.0					22																	43533166		2203	4300	6503	41863110	SO:0001583	missense	27349			AL359401	CCDS14045.1, CCDS33660.1	22q13.2	2010-04-27			ENSG00000100294	ENSG00000100294	2.3.1.39		29622	protein-coding gene	gene with protein product		614479				12882974	Standard	NM_173467		Approved	MT, MCT, fabD, FASN2C, NET62	uc003bdl.1	Q8IVS2	OTTHUMG00000150704	ENST00000290429.6:c.650C>A	22.37:g.43533166G>T	ENSP00000290429:p.Ser217Tyr	Somatic	917	Capture	Illumina GAIIx	4	41863110	B0QY72|O95510|O95511	Missense_Mutation	SNP	HMMPfam_Acyl_transf_1;superfamily_FabD/lysophospholipase-like;superfamily_Probable ACP-binding domain of malonyl-CoA ACP transacylase	p.S217Y	ENST00000290429.6	37	c.650	CCDS33660.1	22	.	.	.	.	.	.	.	.	.	.	G	16.74	3.207714	0.58343	.	.	ENSG00000100294	ENST00000290429	T	0.43688	0.94	5.13	5.13	0.70059	Acyl transferase/acyl hydrolase/lysophospholipase (1);Malonyl-CoA ACP transacylase, ACP-binding (1);Acyl transferase (1);	0.379885	0.29328	N	0.012463	T	0.63474	0.2514	M	0.79926	2.475	0.26730	N	0.970606	D	0.58970	0.984	P	0.56788	0.806	T	0.62364	-0.6870	10	0.72032	D	0.01	-28.5044	18.5829	0.91178	0.0:0.0:1.0:0.0	.	217	Q8IVS2	FABD_HUMAN	Y	217	ENSP00000290429:S217Y	ENSP00000290429:S217Y	S	-	2	0	MCAT	41863110	0.790000	0.28787	0.310000	0.25168	0.573000	0.36030	4.567000	0.60850	2.387000	0.81309	0.591000	0.81541	TCT	-	HMMPfam_Acyl_transf_1		0.532	MCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCAT	protein_coding	OTTHUMT00000319677.2	G	NM_173467		41863110	-1	no_errors	NM_173467	genbank	human	reviewed	54_36p	missense	SNP	0.04	T
CELSR3	1951	genome.wustl.edu	37	3	48697952	48697952	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr3:48697952C>T	ENST00000164024.4	-	1	2396	c.2116G>A	c.(2116-2118)Ggc>Agc	p.G706S	CELSR3_ENST00000544264.1_Missense_Mutation_p.G706S	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	706	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.G706S(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GAGACCCAGCCAGTGGCGCTG	0.557																																																1	Substitution - Missense(1)	ovary(1)	3											55.0	52.0	53.0					3																	48697952		2203	4300	6503	48672956	SO:0001583	missense	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.2116G>A	3.37:g.48697952C>T	ENSP00000164024:p.Gly706Ser	Somatic		Capture	Illumina GAIIx	4	48672956	O75092	Missense_Mutation	SNP	HMMPfam_GPS;HMMPfam_7tm_2;HMMPfam_HRM;HMMPfam_Laminin_EGF;HMMPfam_Cadherin;HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_Cadherin-like;superfamily_EGF/Laminin	p.G706S	ENST00000164024.4	37	c.2116	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368279	0.82463	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.05996	3.36;3.36	5.95	5.95	0.96441	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.42787	0.1218	H	0.97103	3.94	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.97110	0.992;1.0	T	0.59915	-0.7364	9	0.87932	D	0	.	20.3854	0.98941	0.0:1.0:0.0:0.0	.	706;776	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	S	706	ENSP00000164024:G706S;ENSP00000445694:G706S	ENSP00000164024:G706S	G	-	1	0	CELSR3	48672956	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.770000	0.85390	2.825000	0.97269	0.655000	0.94253	GGC	-	HMMPfam_Cadherin		0.557	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	protein_coding	OTTHUMT00000257523.1	C	NM_001407		48672956	-1	no_errors	NM_001407	genbank	human	reviewed	54_36p	missense	SNP	1	T
CACNA1D	776	genome.wustl.edu	37	3	53531197	53531197	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr3:53531197G>T	ENST00000350061.5	+	2	597	c.86G>T	c.(85-87)gGc>gTc	p.G29V	CACNA1D_ENST00000422281.2_Missense_Mutation_p.G29V|CACNA1D_ENST00000288139.4_Missense_Mutation_p.G29V	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	29					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.G29V(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TATGCAAGAGGCACCAGACTT	0.448																																																1	Substitution - Missense(1)	ovary(1)	3											47.0	49.0	49.0					3																	53531197		2203	4300	6503	53506237	SO:0001583	missense	776			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.86G>T	3.37:g.53531197G>T	ENSP00000288133:p.Gly29Val	Somatic		Capture	Illumina GAIIx	4	53506237	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	-	p.G29V	ENST00000350061.5	37	c.86	CCDS46848.1	3	.	.	.	.	.	.	.	.	.	.	G	16.65	3.182869	0.57800	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281	D;D;D	0.96073	-3.87;-3.9;-3.88	5.88	5.88	0.94601	.	1.369300	0.04234	N	0.335773	D	0.93871	0.8039	L	0.29908	0.895	0.80722	D	1	B;B;P	0.35908	0.392;0.392;0.527	B;B;B	0.32533	0.07;0.07;0.147	T	0.80274	-0.1451	10	0.66056	D	0.02	.	20.218	0.98305	0.0:0.0:1.0:0.0	.	29;29;29	B0FYA3;Q01668;Q01668-2	.;CAC1D_HUMAN;.	V	29	ENSP00000288133:G29V;ENSP00000288139:G29V;ENSP00000409174:G29V	ENSP00000288139:G29V	G	+	2	0	CACNA1D	53506237	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.430000	0.90283	2.791000	0.96007	0.561000	0.74099	GGC	-	NULL		0.448	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	protein_coding	OTTHUMT00000350557.1	G	NM_000720		53506237	1	no_errors	NM_000720	genbank	human	validated	54_36p	missense	SNP	1	T
STXBP5L	9515	genome.wustl.edu	37	3	121137248	121137248	+	Missense_Mutation	SNP	T	T	G	rs377695658		TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr3:121137248T>G	ENST00000273666.6	+	27	3634	c.3363T>G	c.(3361-3363)agT>agG	p.S1121R	STXBP5L_ENST00000471454.1_Missense_Mutation_p.S1097R	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	1121	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1121R(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		GACCAGGTAGTATAGAAGGGA	0.507																																																1	Substitution - Missense(1)	ovary(1)	3											50.0	56.0	54.0					3																	121137248		2004	4179	6183	122619938	SO:0001583	missense	9515			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.3363T>G	3.37:g.121137248T>G	ENSP00000273666:p.Ser1121Arg	Somatic		Capture	Illumina GAIIx	4	122619938	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	-	p.S1121R	ENST00000273666.6	37	c.3363	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	T	8.371	0.835414	0.16820	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000471262	T;T;T	0.24151	1.87;1.87;1.88	5.35	-10.7	0.00240	Synaptobrevin (1);	0.232564	0.43747	D	0.000531	T	0.07234	0.0183	N	0.08118	0	0.80722	D	1	B;B	0.21147	0.052;0.052	B;B	0.27170	0.038;0.077	T	0.44667	-0.9313	10	0.35671	T	0.21	-1.4673	2.0845	0.03642	0.2414:0.3307:0.2504:0.1774	.	1097;1121	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	R	1121;1097;1064	ENSP00000273666:S1121R;ENSP00000420019:S1097R;ENSP00000420167:S1064R	ENSP00000273666:S1121R	S	+	3	2	STXBP5L	122619938	0.000000	0.05858	0.048000	0.18961	0.623000	0.37688	-3.686000	0.00393	-2.717000	0.00390	-0.899000	0.02877	AGT	-	NULL		0.507	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	protein_coding	OTTHUMT00000355256.3	T			122619938	1	no_errors	NM_014980	genbank	human	validated	54_36p	missense	SNP	0.19	G
RSU1P1	100129622	genome.wustl.edu	37	10	43232605	43232605	+	IGR	SNP	G	G	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr10:43232605G>A								AL022344.5 (30704 upstream) : AL022344.7 (14020 downstream)																							CCAGAATTAGGTAAGTTTGCT	0.443																																																0			10																																								42552611	SO:0001628	intergenic_variant	100129622																															10.37:g.43232605G>A		Somatic		Capture	Illumina GAIIx	4	42552611		Splice_Site	SNP	-	e4+1		37	c.463+1		10	.	.	.	.	.	.	.	.	.	.	.	1.760	-0.487135	0.04352	.	.	ENSG00000230425	ENST00000453416	.	.	.	1.8	1.8	0.24995	.	.	.	.	.	T	0.49236	0.1545	.	.	.	.	.	.	.	.	.	.	.	.	T	0.58476	-0.7630	3	.	.	.	-8.6879	9.6369	0.39814	0.0:0.0:1.0:0.0	.	.	.	.	I	147	.	.	V	+	1	0	AL022344.6	42552611	1.000000	0.71417	0.969000	0.41365	0.065000	0.16274	8.803000	0.91915	1.318000	0.45170	0.194000	0.17425	GTA	-	-	0	0.443					LOC100129622			G			42552611	1	pseudogene	XM_001724175	genbank	human	model	54_36p	splice_site	SNP	1	A
SLC36A2	153201	genome.wustl.edu	37	5	150704952	150704952	+	Missense_Mutation	SNP	C	C	A	rs577271191		TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr5:150704952C>A	ENST00000335244.4	-	8	1034	c.905G>T	c.(904-906)gGa>gTa	p.G302V	SLC36A2_ENST00000450886.1_Missense_Mutation_p.G26V|SLC36A2_ENST00000521967.1_Missense_Mutation_p.G302V	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	302					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)	p.G302V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	GATGGACATTCCCAAAGACAG	0.493																																																1	Substitution - Missense(1)	ovary(1)	5											105.0	92.0	96.0					5																	150704952		2203	4300	6503	150685145	SO:0001583	missense	153201			AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.905G>T	5.37:g.150704952C>A	ENSP00000334223:p.Gly302Val	Somatic		Capture	Illumina GAIIx	4	150685145	Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Missense_Mutation	SNP	-	p.G302V	ENST00000335244.4	37	c.905	CCDS4315.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.3|24.3	4.512062|4.512062	0.85389|0.85389	.|.	.|.	ENSG00000186335|ENSG00000186335	ENST00000523044|ENST00000335244;ENST00000450886;ENST00000521967	.|T;T;T	.|0.02085	.|4.46;4.46;4.46	4.82|4.82	4.82|4.82	0.62117|0.62117	.|.	.|0.225652	.|0.44688	.|D	.|0.000434	.|T	.|0.10637	.|0.0260	M|M	0.64170|0.64170	1.965|1.965	0.80722|0.80722	D|D	1|1	.|D;P	.|0.55172	.|0.97;0.828	.|D;P	.|0.68765	.|0.96;0.838	.|T	.|0.08806	.|-1.0704	.|10	.|0.33940	.|T	.|0.23	-11.5759|-11.5759	18.4691|18.4691	0.90766|0.90766	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|302;302	.|E5RJJ5;Q495M3	.|.;S36A2_HUMAN	X|V	55|302;26;302	.|ENSP00000334223:G302V;ENSP00000399479:G26V;ENSP00000430535:G302V	.|ENSP00000334223:G302V	E|G	-|-	1|2	0|0	SLC36A2|SLC36A2	150685145|150685145	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.777000|0.777000	0.43975|0.43975	7.317000|7.317000	0.79018|0.79018	2.660000|2.660000	0.90430|0.90430	0.467000|0.467000	0.42956|0.42956	GAA|GGA	-	NULL		0.493	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC36A2	protein_coding	OTTHUMT00000252437.1	C			150685145	-1	no_errors	NM_181776	genbank	human	validated	54_36p	missense	SNP	1	A
NOTCH4	4855	genome.wustl.edu	37	6	32172107	32172107	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr6:32172107T>A	ENST00000375023.3	-	19	3063	c.2925A>T	c.(2923-2925)caA>caT	p.Q975H		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	975	EGF-like 25. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.Q975H(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TGTGACAGGGTTGGGACTGAC	0.562																																																1	Substitution - Missense(1)	ovary(1)	6											109.0	88.0	95.0					6																	32172107		1509	2709	4218	32280085	SO:0001583	missense	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.2925A>T	6.37:g.32172107T>A	ENSP00000364163:p.Gln975His	Somatic		Capture	Illumina GAIIx	4	32280085	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	HMMPfam_Notch;HMMPfam_Ank;superfamily_Ankyrin repeat;HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_NODP;HMMPfam_EGF_CA;superfamily_EGF/Laminin;superfamily_Notch domain	p.Q975H	ENST00000375023.3	37	c.2925	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	T	16.47	3.133157	0.56828	.	.	ENSG00000204301	ENST00000375023	D	0.86865	-2.18	4.91	-2.14	0.07123	EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.348667	0.20639	N	0.088430	T	0.59878	0.2226	L	0.31752	0.955	0.80722	D	1	B	0.22080	0.064	B	0.22386	0.039	T	0.39800	-0.9596	9	.	.	.	.	6.9956	0.24780	0.0:0.2079:0.1448:0.6474	.	975	Q99466	NOTC4_HUMAN	H	975	ENSP00000364163:Q975H	.	Q	-	3	2	NOTCH4	32280085	0.000000	0.05858	0.991000	0.47740	0.999000	0.98932	-3.451000	0.00466	-0.273000	0.09246	0.533000	0.62120	CAA	-	HMMPfam_EGF		0.562	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	protein_coding	OTTHUMT00000076045.2	T			32280085	-1	no_errors	NM_004557	genbank	human	reviewed	54_36p	missense	SNP	0.99	A
CLIC5	53405	genome.wustl.edu	37	6	45870921	45870921	+	Silent	SNP	G	G	A	rs138583424		TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr6:45870921G>A	ENST00000185206.6	-	6	1289	c.1137C>T	c.(1135-1137)aaC>aaT	p.N379N	CLIC5_ENST00000339561.6_Silent_p.N220N	NM_001114086.1	NP_001107558.1	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5	379	GST C-terminal.				auditory receptor cell stereocilium organization (GO:0060088)|chloride transport (GO:0006821)|diet induced thermogenesis (GO:0002024)|female pregnancy (GO:0007565)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|sensory perception of sound (GO:0007605)|transport (GO:0006810)	actin cytoskeleton (GO:0015629)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|stereocilium (GO:0032420)	voltage-gated chloride channel activity (GO:0005247)	p.N220N(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	13						GGGCATAGGCGTTCTTGAGGT	0.547													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19198	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	6						G	,	2,4404	2.1+/-5.4	0,2,2201	135.0	103.0	114.0		1137,660	-7.6	0.9	6	dbSNP_134	114	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CLIC5	NM_001114086.1,NM_016929.3	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	379/411,220/252	45870921	2,13004	2203	4300	6503	45978899	SO:0001819	synonymous_variant	53405			AF216941	CCDS4914.1, CCDS47438.1, CCDS59022.1	6p12.3	2014-03-14			ENSG00000112782	ENSG00000112782		"""Ion channels / Chloride channels : Intracellular"""	13517	protein-coding gene	gene with protein product		607293				10793131	Standard	NM_001114086		Approved		uc003oxv.3	Q9NZA1	OTTHUMG00000014775	ENST00000185206.6:c.1137C>T	6.37:g.45870921G>A		Somatic		Capture	Illumina GAIIx	4	45978899	B3KUF1|Q5T4Z0|Q8NBY3|Q96JT5|Q9BWZ0	Silent	SNP	-	p.N220	ENST00000185206.6	37	c.660	CCDS47438.1	6																																																																																			-	NULL		0.547	CLIC5-002	KNOWN	basic|CCDS	protein_coding	CLIC5	protein_coding	OTTHUMT00000040761.1	G			45978899	-1	no_errors	NM_016929	genbank	human	validated	54_36p	silent	SNP	0.97	A
RIMS1	22999	genome.wustl.edu	37	6	72975151	72975151	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr6:72975151C>A	ENST00000521978.1	+	21	3253	c.3253C>A	c.(3253-3255)Cat>Aat	p.H1085N	RIMS1_ENST00000401910.3_Intron|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000491071.2_Intron|RIMS1_ENST00000520567.1_Intron|RIMS1_ENST00000538414.1_Intron|RIMS1_ENST00000348717.5_Intron|RIMS1_ENST00000517960.1_Intron|RIMS1_ENST00000264839.7_Intron|RIMS1_ENST00000518273.1_Intron|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000425662.2_Intron	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1085					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.H1085N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CATTTCCCTTCATCATGAATG	0.323																																																1	Substitution - Missense(1)	ovary(1)	6											102.0	95.0	97.0					6																	72975151		1856	4102	5958	73031872	SO:0001583	missense	22999			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3253C>A	6.37:g.72975151C>A	ENSP00000428417:p.His1085Asn	Somatic		Capture	Illumina GAIIx	4	73031872	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	HMMPfam_C2;HMMPfam_PDZ;superfamily_PDZ domain-like;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);superfamily_FYVE/PHD zinc finger	p.H1085N	ENST00000521978.1	37	c.3253	CCDS47449.1	6	.	.	.	.	.	.	.	.	.	.	C	11.10	1.539508	0.27563	.	.	ENSG00000079841	ENST00000521978	T	0.12465	2.68	5.42	3.63	0.41609	.	0.166643	0.28230	N	0.016102	T	0.02083	0.0065	N	0.08118	0	0.58432	D	0.999991	B	0.14012	0.009	B	0.12156	0.007	T	0.38373	-0.9664	10	0.13470	T	0.59	-5.8025	9.771	0.40589	0.0:0.8412:0.0:0.1588	.	1085	Q86UR5	RIMS1_HUMAN	N	1085	ENSP00000428417:H1085N	ENSP00000428417:H1085N	H	+	1	0	RIMS1	73031872	0.004000	0.15560	0.631000	0.29282	0.969000	0.65631	1.759000	0.38420	1.287000	0.44583	0.585000	0.79938	CAT	-	NULL		0.323	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	protein_coding	OTTHUMT00000374968.1	C			73031872	1	no_errors	NM_014989	genbank	human	validated	54_36p	missense	SNP	0.38	A
LATS1	9113	genome.wustl.edu	37	6	150004239	150004239	+	Silent	SNP	T	T	C			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr6:150004239T>C	ENST00000543571.1	-	4	2533	c.1986A>G	c.(1984-1986)aaA>aaG	p.K662K	LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000392273.3_Silent_p.K662K|LATS1_ENST00000253339.5_Silent_p.K662K	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1									p.K662K(1)		central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		TCTCTAATTGTTTTTTACGAT	0.308																																																1	Substitution - coding silent(1)	ovary(1)	6											55.0	52.0	53.0					6																	150004239		2202	4300	6502	150045932	SO:0001819	synonymous_variant	9113			AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.1986A>G	6.37:g.150004239T>C		Somatic		Capture	Illumina GAIIx	4	150045932		Silent	SNP	UBA;HMMPfam_UBA;Pkinase;HMMPfam_Pkinase;Pkinase_C;HMMPfam_Pkinase_C	p.K662	ENST00000543571.1	37	c.1986	CCDS34551.1	6																																																																																			-	NULL		0.308	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS1	protein_coding	OTTHUMT00000043923.4	T	NM_004690		150045932	-1	no_errors	NM_004690	genbank	human	reviewed	54_36p	silent	SNP	1	C
EXOC4	60412	genome.wustl.edu	37	7	133580353	133580353	+	Splice_Site	SNP	G	G	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr7:133580353G>A	ENST00000253861.4	+	12	1765	c.1736G>A	c.(1735-1737)aGc>aAc	p.S579N	EXOC4_ENST00000545148.1_Splice_Site_p.S189N|EXOC4_ENST00000460346.1_3'UTR|EXOC4_ENST00000539845.1_Splice_Site_p.S478N	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	579					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)	p.S579N(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				CATTTCCAGAGCACAATCATT	0.418																																																1	Substitution - Missense(1)	ovary(1)	7											194.0	170.0	178.0					7																	133580353		2203	4300	6503	133230893	SO:0001630	splice_region_variant	60412			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1735-1G>A	7.37:g.133580353G>A		Somatic		Capture	Illumina GAIIx	4	133230893	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	HMMPfam_Sec8_exocyst	p.S579N	ENST00000253861.4	37	c.1736	CCDS5829.1	7	.	.	.	.	.	.	.	.	.	.	G	17.98	3.520042	0.64747	.	.	ENSG00000131558	ENST00000253861;ENST00000546185;ENST00000539845;ENST00000545148	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.75997	0.3926	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	0.999;0.994;1.0	D;P;D	0.71656	0.974;0.895;0.972	T	0.68834	-0.5304	9	0.27785	T	0.31	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	111;189;579	B7Z689;F5GZT1;Q96A65	.;.;EXOC4_HUMAN	N	579;198;478;189	.	ENSP00000253861:S579N	S	+	2	0	EXOC4	133230893	1.000000	0.71417	1.000000	0.80357	0.136000	0.21042	9.841000	0.99482	2.894000	0.99253	0.591000	0.81541	AGC	-	NULL		0.418	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC4	protein_coding	OTTHUMT00000339182.1	G	NM_021807	Missense_Mutation	133230893	1	no_errors	NM_021807	genbank	human	reviewed	54_36p	missense	SNP	1	A
HIPK2	28996	genome.wustl.edu	37	7	139285283	139285283	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr7:139285283G>A	ENST00000406875.3	-	11	2409	c.2315C>T	c.(2314-2316)aCc>aTc	p.T772I	HIPK2_ENST00000342645.6_Missense_Mutation_p.T772I|HIPK2_ENST00000428878.2_Missense_Mutation_p.T745I	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	772	Interaction with POU4F1. {ECO:0000250}.|Interaction with SKI and SMAD1.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)	p.T772I(1)		breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					CACATGACCGGTCAATAGTGC	0.552																																																1	Substitution - Missense(1)	ovary(1)	7											108.0	113.0	111.0					7																	139285283		2137	4240	6377	138935823	SO:0001583	missense	28996			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.2315C>T	7.37:g.139285283G>A	ENSP00000385571:p.Thr772Ile	Somatic		Capture	Illumina GAIIx	4	138935823	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	-	p.T389I	ENST00000406875.3	37	c.1166		7	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872056	0.72180	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.27256	1.68;1.68;1.68	4.84	3.95	0.45737	.	.	.	.	.	T	0.25975	0.0633	.	.	.	0.39847	D	0.973182	B;B	0.21606	0.058;0.039	B;B	0.26416	0.046;0.069	T	0.11792	-1.0573	8	0.56958	D	0.05	.	14.9599	0.71147	0.0:0.0:0.8562:0.1438	.	772;745	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	I	772;745;772	ENSP00000385571:T772I;ENSP00000413724:T745I;ENSP00000343108:T772I	ENSP00000343108:T772I	T	-	2	0	HIPK2	138935823	1.000000	0.71417	0.927000	0.36925	0.968000	0.65278	7.400000	0.79949	1.388000	0.46506	-0.175000	0.13238	ACC	-	NULL		0.552	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	HIPK2	protein_coding	OTTHUMT00000349430.3	G	NM_022740		138935823	-1	no_errors	NM_022740	genbank	human	validated	54_36p	missense	SNP	1	A
CYP3A43	64816	genome.wustl.edu	37	7	99457614	99457614	+	Splice_Site	SNP	G	G	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr7:99457614G>T	ENST00000354829.2	+	10	1129		c.e10+1		CYP3A43_ENST00000477658.1_Splice_Site|CYP3A43_ENST00000444905.1_Splice_Site|CYP3A43_ENST00000342499.4_Splice_Site|CYP3A43_ENST00000222382.5_Splice_Site|CYP3A43_ENST00000312017.5_Splice_Site|CYP3A43_ENST00000415413.1_Splice_Site|CYP3A43_ENST00000417625.1_Splice_Site	NM_022820.3|NM_057095.1	NP_073731.1|NP_476436.1	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 43						small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)	p.?(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Dexamethasone(DB01234)|Dolutegravir(DB08930)|Ethosuximide(DB00593)|Oxazepam(DB00842)|Phenelzine(DB00780)|Praziquantel(DB01058)|Rifampicin(DB01045)|Rifapentine(DB01201)|Testosterone(DB00624)|Troleandomycin(DB01361)|Zalcitabine(DB00943)	ACCCAATAAGGTAAGGGGATG	0.493																																																1	Unknown(1)	ovary(1)	7											83.0	80.0	81.0					7																	99457614		2203	4300	6503	99295550	SO:0001630	splice_region_variant	64816			AF319634	CCDS5675.1, CCDS5676.1, CCDS5677.1, CCDS64723.1	7q21.1	2007-12-14	2003-01-14		ENSG00000021461	ENSG00000021461		"""Cytochrome P450s"""	17450	protein-coding gene	gene with protein product		606534	"""cytochrome P450, subfamily IIIA, polypeptide 43"""			11160876, 11266076	Standard	NM_022820		Approved		uc003ury.1	Q9HB55	OTTHUMG00000156498	ENST00000354829.2:c.1026+1G>T	7.37:g.99457614G>T		Somatic		Capture	Illumina GAIIx	4	99295550	Q495Y1|Q75MK2|Q75MK3|Q9HB52|Q9HB53|Q9HB54|Q9HB57	Splice_Site	SNP	-	e10+1	ENST00000354829.2	37	c.1026+1	CCDS5676.1	7	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413095	0.25465	.	.	ENSG00000021461	ENST00000354829;ENST00000417625;ENST00000342499;ENST00000444905;ENST00000415413;ENST00000312017;ENST00000222382	.	.	.	2.49	2.49	0.30216	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0606	0.47944	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CYP3A43	99295550	1.000000	0.71417	0.997000	0.53966	0.240000	0.25518	8.729000	0.91490	1.694000	0.51137	0.205000	0.17691	.	-	-		0.493	CYP3A43-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP3A43	protein_coding	OTTHUMT00000344379.1	G		Intron	99295550	1	no_errors	NM_022820	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
MGAM	8972	genome.wustl.edu	37	7	141750507	141750507	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr7:141750507A>G	ENST00000549489.2	+	24	2743	c.2648A>G	c.(2647-2649)gAg>gGg	p.E883G	MGAM_ENST00000475668.2_Missense_Mutation_p.E883G	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	883	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.E883G(1)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AACCGCTTGGAGGTGAATATT	0.368																																																1	Substitution - Missense(1)	ovary(1)	7											65.0	56.0	59.0					7																	141750507		1828	4077	5905	141396976	SO:0001583	missense	8972			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2648A>G	7.37:g.141750507A>G	ENSP00000447378:p.Glu883Gly	Somatic		Capture	Illumina GAIIx	4	141396976	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	HMMPfam_Glyco_hydro_31;HMMPfam_Trefoil;superfamily_Trefoil;superfamily_(Trans)glycosidases	p.E883G	ENST00000549489.2	37	c.2648	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	A	10.39	1.337081	0.24253	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.89617	-2.54	5.67	4.49	0.54785	.	0.575031	0.16542	N	0.209905	D	0.82481	0.5046	L	0.31926	0.97	0.24222	N	0.995435	B	0.02656	0.0	B	0.04013	0.001	T	0.67264	-0.5714	10	0.25106	T	0.35	.	11.9001	0.52678	0.8538:0.1462:0.0:0.0	.	883	O43451	MGA_HUMAN	G	883;883;760	ENSP00000447378:E883G	ENSP00000316431:E760G	E	+	2	0	MGAM	141396976	0.932000	0.31603	0.476000	0.27291	0.723000	0.41478	2.804000	0.47931	0.958000	0.37956	0.374000	0.22700	GAG	-	NULL		0.368	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	protein_coding	OTTHUMT00000351244.3	A			141396976	1	no_errors	NM_004668	genbank	human	reviewed	54_36p	missense	SNP	0.01	G
ANGPT1	284	genome.wustl.edu	37	8	108315546	108315547	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	-	-	-	TT	-	-	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr8:108315546_108315547insTT	ENST00000520734.1	-	4	542_543	c.257_258insAA	c.(256-258)tgtfs	p.C86fs	ANGPT1_ENST00000520052.1_Frame_Shift_Ins_p.C85fs|ANGPT1_ENST00000518386.1_Intron			Q15389	ANGP1_HUMAN	angiopoietin 1	286					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)	p.C286fs*1(1)		NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			ATACATCTGCACAGTCTCTAAA	0.302																																																1	Insertion - Frameshift(1)	ovary(1)	8																																								108384723	SO:0001589	frameshift_variant	284			D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.257_258insAA	8.37:g.108315546_108315547insTT	ENSP00000430750:p.Cys86fs	Somatic		Capture	Illumina GAIIx	4	108384722	Q5HYA0	Frame_Shift_Ins	INS	HMMPfam_Fibrinogen_C;superfamily_Fibrinogen C-terminal domain-like	p.C286fs	ENST00000520734.1	37	c.858_857		8																																																																																			-	HMMPfam_Fibrinogen_C		0.302	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	ANGPT1	protein_coding	OTTHUMT00000380428.2	-	NM_001146, NM_139290		108384723	-1	no_errors	NM_001146	genbank	human	reviewed	54_36p	frame_shift_ins	INS	1.000:1.000	TT
CSPP1	79848	genome.wustl.edu	37	8	68087634	68087634	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr8:68087634G>C	ENST00000262210.5	+	24	3088	c.3057G>C	c.(3055-3057)aaG>aaC	p.K1019N	CSPP1_ENST00000412460.1_Missense_Mutation_p.K674N|CSPP1_ENST00000521168.1_3'UTR|ARFGEF1_ENST00000520381.1_3'UTR	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	1054					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)		p.K1019N(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			AGCAGCAGAAGAGGCTGAACA	0.433																																																1	Substitution - Missense(1)	ovary(1)	8											56.0	55.0	55.0					8																	68087634		1910	4120	6030	68250188	SO:0001583	missense	79848			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.3057G>C	8.37:g.68087634G>C	ENSP00000262210:p.Lys1019Asn	Somatic		Capture	Illumina GAIIx	4	68250188	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	-	p.K1054N	ENST00000262210.5	37	c.3162	CCDS43744.1	8	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595136	0.66219	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.34859	1.34;1.37;1.37	4.8	2.98	0.34508	.	0.232657	0.35291	N	0.003310	T	0.41766	0.1173	L	0.56769	1.78	0.80722	D	1	P;P;P;P	0.49783	0.928;0.726;0.928;0.835	P;B;P;P	0.50659	0.647;0.385;0.647;0.553	T	0.29458	-1.0011	10	0.46703	T	0.11	-13.3239	9.7889	0.40692	0.1734:0.0:0.8266:0.0	.	177;674;1019;1054	Q9H688;Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5	.;.;.;CSPP1_HUMAN	N	1019;1054;674;674	ENSP00000262210:K1019N;ENSP00000415782:K674N;ENSP00000430092:K674N	ENSP00000262210:K1019N	K	+	3	2	CSPP1	68250188	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	3.962000	0.56766	1.146000	0.42352	0.591000	0.81541	AAG	-	NULL		0.433	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	protein_coding	OTTHUMT00000379254.1	G	NM_024790		68250188	1	no_errors	NM_001077204	genbank	human	validated	54_36p	missense	SNP	1	C
INVS	27130	genome.wustl.edu	37	9	103004892	103004892	+	Silent	SNP	G	G	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chr9:103004892G>A	ENST00000262457.2	+	7	1022	c.837G>A	c.(835-837)aaG>aaA	p.K279K	INVS_ENST00000262456.2_Silent_p.K279K|INVS_ENST00000541287.1_Silent_p.K183K	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	279					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.K279K(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				AAAGAAATAAGTCTGGAACTA	0.363																																																1	Substitution - coding silent(1)	ovary(1)	9											118.0	120.0	119.0					9																	103004892		2203	4300	6503	102044713	SO:0001819	synonymous_variant	27130			AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.837G>A	9.37:g.103004892G>A		Somatic		Capture	Illumina GAIIx	4	102044713	A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Silent	SNP	HMMPfam_IQ;HMMPfam_Ank;superfamily_Ankyrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.K279	ENST00000262457.2	37	c.837	CCDS6746.1	9																																																																																			-	HMMPfam_Ank		0.363	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	INVS	protein_coding	OTTHUMT00000053407.1	G	NM_014425		102044713	1	no_errors	NM_014425	genbank	human	reviewed	54_36p	silent	SNP	1	A
ATXN3L	92552	genome.wustl.edu	37	X	13337344	13337344	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chrX:13337344C>T	ENST00000380622.2	-	1	1174	c.710G>A	c.(709-711)cGc>cAc	p.R237H	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	237					protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)	p.R237H(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						GGTTTCTTGGCGGCTTAGTTC	0.423																																																1	Substitution - Missense(1)	ovary(1)	X											277.0	251.0	259.0					X																	13337344		1568	3582	5150	13247265	SO:0001583	missense	92552				CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.710G>A	X.37:g.13337344C>T	ENSP00000369996:p.Arg237His	Somatic		Capture	Illumina GAIIx	4	13247265	B2RNY8	Missense_Mutation	SNP	HMMPfam_UIM;HMMPfam_Josephin	p.R237H	ENST00000380622.2	37	c.710	CCDS48080.1	X	.	.	.	.	.	.	.	.	.	.	c	12.53	1.965601	0.34659	.	.	ENSG00000123594	ENST00000380622	T	0.20598	2.06	0.793	-1.59	0.08453	Ubiquitin interacting motif (3);	0.000000	0.85682	D	0.000000	T	0.28599	0.0708	L	0.47190	1.495	0.46725	D	0.999175	D	0.89917	1.0	D	0.76071	0.987	T	0.14254	-1.0479	10	0.72032	D	0.01	.	3.0549	0.06181	0.2508:0.5416:0.0:0.2076	.	237	Q9H3M9	ATX3L_HUMAN	H	237	ENSP00000369996:R237H	ENSP00000369996:R237H	R	-	2	0	ATXN3L	13247265	0.832000	0.29368	0.001000	0.08648	0.004000	0.04260	0.425000	0.21346	-0.985000	0.03503	-0.592000	0.04112	CGC	-	HMMPfam_UIM		0.423	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN3L	protein_coding	OTTHUMT00000055785.2	C	NM_001135995		13247265	-1	no_errors	ENST00000380622	ensembl	human	known	54_36p	missense	SNP	1	T
BTK	695	genome.wustl.edu	37	X	100608315	100608315	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1489-01A-01W-0549-09	TCGA-13-1489-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	395c1d93-7216-4c9d-bfad-26ff95fb8afe	adc2fdad-5ea9-40fc-939c-52b4031226c0	g.chrX:100608315G>A	ENST00000308731.7	-	18	1938	c.1775C>T	c.(1774-1776)tCc>tTc	p.S592F	BTK_ENST00000372880.1_Missense_Mutation_p.S416F	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	592	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		S -> P (in XLA). {ECO:0000269|PubMed:8834236}.		adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)	p.S592F(1)		breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						CTTCCCCAGGGAGTAAATTTC	0.438									Agammaglobulinemia, X-linked																																							1	Substitution - Missense(1)	ovary(1)	X	GRCh37	CM003419	BTK	M							177.0	166.0	170.0					X																	100608315		2203	4300	6503	100494971	SO:0001583	missense	695	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.1775C>T	X.37:g.100608315G>A	ENSP00000308176:p.Ser592Phe	Somatic		Capture	Illumina GAIIx	4	100494971	B2RAW1|Q32ML5	Missense_Mutation	SNP	HMMPfam_SH2;HMMPfam_Pkinase_Tyr;HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_BTK;HMMPfam_PH;superfamily_Protein kinase-like (PK-like);superfamily_PH domain-like;superfamily_SH2 domain	p.S592F	ENST00000308731.7	37	c.1775	CCDS14482.1	X	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590593	0.86851	.	.	ENSG00000010671	ENST00000372880;ENST00000372855;ENST00000372859;ENST00000372860;ENST00000308731	T;D	0.89746	-0.47;-2.56	5.6	5.6	0.85130	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.052458	0.85682	D	0.000000	D	0.95714	0.8606	M	0.91459	3.21	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.87578	0.968;0.994;0.998;0.973	D	0.96573	0.9424	10	0.87932	D	0	.	17.021	0.86433	0.0:0.0:1.0:0.0	.	416;263;167;592	Q5JY90;Q3MS96;Q572P5;Q06187	.;.;.;BTK_HUMAN	F	416;141;72;167;592	ENSP00000361971:S416F;ENSP00000308176:S592F	ENSP00000308176:S592F	S	-	2	0	BTK	100494971	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.333000	0.79357	0.600000	0.82982	TCC	-	HMMPfam_Pkinase_Tyr		0.438	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	protein_coding	OTTHUMT00000057532.2	G	NM_000061		100494971	-1	no_errors	NM_000061	genbank	human	reviewed	54_36p	missense	SNP	1	A
