#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
REG4	83998	genome.wustl.edu	37	1	120337249	120337249	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:120337249G>A	ENST00000354219.1	-	7	908	c.469C>T	c.(469-471)Cga>Tga	p.R157*	REG4_ENST00000530654.1_3'UTR|REG4_ENST00000256585.5_Nonsense_Mutation_p.R157*	NM_001159352.1	NP_001152824.1	Q9BYZ8	REG4_HUMAN	regenerating islet-derived family, member 4	157						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|mannan binding (GO:2001065)	p.R157R(1)|p.R157*(1)		central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(2)|prostate(1)|skin(2)	15	all_cancers(5;4.81e-10)|all_epithelial(5;7.98e-11)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;8.1e-07)|Lung NSC(69;5.89e-06)|all_epithelial(167;0.000959)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0588)		CTCTATGGTCGGTACTTGCAC	0.428																																																2	Substitution - Nonsense(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	1											265.0	258.0	261.0					1																	120337249		2203	4300	6503	120138772	SO:0001587	stop_gained	83998			AY007243	CCDS906.1, CCDS53354.1	1p13.1-p12	2008-02-05			ENSG00000134193	ENSG00000134193			22977	protein-coding gene	gene with protein product	"""regenerating gene type IV"", "" gastrointestinal secretory protein"""	609846				11311942, 12455032	Standard	NM_032044		Approved	REG-IV, RELP, GISP	uc001eif.3	Q9BYZ8	OTTHUMG00000012175	ENST00000354219.1:c.469C>T	1.37:g.120337249G>A	ENSP00000346158:p.Arg157*	Somatic		Capture	Illumina GAIIx	4	120138772	Q8NER6|Q8NER7	Nonsense_Mutation	SNP	HMMPfam_Lectin_C;superfamily_C-type lectin-like	p.R157*	ENST00000354219.1	37	c.469	CCDS906.1	1	.	.	.	.	.	.	.	.	.	.	G	17.14	3.313976	0.60414	.	.	ENSG00000134193	ENST00000354219;ENST00000256585	.	.	.	4.92	-2.08	0.07254	.	1.071720	0.07439	N	0.896965	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	0.3763	5.325	0.15901	0.1701:0.0:0.2603:0.5696	.	.	.	.	X	157	.	ENSP00000256585:R157X	R	-	1	2	REG4	120138772	0.082000	0.21442	0.001000	0.08648	0.003000	0.03518	0.240000	0.18042	-0.584000	0.05913	-0.923000	0.02734	CGA	-	NULL		0.428	REG4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	REG4	protein_coding	OTTHUMT00000033675.1	G	NM_032044		120138772	-1	no_errors	NM_032044	genbank	human	validated	54_36p	nonsense	SNP	0.02	A
BCL9	607	genome.wustl.edu	37	1	147092631	147092631	+	Silent	SNP	G	G	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:147092631G>T	ENST00000234739.3	+	8	3410	c.2670G>T	c.(2668-2670)tcG>tcT	p.S890S		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	890	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.S890S(1)		breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					AGACTCCATCGCAGCTGGCAG	0.617			T	"""IGH@, IGL@"""	B-ALL																																		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	1	Substitution - coding silent(1)	ovary(1)	1											76.0	78.0	77.0					1																	147092631		2203	4300	6503	145559255	SO:0001819	synonymous_variant	607			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.2670G>T	1.37:g.147092631G>T		Somatic		Capture	Illumina GAIIx	4	145559255	Q5T489	Silent	SNP	-	p.S890	ENST00000234739.3	37	c.2670	CCDS30833.1	1																																																																																			-	NULL		0.617	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	protein_coding	OTTHUMT00000039468.1	G	NM_004326		145559255	1	no_errors	NM_004326	genbank	human	reviewed	54_36p	silent	SNP	0.97	T
RFX5	5993	genome.wustl.edu	37	1	151314685	151314685	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:151314685C>T	ENST00000290524.4	-	11	2006	c.1828G>A	c.(1828-1830)Gac>Aac	p.D610N	RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000452671.2_Missense_Mutation_p.D610N|RFX5_ENST00000452513.2_Missense_Mutation_p.D570N|RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000368870.2_Missense_Mutation_p.D610N	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	610					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D610N(1)		endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCTTTTGGGTCTTTATGCTCC	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											141.0	132.0	135.0					1																	151314685		2203	4300	6503	149581309	SO:0001583	missense	5993				CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.1828G>A	1.37:g.151314685C>T	ENSP00000290524:p.Asp610Asn	Somatic		Capture	Illumina GAIIx	4	149581309	B7Z848|D3DV19|E9PFU4|Q5VWC3	Missense_Mutation	SNP	-	p.D610N	ENST00000290524.4	37	c.1828	CCDS994.1	1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458628	0.84317	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000452671;ENST00000452513	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.37	5.37	0.77165	.	0.127880	0.50627	D	0.000118	T	0.58293	0.2112	M	0.64997	1.995	0.37149	D	0.902065	D;D	0.89917	1.0;0.996	D;P	0.80764	0.994;0.906	T	0.60161	-0.7317	10	0.56958	D	0.05	-19.4471	14.4852	0.67611	0.0:1.0:0.0:0.0	.	570;610	B7Z848;P48382	.;RFX5_HUMAN	N	610;610;610;570	ENSP00000290524:D610N;ENSP00000357864:D610N;ENSP00000389130:D610N;ENSP00000398388:D570N	ENSP00000290524:D610N	D	-	1	0	RFX5	149581309	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.144000	0.42197	2.806000	0.96561	0.591000	0.81541	GAC	-	NULL		0.463	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX5	protein_coding	OTTHUMT00000034892.6	C	NM_000449		149581309	-1	no_errors	NM_000449	genbank	human	reviewed	54_36p	missense	SNP	1	T
NPR1	4881	genome.wustl.edu	37	1	153659678	153659678	+	Silent	SNP	C	C	A	rs369711085		TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:153659678C>A	ENST00000368680.3	+	13	2410	c.1938C>A	c.(1936-1938)ggC>ggA	p.G646G		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	646	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)	p.G646G(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	ATTTCCAGGGCATGCTGTTTC	0.547																																					Pancreas(141;1349 1870 15144 15830 40702)											1	Substitution - coding silent(1)	ovary(1)	1											131.0	117.0	122.0					1																	153659678		2203	4300	6503	151926302	SO:0001819	synonymous_variant	4881			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.1938C>A	1.37:g.153659678C>A		Somatic		Capture	Illumina GAIIx	4	151926302	B0ZBF0|Q5SR08|Q6P4Q3	Silent	SNP	HMMPfam_Guanylate_cyc;HMMPfam_Pkinase_Tyr;HMMPfam_ANF_receptor;superfamily_Protein kinase-like (PK-like);superfamily_Periplasmic binding protein-like I;superfamily_Adenylyl and guanylyl cyclase catalytic domain	p.G646	ENST00000368680.3	37	c.1938	CCDS1051.1	1																																																																																			-	HMMPfam_Pkinase_Tyr		0.547	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR1	protein_coding	OTTHUMT00000090034.1	C	NM_000906		151926302	1	no_errors	NM_000906	genbank	human	validated	54_36p	silent	SNP	0.76	A
NTRK1	4914	genome.wustl.edu	37	1	156849010	156849010	+	Silent	SNP	C	C	T	rs148270992		TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:156849010C>T	ENST00000524377.1	+	15	1943	c.1902C>T	c.(1900-1902)gtC>gtT	p.V634V	NTRK1_ENST00000392302.2_Silent_p.V598V|NTRK1_ENST00000368196.3_Silent_p.V628V|NTRK1_ENST00000358660.3_Silent_p.V631V	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	634	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V634V(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	CTAGCCAGGTCGCTGCGGGGA	0.647			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																													Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	1	Substitution - coding silent(1)	ovary(1)	1						C	,,	1,4405	2.1+/-5.4	0,1,2202	34.0	33.0	33.0		1794,1884,1902	-6.6	0.6	1	dbSNP_134	33	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	NTRK1	NM_001007792.1,NM_001012331.1,NM_002529.3	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	598/761,628/791,634/797	156849010	1,13005	2203	4300	6503	155115634	SO:0001819	synonymous_variant	4914			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1902C>T	1.37:g.156849010C>T		Somatic		Capture	Illumina GAIIx	4	155115634	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Silent	SNP	Pkinase_Tyr;HMMPfam_Pkinase_Tyr;LRR_1;HMMPfam_LRR_1	p.V634	ENST00000524377.1	37	c.1902	CCDS1161.1	1																																																																																			-	HMMPfam_Pkinase_Tyr		0.647	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTRK1	protein_coding	OTTHUMT00000392279.1	C	NM_002529		155115634	1	no_errors	NM_002529	genbank	human	reviewed	54_36p	silent	SNP	0.99	T
KIRREL	55243	genome.wustl.edu	37	1	158061246	158061246	+	Silent	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:158061246C>T	ENST00000359209.6	+	11	1438	c.1371C>T	c.(1369-1371)acC>acT	p.T457T	KIRREL_ENST00000360089.4_Silent_p.T293T|KIRREL_ENST00000416935.2_Silent_p.T357T|KIRREL_ENST00000368172.1_Silent_p.T271T|KIRREL_ENST00000368173.3_Silent_p.T473T|KIRREL_ENST00000392272.2_Silent_p.T354T			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	457	Ig-like C2-type 5.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)	p.T293T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CCACGCTCACCATCAACAATG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	1											158.0	138.0	145.0					1																	158061246		2203	4300	6503	156327870	SO:0001819	synonymous_variant	55243			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1371C>T	1.37:g.158061246C>T		Somatic		Capture	Illumina GAIIx	4	156327870	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Silent	SNP	-	p.T293	ENST00000359209.6	37	c.879	CCDS1172.2	1																																																																																			-	NULL		0.577	KIRREL-001	KNOWN	basic|CCDS	protein_coding	KIRREL	protein_coding	OTTHUMT00000058342.3	C	NM_018240		156327870	1	no_errors	NM_018240	genbank	human	validated	54_36p	silent	SNP	1	T
CD1B	910	genome.wustl.edu	37	1	158299162	158299162	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:158299162C>A	ENST00000368168.3	-	4	991	c.884G>T	c.(883-885)tGg>tTg	p.W295L		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	295	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)		p.W295L(1)		breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					TTTCTTACTCCAGTAGAGGAT	0.552																																																1	Substitution - Missense(1)	ovary(1)	1											56.0	57.0	57.0					1																	158299162		2203	4300	6503	156565786	SO:0001583	missense	910			M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.884G>T	1.37:g.158299162C>A	ENSP00000357150:p.Trp295Leu	Somatic		Capture	Illumina GAIIx	4	156565786	Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	HMMPfam_C1-set;superfamily_MHC antigen-recognition domain;superfamily_Immunoglobulin	p.W295L	ENST00000368168.3	37	c.884	CCDS1176.1	1	.	.	.	.	.	.	.	.	.	.	C	11.64	1.698551	0.30142	.	.	ENSG00000158485	ENST00000368168	T	0.13778	2.56	4.26	3.33	0.38152	MHC class I-like antigen recognition (1);	0.204806	0.24886	N	0.034813	T	0.22322	0.0538	H	0.96365	3.81	0.36075	D	0.842387	D	0.58970	0.984	P	0.47744	0.556	T	0.36089	-0.9762	10	0.87932	D	0	-5.9007	9.4821	0.38906	0.2116:0.7884:0.0:0.0	.	295	P29016	CD1B_HUMAN	L	295	ENSP00000357150:W295L	ENSP00000357150:W295L	W	-	2	0	CD1B	156565786	1.000000	0.71417	0.998000	0.56505	0.125000	0.20455	3.174000	0.50847	1.119000	0.41883	-0.181000	0.13052	TGG	-	NULL		0.552	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1B	protein_coding	OTTHUMT00000046350.2	C	NM_001764		156565786	-1	no_errors	NM_001764	genbank	human	reviewed	54_36p	missense	SNP	0.99	A
TAS1R2	80834	genome.wustl.edu	37	1	19166493	19166493	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:19166493C>T	ENST00000375371.3	-	6	2141	c.2120G>A	c.(2119-2121)cGt>cAt	p.R707H		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	707					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.R707H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GGGGTCAGTACGGGTGGTGGG	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											128.0	135.0	133.0					1																	19166493		2203	4300	6503	19039080	SO:0001583	missense	80834				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.2120G>A	1.37:g.19166493C>T	ENSP00000364520:p.Arg707His	Somatic		Capture	Illumina GAIIx	4	19039080	Q5TZ19	Missense_Mutation	SNP	-	p.R707H	ENST00000375371.3	37	c.2120	CCDS187.1	1	.	.	.	.	.	.	.	.	.	.	C	7.323	0.617457	0.14129	.	.	ENSG00000179002	ENST00000375371	D	0.88664	-2.41	4.94	0.504	0.16946	GPCR, family 3, C-terminal (2);	0.155508	0.29707	N	0.011419	T	0.79805	0.4509	L	0.35288	1.05	0.09310	N	0.999999	B	0.21520	0.057	B	0.22601	0.04	T	0.68838	-0.5303	10	0.59425	D	0.04	.	5.422	0.16405	0.2923:0.5531:0.0:0.1546	.	707	Q8TE23	TS1R2_HUMAN	H	707	ENSP00000364520:R707H	ENSP00000364520:R707H	R	-	2	0	TAS1R2	19039080	0.000000	0.05858	0.133000	0.22050	0.119000	0.20118	0.205000	0.17356	0.095000	0.17434	0.561000	0.74099	CGT	-	NULL		0.557	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	protein_coding	OTTHUMT00000006953.1	C			19039080	-1	no_errors	NM_152232	genbank	human	validated	54_36p	missense	SNP		T
TEDDM1	127670	genome.wustl.edu	37	1	182369354	182369354	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:182369354C>G	ENST00000367565.1	-	1	397	c.267G>C	c.(265-267)aaG>aaC	p.K89N		NM_172000.3	NP_741997.3	Q5T9Z0	TEDM1_HUMAN	transmembrane epididymal protein 1	89						integral component of membrane (GO:0016021)		p.K89N(1)		haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)	7						GCAGCACATTCTTGCTCATGA	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											169.0	159.0	162.0					1																	182369354		2203	4300	6503	180635977	SO:0001583	missense	127670			AJ515384	CCDS30953.1	1q25.3	2009-09-17		2005-08-09	ENSG00000203730	ENSG00000203730			30233	protein-coding gene	gene with protein product	"""putative membrane protein HE9"", ""transmembrane protein 45C"", ""epididymal protein 9"""						Standard	NM_172000		Approved	HE9, Epdd1, TMEM45C, EDDM9	uc001gpe.3	Q5T9Z0	OTTHUMG00000037398	ENST00000367565.1:c.267G>C	1.37:g.182369354C>G	ENSP00000356536:p.Lys89Asn	Somatic		Capture	Illumina GAIIx	4	180635977	Q8IVJ0	Missense_Mutation	SNP	-	p.K89N	ENST00000367565.1	37	c.267	CCDS30953.1	1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.612252	0.28712	.	.	ENSG00000203730	ENST00000367565	T	0.46819	0.86	5.26	4.36	0.52297	.	0.493751	0.19757	N	0.106753	T	0.36771	0.0979	L	0.52573	1.65	0.33401	D	0.577317	P	0.44627	0.839	B	0.36134	0.218	T	0.49643	-0.8918	10	0.18276	T	0.48	-20.2773	11.6981	0.51554	0.0:0.9149:0.0:0.0851	.	89	Q5T9Z0	TEDM1_HUMAN	N	89	ENSP00000356536:K89N	ENSP00000356536:K89N	K	-	3	2	TEDDM1	180635977	0.951000	0.32395	0.988000	0.46212	0.035000	0.12851	0.934000	0.28910	1.451000	0.47736	0.655000	0.94253	AAG	-	NULL		0.502	TEDDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEDDM1	protein_coding	OTTHUMT00000091029.1	C	NM_172000		180635977	-1	no_errors	NM_172000	genbank	human	validated	54_36p	missense	SNP	0.06	G
NBL1	4681	genome.wustl.edu	37	1	19981859	19981859	+	Silent	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:19981859C>T	ENST00000375136.3	+	3	516	c.213C>T	c.(211-213)acC>acT	p.T71T	NBL1_ENST00000548815.1_Silent_p.T70T|NBL1_ENST00000289749.2_Silent_p.T106T|MINOS1-NBL1_ENST00000602662.1_Silent_p.T71T	NM_001204085.1|NM_001204089.1|NM_001278164.1|NM_001278166.1	NP_001191014.1|NP_001191018.1|NP_001265093.1|NP_001265095.1	P41271	NBL1_HUMAN	neuroblastoma 1, DAN family BMP antagonist	71	CTCK.				determination of dorsal identity (GO:0048263)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of monocyte chemotaxis (GO:0090027)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)|positive regulation of neuron differentiation (GO:0045666)|sequestering of BMP from receptor via BMP binding (GO:0038098)|sequestering of BMP in extracellular matrix (GO:0035582)	extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)	p.T70T(1)		lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00043)|Ovarian(437;0.00373)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.9e-05)|Kidney(64;0.000173)|GBM - Glioblastoma multiforme(114;0.0012)|KIRC - Kidney renal clear cell carcinoma(64;0.0026)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TCCCCAACACCTTCCCACAGT	0.612																																																1	Substitution - coding silent(1)	ovary(1)	1											218.0	153.0	175.0					1																	19981859		2203	4300	6503	19854446	SO:0001819	synonymous_variant	4681				CCDS196.1, CCDS41278.1, CCDS196.2, CCDS72720.1	1p36.3-p36.2	2013-02-26	2013-02-26		ENSG00000158747	ENSG00000158747			7650	protein-coding gene	gene with protein product	"""neuroblastoma candidate region, suppression of tumorigenicity 1"", ""neuroblastoma suppressor of tumorigenicity 1"", ""differential screening-selected gene aberrant in neuroblastoma"""	600613	"""neuroblastoma, suppression of tumorigenicity 1"""			7633401	Standard	NM_182744		Approved	D1S1733E, NB, DAN, NO3, DAND1	uc001bcj.2	P41271	OTTHUMG00000002700	ENST00000375136.3:c.213C>T	1.37:g.19981859C>T		Somatic		Capture	Illumina GAIIx	4	19854446	A3KFI7|Q5TGZ2|Q5U0N4|Q96L68	Silent	SNP	-	p.T106	ENST00000375136.3	37	c.318	CCDS196.2	1																																																																																			-	NULL		0.612	NBL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBL1	protein_coding	OTTHUMT00000007681.4	C	NM_005380		19854446	1	no_errors	NM_182744	genbank	human	reviewed	54_36p	silent	SNP	1	T
NR5A2	2494	genome.wustl.edu	37	1	200089981	200089981	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:200089981A>C	ENST00000367362.3	+	7	1522	c.1276A>C	c.(1276-1278)Aac>Cac	p.N426H	NR5A2_ENST00000544748.1_Missense_Mutation_p.N354H|NR5A2_ENST00000236914.3_Missense_Mutation_p.N380H	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	426					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.N426H(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					CACCCTCAACAACCTCATGAG	0.413																																					Melanoma(179;1138 2773 15678 26136)											1	Substitution - Missense(1)	ovary(1)	1											178.0	149.0	159.0					1																	200089981		2203	4300	6503	198356604	SO:0001583	missense	2494			U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.1276A>C	1.37:g.200089981A>C	ENSP00000356331:p.Asn426His	Somatic		Capture	Illumina GAIIx	4	198356604	B4E2P3|O95642|Q147U3	Missense_Mutation	SNP	superfamily_Nuclear receptor ligand-binding domain;superfamily_Glucocorticoid receptor-like (DNA-binding domain);HMMPfam_Hormone_recep;HMMPfam_zf-C4	p.N426H	ENST00000367362.3	37	c.1276	CCDS1401.1	1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.013604	0.75161	.	.	ENSG00000116833	ENST00000367362;ENST00000236914;ENST00000544748	D;D;D	0.96619	-4.07;-4.07;-4.07	5.72	5.72	0.89469	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.121727	0.85682	D	0.000000	D	0.95059	0.8400	L	0.38531	1.155	0.58432	D	0.999999	P;B	0.47350	0.894;0.251	P;B	0.49226	0.603;0.389	D	0.94305	0.7540	9	.	.	.	.	16.3625	0.83273	1.0:0.0:0.0:0.0	.	380;426	F1D8R9;O00482	.;NR5A2_HUMAN	H	426;380;354	ENSP00000356331:N426H;ENSP00000236914:N380H;ENSP00000439116:N354H	.	N	+	1	0	NR5A2	198356604	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.237000	0.78164	2.319000	0.78375	0.524000	0.50904	AAC	-	HMMPfam_Hormone_recep		0.413	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR5A2	protein_coding	OTTHUMT00000086497.2	A			198356604	1	no_errors	NM_205860	genbank	human	validated	54_36p	missense	SNP	1	C
CACNA1S	779	genome.wustl.edu	37	1	201060858	201060858	+	Silent	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:201060858G>A	ENST00000362061.3	-	5	830	c.604C>T	c.(604-606)Ctg>Ttg	p.L202L	CACNA1S_ENST00000367338.3_Silent_p.L202L	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	202					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.L202L(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AAGAGGACCAGCAGGGCGATG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											92.0	75.0	81.0					1																	201060858		2203	4300	6503	199327481	SO:0001819	synonymous_variant	779			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.604C>T	1.37:g.201060858G>A		Somatic		Capture	Illumina GAIIx	4	199327481	A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	HMMPfam_Ion_trans;HMMPfam_Ca_chan_IQ;superfamily_EF-hand;superfamily_Voltage-gated potassium channels	p.L202	ENST00000362061.3	37	c.604	CCDS1407.1	1																																																																																			-	HMMPfam_Ion_trans		0.562	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	protein_coding	OTTHUMT00000087049.1	G	NM_000069		199327481	-1	no_errors	NM_000069	genbank	human	reviewed	54_36p	silent	SNP	1	A
RYR2	6262	genome.wustl.edu	37	1	237965198	237965198	+	Silent	SNP	A	A	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:237965198A>T	ENST00000366574.2	+	98	14450	c.14133A>T	c.(14131-14133)ggA>ggT	p.G4711G	RYR2_ENST00000360064.6_Silent_p.G4717G|RYR2_ENST00000542537.1_Silent_p.G4695G	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4711					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.G4709G(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGAAACTAGGAGTCGTTTTCA	0.388																																																1	Substitution - coding silent(1)	ovary(1)	1											108.0	100.0	103.0					1																	237965198		1872	4120	5992	236031821	SO:0001819	synonymous_variant	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14133A>T	1.37:g.237965198A>T		Somatic		Capture	Illumina GAIIx	4	236031821	Q15411|Q546N8|Q5T3P2	Silent	SNP	HMMPfam_RYDR_ITPR;HMMPfam_efhand;HMMPfam_RyR;HMMPfam_MIR;HMMPfam_SPRY;HMMPfam_Ion_trans;HMMPfam_RR_TM4-6;HMMPfam_RIH_assoc;HMMPfam_Ins145_P3_rec;superfamily_EF-hand;superfamily_MIR domain (Pfam 02815)	p.G4711	ENST00000366574.2	37	c.14133	CCDS55691.1	1																																																																																			-	NULL		0.388	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	A	NM_001035		236031821	1	no_errors	NM_001035	genbank	human	reviewed	54_36p	silent	SNP	1	T
RPA2	6118	genome.wustl.edu	37	1	28241136	28241136	+	5'UTR	SNP	A	A	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:28241136A>C	ENST00000373912.3	-	0	118				RPA2_ENST00000313433.7_5'Flank|RPA2_ENST00000373909.3_Splice_Site	NM_002946.3	NP_002937.1	P15927	RFA2_HUMAN	replication protein A2, 32kDa						base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of DNA damage checkpoint (GO:2000001)|regulation of double-strand break repair via homologous recombination (GO:0010569)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|enzyme binding (GO:0019899)|protein phosphatase binding (GO:0019903)|single-stranded DNA binding (GO:0003697)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(3)|skin(1)	11		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		ATCGGTGCTCACGGATGCTAC	0.607								Direct reversal of damage;Nucleotide excision repair (NER)																																								0			1											34.0	31.0	32.0					1																	28241136		876	1991	2867	28113723	SO:0001623	5_prime_UTR_variant	6118			BC021257	CCDS314.1, CCDS72740.1	1p35	2008-02-05	2002-08-29		ENSG00000117748	ENSG00000117748			10290	protein-coding gene	gene with protein product		179836	"""replication protein A2 (32kD)"""			8454588	Standard	XM_005245965		Approved		uc001bpe.1	P15927	OTTHUMG00000003915	ENST00000373912.3:c.-182T>G	1.37:g.28241136A>C		Somatic		Capture	Illumina GAIIx	4	28113723	Q52II0|Q5TEI9|Q5TEJ5	Splice_Site	SNP	-	e1+2	ENST00000373912.3	37	c.34+2	CCDS314.1	1	.	.	.	.	.	.	.	.	.	.	A	8.182	0.794158	0.16327	.	.	ENSG00000117748	ENST00000373909	.	.	.	4.96	-0.482	0.12078	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.99999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.3214	0.32132	0.4546:0.0:0.5454:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RPA2	28113723	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-0.115000	0.10741	-0.201000	0.10284	0.460000	0.39030	.	-	-		0.607	RPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA2	protein_coding	OTTHUMT00000011179.1	A	NM_002946		28113723	-1	no_errors	ENST00000373909	ensembl	human	known	54_36p	splice_site	SNP		C
PTCH2	8643	genome.wustl.edu	37	1	45297700	45297700	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:45297700T>A	ENST00000372192.3	-	4	602	c.472A>T	c.(472-474)Aaa>Taa	p.K158*	PTCH2_ENST00000447098.2_Nonsense_Mutation_p.K158*	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	158					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)	p.K158*(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					TAGCAGATTTTGTTCAAATCC	0.522									Basal Cell Nevus syndrome																																							1	Substitution - Nonsense(1)	ovary(1)	1											85.0	89.0	88.0					1																	45297700		2203	4300	6503	45070287	SO:0001587	stop_gained	8643	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.472A>T	1.37:g.45297700T>A	ENSP00000361266:p.Lys158*	Somatic		Capture	Illumina GAIIx	4	45070287	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Nonsense_Mutation	SNP	Patched;HMMPfam_Patched	p.K158*	ENST00000372192.3	37	c.472	CCDS516.1	1	.	.	.	.	.	.	.	.	.	.	T	31	5.096764	0.94197	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	.	.	.	4.52	4.52	0.55395	.	0.000000	0.50627	D	0.000108	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-20.4993	12.9626	0.58466	0.0:0.0:0.0:1.0	.	.	.	.	X	158	.	ENSP00000361266:K158X	K	-	1	0	PTCH2	45070287	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.431000	0.59915	1.898000	0.54952	0.459000	0.35465	AAA	-	HMMPfam_Patched		0.522	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCH2	protein_coding	OTTHUMT00000023428.4	T	NM_003738		45070287	-1	no_errors	NM_003738	genbank	human	validated	54_36p	nonsense	SNP	1	A
MAST2	23139	genome.wustl.edu	37	1	46491441	46491441	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:46491441T>A	ENST00000361297.2	+	16	2156	c.1873T>A	c.(1873-1875)Tac>Aac	p.Y625N	MAST2_ENST00000372009.2_Missense_Mutation_p.Y555N	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2									p.Y625N(2)		breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GGCCCTGGAGTACTTACACAA	0.547																																																2	Substitution - Missense(2)	ovary(2)	1											160.0	165.0	163.0					1																	46491441		2201	4300	6501	46264028	SO:0001583	missense	23139			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.1873T>A	1.37:g.46491441T>A	ENSP00000354671:p.Tyr625Asn	Somatic		Capture	Illumina GAIIx	4	46264028		Missense_Mutation	SNP	-	p.Y625N	ENST00000361297.2	37	c.1873	CCDS41326.1	1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.839921	0.91117	.	.	ENSG00000086015	ENST00000361297;ENST00000372009;ENST00000432341;ENST00000372008	T;T;T	0.75154	-0.91;-0.91;-0.91	5.06	5.06	0.68205	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.062606	0.64402	D	0.000003	D	0.88396	0.6425	M	0.90483	3.12	0.80722	D	1	D;D;D;D	0.89917	0.997;0.998;1.0;1.0	D;D;D;D	0.91635	0.991;0.989;0.999;0.999	D	0.90956	0.4809	10	0.87932	D	0	-15.2255	15.1319	0.72530	0.0:0.0:0.0:1.0	.	555;299;555;625	Q6P0Q8-2;E7EWL1;E7ERL6;Q6P0Q8	.;.;.;MAST2_HUMAN	N	625;555;299;510	ENSP00000354671:Y625N;ENSP00000361079:Y555N;ENSP00000361078:Y510N	ENSP00000354671:Y625N	Y	+	1	0	MAST2	46264028	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.036000	0.88901	2.028000	0.59812	0.533000	0.62120	TAC	-	NULL		0.547	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	protein_coding	OTTHUMT00000021977.1	T	NM_015112		46264028	1	no_errors	NM_015112	genbank	human	validated	54_36p	missense	SNP	1	A
LRRIQ3	127255	genome.wustl.edu	37	1	74506970	74506970	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:74506970T>A	ENST00000395089.1	-	6	1644	c.1645A>T	c.(1645-1647)Agc>Tgc	p.S549C	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.S549C			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	549								p.S549C(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						ACAATCAGGCTTTTCTCTTTT	0.308																																																1	Substitution - Missense(1)	ovary(1)	1											74.0	70.0	71.0					1																	74506970		1799	4062	5861	74279558	SO:0001583	missense	127255			BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1645A>T	1.37:g.74506970T>A	ENSP00000378524:p.Ser549Cys	Somatic		Capture	Illumina GAIIx	4	74279558	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	-	p.S549C	ENST00000395089.1	37	c.1645	CCDS41350.1	1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.383985	0.42308	.	.	ENSG00000162620	ENST00000395089;ENST00000354431	T;T	0.09445	2.98;2.98	5.86	-7.02	0.01589	.	.	.	.	.	T	0.02494	0.0076	N	0.24115	0.695	0.09310	N	1	D	0.59357	0.985	B	0.43103	0.408	T	0.15150	-1.0447	9	0.59425	D	0.04	.	12.033	0.53408	0.1435:0.0:0.601:0.2555	.	549	A6PVS8	LRIQ3_HUMAN	C	549	ENSP00000378524:S549C;ENSP00000346414:S549C	ENSP00000346414:S549C	S	-	1	0	LRRIQ3	74279558	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.217000	0.02979	-1.506000	0.01805	0.528000	0.53228	AGC	-	NULL		0.308	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRIQ3	protein_coding	OTTHUMT00000316539.1	T	NM_145258		74279558	-1	no_errors	NM_001105659	genbank	human	inferred	54_36p	missense	SNP	0.02	A
COL24A1	255631	genome.wustl.edu	37	1	86524812	86524812	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:86524812C>A	ENST00000370571.2	-	9	2164	c.1798G>T	c.(1798-1800)Ggc>Tgc	p.G600C	COL24A1_ENST00000436319.1_Missense_Mutation_p.G600C	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	600	Collagen-like 2.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.G600C(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		ACCTGCCTGCCAGGGTAACCG	0.323																																																1	Substitution - Missense(1)	ovary(1)	1											51.0	48.0	49.0					1																	86524812		1829	4121	5950	86297400	SO:0001583	missense	255631			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.1798G>T	1.37:g.86524812C>A	ENSP00000359603:p.Gly600Cys	Somatic		Capture	Illumina GAIIx	4	86297400	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	-	p.G600C	ENST00000370571.2	37	c.1798	CCDS41353.1	1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.923260	0.52653	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.99369	-5.78;-5.78	5.68	5.68	0.88126	.	0.183995	0.26662	N	0.023143	D	0.99687	0.9882	H	0.96916	3.905	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97744	1.0210	10	0.87932	D	0	.	17.5819	0.87971	0.0:1.0:0.0:0.0	.	600;600	F8WDM8;Q17RW2	.;COOA1_HUMAN	C	600	ENSP00000359603:G600C;ENSP00000392531:G600C	ENSP00000359603:G600C	G	-	1	0	COL24A1	86297400	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.856000	0.69518	2.677000	0.91161	0.563000	0.77884	GGC	-	NULL		0.323	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL24A1	protein_coding	OTTHUMT00000029335.4	C	NM_152890		86297400	-1	no_errors	NM_152890	genbank	human	validated	54_36p	missense	SNP	1	A
ADSS	159	genome.wustl.edu	37	1	244587341	244587341	+	Silent	SNP	G	G	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:244587341G>T	ENST00000366535.3	-	6	811	c.495C>A	c.(493-495)ggC>ggA	p.G165G	ADSS_ENST00000462358.1_5'UTR	NM_001126.3	NP_001117.2			adenylosuccinate synthase									p.G165G(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(71;2.17e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)	all_cancers(173;0.0896)|all_epithelial(177;0.172)	all cancers(7;9.71e-08)|GBM - Glioblastoma multiforme(7;1.28e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.0014)			CTGGGCCAATGCCCTTTTTTG	0.423																																																1	Substitution - coding silent(1)	ovary(1)	1											59.0	56.0	57.0					1																	244587341		2203	4300	6503	242653964	SO:0001819	synonymous_variant	159			BC012356	CCDS1624.1	1q44	2008-02-05			ENSG00000035687	ENSG00000035687	6.3.4.4		292	protein-coding gene	gene with protein product		103060				2004783, 1592113	Standard	NM_001126		Approved		uc001iaj.3	P30520	OTTHUMG00000040102	ENST00000366535.3:c.495C>A	1.37:g.244587341G>T		Somatic		Capture	Illumina GAIIx	4	242653964		Silent	SNP	HMMPfam_Adenylsucc_synt;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.G165	ENST00000366535.3	37	c.495	CCDS1624.1	1																																																																																			-	HMMPfam_Adenylsucc_synt		0.423	ADSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADSS	protein_coding	OTTHUMT00000096697.1	G	NM_001126		242653964	-1	no_errors	NM_001126	genbank	human	reviewed	54_36p	silent	SNP	0.85	T
PARD3	56288	genome.wustl.edu	37	10	34620237	34620248	+	In_Frame_Del	DEL	GACCCAGGGAAG	GACCCAGGGAAG	-	rs372479448		TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	GACCCAGGGAAG	GACCCAGGGAAG	GACCCAGGGAAG	-	GACCCAGGGAAG	GACCCAGGGAAG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr10:34620237_34620248delGACCCAGGGAAG	ENST00000374789.3	-	19	2964_2975	c.2639_2650delCTTCCCTGGGTC	c.(2638-2652)ccttccctgggtctg>ctg	p.PSLG880del	PARD3_ENST00000374794.3_In_Frame_Del_p.PSLG805del|PARD3_ENST00000374776.1_In_Frame_Del_p.PSLG834del|PARD3_ENST00000374788.3_In_Frame_Del_p.PSLG877del|PARD3_ENST00000350537.4_In_Frame_Del_p.PSLG834del|PARD3_ENST00000544292.1_In_Frame_Del_p.PSLG593del|PARD3_ENST00000545260.1_In_Frame_Del_p.PSLG790del|PARD3_ENST00000340077.5_In_Frame_Del_p.PSLG877del|PARD3_ENST00000346874.4_In_Frame_Del_p.PSLG880del|PARD3_ENST00000374790.3_In_Frame_Del_p.PSLG820del|PARD3_ENST00000545693.1_In_Frame_Del_p.PSLG864del|PARD3_ENST00000466092.1_5'UTR|PARD3_ENST00000374773.1_In_Frame_Del_p.PSLG847del	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	880	Interacts with PRKCI and PRKCZ. {ECO:0000250}.				apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.P880_G883del(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				GACTTCTTCAGACCCAGGGAAGGACCCACATC	0.472																																																1	Deletion - In frame(1)	ovary(1)	10																																								34660254	SO:0001651	inframe_deletion	56288			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.2639_2650delCTTCCCTGGGTC	10.37:g.34620237_34620248delGACCCAGGGAAG	ENSP00000363921:p.Pro880_Gly883del	Somatic		Capture	Illumina GAIIx	4	34660243	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	In_Frame_Del	DEL	HMMPfam_PDZ;superfamily_PDZ domain-like	p.PSLG880in_frame_del	ENST00000374789.3	37	c.2650_2639	CCDS7178.1	10																																																																																			(deletion:cds_exon[34660051;34660278])	NULL		0.472	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD3	protein_coding	OTTHUMT00000047527.1	GACCCAGGGAAG	NM_019619		34660254	-1	no_errors	NM_019619	genbank	human	provisional	54_36p	in_frame_del	DEL	0.997:0.994:1.000:1.000:0.998:1.000:1.000:1.000:1.000:1.000:0.885:1.000	-
ANAPC16	119504	genome.wustl.edu	37	10	73983804	73983804	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr10:73983804G>C	ENST00000299381.4	+	2	250	c.132G>C	c.(130-132)gaG>gaC	p.E44D	ANAPC16_ENST00000470481.2_3'UTR	NM_001242546.1|NM_001242547.1|NM_001242548.1|NM_173473.3	NP_001229475.1|NP_001229476.1|NP_001229477.1|NP_775744.1	Q96DE5	APC16_HUMAN	anaphase promoting complex subunit 16	44					mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	anaphase-promoting complex (GO:0005680)|cytoplasm (GO:0005737)		p.E44D(1)		large_intestine(1)|ovary(1)	2						GAGCTGGAGAGATGTTAGAAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	10											122.0	118.0	119.0					10																	73983804		2203	4300	6503	73653810	SO:0001583	missense	119504			BC009530	CCDS7314.1, CCDS73147.1	10q22.2	2011-08-12	2010-04-06	2010-04-06	ENSG00000166295	ENSG00000166295		"""Anaphase promoting complex subunits"""	26976	protein-coding gene	gene with protein product	"""centromere protein 27"""	613427	"""chromosome 10 open reading frame 104"""	C10orf104		14702039, 20360068	Standard	NM_001242546		Approved	bA570G20.3, FLJ33728, APC16, CENP-27	uc021psp.1	Q96DE5	OTTHUMG00000018433	ENST00000299381.4:c.132G>C	10.37:g.73983804G>C	ENSP00000299381:p.Glu44Asp	Somatic		Capture	Illumina GAIIx	4	73653810		Missense_Mutation	SNP	-	p.E44D	ENST00000299381.4	37	c.132	CCDS7314.1	10	.	.	.	.	.	.	.	.	.	.	G	12.98	2.099916	0.37048	.	.	ENSG00000166295	ENST00000299381	.	.	.	6.02	2.84	0.33178	.	0.000000	0.85682	D	0.000000	T	0.29389	0.0732	N	0.08118	0	0.58432	D	0.999991	B	0.20261	0.043	B	0.14023	0.01	T	0.10989	-1.0606	9	0.87932	D	0	.	7.7891	0.29110	0.408:0.0:0.592:0.0	.	44	Q96DE5	APC16_HUMAN	D	44	.	ENSP00000299381:E44D	E	+	3	2	ANAPC16	73653810	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.623000	0.46435	0.886000	0.36113	-0.137000	0.14449	GAG	-	NULL		0.438	ANAPC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf104	protein_coding	OTTHUMT00000048565.2	G	NM_173473		73653810	1	no_errors	NM_173473	genbank	human	validated	54_36p	missense	SNP	1	C
CADM1	23705	genome.wustl.edu	37	11	115049427	115049427	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr11:115049427C>A	ENST00000452722.3	-	9	1167	c.1147G>T	c.(1147-1149)Gtg>Ttg	p.V383L	CADM1_ENST00000542447.2_Missense_Mutation_p.V355L|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000331581.6_Missense_Mutation_p.V412L|CADM1_ENST00000536727.1_Missense_Mutation_p.V384L|CADM1_ENST00000537058.1_Missense_Mutation_p.V394L	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.V383L(1)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		AACACCACCACCGCCACGACG	0.532																																																1	Substitution - Missense(1)	ovary(1)	11											138.0	120.0	126.0					11																	115049427		2201	4296	6497	114554637	SO:0001583	missense	23705			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1147G>T	11.37:g.115049427C>A	ENSP00000395359:p.Val383Leu	Somatic		Capture	Illumina GAIIx	4	114554637		Missense_Mutation	SNP	HMMPfam_V-set;HMMPfam_ig;HMMPfam_C2-set_2;superfamily_Immunoglobulin	p.V383L	ENST00000452722.3	37	c.1147	CCDS8373.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.07|16.07	3.017385|3.017385	0.54576|0.54576	.|.	.|.	ENSG00000182985|ENSG00000182985	ENST00000545380|ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000541325	.|T;T;T;T;T	.|0.61510	.|0.1;0.1;0.1;0.1;0.1	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.71333|0.71333	0.3327|0.3327	L|L	0.60904|0.60904	1.88|1.88	0.80722|0.80722	D|D	1|1	.|D;D;P;D	.|0.69078	.|0.997;0.994;0.876;0.984	.|D;D;B;D	.|0.79784	.|0.993;0.97;0.412;0.935	T|T	0.64761|0.64761	-0.6331|-0.6331	5|10	.|0.16896	.|T	.|0.51	.|.	18.4828|18.4828	0.90818|0.90818	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|394;356;383;355	.|F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.|.;.;CADM1_HUMAN;.	V|L	353|355;383;394;384;314;412;68	.|ENSP00000439176:V355L;ENSP00000395359:V383L;ENSP00000439817:V394L;ENSP00000440322:V384L;ENSP00000329797:V412L	.|ENSP00000329797:V412L	G|V	-|-	2|1	0|0	CADM1|CADM1	114554637|114554637	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.569000|5.569000	0.67391|0.67391	2.617000|2.617000	0.88574|0.88574	0.655000|0.655000	0.94253|0.94253	GGT|GTG	-	NULL		0.532	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CADM1	protein_coding	OTTHUMT00000398753.2	C	NM_014333		114554637	-1	no_errors	NM_014333	genbank	human	validated	54_36p	missense	SNP	1	A
OLFML1	283298	genome.wustl.edu	37	11	7509633	7509633	+	Silent	SNP	T	T	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr11:7509633T>A	ENST00000329293.3	+	2	799	c.405T>A	c.(403-405)acT>acA	p.T135T	CTD-2516F10.2_ENST00000530201.1_RNA|OLFML1_ENST00000528758.1_Intron|OLFML1_ENST00000530135.1_Silent_p.T135T	NM_198474.3	NP_940876.2	Q6UWY5	OLFL1_HUMAN	olfactomedin-like 1	135						extracellular region (GO:0005576)		p.T135T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(3)|prostate(2)	24				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		AGATCCGGACTCTGCTGAATG	0.458																																																1	Substitution - coding silent(1)	ovary(1)	11											56.0	52.0	53.0					11																	7509633		2201	4296	6497	7466209	SO:0001819	synonymous_variant	283298			AY358591	CCDS7779.1	11p15	2008-02-05			ENSG00000183801	ENSG00000183801			24473	protein-coding gene	gene with protein product							Standard	NM_198474		Approved	UNQ564	uc001mfi.3	Q6UWY5	OTTHUMG00000165527	ENST00000329293.3:c.405T>A	11.37:g.7509633T>A		Somatic		Capture	Illumina GAIIx	4	7466209	B4DP03|Q569G4	Silent	SNP	-	p.T135	ENST00000329293.3	37	c.405	CCDS7779.1	11																																																																																			-	NULL		0.458	OLFML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML1	protein_coding	OTTHUMT00000384656.1	T	NM_198474		7466209	1	no_errors	NM_198474	genbank	human	provisional	54_36p	silent	SNP	0.29	A
LRRC4C	57689	genome.wustl.edu	37	11	40136253	40136253	+	Silent	SNP	A	A	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr11:40136253A>T	ENST00000278198.2	-	2	3553	c.1590T>A	c.(1588-1590)atT>atA	p.I530I	LRRC4C_ENST00000530763.1_Silent_p.I530I|LRRC4C_ENST00000527150.1_Silent_p.I530I|LRRC4C_ENST00000528697.1_Silent_p.I530I			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	530					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.I530I(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				CAAAACACCCAATGATGATTT	0.473																																																1	Substitution - coding silent(1)	ovary(1)	11											163.0	139.0	147.0					11																	40136253		2203	4300	6503	40092829	SO:0001819	synonymous_variant	57689			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1590T>A	11.37:g.40136253A>T		Somatic		Capture	Illumina GAIIx	4	40092829	A8K0T1|Q7L0N3	Silent	SNP	HMMPfam_LRRNT;HMMPfam_LRR_1;HMMPfam_I-set;superfamily_Immunoglobulin;superfamily_L domain-like	p.I530	ENST00000278198.2	37	c.1590	CCDS31464.1	11																																																																																			-	NULL		0.473	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC4C	protein_coding	OTTHUMT00000389499.1	A	NM_020929		40092829	-1	no_errors	NM_020929	genbank	human	validated	54_36p	silent	SNP	1	T
OR5AK2	390181	genome.wustl.edu	37	11	56757317	56757317	+	Nonstop_Mutation	SNP	A	A	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr11:56757317A>C	ENST00000326855.2	+	1	971	c.929A>C	c.(928-930)tAa>tCa	p.*310S		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.*310S(1)		breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						AAGTTATTTTAAATCAGCCCC	0.299																																																1	Nonstop extension(1)	ovary(1)	11											15.0	15.0	15.0					11																	56757317		1911	4053	5964	56513893	SO:0001578	stop_lost	390181			AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.929A>C	11.37:g.56757317A>C	ENSP00000322784:p.*310Serext*6	Somatic		Capture	Illumina GAIIx	4	56513893	B2RNZ9	Nonstop_Mutation	SNP	-	p.*310S	ENST00000326855.2	37	c.929	CCDS31538.1	11	.	.	.	.	.	.	.	.	.	.	A	6.664	0.490997	0.12702	.	.	ENSG00000181273	ENST00000326855	.	.	.	4.5	0.396	0.16309	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.9344	0.19156	0.5687:0.0:0.4313:0.0	.	.	.	.	S	310	.	.	X	+	2	2	OR5AK2	56513893	.	.	0.001000	0.08648	0.005000	0.04900	.	.	0.215000	0.20761	0.329000	0.21502	TAA	-	NULL		0.299	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AK2	protein_coding	OTTHUMT00000392446.1	A	NM_001005323		56513893	1	no_errors	NM_001005323	genbank	human	provisional	54_36p	nonstop	SNP		C
SYVN1	84447	genome.wustl.edu	37	11	64897274	64897274	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr11:64897274G>A	ENST00000377190.3	-	14	1616	c.1522C>T	c.(1522-1524)Cgt>Tgt	p.R508C	SYVN1_ENST00000307289.6_Missense_Mutation_p.R456C|SYVN1_ENST00000526060.1_Missense_Mutation_p.R507C|SYVN1_ENST00000294256.8_Missense_Mutation_p.R507C|SYVN1_ENST00000526121.1_5'Flank	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	508					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)	p.R508C(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						TGGATGTTACGCAGGCTCTGC	0.652																																																1	Substitution - Missense(1)	ovary(1)	11											52.0	56.0	54.0					11																	64897274		2201	4297	6498	64653850	SO:0001583	missense	84447			AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.1522C>T	11.37:g.64897274G>A	ENSP00000366395:p.Arg508Cys	Somatic		Capture	Illumina GAIIx	4	64653850	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;superfamily_RING/U-box	p.R508C	ENST00000377190.3	37	c.1522	CCDS31605.1	11	.	.	.	.	.	.	.	.	.	.	G	18.45	3.627521	0.66901	.	.	ENSG00000162298	ENST00000377190;ENST00000294256;ENST00000434219;ENST00000307289;ENST00000526060	T;T;T;T	0.12361	2.7;2.69;2.84;2.69	4.75	4.75	0.60458	.	0.147219	0.48767	D	0.000175	T	0.26702	0.0653	M	0.72118	2.19	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.996;0.993	P;P;B	0.50754	0.649;0.649;0.446	T	0.03043	-1.1079	10	0.72032	D	0.01	-15.1207	15.2759	0.73742	0.0:0.0:1.0:0.0	.	456;507;508	Q86TM6-2;Q86TM6-3;Q86TM6	.;.;SYVN1_HUMAN	C	508;507;508;456;507	ENSP00000366395:R508C;ENSP00000294256:R507C;ENSP00000302035:R456C;ENSP00000436984:R507C	ENSP00000294256:R507C	R	-	1	0	SYVN1	64653850	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.055000	0.93873	2.493000	0.84123	0.561000	0.74099	CGT	-	NULL		0.652	SYVN1-001	KNOWN	basic|CCDS	protein_coding	SYVN1	protein_coding	OTTHUMT00000385274.1	G	NM_032431		64653850	-1	no_errors	NM_172230	genbank	human	reviewed	54_36p	missense	SNP	1	A
FCHSD2	9873	genome.wustl.edu	37	11	72554254	72554254	+	Silent	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr11:72554254C>T	ENST00000409418.4	-	16	2030	c.1647G>A	c.(1645-1647)acG>acA	p.T549T	FCHSD2_ENST00000311172.7_Silent_p.T493T|FCHSD2_ENST00000458644.2_Silent_p.T413T|FCHSD2_ENST00000409263.1_5'UTR|ATG16L2_ENST00000534905.1_3'UTR|FCHSD2_ENST00000409853.1_Silent_p.T493T|FCHSD2_ENST00000409314.1_Silent_p.T573T	NM_014824.2	NP_055639.2	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	549								p.T493T(1)		endometrium(2)|large_intestine(11)|lung(5)|ovary(2)|prostate(1)|skin(1)	22			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			AATTGCTGGACGTGTGTGACC	0.517																																																1	Substitution - coding silent(1)	ovary(1)	11											113.0	97.0	102.0					11																	72554254		2200	4293	6493	72231902	SO:0001819	synonymous_variant	9873			AB018312	CCDS8218.2	11q13.3	2008-02-05	2004-04-14	2004-04-16	ENSG00000137478	ENSG00000137478			29114	protein-coding gene	gene with protein product			"""SH3 multiple domains 3"""	SH3MD3		9872452, 15067381	Standard	NM_014824		Approved	KIAA0769	uc009ytl.3	O94868	OTTHUMG00000153082	ENST00000409418.4:c.1647G>A	11.37:g.72554254C>T		Somatic		Capture	Illumina GAIIx	4	72231902	B4DNI3|Q7L8J9|Q8WVM2|Q96FV7|Q9UF77	Silent	SNP	-	p.T493	ENST00000409418.4	37	c.1479	CCDS8218.2	11																																																																																			-	NULL		0.517	FCHSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FCHSD2	protein_coding	OTTHUMT00000329429.2	C	NM_014824		72231902	-1	no_errors	NM_014824	genbank	human	validated	54_36p	silent	SNP	0.81	T
CEP57	9702	genome.wustl.edu	37	11	95564199	95564199	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr11:95564199C>A	ENST00000325542.5	+	11	1520	c.1282C>A	c.(1282-1284)Cag>Aag	p.Q428K	CEP57_ENST00000325486.5_Missense_Mutation_p.Q402K|CEP57_ENST00000541150.1_Missense_Mutation_p.Q419K|CEP57_ENST00000537677.1_Missense_Mutation_p.Q401K	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	428	Mediates interaction with microtubules. {ECO:0000250}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)	p.Q428K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GCTGGAGAAACAGAAGTTAGA	0.358									Mosaic Variegated Aneuploidy Syndrome																																							1	Substitution - Missense(1)	ovary(1)	11											47.0	50.0	49.0					11																	95564199		2201	4296	6497	95203847	SO:0001583	missense	9702	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.1282C>A	11.37:g.95564199C>A	ENSP00000317902:p.Gln428Lys	Somatic		Capture	Illumina GAIIx	4	95203847	A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	HMMPfam_DUF1167;superfamily_Spectrin repeat	p.Q428K	ENST00000325542.5	37	c.1282	CCDS8304.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.052|8.052	0.766179|0.766179	0.15983|0.15983	.|.	.|.	ENSG00000166037|ENSG00000166037	ENST00000537677;ENST00000325542;ENST00000325486;ENST00000541150|ENST00000535224	T;T;T;T|.	0.29397|.	1.58;1.58;1.57;1.58|.	5.89|5.89	4.97|4.97	0.65823|0.65823	.|.	0.639319|.	0.15542|.	N|.	0.256898|.	T|T	0.60843|0.60843	0.2300|0.2300	L|L	0.50333|0.50333	1.59|1.59	0.37036|0.37036	D|D	0.896897|0.896897	B;B;P|.	0.38535|.	0.372;0.023;0.635|.	B;B;B|.	0.30855|.	0.121;0.013;0.121|.	T|T	0.62487|0.62487	-0.6844|-0.6844	10|5	0.87932|.	D|.	0|.	-18.6349|-18.6349	11.6013|11.6013	0.51003|0.51003	0.0:0.9174:0.0:0.0826|0.0:0.9174:0.0:0.0826	.|.	419;402;428|.	F5H5F7;Q86XR8-2;Q86XR8|.	.;.;CEP57_HUMAN|.	K|K	401;428;402;419|217	ENSP00000441392:Q401K;ENSP00000317902:Q428K;ENSP00000317487:Q402K;ENSP00000443436:Q419K|.	ENSP00000317487:Q402K|.	Q|T	+|+	1|2	0|0	CEP57|CEP57	95203847|95203847	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.931000|0.931000	0.56810|0.56810	2.999000|2.999000	0.49473|0.49473	2.788000|2.788000	0.95919|0.95919	0.557000|0.557000	0.71058|0.71058	CAG|ACA	-	HMMPfam_DUF1167		0.358	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP57	protein_coding	OTTHUMT00000395983.1	C	NM_014679		95203847	1	no_errors	NM_014679	genbank	human	validated	54_36p	missense	SNP	0.99	A
SCN3B	55800	genome.wustl.edu	37	11	123508916	123508916	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr11:123508916C>T	ENST00000392770.2	-	4	1364	c.562G>A	c.(562-564)Gaa>Aaa	p.E188K	SCN3B_ENST00000530277.1_Missense_Mutation_p.E188K|SCN3B_ENST00000299333.3_Missense_Mutation_p.E188K	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	188					atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.E188K(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	GCTGCCTCTTCGGCTTTTGAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	11											136.0	113.0	121.0					11																	123508916		2202	4299	6501	123014126	SO:0001583	missense	55800			AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.562G>A	11.37:g.123508916C>T	ENSP00000376523:p.Glu188Lys	Somatic		Capture	Illumina GAIIx	4	123014126	A5H1I5|Q17RL3|Q9ULR2	Missense_Mutation	SNP	HMMPfam_V-set;superfamily_Immunoglobulin	p.E188K	ENST00000392770.2	37	c.562	CCDS8442.1	11	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684871	0.88639	.	.	ENSG00000166257	ENST00000392770;ENST00000299333;ENST00000530277	D;D;D	0.96459	-4.02;-4.02;-4.02	5.7	5.7	0.88788	.	0.042915	0.85682	D	0.000000	D	0.92635	0.7660	N	0.22421	0.69	0.80722	D	1	D	0.57571	0.98	B	0.41860	0.368	D	0.91264	0.5039	10	0.20046	T	0.44	-4.591	19.8411	0.96685	0.0:1.0:0.0:0.0	.	188	Q9NY72	SCN3B_HUMAN	K	188	ENSP00000376523:E188K;ENSP00000299333:E188K;ENSP00000432785:E188K	ENSP00000299333:E188K	E	-	1	0	SCN3B	123014126	1.000000	0.71417	0.961000	0.40146	0.755000	0.42902	7.481000	0.81124	2.683000	0.91414	0.655000	0.94253	GAA	-	NULL		0.463	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN3B	protein_coding	OTTHUMT00000387412.1	C	NM_018400		123014126	-1	no_errors	NM_001040151	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
TCP11L2	255394	genome.wustl.edu	37	12	106715367	106715367	+	Missense_Mutation	SNP	T	T	C	rs552042741		TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr12:106715367T>C	ENST00000299045.3	+	5	692	c.518T>C	c.(517-519)gTt>gCt	p.V173A	TCP11L2_ENST00000547153.1_Missense_Mutation_p.V173A|TCP11L2_ENST00000546625.1_Missense_Mutation_p.V173A|TCP11L2_ENST00000552690.1_3'UTR	NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	173								p.V173A(1)		endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						CACAGTGCTGTTGACATCCAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	12											128.0	114.0	119.0					12																	106715367		2203	4300	6503	105239497	SO:0001583	missense	255394			BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.518T>C	12.37:g.106715367T>C	ENSP00000299045:p.Val173Ala	Somatic		Capture	Illumina GAIIx	4	105239497	B2RA65|G3V1Y9	Missense_Mutation	SNP	-	p.V173A	ENST00000299045.3	37	c.518	CCDS9104.1	12	.	.	.	.	.	.	.	.	.	.	T	29.7	5.027255	0.93518	.	.	ENSG00000166046	ENST00000547153;ENST00000299045;ENST00000546625;ENST00000553098	T;T;T;T	0.12147	2.71;2.71;2.71;2.71	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.31167	0.0788	L	0.50919	1.6	0.80722	D	1	D;P;D	0.69078	0.989;0.917;0.997	D;P;D	0.65987	0.94;0.693;0.921	T	0.00525	-1.1689	10	0.40728	T	0.16	-17.3954	16.6288	0.85011	0.0:0.0:0.0:1.0	.	173;173;173	Q8N4U5;G3V1Y9;G3V1Z2	T11L2_HUMAN;.;.	A	173	ENSP00000448952:V173A;ENSP00000299045:V173A;ENSP00000449123:V173A;ENSP00000448629:V173A	ENSP00000299045:V173A	V	+	2	0	TCP11L2	105239497	1.000000	0.71417	0.929000	0.37066	0.997000	0.91878	7.698000	0.84413	2.326000	0.78906	0.533000	0.62120	GTT	-	NULL		0.507	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCP11L2	protein_coding	OTTHUMT00000407206.1	T	NM_152772		105239497	1	no_errors	NM_152772	genbank	human	provisional	54_36p	missense	SNP	0.97	C
TMEM132D	121256	genome.wustl.edu	37	12	129566556	129566556	+	Silent	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr12:129566556C>T	ENST00000422113.2	-	7	1997	c.1671G>A	c.(1669-1671)gaG>gaA	p.E557E	TMEM132D_ENST00000389441.4_Silent_p.E95E	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	557					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.E557E(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CATCCTCCTCCTCTTCACTGT	0.642																																																1	Substitution - coding silent(1)	ovary(1)	12											46.0	49.0	48.0					12																	129566556		2203	4300	6503	128132509	SO:0001819	synonymous_variant	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1671G>A	12.37:g.129566556C>T		Somatic		Capture	Illumina GAIIx	4	128132509	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	-	p.E557	ENST00000422113.2	37	c.1671	CCDS9266.1	12																																																																																			-	NULL		0.642	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	protein_coding	OTTHUMT00000399592.1	C	NM_133448		128132509	-1	no_errors	NM_133448	genbank	human	validated	54_36p	silent	SNP	0.99	T
WNK1	65125	genome.wustl.edu	37	12	988774	988774	+	Silent	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr12:988774C>A	ENST00000315939.6	+	11	3052	c.2409C>A	c.(2407-2409)ggC>ggA	p.G803G	WNK1_ENST00000340908.4_Silent_p.G396G|WNK1_ENST00000537687.1_Intron|WNK1_ENST00000535572.1_Intron|WNK1_ENST00000530271.2_Silent_p.G1301G	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	803					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.G803G(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CTATCCAAGGCGAACCTCAGA	0.473																																					Colon(19;451 567 6672 12618 28860)											1	Substitution - coding silent(1)	ovary(1)	12											98.0	90.0	93.0					12																	988774		2203	4300	6503	859035	SO:0001819	synonymous_variant	65125			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2409C>A	12.37:g.988774C>A		Somatic		Capture	Illumina GAIIx	4	859035	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.G803	ENST00000315939.6	37	c.2409	CCDS8506.1	12																																																																																			-	NULL		0.473	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	protein_coding	OTTHUMT00000206683.1	C	NM_018979		859035	1	no_errors	NM_018979	genbank	human	validated	54_36p	silent	SNP	1	A
ITPR2	3709	genome.wustl.edu	37	12	26564322	26564322	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr12:26564322T>A	ENST00000381340.3	-	52	7746	c.7330A>T	c.(7330-7332)Act>Tct	p.T2444S	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2444					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.T2444S(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GTAGTTAAAGTCATAGTAGGC	0.373																																																1	Substitution - Missense(1)	ovary(1)	12											125.0	112.0	116.0					12																	26564322		1878	4106	5984	26455589	SO:0001583	missense	3709			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7330A>T	12.37:g.26564322T>A	ENSP00000370744:p.Thr2444Ser	Somatic		Capture	Illumina GAIIx	4	26455589	O94773	Missense_Mutation	SNP	-	p.T2444S	ENST00000381340.3	37	c.7330	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	T	2.624	-0.287970	0.05605	.	.	ENSG00000123104	ENST00000381340	D	0.90955	-2.76	5.3	5.3	0.74995	Ion transport (1);	0.203100	0.40908	D	0.000986	T	0.77532	0.4144	N	0.03608	-0.345	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.73199	-0.4058	10	0.09338	T	0.73	.	14.1294	0.65242	0.0:0.0:0.0:1.0	.	2444	Q14571	ITPR2_HUMAN	S	2444	ENSP00000370744:T2444S	ENSP00000370744:T2444S	T	-	1	0	ITPR2	26455589	1.000000	0.71417	0.544000	0.28141	0.218000	0.24690	4.728000	0.62000	2.133000	0.65898	0.477000	0.44152	ACT	-	NULL		0.373	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	protein_coding	OTTHUMT00000402732.1	T	NM_002223		26455589	-1	no_errors	NM_002223	genbank	human	validated	54_36p	missense	SNP	0.6	A
KIF21A	55605	genome.wustl.edu	37	12	39703478	39703478	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr12:39703478C>T	ENST00000361418.5	-	33	4202	c.4187G>A	c.(4186-4188)tGt>tAt	p.C1396Y	KIF21A_ENST00000361961.3_Missense_Mutation_p.C1383Y|KIF21A_ENST00000541463.2_Missense_Mutation_p.C1343Y|KIF21A_ENST00000547745.1_5'Flank|KIF21A_ENST00000395670.3_Missense_Mutation_p.C1397Y|KIF21A_ENST00000544797.2_Missense_Mutation_p.C1359Y			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1396					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.C1383Y(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				GGTATAATTACAGTATTTTAC	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											98.0	91.0	94.0					12																	39703478		2203	4300	6503	37989745	SO:0001583	missense	55605			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.4187G>A	12.37:g.39703478C>T	ENSP00000354878:p.Cys1396Tyr	Somatic		Capture	Illumina GAIIx	4	37989745	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	-	p.C1383Y	ENST00000361418.5	37	c.4148	CCDS53776.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.28|16.28	3.078689|3.078689	0.55753|0.55753	.|.	.|.	ENSG00000139116|ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000545778;ENST00000551264;ENST00000544797;ENST00000361418;ENST00000541463|ENST00000552961	T;T;T;T;T;T|.	0.80909|.	-1.43;-1.43;-1.43;-0.45;-1.43;-0.02|.	5.39|5.39	4.5|4.5	0.54988|0.54988	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.000000|.	0.64402|.	D|.	0.000020|.	T|T	0.62171|0.62171	0.2406|0.2406	L|L	0.49699|0.49699	1.58|1.58	0.44611|0.44611	D|D	0.99758|0.99758	D;B;D;D;D;D|.	0.76494|.	0.969;0.001;0.985;0.999;0.997;0.991|.	P;B;P;D;D;P|.	0.83275|.	0.558;0.003;0.845;0.996;0.916;0.861|.	T|T	0.59815|0.59815	-0.7383|-0.7383	10|5	0.72032|.	D|.	0.01|.	.|.	14.1475|14.1475	0.65360|0.65360	0.0:0.9279:0.0:0.0721|0.0:0.9279:0.0:0.0721	.|.	1359;1343;1396;1383;1349;383|.	F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3;F5H0V8|.	.;.;KI21A_HUMAN;.;.;.|.	Y|I	1383;1397;1349;383;377;1359;1396;1343|697	ENSP00000354851:C1383Y;ENSP00000379029:C1397Y;ENSP00000448792:C377Y;ENSP00000445606:C1359Y;ENSP00000354878:C1396Y;ENSP00000438075:C1343Y|.	ENSP00000344501:C1349Y|.	C|V	-|-	2|1	0|0	KIF21A|KIF21A	37989745|37989745	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.294000|0.294000	0.27393|0.27393	4.785000|4.785000	0.62418|0.62418	1.279000|1.279000	0.44446|0.44446	0.650000|0.650000	0.86243|0.86243	TGT|GTA	-	NULL		0.383	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	protein_coding	OTTHUMT00000403581.1	C	NM_017641		37989745	-1	no_errors	NM_017641	genbank	human	validated	54_36p	missense	SNP	0.95	T
SCAF11	9169	genome.wustl.edu	37	12	46321679	46321679	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr12:46321679G>C	ENST00000369367.3	-	11	2038	c.1805C>G	c.(1804-1806)aCa>aGa	p.T602R	SCAF11_ENST00000549162.1_Missense_Mutation_p.T410R|SCAF11_ENST00000419565.2_Missense_Mutation_p.T602R|SCAF11_ENST00000465950.1_Missense_Mutation_p.T287R	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	602					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.T602R(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						AAGCTCCTCTGTTTTTAGTGT	0.368																																																1	Substitution - Missense(1)	ovary(1)	12											57.0	61.0	59.0					12																	46321679		2170	4290	6460	44607946	SO:0001583	missense	9169			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.1805C>G	12.37:g.46321679G>C	ENSP00000358374:p.Thr602Arg	Somatic		Capture	Illumina GAIIx	4	44607946	A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	-	p.T602R	ENST00000369367.3	37	c.1805	CCDS8748.2	12	.	.	.	.	.	.	.	.	.	.	G	6.544	0.468576	0.12461	.	.	ENSG00000139218	ENST00000465950;ENST00000369367;ENST00000549162;ENST00000419565;ENST00000547018	T;T;T;T;T	0.44482	1.52;2.26;1.52;2.26;0.92	5.54	-4.2	0.03823	.	0.901452	0.09553	N	0.786608	T	0.30008	0.0751	L	0.50333	1.59	0.20074	N	0.999932	P;B	0.45078	0.85;0.183	B;B	0.40285	0.325;0.054	T	0.32508	-0.9904	10	0.15066	T	0.55	-0.0773	8.5865	0.33662	0.1304:0.0:0.6006:0.269	.	410;602	F8VXG7;Q99590	.;SCAFB_HUMAN	R	287;602;410;602;542	ENSP00000449812:T287R;ENSP00000358374:T602R;ENSP00000448864:T410R;ENSP00000413036:T602R;ENSP00000446746:T542R	ENSP00000358374:T602R	T	-	2	0	SCAF11	44607946	0.000000	0.05858	0.365000	0.25901	0.570000	0.35934	-1.532000	0.02217	-0.520000	0.06435	-0.367000	0.07326	ACA	-	NULL		0.368	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRS2IP	protein_coding	OTTHUMT00000313992.2	G	NM_004719		44607946	-1	no_errors	NM_004719	genbank	human	validated	54_36p	missense	SNP	0.03	C
IKZF4	64375	genome.wustl.edu	37	12	56428533	56428533	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr12:56428533C>G	ENST00000262032.5	+	12	1543	c.1176C>G	c.(1174-1176)atC>atG	p.I392M	IKZF4_ENST00000547791.1_Missense_Mutation_p.I347M|RP11-603J24.4_ENST00000551846.1_RNA|IKZF4_ENST00000547167.1_Missense_Mutation_p.I392M|IKZF4_ENST00000431367.2_Missense_Mutation_p.I290M			Q9H2S9	IKZF4_HUMAN	IKAROS family zinc finger 4 (Eos)	392					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I351M(1)|p.I392M(1)		NS(1)|endometrium(2)|lung(3)|ovary(1)|prostate(1)	8			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			CCAATTGCATCTCAGAACTCA	0.602																																																2	Substitution - Missense(2)	ovary(2)	12											105.0	103.0	104.0					12																	56428533		2047	4220	6267	54714800	SO:0001583	missense	64375			AF230809	CCDS44917.1	12q13	2013-01-08	2006-08-25	2006-08-25		ENSG00000123411		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13179	protein-coding gene	gene with protein product		606239	"""zinc finger protein, subfamily 1A, 4 (Eos)"""	ZNFN1A4		10978333	Standard	NM_022465		Approved	Eos	uc001sjc.1	Q9H2S9		ENST00000262032.5:c.1176C>G	12.37:g.56428533C>G	ENSP00000262032:p.Ile392Met	Somatic		Capture	Illumina GAIIx	4	54714800	Q96JP3	Missense_Mutation	SNP	-	p.I392M	ENST00000262032.5	37	c.1176	CCDS44917.1	12	.	.	.	.	.	.	.	.	.	.	C	10.37	1.330673	0.24167	.	.	ENSG00000123411	ENST00000262032;ENST00000431367;ENST00000547167;ENST00000547791	T;T;T;T	0.07688	3.17;3.17;3.17;3.18	4.61	3.72	0.42706	.	0.000000	0.49916	D	0.000139	T	0.10937	0.0267	N	0.21282	0.65	0.33681	D	0.612129	P;D;P;D	0.58268	0.935;0.982;0.935;0.969	P;P;P;P	0.56788	0.52;0.644;0.52;0.806	T	0.16364	-1.0405	10	0.46703	T	0.11	-13.5356	8.2572	0.31763	0.0:0.8157:0.0:0.1843	.	290;347;351;392	G5E9S4;F8VPL6;Q9H2S9-2;Q9H2S9	.;.;.;IKZF4_HUMAN	M	392;290;392;347	ENSP00000262032:I392M;ENSP00000412101:I290M;ENSP00000448419:I392M;ENSP00000450020:I347M	ENSP00000262032:I392M	I	+	3	3	IKZF4	54714800	0.007000	0.16637	1.000000	0.80357	0.974000	0.67602	-0.142000	0.10311	1.296000	0.44742	0.462000	0.41574	ATC	-	NULL		0.602	IKZF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF4	protein_coding	OTTHUMT00000407590.1	C	NM_022465		54714800	1	no_errors	NM_022465	genbank	human	validated	54_36p	missense	SNP	1	G
HAL	3034	genome.wustl.edu	37	12	96370402	96370402	+	Silent	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr12:96370402G>A	ENST00000261208.3	-	19	2105	c.1737C>T	c.(1735-1737)gtC>gtT	p.V579V	HAL_ENST00000541929.1_Silent_p.V371V|HAL_ENST00000538703.1_Silent_p.V579V	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	579					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)	p.V579V(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	CCAGGTCATAGACCTTCTCCA	0.498																																					NSCLC(169;943 2815 23563 30031)											1	Substitution - coding silent(1)	ovary(1)	12											96.0	92.0	94.0					12																	96370402		2203	4300	6503	94894533	SO:0001819	synonymous_variant	3034				CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.1737C>T	12.37:g.96370402G>A		Somatic		Capture	Illumina GAIIx	4	94894533	B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Silent	SNP	HMMPfam_PAL;superfamily_L-aspartase-like	p.V579	ENST00000261208.3	37	c.1737	CCDS9058.1	12																																																																																			-	HMMPfam_PAL		0.498	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAL	protein_coding	OTTHUMT00000408644.1	G			94894533	-1	no_errors	NM_002108	genbank	human	reviewed	54_36p	silent	SNP	1	A
GPR133	283383	genome.wustl.edu	37	12	131487330	131487330	+	Intron	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr12:131487330C>T	ENST00000261654.5	+	10	1585				GPR133_ENST00000535015.1_Intron|GPR133_ENST00000376682.4_Missense_Mutation_p.P11L	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CTGGTGTCCCCATCCCAGAGT	0.632																																																0			12											37.0	36.0	37.0					12																	131487330		875	1991	2866	130053283	SO:0001627	intron_variant	283383			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1027-400C>T	12.37:g.131487330C>T		Somatic		Capture	Illumina GAIIx	4	130053283	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	-	p.P11L	ENST00000261654.5	37	c.32	CCDS9272.1	12	.	.	.	.	.	.	.	.	.	.	C	12.82	2.053063	0.36181	.	.	ENSG00000111452	ENST00000376682	T	0.42513	0.97	2.68	-0.582	0.11709	.	.	.	.	.	T	0.33933	0.0880	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37842	-0.9688	6	0.72032	D	0.01	.	2.2376	0.04012	0.2421:0.434:0.0:0.3239	.	.	.	.	L	11	ENSP00000365872:P11L	ENSP00000365872:P11L	P	+	2	0	GPR133	130053283	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.204000	0.17335	-0.133000	0.11537	-0.339000	0.08088	CCA	-	NULL		0.632	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR133	protein_coding	OTTHUMT00000399356.1	C	NM_198827		130053283	1	no_errors	ENST00000376682	ensembl	human	known	54_36p	missense	SNP	0	T
AMER2	219287	genome.wustl.edu	37	13	25743799	25743799	+	Silent	SNP	G	G	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr13:25743799G>T	ENST00000515384.1	-	1	2626	c.1959C>A	c.(1957-1959)ggC>ggA	p.G653G	AMER2_ENST00000381853.3_Silent_p.G534G|AMER2_ENST00000357816.2_Silent_p.G534G			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	653					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.G534G(1)									TCCCAGCCAAGCCCCGGTTGC	0.587																																																1	Substitution - coding silent(1)	ovary(1)	13											56.0	60.0	59.0					13																	25743799		2203	4300	6503	24641799	SO:0001819	synonymous_variant	219287			AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1959C>A	13.37:g.25743799G>T		Somatic		Capture	Illumina GAIIx	4	24641799	Q5RL80|Q5VX56|Q8N593|Q96NN5	Silent	SNP	-	p.G653	ENST00000515384.1	37	c.1959	CCDS53859.1	13																																																																																			-	NULL		0.587	AMER2-002	KNOWN	basic|CCDS	protein_coding	FAM123A	protein_coding	OTTHUMT00000370229.1	G	NM_152704		24641799	-1	no_errors	NM_152704	genbank	human	validated	54_36p	silent	SNP	1	T
DCLK1	9201	genome.wustl.edu	37	13	36384981	36384981	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr13:36384981G>A	ENST00000360631.3	-	12	1890	c.1679C>T	c.(1678-1680)gCa>gTa	p.A560V	DCLK1_ENST00000255448.4_Missense_Mutation_p.A560V|DCLK1_ENST00000379893.1_Missense_Mutation_p.A253V			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	560	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.A560V(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CCCAGTCTCTGCAATGATTTC	0.478																																																1	Substitution - Missense(1)	ovary(1)	13											176.0	180.0	179.0					13																	36384981		2203	4300	6503	35282981	SO:0001583	missense	9201			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1679C>T	13.37:g.36384981G>A	ENSP00000353846:p.Ala560Val	Somatic		Capture	Illumina GAIIx	4	35282981	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_DCX;superfamily_Protein kinase-like (PK-like);superfamily_Doublecortin (DC)	p.A560V	ENST00000360631.3	37	c.1679		13	.	.	.	.	.	.	.	.	.	.	G	25.1	4.599055	0.87055	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	T;T;T	0.65732	-0.17;-0.17;-0.17	5.18	5.18	0.71444	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.062466	0.64402	D	0.000003	T	0.68348	0.2991	L	0.28192	0.835	0.80722	D	1	B;D;D;B	0.59767	0.338;0.977;0.986;0.338	B;P;P;B	0.62560	0.281;0.904;0.885;0.209	T	0.72064	-0.4403	10	0.66056	D	0.02	.	19.0516	0.93049	0.0:0.0:1.0:0.0	.	253;560;560;253	O15075-4;O15075;O15075-2;O15075-3	.;DCLK1_HUMAN;.;.	V	252;560;560;253;542	ENSP00000255448:A560V;ENSP00000353846:A560V;ENSP00000369223:A253V	ENSP00000255448:A560V	A	-	2	0	DCLK1	35282981	1.000000	0.71417	0.996000	0.52242	0.341000	0.28922	7.362000	0.79507	2.572000	0.86782	0.655000	0.94253	GCA	-	NULL		0.478	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	protein_coding	OTTHUMT00000044487.1	G	NM_004734		35282981	-1	no_errors	NM_004734	genbank	human	validated	54_36p	missense	SNP	1	A
SLC10A2	6555	genome.wustl.edu	37	13	103718247	103718247	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr13:103718247C>T	ENST00000245312.3	-	1	949	c.353G>A	c.(352-354)tGg>tAg	p.W118*		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	118					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)	p.W118*(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	GCCATCGACCCAATAGGCCAA	0.502																																																1	Substitution - Nonsense(1)	ovary(1)	13											85.0	81.0	82.0					13																	103718247		2203	4300	6503	102516248	SO:0001587	stop_gained	6555			U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.353G>A	13.37:g.103718247C>T	ENSP00000245312:p.Trp118*	Somatic		Capture	Illumina GAIIx	4	102516248	A1L4F4|Q13839	Nonsense_Mutation	SNP	HMMPfam_SBF	p.W118*	ENST00000245312.3	37	c.353	CCDS9506.1	13	.	.	.	.	.	.	.	.	.	.	C	43	10.345394	0.99388	.	.	ENSG00000125255	ENST00000245312	.	.	.	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.4014	18.848	0.92215	0.0:1.0:0.0:0.0	.	.	.	.	X	118	.	ENSP00000245312:W118X	W	-	2	0	SLC10A2	102516248	1.000000	0.71417	0.995000	0.50966	0.881000	0.50899	6.067000	0.71193	2.451000	0.82905	0.655000	0.94253	TGG	-	HMMPfam_SBF		0.502	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A2	protein_coding	OTTHUMT00000045716.1	C			102516248	-1	no_errors	NM_000452	genbank	human	validated	54_36p	nonsense	SNP	1	T
FLRT2	23768	genome.wustl.edu	37	14	86089004	86089004	+	Silent	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr14:86089004G>A	ENST00000330753.4	+	2	1913	c.1146G>A	c.(1144-1146)caG>caA	p.Q382Q	FLRT2_ENST00000554746.1_Silent_p.Q382Q	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	382					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)	p.Q382Q(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CGACCACTCAGCCTCCCACCC	0.547																																																1	Substitution - coding silent(1)	ovary(1)	14											84.0	88.0	87.0					14																	86089004		2203	4300	6503	85158757	SO:0001819	synonymous_variant	23768			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1146G>A	14.37:g.86089004G>A		Somatic		Capture	Illumina GAIIx	4	85158757	A0AV84|B7ZLP3	Silent	SNP	HMMPfam_LRRNT;HMMPfam_LRRCT;HMMPfam_LRR_1;HMMPfam_fn3;superfamily_Fibronectin type III;superfamily_L domain-like	p.Q382	ENST00000330753.4	37	c.1146	CCDS9877.1	14																																																																																			-	NULL		0.547	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	protein_coding	OTTHUMT00000413193.1	G			85158757	1	no_errors	NM_013231	genbank	human	reviewed	54_36p	silent	SNP		A
MAP1A	4130	genome.wustl.edu	37	15	43820357	43820357	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr15:43820357C>T	ENST00000300231.5	+	4	7136	c.6686C>T	c.(6685-6687)tCa>tTa	p.S2229L	MAP1A_ENST00000399453.1_Missense_Mutation_p.S2229L|MAP1A_ENST00000382031.1_Missense_Mutation_p.S2467L			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2229					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)	p.S2229L(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CTGGATTCCTCACTGCCCCAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	15											80.0	87.0	85.0					15																	43820357		1905	4109	6014	41607649	SO:0001583	missense	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.6686C>T	15.37:g.43820357C>T	ENSP00000300231:p.Ser2229Leu	Somatic		Capture	Illumina GAIIx	4	41607649	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	-	p.S2229L	ENST00000300231.5	37	c.6686	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	C	13.84	2.356654	0.41801	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.02525	4.26;4.27;4.27	4.56	4.56	0.56223	.	0.000000	0.29087	N	0.013195	T	0.07188	0.0182	L	0.36672	1.1	0.41900	D	0.99041	D	0.54964	0.969	P	0.55087	0.768	T	0.22243	-1.0222	10	0.87932	D	0	-8.0352	15.6918	0.77461	0.0:1.0:0.0:0.0	.	2229	P78559	MAP1A_HUMAN	L	2467;2229;2229	ENSP00000371462:S2467L;ENSP00000382380:S2229L;ENSP00000300231:S2229L	ENSP00000300231:S2229L	S	+	2	0	MAP1A	41607649	0.994000	0.37717	0.916000	0.36221	0.948000	0.59901	3.387000	0.52501	2.359000	0.80004	0.561000	0.74099	TCA	-	NULL		0.632	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	protein_coding	OTTHUMT00000132894.5	C	NM_002373		41607649	1	no_errors	NM_002373	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
FBN1	2200	genome.wustl.edu	37	15	48713002	48713002	+	Splice_Site	SNP	G	G	A	rs368054842		TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr15:48713002G>A	ENST00000316623.5	-	63	8156	c.7701C>T	c.(7699-7701)gaC>gaT	p.D2567D		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2567	EGF-like 45; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.D2567D(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ACTCGTCCACGTCTGAAAAAG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	15						G		1,4395	2.1+/-5.4	0,1,2197	62.0	56.0	58.0		7701	-1.5	1.0	15		58	0,8592		0,0,4296	no	coding-synonymous-near-splice	FBN1	NM_000138.4		0,1,6493	AA,AG,GG		0.0,0.0227,0.0077		2567/2872	48713002	1,12987	2198	4296	6494	46500294	SO:0001630	splice_region_variant	2200			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7700-1C>T	15.37:g.48713002G>A		Somatic		Capture	Illumina GAIIx	4	46500294	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	HMMPfam_TB;HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;superfamily_Growth factor receptor domain;HMMPfam_EGF_CA;HMMPfam_EGF_2;superfamily_EGF/Laminin;superfamily_TB module/8-cys domain	p.D2567	ENST00000316623.5	37	c.7701	CCDS32232.1	15																																																																																			-	HMMPfam_EGF_CA		0.537	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	protein_coding	OTTHUMT00000417355.1	G		Silent	46500294	-1	no_errors	NM_000138	genbank	human	reviewed	54_36p	silent	SNP	1	A
SCG3	29106	genome.wustl.edu	37	15	51973988	51973988	+	Silent	SNP	G	G	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr15:51973988G>C	ENST00000220478.3	+	1	439	c.36G>C	c.(34-36)gtG>gtC	p.V12V	SCG3_ENST00000542355.2_5'UTR	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III	12					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)	p.V12V(1)		breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		GGATTCTGGTGTTAGTGCTCC	0.527																																																1	Substitution - coding silent(1)	ovary(1)	15											114.0	94.0	100.0					15																	51973988		2195	4293	6488	49761280	SO:0001819	synonymous_variant	29106			AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.36G>C	15.37:g.51973988G>C		Somatic		Capture	Illumina GAIIx	4	49761280	A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	Silent	SNP	-	p.V12	ENST00000220478.3	37	c.36	CCDS10142.1	15																																																																																			-	NULL		0.527	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG3	protein_coding	OTTHUMT00000254670.2	G	NM_013243		49761280	1	no_errors	NM_013243	genbank	human	reviewed	54_36p	silent	SNP	1	C
MYO5C	55930	genome.wustl.edu	37	15	52571799	52571799	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr15:52571799C>T	ENST00000261839.7	-	3	372	c.211G>A	c.(211-213)Gac>Aac	p.D71N	MYO5C_ENST00000443683.2_5'UTR|MYO5C_ENST00000541028.1_5'UTR|MIR1266_ENST00000408125.1_RNA	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	71	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.D71N(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		GCCGTGAGGTCATTCTCGCCC	0.483																																																1	Substitution - Missense(1)	ovary(1)	15											70.0	69.0	69.0					15																	52571799		1907	4124	6031	50359091	SO:0001583	missense	55930			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.211G>A	15.37:g.52571799C>T	ENSP00000261839:p.Asp71Asn	Somatic		Capture	Illumina GAIIx	4	50359091	Q6P1W8	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_DIL;HMMPfam_Myosin_N;superfamily_Myosin S1 fragment N-terminal domain;superfamily_Hypothetical protein yfbM;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.D71N	ENST00000261839.7	37	c.211	CCDS42036.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.843139	0.97016	.	.	ENSG00000128833	ENST00000261839;ENST00000541028	D	0.98345	-4.88	5.88	5.88	0.94601	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.99193	0.9720	M	0.90759	3.145	0.80722	D	1	D;D	0.76494	0.991;0.999	D;D	0.91635	0.999;0.994	D	0.99246	1.0886	10	0.59425	D	0.04	.	20.2366	0.98359	0.0:1.0:0.0:0.0	.	34;71	F5H231;Q9NQX4	.;MYO5C_HUMAN	N	71;34	ENSP00000261839:D71N	ENSP00000261839:D71N	D	-	1	0	MYO5C	50359091	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.794000	0.85869	2.792000	0.96026	0.557000	0.71058	GAC	-	HMMPfam_Myosin_head		0.483	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	protein_coding	OTTHUMT00000419562.1	C	NM_018728		50359091	-1	no_errors	NM_018728	genbank	human	validated	54_36p	missense	SNP	1	T
ZSCAN10	84891	genome.wustl.edu	37	16	3142122	3142122	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr16:3142122T>C	ENST00000252463.2	-	2	514	c.427A>G	c.(427-429)Agg>Ggg	p.R143G	ZSCAN10_ENST00000538082.2_Intron|ZSCAN10_ENST00000572548.1_Intron|ZSCAN10_ENST00000575108.1_5'UTR	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	143	Pro-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R143G(1)		breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						GGGGGAAGCCTCCACTGTCCC	0.642																																																1	Substitution - Missense(1)	ovary(1)	16											25.0	29.0	28.0					16																	3142122		2197	4300	6497	3082123	SO:0001583	missense	84891			AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.427A>G	16.37:g.3142122T>C	ENSP00000252463:p.Arg143Gly	Somatic		Capture	Illumina GAIIx	4	3082123	B3KQD3|H0YFS6|Q1WWM2	Missense_Mutation	SNP	-	p.R143G	ENST00000252463.2	37	c.427	CCDS10493.1	16	.	.	.	.	.	.	.	.	.	.	T	13.44	2.236975	0.39498	.	.	ENSG00000130182	ENST00000252463	T	0.06218	3.33	5.05	5.05	0.67936	.	0.791335	0.11039	N	0.606322	T	0.04815	0.0130	N	0.14661	0.345	0.80722	D	1	B	0.12013	0.005	B	0.08055	0.003	T	0.44097	-0.9350	10	0.25106	T	0.35	-1.4308	11.1882	0.48669	0.0:0.0:0.0:1.0	.	143	Q96SZ4	ZSC10_HUMAN	G	143	ENSP00000252463:R143G	ENSP00000252463:R143G	R	-	1	2	ZSCAN10	3082123	0.145000	0.22656	0.930000	0.37139	0.479000	0.33129	0.337000	0.19841	1.923000	0.55706	0.459000	0.35465	AGG	-	NULL		0.642	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN10	protein_coding	OTTHUMT00000437124.2	T	NM_032805		3082123	-1	no_errors	NM_032805	genbank	human	provisional	54_36p	missense	SNP	0	C
PLCG2	5336	genome.wustl.edu	37	16	81971416	81971416	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr16:81971416T>G	ENST00000359376.3	+	28	3320	c.3106T>G	c.(3106-3108)Tac>Gac	p.Y1036D		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	1036	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.Y1036D(1)		NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						GCGCACGGGCTACGTTCTGCA	0.522																																																1	Substitution - Missense(1)	ovary(1)	16											105.0	104.0	105.0					16																	81971416		2135	4241	6376	80528917	SO:0001583	missense	5336				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.3106T>G	16.37:g.81971416T>G	ENSP00000352336:p.Tyr1036Asp	Somatic		Capture	Illumina GAIIx	4	80528917	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	HMMPfam_C2;HMMPfam_PI-PLC-X;HMMPfam_SH2;HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_PI-PLC-Y;HMMPfam_PH;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);superfamily_EF-hand;superfamily_PH domain-like;superfamily_PLC-like phosphodiesterases;superfamily_SH2 domain	p.Y1036D	ENST00000359376.3	37	c.3106	CCDS42204.1	16	.	.	.	.	.	.	.	.	.	.	T	18.84	3.709907	0.68730	.	.	ENSG00000197943	ENST00000359376	T	0.72835	-0.69	5.42	5.42	0.78866	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.000000	0.85682	D	0.000000	D	0.85779	0.5776	H	0.98754	4.32	0.80722	D	1	B	0.31611	0.331	B	0.39503	0.301	D	0.88608	0.3154	10	0.87932	D	0	.	15.4811	0.75528	0.0:0.0:0.0:1.0	.	1036	P16885	PLCG2_HUMAN	D	1036	ENSP00000352336:Y1036D	ENSP00000352336:Y1036D	Y	+	1	0	PLCG2	80528917	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.489000	0.81451	2.064000	0.61679	0.459000	0.35465	TAC	-	HMMPfam_PI-PLC-Y		0.522	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCG2	protein_coding	OTTHUMT00000432429.1	T			80528917	1	no_errors	NM_002661	genbank	human	validated	54_36p	missense	SNP	1	G
C1orf226	400793	genome.wustl.edu	37	1	162353375	162353375	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr1:162353375C>G	ENST00000458626.2	+	2	893	c.721C>G	c.(721-723)Ctg>Gtg	p.L241V	C1orf226_ENST00000426197.2_Missense_Mutation_p.L284V	NM_001085375.1	NP_001078844.1	A1L170	CA226_HUMAN	chromosome 1 open reading frame 226	241								p.L284V(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12						CCCCATCAGCCTGGCTGAGTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											24.0	27.0	26.0					1																	162353375		2008	4162	6170	160619999	SO:0001583	missense	400793			AI480219, AK023199, AK125122, AL512785, BC127743	CCDS44268.1, CCDS53422.1	1q23.3	2013-10-11			ENSG00000239887	ENSG00000239887			34351	protein-coding gene	gene with protein product						14702039	Standard	NM_001085375		Approved	FLJ13137	uc010pkt.1	A1L170	OTTHUMG00000031376	ENST00000458626.2:c.721C>G	1.37:g.162353375C>G	ENSP00000437071:p.Leu241Val	Somatic		Capture	Illumina GAIIx	4	160619999	B4DF31	Missense_Mutation	SNP	-	p.L241V	ENST00000458626.2	37	c.721	CCDS53422.1	1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918266	0.73098	.	.	ENSG00000239887	ENST00000426197;ENST00000458626	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	T	0.27241	0.0668	L	0.29908	0.895	.	.	.	P;P	0.42518	0.782;0.782	B;B	0.34652	0.187;0.187	T	0.10917	-1.0609	6	.	.	.	-3.0993	18.4629	0.90746	0.0:1.0:0.0:0.0	.	284;241	A1L170-2;A1L170	.;CA226_HUMAN	V	284;241	.	.	L	+	1	2	C1orf226	160619999	1.000000	0.71417	0.990000	0.47175	0.976000	0.68499	3.819000	0.55686	2.708000	0.92522	0.655000	0.94253	CTG	-	NULL		0.592	C1orf226-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C1orf226	protein_coding	OTTHUMT00000076793.2	C	NM_001085375		160619999	1	no_errors	NM_001085375	genbank	human	validated	54_36p	missense	SNP	1	G
MYH3	4621	genome.wustl.edu	37	17	10545863	10545863	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr17:10545863C>T	ENST00000583535.1	-	16	1846	c.1759G>A	c.(1759-1761)Gtg>Atg	p.V587M	MYH3_ENST00000226209.7_Missense_Mutation_p.V587M	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	587	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)	p.V587M(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CTGTAGTCCACGGTGCCCGCA	0.547																																																1	Substitution - Missense(1)	ovary(1)	17											164.0	158.0	160.0					17																	10545863		2203	4300	6503	10486588	SO:0001583	missense	4621				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.1759G>A	17.37:g.10545863C>T	ENSP00000464317:p.Val587Met	Somatic		Capture	Illumina GAIIx	4	10486588	Q15492	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Prefoldin;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.V587M	ENST00000583535.1	37	c.1759	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972511	0.74246	.	.	ENSG00000109063	ENST00000226209	D	0.93953	-3.32	4.86	3.89	0.44902	Myosin head, motor domain (2);	.	.	.	.	D	0.98346	0.9451	H	0.99881	4.885	0.41375	D	0.987516	D	0.76494	0.999	D	0.70227	0.968	D	0.98760	1.0724	9	0.87932	D	0	.	13.4975	0.61434	0.0:0.9245:0.0:0.0755	.	587	P11055	MYH3_HUMAN	M	587	ENSP00000226209:V587M	ENSP00000226209:V587M	V	-	1	0	MYH3	10486588	1.000000	0.71417	0.993000	0.49108	0.745000	0.42441	7.651000	0.83577	1.416000	0.47057	0.650000	0.86243	GTG	-	HMMPfam_Myosin_head		0.547	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	protein_coding	OTTHUMT00000252734.2	C	NM_002470		10486588	-1	no_errors	NM_002470	genbank	human	reviewed	54_36p	missense	SNP	1	T
PELP1	27043	genome.wustl.edu	37	17	4577907	4577907	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr17:4577907G>T	ENST00000574876.1	-	13	1497	c.1480C>A	c.(1480-1482)Ccc>Acc	p.P494T	PELP1_ENST00000269230.7_Missense_Mutation_p.P492T|PELP1_ENST00000572293.1_Missense_Mutation_p.P544T|AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000436683.2_Missense_Mutation_p.P347T|PELP1_ENST00000301396.4_Missense_Mutation_p.P638T			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	494					cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.P544T(1)		breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						AGCTTCTTGGGGGCGCTAGGC	0.592																																																1	Substitution - Missense(1)	ovary(1)	17											38.0	41.0	40.0					17																	4577907		1923	4133	6056	4524656	SO:0001583	missense	27043				CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.1480C>A	17.37:g.4577907G>T	ENSP00000461625:p.Pro494Thr	Somatic		Capture	Illumina GAIIx	4	4524656	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Missense_Mutation	SNP	HMMPfam_NUC201;HMMPfam_NUC202;superfamily_ARM repeat;superfamily_beta-sandwich domain of Sec23/24	p.P494T	ENST00000574876.1	37	c.1480	CCDS58503.1	17	.	.	.	.	.	.	.	.	.	.	G	14.40	2.523149	0.44866	.	.	ENSG00000141456	ENST00000301396;ENST00000269230;ENST00000436683	T;T;T	0.44083	0.94;0.93;1.58	5.35	5.35	0.76521	.	0.130444	0.50627	D	0.000110	T	0.46870	0.1415	N	0.14661	0.345	0.40381	D	0.979443	D;D	0.76494	0.999;0.997	D;D	0.78314	0.991;0.915	T	0.49214	-0.8963	10	0.48119	T	0.1	-24.4311	14.4215	0.67187	0.0:0.0:1.0:0.0	.	347;494	E7EV54;Q8IZL8	.;PELP1_HUMAN	T	638;492;347	ENSP00000301396:P638T;ENSP00000269230:P492T;ENSP00000416231:P347T	ENSP00000269230:P492T	P	-	1	0	AC091153.1	4524656	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	6.069000	0.71209	2.781000	0.95711	0.655000	0.94253	CCC	-	NULL		0.592	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PELP1	protein_coding	OTTHUMT00000439140.2	G	NM_014389		4524656	-1	no_errors	NM_014389	genbank	human	validated	54_36p	missense	SNP	1	T
TP53	7157	genome.wustl.edu	37	17	7574034	7574034	+	Splice_Site	SNP	C	C	T	rs587782272		TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr17:7574034C>T	ENST00000269305.4	-	10	1183		c.e10-1		TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(9)|p.0?(8)|p.I332fs*49(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCACGGATCTGCAGCAACA	0.512		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	18	Unknown(9)|Whole gene deletion(8)|Insertion - Frameshift(1)	lung(5)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|endometrium(2)|stomach(1)|breast(1)|ovary(1)	17	GRCh37	CS002470|CS033842	TP53	S							44.0	36.0	39.0					17																	7574034		2203	4300	6503	7514759	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.994-1G>A	17.37:g.7574034C>T		Somatic		Capture	Illumina GAIIx	4	7514759	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e9-1	ENST00000269305.4	37	c.994-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	13.23	2.174851	0.38413	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4323	0.83853	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7514759	1.000000	0.71417	0.997000	0.53966	0.143000	0.21401	6.410000	0.73294	2.549000	0.85964	0.561000	0.74099	.	-	-		0.512	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Intron	7514759	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
HAP1	9001	genome.wustl.edu	37	17	39881248	39881248	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr17:39881248G>C	ENST00000310778.5	-	12	1730	c.1721C>G	c.(1720-1722)gCt>gGt	p.A574G	HAP1_ENST00000393939.2_Missense_Mutation_p.A497G|HAP1_ENST00000347901.4_Missense_Mutation_p.A522G|JUP_ENST00000540235.1_Intron|HAP1_ENST00000341193.5_Missense_Mutation_p.A505G			P54257	HAP1_HUMAN	huntingtin-associated protein 1	574	Glu-rich.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)	p.A522G(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CCCTTCCTCAGCCGGCACCTT	0.632																																																1	Substitution - Missense(1)	ovary(1)	17											236.0	228.0	231.0					17																	39881248		2203	4300	6503	37134774	SO:0001583	missense	9001			AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1721C>G	17.37:g.39881248G>C	ENSP00000309392:p.Ala574Gly	Somatic		Capture	Illumina GAIIx	4	37134774	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	-	p.A522G	ENST00000310778.5	37	c.1565		17	.	.	.	.	.	.	.	.	.	.	G	13.75	2.329208	0.41197	.	.	ENSG00000173805	ENST00000458656;ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T;T	0.38077	1.16;2.93;3.22;3.03;2.94	4.14	3.13	0.36017	.	0.370487	0.19922	N	0.103074	T	0.33059	0.0850	L	0.29908	0.895	0.09310	N	1	D;D;P;P	0.56035	0.974;0.974;0.932;0.888	P;P;B;B	0.49502	0.613;0.513;0.301;0.158	T	0.09037	-1.0693	10	0.46703	T	0.11	-0.869	10.9717	0.47442	0.0:0.0:0.8117:0.1883	.	497;505;522;574	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	G	29;497;574;522;505	ENSP00000404640:A29G;ENSP00000377513:A497G;ENSP00000309392:A574G;ENSP00000334002:A522G;ENSP00000343170:A505G	ENSP00000309392:A574G	A	-	2	0	HAP1	37134774	0.021000	0.18746	0.002000	0.10522	0.019000	0.09904	2.406000	0.44557	1.041000	0.40125	0.511000	0.50034	GCT	-	NULL		0.632	HAP1-006	KNOWN	basic|appris_principal	protein_coding	HAP1	protein_coding	OTTHUMT00000389619.1	G	NM_003949		37134774	-1	no_errors	NM_177977	genbank	human	reviewed	54_36p	missense	SNP		C
NOL4	8715	genome.wustl.edu	37	18	31685025	31685025	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr18:31685025T>G	ENST00000261592.5	-	3	811	c.514A>C	c.(514-516)Aca>Cca	p.T172P	NOL4_ENST00000269185.4_Missense_Mutation_p.T58P|NOL4_ENST00000535475.1_Missense_Mutation_p.T17P|NOL4_ENST00000538587.1_Missense_Mutation_p.T98P|NOL4_ENST00000589544.1_Missense_Mutation_p.T172P	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	172						nucleolus (GO:0005730)	RNA binding (GO:0003723)	p.T172P(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TTATGATCTGTTCCATCTGGG	0.378																																																1	Substitution - Missense(1)	ovary(1)	18											178.0	163.0	168.0					18																	31685025		2203	4300	6503	29939023	SO:0001583	missense	8715			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.514A>C	18.37:g.31685025T>G	ENSP00000261592:p.Thr172Pro	Somatic		Capture	Illumina GAIIx	4	29939023	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	-	p.T172P	ENST00000261592.5	37	c.514	CCDS11907.2	18	.	.	.	.	.	.	.	.	.	.	T	12.31	1.899720	0.33535	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000535475;ENST00000538587	.	.	.	5.51	2.88	0.33553	.	0.170048	0.41294	D	0.000914	T	0.17662	0.0424	N	0.03608	-0.345	0.32972	D	0.522491	B;B;B;B;B	0.25609	0.019;0.039;0.045;0.13;0.13	B;B;B;B;B	0.28139	0.039;0.086;0.062;0.086;0.086	T	0.09530	-1.0670	9	0.36615	T	0.2	-6.5026	4.7322	0.12970	0.0:0.3998:0.0:0.6002	.	58;98;172;172;17	B4DLW2;B4DSQ0;O94818;O94818-2;B3KRF4	.;.;NOL4_HUMAN;.;.	P	172;58;17;98	.	ENSP00000261592:T172P	T	-	1	0	NOL4	29939023	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.363000	0.44178	1.037000	0.40024	0.533000	0.62120	ACA	-	NULL		0.378	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL4	protein_coding	OTTHUMT00000255386.1	T	NM_003787		29939023	-1	no_errors	NM_003787	genbank	human	validated	54_36p	missense	SNP	1	G
NCAN	1463	genome.wustl.edu	37	19	19349115	19349115	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr19:19349115T>A	ENST00000252575.6	+	11	3403	c.3304T>A	c.(3304-3306)Tat>Aat	p.Y1102N	NCAN_ENST00000538881.1_Missense_Mutation_p.Y553N	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	1102	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.Y1102N(1)		breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	CTGTTACCGCTATTTTGCCCA	0.647																																																1	Substitution - Missense(1)	ovary(1)	19											56.0	59.0	58.0					19																	19349115		2203	4300	6503	19210115	SO:0001583	missense	1463			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.3304T>A	19.37:g.19349115T>A	ENSP00000252575:p.Tyr1102Asn	Somatic		Capture	Illumina GAIIx	4	19210115	Q9UPK6	Missense_Mutation	SNP	HMMPfam_Sushi;HMMPfam_Xlink;HMMPfam_Lectin_C;HMMPfam_EGF;superfamily_Immunoglobulin;superfamily_C-type lectin-like;superfamily_EGF/Laminin;superfamily_Complement control module/SCR domain	p.Y1102N	ENST00000252575.6	37	c.3304	CCDS12397.1	19	.	.	.	.	.	.	.	.	.	.	T	20.6	4.013636	0.75161	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	T;T	0.17854	2.25;2.25	4.75	3.74	0.42951	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.000000	0.36268	N	0.002695	T	0.36717	0.0977	M	0.70595	2.14	0.47153	D	0.99933	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.07195	-1.0785	10	0.62326	D	0.03	.	8.1981	0.31409	0.0:0.0946:0.0:0.9054	.	1116;1102	Q4LE67;O14594	.;NCAN_HUMAN	N	1116;1102;553	ENSP00000252575:Y1102N;ENSP00000442202:Y553N	ENSP00000252575:Y1102N	Y	+	1	0	NCAN	19210115	0.999000	0.42202	0.349000	0.25694	0.954000	0.61252	3.239000	0.51360	0.864000	0.35578	0.459000	0.35465	TAT	-	NULL		0.647	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAN	protein_coding	OTTHUMT00000460111.2	T	NM_004386		19210115	1	no_errors	NM_004386	genbank	human	validated	54_36p	missense	SNP	0.97	A
NPHS1	4868	genome.wustl.edu	37	19	36333452	36333452	+	Splice_Site	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr19:36333452C>A	ENST00000378910.5	-	18	2334	c.2335G>T	c.(2335-2337)Gga>Tga	p.G779*	NPHS1_ENST00000353632.6_Splice_Site_p.G779*	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	779	Ig-like C2-type 7.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.G779*(1)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCATCTTCTCCCTGGAGGCCC	0.572																																																1	Substitution - Nonsense(1)	ovary(1)	19											61.0	62.0	62.0					19																	36333452		2203	4300	6503	41025292	SO:0001630	splice_region_variant	4868				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2335-1G>T	19.37:g.36333452C>A		Somatic		Capture	Illumina GAIIx	4	41025292	A6NDH2|C3RX61	Nonsense_Mutation	SNP	HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_I-set;HMMPfam_V-set;HMMPfam_ig;HMMPfam_C2-set_2;superfamily_Immunoglobulin	p.G779*	ENST00000378910.5	37	c.2335	CCDS32996.1	19	.	.	.	.	.	.	.	.	.	.	C	41	8.745354	0.98937	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	.	.	.	4.46	4.46	0.54185	.	0.131674	0.49916	D	0.000130	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-6.8332	12.5556	0.56252	0.0:1.0:0.0:0.0	.	.	.	.	X	779	.	ENSP00000343634:G779X	G	-	1	0	NPHS1	41025292	1.000000	0.71417	0.957000	0.39632	0.964000	0.63967	5.249000	0.65427	2.333000	0.79357	0.558000	0.71614	GGA	-	NULL		0.572	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	protein_coding	OTTHUMT00000452553.1	C		Nonsense_Mutation	41025292	-1	no_errors	NM_004646	genbank	human	validated	54_36p	nonsense	SNP	0.75	A
ZNF527	84503	genome.wustl.edu	37	19	37879442	37879449	+	Frame_Shift_Del	DEL	AATTTAGT	AATTTAGT	-			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	AATTTAGT	AATTTAGT	AATTTAGT	-	AATTTAGT	AATTTAGT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr19:37879442_37879449delAATTTAGT	ENST00000436120.2	+	5	598_605	c.491_498delAATTTAGT	c.(490-498)gaatttagtfs	p.EFS164fs	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S166fs*24(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGAGACAATGAATTTAGTAATTCTGGGA	0.356																																																1	Deletion - Frameshift(1)	ovary(1)	19																																								42571289	SO:0001589	frameshift_variant	84503			AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.491_498delAATTTAGT	19.37:g.37879442_37879449delAATTTAGT	ENSP00000390179:p.Glu164fs	Somatic		Capture	Illumina GAIIx	4	42571282	B4DVL5	Frame_Shift_Del	DEL	-	p.S166fs	ENST00000436120.2	37	c.491_498	CCDS42559.1	19																																																																																			(deletion:cds_exon[42571048;42572621])	NULL		0.356	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF527	protein_coding	OTTHUMT00000458434.1	AATTTAGT	NM_032453		42571289	1	no_errors	NM_032453	genbank	human	validated	54_36p	frame_shift_del	DEL	0.016:0.011:0.015:0.000:0.000:0.000:0.000:0.000	-
HNRNPL	3191	genome.wustl.edu	37	19	39338015	39338015	+	Silent	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr19:39338015C>A	ENST00000221419.5	-	2	693	c.327G>T	c.(325-327)ctG>ctT	p.L109L	AC008982.2_ENST00000600473.1_RNA|HNRNPL_ENST00000600873.1_5'UTR	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	109	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)	p.L109L(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			CACCGTCAATCAGGCCCCTGA	0.522																																																1	Substitution - coding silent(1)	ovary(1)	19											91.0	81.0	84.0					19																	39338015		2203	4300	6503	44029855	SO:0001819	synonymous_variant	3191			X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.327G>T	19.37:g.39338015C>A		Somatic		Capture	Illumina GAIIx	4	44029855	A6ND69|A6NIT8|Q9H3P3	Silent	SNP	HMMPfam_RRM_1;superfamily_RNA-binding domain RBD	p.L109	ENST00000221419.5	37	c.327	CCDS33015.1	19																																																																																			-	NULL		0.522	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPL	protein_coding	OTTHUMT00000462670.1	C			44029855	-1	no_errors	NM_001533	genbank	human	reviewed	54_36p	silent	SNP	1	A
CEACAM7	1087	genome.wustl.edu	37	19	42190798	42190798	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr19:42190798T>C	ENST00000006724.3	-	2	620	c.419A>G	c.(418-420)tAc>tGc	p.Y140C	CEACAM7_ENST00000599715.1_5'UTR|CEACAM7_ENST00000401731.1_Missense_Mutation_p.Y140C|CEACAM7_ENST00000602225.1_Missense_Mutation_p.Y140C|CEACAM7_ENST00000338196.4_Missense_Mutation_p.Y140C	NM_006890.3	NP_008821.1	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 7	140	Ig-like V-type.					anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Y140C(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)		ACAGAATACGTAGAATTGTCT	0.483																																																1	Substitution - Missense(1)	ovary(1)	19											145.0	134.0	137.0					19																	42190798		2203	4300	6503	46882638	SO:0001583	missense	1087			X98311	CCDS12583.1	19q13.2	2013-01-29			ENSG00000007306	ENSG00000007306		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1819	protein-coding gene	gene with protein product	"""carcinoembryonic antigen gene family member 2"""			CGM2		7806520, 9135022	Standard	XM_005278379		Approved	CEA	uc002ori.1	Q14002	OTTHUMG00000151063	ENST00000006724.3:c.419A>G	19.37:g.42190798T>C	ENSP00000006724:p.Tyr140Cys	Somatic		Capture	Illumina GAIIx	4	46882638	A8K848|O15148|O15149|Q0VAC1|Q13983|Q9UPJ2	Missense_Mutation	SNP	-	p.Y140C	ENST00000006724.3	37	c.419	CCDS12583.1	19	.	.	.	.	.	.	.	.	.	.	T	7.166	0.586584	0.13749	.	.	ENSG00000007306	ENST00000006724;ENST00000412062;ENST00000401731;ENST00000338196	T;T;T	0.65916	-0.18;-0.18;-0.18	1.68	-3.36	0.04913	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.40932	0.1137	N	0.17082	0.46	0.09310	N	1	D;B	0.56287	0.975;0.001	B;B	0.42361	0.385;0.003	T	0.39542	-0.9609	9	0.38643	T	0.18	.	8.126	0.30999	0.0:0.6423:0.0:0.3577	.	140;140	Q14002-2;Q14002	.;CEAM7_HUMAN	C	140;119;140;140	ENSP00000006724:Y140C;ENSP00000385932:Y140C;ENSP00000343286:Y140C	ENSP00000006724:Y140C	Y	-	2	0	CEACAM7	46882638	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.332000	0.01109	-1.441000	0.01958	-0.908000	0.02827	TAC	-	NULL		0.483	CEACAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM7	protein_coding	OTTHUMT00000321145.1	T	NM_006890		46882638	-1	no_errors	NM_006890	genbank	human	provisional	54_36p	missense	SNP	0	C
GRIK5	2901	genome.wustl.edu	37	19	42569497	42569497	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr19:42569497C>T	ENST00000262895.3	-	2	121	c.122G>A	c.(121-123)cGt>cAt	p.R41H	GRIK5_ENST00000301218.4_Missense_Mutation_p.R41H|GRIK5_ENST00000593562.1_Missense_Mutation_p.R41H	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	41					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.R41H(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				CAAGGCCAGACGCTCACCGCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											62.0	56.0	58.0					19																	42569497		2203	4300	6503	47261337	SO:0001583	missense	2901				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.122G>A	19.37:g.42569497C>T	ENSP00000262895:p.Arg41His	Somatic		Capture	Illumina GAIIx	4	47261337	Q8WWG8	Missense_Mutation	SNP	HMMPfam_Lig_chan;HMMPfam_ANF_receptor;superfamily_Periplasmic binding protein-like I;superfamily_Periplasmic binding protein-like II	p.R41H	ENST00000262895.3	37	c.122	CCDS12595.1	19	.	.	.	.	.	.	.	.	.	.	c	26.7	4.766620	0.90020	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	T;T	0.22539	1.95;1.95	4.82	4.82	0.62117	.	0.000000	0.64402	D	0.000002	T	0.45155	0.1328	M	0.63428	1.95	0.32684	N	0.51515	D	0.89917	1.0	D	0.91635	0.999	T	0.56469	-0.7974	10	0.87932	D	0	.	16.9071	0.86131	0.0:1.0:0.0:0.0	.	41	Q16478	GRIK5_HUMAN	H	41	ENSP00000262895:R41H;ENSP00000301218:R41H	ENSP00000262895:R41H	R	-	2	0	GRIK5	47261337	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.882000	0.75589	2.508000	0.84585	0.632000	0.83419	CGT	-	HMMPfam_ANF_receptor		0.622	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	protein_coding	OTTHUMT00000463453.1	C			47261337	-1	no_errors	NM_002088	genbank	human	reviewed	54_36p	missense	SNP	1	T
FOSB	2354	genome.wustl.edu	37	19	45974102	45974102	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr19:45974102T>G	ENST00000353609.3	+	2	934	c.342T>G	c.(340-342)agT>agG	p.S114R	FOSB_ENST00000585836.1_Missense_Mutation_p.S75R|ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000443841.2_Intron|FOSB_ENST00000590335.1_Missense_Mutation_p.S114R|FOSB_ENST00000586615.1_Missense_Mutation_p.S65R|FOSB_ENST00000591858.1_Missense_Mutation_p.S75R|FOSB_ENST00000417353.2_Missense_Mutation_p.S114R|FOSB_ENST00000592436.1_Missense_Mutation_p.S114R|FOSB_ENST00000592811.1_Missense_Mutation_p.S65R	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	114					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S114R(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		GCTACAGCAGTGGCGGAGCGA	0.701																																																1	Substitution - Missense(1)	ovary(1)	19											63.0	73.0	70.0					19																	45974102		2203	4299	6502	50665942	SO:0001583	missense	2354				CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.342T>G	19.37:g.45974102T>G	ENSP00000245919:p.Ser114Arg	Somatic		Capture	Illumina GAIIx	4	50665942	A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Missense_Mutation	SNP	superfamily_A DNA-binding domain in eukaryotic transcription factors;HMMPfam_bZIP_2	p.S114R	ENST00000353609.3	37	c.342	CCDS12664.1	19	.	.	.	.	.	.	.	.	.	.	T	10.97	1.502966	0.26949	.	.	ENSG00000125740	ENST00000353609;ENST00000417353;ENST00000455928	T;T	0.62788	-0.0;-0.0	4.49	1.05	0.20165	.	.	.	.	.	T	0.51500	0.1678	N	0.08118	0	0.24242	N	0.995359	D;B;D;D;P	0.62365	0.972;0.095;0.991;0.972;0.739	P;B;D;P;B	0.65323	0.766;0.046;0.934;0.766;0.429	T	0.42515	-0.9447	9	0.17832	T	0.49	-17.1661	5.6716	0.17725	0.0:0.3831:0.0:0.6169	.	75;75;114;114;114	A8VJF0;A8VJF3;E9PHJ3;P53539;A8VJE1	.;.;.;FOSB_HUMAN;.	R	114	ENSP00000245919:S114R;ENSP00000407207:S114R	ENSP00000245919:S114R	S	+	3	2	FOSB	50665942	0.162000	0.22906	0.999000	0.59377	0.996000	0.88848	-0.442000	0.06871	0.271000	0.22005	0.459000	0.35465	AGT	-	NULL		0.701	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSB	protein_coding	OTTHUMT00000459561.1	T	NM_006732		50665942	1	no_errors	NM_006732	genbank	human	reviewed	54_36p	missense	SNP	1	G
INSR	3643	genome.wustl.edu	37	19	7117339	7117339	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr19:7117339C>A	ENST00000302850.5	-	22	4019	c.3877G>T	c.(3877-3879)Gac>Tac	p.D1293Y	INSR_ENST00000341500.5_Missense_Mutation_p.D1281Y	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	1293	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.D1293Y(1)		breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GGGTGCAGGTCGTCCTTGAGC	0.562																																																1	Substitution - Missense(1)	ovary(1)	19											122.0	112.0	115.0					19																	7117339		2203	4300	6503	7068339	SO:0001583	missense	3643			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.3877G>T	19.37:g.7117339C>A	ENSP00000303830:p.Asp1293Tyr	Somatic		Capture	Illumina GAIIx	4	7068339	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	superfamily_Fibronectin type III;superfamily_Growth factor receptor domain;superfamily_Protein kinase-like (PK-like);superfamily_L domain-like;Recep_L_domain;HMMPfam_Recep_L_domain;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;fn3;HMMPfam_fn3;Furin-like;HMMPfam_Furin-like	p.D1293Y	ENST00000302850.5	37	c.3877	CCDS12176.1	19	.	.	.	.	.	.	.	.	.	.	C	15.12	2.738489	0.49045	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.76578	-1.03;-1.02	4.99	3.96	0.45880	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.132610	0.33144	N	0.005223	T	0.60521	0.2275	N	0.13272	0.32	0.58432	D	0.999997	P;B	0.35456	0.502;0.194	B;B	0.32149	0.141;0.045	T	0.65380	-0.6182	10	0.87932	D	0	.	11.1676	0.48552	0.0:0.9109:0.0:0.0891	.	1281;1293	P06213-2;P06213	.;INSR_HUMAN	Y	1293;1281	ENSP00000303830:D1293Y;ENSP00000342838:D1281Y	ENSP00000303830:D1293Y	D	-	1	0	INSR	7068339	1.000000	0.71417	0.986000	0.45419	0.947000	0.59692	4.473000	0.60196	1.328000	0.45358	0.563000	0.77884	GAC	-	NULL		0.562	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	protein_coding	OTTHUMT00000458544.1	C			7068339	-1	no_errors	NM_000208	genbank	human	reviewed	54_36p	missense	SNP	1	A
C5AR1	728	genome.wustl.edu	37	19	47824003	47824003	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr19:47824003G>T	ENST00000355085.3	+	2	991	c.969G>T	c.(967-969)ttG>ttT	p.L323F		NM_001736.3	NP_001727.1	P21730	C5AR1_HUMAN	complement component 5a receptor 1	323					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|cell proliferation in hindbrain (GO:0021534)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)|complement component C5a signaling pathway (GO:0038178)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of neuron apoptotic process (GO:0043524)|neutrophil chemotaxis (GO:0030593)|organ regeneration (GO:0031100)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)|complement component C5a receptor activity (GO:0004878)	p.L323F(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)	20		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		GGAACGTGTTGACTGAAGAGT	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											72.0	69.0	70.0					19																	47824003		2203	4300	6503	52515843	SO:0001583	missense	728				CCDS33063.1	19q13.3-q13.4	2012-08-10	2006-02-09	2006-02-09		ENSG00000197405		"""CD molecules"", ""Complement system"", ""GPCR / Class A : Complement component receptors"""	1338	protein-coding gene	gene with protein product		113995	"""complement component 5 receptor 1 (C5a ligand)"""	C5R1		1612600	Standard	NM_001736		Approved	C5A, C5AR, CD88	uc002pgj.1	P21730		ENST00000355085.3:c.969G>T	19.37:g.47824003G>T	ENSP00000347197:p.Leu323Phe	Somatic		Capture	Illumina GAIIx	4	52515843		Missense_Mutation	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.L323F	ENST00000355085.3	37	c.969	CCDS33063.1	19	.	.	.	.	.	.	.	.	.	.	G	17.10	3.302282	0.60195	.	.	ENSG00000197405	ENST00000355085	T	0.38240	1.15	5.02	1.51	0.23008	.	0.075715	0.53938	U	0.000049	T	0.46737	0.1408	M	0.68952	2.095	0.09310	N	0.999995	D	0.62365	0.991	P	0.55965	0.788	T	0.37888	-0.9686	10	0.87932	D	0	.	9.1694	0.37072	0.0784:0.2778:0.6438:0.0	.	323	P21730	C5AR_HUMAN	F	323	ENSP00000347197:L323F	ENSP00000347197:L323F	L	+	3	2	C5AR1	52515843	0.027000	0.19231	0.003000	0.11579	0.093000	0.18481	0.207000	0.17395	0.187000	0.20147	0.579000	0.79373	TTG	-	NULL		0.602	C5AR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C5AR1	protein_coding	OTTHUMT00000466925.1	G	NM_001736		52515843	1	no_errors	NM_001736	genbank	human	validated	54_36p	missense	SNP	0.02	T
NCKAP5	344148	genome.wustl.edu	37	2	133541439	133541439	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr2:133541439A>T	ENST00000409261.1	-	14	3318	c.2945T>A	c.(2944-2946)aTt>aAt	p.I982N	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.I982N	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	982										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						ATTAGAAGAAATAACTGGAGC	0.517																																																0			2											29.0	32.0	31.0					2																	133541439		1883	4109	5992	133257909	SO:0001583	missense	344148			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2945T>A	2.37:g.133541439A>T	ENSP00000387128:p.Ile982Asn	Somatic		Capture	Illumina GAIIx	4	133257909	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	-	p.I982N	ENST00000409261.1	37	c.2945	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	A	5.526	0.282046	0.10458	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.11495	2.77;2.77	4.49	0.433	0.16534	.	0.190844	0.24693	U	0.036362	T	0.08133	0.0203	L	0.29908	0.895	0.09310	N	1	P	0.49090	0.919	P	0.46718	0.525	T	0.27706	-1.0066	10	0.27785	T	0.31	.	4.7229	0.12927	0.659:0.1582:0.1828:0.0	.	982	O14513	NCKP5_HUMAN	N	982	ENSP00000387128:I982N;ENSP00000380603:I982N	ENSP00000380603:I982N	I	-	2	0	NCKAP5	133257909	0.131000	0.22433	0.000000	0.03702	0.001000	0.01503	0.674000	0.25218	-0.057000	0.13199	-0.417000	0.06048	ATT	-	NULL		0.517	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAP5	protein_coding	OTTHUMT00000331663.1	A	NM_207481		133257909	-1	no_errors	NM_207363	genbank	human	validated	54_36p	missense	SNP	0.02	T
RIF1	55183	genome.wustl.edu	37	2	152319991	152319991	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr2:152319991A>C	ENST00000243326.5	+	29	4440	c.3957A>C	c.(3955-3957)gaA>gaC	p.E1319D	RIF1_ENST00000430328.2_Missense_Mutation_p.E1319D|RIF1_ENST00000428287.2_Missense_Mutation_p.E1319D|RIF1_ENST00000453091.2_Missense_Mutation_p.E1319D|RIF1_ENST00000444746.2_Missense_Mutation_p.E1319D			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.E1319D(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		AATCTGTTGAAGGCATTGTAG	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											77.0	84.0	82.0					2																	152319991		2203	4300	6503	152028237	SO:0001583	missense	55183			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.3957A>C	2.37:g.152319991A>C	ENSP00000243326:p.Glu1319Asp	Somatic		Capture	Illumina GAIIx	4	152028237	A0AVS0|Q9NS16	Missense_Mutation	SNP	superfamily_ARM repeat	p.E1319D	ENST00000243326.5	37	c.3957	CCDS2194.1	2	.	.	.	.	.	.	.	.	.	.	A	0.016	-1.523288	0.00967	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.09817	2.94;2.94;2.94;2.94;2.94	4.55	0.842	0.18927	.	0.331776	0.27302	N	0.019995	T	0.01695	0.0054	N	0.00347	-1.61	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.39187	-0.9626	10	0.11485	T	0.65	-3.3916	0.6966	0.00900	0.2425:0.1146:0.2822:0.3608	.	1319;1319	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	D	1319	ENSP00000390181:E1319D;ENSP00000414615:E1319D;ENSP00000415691:E1319D;ENSP00000243326:E1319D;ENSP00000416123:E1319D	ENSP00000243326:E1319D	E	+	3	2	RIF1	152028237	0.946000	0.32159	0.034000	0.17996	0.179000	0.23085	1.475000	0.35409	0.000000	0.14550	-0.379000	0.06801	GAA	-	NULL		0.408	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIF1	protein_coding	OTTHUMT00000254836.3	A			152028237	1	no_errors	NM_018151	genbank	human	validated	54_36p	missense	SNP	0.48	C
FRZB	2487	genome.wustl.edu	37	2	183703158	183703158	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr2:183703158T>C	ENST00000295113.4	-	4	1385	c.776A>G	c.(775-777)tAt>tGt	p.Y259C		NM_001463.3	NP_001454.2	Q92765	SFRP3_HUMAN	frizzled-related protein	259	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				brain development (GO:0007420)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell development (GO:0010721)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hepatocyte differentiation (GO:0070367)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell differentiation (GO:0014033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fat cell differentiation (GO:0045600)|skeletal system development (GO:0001501)|somite development (GO:0061053)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.Y259C(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			CTCATCTTCATAGCCCATGAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											102.0	98.0	99.0					2																	183703158		2203	4300	6503	183411403	SO:0001583	missense	2487			U24163	CCDS2286.1	2q32.1	2013-09-19			ENSG00000162998	ENSG00000162998		"""Secreted frizzled-related proteins"""	3959	protein-coding gene	gene with protein product		605083				8824257, 9118218	Standard	NM_001463		Approved	FRZB-PEN, FRZB1, SRFP3, FRP-3, SFRP3, FRE, FRITZ, FRZB-1, FZRB, hFIZ	uc002upa.2	Q92765	OTTHUMG00000132597	ENST00000295113.4:c.776A>G	2.37:g.183703158T>C	ENSP00000295113:p.Tyr259Cys	Somatic		Capture	Illumina GAIIx	4	183411403	O00181|Q99686	Missense_Mutation	SNP	HMMPfam_Fz;HMMPfam_NTR;superfamily_TIMP-like;superfamily_Frizzled cysteine-rich domain	p.Y259C	ENST00000295113.4	37	c.776	CCDS2286.1	2	.	.	.	.	.	.	.	.	.	.	T	23.1	4.377499	0.82682	.	.	ENSG00000162998	ENST00000295113	T	0.22134	1.97	5.39	5.39	0.77823	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.115902	0.64402	D	0.000010	T	0.43919	0.1269	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.38415	-0.9662	10	0.87932	D	0	.	15.4385	0.75165	0.0:0.0:0.0:1.0	.	259	Q92765	SFRP3_HUMAN	C	259	ENSP00000295113:Y259C	ENSP00000295113:Y259C	Y	-	2	0	FRZB	183411403	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.986000	0.88173	2.041000	0.60428	0.455000	0.32223	TAT	-	HMMPfam_NTR		0.418	FRZB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRZB	protein_coding	OTTHUMT00000255808.1	T	NM_001463		183411403	-1	no_errors	NM_001463	genbank	human	validated	54_36p	missense	SNP	1	C
HAAO	23498	genome.wustl.edu	37	2	42994629	42994629	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr2:42994629G>A	ENST00000294973.6	-	10	864	c.809C>T	c.(808-810)tCt>tTt	p.S270F		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase									p.S270F(1)		breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						CAGGGCCACAGAGCCTTGTGT	0.617																																																1	Substitution - Missense(1)	ovary(1)	2											56.0	50.0	52.0					2																	42994629		2203	4300	6503	42848133	SO:0001583	missense	23498			Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.809C>T	2.37:g.42994629G>A	ENSP00000294973:p.Ser270Phe	Somatic		Capture	Illumina GAIIx	4	42848133		Missense_Mutation	SNP	HMMPfam_3-HAO;superfamily_RmlC-like cupins	p.S270F	ENST00000294973.6	37	c.809	CCDS33187.1	2	.	.	.	.	.	.	.	.	.	.	g	14.52	2.558969	0.45590	.	.	ENSG00000162882	ENST00000294973	T	0.32023	1.47	4.83	3.93	0.45458	Cupin, RmlC-type (1);	0.228496	0.37530	N	0.002053	T	0.46698	0.1406	M	0.63843	1.955	0.24963	N	0.991715	D	0.76494	0.999	D	0.65140	0.932	T	0.26985	-1.0087	10	0.66056	D	0.02	.	9.7005	0.40184	0.0:0.2807:0.7193:0.0	.	270	P46952	3HAO_HUMAN	F	270	ENSP00000294973:S270F	ENSP00000294973:S270F	S	-	2	0	HAAO	42848133	0.229000	0.23729	0.970000	0.41538	0.995000	0.86356	1.011000	0.29911	2.252000	0.74401	0.550000	0.68814	TCT	-	NULL		0.617	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAAO	protein_coding	OTTHUMT00000325948.2	G			42848133	-1	no_errors	NM_012205	genbank	human	reviewed	54_36p	missense	SNP	0.26	A
KDM3A	55818	genome.wustl.edu	37	2	86709168	86709168	+	Silent	SNP	C	C	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr2:86709168C>G	ENST00000409556.1	+	18	2993	c.2628C>G	c.(2626-2628)ccC>ccG	p.P876P	KDM3A_ENST00000542128.1_Silent_p.P824P|KDM3A_ENST00000312912.5_Silent_p.P876P|KDM3A_ENST00000409064.1_Silent_p.P876P			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	876					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.P876P(3)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						TTTTGACACCCGTAAGCAACA	0.393																																					NSCLC(96;1150 1523 6936 46253 49736)											3	Substitution - coding silent(3)	lung(2)|ovary(1)	2											151.0	143.0	146.0					2																	86709168		2203	4300	6503	86562679	SO:0001819	synonymous_variant	55818			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.2628C>G	2.37:g.86709168C>G		Somatic		Capture	Illumina GAIIx	4	86562679	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	HMMPfam_JmjC;superfamily_Clavaminate synthase-like;superfamily_Cysteine-rich domain	p.P876	ENST00000409556.1	37	c.2628	CCDS1990.1	2																																																																																			-	NULL		0.393	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JMJD1A	protein_coding	OTTHUMT00000252522.2	C	NM_018433		86562679	1	no_errors	NM_018433	genbank	human	reviewed	54_36p	silent	SNP	1	G
HECW2	57520	genome.wustl.edu	37	2	197184552	197184552	+	Silent	SNP	G	G	A	rs141702751	byFrequency	TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr2:197184552G>A	ENST00000260983.3	-	9	1244	c.1062C>T	c.(1060-1062)gaC>gaT	p.D354D	HECW2_ENST00000409111.1_De_novo_Start_OutOfFrame	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	354					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.D354D(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GCATGTCCTCGTCATCGGAAG	0.507													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		19969	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	2						G		1,4405	2.1+/-5.4	0,1,2202	84.0	73.0	76.0		1062	-3.6	0.9	2	dbSNP_134	76	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	HECW2	NM_020760.1		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		354/1573	197184552	2,13004	2203	4300	6503	196892797	SO:0001819	synonymous_variant	57520			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.1062C>T	2.37:g.197184552G>A		Somatic		Capture	Illumina GAIIx	4	196892797	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Silent	SNP	HMMPfam_C2;HMMPfam_HECT;HMMPfam_WW;superfamily_WW domain;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);superfamily_Hect E3 ligase catalytic domain	p.D354	ENST00000260983.3	37	c.1062	CCDS33354.1	2																																																																																			-	NULL		0.507	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	protein_coding	OTTHUMT00000335199.3	G	NM_020760		196892797	-1	no_errors	NM_020760	genbank	human	provisional	54_36p	silent	SNP	0.99	A
DEFB118	117285	genome.wustl.edu	37	20	29960956	29960956	+	Missense_Mutation	SNP	G	G	A	rs547430486		TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr20:29960956G>A	ENST00000253381.2	+	2	388	c.355G>A	c.(355-357)Gtt>Att	p.V119I		NM_054112.2	NP_473453.1	Q96PH6	DB118_HUMAN	defensin, beta 118	119					cell-matrix adhesion (GO:0007160)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)		p.V119I(1)		breast(1)|endometrium(1)|lung(7)|ovary(3)|pancreas(1)|prostate(1)	14	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TCTTCCAAATGTTCACCATAG	0.453													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19090	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	20											84.0	85.0	85.0					20																	29960956		2203	4300	6503	29424617	SO:0001583	missense	117285			AF347073	CCDS13177.1	20q11.21	2008-02-01	2002-05-09	2002-05-10	ENSG00000131068	ENSG00000131068		"""Defensins, beta"""	16196	protein-coding gene	gene with protein product		607650	"""chromosome 20 open reading frame 63"""	C20orf63		11564719, 15033915	Standard	NM_054112		Approved	dJ1018D12.3, DEFB-18, ESC42	uc002wvr.3	Q96PH6	OTTHUMG00000032161	ENST00000253381.2:c.355G>A	20.37:g.29960956G>A	ENSP00000253381:p.Val119Ile	Somatic		Capture	Illumina GAIIx	4	29424617	Q17RC4|Q8N691|Q9NUH0	Missense_Mutation	SNP	-	p.V119I	ENST00000253381.2	37	c.355	CCDS13177.1	20	.	.	.	.	.	.	.	.	.	.	G	13.49	2.252031	0.39797	.	.	ENSG00000131068	ENST00000253381	T	0.09163	3.01	3.26	0.167	0.15006	.	.	.	.	.	T	0.05318	0.0141	N	0.24115	0.695	0.09310	N	1	P	0.43094	0.799	B	0.37692	0.256	T	0.33803	-0.9854	9	0.17832	T	0.49	.	3.6415	0.08169	0.2302:0.2132:0.5566:0.0	.	119	Q96PH6	DB118_HUMAN	I	119	ENSP00000253381:V119I	ENSP00000253381:V119I	V	+	1	0	DEFB118	29424617	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.391000	0.07323	0.059000	0.16252	0.650000	0.86243	GTT	-	NULL		0.453	DEFB118-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB118	protein_coding	OTTHUMT00000078501.2	G	NM_054112		29424617	1	no_errors	NM_054112	genbank	human	provisional	54_36p	missense	SNP		A
NFS1	9054	genome.wustl.edu	37	20	34268746	34268746	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr20:34268746G>A	ENST00000374092.4	-	7	773	c.703C>T	c.(703-705)Cag>Tag	p.Q235*	NFS1_ENST00000374085.1_Nonsense_Mutation_p.Q175*|NFS1_ENST00000541387.1_Nonsense_Mutation_p.Q184*|NFS1_ENST00000397425.1_Nonsense_Mutation_p.Q175*|NFS1_ENST00000540053.1_Nonsense_Mutation_p.Q33*	NM_021100.4	NP_066923.3	Q9Y697	NFS1_HUMAN	NFS1 cysteine desulfurase	235					cysteine metabolic process (GO:0006534)|iron incorporation into metallo-sulfur cluster (GO:0018283)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|protein complex assembly (GO:0006461)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine desulfurase activity (GO:0031071)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.Q235*(1)		central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	18	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)	CCAACAGCCTGGGCTGCATCA	0.458																																																1	Substitution - Nonsense(1)	ovary(1)	20											123.0	100.0	108.0					20																	34268746		2203	4300	6503	33732160	SO:0001587	stop_gained	9054			AF097025	CCDS13262.1, CCDS56185.1	20q11.22	2013-08-06	2013-08-06		ENSG00000244005	ENSG00000244005	2.8.1.7		15910	protein-coding gene	gene with protein product		603485	"""nitrogen fixation 1 (S. cerevisiae, homolog)"", ""NFS1 nitrogen fixation 1 homolog (S. cerevisiae)"""			9885568, 16847322	Standard	NM_021100		Approved	NifS, IscS	uc002xdw.2	Q9Y697	OTTHUMG00000032361	ENST00000374092.4:c.703C>T	20.37:g.34268746G>A	ENSP00000363205:p.Gln235*	Somatic		Capture	Illumina GAIIx	4	33732160	B3KMA5|B4DXK9|E1P5R8|F5GYK5|Q6P0L8|Q9NTZ5|Q9Y481	Nonsense_Mutation	SNP	HMMPfam_Aminotran_5;superfamily_PLP-dependent transferases	p.Q235*	ENST00000374092.4	37	c.703	CCDS13262.1	20	.	.	.	.	.	.	.	.	.	.	G	36	5.654971	0.96724	.	.	ENSG00000244005	ENST00000374092;ENST00000374085;ENST00000397425;ENST00000540053;ENST00000541387	.	.	.	5.55	4.61	0.57282	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-1.1185	14.5239	0.67873	0.0697:0.0:0.9303:0.0	.	.	.	.	X	235;175;175;33;184	.	ENSP00000363198:Q175X	Q	-	1	0	NFS1	33732160	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.610000	0.98337	1.595000	0.50050	-0.229000	0.12294	CAG	-	HMMPfam_Aminotran_5		0.458	NFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFS1	protein_coding	OTTHUMT00000078936.4	G	NM_021100		33732160	-1	no_errors	NM_021100	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
PAK7	57144	genome.wustl.edu	37	20	9561002	9561002	+	Silent	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr20:9561002G>A	ENST00000378429.3	-	5	1326	c.780C>T	c.(778-780)agC>agT	p.S260S	PAK7_ENST00000353224.5_Silent_p.S260S|RP5-986I17.2_ENST00000428769.1_RNA|PAK7_ENST00000378423.1_Silent_p.S260S	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	260	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S260S(1)		NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			AGTCATCCAGGCTGGGTCCCC	0.562																																																1	Substitution - coding silent(1)	ovary(1)	20											100.0	94.0	96.0					20																	9561002		2203	4300	6503	9509002	SO:0001819	synonymous_variant	57144			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.780C>T	20.37:g.9561002G>A		Somatic		Capture	Illumina GAIIx	4	9509002	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Silent	SNP	PBD;HMMPfam_PBD;Pkinase;HMMPfam_Pkinase	p.S260	ENST00000378429.3	37	c.780	CCDS13107.1	20																																																																																			-	NULL		0.562	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK7	protein_coding	OTTHUMT00000077962.1	G			9509002	-1	no_errors	NM_020341	genbank	human	reviewed	54_36p	silent	SNP	1	A
STAU1	6780	genome.wustl.edu	37	20	47739667	47739667	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr20:47739667C>G	ENST00000371856.2	-	8	1338	c.928G>C	c.(928-930)Gag>Cag	p.E310Q	STAU1_ENST00000371802.1_Missense_Mutation_p.E235Q|STAU1_ENST00000347458.5_Missense_Mutation_p.E229Q|STAU1_ENST00000360426.4_Missense_Mutation_p.E229Q|STAU1_ENST00000340954.7_Missense_Mutation_p.E229Q|STAU1_ENST00000371828.3_Missense_Mutation_p.E235Q|STAU1_ENST00000371792.1_Missense_Mutation_p.E227Q	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	310	DRBM 3. {ECO:0000255|PROSITE- ProRule:PRU00266}.				intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.E310Q(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			AGGCCTCGCTCTGTGAGGAGC	0.612																																																1	Substitution - Missense(1)	ovary(1)	20											84.0	67.0	72.0					20																	47739667		2203	4300	6503	47173074	SO:0001583	missense	6780				CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.928G>C	20.37:g.47739667C>G	ENSP00000360922:p.Glu310Gln	Somatic		Capture	Illumina GAIIx	4	47173074	A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Missense_Mutation	SNP	-	p.E310Q	ENST00000371856.2	37	c.928	CCDS13414.1	20	.	.	.	.	.	.	.	.	.	.	C	29.4	5.003070	0.93287	.	.	ENSG00000124214	ENST00000371828;ENST00000340954;ENST00000371856;ENST00000360426;ENST00000347458;ENST00000371805;ENST00000371802;ENST00000371792	T;T;T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06	5.28	4.34	0.51931	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.86648	0.5983	M	0.70108	2.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.992;0.998	D	0.87998	0.2754	10	0.87932	D	0	-19.0891	14.0447	0.64698	0.0:0.9269:0.0:0.0731	.	310;235	O95793;Q5JW29	STAU1_HUMAN;.	Q	235;229;310;229;229;229;235;227	ENSP00000360893:E235Q;ENSP00000345425:E229Q;ENSP00000360922:E310Q;ENSP00000353604:E229Q;ENSP00000323443:E229Q;ENSP00000360867:E235Q;ENSP00000360857:E227Q	ENSP00000345425:E229Q	E	-	1	0	STAU1	47173074	1.000000	0.71417	0.969000	0.41365	0.993000	0.82548	7.818000	0.86416	1.210000	0.43336	0.650000	0.86243	GAG	-	NULL		0.612	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAU1	protein_coding	OTTHUMT00000079633.1	C	NM_017453		47173074	-1	no_errors	NM_017453	genbank	human	reviewed	54_36p	missense	SNP	0.99	G
ITGB2	3689	genome.wustl.edu	37	21	46326980	46326980	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr21:46326980T>G	ENST00000397850.2	-	5	630	c.178A>C	c.(178-180)Att>Ctt	p.I60L	ITGB2_ENST00000355153.4_Missense_Mutation_p.I60L|ITGB2_ENST00000397852.1_Missense_Mutation_p.I60L|ITGB2_ENST00000302347.5_Missense_Mutation_p.I60L|ITGB2_ENST00000397854.3_Missense_Mutation_p.I60L|ITGB2_ENST00000397857.1_Missense_Mutation_p.I60L|ITGB2_ENST00000523126.1_5'Flank			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	60					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.I60L(1)		breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	TCGCAGCGAATGGAGTCAGGA	0.652																																																1	Substitution - Missense(1)	ovary(1)	21											64.0	63.0	63.0					21																	46326980		2203	4300	6503	45151408	SO:0001583	missense	3689			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.178A>C	21.37:g.46326980T>G	ENSP00000380948:p.Ile60Leu	Somatic		Capture	Illumina GAIIx	4	45151408	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	superfamily_Integrin beta tail domain;Integrin_beta;HMMPfam_Integrin_beta;Integrin_B_tail;HMMPfam_Integrin_B_tail;EGF_2;HMMPfam_EGF_2;Integrin_b_cyt;HMMPfam_Integrin_b_cyt;vWA-like;superfamily_vWA-like;EGF/Laminin;superfamily_EGF/Laminin;Integrin domains;superfamily_Integrin domains;Integrin beta tail domain	p.I60L	ENST00000397850.2	37	c.178	CCDS13716.1	21	.	.	.	.	.	.	.	.	.	.	T	5.403	0.259477	0.10239	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347;ENST00000545414;ENST00000320216;ENST00000523663;ENST00000522931;ENST00000517563;ENST00000517819	D;D;D;D;D;D;D;D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-2.99	4.47	-5.33	0.02713	Integrin beta subunit, N-terminal (2);	.	.	.	.	T	0.78298	0.4261	N	0.04018	-0.295	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.12837	0.002;0.008	T	0.67300	-0.5705	9	0.22109	T	0.4	.	2.6958	0.05134	0.118:0.3278:0.112:0.4422	.	60;60	A8MYE6;P05107	.;ITB2_HUMAN	L	60;60;60;60;60;60;60;51;60;60;60;60	ENSP00000380950:I60L;ENSP00000380955:I60L;ENSP00000380952:I60L;ENSP00000347279:I60L;ENSP00000380948:I60L;ENSP00000303242:I60L;ENSP00000317697:I51L;ENSP00000428503:I60L;ENSP00000428979:I60L;ENSP00000428413:I60L;ENSP00000428870:I60L	ENSP00000303242:I60L	I	-	1	0	ITGB2	45151408	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.416000	0.07097	-0.946000	0.03677	0.418000	0.28097	ATT	-	HMMPfam_Integrin_beta		0.652	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB2	protein_coding	OTTHUMT00000206566.2	T	NM_000211		45151408	-1	no_errors	NM_000211	genbank	human	reviewed	54_36p	missense	SNP		G
IL2RB	3560	genome.wustl.edu	37	22	37524514	37524514	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr22:37524514G>T	ENST00000216223.5	-	10	1476	c.1278C>A	c.(1276-1278)gaC>gaA	p.D426E		NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	426					cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)	p.D426E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	AGAGCAGCAGGTCATCCCTGG	0.682																																																1	Substitution - Missense(1)	ovary(1)	22											20.0	21.0	21.0					22																	37524514		2203	4298	6501	35854460	SO:0001583	missense	3560			M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.1278C>A	22.37:g.37524514G>T	ENSP00000216223:p.Asp426Glu	Somatic		Capture	Illumina GAIIx	4	35854460	B2R765	Missense_Mutation	SNP	superfamily_Fibronectin type III	p.D426E	ENST00000216223.5	37	c.1278	CCDS13942.1	22	.	.	.	.	.	.	.	.	.	.	G	14.48	2.549471	0.45383	.	.	ENSG00000100385	ENST00000216223	T	0.20738	2.05	4.64	1.22	0.21188	.	0.843870	0.10813	N	0.631419	T	0.36717	0.0977	M	0.68952	2.095	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.18903	-1.0322	10	0.62326	D	0.03	-11.4777	1.6773	0.02824	0.1816:0.3037:0.3588:0.1559	.	426	P14784	IL2RB_HUMAN	E	426	ENSP00000216223:D426E	ENSP00000216223:D426E	D	-	3	2	IL2RB	35854460	0.150000	0.22732	0.925000	0.36789	0.320000	0.28249	0.440000	0.21592	0.441000	0.26529	0.655000	0.94253	GAC	-	NULL		0.682	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RB	protein_coding	OTTHUMT00000318792.1	G			35854460	-1	no_errors	NM_000878	genbank	human	reviewed	54_36p	missense	SNP	0.5	T
TOB2	10766	genome.wustl.edu	37	22	41832900	41832900	+	Silent	SNP	C	C	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr22:41832900C>G	ENST00000327492.3	-	2	1156	c.450G>C	c.(448-450)ctG>ctC	p.L150L		NM_016272.3	NP_057356.1	Q14106	TOB2_HUMAN	transducer of ERBB2, 2	150					female gamete generation (GO:0007292)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ossification (GO:0045778)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L150L(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						GGGAGTTGGACAGGGAGCTGT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	22											87.0	78.0	81.0					22																	41832900		2203	4300	6503	40162846	SO:0001819	synonymous_variant	10766			D64109	CCDS14015.1	22q13.2	2010-02-26			ENSG00000183864	ENSG00000183864			11980	protein-coding gene	gene with protein product		607396		TROB2		10602502, 10591208	Standard	XM_005261315		Approved	TOBL, TOB4, bK223H9	uc003azz.1	Q14106	OTTHUMG00000150970	ENST00000327492.3:c.450G>C	22.37:g.41832900C>G		Somatic		Capture	Illumina GAIIx	4	40162846	Q6FHR7|Q6PIT9|Q9BY97|Q9UBI0	Silent	SNP	HMMPfam_BTG;HMMPfam_PAM2	p.L150	ENST00000327492.3	37	c.450	CCDS14015.1	22																																																																																			-	NULL		0.627	TOB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOB2	protein_coding	OTTHUMT00000320699.1	C	NM_016272		40162846	-1	no_errors	NM_016272	genbank	human	validated	54_36p	silent	SNP	1	G
SMC1B	27127	genome.wustl.edu	37	22	45789614	45789614	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	A	C	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr22:45789614C>A	ENST00000357450.4	-	9	1444	c.1445G>T	c.(1444-1446)aGt>aTt	p.S482I	SMC1B_ENST00000404354.3_Missense_Mutation_p.S482I	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	482					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.S482I(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CTGCAATTCACTTCTAATAAG	0.368																																																1	Substitution - Missense(1)	ovary(1)	22											121.0	107.0	111.0					22																	45789614		1837	4085	5922	44168278	SO:0001583	missense	27127			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.1445G>T	22.37:g.45789614C>A	ENSP00000350036:p.Ser482Ile	Somatic		Capture	Illumina GAIIx	Phase_III	44168278	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	HMMPfam_SMC_N;HMMPfam_SMC_hinge;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Smc hinge domain	p.S482I	ENST00000357450.4	37	c.1445	CCDS43027.1	22	.	.	.	.	.	.	.	.	.	.	C	13.82	2.351192	0.41700	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	D;D	0.86562	-2.14;-2.14	6.07	-1.67	0.08238	SMCs flexible hinge (1);RecF/RecN/SMC (1);	0.575317	0.17305	N	0.179101	T	0.72120	0.3421	N	0.08118	0	0.23784	N	0.996856	B;B;B	0.26258	0.009;0.145;0.087	B;B;B	0.29077	0.027;0.098;0.062	T	0.61252	-0.7100	10	0.44086	T	0.13	.	10.4524	0.44531	0.0:0.5686:0.0:0.4313	.	482;482;482	Q8NDV3;Q8NDV3-2;Q8NDV3-3	SMC1B_HUMAN;.;.	I	482	ENSP00000350036:S482I;ENSP00000385902:S482I	ENSP00000350036:S482I	S	-	2	0	SMC1B	44168278	0.046000	0.20272	0.901000	0.35422	0.838000	0.47535	0.039000	0.13884	-0.421000	0.07416	-0.237000	0.12165	AGT	-	HMMPfam_SMC_N		0.368	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1B	protein_coding	OTTHUMT00000322256.2	C	NM_148674		44168278	-1	no_errors	NM_148674	genbank	human	validated	54_36p	missense	SNP	0.99	A
ACPP	55	genome.wustl.edu	37	3	132075559	132075579	+	In_Frame_Del	DEL	ATGAGACGCAGCACGAGCCGT	ATGAGACGCAGCACGAGCCGT	-	rs148218296|rs373024039		TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	ATGAGACGCAGCACGAGCCGT	ATGAGACGCAGCACGAGCCGT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr3:132075559_132075579delATGAGACGCAGCACGAGCCGT	ENST00000336375.5	+	10	1088_1108	c.998_1018delATGAGACGCAGCACGAGCCGT	c.(997-1020)aatgagacgcagcacgagccgtat>aat	p.ETQHEPY334del	ACPP_ENST00000351273.7_In_Frame_Del_p.ETQHEPY334del|ACPP_ENST00000475741.1_In_Frame_Del_p.ETQHEPY301del	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	334					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)	p.E334_Y340delETQHEPY(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						TACTATCGGAATGAGACGCAGCACGAGCCGTATCCCCTCAT	0.534																																																1	Deletion - In frame(1)	ovary(1)	3																																								133558269	SO:0001651	inframe_deletion	55				CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.998_1018delATGAGACGCAGCACGAGCCGT	3.37:g.132075559_132075579delATGAGACGCAGCACGAGCCGT	ENSP00000337471:p.Glu334_Tyr340del	Somatic		Capture	Illumina GAIIx	4	133558249	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	In_Frame_Del	DEL	HMMPfam_Acid_phosphat_A;superfamily_Phosphoglycerate mutase-like	p.ETQHEPY334in_frame_del	ENST00000336375.5	37	c.998_1018	CCDS3073.1	3																																																																																			(deletion:cds_exon[133558220;133558412])	NULL		0.534	ACPP-001	KNOWN	basic|CCDS	protein_coding	ACPP	protein_coding	OTTHUMT00000356699.2	ATGAGACGCAGCACGAGCCGT	NM_001099		133558269	1	no_errors	NM_001099	genbank	human	reviewed	54_36p	in_frame_del	DEL	0.994:0.951:0.952:0.942:0.840:0.749:0.683:0.000:0.001:0.000:0.001:0.000:0.001:0.001:0.023:0.021:0.012:0.021:0.016:0.000:0.000	-
RPL15	6138	genome.wustl.edu	37	3	23960900	23960900	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr3:23960900G>T	ENST00000307839.5	+	4	1162	c.523G>T	c.(523-525)Gga>Tga	p.G175*	RPL15_ENST00000354811.5_Nonsense_Mutation_p.G175*|RPL15_ENST00000456530.2_Intron|NKIRAS1_ENST00000437230.1_5'Flank|RPL15_ENST00000415719.1_Nonsense_Mutation_p.G175*|NKIRAS1_ENST00000421515.2_Intron|RPL15_ENST00000413699.1_Nonsense_Mutation_p.G175*|NKIRAS1_ENST00000416026.2_5'Flank|NKIRAS1_ENST00000443659.2_5'Flank|RPL15_ENST00000435882.1_Nonsense_Mutation_p.G175*|NKIRAS1_ENST00000415901.2_5'Flank|NKIRAS1_ENST00000412028.1_5'Flank|NKIRAS1_ENST00000388759.3_5'Flank|NKIRAS1_ENST00000425478.2_5'Flank	NM_001253379.1|NM_001253380.1|NM_002948.3	NP_001240308.1|NP_001240309.1|NP_002939.2	P61313	RL15_HUMAN	ribosomal protein L15	175					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.G175*(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7						CCGTGGCCTTGGAAAGGGCCA	0.547																																																1	Substitution - Nonsense(1)	ovary(1)	3											20.0	21.0	21.0					3																	23960900		2186	4295	6481	23935904	SO:0001587	stop_gained	6138			AB007173	CCDS2640.1, CCDS58818.1	3p24.1	2011-04-06			ENSG00000174748	ENSG00000174748		"""L ribosomal proteins"""	10306	protein-coding gene	gene with protein product		604174				9582194	Standard	NM_002948		Approved	RPL10, RPLY10, RPYL10, EC45, L15	uc003ccp.3	P61313	OTTHUMG00000130485	ENST00000307839.5:c.523G>T	3.37:g.23960900G>T	ENSP00000309334:p.Gly175*	Somatic		Capture	Illumina GAIIx	4	23935904	P39030|P41051|Q5U0C0|Q642I1|Q6IPX6|Q8WYP2|Q96C44|Q9H2E5	Nonsense_Mutation	SNP	-	p.G175*	ENST00000307839.5	37	c.523	CCDS2640.1	3	.	.	.	.	.	.	.	.	.	.	G	28.1	4.889185	0.91889	.	.	ENSG00000174748	ENST00000307839;ENST00000413699;ENST00000412097;ENST00000510788;ENST00000435882;ENST00000415719;ENST00000354811	.	.	.	5.54	5.54	0.83059	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	19.5614	0.95374	0.0:0.0:1.0:0.0	.	.	.	.	X	175;175;175;135;175;175;175	.	ENSP00000309334:G175X	G	+	1	0	RPL15	23935904	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.627000	0.74258	2.625000	0.88918	0.644000	0.83932	GGA	-	NULL		0.547	RPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL15	protein_coding	OTTHUMT00000252885.3	G	NM_002948		23935904	1	no_errors	NM_002948	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
PLXNB1	5364	genome.wustl.edu	37	3	48450875	48450875	+	Silent	SNP	C	C	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr3:48450875C>G	ENST00000358536.4	-	34	6218	c.5949G>C	c.(5947-5949)ctG>ctC	p.L1983L	PLXNB1_ENST00000456774.1_Silent_p.L1800L|PLXNB1_ENST00000296440.6_Silent_p.L1983L|PLXNB1_ENST00000448774.2_Silent_p.L594L|PLXNB1_ENST00000358459.4_Silent_p.L1800L	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1983					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.L1983L(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TCCAGAACCTCAGAGGCAAGC	0.542																																																1	Substitution - coding silent(1)	ovary(1)	3											90.0	103.0	99.0					3																	48450875		2203	4300	6503	48425879	SO:0001819	synonymous_variant	5364			X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.5949G>C	3.37:g.48450875C>G		Somatic		Capture	Illumina GAIIx	4	48425879	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Silent	SNP	-	p.L1983	ENST00000358536.4	37	c.5949	CCDS2765.1	3																																																																																			-	NULL		0.542	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	protein_coding	OTTHUMT00000344454.1	C	NM_002673		48425879	-1	no_errors	NM_002673	genbank	human	validated	54_36p	silent	SNP	1	G
USP19	10869	genome.wustl.edu	37	3	49148251	49148251	+	Silent	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr3:49148251C>A	ENST00000398888.2	-	23	3600	c.3282G>T	c.(3280-3282)ctG>ctT	p.L1094L	USP19_ENST00000453664.1_Silent_p.L1185L|USP19_ENST00000398896.1_Silent_p.L902L|USP19_ENST00000434032.2_Silent_p.L1195L|USP19_ENST00000398898.2_Silent_p.L1134L|USP19_ENST00000417901.1_Silent_p.L1197L|USP19_ENST00000398892.3_Silent_p.L1134L	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	1094	USP.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)	p.L1182L(1)		NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GCCATAGCAACAGCTGCTTGG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	3											95.0	101.0	99.0					3																	49148251		2070	4210	6280	49123255	SO:0001819	synonymous_variant	10869			AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.3282G>T	3.37:g.49148251C>A		Somatic		Capture	Illumina GAIIx	4	49123255	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Silent	SNP	-	p.L1094	ENST00000398888.2	37	c.3282	CCDS43090.1	3																																																																																			-	NULL		0.537	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USP19	protein_coding	OTTHUMT00000257721.1	C	NM_006677		49123255	-1	no_errors	NM_006677	genbank	human	provisional	54_36p	silent	SNP	1	A
CACNA2D3	55799	genome.wustl.edu	37	3	55021779	55021779	+	Splice_Site	SNP	A	A	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr3:55021779A>T	ENST00000474759.1	+	31	2737	c.2689A>T	c.(2689-2691)Aga>Tga	p.R897*	CACNA2D3_ENST00000415676.2_Splice_Site_p.R897*|CACNA2D3_ENST00000288197.5_Splice_Site_p.R897*|CACNA2D3_ENST00000478261.1_3'UTR|CACNA2D3_ENST00000490478.1_Splice_Site_p.R803*	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	897						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R897*(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	CTCCTTTAAAAGGTAAGGGTT	0.423																																																1	Substitution - Nonsense(1)	ovary(1)	3											114.0	110.0	111.0					3																	55021779		1813	4071	5884	54996819	SO:0001630	splice_region_variant	55799			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.2690+1A>T	3.37:g.55021779A>T		Somatic		Capture	Illumina GAIIx	4	54996819	B2RPL6|Q9NY16|Q9NY18	Nonsense_Mutation	SNP	HMMPfam_VWA;HMMPfam_Cache_1;HMMPfam_VWA_N;superfamily_vWA-like	p.R897*	ENST00000474759.1	37	c.2689	CCDS54598.1	3	.	.	.	.	.	.	.	.	.	.	A	43	10.492374	0.99415	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624	.	.	.	5.79	4.61	0.57282	.	0.096936	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.9687	0.53051	0.8557:0.1443:0.0:0.0	.	.	.	.	X	897;897;897;803;803	.	ENSP00000288197:R897X	R	+	1	2	CACNA2D3	54996819	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.717000	0.61923	0.990000	0.38787	0.533000	0.62120	AGA	-	NULL		0.423	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	protein_coding	OTTHUMT00000351402.1	A		Nonsense_Mutation	54996819	1	no_errors	NM_018398	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
PDHB	5162	genome.wustl.edu	37	3	58414285	58414285	+	Silent	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr3:58414285G>A	ENST00000302746.6	-	9	891	c.849C>T	c.(847-849)gtC>gtT	p.V283V	RP11-802O23.3_ENST00000607214.1_RNA|PDHB_ENST00000485460.1_Silent_p.V265V|PDHB_ENST00000474765.1_Silent_p.V265V	NM_000925.3|NM_001173468.1	NP_000916.2|NP_001166939.1	P11177	ODPB_HUMAN	pyruvate dehydrogenase (lipoamide) beta	283					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)	p.V283V(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	9				BRCA - Breast invasive adenocarcinoma(55;0.000179)|Kidney(10;0.00231)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.187)	Pyruvic acid(DB00119)	TTGTCTTCATGACACTGGCTT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	3											124.0	106.0	112.0					3																	58414285		2203	4300	6503	58389325	SO:0001819	synonymous_variant	5162				CCDS2890.1, CCDS54602.1	3p21.1-p14.2	1995-12-20			ENSG00000168291	ENSG00000168291	1.2.4.1		8808	protein-coding gene	gene with protein product		179060					Standard	NR_033384		Approved		uc003dkf.4	P11177	OTTHUMG00000159157	ENST00000302746.6:c.849C>T	3.37:g.58414285G>A		Somatic		Capture	Illumina GAIIx	4	58389325	B2R7L0|B4DDD7|Q6FH45|Q9BQ27|Q9UFK3	Silent	SNP	HMMPfam_Transket_pyr;HMMPfam_Transketolase_C;superfamily_TK C-terminal domain-like;superfamily_Thiamin diphosphate-binding fold (THDP-binding)	p.V283	ENST00000302746.6	37	c.849	CCDS2890.1	3																																																																																			-	HMMPfam_Transketolase_C		0.413	PDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHB	protein_coding	OTTHUMT00000353558.1	G			58389325	-1	no_errors	NM_000925	genbank	human	validated	54_36p	silent	SNP	1	A
PDZRN3	23024	genome.wustl.edu	37	3	73433881	73433881	+	Silent	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr3:73433881G>A	ENST00000263666.4	-	10	1950	c.1836C>T	c.(1834-1836)acC>acT	p.T612T	PDZRN3_ENST00000479530.1_Silent_p.T329T|PDZRN3_ENST00000535920.1_Silent_p.T334T|PDZRN3_ENST00000462146.2_Silent_p.T269T|PDZRN3_ENST00000466780.1_Silent_p.T269T|PDZRN3_ENST00000466348.1_5'Flank	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	612					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T612T(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CGCTGCCCAAGGTGTCCTGGC	0.642																																																1	Substitution - coding silent(1)	ovary(1)	3											67.0	65.0	66.0					3																	73433881		2203	4300	6503	73516571	SO:0001819	synonymous_variant	23024			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1836C>T	3.37:g.73433881G>A		Somatic		Capture	Illumina GAIIx	4	73516571	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	-	p.T612	ENST00000263666.4	37	c.1836	CCDS33789.1	3	.	.	.	.	.	.	.	.	.	.	G	7.113	0.576396	0.13686	.	.	ENSG00000121440	ENST00000494559	.	.	.	4.77	-0.798	0.10905	.	.	.	.	.	T	0.42877	0.1222	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21759	-1.0236	4	.	.	.	.	3.4712	0.07567	0.151:0.3652:0.359:0.1248	.	.	.	.	L	209	.	.	P	-	2	0	PDZRN3	73516571	0.009000	0.17119	0.990000	0.47175	0.986000	0.74619	-1.277000	0.02812	-0.379000	0.07906	0.655000	0.94253	CCT	-	NULL		0.642	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN3	protein_coding	OTTHUMT00000352460.1	G	XM_041363		73516571	-1	no_errors	NM_015009	genbank	human	provisional	54_36p	silent	SNP	1	A
PLD1	5337	genome.wustl.edu	37	3	171404519	171404519	+	Missense_Mutation	SNP	T	T	A	rs577809685		TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr3:171404519T>A	ENST00000351298.4	-	16	1949	c.1823A>T	c.(1822-1824)cAc>cTc	p.H608L	PLD1_ENST00000342215.6_Intron|PLD1_ENST00000340989.4_Missense_Mutation_p.H608L|PLD1_ENST00000356327.5_Intron	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	608	Catalytic.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)	p.H608L(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	ACTGGACGGGTGAAAGAGTTT	0.373																																					NSCLC(149;2174 3517 34058)											1	Substitution - Missense(1)	ovary(1)	3											135.0	143.0	140.0					3																	171404519		2203	4300	6503	172887213	SO:0001583	missense	5337			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.1823A>T	3.37:g.171404519T>A	ENSP00000342793:p.His608Leu	Somatic		Capture	Illumina GAIIx	4	172887213		Missense_Mutation	SNP	HMMPfam_PX;HMMPfam_PLDc;HMMPfam_PH;superfamily_PH domain-like;superfamily_Phospholipase D/nuclease;superfamily_PX domain	p.H608L	ENST00000351298.4	37	c.1823	CCDS3216.1	3	.	.	.	.	.	.	.	.	.	.	T	1.468	-0.560563	0.03939	.	.	ENSG00000075651	ENST00000351298;ENST00000340989	T;T	0.06218	3.5;3.33	5.68	-0.14	0.13456	.	0.861740	0.10306	N	0.690585	T	0.03915	0.0110	L	0.29908	0.895	0.22787	N	0.998734	B	0.02656	0.0	B	0.01281	0.0	T	0.46148	-0.9212	10	0.26408	T	0.33	-0.8385	1.2062	0.01895	0.1525:0.2681:0.1497:0.4297	.	608	Q13393	PLD1_HUMAN	L	608	ENSP00000342793:H608L;ENSP00000340326:H608L	ENSP00000340326:H608L	H	-	2	0	PLD1	172887213	0.792000	0.28813	0.638000	0.29380	0.531000	0.34715	-0.322000	0.08007	0.037000	0.15575	-0.251000	0.11542	CAC	-	NULL		0.373	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	protein_coding	OTTHUMT00000346730.2	T	NM_002662		172887213	-1	no_errors	NM_002662	genbank	human	validated	54_36p	missense	SNP	0.4	A
USP53	54532	genome.wustl.edu	37	4	120189479	120189479	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr4:120189479G>C	ENST00000274030.6	+	14	2371	c.1192G>C	c.(1192-1194)Gat>Cat	p.D398H	USP53_ENST00000450251.1_Missense_Mutation_p.D398H	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53									p.D397H(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						TGGATTTGGTGATCAGGCAAA	0.363																																																1	Substitution - Missense(1)	ovary(1)	4											63.0	60.0	61.0					4																	120189479		1824	4085	5909	120408927	SO:0001583	missense	54532			BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.1192G>C	4.37:g.120189479G>C	ENSP00000274030:p.Asp398His	Somatic		Capture	Illumina GAIIx	4	120408927		Missense_Mutation	SNP	-	p.D398H	ENST00000274030.6	37	c.1192	CCDS43265.1	4	.	.	.	.	.	.	.	.	.	.	G	14.18	2.459657	0.43736	.	.	ENSG00000145390	ENST00000274030;ENST00000450251	T;T	0.50548	0.74;0.74	5.46	4.59	0.56863	.	0.187671	0.44285	N	0.000473	T	0.44644	0.1303	L	0.53249	1.67	0.25737	N	0.985204	B	0.18741	0.03	B	0.14578	0.011	T	0.43147	-0.9409	10	0.54805	T	0.06	-13.9814	14.6802	0.69012	0.0:0.1439:0.8561:0.0	.	398	Q70EK8	UBP53_HUMAN	H	398	ENSP00000274030:D398H;ENSP00000409906:D398H	ENSP00000274030:D398H	D	+	1	0	USP53	120408927	1.000000	0.71417	0.926000	0.36857	0.981000	0.71138	3.770000	0.55310	2.570000	0.86706	0.563000	0.77884	GAT	-	NULL		0.363	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP53	protein_coding	OTTHUMT00000364564.2	G	XM_052597		120408927	1	no_errors	NM_019050	genbank	human	validated	54_36p	missense	SNP	0.77	C
KIAA1109	84162	genome.wustl.edu	37	4	123267859	123267859	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr4:123267859A>G	ENST00000264501.4	+	75	13188	c.12815A>G	c.(12814-12816)tAt>tGt	p.Y4272C	KIAA1109_ENST00000388738.3_Missense_Mutation_p.Y4272C			Q2LD37	K1109_HUMAN	KIAA1109	4272					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.Y4272C(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AGAGCATGGTATAGAAGAAGT	0.358																																																1	Substitution - Missense(1)	ovary(1)	4											186.0	171.0	176.0					4																	123267859		1860	4098	5958	123487309	SO:0001583	missense	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.12815A>G	4.37:g.123267859A>G	ENSP00000264501:p.Tyr4272Cys	Somatic		Capture	Illumina GAIIx	4	123487309	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	-	p.Y4272C	ENST00000264501.4	37	c.12815	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.2|25.2	4.612115|4.612115	0.87258|0.87258	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000306802|ENST00000264501;ENST00000388738;ENST00000438707	.|T;T;T	.|0.60424	.|1.02;1.02;0.19	5.99|5.99	5.99|5.99	0.97316|0.97316	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.76630|0.76630	0.4014|0.4014	M|M	0.73598|0.73598	2.24|2.24	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.85130	.|0.997;0.996	T|T	0.79293|0.79293	-0.1863|-0.1863	5|10	.|0.87932	.|D	.|0	.|.	16.4943|16.4943	0.84223|0.84223	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|4271;4272	.|Q2LD37-4;Q2LD37	.|.;K1109_HUMAN	V|C	648|4272;4272;941	.|ENSP00000264501:Y4272C;ENSP00000373390:Y4272C;ENSP00000410874:Y941C	.|ENSP00000264501:Y4272C	I|Y	+|+	1|2	0|0	KIAA1109|KIAA1109	123487309|123487309	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.995000|0.995000	0.86356|0.86356	9.339000|9.339000	0.96797|0.96797	2.291000|2.291000	0.77112|0.77112	0.533000|0.533000	0.62120|0.62120	ATA|TAT	-	NULL		0.358	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	protein_coding	OTTHUMT00000316415.1	A	NM_020797		123487309	1	no_errors	NM_015312	genbank	human	validated	54_36p	missense	SNP	1	G
FBXL5	26234	genome.wustl.edu	37	4	15628522	15628531	+	Frame_Shift_Del	DEL	AGTCTGGGTA	AGTCTGGGTA	-	rs377569649|rs199959677		TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	AGTCTGGGTA	AGTCTGGGTA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr4:15628522_15628531delAGTCTGGGTA	ENST00000341285.3	-	8	1213_1222	c.1089_1098delTACCCAGACT	c.(1087-1098)cttacccagactfs	p.LTQT363fs	FBXL5_ENST00000412094.2_Frame_Shift_Del_p.LTQT346fs|FBXL5_ENST00000382358.4_Frame_Shift_Del_p.LTQT237fs	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5	363					iron ion homeostasis (GO:0055072)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	iron ion binding (GO:0005506)|ubiquitin-protein transferase activity (GO:0004842)	p.Q365fs*34(1)		endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13						CTGAAATGTCAGTCTGGGTAAGATCCAGAT	0.319																																																1	Deletion - Frameshift(1)	ovary(1)	4																																								15237629	SO:0001589	frameshift_variant	26234			AF174591	CCDS3415.1, CCDS54745.1	4p15.33	2011-06-09			ENSG00000118564	ENSG00000118564		"""F-boxes / Leucine-rich repeats"""	13602	protein-coding gene	gene with protein product		605655				10531035	Standard	NM_012161		Approved	FBL4, FBL5, FLR1	uc003goc.2	Q9UKA1	OTTHUMG00000097097	ENST00000341285.3:c.1089_1098delTACCCAGACT	4.37:g.15628522_15628531delAGTCTGGGTA	ENSP00000344866:p.Leu363fs	Somatic		Capture	Illumina GAIIx	4	15237620	A8MSK4|B4DIB5|Q4W5A8|Q8NHP3|Q9NXN2|Q9P0I0|Q9P0X5|Q9UJT7|Q9UKC8	Frame_Shift_Del	DEL	HMMPfam_LRR_1;HMMPfam_F-box;HMMPfam_LRR_2;superfamily_RNI-like;superfamily_F-box domain	p.Q365fs	ENST00000341285.3	37	c.1098_1089	CCDS3415.1	4																																																																																			(deletion:cds_exon[15237594;15237676])	HMMPfam_LRR_1		0.319	FBXL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL5	protein_coding	OTTHUMT00000214235.2	AGTCTGGGTA			15237629	-1	no_errors	NM_012161	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.998:1.000:1.000:0.998:1.000:1.000:0.998:1.000:1.000:0.991	-
FAT4	79633	genome.wustl.edu	37	4	126408729	126408729	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr4:126408729C>T	ENST00000394329.3	+	16	13059	c.13046C>T	c.(13045-13047)cCa>cTa	p.P4349L	FAT4_ENST00000335110.5_Missense_Mutation_p.P2590L	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4349	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P4292L(1)|p.P4349L(1)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GGAGGAATTCCACCCAATCAA	0.383																																																2	Substitution - Missense(2)	ovary(2)	4											69.0	66.0	67.0					4																	126408729		2203	4300	6503	126628179	SO:0001583	missense	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.13046C>T	4.37:g.126408729C>T	ENSP00000377862:p.Pro4349Leu	Somatic		Capture	Illumina GAIIx	4	126628179	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	-	p.P4292L	ENST00000394329.3	37	c.12875	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	C	19.47	3.833921	0.71373	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	D;D	0.83506	-1.73;-1.54	5.41	5.41	0.78517	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.34268	U	0.004114	D	0.86715	0.5999	M	0.72118	2.19	0.80722	D	1	P;P;P	0.52577	0.944;0.954;0.944	P;P;P	0.54706	0.646;0.759;0.646	D	0.84668	0.0710	10	0.27785	T	0.31	.	13.2006	0.59765	0.159:0.841:0.0:0.0	.	2590;4349;4349	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	L	4349;2590	ENSP00000377862:P4349L;ENSP00000335169:P2590L	ENSP00000335169:P2590L	P	+	2	0	FAT4	126628179	0.999000	0.42202	1.000000	0.80357	0.737000	0.42083	4.041000	0.57339	2.532000	0.85374	0.650000	0.86243	CCA	-	NULL		0.383	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	protein_coding	OTTHUMT00000256765.2	C	NM_024582		126628179	1	no_errors	NM_024582	genbank	human	validated	54_36p	missense	SNP	1	T
WNT8A	7478	genome.wustl.edu	37	5	137419943	137419943	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr5:137419943G>C	ENST00000398754.1	+	2	78	c.73G>C	c.(73-75)Gtg>Ctg	p.V25L	WNT8A_ENST00000506684.1_Missense_Mutation_p.V43L	NM_058244.2	NP_490645.1	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family, member 8A	25					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|endoderm development (GO:0007492)|establishment of organ orientation (GO:0048561)|neural crest cell fate commitment (GO:0014034)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|polarity specification of anterior/posterior axis (GO:0009949)|polarity specification of proximal/distal axis (GO:0010085)|regulation of protein localization (GO:0032880)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|response to retinoic acid (GO:0032526)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.V25L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGGTAGGTCAGTGAACAATTT	0.507																																																1	Substitution - Missense(1)	ovary(1)	5											130.0	129.0	129.0					5																	137419943		1912	4137	6049	137447842	SO:0001583	missense	7478			AB057725	CCDS43368.1, CCDS75311.1	5q31	2008-07-18			ENSG00000061492	ENSG00000061492		"""Wingless-type MMTV integration sites"""	12788	protein-coding gene	gene with protein product		606360				11408932	Standard	XM_005272076		Approved	WNT8D	uc003lcd.1	Q9H1J5	OTTHUMG00000129196	ENST00000398754.1:c.73G>C	5.37:g.137419943G>C	ENSP00000381739:p.Val25Leu	Somatic		Capture	Illumina GAIIx	4	137447842	Q96S51	Missense_Mutation	SNP	HMMPfam_wnt	p.V25L	ENST00000398754.1	37	c.73	CCDS43368.1	5	.	.	.	.	.	.	.	.	.	.	G	18.85	3.710661	0.68730	.	.	ENSG00000061492	ENST00000506684;ENST00000504809;ENST00000398754	T;T;T	0.74842	-0.79;-0.78;-0.88	5.28	5.28	0.74379	.	0.244211	0.24854	N	0.035073	T	0.74718	0.3753	L	0.37561	1.115	0.80722	D	1	B;B;D	0.53745	0.345;0.345;0.962	B;B;P	0.51701	0.163;0.163;0.677	T	0.69982	-0.4997	10	0.23302	T	0.38	.	19.1173	0.93346	0.0:0.0:1.0:0.0	.	43;43;25	D6RF47;D6RF94;Q9H1J5	.;.;WNT8A_HUMAN	L	43;43;25	ENSP00000426653:V43L;ENSP00000424809:V43L;ENSP00000381739:V25L	ENSP00000354726:V25L	V	+	1	0	WNT8A	137447842	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.263000	0.95617	2.746000	0.94184	0.655000	0.94253	GTG	-	HMMPfam_wnt		0.507	WNT8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT8A	protein_coding	OTTHUMT00000280395.1	G	NM_058244		137447842	1	no_errors	NM_058244	genbank	human	reviewed	54_36p	missense	SNP	1	C
FAM53C	51307	genome.wustl.edu	37	5	137682561	137682561	+	Silent	SNP	G	G	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr5:137682561G>T	ENST00000239906.5	+	5	1520	c.1092G>T	c.(1090-1092)gtG>gtT	p.V364V	FAM53C_ENST00000434981.2_Silent_p.V364V|RP11-256P1.1_ENST00000504539.1_RNA|FAM53C_ENST00000513056.1_3'UTR	NM_016605.2	NP_057689.1	Q9NYF3	FA53C_HUMAN	family with sequence similarity 53, member C	364								p.V364V(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			AGGGGGCTGTGCGGTGGGGTC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	5											37.0	45.0	42.0					5																	137682561		2203	4300	6503	137710460	SO:0001819	synonymous_variant	51307			AF251040	CCDS4204.1	5q31	2008-02-05	2004-11-24	2004-11-26	ENSG00000120709	ENSG00000120709			1336	protein-coding gene	gene with protein product		609372	"""chromosome 5 open reading frame 6"""	C5orf6		11087669, 11161817	Standard	NM_001135647		Approved		uc003lcv.3	Q9NYF3	OTTHUMG00000129201	ENST00000239906.5:c.1092G>T	5.37:g.137682561G>T		Somatic		Capture	Illumina GAIIx	4	137710460	B2RDJ5|D3DQB9	Silent	SNP	-	p.V364	ENST00000239906.5	37	c.1092	CCDS4204.1	5																																																																																			-	NULL		0.607	FAM53C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM53C	protein_coding	OTTHUMT00000251278.2	G	NM_016605		137710460	1	no_errors	NM_016605	genbank	human	validated	54_36p	silent	SNP	0.99	T
PCDHGA5	56110	genome.wustl.edu	37	5	140745791	140745791	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr5:140745791C>A	ENST00000518069.1	+	1	1894	c.1894C>A	c.(1894-1896)Ctg>Atg	p.L632M	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	632	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L632M(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCGCGAGCCCTGCTGGACAG	0.672																																																1	Substitution - Missense(1)	ovary(1)	5											69.0	78.0	75.0					5																	140745791		2203	4300	6503	140725975	SO:0001583	missense	56110			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.1894C>A	5.37:g.140745791C>A	ENSP00000429834:p.Leu632Met	Somatic		Capture	Illumina GAIIx	4	140725975	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	-	p.L632M	ENST00000518069.1	37	c.1894	CCDS54925.1	5	.	.	.	.	.	.	.	.	.	.	.	10.46	1.357023	0.24598	.	.	ENSG00000253485	ENST00000518069	T	0.15834	2.39	4.58	3.42	0.39159	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.35422	0.0931	M	0.84219	2.685	0.09310	N	1	P;P	0.49358	0.906;0.923	P;P	0.55161	0.66;0.77	T	0.11324	-1.0592	9	0.66056	D	0.02	.	8.3159	0.32100	0.0:0.7727:0.0:0.2273	.	632;632	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	M	632	ENSP00000429834:L632M	ENSP00000429834:L632M	L	+	1	2	PCDHGA5	140725975	0.000000	0.05858	0.996000	0.52242	0.205000	0.24178	-0.211000	0.09332	2.266000	0.75297	0.563000	0.77884	CTG	-	NULL		0.672	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA5	protein_coding	OTTHUMT00000374742.1	C	NM_018918		140725975	1	no_errors	NM_018918	genbank	human	reviewed	54_36p	missense	SNP	0.18	A
GABRG2	2566	genome.wustl.edu	37	5	161531031	161531031	+	Splice_Site	SNP	C	C	A	rs201672465	byFrequency	TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr5:161531031C>A	ENST00000361925.4	+	6	988	c.768C>A	c.(766-768)tcC>tcA	p.S256S	GABRG2_ENST00000414552.2_Splice_Site_p.S296S|GABRG2_ENST00000393933.4_Splice_Site_p.S161S|GABRG2_ENST00000356592.3_Splice_Site_p.S256S			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	256					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.S256S(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGACAACTTCCGGTAAGATGC	0.383																																																1	Substitution - coding silent(1)	ovary(1)	5											72.0	70.0	71.0					5																	161531031		2203	4300	6503	161463609	SO:0001630	splice_region_variant	2566				CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.769+1C>A	5.37:g.161531031C>A		Somatic		Capture	Illumina GAIIx	4	161463609	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Silent	SNP	HMMPfam_Neur_chan_memb;HMMPfam_Neur_chan_LBD;superfamily_Nicotinic receptor ligand binding domain-like;superfamily_Neurotransmitter-gated ion-channel transmembrane pore	p.S256	ENST00000361925.4	37	c.768	CCDS4358.1	5																																																																																			-	HMMPfam_Neur_chan_LBD		0.383	GABRG2-002	KNOWN	basic|CCDS	protein_coding	GABRG2	protein_coding	OTTHUMT00000252706.1	C		Silent	161463609	1	no_errors	NM_198904	genbank	human	reviewed	54_36p	silent	SNP	0.99	A
CDH18	1016	genome.wustl.edu	37	5	19838997	19838997	+	Silent	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr5:19838997C>T	ENST00000507958.1	-	5	1089	c.99G>A	c.(97-99)gtG>gtA	p.V33V	CDH18_ENST00000274170.4_Silent_p.V33V|CDH18_ENST00000511273.1_Silent_p.V33V|CDH18_ENST00000502796.1_Silent_p.V33V|CDH18_ENST00000382275.1_Silent_p.V33V|CDH18_ENST00000506372.1_Silent_p.V33V			Q13634	CAD18_HUMAN	cadherin 18, type 2	33					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V33V(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GGTTTCTCATCACCTTGATGG	0.428																																																1	Substitution - coding silent(1)	ovary(1)	5											223.0	184.0	197.0					5																	19838997		2203	4300	6503	19874754	SO:0001819	synonymous_variant	1016			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.99G>A	5.37:g.19838997C>T		Somatic		Capture	Illumina GAIIx	4	19874754	A8K0I2|B4DHG6|Q8N5Z2	Silent	SNP	HMMPfam_Cadherin_C;HMMPfam_Cadherin;superfamily_Cadherin-like	p.V33	ENST00000507958.1	37	c.99	CCDS3889.1	5																																																																																			-	NULL		0.428	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	protein_coding	OTTHUMT00000366747.1	C	NM_004934		19874754	-1	no_errors	NM_004934	genbank	human	reviewed	54_36p	silent	SNP	1	T
RUFY1	80230	genome.wustl.edu	37	5	179036423	179036423	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr5:179036423G>C	ENST00000319449.4	+	18	2042	c.2030G>C	c.(2029-2031)aGc>aCc	p.S677T	RUFY1_ENST00000377001.2_3'UTR|RUFY1_ENST00000437570.2_Missense_Mutation_p.S569T|RUFY1_ENST00000508797.1_3'UTR|RUFY1_ENST00000393438.2_Missense_Mutation_p.S569T	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	677					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.S569T(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACCTGCTCCAGCAACGAGCTG	0.652										HNSCC(44;0.11)																																						1	Substitution - Missense(1)	ovary(1)	5											85.0	67.0	73.0					5																	179036423		2203	4300	6503	178969029	SO:0001583	missense	80230			AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.2030G>C	5.37:g.179036423G>C	ENSP00000325594:p.Ser677Thr	Somatic		Capture	Illumina GAIIx	4	178969029	Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	-	p.S677T	ENST00000319449.4	37	c.2030	CCDS4445.2	5	.	.	.	.	.	.	.	.	.	.	N	13.30	2.195288	0.38806	.	.	ENSG00000176783	ENST00000319449;ENST00000437570;ENST00000393438;ENST00000360569	T;T;T	0.72835	-0.69;-0.69;-0.69	5.34	4.45	0.53987	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.079098	0.85682	D	0.000000	T	0.65026	0.2652	L	0.46885	1.475	0.80722	D	1	B	0.18863	0.031	B	0.25759	0.063	T	0.59621	-0.7420	10	0.19590	T	0.45	-3.6536	16.1261	0.81397	0.0:0.1341:0.8659:0.0	.	677	Q96T51	RUFY1_HUMAN	T	677;569;569;279	ENSP00000325594:S677T;ENSP00000390025:S569T;ENSP00000377087:S569T	ENSP00000325594:S677T	S	+	2	0	RUFY1	178969029	1.000000	0.71417	0.988000	0.46212	0.997000	0.91878	5.673000	0.68109	1.350000	0.45770	0.549000	0.68633	AGC	-	NULL		0.652	RUFY1-001	KNOWN	basic|CCDS	protein_coding	RUFY1	protein_coding	OTTHUMT00000253505.2	G	NM_001040451		178969029	1	no_errors	NM_025158	genbank	human	validated	54_36p	missense	SNP	1	C
OR4A13P	81330	genome.wustl.edu	37	11	55234749	55234749	+	IGR	SNP	G	G	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr11:55234749G>T								OR4A15 (98355 upstream) : OR4C15 (87033 downstream)														p.G73V(1)									CCTTTCTGTGGCCCCAATGTC	0.463																																																1	Substitution - Missense(1)	ovary(1)	11																																								54991325	SO:0001628	intergenic_variant	81330																															11.37:g.55234749G>T		Somatic		Capture	Illumina GAIIx	4	54991325		Missense_Mutation	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.G73V		37	c.218		11																																																																																			-	HMMPfam_7tm_1	0	0.463					OR4A13P			G			54991325	1	no_errors	ENST00000314689	ensembl	human	known	54_36p	missense	SNP	0.01	T
HACE1	57531	genome.wustl.edu	37	6	105198338	105198338	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr6:105198338C>G	ENST00000262903.4	-	20	2497	c.2221G>C	c.(2221-2223)Gtc>Ctc	p.V741L	HACE1_ENST00000369125.2_Missense_Mutation_p.V526L|HACE1_ENST00000517995.1_5'UTR	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	741	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)	p.V741L(1)|p.V741F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		ACAAGCTGGACGTACTCCGCC	0.353																																																2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)	6											98.0	90.0	93.0					6																	105198338		2203	4300	6503	105305031	SO:0001583	missense	57531			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.2221G>C	6.37:g.105198338C>G	ENSP00000262903:p.Val741Leu	Somatic		Capture	Illumina GAIIx	4	105305031	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	-	p.V741L	ENST00000262903.4	37	c.2221	CCDS5050.1	6	.	.	.	.	.	.	.	.	.	.	C	26.5	4.746671	0.89663	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	T;T	0.50548	0.74;0.74	5.3	5.3	0.74995	HECT (4);	0.000000	0.85682	D	0.000000	T	0.59362	0.2188	L	0.52823	1.66	0.34240	D	0.677519	D;D;D;D	0.89917	0.994;1.0;0.967;0.959	D;D;D;D	0.87578	0.979;0.998;0.964;0.94	T	0.64533	-0.6385	10	0.87932	D	0	.	18.9352	0.92583	0.0:1.0:0.0:0.0	.	526;230;741;394	E9PGP0;B4DFM6;Q8IYU2;Q8IYU2-3	.;.;HACE1_HUMAN;.	L	741;526	ENSP00000262903:V741L;ENSP00000358121:V526L	ENSP00000262903:V741L	V	-	1	0	HACE1	105305031	1.000000	0.71417	0.981000	0.43875	0.907000	0.53573	7.323000	0.79105	2.473000	0.83533	0.563000	0.77884	GTC	-	NULL		0.353	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HACE1	protein_coding	OTTHUMT00000041643.2	C	XM_045095		105305031	-1	no_errors	NM_020771	genbank	human	validated	54_36p	missense	SNP	1	G
LAMA4	3910	genome.wustl.edu	37	6	112443318	112443318	+	Silent	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr6:112443318G>A	ENST00000230538.7	-	32	4771	c.4374C>T	c.(4372-4374)caC>caT	p.H1458H	LAMA4_ENST00000522006.1_Silent_p.H1451H|LAMA4_ENST00000389463.4_Silent_p.H1451H|LAMA4_ENST00000424408.2_Silent_p.H1451H	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1458					blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)	p.H1451H(1)		NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TGTTGGAAAGGTGGCAATGAG	0.458																																																1	Substitution - coding silent(1)	ovary(1)	6											164.0	154.0	157.0					6																	112443318		2203	4300	6503	112550011	SO:0001819	synonymous_variant	3910				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.4374C>T	6.37:g.112443318G>A		Somatic		Capture	Illumina GAIIx	4	112550011	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Silent	SNP	-	p.H1458	ENST00000230538.7	37	c.4374	CCDS43491.1	6																																																																																			-	NULL		0.458	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	protein_coding	OTTHUMT00000041876.2	G	NM_001105206		112550011	-1	no_errors	NM_001105206	genbank	human	reviewed	54_36p	silent	SNP	1	A
MAP3K5	4217	genome.wustl.edu	37	6	137019626	137019626	+	Splice_Site	SNP	C	C	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr6:137019626C>G	ENST00000359015.4	-	4	1167		c.e4+1			NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)	p.?(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TTAAACTTTACCTAGAACTTG	0.383																																																1	Unknown(1)	ovary(1)	6											65.0	62.0	63.0					6																	137019626		2203	4300	6503	137061319	SO:0001630	splice_region_variant	4217			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.806+1G>C	6.37:g.137019626C>G		Somatic		Capture	Illumina GAIIx	4	137061319	A6NIA0|B4DGB2|Q5THN3|Q99461	Splice_Site	SNP	-	e4+1	ENST00000359015.4	37	c.806+1	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396406	0.83011	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.88	0.96892	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAP3K5	137061319	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.270000	0.78493	2.703000	0.92315	0.655000	0.94253	.	-	-		0.383	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	protein_coding	OTTHUMT00000042383.1	C		Intron	137061319	-1	no_errors	NM_005923	genbank	human	reviewed	54_36p	splice_site	SNP	1	G
PPP1R11	6992	genome.wustl.edu	37	6	30036907	30036907	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr6:30036907G>T	ENST00000376772.3	+	3	528	c.205G>T	c.(205-207)Gcc>Tcc	p.A69S	PPP1R11_ENST00000376765.2_Missense_Mutation_p.A17S|PPP1R11_ENST00000376763.1_Missense_Mutation_p.A17S|PPP1R11_ENST00000376758.1_Missense_Mutation_p.A17S|PPP1R11_ENST00000376773.1_Missense_Mutation_p.A17S|PPP1R11_ENST00000376769.2_Missense_Mutation_p.A17S	NM_021959.2	NP_068778.1	O60927	PP1RB_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 11	69						cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)	p.A69S(1)		lung(2)|ovary(1)|prostate(1)|skin(2)	6						GAAACCTCGGGCCTTTGGCGA	0.512																																					Pancreas(185;1767 3918 43793)											1	Substitution - Missense(1)	ovary(1)	6											57.0	62.0	60.0					6																	30036907		1510	2707	4217	30144886	SO:0001583	missense	6992			X81003	CCDS4671.1	6p21.3	2012-04-17			ENSG00000204619	ENSG00000204619		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9285	protein-coding gene	gene with protein product		606670		TCTE5		9843442, 8781118	Standard	NM_021959		Approved	HCGV, Tctex5, HCG-V	uc003npb.3	O60927	OTTHUMG00000031260	ENST00000376772.3:c.205G>T	6.37:g.30036907G>T	ENSP00000365963:p.Ala69Ser	Somatic		Capture	Illumina GAIIx	4	30144886		Missense_Mutation	SNP	HMMPfam_PPI_Ypi1	p.A69S	ENST00000376772.3	37	c.205	CCDS4671.1	6	.	.	.	.	.	.	.	.	.	.	G	20.3	3.964527	0.74131	.	.	ENSG00000204619	ENST00000376773;ENST00000376772;ENST00000376769;ENST00000376765;ENST00000376763;ENST00000376758	.	.	.	5.4	4.54	0.55810	.	0.110785	0.64402	D	0.000009	T	0.45115	0.1326	L	0.53671	1.685	0.37622	D	0.921332	P	0.52170	0.951	P	0.51866	0.682	T	0.52997	-0.8500	9	0.66056	D	0.02	-2.513	10.2932	0.43608	0.0918:0.0:0.9082:0.0	.	69	O60927	PP1RB_HUMAN	S	17;69;17;17;17;17	.	ENSP00000365949:A17S	A	+	1	0	PPP1R11	30144886	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.455000	0.60075	1.269000	0.44280	0.549000	0.68633	GCC	-	HMMPfam_PPI_Ypi1		0.512	PPP1R11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R11	protein_coding	OTTHUMT00000076557.3	G	NM_021959		30144886	1	no_errors	NM_021959	genbank	human	reviewed	54_36p	missense	SNP	1	T
VARS	7407	genome.wustl.edu	37	6	31746775	31746775	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr6:31746775G>A	ENST00000375663.3	-	29	4135	c.3695C>T	c.(3694-3696)cCg>cTg	p.P1232L	VWA7_ENST00000375686.3_5'Flank|VWA7_ENST00000467576.1_5'Flank|Y_RNA_ENST00000364685.1_RNA|VARS_ENST00000482996.1_5'Flank|VWA7_ENST00000447450.1_5'Flank|VWA7_ENST00000375688.4_5'Flank	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	1232					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)	p.P1232L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	GACTTCGAGCGGCACCTTGAC	0.647																																																1	Substitution - Missense(1)	ovary(1)	6											48.0	53.0	52.0					6																	31746775		1503	2699	4202	31854754	SO:0001583	missense	7407			BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.3695C>T	6.37:g.31746775G>A	ENSP00000364815:p.Pro1232Leu	Somatic		Capture	Illumina GAIIx	4	31854754	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	HMMPfam_tRNA-synt_1;HMMPfam_GST_N;HMMPfam_GST_C;superfamily_ValRS/IleRS/LeuRS editing domain;superfamily_Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases;superfamily_tRNA-binding arm;superfamily_Glutathione S-transferase (GST) C-terminal domain;HMMPfam_Anticodon_1;superfamily_Nucleotidylyl transferase	p.P1232L	ENST00000375663.3	37	c.3695	CCDS34412.1	6	.	.	.	.	.	.	.	.	.	.	G	16.81	3.225996	0.58668	.	.	ENSG00000204394	ENST00000375663	T	0.06528	3.29	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.18635	0.0447	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.00346	-1.1800	10	0.87932	D	0	-22.3061	15.805	0.78491	0.0:0.0:1.0:0.0	.	1232	P26640	SYVC_HUMAN	L	1232	ENSP00000364815:P1232L	ENSP00000364815:P1232L	P	-	2	0	VARS	31854754	1.000000	0.71417	1.000000	0.80357	0.247000	0.25773	5.105000	0.64591	2.593000	0.87608	0.456000	0.33151	CCG	-	NULL		0.647	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VARS	protein_coding	OTTHUMT00000076619.2	G	NM_006295		31854754	-1	no_errors	NM_006295	genbank	human	reviewed	54_36p	missense	SNP	0.99	A
BRD2	6046	genome.wustl.edu	37	6	32945907	32945907	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr6:32945907G>C	ENST00000374825.4	+	10	3284	c.1583G>C	c.(1582-1584)cGg>cCg	p.R528P	BRD2_ENST00000374831.4_Missense_Mutation_p.R528P|BRD2_ENST00000449085.2_Missense_Mutation_p.R481P|BRD2_ENST00000395287.1_Missense_Mutation_p.R528P|BRD2_ENST00000395289.2_Missense_Mutation_p.R528P|BRD2_ENST00000443797.2_Missense_Mutation_p.R408P	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	528					chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)	p.R528P(1)		central_nervous_system(3)|stomach(2)	5						CTTTAGCTTCGGGCAGTACAT	0.388																																																1	Substitution - Missense(1)	ovary(1)	6											37.0	44.0	41.0					6																	32945907		1503	2706	4209	33053885	SO:0001583	missense	6046			X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1583G>C	6.37:g.32945907G>C	ENSP00000363958:p.Arg528Pro	Somatic		Capture	Illumina GAIIx	4	33053885	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	HMMPfam_Bromodomain;superfamily_Bromodomain	p.R528P	ENST00000374825.4	37	c.1583	CCDS4762.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.034333|4.034333	0.75617|0.75617	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000449025|ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085	.|T;T;T;T;T;T	.|0.12147	.|2.71;2.71;2.71;2.71;2.71;2.71	5.37|5.37	5.37|5.37	0.77165|0.77165	.|.	.|0.153231	.|0.30528	.|N	.|0.009439	T|T	0.21267|0.21267	0.0512|0.0512	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	.|D;B	.|0.60160	.|0.987;0.064	.|P;B	.|0.51453	.|0.67;0.018	T|T	0.00829|0.00829	-1.1549|-1.1549	5|10	.|0.56958	.|D	.|0.05	-13.2152|-13.2152	16.6505|16.6505	0.85188|0.85188	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|528;528	.|A2AAU0;P25440	.|.;BRD2_HUMAN	R|P	534|528;528;528;408;528;481	.|ENSP00000363958:R528P;ENSP00000363964:R528P;ENSP00000378704:R528P;ENSP00000413495:R408P;ENSP00000378702:R528P;ENSP00000409145:R481P	.|ENSP00000363958:R528P	G|R	+|+	1|2	0|0	BRD2|BRD2	33053885|33053885	0.028000|0.028000	0.19301|0.19301	1.000000|1.000000	0.80357|0.80357	0.690000|0.690000	0.40134|0.40134	1.926000|1.926000	0.40084|0.40084	2.786000|2.786000	0.95864|0.95864	0.643000|0.643000	0.83706|0.83706	GGG|CGG	-	NULL		0.388	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD2	protein_coding	OTTHUMT00000076503.2	G			33053885	1	no_errors	NM_005104	genbank	human	reviewed	54_36p	missense	SNP	0.74	C
PKHD1	5314	genome.wustl.edu	37	6	51483974	51483974	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr6:51483974A>C	ENST00000371117.3	-	67	12405	c.12130T>G	c.(12130-12132)Ttg>Gtg	p.L4044V	RP3-335N17.2_ENST00000589278.2_RNA|RP3-335N17.2_ENST00000454361.1_RNA|RP3-335N17.2_ENST00000587000.1_RNA	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	4044					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.L4044V(2)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GAAAGCCCCAAGCTGCCACTT	0.552																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	6											43.0	45.0	44.0					6																	51483974		2203	4300	6503	51591933	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.12130T>G	6.37:g.51483974A>C	ENSP00000360158:p.Leu4044Val	Somatic		Capture	Illumina GAIIx	4	51591933	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	HMMPfam_TIG;superfamily_Pectin lyase-like;superfamily_E set domains;superfamily_Anthrax protective antigen	p.L4044V	ENST00000371117.3	37	c.12130	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	A	9.797	1.179552	0.21787	.	.	ENSG00000170927	ENST00000371117	D	0.86497	-2.13	5.27	-4.87	0.03123	.	1.776200	0.03235	N	0.179515	T	0.60051	0.2239	L	0.28740	0.885	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.54029	-0.8354	10	0.40728	T	0.16	.	4.4046	0.11402	0.238:0.5329:0.0898:0.1392	.	4044	P08F94	PKHD1_HUMAN	V	4044	ENSP00000360158:L4044V	ENSP00000360158:L4044V	L	-	1	2	PKHD1	51591933	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.131000	0.03238	-0.534000	0.06315	0.533000	0.62120	TTG	-	NULL		0.552	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	protein_coding	OTTHUMT00000040893.1	A	NM_138694		51591933	-1	no_errors	NM_138694	genbank	human	reviewed	54_36p	missense	SNP		C
SYNE1	23345	genome.wustl.edu	37	6	152683379	152683379	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr6:152683379C>A	ENST00000367255.5	-	64	10826	c.10225G>T	c.(10225-10227)Gaa>Taa	p.E3409*	SYNE1_ENST00000423061.1_Nonsense_Mutation_p.E3416*|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.E3409*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.E3416*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3409					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.E3409*(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGGTTGGCTTCCATACTATCC	0.493										HNSCC(10;0.0054)																																						2	Substitution - Nonsense(2)	ovary(2)	6											139.0	123.0	129.0					6																	152683379		2203	4300	6503	152725072	SO:0001587	stop_gained	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10225G>T	6.37:g.152683379C>A	ENSP00000356224:p.Glu3409*	Somatic		Capture	Illumina GAIIx	4	152725072	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	superfamily_Spectrin repeat;superfamily_Calponin-homology domain CH-domain;superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain;HMMPfam_CH;HMMPfam_Spectrin	p.E3409*	ENST00000367255.5	37	c.10225	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	54	21.926216	0.99944	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	.	.	.	5.28	5.28	0.74379	.	0.000000	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	19.2776	0.94038	0.0:1.0:0.0:0.0	.	.	.	.	X	3409;3416;3409;3416	.	ENSP00000265368:E3409X	E	-	1	0	SYNE1	152725072	1.000000	0.71417	0.959000	0.39883	0.054000	0.15201	7.424000	0.80242	2.611000	0.88343	0.655000	0.94253	GAA	-	NULL		0.493	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	C	NM_182961		152725072	-1	no_errors	NM_182961	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
OR52L2P	79274	genome.wustl.edu	37	11	6078563	6078563	+	IGR	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr11:6078563G>A								OR56A1 (29592 upstream) : OR56B4 (50350 downstream)														p.Q315*(1)									TGGATCTTCTGGGTCTTCACC	0.493																																																1	Substitution - Nonsense(1)	ovary(1)	11																																								6035139	SO:0001628	intergenic_variant	79274																															11.37:g.6078563G>A		Somatic		Capture	Illumina GAIIx	4	6035139		Nonsense_Mutation	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.Q315*		37	c.943		11																																																																																			-	NULL	0	0.493					OR52L2P			G			6035139	-1	no_errors	ENST00000316540	ensembl	human	known	54_36p	nonsense	SNP	0.01	A
PMS2CL	441194	genome.wustl.edu	37	7	6777092	6777092	+	RNA	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr7:6777092C>A	ENST00000486256.1	+	0	1219					NR_002217.1		Q68D20	PMS2L_HUMAN	PMS2 C-terminal like pseudogene									p.D124E(1)									GCATCCCAGACACGGGCAGTC	0.627																																																1	Substitution - Missense(1)	ovary(1)	7																																								6743617			5395			BC041364		7p22.1	2010-10-26			ENSG00000187953	ENSG00000187953			30061	pseudogene	pseudogene	"""postmeiotic segregation increased 2 pseudogene 13"""					15256438, 17253626	Standard	NR_002217		Approved	PMS2P13	uc011jxb.1	Q68D20	OTTHUMG00000151857		7.37:g.6777092C>A		Somatic		Capture	Illumina GAIIx	4	6743617	B4DK88|Q764P1	Missense_Mutation	SNP	-	p.D124E	ENST00000486256.1	37	c.372		7																																																																																			-	NULL		0.627	PMS2CL-002	KNOWN	basic	processed_transcript	PMS2CL	pseudogene	OTTHUMT00000324193.1	C	NR_002217		6743617	1	no_errors	ENST00000338780	ensembl	human	known	54_36p	missense	SNP	0.03	A
AMPH	273	genome.wustl.edu	37	7	38429468	38429468	+	Silent	SNP	A	A	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr7:38429468A>G	ENST00000356264.2	-	20	2132	c.1917T>C	c.(1915-1917)gaT>gaC	p.D639D	AMPH_ENST00000471913.1_5'Flank|AMPH_ENST00000325590.5_Silent_p.D597D|AMPH_ENST00000428293.2_Silent_p.D597D	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	639	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)	p.D639D(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						AGGTAAGTTCATCAGAATTTG	0.418																																																1	Substitution - coding silent(1)	ovary(1)	7											181.0	171.0	174.0					7																	38429468		2203	4300	6503	38395993	SO:0001819	synonymous_variant	273				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1917T>C	7.37:g.38429468A>G		Somatic		Capture	Illumina GAIIx	4	38395993	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Silent	SNP	HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_BAR	p.D639	ENST00000356264.2	37	c.1917	CCDS5456.1	7	.	.	.	.	.	.	.	.	.	.	A	8.884	0.952458	0.18431	.	.	ENSG00000078053	ENST00000441628	.	.	.	5.04	2.73	0.32206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-34.0462	9.31	0.37898	0.8504:0.0:0.1495:0.0	.	.	.	.	R	522	.	.	X	-	1	0	AMPH	38395993	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.274000	0.58921	1.024000	0.39682	-0.456000	0.05471	TGA	-	HMMPfam_SH3_1		0.418	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPH	protein_coding	OTTHUMT00000226953.2	A	NM_001635		38395993	-1	no_errors	NM_001635	genbank	human	reviewed	54_36p	silent	SNP	1	G
VSTM2A	222008	genome.wustl.edu	37	7	54617710	54617710	+	Missense_Mutation	SNP	G	G	A	rs548506452		TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr7:54617710G>A	ENST00000407838.3	+	4	887	c.481G>A	c.(481-483)Gaa>Aaa	p.E161K	VSTM2A_ENST00000302287.3_Missense_Mutation_p.E161K|VSTM2A_ENST00000402026.2_Missense_Mutation_p.E160K|VSTM2A_ENST00000498834.1_3'UTR|VSTM2A_ENST00000404951.1_Missense_Mutation_p.E161K|VSTM2A_ENST00000402613.3_Missense_Mutation_p.E161K	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	161						extracellular region (GO:0005576)		p.E160K(1)		endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			GCAGGCCTTCGAAGCCTCGCC	0.592													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16996	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	7											62.0	56.0	58.0					7																	54617710		2203	4299	6502	54585204	SO:0001583	missense	222008			BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.481G>A	7.37:g.54617710G>A	ENSP00000384967:p.Glu161Lys	Somatic		Capture	Illumina GAIIx	4	54585204	A4D2E9|B5MC94	Missense_Mutation	SNP	-	p.E161K	ENST00000407838.3	37	c.481	CCDS5512.2	7	.	.	.	.	.	.	.	.	.	.	G	17.94	3.511284	0.64522	.	.	ENSG00000170419	ENST00000302287;ENST00000407838;ENST00000404951;ENST00000402026;ENST00000402613	T;T;T;T;T	0.54071	0.61;0.62;0.6;0.61;0.59	5.06	5.06	0.68205	.	0.049488	0.85682	D	0.000000	T	0.66268	0.2772	L	0.46157	1.445	0.36811	D	0.885866	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.986;0.994;0.981	T	0.70905	-0.4745	10	0.49607	T	0.09	-28.802	16.2779	0.82654	0.0:0.0:1.0:0.0	.	161;161;161	Q8TAG5;Q8TAG5-2;B5MCX6	VTM2A_HUMAN;.;.	K	161;161;161;160;161	ENSP00000303108:E161K;ENSP00000384967:E161K;ENSP00000384701:E161K;ENSP00000385933:E160K;ENSP00000384103:E161K	ENSP00000303108:E161K	E	+	1	0	VSTM2A	54585204	1.000000	0.71417	0.995000	0.50966	0.768000	0.43524	6.097000	0.71452	2.501000	0.84356	0.655000	0.94253	GAA	-	NULL		0.592	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VSTM2A	protein_coding	OTTHUMT00000318694.1	G	NM_182546		54585204	1	no_errors	NM_182546	genbank	human	validated	54_36p	missense	SNP	1	A
PTPRZ1	5803	genome.wustl.edu	37	7	121651099	121651099	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr7:121651099G>T	ENST00000393386.2	+	12	2410	c.1999G>T	c.(1999-2001)Gga>Tga	p.G667*	PTPRZ1_ENST00000449182.1_Nonsense_Mutation_p.G667*	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	667					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G667*(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GCCCGATGTTGGATCAGGCAG	0.448																																																1	Substitution - Nonsense(1)	ovary(1)	7											71.0	62.0	65.0					7																	121651099		2203	4300	6503	121438335	SO:0001587	stop_gained	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1999G>T	7.37:g.121651099G>T	ENSP00000377047:p.Gly667*	Somatic		Capture	Illumina GAIIx	4	121438335	A4D0W5|C9JFM0|O76043|Q9UDR6	Nonsense_Mutation	SNP	superfamily_Carbonic anhydrase;HMMPfam_fn3;superfamily_Fibronectin type III;superfamily_(Phosphotyrosine protein) phosphatases II;HMMPfam_Y_phosphatase;HMMPfam_Carb_anhydrase	p.G667*	ENST00000393386.2	37	c.1999	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	G	37	6.332964	0.97480	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	.	.	.	5.87	2.74	0.32292	.	0.555381	0.18310	N	0.145140	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	5.3595	0.16079	0.2239:0.4376:0.3384:0.0	.	.	.	.	X	667	.	ENSP00000377047:G667X	G	+	1	0	PTPRZ1	121438335	0.062000	0.20869	0.017000	0.16124	0.891000	0.51852	1.018000	0.30002	1.484000	0.48361	0.655000	0.94253	GGA	-	NULL		0.448	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	protein_coding	OTTHUMT00000347288.1	G	NM_002851		121438335	1	no_errors	NM_002851	genbank	human	reviewed	54_36p	nonsense	SNP		T
MSR1	4481	genome.wustl.edu	37	8	15967728	15967728	+	Splice_Site	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr8:15967728C>T	ENST00000262101.5	-	10	1344		c.e10-1		MSR1_ENST00000355282.2_Splice_Site|MSR1_ENST00000350896.3_Splice_Site|MSR1_ENST00000445506.2_Splice_Site			P21757	MSRE_HUMAN	macrophage scavenger receptor 1						cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)	p.?(1)		haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		GGACCAGTACCTGCAATAATG	0.368																																																1	Unknown(1)	ovary(1)	8											84.0	88.0	87.0					8																	15967728		2203	4300	6503	16012099	SO:0001630	splice_region_variant	4481			D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.1223-1G>A	8.37:g.15967728C>T		Somatic		Capture	Illumina GAIIx	4	16012099	D3DSP3|O60505|P21759|Q45F10	Splice_Site	SNP	-	e9-1	ENST00000262101.5	37	c.1223-1	CCDS5995.1	8	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948671	0.73787	.	.	ENSG00000038945	ENST00000350896;ENST00000262101;ENST00000445506;ENST00000355282	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1413	0.65322	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MSR1	16012099	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.201000	0.58439	2.458000	0.83093	0.650000	0.86243	.	-	-		0.368	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSR1	protein_coding	OTTHUMT00000211627.2	C		Intron	16012099	-1	no_errors	NM_138715	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
FUT10	84750	genome.wustl.edu	37	8	33246748	33246748	+	Silent	SNP	A	A	C			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr8:33246748A>C	ENST00000327671.5	-	4	1576	c.945T>G	c.(943-945)ctT>ctG	p.L315L	FUT10_ENST00000335589.3_Silent_p.L253L|FUT10_ENST00000524021.1_Silent_p.L287L|FUT10_ENST00000518076.1_5'UTR|FUT10_ENST00000518672.1_Silent_p.L287L	NM_032664.3	NP_116053.3	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10 (alpha (1,3) fucosyltransferase)	315					embryo development (GO:0009790)|fertilization (GO:0009566)|fucosylation (GO:0036065)|hemopoiesis (GO:0030097)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein folding (GO:0006457)|protein glycosylation (GO:0006486)|protein targeting (GO:0006605)|wound healing (GO:0042060)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)	p.L315L(1)		cervix(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	29				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		TGTTACTTGGAAGCCAGTCTG	0.458																																																1	Substitution - coding silent(1)	ovary(1)	8											53.0	49.0	50.0					8																	33246748		2203	4300	6503	33366290	SO:0001819	synonymous_variant	84750			AJ512465	CCDS6088.1	8p12	2013-02-26			ENSG00000172728	ENSG00000172728		"""Fucosyltransferases"""	19234	protein-coding gene	gene with protein product							Standard	NM_032664		Approved		uc003xje.3	Q6P4F1	OTTHUMG00000163954	ENST00000327671.5:c.945T>G	8.37:g.33246748A>C		Somatic		Capture	Illumina GAIIx	4	33366290	A8KAC8|Q70GG3|Q8IVI6|Q8IVI7|Q8IVJ3|Q8TE43|Q9BSR3	Silent	SNP	HMMPfam_Glyco_transf_10	p.L315	ENST00000327671.5	37	c.945	CCDS6088.1	8																																																																																			-	HMMPfam_Glyco_transf_10		0.458	FUT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT10	protein_coding	OTTHUMT00000376540.1	A	NM_032664		33366290	-1	no_errors	NM_032664	genbank	human	validated	54_36p	silent	SNP	1	C
STAR	6770	genome.wustl.edu	37	8	38006254	38006254	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr8:38006254A>T	ENST00000276449.4	-	2	529	c.83T>A	c.(82-84)gTg>gAg	p.V28E	RP11-90P5.2_ENST00000520598.1_RNA	NM_000349.2	NP_000340.2	P49675	STAR_HUMAN	steroidogenic acute regulatory protein	28					bile acid biosynthetic process (GO:0006699)|biphenyl metabolic process (GO:0018879)|brain development (GO:0007420)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth hormone stimulus (GO:0071378)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-alpha (GO:0035457)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to luteinizing hormone stimulus (GO:0071373)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cholesterol metabolic process (GO:0008203)|circadian sleep/wake cycle, REM sleep (GO:0042747)|dibenzo-p-dioxin metabolic process (GO:0018894)|diterpenoid metabolic process (GO:0016101)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|glucocorticoid metabolic process (GO:0008211)|insecticide metabolic process (GO:0017143)|intracellular cholesterol transport (GO:0032367)|male gonad development (GO:0008584)|negative regulation of neuron apoptotic process (GO:0043524)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of gene expression (GO:0010628)|positive regulation of neurogenesis (GO:0050769)|progesterone biosynthetic process (GO:0006701)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of steroid biosynthetic process (GO:0050810)|response to activity (GO:0014823)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to hydrogen peroxide (GO:0042542)|response to ionizing radiation (GO:0010212)|response to lead ion (GO:0010288)|response to leptin (GO:0044321)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytosol (GO:0005829)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	cholesterol binding (GO:0015485)	p.V28E(1)		breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11	Colorectal(12;0.000442)	all_lung(54;0.0151)|Lung NSC(58;0.0295)		READ - Rectum adenocarcinoma(644;0.188)		GATGGCCATCACAGCCTGTTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	8											32.0	35.0	34.0					8																	38006254		2203	4300	6503	38125411	SO:0001583	missense	6770			BC010550	CCDS6102.1	8p11.2	2011-09-13	2007-05-15		ENSG00000147465	ENSG00000147465		"""StAR-related lipid transfer (START) domain containing"""	11359	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 1"""	600617	"""steroidogenic acute regulator"""			7761400	Standard	NM_000349		Approved	StAR, STARD1	uc003xkv.1	P49675	OTTHUMG00000164058	ENST00000276449.4:c.83T>A	8.37:g.38006254A>T	ENSP00000276449:p.Val28Glu	Somatic		Capture	Illumina GAIIx	4	38125411	Q16396	Missense_Mutation	SNP	HMMPfam_START;superfamily_Bet v1-like	p.V28E	ENST00000276449.4	37	c.83	CCDS6102.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.02|14.02	2.410485|2.410485	0.42715|0.42715	.|.	.|.	ENSG00000147465|ENSG00000147465	ENST00000276449|ENST00000522050	D|.	0.88509|.	-2.39|.	5.28|5.28	2.91|2.91	0.33838|0.33838	.|.	0.710749|.	0.14761|.	N|.	0.299965|.	T|.	0.41971|.	0.1182|.	L|L	0.55481|0.55481	1.735|1.735	0.19300|0.19300	N|N	0.999973|0.999973	B|.	0.28933|.	0.228|.	B|.	0.31812|.	0.136|.	T|.	0.27123|.	-1.0083|.	10|.	0.72032|.	D|.	0.01|.	-7.9645|-7.9645	7.2037|7.2037	0.25895|0.25895	0.6116:0.0:0.3884:0.0|0.6116:0.0:0.3884:0.0	.|.	28|.	P49675|.	STAR_HUMAN|.	E|R	28|7	ENSP00000276449:V28E|.	ENSP00000276449:V28E|.	V|X	-|-	2|1	0|0	STAR|STAR	38125411|38125411	0.137000|0.137000	0.22531|0.22531	0.112000|0.112000	0.21494|0.21494	0.352000|0.352000	0.29268|0.29268	3.810000|3.810000	0.55613|0.55613	0.420000|0.420000	0.25954|0.25954	0.379000|0.379000	0.24179|0.24179	GTG|TGA	-	NULL		0.602	STAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAR	protein_coding	OTTHUMT00000376990.2	A	NM_000349		38125411	-1	no_errors	NM_000349	genbank	human	reviewed	54_36p	missense	SNP	0	T
RB1CC1	9821	genome.wustl.edu	37	8	53555089	53555089	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr8:53555089C>A	ENST00000025008.5	-	18	4682	c.4159G>T	c.(4159-4161)Gaa>Taa	p.E1387*	RB1CC1_ENST00000539297.1_Nonsense_Mutation_p.E1387*|RB1CC1_ENST00000435644.2_Nonsense_Mutation_p.E1387*|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1387					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.E1387*(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				CTGACTTCTTCTTCAAGCTTT	0.403																																					GBM(180;1701 2102 13475 42023 52570)											1	Substitution - Nonsense(1)	ovary(1)	8											105.0	99.0	101.0					8																	53555089		2203	4300	6503	53717642	SO:0001587	stop_gained	9821			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4159G>T	8.37:g.53555089C>A	ENSP00000025008:p.Glu1387*	Somatic		Capture	Illumina GAIIx	4	53717642	Q86YR4|Q8WVU9|Q92601	Nonsense_Mutation	SNP	superfamily_Prefoldin;superfamily_Ubiquitin-like	p.E1387*	ENST00000025008.5	37	c.4159	CCDS34892.1	8	.	.	.	.	.	.	.	.	.	.	C	49	14.930870	0.99816	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	.	.	.	5.61	5.61	0.85477	.	0.054168	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-20.9061	18.6201	0.91318	0.0:1.0:0.0:0.0	.	.	.	.	X	1387	.	ENSP00000025008:E1387X	E	-	1	0	RB1CC1	53717642	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.619000	0.74219	2.632000	0.89209	0.655000	0.94253	GAA	-	NULL		0.403	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RB1CC1	protein_coding	OTTHUMT00000378011.1	C	NM_014781		53717642	-1	no_errors	NM_014781	genbank	human	validated	54_36p	nonsense	SNP	1	A
TMEM67	91147	genome.wustl.edu	37	8	94809683	94809683	+	Silent	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr8:94809683C>T	ENST00000453321.3	+	20	2143	c.2085C>T	c.(2083-2085)gtC>gtT	p.V695V	TMEM67_ENST00000409623.3_Silent_p.V614V	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	695					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)	p.V685V(1)		breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			TACTTACTGTCCTCTTCTTTT	0.299																																																1	Substitution - coding silent(1)	ovary(1)	8											111.0	106.0	108.0					8																	94809683		2203	4300	6503	94878859	SO:0001819	synonymous_variant	91147			BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.2085C>T	8.37:g.94809683C>T		Somatic		Capture	Illumina GAIIx	4	94878859	B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Silent	SNP	-	p.V685	ENST00000453321.3	37	c.2055	CCDS6258.2	8																																																																																			-	NULL		0.299	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM67	protein_coding	OTTHUMT00000329641.2	C	NM_153704		94878859	1	no_errors	NM_153704	genbank	human	reviewed	54_36p	silent	SNP	0.92	T
RSPO2	340419	genome.wustl.edu	37	8	109001330	109001330	+	Silent	SNP	T	T	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr8:109001330T>A	ENST00000276659.5	-	3	857	c.237A>T	c.(235-237)ccA>ccT	p.P79P	RSPO2_ENST00000517781.1_Intron|RSPO2_ENST00000517939.1_Silent_p.P12P|RSPO2_ENST00000378439.2_Intron	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	79					bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.P79P(1)	EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			AGTACCCGGATGGGCAGGAAT	0.488																																																1	Substitution - coding silent(1)	ovary(1)	8											112.0	94.0	100.0					8																	109001330		2203	4300	6503	109070506	SO:0001819	synonymous_variant	340419			AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.237A>T	8.37:g.109001330T>A		Somatic		Capture	Illumina GAIIx	4	109070506	B3KVP0|Q4G0U4|Q8N6X6	Silent	SNP	superfamily_Growth factor receptor domain;superfamily_TSP-1 type 1 repeat	p.P79	ENST00000276659.5	37	c.237	CCDS6307.1	8																																																																																			-	NULL		0.488	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPO2	protein_coding	OTTHUMT00000380830.1	T	NM_178565		109070506	-1	no_errors	NM_178565	genbank	human	validated	54_36p	silent	SNP	0.99	A
TMEM38B	55151	genome.wustl.edu	37	9	108467893	108467893	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr9:108467893C>A	ENST00000374692.3	+	2	245	c.128C>A	c.(127-129)gCa>gAa	p.A43E	TMEM38B_ENST00000374688.1_De_novo_Start_OutOfFrame	NM_018112.1	NP_060582.1	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	43						integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)	p.A43E(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13						GCTGCATTGGCATGGAAGAAT	0.383																																																1	Substitution - Missense(1)	ovary(1)	9											189.0	173.0	178.0					9																	108467893		2203	4300	6503	107507714	SO:0001583	missense	55151			BC031938	CCDS6768.1	9q31.3	2013-05-23	2004-12-21	2004-12-22	ENSG00000095209	ENSG00000095209			25535	protein-coding gene	gene with protein product		611236	"""chromosome 9 open reading frame 87"""	C9orf87		17611541, 23316006	Standard	NM_018112		Approved	FLJ10493, bA219P18.1, D4Ertd89e, TRIC-B	uc004bcu.2	Q9NVV0	OTTHUMG00000020429	ENST00000374692.3:c.128C>A	9.37:g.108467893C>A	ENSP00000363824:p.Ala43Glu	Somatic		Capture	Illumina GAIIx	4	107507714	Q5JR63|Q5SVN5|Q5SVN6|Q5VTE2|Q6IA97	Missense_Mutation	SNP	-	p.A43E	ENST00000374692.3	37	c.128	CCDS6768.1	9	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172098	0.78452	.	.	ENSG00000095209	ENST00000374692	T	0.44881	0.91	5.61	5.61	0.85477	.	0.236322	0.44097	D	0.000488	T	0.60881	0.2303	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.54397	-0.8300	10	0.28530	T	0.3	-8.5428	17.1414	0.86755	0.0:1.0:0.0:0.0	.	43	Q9NVV0	TM38B_HUMAN	E	43	ENSP00000363824:A43E	ENSP00000363824:A43E	A	+	2	0	TMEM38B	107507714	0.999000	0.42202	0.983000	0.44433	0.799000	0.45148	5.234000	0.65343	2.653000	0.90120	0.655000	0.94253	GCA	-	NULL		0.383	TMEM38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM38B	protein_coding	OTTHUMT00000053517.1	C	NM_018112		107507714	1	no_errors	NM_018112	genbank	human	provisional	54_36p	missense	SNP	0.19	A
APTX	54840	genome.wustl.edu	37	9	32989805	32989805	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr9:32989805G>A	ENST00000379819.1	-	2	126	c.127C>T	c.(127-129)Cgt>Tgt	p.R43C	APTX_ENST00000309615.3_Missense_Mutation_p.R43C|APTX_ENST00000463596.1_Missense_Mutation_p.R29C|APTX_ENST00000379813.3_Missense_Mutation_p.R29C|APTX_ENST00000476858.1_Missense_Mutation_p.R43C|APTX_ENST00000436040.2_Missense_Mutation_p.R29C|APTX_ENST00000397172.3_Missense_Mutation_p.R43C|APTX_ENST00000468275.1_Missense_Mutation_p.R29C|APTX_ENST00000379825.2_Missense_Mutation_p.R43C|APTX_ENST00000379817.2_Missense_Mutation_p.R29C			Q7Z2E3	APTX_HUMAN	aprataxin	43	FHA-like.|Interactions with ADPRT and NCL.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|dephosphorylation (GO:0016311)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA ligation (GO:0006266)|double-strand break repair (GO:0006302)|polynucleotide 3' dephosphorylation (GO:0098506)|regulation of protein stability (GO:0031647)|response to hydrogen peroxide (GO:0042542)|single strand break repair (GO:0000012)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA 5'-adenosine monophosphate hydrolase activity (GO:0033699)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|phosphoglycolate phosphatase activity (GO:0008967)|phosphoprotein binding (GO:0051219)|polynucleotide 3'-phosphatase activity (GO:0046403)|protein N-terminus binding (GO:0047485)	p.R43C(1)		endometrium(1)|lung(1)|ovary(2)|prostate(2)	6			LUSC - Lung squamous cell carcinoma(29;0.0302)	GBM - Glioblastoma multiforme(74;0.105)		TCTGGGCCACGCCCAATCACA	0.478								Editing and processing nucleases																																								1	Substitution - Missense(1)	ovary(1)	9											125.0	104.0	111.0					9																	32989805		2203	4300	6503	32979805	SO:0001583	missense	54840			AK000164	CCDS47956.1, CCDS56568.1, CCDS75827.1	9p13.3	2014-01-28	2003-04-03		ENSG00000137074	ENSG00000137074			15984	protein-coding gene	gene with protein product		606350	"""ataxia 1, early onset with hypoalbuminemia"""	AXA1		11586299, 11586300	Standard	NM_175069		Approved	FLJ20157, AOA, AOA1, EAOH, EOAHA	uc003zry.3	Q7Z2E3	OTTHUMG00000019759	ENST00000379819.1:c.127C>T	9.37:g.32989805G>A	ENSP00000369147:p.Arg43Cys	Somatic		Capture	Illumina GAIIx	4	32979805	A8MTN4|D3DRK9|D3DRL0|Q0P662|Q5T781|Q5T782|Q5T784|Q6JV81|Q6JV82|Q6JV85|Q7Z2F3|Q7Z336|Q7Z5R5|Q7Z6V7|Q7Z6V8|Q9NXM5	Missense_Mutation	SNP	HMMPfam_HIT;superfamily_SMAD/FHA domain;superfamily_HIT-like	p.R29C	ENST00000379819.1	37	c.85		9	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622273	0.87460	.	.	ENSG00000137074	ENST00000379825;ENST00000309615;ENST00000397172;ENST00000379817;ENST00000436040;ENST00000379819;ENST00000468275;ENST00000463596;ENST00000476858;ENST00000344355;ENST00000379813;ENST00000379812;ENST00000473221;ENST00000477119	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97906	-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-4.6;-3.0;-3.0;-4.05;-3.0	5.58	5.58	0.84498	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	0.000000	0.85682	D	0.000000	D	0.98833	0.9606	M	0.87097	2.86	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.99764	1.1022	10	0.87932	D	0	-11.6207	17.0674	0.86563	0.0:0.0:1.0:0.0	.	43;43;43;29;43	C9JZ40;Q7Z2E3-3;Q5T782;Q7Z2E3-5;Q7Z2E3	.;.;.;.;APTX_HUMAN	C	43;43;43;29;29;43;29;29;43;43;29;43;43;29	ENSP00000369153:R43C;ENSP00000311547:R43C;ENSP00000380357:R43C;ENSP00000369145:R29C;ENSP00000400806:R29C;ENSP00000369147:R43C;ENSP00000420263:R29C;ENSP00000419846:R29C;ENSP00000419042:R43C;ENSP00000369141:R29C;ENSP00000369140:R43C;ENSP00000419020:R43C;ENSP00000417649:R29C	ENSP00000311547:R43C	R	-	1	0	APTX	32979805	1.000000	0.71417	0.985000	0.45067	0.993000	0.82548	7.394000	0.79862	2.636000	0.89361	0.655000	0.94253	CGT	-	NULL		0.478	APTX-003	KNOWN	basic|appris_candidate_longest	protein_coding	APTX	protein_coding	OTTHUMT00000052028.2	G	NM_017692		32979805	-1	no_errors	NM_175073	genbank	human	reviewed	54_36p	missense	SNP	1	A
NAA35	60560	genome.wustl.edu	37	9	88557111	88557111	+	Frame_Shift_Del	DEL	G	G	-			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr9:88557111delG	ENST00000361671.5	+	2	170	c.37delG	c.(37-39)ggafs	p.G13fs	NAA35_ENST00000376040.1_Frame_Shift_Del_p.G13fs	NM_024635.3	NP_078911.3	Q5VZE5	NAA35_HUMAN	N(alpha)-acetyltransferase 35, NatC auxiliary subunit	13					negative regulation of apoptotic process (GO:0043066)|smooth muscle cell proliferation (GO:0048659)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)		p.G13fs*31(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	25						TGACGATTCAGGATGGGAGCT	0.398																																																1	Deletion - Frameshift(1)	ovary(1)	9											130.0	119.0	123.0					9																	88557111		2203	4300	6503	87746931	SO:0001589	frameshift_variant	60560			AK025266	CCDS6673.1	9q22.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000135040	ENSG00000135040		"""N(alpha)-acetyltransferase subunits"""	24340	protein-coding gene	gene with protein product			"""MAK10 homolog, amino-acid N-acetyltransferase subunit (S. cerevisiae)"""	MAK10		14702039, 19660095	Standard	NM_024635		Approved	FLJ21613, FLJ22643, bA379P1.1	uc004aoi.4	Q5VZE5	OTTHUMG00000020131	ENST00000361671.5:c.37delG	9.37:g.88557111delG	ENSP00000354972:p.Gly13fs	Somatic		Capture	Illumina GAIIx	4	87746931	Q5VZE6|Q9H631|Q9H703	Frame_Shift_Del	DEL	-	p.G13fs	ENST00000361671.5	37	c.37	CCDS6673.1	9																																																																																			(deletion:cds_exon[87746895;87747018])	NULL		0.398	NAA35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAK10	protein_coding	OTTHUMT00000052906.1	G	NM_024635		87746931	1	no_errors	NM_024635	genbank	human	validated	54_36p	frame_shift_del	DEL	1	-
TNFSF8	944	genome.wustl.edu	37	9	117666273	117666273	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chr9:117666273C>T	ENST00000223795.2	-	4	756	c.643G>A	c.(643-645)Gat>Aat	p.D215N	TNFSF8_ENST00000474301.1_Intron	NM_001244.3	NP_001235.1	P32971	TNFL8_HUMAN	tumor necrosis factor (ligand) superfamily, member 8	215					apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)	p.D215N(1)		endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(3)|urinary_tract(1)	12						GTGCTTGTATCTATGTACTGG	0.423																																																1	Substitution - Missense(1)	ovary(1)	9											247.0	226.0	233.0					9																	117666273		2203	4300	6503	116706094	SO:0001583	missense	944			L09753	CCDS6810.1, CCDS75884.1	9q33	2008-02-05			ENSG00000106952	ENSG00000106952		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11938	protein-coding gene	gene with protein product		603875		CD30LG		8391931, 9349718	Standard	NM_001244		Approved	CD153	uc004bji.2	P32971	OTTHUMG00000021025	ENST00000223795.2:c.643G>A	9.37:g.117666273C>T	ENSP00000223795:p.Asp215Asn	Somatic		Capture	Illumina GAIIx	4	116706094	O43404	Missense_Mutation	SNP	HMMPfam_TNF;superfamily_TNF-like	p.D215N	ENST00000223795.2	37	c.643	CCDS6810.1	9	.	.	.	.	.	.	.	.	.	.	C	4.546	0.101315	0.08731	.	.	ENSG00000106952	ENST00000223795	D	0.95069	-3.6	5.78	4.88	0.63580	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.104923	0.46442	D	0.000281	D	0.85522	0.5716	N	0.12746	0.255	0.34515	D	0.707549	P	0.42785	0.79	B	0.40901	0.343	D	0.84861	0.0819	10	0.11485	T	0.65	-13.2654	7.4694	0.27340	0.0:0.7444:0.169:0.0866	.	215	P32971	TNFL8_HUMAN	N	215	ENSP00000223795:D215N	ENSP00000223795:D215N	D	-	1	0	TNFSF8	116706094	1.000000	0.71417	1.000000	0.80357	0.097000	0.18754	1.080000	0.30779	2.729000	0.93468	0.655000	0.94253	GAT	-	HMMPfam_TNF		0.423	TNFSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF8	protein_coding	OTTHUMT00000055464.1	C			116706094	-1	no_errors	NM_001244	genbank	human	reviewed	54_36p	missense	SNP	1	T
GPRASP2	114928	genome.wustl.edu	37	X	101971320	101971320	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chrX:101971320T>G	ENST00000535209.1	+	4	2354	c.1523T>G	c.(1522-1524)tTc>tGc	p.F508C	GPRASP2_ENST00000332262.5_Missense_Mutation_p.F508C|GPRASP2_ENST00000543253.1_Missense_Mutation_p.F508C			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	508						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)	p.F508C(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						GGGGTTGGCTTCCGATCCACA	0.512																																																1	Substitution - Missense(1)	ovary(1)	X											73.0	68.0	70.0					X																	101971320		2203	4300	6503	101857976	SO:0001583	missense	114928			AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1523T>G	X.37:g.101971320T>G	ENSP00000437394:p.Phe508Cys	Somatic		Capture	Illumina GAIIx	4	101857976	D3DXA0|Q8NAB4	Missense_Mutation	SNP	HMMPfam_DUF634;superfamily_ARM repeat	p.F508C	ENST00000535209.1	37	c.1523	CCDS14501.1	X	.	.	.	.	.	.	.	.	.	.	T	9.243	1.038719	0.19669	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.16196	2.36;2.36;2.36	4.44	4.44	0.53790	.	0.000000	0.49305	D	0.000156	T	0.37376	0.1001	M	0.71036	2.16	0.35307	D	0.78357	D	0.89917	1.0	D	0.85130	0.997	T	0.51148	-0.8742	10	0.62326	D	0.03	.	9.0697	0.36484	0.0:0.0:0.0:1.0	.	508	Q96D09	GASP2_HUMAN	C	508	ENSP00000437872:F508C;ENSP00000437394:F508C;ENSP00000339057:F508C	ENSP00000339057:F508C	F	+	2	0	GPRASP2	101857976	0.986000	0.35501	0.916000	0.36221	0.006000	0.05464	1.970000	0.40520	1.963000	0.57068	0.486000	0.48141	TTC	-	NULL		0.512	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP2	protein_coding	OTTHUMT00000057626.2	T	NM_138437		101857976	1	no_errors	NM_001004051	genbank	human	validated	54_36p	missense	SNP	0.96	G
USP11	8237	genome.wustl.edu	37	X	47101535	47101535	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chrX:47101535G>A	ENST00000218348.3	+	10	1363	c.1363G>A	c.(1363-1365)Gtg>Atg	p.V455M	USP11_ENST00000377107.2_Missense_Mutation_p.V412M	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	455	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)	p.V455M(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						TTCTGTGATCGTGGACACTTT	0.557																																																1	Substitution - Missense(1)	ovary(1)	X											120.0	85.0	97.0					X																	47101535		2203	4300	6503	46986479	SO:0001583	missense	8237			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.1363G>A	X.37:g.47101535G>A	ENSP00000218348:p.Val455Met	Somatic		Capture	Illumina GAIIx	4	46986479	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	-	p.V455M	ENST00000218348.3	37	c.1363	CCDS14277.1	X	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703516	0.88924	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.31247	1.5;1.5	5.6	5.6	0.85130	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000001	T	0.59905	0.2228	M	0.80183	2.485	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.994;1.0	T	0.65113	-0.6247	10	0.87932	D	0	-21.9287	17.2763	0.87116	0.0:0.0:1.0:0.0	.	182;455	B3KP28;P51784	.;UBP11_HUMAN	M	412;455	ENSP00000366311:V412M;ENSP00000218348:V455M	ENSP00000218348:V455M	V	+	1	0	USP11	46986479	1.000000	0.71417	0.940000	0.37924	0.987000	0.75469	7.924000	0.87555	2.346000	0.79739	0.600000	0.82982	GTG	-	NULL		0.557	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP11	protein_coding		G	NM_004651		46986479	1	no_errors	NM_004651	genbank	human	reviewed	54_36p	missense	SNP	1	A
BMP15	9210	genome.wustl.edu	37	X	50659305	50659305	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chrX:50659305C>A	ENST00000252677.3	+	2	877	c.877C>A	c.(877-879)Ctc>Atc	p.L293I		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	293					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.L293I(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					CCAGTGTTCCCTCCACCCTTT	0.512																																																1	Substitution - Missense(1)	ovary(1)	X											109.0	92.0	98.0					X																	50659305		2203	4299	6502	50676045	SO:0001583	missense	9210			AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.877C>A	X.37:g.50659305C>A	ENSP00000252677:p.Leu293Ile	Somatic		Capture	Illumina GAIIx	4	50676045	Q17RM6|Q5JST1|Q9UMS1	Missense_Mutation	SNP	HMMPfam_TGF_beta;superfamily_Cystine-knot cytokines	p.L293I	ENST00000252677.3	37	c.877	CCDS14334.1	X	.	.	.	.	.	.	.	.	.	.	c	17.75	3.466014	0.63625	.	.	ENSG00000130385	ENST00000252677	D	0.89810	-2.57	5.51	4.65	0.58169	Transforming growth factor-beta, C-terminal (3);	0.185069	0.48767	D	0.000178	D	0.92841	0.7723	M	0.67625	2.065	0.54753	D	0.999986	D	0.89917	1.0	D	0.91635	0.999	D	0.92475	0.5988	10	0.59425	D	0.04	.	11.0729	0.48014	0.0:0.9077:0.0:0.0923	.	293	O95972	BMP15_HUMAN	I	293	ENSP00000252677:L293I	ENSP00000252677:L293I	L	+	1	0	BMP15	50676045	0.993000	0.37304	0.999000	0.59377	0.921000	0.55340	2.297000	0.43593	1.105000	0.41606	0.550000	0.68814	CTC	-	HMMPfam_TGF_beta		0.512	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP15	protein_coding	OTTHUMT00000056572.1	C	NM_005448		50676045	1	no_errors	NM_005448	genbank	human	reviewed	54_36p	missense	SNP	0.37	A
TENM1	10178	genome.wustl.edu	37	X	123631096	123631096	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1498-01A-01W-0549-09	TCGA-13-1498-10A-01W-0549-09	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b00d9680-4099-43fe-87de-b3cc8b9e70c8	30b2b852-217f-459e-bac0-5e2df47fded7	g.chrX:123631096A>T	ENST00000371130.3	-	20	3528	c.3465T>A	c.(3463-3465)aaT>aaA	p.N1155K	TENM1_ENST00000422452.2_Missense_Mutation_p.N1155K|TENM1_ENST00000461429.1_5'Flank	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1155					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.N1157K(1)									TATTTTCTCCATTCCCTTTAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	X											89.0	76.0	80.0					X																	123631096		2202	4300	6502	123458777	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3465T>A	X.37:g.123631096A>T	ENSP00000360171:p.Asn1155Lys	Somatic		Capture	Illumina GAIIx	4	123458777	B2RTR5|Q5JZ17	Missense_Mutation	SNP	HMMPfam_NHL;HMMPfam_EGF;HMMPfam_RHS_repeat;superfamily_Carboxypeptidase regulatory domain;HMMPfam_Ten_N;superfamily_Nitrous oxide reductase N-terminal domain;HMMPfam_EGF_2;superfamily_NHL repeat;superfamily_EGF/Laminin	p.N1155K	ENST00000371130.3	37	c.3465	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	A	12.49	1.953267	0.34471	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.87334	-2.24;-2.16	5.55	3.16	0.36331	.	0.106321	0.64402	D	0.000006	T	0.79106	0.4390	L	0.33753	1.03	0.54753	D	0.999986	P;P;P	0.43094	0.651;0.799;0.745	B;B;B	0.38562	0.214;0.276;0.218	T	0.75698	-0.3227	10	0.87932	D	0	.	9.1252	0.36810	0.8493:0.0:0.1507:0.0	.	1154;1155;1155	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	K	1155	ENSP00000360171:N1155K;ENSP00000403954:N1155K	ENSP00000360171:N1155K	N	-	3	2	ODZ1	123458777	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	1.199000	0.32235	0.256000	0.21614	-0.314000	0.08810	AAT	-	NULL		0.368	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	protein_coding	OTTHUMT00000058985.1	A	NM_014253		123458777	-1	no_errors	NM_014253	genbank	human	provisional	54_36p	missense	SNP	1	T
