#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
HSD3B2	3284	genome.wustl.edu	37	1	119965185	119965185	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:119965185A>T	ENST00000543831.1	+	4	1310	c.1061A>T	c.(1060-1062)gAg>gTg	p.E354V	HSD3B2_ENST00000369416.3_Missense_Mutation_p.E354V	NM_001166120.1	NP_001159592.1	P26439	3BHS2_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2	354					androgen biosynthetic process (GO:0006702)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)	p.E354V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(19)|ovary(2)|skin(1)	27	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	Corticotropin(DB01285)|Medroxyprogesterone Acetate(DB00603)|Trilostane(DB01108)	AAAACCGTGGAGTGGGTTGGT	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											57.0	51.0	53.0					1																	119965185		2203	4300	6503	119766708	SO:0001583	missense	3284			BC038419	CCDS902.1	1p12	2014-06-03			ENSG00000203859	ENSG00000203859	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5218	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 2"""	613890				1363812, 19027726	Standard	NM_000198		Approved	SDR11E2	uc001eht.3	P26439	OTTHUMG00000012526	ENST00000543831.1:c.1061A>T	1.37:g.119965185A>T	ENSP00000445122:p.Glu354Val	Somatic		Capture	Illumina GAIIx	4	119766708	A2RRA5|Q16010|Q53GD4|Q6AI10|Q6LDB9|Q99890|Q9UD08	Missense_Mutation	SNP	HMMPfam_3Beta_HSD;superfamily_NAD(P)-binding Rossmann-fold domains	p.E354V	ENST00000543831.1	37	c.1061	CCDS902.1	1	.	.	.	.	.	.	.	.	.	.	-	15.86	2.958922	0.53400	.	.	ENSG00000203859	ENST00000543831;ENST00000369416	D;D	0.89875	-2.58;-2.58	4.32	3.14	0.36123	.	0.442237	0.26103	N	0.026328	D	0.87034	0.6077	M	0.91196	3.185	0.36550	D	0.871775	P	0.44659	0.84	P	0.45343	0.477	D	0.85606	0.1255	9	.	.	.	-3.9978	5.2149	0.15336	0.7233:0.1825:0.0942:0.0	.	354	P26439	3BHS2_HUMAN	V	354	ENSP00000445122:E354V;ENSP00000358424:E354V	.	E	+	2	0	HSD3B2	119766708	0.996000	0.38824	0.596000	0.28811	0.770000	0.43624	2.663000	0.46774	0.505000	0.28104	0.248000	0.18094	GAG	-	NULL		0.483	HSD3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B2	protein_coding	OTTHUMT00000034994.1	A	NM_000198		119766708	1	no_errors	NM_000198	genbank	human	validated	54_36p	missense	SNP	0.8	T
SPATA21	374955	genome.wustl.edu	37	1	16725989	16725989	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:16725989T>C	ENST00000335496.1	-	12	1684	c.1202A>G	c.(1201-1203)cAg>cGg	p.Q401R	SPATA21_ENST00000466212.1_5'UTR|SPATA21_ENST00000540400.1_Missense_Mutation_p.Q378R	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21	401							calcium ion binding (GO:0005509)	p.Q401R(1)		breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		GCAGGGCACCTGGGCATAGGG	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											58.0	49.0	52.0					1																	16725989		2203	4300	6503	16598576	SO:0001583	missense	374955				CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.1202A>G	1.37:g.16725989T>C	ENSP00000335612:p.Gln401Arg	Somatic		Capture	Illumina GAIIx	4	16598576	B9EK40|F5GXP5	Missense_Mutation	SNP	-	p.Q401R	ENST00000335496.1	37	c.1202	CCDS172.1	1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.980489	0.74474	.	.	ENSG00000187144	ENST00000491418;ENST00000335496;ENST00000540400	T;T;T	0.68181	0.75;-0.31;-0.31	5.11	5.11	0.69529	.	0.119203	0.38436	N	0.001699	T	0.76271	0.3964	L	0.55481	1.735	0.35657	D	0.812235	D;D	0.89917	0.998;1.0	D;D	0.78314	0.978;0.991	T	0.82090	-0.0629	10	0.56958	D	0.05	-13.1176	11.4757	0.50297	0.0:0.0:0.0:1.0	.	378;401	F5GXP5;Q7Z572	.;SPT21_HUMAN	R	109;401;378	ENSP00000420753:Q109R;ENSP00000335612:Q401R;ENSP00000440046:Q378R	ENSP00000335612:Q401R	Q	-	2	0	SPATA21	16598576	0.998000	0.40836	1.000000	0.80357	0.855000	0.48748	3.428000	0.52792	2.279000	0.76181	0.459000	0.35465	CAG	-	NULL		0.597	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA21	protein_coding	OTTHUMT00000006677.2	T	NM_198546		16598576	-1	no_errors	NM_198546	genbank	human	provisional	54_36p	missense	SNP	0.99	C
PADI3	51702	genome.wustl.edu	37	1	17599933	17599933	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:17599933A>T	ENST00000375460.3	+	10	1186	c.1146A>T	c.(1144-1146)aaA>aaT	p.K382N		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	382					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.K382N(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TCCCTTACAAAAGAATCCTGG	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	43.0	42.0					1																	17599933		2203	4300	6503	17472520	SO:0001583	missense	51702			AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.1146A>T	1.37:g.17599933A>T	ENSP00000364609:p.Lys382Asn	Somatic		Capture	Illumina GAIIx	4	17472520	Q58EY7|Q70SX5	Missense_Mutation	SNP	-	p.K382N	ENST00000375460.3	37	c.1146	CCDS179.1	1	.	.	.	.	.	.	.	.	.	.	A	11.04	1.522410	0.27211	.	.	ENSG00000142619	ENST00000375460	T	0.28895	1.59	5.29	-1.23	0.09465	Protein-arginine deiminase, C-terminal (1);	0.261257	0.44483	D	0.000460	T	0.33847	0.0877	M	0.82923	2.615	0.25203	N	0.990036	B	0.30937	0.301	B	0.32090	0.14	T	0.30650	-0.9971	10	0.45353	T	0.12	-10.6378	10.9974	0.47585	0.5488:0.0:0.4512:0.0	.	382	Q9ULW8	PADI3_HUMAN	N	382	ENSP00000364609:K382N	ENSP00000364609:K382N	K	+	3	2	PADI3	17472520	0.999000	0.42202	0.641000	0.29422	0.393000	0.30537	0.792000	0.26929	-0.515000	0.06479	-0.534000	0.04291	AAA	-	NULL		0.622	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI3	protein_coding	OTTHUMT00000006805.1	A			17472520	1	no_errors	NM_016233	genbank	human	reviewed	54_36p	missense	SNP	0.31	T
PADI4	23569	genome.wustl.edu	37	1	17674461	17674461	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:17674461A>T	ENST00000375448.4	+	10	1099	c.1073A>T	c.(1072-1074)cAa>cTa	p.Q358L	AC004824.2_ENST00000602074.1_Intron|PADI4_ENST00000487048.1_3'UTR	NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	358					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.Q358L(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	GGCTACATCCAAGCCCCACAC	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											113.0	96.0	102.0					1																	17674461		2203	4300	6503	17547048	SO:0001583	missense	23569			AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.1073A>T	1.37:g.17674461A>T	ENSP00000364597:p.Gln358Leu	Somatic		Capture	Illumina GAIIx	Phase_III	17547048	A8K392|B2RBW0|Q5VTZ8|Q70SX4	Missense_Mutation	SNP	-	p.Q358L	ENST00000375448.4	37	c.1073	CCDS180.1	1	.	.	.	.	.	.	.	.	.	.	-	18.92	3.726027	0.69074	.	.	ENSG00000159339	ENST00000375448	T	0.24908	1.83	5.47	5.47	0.80525	Protein-arginine deiminase, C-terminal (1);	0.166295	0.39687	N	0.001283	T	0.51924	0.1703	M	0.87328	2.875	0.39281	D	0.964565	D;D	0.57257	0.975;0.979	P;P	0.60236	0.863;0.871	T	0.63189	-0.6693	10	0.72032	D	0.01	-19.5908	12.9677	0.58494	1.0:0.0:0.0:0.0	.	358;358	A8K392;Q9UM07	.;PADI4_HUMAN	L	358	ENSP00000364597:Q358L	ENSP00000364597:Q358L	Q	+	2	0	PADI4	17547048	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.307000	0.89964	2.087000	0.62958	0.423000	0.28283	CAA	-	NULL		0.597	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI4	protein_coding	OTTHUMT00000006799.1	A	NM_012387		17547048	1	no_errors	NM_012387	genbank	human	reviewed	54_36p	missense	SNP	1	T
ACTL8	81569	genome.wustl.edu	37	1	18152897	18152897	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:18152897G>C	ENST00000375406.1	+	3	1200	c.984G>C	c.(982-984)tgG>tgC	p.W328C		NM_030812.2	NP_110439.2	Q9H568	ACTL8_HUMAN	actin-like 8	328					epithelial cell differentiation (GO:0030855)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.W328C(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	28		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		CCACAGTCTGGGAGGGTTCCA	0.577											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											70.0	77.0	75.0					1																	18152897		2203	4300	6503	18025484	SO:0001583	missense	81569			AK057339	CCDS183.1	1p36.2-p35	2009-03-25			ENSG00000117148	ENSG00000117148			24018	protein-coding gene	gene with protein product	"""cancer/testis antigen 57"""						Standard	NM_030812		Approved	CT57	uc001bat.3	Q9H568	OTTHUMG00000002512	ENST00000375406.1:c.984G>C	1.37:g.18152897G>C	ENSP00000364555:p.Trp328Cys	Somatic	723	Capture	Illumina GAIIx	4	18025484	Q13104|Q96M75	Missense_Mutation	SNP	-	p.W328C	ENST00000375406.1	37	c.984	CCDS183.1	1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.181360	0.38511	.	.	ENSG00000117148	ENST00000375406	T	0.07800	3.16	4.63	2.71	0.32032	.	0.518801	0.16455	N	0.213665	T	0.10380	0.0254	N	0.25647	0.755	0.09310	N	0.999996	D	0.58620	0.983	P	0.54346	0.749	T	0.13469	-1.0508	10	0.87932	D	0	-4.9511	6.1014	0.20049	0.0915:0.0:0.5796:0.3288	.	328	Q9H568	ACTL8_HUMAN	C	328	ENSP00000364555:W328C	ENSP00000364555:W328C	W	+	3	0	ACTL8	18025484	0.012000	0.17670	0.027000	0.17364	0.009000	0.06853	0.576000	0.23744	0.610000	0.30035	0.655000	0.94253	TGG	-	NULL		0.577	ACTL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL8	protein_coding	OTTHUMT00000007143.1	G	NM_030812		18025484	1	no_errors	NM_030812	genbank	human	provisional	54_36p	missense	SNP		C
OR6K3	391114	genome.wustl.edu	37	1	158687573	158687573	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:158687573C>G	ENST00000368146.1	-	1	380	c.381G>C	c.(379-381)gaG>gaC	p.E127D	OR6K3_ENST00000368145.1_Missense_Mutation_p.E111D			Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K, member 3	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E127D(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)	41	all_hematologic(112;0.0378)					GCAAGATCCCCTCTGAGTTTT	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											121.0	126.0	124.0					1																	158687573		2203	4300	6503	156954197	SO:0001583	missense	391114			AB065633	CCDS30903.1, CCDS30903.2	1q23.1	2012-08-09			ENSG00000203757	ENSG00000203757		"""GPCR / Class A : Olfactory receptors"""	15030	protein-coding gene	gene with protein product							Standard	NM_001005327		Approved		uc021pbn.1	Q8NGY3	OTTHUMG00000022770	ENST00000368146.1:c.381G>C	1.37:g.158687573C>G	ENSP00000357128:p.Glu127Asp	Somatic		Capture	Illumina GAIIx	4	156954197	Q5VUV0|Q6IFR5	Missense_Mutation	SNP	-	p.E127D	ENST00000368146.1	37	c.381		1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.799404	0.31869	.	.	ENSG00000203757	ENST00000368145;ENST00000368146	T;T	0.00354	7.92;7.92	4.03	-8.06	0.01102	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00210	0.0006	L	0.59912	1.85	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04650	-1.0936	9	0.37606	T	0.19	.	12.2845	0.54786	0.0:0.6252:0.1133:0.2615	.	127	Q8NGY3	OR6K3_HUMAN	D	111;127	ENSP00000357127:E111D;ENSP00000357128:E127D	ENSP00000357127:E111D	E	-	3	2	OR6K3	156954197	0.000000	0.05858	0.000000	0.03702	0.441000	0.31987	-5.717000	0.00102	-2.507000	0.00506	-0.490000	0.04691	GAG	-	NULL		0.488	OR6K3-201	KNOWN	basic	protein_coding	OR6K3	protein_coding		C			156954197	-1	no_errors	NM_001005327	genbank	human	provisional	54_36p	missense	SNP		G
UBR4	23352	genome.wustl.edu	37	1	19493580	19493580	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:19493580G>C	ENST00000375254.3	-	29	4072	c.4045C>G	c.(4045-4047)Cgt>Ggt	p.R1349G	UBR4_ENST00000375226.2_Missense_Mutation_p.R1349G|UBR4_ENST00000375267.2_Missense_Mutation_p.R1349G|UBR4_ENST00000375217.2_Missense_Mutation_p.R1349G	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1349					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R1349G(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TCATAAACACGAGCCAAGAAC	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											166.0	151.0	156.0					1																	19493580		2203	4300	6503	19366167	SO:0001583	missense	23352			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.4045C>G	1.37:g.19493580G>C	ENSP00000364403:p.Arg1349Gly	Somatic		Capture	Illumina GAIIx	4	19366167	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	-	p.R1349G	ENST00000375254.3	37	c.4045	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981967	0.74474	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.15	5.75	5.75	0.90469	.	0.060870	0.64402	D	0.000003	T	0.53400	0.1794	L	0.29908	0.895	0.80722	D	1	B	0.32160	0.358	B	0.26310	0.068	T	0.53486	-0.8432	10	0.39692	T	0.17	.	14.3861	0.66945	0.0:0.0:0.8521:0.1479	.	1349	Q5T4S7	UBR4_HUMAN	G	1349;1349;1349;1349;59;565	ENSP00000364403:R1349G;ENSP00000364416:R1349G;ENSP00000364365:R1349G;ENSP00000364374:R1349G;ENSP00000404897:R59G	ENSP00000364365:R1349G	R	-	1	0	UBR4	19366167	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	7.421000	0.80204	2.721000	0.93114	0.585000	0.79938	CGT	-	NULL		0.483	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	protein_coding	OTTHUMT00000007085.1	G	NM_020765		19366167	-1	no_errors	NM_020765	genbank	human	validated	54_36p	missense	SNP	1	C
HMCN1	83872	genome.wustl.edu	37	1	185992266	185992266	+	Silent	SNP	C	C	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:185992266C>T	ENST00000271588.4	+	36	5959	c.5730C>T	c.(5728-5730)caC>caT	p.H1910H	HMCN1_ENST00000367492.2_Silent_p.H1910H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1910	Ig-like C2-type 16.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.H1910H(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CACAACAGCACATTCAACTGC	0.378																																																1	Substitution - coding silent(1)	ovary(1)	1											120.0	115.0	117.0					1																	185992266		2203	4300	6503	184258889	SO:0001819	synonymous_variant	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5730C>T	1.37:g.185992266C>T		Somatic		Capture	Illumina GAIIx	4	184258889	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	-	p.H1910	ENST00000271588.4	37	c.5730	CCDS30956.1	1																																																																																			-	NULL		0.378	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	C	NM_031935		184258889	1	no_errors	NM_031935	genbank	human	reviewed	54_36p	silent	SNP	1	T
IPO9	55705	genome.wustl.edu	37	1	201821291	201821291	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:201821291G>A	ENST00000361565.4	+	5	643	c.574G>A	c.(574-576)Gag>Aag	p.E192K	IPO9_ENST00000464348.1_3'UTR	NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	192					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)	p.E192K(1)		cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						CATTCTCCCAGAGATGTATAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											97.0	95.0	96.0					1																	201821291		2203	4300	6503	200087914	SO:0001583	missense	55705			AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.574G>A	1.37:g.201821291G>A	ENSP00000354742:p.Glu192Lys	Somatic		Capture	Illumina GAIIx	4	200087914	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	HMMPfam_IBN_N;superfamily_ARM repeat	p.E192K	ENST00000361565.4	37	c.574	CCDS1415.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.608183	0.96626	.	.	ENSG00000198700	ENST00000361565	T	0.65732	-0.17	5.93	5.93	0.95920	Armadillo-like helical (1);Armadillo-type fold (1);	0.044602	0.85682	D	0.000000	T	0.70465	0.3227	M	0.72353	2.195	0.80722	D	1	D	0.59357	0.985	P	0.54965	0.765	T	0.65973	-0.6038	10	0.06365	T	0.9	-5.0673	17.8336	0.88689	0.0:0.0:1.0:0.0	.	192	Q96P70	IPO9_HUMAN	K	192	ENSP00000354742:E192K	ENSP00000354742:E192K	E	+	1	0	IPO9	200087914	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.733000	0.84916	2.811000	0.96726	0.557000	0.71058	GAG	-	NULL		0.423	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO9	protein_coding	OTTHUMT00000087088.1	G	NM_018085		200087914	1	no_errors	NM_018085	genbank	human	validated	54_36p	missense	SNP	1	A
CLSPN	63967	genome.wustl.edu	37	1	36226156	36226156	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:36226156G>C	ENST00000318121.3	-	8	1423	c.1366C>G	c.(1366-1368)Ctg>Gtg	p.L456V	CLSPN_ENST00000251195.5_Missense_Mutation_p.L456V|CLSPN_ENST00000520551.1_Missense_Mutation_p.L456V|CLSPN_ENST00000373220.3_Missense_Mutation_p.L456V	NM_022111.3	NP_071394.2	Q9HAW4	CLSPN_HUMAN	claspin	456					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|mitotic DNA replication checkpoint (GO:0033314)|peptidyl-serine phosphorylation (GO:0018105)	nucleoplasm (GO:0005654)	anaphase-promoting complex binding (GO:0010997)|DNA binding (GO:0003677)	p.L456V(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TCACCCTCCAGGGCATGAGGT	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											157.0	148.0	151.0					1																	36226156		2203	4300	6503	35998743	SO:0001583	missense	63967			AF297866	CCDS396.1, CCDS53297.1	1p34.3	2010-06-24	2010-06-24		ENSG00000092853	ENSG00000092853			19715	protein-coding gene	gene with protein product		605434	"""claspin homolog (Xenopus laevis)"""			11090622, 12766152	Standard	NM_022111		Approved		uc001bzi.3	Q9HAW4	OTTHUMG00000004168	ENST00000318121.3:c.1366C>G	1.37:g.36226156G>C	ENSP00000312995:p.Leu456Val	Somatic		Capture	Illumina GAIIx	4	35998743	A6NFL4|Q1RMC6|Q2KHM3|Q5VYG0|Q6P6H5|Q8IWI1	Missense_Mutation	SNP	-	p.L456V	ENST00000318121.3	37	c.1366	CCDS396.1	1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603519	0.28534	.	.	ENSG00000092853	ENST00000251195;ENST00000318121;ENST00000373220;ENST00000520551;ENST00000544356	T;T;T;T	0.24151	1.88;1.88;1.87;1.88	5.32	-0.846	0.10734	.	0.279625	0.29565	N	0.011795	T	0.34366	0.0895	L	0.55103	1.725	0.09310	N	1	D;D	0.71674	0.974;0.998	P;D	0.77557	0.684;0.99	T	0.23226	-1.0194	10	0.19590	T	0.45	-5.8648	6.4369	0.21829	0.3345:0.1263:0.5392:0.0	.	456;456	Q9HAW4-2;Q9HAW4	.;CLSPN_HUMAN	V	456	ENSP00000251195:L456V;ENSP00000312995:L456V;ENSP00000362317:L456V;ENSP00000428848:L456V	ENSP00000251195:L456V	L	-	1	2	CLSPN	35998743	0.000000	0.05858	0.236000	0.24074	0.811000	0.45836	-0.129000	0.10515	0.170000	0.19704	0.591000	0.81541	CTG	-	NULL		0.493	CLSPN-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSPN	protein_coding	OTTHUMT00000377857.1	G	NM_022111		35998743	-1	no_errors	NM_022111	genbank	human	reviewed	54_36p	missense	SNP	0.16	C
THRAP3	9967	genome.wustl.edu	37	1	36762273	36762273	+	Silent	SNP	T	T	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:36762273T>A	ENST00000354618.5	+	9	2429	c.2205T>A	c.(2203-2205)ggT>ggA	p.G735G	THRAP3_ENST00000469141.2_Silent_p.G735G	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	735	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.G735G(1)		breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TTAAACGAGGTAAATCGAGAG	0.398			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	1	Substitution - coding silent(1)	ovary(1)	1											125.0	125.0	125.0					1																	36762273		2203	4300	6503	36534860	SO:0001819	synonymous_variant	9967			AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.2205T>A	1.37:g.36762273T>A		Somatic		Capture	Illumina GAIIx	4	36534860	D3DPS5|Q5VTK6	Silent	SNP	-	p.G735	ENST00000354618.5	37	c.2205	CCDS405.1	1																																																																																			-	NULL		0.398	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THRAP3	protein_coding	OTTHUMT00000021688.2	T	NM_005119		36534860	1	no_errors	NM_005119	genbank	human	validated	54_36p	silent	SNP	0.98	A
DNAJC6	9829	genome.wustl.edu	37	1	65855051	65855051	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:65855051G>T	ENST00000395325.3	+	10	1292	c.1135G>T	c.(1135-1137)Gaa>Taa	p.E379*	DNAJC6_ENST00000263441.7_Nonsense_Mutation_p.E366*|DNAJC6_ENST00000371069.4_Nonsense_Mutation_p.E436*	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	379					cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)	p.E379*(1)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						TCCACCATGGGAACATTACTG	0.443																																																1	Substitution - Nonsense(1)	ovary(1)	1											139.0	124.0	129.0					1																	65855051		2203	4300	6503	65627639	SO:0001587	stop_gained	9829			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.1135G>T	1.37:g.65855051G>T	ENSP00000378735:p.Glu379*	Somatic		Capture	Illumina GAIIx	4	65627639	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Nonsense_Mutation	SNP	HMMPfam_DnaJ;superfamily_Chaperone J-domain;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);superfamily_(Phosphotyrosine protein) phosphatases II	p.E379*	ENST00000395325.3	37	c.1135	CCDS30739.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.399510	0.97537	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	19.5125	0.95148	0.0:0.0:1.0:0.0	.	.	.	.	X	366;379;436	.	ENSP00000263441:E366X	E	+	1	0	DNAJC6	65627639	1.000000	0.71417	1.000000	0.80357	0.346000	0.29079	9.249000	0.95470	2.840000	0.97914	0.655000	0.94253	GAA	-	NULL		0.443	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DNAJC6	protein_coding	OTTHUMT00000025134.1	G			65627639	1	no_errors	NM_014787	genbank	human	validated	54_36p	nonsense	SNP	1	T
KCTD3	51133	genome.wustl.edu	37	1	215747131	215747131	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr1:215747131T>G	ENST00000259154.4	+	2	380	c.86T>G	c.(85-87)tTt>tGt	p.F29C		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	29	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein homooligomerization (GO:0051260)			p.F29C(1)		breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		AATTGCAGATTTAGTACCTCA	0.264																																																1	Substitution - Missense(1)	ovary(1)	1											62.0	72.0	69.0					1																	215747131		2192	4262	6454	213813754	SO:0001583	missense	51133			AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.86T>G	1.37:g.215747131T>G	ENSP00000259154:p.Phe29Cys	Somatic		Capture	Illumina GAIIx	4	213813754	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	-	p.F29C	ENST00000259154.4	37	c.86	CCDS1515.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.2|20.2	3.954459|3.954459	0.73902|0.73902	.|.	.|.	ENSG00000136636|ENSG00000136636	ENST00000259154;ENST00000366945|ENST00000448333	T|.	0.56444|.	0.46|.	5.17|5.17	5.17|5.17	0.71159|0.71159	BTB/POZ-like (2);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88123|0.88123	0.6352|0.6352	H|H	0.97516|0.97516	4.02|4.02	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.998;1.0|.	D|D	0.92352|0.92352	0.5890|0.5890	10|5	0.87932|.	D|.	0|.	-25.6184|-25.6184	15.2955|15.2955	0.73902|0.73902	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	29;29|.	Q9Y597-2;Q9Y597|.	.;KCTD3_HUMAN|.	C|M	29|1	ENSP00000259154:F29C|.	ENSP00000259154:F29C|.	F|I	+|+	2|3	0|3	KCTD3|KCTD3	213813754|213813754	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	7.164000|7.164000	0.77533|0.77533	2.082000|2.082000	0.62665|0.62665	0.397000|0.397000	0.26171|0.26171	TTT|ATT	-	NULL		0.264	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD3	protein_coding	OTTHUMT00000089871.2	T	NM_016121		213813754	1	no_errors	NM_016121	genbank	human	validated	54_36p	missense	SNP	1	G
TNKS2	80351	genome.wustl.edu	37	10	93602091	93602091	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr10:93602091G>C	ENST00000371627.4	+	16	2381	c.2002G>C	c.(2002-2004)Gat>Cat	p.D668H		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	668					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.D668H(1)		biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				GTCTTCTCCTGATAATGTAAA	0.418																																																1	Substitution - Missense(1)	ovary(1)	10											146.0	130.0	135.0					10																	93602091		2203	4300	6503	93592071	SO:0001583	missense	80351			AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.2002G>C	10.37:g.93602091G>C	ENSP00000360689:p.Asp668His	Somatic		Capture	Illumina GAIIx	4	93592071	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	HMMPfam_Ank;superfamily_Ankyrin repeat;superfamily_SAM/Pointed domain;HMMPfam_SAM_2;HMMPfam_PARP;superfamily_ADP-ribosylation	p.D668H	ENST00000371627.4	37	c.2002	CCDS7417.1	10	.	.	.	.	.	.	.	.	.	.	G	29.9	5.043088	0.93685	.	.	ENSG00000107854	ENST00000371627	T	0.66815	-0.23	5.68	5.68	0.88126	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000006	T	0.75170	0.3813	L	0.35793	1.09	0.80722	D	1	D	0.53619	0.961	P	0.62014	0.897	T	0.75465	-0.3308	10	0.62326	D	0.03	.	20.1595	0.98130	0.0:0.0:1.0:0.0	.	668	Q9H2K2	TNKS2_HUMAN	H	668	ENSP00000360689:D668H	ENSP00000360689:D668H	D	+	1	0	TNKS2	93592071	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.813000	0.99286	2.847000	0.97988	0.591000	0.81541	GAT	-	NULL		0.418	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS2	protein_coding	OTTHUMT00000049374.1	G	NM_025235		93592071	1	no_errors	NM_025235	genbank	human	validated	54_36p	missense	SNP	1	C
SLC1A2	6506	genome.wustl.edu	37	11	35333940	35333940	+	Silent	SNP	C	C	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr11:35333940C>A	ENST00000278379.3	-	4	648	c.366G>T	c.(364-366)gtG>gtT	p.V122V	SLC1A2_ENST00000395753.1_Silent_p.V113V|SLC1A2_ENST00000606205.1_Silent_p.V122V|SLC1A2_ENST00000395750.1_Silent_p.V113V	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	122					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.V122V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			ACATGTAATACACCATGGCTC	0.507																																					NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)											1	Substitution - coding silent(1)	ovary(1)	11											129.0	121.0	124.0					11																	35333940		2202	4298	6500	35290516	SO:0001819	synonymous_variant	6506			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.366G>T	11.37:g.35333940C>A		Somatic		Capture	Illumina GAIIx	4	35290516	B4DQE9|Q14417|Q541G6|U3KQQ4	Silent	SNP	HMMPfam_SDF	p.V122	ENST00000278379.3	37	c.366	CCDS31459.1	11																																																																																			-	HMMPfam_SDF		0.507	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	SLC1A2	protein_coding	OTTHUMT00000258181.1	C	NM_004171		35290516	-1	no_errors	NM_004171	genbank	human	reviewed	54_36p	silent	SNP	1	A
OR5M1	390168	genome.wustl.edu	37	11	56380660	56380660	+	Silent	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr11:56380660G>A	ENST00000526538.1	-	1	318	c.319C>T	c.(319-321)Ctg>Ttg	p.L107L		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L107L(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						GTGATCACCAGGGCGATGAAG	0.448																																																1	Substitution - coding silent(1)	ovary(1)	11											177.0	162.0	167.0					11																	56380660		1989	4165	6154	56137236	SO:0001819	synonymous_variant	390168			AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.319C>T	11.37:g.56380660G>A		Somatic		Capture	Illumina GAIIx	4	56137236	Q6IF60|Q96RB6	Silent	SNP	-	p.L107	ENST00000526538.1	37	c.319	CCDS53631.1	11																																																																																			-	NULL		0.448	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M1	protein_coding	OTTHUMT00000391610.1	G	NM_001004740		56137236	-1	no_errors	NM_001004740	genbank	human	provisional	54_36p	silent	SNP	0.29	A
SHANK2	22941	genome.wustl.edu	37	11	70332194	70332194	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr11:70332194C>A	ENST00000423696.2	-	15	3103	c.3067G>T	c.(3067-3069)Gat>Tat	p.D1023Y	SHANK2_ENST00000409161.1_Missense_Mutation_p.D806Y|SHANK2_ENST00000449833.2_Missense_Mutation_p.D807Y|SHANK2_ENST00000338508.4_Missense_Mutation_p.D1403Y			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1023					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)	p.D807Y(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			AAATCCTCATCCAAGTCCACG	0.562																																																1	Substitution - Missense(1)	ovary(1)	11											62.0	71.0	68.0					11																	70332194		2200	4294	6494	70009842	SO:0001583	missense	22941			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.3067G>T	11.37:g.70332194C>A	ENSP00000394536:p.Asp1023Tyr	Somatic		Capture	Illumina GAIIx	4	70009842	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_SAM_1;superfamily_SAM/Pointed domain	p.D807Y	ENST00000423696.2	37	c.2419		11	.	.	.	.	.	.	.	.	.	.	C	19.33	3.806452	0.70682	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13;1.13	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.68311	0.2987	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.99;0.999;1.0	T	0.71059	-0.4702	10	0.87932	D	0	.	19.756	0.96291	0.0:1.0:0.0:0.0	.	1023;1402;807	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	Y	807;806;681;1403;1023;1041;1026	ENSP00000399423:D807Y;ENSP00000386491:D806Y;ENSP00000402944:D681Y;ENSP00000345193:D1403Y;ENSP00000394536:D1023Y;ENSP00000294018:D1026Y	ENSP00000294018:D1026Y	D	-	1	0	SHANK2	70009842	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.205000	0.77881	2.665000	0.90641	0.655000	0.94253	GAT	-	NULL		0.562	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	protein_coding		C	NM_012309		70009842	-1	no_errors	NM_012309	genbank	human	reviewed	54_36p	missense	SNP	1	A
ABCG4	64137	genome.wustl.edu	37	11	119031698	119031698	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr11:119031698C>T	ENST00000449422.2	+	15	2011	c.1823C>T	c.(1822-1824)gCg>gTg	p.A608V	ABCG4_ENST00000307417.3_Missense_Mutation_p.A608V|ABCG4_ENST00000531739.1_Missense_Mutation_p.A608V	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	608	ABC transmembrane type-2.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.A608V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		ATCCTCCGAGCGCTGGATGTG	0.582																																																1	Substitution - Missense(1)	ovary(1)	11											113.0	97.0	102.0					11																	119031698		2200	4295	6495	118536908	SO:0001583	missense	64137			AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.1823C>T	11.37:g.119031698C>T	ENSP00000406874:p.Ala608Val	Somatic		Capture	Illumina GAIIx	4	118536908	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	HMMPfam_ABC_tran;HMMPfam_ABC2_membrane;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.A608V	ENST00000449422.2	37	c.1823	CCDS8415.1	11	.	.	.	.	.	.	.	.	.	.	C	15.10	2.734552	0.48939	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739	T;T;T	0.43294	0.95;0.95;0.95	5.42	2.02	0.26589	.	0.387908	0.28606	N	0.014755	T	0.34948	0.0915	L	0.42245	1.32	0.22858	N	0.998643	B	0.18461	0.028	B	0.15870	0.014	T	0.36601	-0.9741	10	0.59425	D	0.04	-10.6573	13.1861	0.59682	0.7279:0.2721:0.0:0.0	.	608	Q9H172	ABCG4_HUMAN	V	608	ENSP00000304111:A608V;ENSP00000406874:A608V;ENSP00000434318:A608V	ENSP00000304111:A608V	A	+	2	0	ABCG4	118536908	1.000000	0.71417	0.514000	0.27761	0.998000	0.95712	3.313000	0.51935	0.569000	0.29329	0.561000	0.74099	GCG	-	NULL		0.582	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ABCG4	protein_coding	OTTHUMT00000388215.1	C	NM_022169		118536908	1	no_errors	NM_022169	genbank	human	reviewed	54_36p	missense	SNP	0.8	T
TESPA1	9840	genome.wustl.edu	37	12	55354975	55354975	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr12:55354975G>T	ENST00000449076.1	-	10	1676	c.1544C>A	c.(1543-1545)aCt>aAt	p.T515N	TESPA1_ENST00000524959.1_5'Flank|TESPA1_ENST00000524622.1_Missense_Mutation_p.T377N|TESPA1_ENST00000531122.1_Missense_Mutation_p.T377N|TESPA1_ENST00000532804.1_Missense_Mutation_p.T377N|TESPA1_ENST00000316577.8_Missense_Mutation_p.T515N	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	515					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.T377N(1)									GCCAGCAAAAGTCTGGTGGTG	0.502																																																1	Substitution - Missense(1)	ovary(1)	12											143.0	170.0	161.0					12																	55354975		2186	4294	6480	53641242	SO:0001583	missense	9840			AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.1544C>A	12.37:g.55354975G>T	ENSP00000400892:p.Thr515Asn	Somatic		Capture	Illumina GAIIx	4	53641242	B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Missense_Mutation	SNP	-	p.T515N	ENST00000449076.1	37	c.1544	CCDS44913.1	12	.	.	.	.	.	.	.	.	.	.	G	13.15	2.152271	0.38021	.	.	ENSG00000135426	ENST00000524622;ENST00000532804;ENST00000449076;ENST00000316577;ENST00000531122	T;T;T;T;T	0.52526	0.66;0.66;0.69;0.69;0.66	4.06	-0.495	0.12030	.	2.209180	0.01914	N	0.040043	T	0.32376	0.0827	L	0.29908	0.895	0.09310	N	1	B	0.32620	0.378	B	0.29942	0.109	T	0.21827	-1.0234	10	0.66056	D	0.02	-0.2215	0.3206	0.00302	0.2988:0.1962:0.3059:0.1991	.	515	A2RU30	K0748_HUMAN	N	377;377;515;515;377	ENSP00000435622:T377N;ENSP00000432030:T377N;ENSP00000400892:T515N;ENSP00000312679:T515N;ENSP00000433098:T377N	ENSP00000312679:T515N	T	-	2	0	KIAA0748	53641242	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.231000	0.17872	-0.075000	0.12798	0.650000	0.86243	ACT	-	NULL		0.502	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0748	protein_coding	OTTHUMT00000383822.1	G	NM_001098815		53641242	-1	no_errors	NM_001098815	genbank	human	validated	54_36p	missense	SNP		T
FLT1	2321	genome.wustl.edu	37	13	28980000	28980000	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr13:28980000A>G	ENST00000282397.4	-	11	1719	c.1468T>C	c.(1468-1470)Ttt>Ctt	p.F490L	FLT1_ENST00000539099.1_Missense_Mutation_p.F490L|FLT1_ENST00000541932.1_Missense_Mutation_p.F490L	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	490	Ig-like C2-type 5.			F -> S (in Ref. 3; AAC16449). {ECO:0000305}.	blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)	p.F490L(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCCAGGATAAAGGACTCTTCA	0.378																																																1	Substitution - Missense(1)	ovary(1)	13											155.0	151.0	152.0					13																	28980000		2203	4300	6503	27878000	SO:0001583	missense	2321			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1468T>C	13.37:g.28980000A>G	ENSP00000282397:p.Phe490Leu	Somatic		Capture	Illumina GAIIx	4	27878000	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like);superfamily_Immunoglobulin;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;I-set;HMMPfam_I-set;ig;HMMPfam_ig	p.F490L	ENST00000282397.4	37	c.1468	CCDS9330.1	13	.	.	.	.	.	.	.	.	.	.	A	8.333	0.826839	0.16749	.	.	ENSG00000102755	ENST00000282397;ENST00000541932;ENST00000539099	T;T;T	0.74315	-0.83;-0.22;-0.16	5.73	3.29	0.37713	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.365568	0.31797	N	0.007052	T	0.61540	0.2355	L	0.43152	1.355	0.09310	N	1	B;B;B;B	0.09022	0.002;0.002;0.001;0.001	B;B;B;B	0.11329	0.003;0.003;0.003;0.006	T	0.43261	-0.9402	10	0.15499	T	0.54	.	8.351	0.32303	0.7788:0.0:0.2212:0.0	.	490;490;490;490	P17948-4;P17948-3;P17948-2;P17948	.;.;.;VGFR1_HUMAN	L	490	ENSP00000282397:F490L;ENSP00000437631:F490L;ENSP00000442630:F490L	ENSP00000282397:F490L	F	-	1	0	FLT1	27878000	0.992000	0.36948	0.011000	0.14972	0.793000	0.44817	1.762000	0.38451	0.510000	0.28216	0.533000	0.62120	TTT	-	NULL		0.378	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	protein_coding	OTTHUMT00000044322.1	A			27878000	-1	no_errors	NM_002019	genbank	human	validated	54_36p	missense	SNP	0.11	G
CKAP2	26586	genome.wustl.edu	37	13	53048156	53048156	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr13:53048156A>G	ENST00000378037.5	+	8	1832	c.1742A>G	c.(1741-1743)aAt>aGt	p.N581S	CKAP2_ENST00000490903.1_Missense_Mutation_p.N532S|CKAP2_ENST00000258607.5_Missense_Mutation_p.N580S	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2									p.N580S(1)		breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		AAAACCCCCAATACAGAAACG	0.328																																																1	Substitution - Missense(1)	ovary(1)	13											63.0	63.0	63.0					13																	53048156		2203	4299	6502	51946157	SO:0001583	missense	26586			AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.1742A>G	13.37:g.53048156A>G	ENSP00000367276:p.Asn581Ser	Somatic		Capture	Illumina GAIIx	4	51946157		Missense_Mutation	SNP	-	p.N581S	ENST00000378037.5	37	c.1742	CCDS41893.1	13	.	.	.	.	.	.	.	.	.	.	.	5.300	0.240735	0.10077	.	.	ENSG00000136108	ENST00000258607;ENST00000378037;ENST00000490903	T;T;T	0.20881	2.04;2.04;2.04	5.91	-4.77	0.03219	.	0.947664	0.08948	N	0.870584	T	0.08846	0.0219	N	0.05230	-0.09	0.09310	N	1	B;B;B	0.10296	0.003;0.003;0.003	B;B;B	0.08055	0.003;0.002;0.002	T	0.42832	-0.9428	10	0.14656	T	0.56	-1.6384	12.5103	0.56002	0.5196:0.0:0.4804:0.0	.	532;581;580	E9PD90;Q8WWK9;B2RMQ4	.;CKAP2_HUMAN;.	S	580;581;532	ENSP00000258607:N580S;ENSP00000367276:N581S;ENSP00000417830:N532S	ENSP00000258607:N580S	N	+	2	0	CKAP2	51946157	0.008000	0.16893	0.000000	0.03702	0.358000	0.29455	0.690000	0.25451	-1.119000	0.02958	-0.256000	0.11100	AAT	-	NULL		0.328	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CKAP2	protein_coding	OTTHUMT00000355010.2	A			51946157	1	no_errors	NM_001098525	genbank	human	validated	54_36p	missense	SNP		G
RBM26	64062	genome.wustl.edu	37	13	79933778	79933778	+	Silent	SNP	T	T	G	rs372998044		TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr13:79933778T>G	ENST00000438737.2	-	10	1901	c.1461A>C	c.(1459-1461)tcA>tcC	p.S487S	RBM26_ENST00000438724.1_Silent_p.S487S|RBM26_ENST00000267229.7_Silent_p.S487S			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	487					mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S487S(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		TCCTTGATTCTGAGTCCACTA	0.343																																																1	Substitution - coding silent(1)	ovary(1)	13											151.0	143.0	146.0					13																	79933778		2203	4300	6503	78831779	SO:0001819	synonymous_variant	64062			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.1461A>C	13.37:g.79933778T>G		Somatic		Capture	Illumina GAIIx	4	78831779	B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Silent	SNP	HMMPfam_RRM_1;HMMPfam_zf-CCCH;HMMPfam_DUF1777;superfamily_PWI domain;superfamily_RNA-binding domain RBD;superfamily_CCCH zinc finger	p.S487	ENST00000438737.2	37	c.1461		13																																																																																			-	NULL		0.343	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	RBM26	protein_coding	OTTHUMT00000045373.4	T	NM_022118		78831779	-1	no_errors	NM_022118	genbank	human	validated	54_36p	silent	SNP	1	G
AREL1	9870	genome.wustl.edu	37	14	75150179	75150179	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr14:75150179G>A	ENST00000356357.4	-	5	816	c.301C>T	c.(301-303)Cac>Tac	p.H101Y	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	101					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.H101Y(1)									TGAGAGATGTGAACTCTTAGT	0.507																																																1	Substitution - Missense(1)	ovary(1)	14											107.0	100.0	103.0					14																	75150179		1943	4141	6084	74219932	SO:0001583	missense	9870			AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.301C>T	14.37:g.75150179G>A	ENSP00000348714:p.His101Tyr	Somatic		Capture	Illumina GAIIx	4	74219932	B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	HMMPfam_HECT;HMMPfam_Filamin;superfamily_E set domains;superfamily_Hect E3 ligase catalytic domain	p.H101Y	ENST00000356357.4	37	c.301	CCDS41971.1	14	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481318	0.63849	.	.	ENSG00000119682	ENST00000356357;ENST00000555249	T;T	0.50001	0.76;0.76	5.68	5.68	0.88126	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.090386	0.85682	D	0.000000	T	0.39145	0.1067	N	0.22421	0.69	0.45946	D	0.998777	P;B	0.42296	0.775;0.027	B;B	0.38327	0.271;0.085	T	0.40572	-0.9556	10	0.72032	D	0.01	.	19.7921	0.96463	0.0:0.0:1.0:0.0	.	101;101	O15033-2;O15033	.;K0317_HUMAN	Y	101	ENSP00000348714:H101Y;ENSP00000450458:H101Y	ENSP00000348714:H101Y	H	-	1	0	KIAA0317	74219932	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.722000	0.68485	2.671000	0.90904	0.655000	0.94253	CAC	-	HMMPfam_Filamin		0.507	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0317	protein_coding	OTTHUMT00000335517.2	G	NM_014821		74219932	-1	no_errors	NM_001039479	genbank	human	validated	54_36p	missense	SNP	1	A
C14orf178	283579	genome.wustl.edu	37	14	78236010	78236010	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr14:78236010G>T	ENST00000355883.3	+	3	567	c.358G>T	c.(358-360)Gcc>Tcc	p.A120S	C14orf178_ENST00000439131.2_Missense_Mutation_p.A90S|C14orf178_ENST00000557011.1_3'UTR|C14orf178_ENST00000556047.1_3'UTR	NM_174943.3	NP_777603.1	Q8N769	CN178_HUMAN	chromosome 14 open reading frame 178	120								p.A120S(1)		large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		ctgtgaggatgccatggggta	0.398																																																1	Substitution - Missense(1)	ovary(1)	14											79.0	67.0	71.0					14																	78236010		2203	4300	6503	77305763	SO:0001583	missense	283579			AK098842	CCDS9868.1, CCDS53906.1	14q24.3	2012-03-13			ENSG00000197734	ENSG00000197734			26385	protein-coding gene	gene with protein product						12477932	Standard	NM_001173978		Approved	FLJ25976	uc021rwv.1	Q8N769	OTTHUMG00000171528	ENST00000355883.3:c.358G>T	14.37:g.78236010G>T	ENSP00000348145:p.Ala120Ser	Somatic		Capture	Illumina GAIIx	4	77305763	Q2HIX2|Q3KNR7	Missense_Mutation	SNP	-	p.A120S	ENST00000355883.3	37	c.358	CCDS9868.1	14	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384168	0.42308	.	.	ENSG00000197734	ENST00000439131;ENST00000355883	T;T	0.55930	0.49;1.09	2.14	1.23	0.21249	.	.	.	.	.	T	0.28764	0.0713	N	0.08118	0	0.09310	N	1	B	0.31174	0.311	B	0.30646	0.118	T	0.21655	-1.0239	9	0.87932	D	0	.	4.7607	0.13106	0.1847:0.0:0.8153:0.0	.	120	Q8N769	CN178_HUMAN	S	90;120	ENSP00000407405:A90S;ENSP00000348145:A120S	ENSP00000348145:A120S	A	+	1	0	C14orf178	77305763	0.029000	0.19370	0.001000	0.08648	0.167000	0.22549	0.883000	0.28200	0.478000	0.27488	0.448000	0.29417	GCC	-	NULL		0.398	C14orf178-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C14orf178	protein_coding	OTTHUMT00000413920.1	G	NM_174943		77305763	1	no_errors	NM_174943	genbank	human	predicted	54_36p	missense	SNP		T
ZNF106	64397	genome.wustl.edu	37	15	42742522	42742522	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr15:42742522C>T	ENST00000263805.4	-	2	2205	c.1879G>A	c.(1879-1881)Gag>Aag	p.E627K	ZNF106_ENST00000565380.1_Intron|ZNF106_ENST00000565611.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	627					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.E627K(1)									CGGTCATCCTCCTCTTTCTCA	0.448																																																1	Substitution - Missense(1)	ovary(1)	15											191.0	188.0	189.0					15																	42742522		2203	4299	6502	40529814	SO:0001583	missense	64397			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.1879G>A	15.37:g.42742522C>T	ENSP00000263805:p.Glu627Lys	Somatic		Capture	Illumina GAIIx	4	40529814	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	HMMPfam_WD40;HMMPfam_zf-C2H2;superfamily_WD40 repeat-like;superfamily_C2H2 and C2HC zinc fingers	p.E627K	ENST00000263805.4	37	c.1879	CCDS32208.1	15	.	.	.	.	.	.	.	.	.	.	C	1.261	-0.615906	0.03663	.	.	ENSG00000103994	ENST00000263805	T	0.23754	1.89	5.02	-0.335	0.12662	.	1.313510	0.04769	N	0.427731	T	0.14056	0.0340	N	0.14661	0.345	0.09310	N	1	B;B	0.14012	0.009;0.002	B;B	0.11329	0.006;0.002	T	0.27536	-1.0071	10	0.12103	T	0.63	-0.1038	7.3635	0.26760	0.0:0.54:0.2106:0.2494	.	410;627	B4DGC7;Q9H2Y7	.;ZF106_HUMAN	K	627	ENSP00000263805:E627K	ENSP00000263805:E627K	E	-	1	0	ZFP106	40529814	0.000000	0.05858	0.000000	0.03702	0.125000	0.20455	0.062000	0.14389	0.071000	0.16664	0.650000	0.86243	GAG	-	NULL		0.448	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP106	protein_coding	OTTHUMT00000422587.1	C	NM_022473		40529814	-1	no_errors	NM_022473	genbank	human	provisional	54_36p	missense	SNP		T
CORO2B	10391	genome.wustl.edu	37	15	69003075	69003075	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr15:69003075G>A	ENST00000566799.1	+	4	367	c.338G>A	c.(337-339)cGg>cAg	p.R113Q	CORO2B_ENST00000540068.1_Missense_Mutation_p.R108Q|CORO2B_ENST00000543950.1_Missense_Mutation_p.R108Q|CORO2B_ENST00000261861.5_Missense_Mutation_p.R108Q			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	113					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)	p.R113Q(2)		kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						CTGCAGGTGCGGATCTGGGAG	0.652																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	15											23.0	22.0	22.0					15																	69003075		2198	4295	6493	66790129	SO:0001583	missense	10391			AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.338G>A	15.37:g.69003075G>A	ENSP00000454783:p.Arg113Gln	Somatic		Capture	Illumina GAIIx	4	66790129	A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	-	p.R113Q	ENST00000566799.1	37	c.338	CCDS10229.2	15	.	.	.	.	.	.	.	.	.	.	G	36	5.692932	0.96793	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.67865	-0.29;-0.29	5.55	5.55	0.83447	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.052086	0.64402	D	0.000001	T	0.73273	0.3566	L	0.46819	1.47	0.80722	D	1	D	0.55800	0.973	P	0.55087	0.768	T	0.73222	-0.4051	10	0.48119	T	0.1	-25.6916	18.4855	0.90827	0.0:0.0:1.0:0.0	.	113	Q9UQ03	COR2B_HUMAN	Q	113;108;108	ENSP00000446250:R108Q;ENSP00000443819:R108Q	ENSP00000261861:R113Q	R	+	2	0	CORO2B	66790129	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.584000	0.98220	2.597000	0.87782	0.655000	0.94253	CGG	-	NULL		0.652	CORO2B-203	KNOWN	basic|CCDS	protein_coding	CORO2B	protein_coding		G	NM_006091		66790129	1	no_errors	NM_006091	genbank	human	validated	54_36p	missense	SNP	1	A
ABCA3	21	genome.wustl.edu	37	16	2358451	2358451	+	Splice_Site	SNP	C	C	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr16:2358451C>T	ENST00000301732.5	-	11	1985	c.1285G>A	c.(1285-1287)Ggc>Agc	p.G429S	ABCA3_ENST00000382381.3_Intron	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	429					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.G429S(1)		breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	AAACACTCACCTTTCGCCTCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	16											105.0	87.0	93.0					16																	2358451		2198	4300	6498	2298452	SO:0001630	splice_region_variant	21			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.1285+1G>A	16.37:g.2358451C>T		Somatic		Capture	Illumina GAIIx	4	2298452	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	HMMPfam_ABC_tran;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.G429S	ENST00000301732.5	37	c.1285	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025491	0.75390	.	.	ENSG00000167972	ENST00000301732	T	0.76448	-1.02	5.65	4.71	0.59529	.	.	.	.	.	D	0.84701	0.5530	M	0.74258	2.255	0.80722	D	1	P;D	0.54601	0.943;0.967	P;P	0.58391	0.823;0.838	D	0.85066	0.0937	8	.	.	.	.	13.4101	0.60938	0.0:0.9239:0.0:0.0761	.	429;429	A7MBM9;Q99758	.;ABCA3_HUMAN	S	429	ENSP00000301732:G429S	.	G	-	1	0	ABCA3	2298452	1.000000	0.71417	0.992000	0.48379	0.044000	0.14063	7.200000	0.77838	1.389000	0.46526	0.650000	0.86243	GGC	-	NULL		0.552	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	protein_coding	OTTHUMT00000250784.2	C	NM_001089	Missense_Mutation	2298452	-1	no_errors	NM_001089	genbank	human	reviewed	54_36p	missense	SNP	1	T
UBE2MP1	606551	genome.wustl.edu	37	16	34404482	34404482	+	IGR	SNP	G	G	C			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr16:34404482G>C								RP11-244B22.11 (25230 upstream) : RP11-488I20.9 (22578 downstream)																							CACACGTCTTGGGCAGGTTCA	0.552																																																0			16																																								34261983	SO:0001628	intergenic_variant	606551																															16.37:g.34404482G>C		Somatic		Capture	Illumina GAIIx	4	34261983		RNA	SNP	-	NULL		37	NULL		16																																																																																			-	-	0	0.552					UBE2MP1			G			34261983	-1	pseudogene	NR_002837	genbank	human	provisional	54_36p	rna	SNP	1	C
TP53	7157	genome.wustl.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA;Sanger_PCR_WGA		dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	17	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343						65.0	56.0	59.0					17																	7577121		2203	4300	6503	7517846	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys	Somatic		Capture	Illumina GAIIx	Phase_III	7517846	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R273C	ENST00000269305.4	37	c.817	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT	-	HMMPfam_P53		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7517846	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.8	A
TP53	7157	genome.wustl.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	17	GRCh37	CM920675	TP53	M	rs11540652	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	7518263	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln	Somatic		Capture	Illumina GAIIx	4	7518263	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R248Q	ENST00000269305.4	37	c.743	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	-	HMMPfam_P53		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7518263	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	T
CCDC42	146849	genome.wustl.edu	37	17	8646962	8646962	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr17:8646962C>A	ENST00000293845.3	-	3	502	c.276G>T	c.(274-276)aaG>aaT	p.K92N	CCDC42_ENST00000539522.2_Missense_Mutation_p.K92N	NM_144681.2	NP_653282.2	Q96M95	CCD42_HUMAN	coiled-coil domain containing 42	92								p.K92N(1)		kidney(1)|large_intestine(4)|lung(3)|ovary(1)	9						ACTGCTCAGACTTCTGGATGT	0.587																																																1	Substitution - Missense(1)	ovary(1)	17											113.0	95.0	101.0					17																	8646962		2203	4300	6503	8587687	SO:0001583	missense	146849			AK057296	CCDS11145.1, CCDS54088.1	17p13.1	2012-05-28			ENSG00000161973	ENSG00000161973			26528	protein-coding gene	gene with protein product							Standard	NM_144681		Approved	FLJ32734, CCDC42A	uc002gln.3	Q96M95		ENST00000293845.3:c.276G>T	17.37:g.8646962C>A	ENSP00000293845:p.Lys92Asn	Somatic		Capture	Illumina GAIIx	4	8587687	Q8N6Q0	Missense_Mutation	SNP	-	p.K92N	ENST00000293845.3	37	c.276	CCDS11145.1	17	.	.	.	.	.	.	.	.	.	.	C	17.58	3.426064	0.62733	.	.	ENSG00000161973	ENST00000293845;ENST00000539522	T;T	0.19394	2.15;2.15	4.25	1.17	0.20885	.	0.108387	0.40302	N	0.001137	T	0.37404	0.1002	M	0.72353	2.195	0.31496	N	0.665412	D	0.76494	0.999	D	0.72338	0.977	T	0.35025	-0.9805	10	0.36615	T	0.2	-41.2654	7.5199	0.27622	0.0:0.6236:0.0:0.3764	.	92	Q96M95	CCD42_HUMAN	N	92	ENSP00000293845:K92N;ENSP00000444359:K92N	ENSP00000293845:K92N	K	-	3	2	CCDC42	8587687	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	0.389000	0.20751	0.103000	0.17682	0.555000	0.69702	AAG	-	NULL		0.587	CCDC42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC42	protein_coding	OTTHUMT00000442491.1	C	NM_144681		8587687	-1	no_errors	NM_144681	genbank	human	provisional	54_36p	missense	SNP	1	A
PLXDC1	57125	genome.wustl.edu	37	17	37295999	37295999	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr17:37295999C>A	ENST00000315392.4	-	2	374	c.163G>T	c.(163-165)Gtg>Ttg	p.V55L	PLXDC1_ENST00000444911.2_Intron|PLXDC1_ENST00000394316.2_Missense_Mutation_p.V55L|PLXDC1_ENST00000539608.1_5'UTR	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1	55					angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)	p.V55L(1)		kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						GGCTCTGACACATGCCCAGGG	0.672																																																1	Substitution - Missense(1)	ovary(1)	17											57.0	56.0	57.0					17																	37295999		2203	4300	6503	34549525	SO:0001583	missense	57125			AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.163G>T	17.37:g.37295999C>A	ENSP00000323927:p.Val55Leu	Somatic		Capture	Illumina GAIIx	4	34549525	B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Missense_Mutation	SNP	-	p.V55L	ENST00000315392.4	37	c.163	CCDS11333.1	17	.	.	.	.	.	.	.	.	.	.	C	6.796	0.515835	0.12944	.	.	ENSG00000161381	ENST00000315392;ENST00000394316	T	0.22539	1.95	5.39	4.15	0.48705	.	1.533780	0.03730	N	0.253358	T	0.18759	0.0450	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.23261	-1.0193	10	0.27785	T	0.31	-0.6937	8.9169	0.35587	0.0:0.8757:0.0:0.1243	.	55	Q8IUK5	PXDC1_HUMAN	L	55	ENSP00000323927:V55L	ENSP00000323927:V55L	V	-	1	0	PLXDC1	34549525	0.835000	0.29415	0.078000	0.20375	0.199000	0.23934	2.163000	0.42377	1.143000	0.42306	0.561000	0.74099	GTG	-	NULL		0.672	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC1	protein_coding	OTTHUMT00000256892.2	C	NM_020405		34549525	-1	no_errors	NM_020405	genbank	human	validated	54_36p	missense	SNP	0.16	A
TERF1P2	646359	genome.wustl.edu	37	18	14377947	14377947	+	IGR	SNP	T	T	C			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr18:14377947T>C								CYP4F35P (35424 upstream) : CXADRP3 (100006 downstream)																							TAGCTTCAGTTTCCATTTCAA	0.328																																																0			18																																								14367947	SO:0001628	intergenic_variant	646359																															18.37:g.14377947T>C		Somatic		Capture	Illumina GAIIx	4	14367947		Silent	SNP	-	p.E272		37	c.816		18																																																																																			-	NULL	0	0.328					LOC646359			T			14367947	-1	no_errors	XM_929288	genbank	human	model	54_36p	silent	SNP	0.01	C
ZNF236	7776	genome.wustl.edu	37	18	74563808	74563808	+	Silent	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr18:74563808G>A	ENST00000253159.8	+	3	468	c.270G>A	c.(268-270)ggG>ggA	p.G90G	ZNF236_ENST00000583095.1_3'UTR|ZNF236_ENST00000320610.9_Silent_p.G92G	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	90					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G90G(1)		NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CCCACAGCGGGGAAGATCCTA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	18											120.0	118.0	119.0					18																	74563808		1896	4113	6009	72692796	SO:0001819	synonymous_variant	7776			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.270G>A	18.37:g.74563808G>A		Somatic		Capture	Illumina GAIIx	4	72692796	B2RTX9|Q9UL37	Silent	SNP	HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.G90	ENST00000253159.8	37	c.270	CCDS42447.1	18																																																																																			-	NULL		0.433	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	protein_coding	OTTHUMT00000445776.1	G			72692796	1	no_errors	NM_007345	genbank	human	validated	54_36p	silent	SNP	0.99	A
SNRPA	6626	genome.wustl.edu	37	19	41265387	41265387	+	Missense_Mutation	SNP	A	A	G	rs138535346		TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr19:41265387A>G	ENST00000243563.3	+	3	848	c.298A>G	c.(298-300)Acc>Gcc	p.T100A	SNRPA_ENST00000599570.1_3'UTR	NM_004596.4	NP_004587.1	P09012	SNRPA_HUMAN	small nuclear ribonucleoprotein polypeptide A	100					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snRNA binding (GO:0017069)	p.T100S(1)|p.T100A(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GATGAAAGGCACCTTCGTGGA	0.587																																																2	Substitution - Missense(2)	ovary(1)|skin(1)	19											100.0	89.0	93.0					19																	41265387		2203	4300	6503	45957227	SO:0001583	missense	6626			X06347	CCDS12565.1	19q13.1	2013-02-12				ENSG00000077312		"""RNA binding motif (RRM) containing"""	11151	protein-coding gene	gene with protein product		182285				1701111	Standard	NM_004596		Approved	U1A, U1-A, Mud1	uc002ooz.3	P09012		ENST00000243563.3:c.298A>G	19.37:g.41265387A>G	ENSP00000243563:p.Thr100Ala	Somatic		Capture	Illumina GAIIx	4	45957227		Missense_Mutation	SNP	-	p.T100A	ENST00000243563.3	37	c.298	CCDS12565.1	19	.	.	.	.	.	.	.	.	.	.	A	20.4	3.981458	0.74474	.	.	ENSG00000077312	ENST00000243563;ENST00000545469	T	0.26067	1.76	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.41143	0.1146	M	0.88181	2.935	0.80722	D	1	B	0.12013	0.005	B	0.24701	0.055	T	0.39272	-0.9622	10	0.59425	D	0.04	-60.7119	15.2129	0.73241	1.0:0.0:0.0:0.0	.	100	P09012	SNRPA_HUMAN	A	100;21	ENSP00000243563:T100A	ENSP00000243563:T100A	T	+	1	0	SNRPA	45957227	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.026000	0.93700	2.233000	0.73108	0.533000	0.62120	ACC	-	NULL		0.587	SNRPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRPA	protein_coding	OTTHUMT00000463118.2	A	NM_004596		45957227	1	no_errors	NM_004596	genbank	human	provisional	54_36p	missense	SNP	1	G
FBN3	84467	genome.wustl.edu	37	19	8191368	8191368	+	Silent	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr19:8191368G>A	ENST00000600128.1	-	20	2952	c.2538C>T	c.(2536-2538)tgC>tgT	p.C846C	FBN3_ENST00000601739.1_Silent_p.C846C|FBN3_ENST00000270509.2_Silent_p.C846C			Q75N90	FBN3_HUMAN	fibrillin 3	846	TB 4.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.C846C(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CGCAGCGTTCGCAGGGGCTCC	0.657																																																1	Substitution - coding silent(1)	ovary(1)	19											20.0	23.0	22.0					19																	8191368		2203	4300	6503	8097368	SO:0001819	synonymous_variant	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.2538C>T	19.37:g.8191368G>A		Somatic		Capture	Illumina GAIIx	4	8097368	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	HMMPfam_TB,HMMPfam_EGF,superfamily_Growth factor receptor domain,HMMPfam_EGF_CA,superfamily_EGF/Laminin,superfamily_TB module/8-cys domain	p.C846	ENST00000600128.1	37	c.2538	CCDS12196.1	19																																																																																			-	HMMPfam_TB		0.657	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	protein_coding	OTTHUMT00000461428.2	G	NM_032447		8097368	-1	no_errors	NM_032447	genbank	human	reviewed	54_36p	silent	SNP	1	A
FBN3	84467	genome.wustl.edu	37	19	8206902	8206902	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr19:8206902G>A	ENST00000600128.1	-	7	1075	c.661C>T	c.(661-663)Cca>Tca	p.P221S	FBN3_ENST00000601739.1_Missense_Mutation_p.P221S|FBN3_ENST00000270509.2_Missense_Mutation_p.P221S			Q75N90	FBN3_HUMAN	fibrillin 3	221	TB 1.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.P221S(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						AGTTCACATGGAAGGCCCCAG	0.647																																																1	Substitution - Missense(1)	ovary(1)	19											32.0	36.0	34.0					19																	8206902		2203	4300	6503	8112902	SO:0001583	missense	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.661C>T	19.37:g.8206902G>A	ENSP00000470498:p.Pro221Ser	Somatic		Capture	Illumina GAIIx	4	8112902	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	HMMPfam_TB;HMMPfam_EGF;superfamily_Growth factor receptor domain;HMMPfam_EGF_CA;superfamily_EGF/Laminin;superfamily_TB module/8-cys domain	p.P221S	ENST00000600128.1	37	c.661	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	g	18.42	3.620785	0.66787	.	.	ENSG00000142449	ENST00000270509	D	0.93859	-3.3	3.95	3.95	0.45737	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.64402	U	0.000001	D	0.94443	0.8212	L	0.41961	1.31	0.41709	D	0.989446	D	0.56746	0.977	D	0.65573	0.936	D	0.94670	0.7856	10	0.51188	T	0.08	.	15.1368	0.72572	0.0:0.0:1.0:0.0	.	221	Q75N90	FBN3_HUMAN	S	221	ENSP00000270509:P221S	ENSP00000270509:P221S	P	-	1	0	FBN3	8112902	1.000000	0.71417	0.060000	0.19600	0.996000	0.88848	6.211000	0.72182	2.028000	0.59812	0.491000	0.48974	CCA	-	HMMPfam_TB		0.647	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	protein_coding	OTTHUMT00000461428.2	G	NM_032447		8112902	-1	no_errors	NM_032447	genbank	human	reviewed	54_36p	missense	SNP	1	A
ARHGEF1	9138	genome.wustl.edu	37	19	42392892	42392892	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr19:42392892G>A	ENST00000354532.3	+	4	329	c.181G>A	c.(181-183)Gcc>Acc	p.A61T	ARHGEF1_ENST00000599846.1_Missense_Mutation_p.A61T|ARHGEF1_ENST00000337665.4_Missense_Mutation_p.A76T|ARHGEF1_ENST00000347545.4_Missense_Mutation_p.A61T|ARHGEF1_ENST00000596957.1_Intron|ARHGEF1_ENST00000378152.4_Missense_Mutation_p.A76T	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	61	RGSL.				cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A76T(1)		breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		CCACCTCATGGCCCTCCTGCA	0.652																																																1	Substitution - Missense(1)	ovary(1)	19											48.0	47.0	47.0					19																	42392892		2202	4300	6502	47084732	SO:0001583	missense	9138			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.181G>A	19.37:g.42392892G>A	ENSP00000346532:p.Ala61Thr	Somatic		Capture	Illumina GAIIx	4	47084732	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	-	p.A76T	ENST00000354532.3	37	c.226	CCDS12591.1	19	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592098	0.86953	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000316079;ENST00000337665;ENST00000378152	D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69	4.23	4.23	0.50019	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	0.090560	0.43260	D	0.000598	D	0.88299	0.6399	L	0.53249	1.67	0.32615	N	0.524094	D;D;D;D;D	0.76494	0.992;0.997;0.998;0.996;0.999	P;P;D;P;D	0.81914	0.903;0.888;0.995;0.889;0.956	D	0.90358	0.4371	10	0.62326	D	0.03	-18.1275	14.5452	0.68024	0.0:0.0:1.0:0.0	.	76;76;61;61;121	Q6NX52;Q92888-3;Q92888-2;Q92888;Q8NF33	.;.;.;ARHG1_HUMAN;.	T	61;61;97;76;76	ENSP00000346532:A61T;ENSP00000344429:A61T;ENSP00000337261:A76T;ENSP00000367394:A76T	ENSP00000323044:A97T	A	+	1	0	ARHGEF1	47084732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.825000	0.62708	2.372000	0.80975	0.585000	0.79938	GCC	-	NULL		0.652	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	protein_coding	OTTHUMT00000463360.1	G	NM_199002		47084732	1	no_errors	NM_199002	genbank	human	reviewed	54_36p	missense	SNP	1	A
NEB	4703	genome.wustl.edu	37	2	152512413	152512413	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr2:152512413T>G	ENST00000172853.10	-	50	6767	c.6620A>C	c.(6619-6621)cAc>cCc	p.H2207P	NEB_ENST00000409198.1_Missense_Mutation_p.H2207P|NEB_ENST00000604864.1_Missense_Mutation_p.H2207P|NEB_ENST00000603639.1_Missense_Mutation_p.H2207P|NEB_ENST00000397345.3_Missense_Mutation_p.H2207P|NEB_ENST00000427231.2_Missense_Mutation_p.H2207P			P20929	NEBU_HUMAN	nebulin	2207					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.H2207P(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GTTGCTCGGGTGCTGGCGGTA	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											154.0	150.0	152.0					2																	152512413		1995	4166	6161	152220659	SO:0001583	missense	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.6620A>C	2.37:g.152512413T>G	ENSP00000172853:p.His2207Pro	Somatic		Capture	Illumina GAIIx	4	152220659	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	-	p.H2207P	ENST00000172853.10	37	c.6620		2	.	.	.	.	.	.	.	.	.	.	T	15.39	2.819372	0.50633	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.06768	3.26;3.3;3.3;3.26	5.3	5.3	0.74995	.	0.228496	0.43579	D	0.000544	T	0.07908	0.0198	L	0.28608	0.87	0.80722	D	1	B	0.10296	0.003	B	0.10450	0.005	T	0.29671	-1.0004	10	0.23302	T	0.38	.	15.4117	0.74929	0.0:0.0:0.0:1.0	.	2207	P20929	NEBU_HUMAN	P	2207	ENSP00000386259:H2207P;ENSP00000380505:H2207P;ENSP00000416578:H2207P;ENSP00000172853:H2207P	ENSP00000172853:H2207P	H	-	2	0	NEB	152220659	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.731000	0.62022	2.225000	0.72522	0.460000	0.39030	CAC	-	NULL		0.498	NEB-201	KNOWN	basic	protein_coding	NEB	protein_coding		T	NM_004543		152220659	-1	no_errors	NM_004543	genbank	human	reviewed	54_36p	missense	SNP	1	G
ITGA6	3655	genome.wustl.edu	37	2	173344433	173344433	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr2:173344433C>A	ENST00000264106.6	+	11	1773	c.1570C>A	c.(1570-1572)Cag>Aag	p.Q524K	ITGA6_ENST00000409080.1_Missense_Mutation_p.Q485K|ITGA6_ENST00000264107.7_Missense_Mutation_p.Q485K|ITGA6_ENST00000375221.2_Missense_Mutation_p.Q524K|AC093818.1_ENST00000442417.1_RNA|ITGA6_ENST00000409532.1_Missense_Mutation_p.Q366K|ITGA6_ENST00000343713.4_Missense_Mutation_p.Q480K			P23229	ITA6_HUMAN	integrin, alpha 6	524					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.Q485K(1)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			TGACCTCCGCCAGAAAACAGC	0.493																																																1	Substitution - Missense(1)	ovary(1)	2											138.0	146.0	144.0					2																	173344433		2203	4300	6503	173052679	SO:0001583	missense	3655				CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1570C>A	2.37:g.173344433C>A	ENSP00000264106:p.Gln524Lys	Somatic		Capture	Illumina GAIIx	4	173052679	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	-	p.Q485K	ENST00000264106.6	37	c.1453		2	.	.	.	.	.	.	.	.	.	.	C	7.720	0.696891	0.15106	.	.	ENSG00000091409	ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358	T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.38	4.47	0.54385	.	0.549916	0.20487	N	0.091379	T	0.17450	0.0419	N	0.03000	-0.44	0.37526	D	0.917714	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.001	T	0.10660	-1.0620	10	0.07325	T	0.83	.	11.3425	0.49541	0.3538:0.6462:0.0:0.0	.	480;524;485;485	P23229-4;P23229-9;G5E9H1;P23229-2	.;.;.;.	K	366;485;524;524;480;485;524;480	ENSP00000386614:Q366K;ENSP00000264107:Q485K;ENSP00000264106:Q524K;ENSP00000364369:Q524K;ENSP00000341078:Q480K;ENSP00000386896:Q485K;ENSP00000406694:Q524K;ENSP00000394169:Q480K	ENSP00000264106:Q524K	Q	+	1	0	ITGA6	173052679	0.932000	0.31603	1.000000	0.80357	0.609000	0.37215	0.615000	0.24329	1.184000	0.42957	0.655000	0.94253	CAG	-	NULL		0.493	ITGA6-201	KNOWN	basic	protein_coding	ITGA6	protein_coding		C			173052679	1	no_errors	NM_001079818	genbank	human	reviewed	54_36p	missense	SNP	1	A
SH3YL1	26751	genome.wustl.edu	37	2	231084	231084	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr2:231084T>C	ENST00000405430.1	-	9	1017	c.641A>G	c.(640-642)tAt>tGt	p.Y214C	SH3YL1_ENST00000415006.2_Missense_Mutation_p.Y118C|SH3YL1_ENST00000403712.2_Missense_Mutation_p.Y214C|SH3YL1_ENST00000403658.1_Missense_Mutation_p.Y118C|SH3YL1_ENST00000356150.5_Missense_Mutation_p.Y214C|SH3YL1_ENST00000468321.1_5'UTR|SH3YL1_ENST00000403657.1_Missense_Mutation_p.Y118C			Q96HL8	SH3Y1_HUMAN	SH3 and SYLF domain containing 1	214					phosphatidylinositol biosynthetic process (GO:0006661)|regulation of ruffle assembly (GO:1900027)	ruffle membrane (GO:0032587)	phosphatase binding (GO:0019902)|phosphatidylinositol binding (GO:0035091)	p.Y118C(1)		large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)		TTCATTTTCATACTTTTCAGT	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											143.0	136.0	138.0					2																	231084		1881	4100	5981	221084	SO:0001583	missense	26751				CCDS42646.1, CCDS42646.2, CCDS54332.1, CCDS62841.1	2p25.3	2013-10-18	2013-10-18		ENSG00000035115	ENSG00000035115			29546	protein-coding gene	gene with protein product			"""SH3 domain containing, Ysc84-like 1 (S. cerevisiae)"""			21624956	Standard	NM_001282687		Approved	Ray, DKFZP586F1318	uc002qvx.3	Q96HL8	OTTHUMG00000151359	ENST00000405430.1:c.641A>G	2.37:g.231084T>C	ENSP00000384269:p.Tyr214Cys	Somatic		Capture	Illumina GAIIx	4	221084	A8K8E7|B7WNJ4|B7WPL6|Q8NEL2|Q9H5X4|Q9Y3V5	Missense_Mutation	SNP	-	p.Y118C	ENST00000405430.1	37	c.353		2	.	.	.	.	.	.	.	.	.	.	T	15.48	2.846325	0.51164	.	.	ENSG00000035115	ENST00000415006;ENST00000403712;ENST00000403657;ENST00000405430;ENST00000356150;ENST00000403658;ENST00000451005;ENST00000431160	T;T;T;T;T;T;T	0.26067	2.04;2.0;2.02;1.88;1.88;2.02;1.76	5.11	3.93	0.45458	.	0.502845	0.20526	N	0.090610	T	0.36635	0.0974	L	0.32530	0.975	0.58432	D	0.999998	D;P;D;D	0.89917	1.0;0.806;1.0;1.0	D;B;D;D	0.97110	1.0;0.446;0.998;0.999	T	0.04103	-1.0977	10	0.48119	T	0.1	-6.6767	9.5344	0.39213	0.1576:0.0:0.0:0.8424	.	118;214;214;118	Q96HL8-4;Q96HL8-2;Q96HL8;Q96HL8-3	.;.;SH3Y1_HUMAN;.	C	118;214;118;214;214;118;146;170	ENSP00000404143:Y118C;ENSP00000384276:Y214C;ENSP00000385668:Y118C;ENSP00000384269:Y214C;ENSP00000348471:Y214C;ENSP00000383928:Y118C;ENSP00000416312:Y146C	ENSP00000348471:Y214C	Y	-	2	0	SH3YL1	221084	1.000000	0.71417	0.979000	0.43373	0.487000	0.33371	3.346000	0.52190	0.760000	0.33108	0.455000	0.32223	TAT	-	NULL		0.393	SH3YL1-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SH3YL1	protein_coding	OTTHUMT00000322352.1	T	NM_015677		221084	-1	no_errors	NM_015677	genbank	human	provisional	54_36p	missense	SNP	1	C
MAP4K3	8491	genome.wustl.edu	37	2	39515317	39515317	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr2:39515317T>G	ENST00000263881.3	-	20	1743	c.1419A>C	c.(1417-1419)caA>caC	p.Q473H	MAP4K3_ENST00000536018.1_Missense_Mutation_p.Q26H|MAP4K3_ENST00000341681.5_Missense_Mutation_p.Q452H|MAP4K3_ENST00000437545.1_Missense_Mutation_p.Q389H|MAP4K3_ENST00000474502.1_5'Flank	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	473					intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.Q473H(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				TAGGTGGAACTTGGGATGGCT	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											207.0	200.0	202.0					2																	39515317		2203	4300	6503	39368821	SO:0001583	missense	8491			AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.1419A>C	2.37:g.39515317T>G	ENSP00000263881:p.Gln473His	Somatic		Capture	Illumina GAIIx	4	39368821	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Missense_Mutation	SNP	Pkinase,HMMPfam_Pkinase,CNH,HMMPfam_CNH	p.Q473H	ENST00000263881.3	37	c.1419	CCDS1803.1	2	.	.	.	.	.	.	.	.	.	.	T	9.887	1.203059	0.22121	.	.	ENSG00000011566	ENST00000263881;ENST00000437545;ENST00000341681;ENST00000536018	T;T;T;T	0.15139	2.45;2.45;2.45;2.45	5.75	-5.14	0.02875	Protein kinase-like domain (1);	0.370336	0.30771	N	0.008911	T	0.06508	0.0167	N	0.22421	0.69	0.26614	N	0.972787	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.14309	-1.0477	10	0.34782	T	0.22	.	0.3525	0.00351	0.2823:0.1822:0.2829:0.2526	.	452;473	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	H	473;389;452;26	ENSP00000263881:Q473H;ENSP00000416958:Q389H;ENSP00000345434:Q452H;ENSP00000440580:Q26H	ENSP00000263881:Q473H	Q	-	3	2	MAP4K3	39368821	0.009000	0.17119	0.694000	0.30210	0.952000	0.60782	-1.857000	0.01660	-1.240000	0.02529	-0.361000	0.07541	CAA	-	NULL		0.468	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP4K3	protein_coding	OTTHUMT00000219966.2	T	NM_003618		39368821	-1	no_errors	NM_003618	genbank	human	reviewed	54_36p	missense	SNP	0.981	G
SERTAD2	9792	genome.wustl.edu	37	2	64893134	64893134	+	Intron	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr2:64893134G>A	ENST00000476805.2	-	2	725							Q14140	SRTD2_HUMAN	SERTA domain containing 2						negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|skin(1)	12						CCGAGGCTGGGGCTGGGTCAG	0.537																																																0			2																																								64746638	SO:0001627	intron_variant	730187			D50917	CCDS33210.1	2p15	2007-05-01			ENSG00000179833	ENSG00000179833			30784	protein-coding gene	gene with protein product	"""transcriptional regulator interacting with the PHS-bromodomain 2"""					8590280, 11331592	Standard	NM_014755		Approved	TRIP-Br2, KIAA0127, Sei-2	uc002sde.2	Q14140	OTTHUMG00000152678	ENST00000476805.2:c.344-29125C>T	2.37:g.64893134G>A		Somatic		Capture	Illumina GAIIx	4	64746638	Q53TS2	RNA	SNP	-	NULL	ENST00000476805.2	37	NULL		2																																																																																			-	-		0.537	SERTAD2-002	KNOWN	not_organism_supported|mRNA_end_NF|basic	processed_transcript	LOC730187	protein_coding	OTTHUMT00000327470.2	G	NM_014755		64746638	1	pseudogene	XR_042354	genbank	human	model	54_36p	rna	SNP	1	A
HECW2	57520	genome.wustl.edu	37	2	197171942	197171942	+	Silent	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr2:197171942G>A	ENST00000260983.3	-	12	2783	c.2601C>T	c.(2599-2601)cgC>cgT	p.R867R	HECW2_ENST00000409111.1_Silent_p.R511R	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	867	Interaction with TP73.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R867R(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TCATGGTTCTGCGGATACTCT	0.463																																																1	Substitution - coding silent(1)	ovary(1)	2											123.0	107.0	113.0					2																	197171942		2203	4300	6503	196880187	SO:0001819	synonymous_variant	57520			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.2601C>T	2.37:g.197171942G>A		Somatic		Capture	Illumina GAIIx	4	196880187	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Silent	SNP	HMMPfam_C2;HMMPfam_HECT;HMMPfam_WW;superfamily_WW domain;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);superfamily_Hect E3 ligase catalytic domain	p.R867	ENST00000260983.3	37	c.2601	CCDS33354.1	2																																																																																			-	NULL		0.463	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	protein_coding	OTTHUMT00000335199.3	G	NM_020760		196880187	-1	no_errors	NM_020760	genbank	human	provisional	54_36p	silent	SNP	1	A
TGM3	7053	genome.wustl.edu	37	20	2312705	2312705	+	Missense_Mutation	SNP	C	C	G	rs374109992		TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr20:2312705C>G	ENST00000381458.5	+	10	1454	c.1391C>G	c.(1390-1392)aCg>aGg	p.T464R		NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	464					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)	p.T464R(1)		breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	AAACCCAACACGCCATTTGCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	20											74.0	66.0	69.0					20																	2312705		2203	4300	6503	2260705	SO:0001583	missense	7053			L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.1391C>G	20.37:g.2312705C>G	ENSP00000370867:p.Thr464Arg	Somatic		Capture	Illumina GAIIx	4	2260705	A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Missense_Mutation	SNP	HMMPfam_Transglut_C;superfamily_Transglutaminase two C-terminal domains;superfamily_E set domains;superfamily_Cysteine proteinases;HMMPfam_Transglut_N;HMMPfam_Transglut_core	p.T464R	ENST00000381458.5	37	c.1391	CCDS33435.1	20	.	.	.	.	.	.	.	.	.	.	C	3.768	-0.048297	0.07407	.	.	ENSG00000125780	ENST00000381458;ENST00000420960	T	0.78364	-1.17	4.96	-4.02	0.04034	.	3.471750	0.00832	N	0.001673	T	0.50820	0.1638	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47971	-0.9075	10	0.10902	T	0.67	-0.5739	3.8711	0.09036	0.0903:0.3394:0.4295:0.1408	.	464	Q08188	TGM3_HUMAN	R	464	ENSP00000370867:T464R	ENSP00000370867:T464R	T	+	2	0	TGM3	2260705	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.206000	0.01231	-1.062000	0.03181	0.655000	0.94253	ACG	-	NULL		0.522	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM3	protein_coding	OTTHUMT00000077579.2	C	NM_003245		2260705	1	no_errors	NM_003245	genbank	human	reviewed	54_36p	missense	SNP		G
CEP250	11190	genome.wustl.edu	37	20	34096010	34096010	+	Silent	SNP	C	C	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr20:34096010C>G	ENST00000397527.1	+	32	7617	c.6897C>G	c.(6895-6897)acC>acG	p.T2299T	CEP250_ENST00000342580.4_Silent_p.T2243T	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	2299					centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.T2299T(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			TGCGGAGTACCTTGGAGCAGG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	20											112.0	110.0	111.0					20																	34096010		2203	4300	6503	33559424	SO:0001819	synonymous_variant	11190			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.6897C>G	20.37:g.34096010C>G		Somatic		Capture	Illumina GAIIx	4	33559424	E1P5Q3|O14812|O60588|Q9H450	Silent	SNP	-	p.T2299	ENST00000397527.1	37	c.6897	CCDS13255.1	20																																																																																			-	NULL		0.567	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	protein_coding	OTTHUMT00000078877.7	C	NM_007186		33559424	1	no_errors	NM_007186	genbank	human	reviewed	54_36p	silent	SNP	0.64	G
DSN1	79980	genome.wustl.edu	37	20	35396413	35396413	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr20:35396413C>A	ENST00000426836.1	-	4	760	c.388G>T	c.(388-390)Gaa>Taa	p.E130*	DSN1_ENST00000448110.2_Nonsense_Mutation_p.E114*|DSN1_ENST00000473615.1_5'UTR|DSN1_ENST00000373734.4_Nonsense_Mutation_p.E23*|DSN1_ENST00000373740.3_Nonsense_Mutation_p.E58*|DSN1_ENST00000373750.4_Nonsense_Mutation_p.E130*|DSN1_ENST00000373745.3_Nonsense_Mutation_p.E130*	NM_001145316.1	NP_001138788.1	Q9H410	DSN1_HUMAN	DSN1, MIS12 kinetochore complex component	130					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)		p.E130*(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	16		Myeloproliferative disorder(115;0.00874)				CGTTTGCTTTCTGCTAAATCG	0.388																																																1	Substitution - Nonsense(1)	ovary(1)	20											114.0	109.0	111.0					20																	35396413		2203	4300	6503	34829827	SO:0001587	stop_gained	79980			AK023408	CCDS13286.1, CCDS46596.1, CCDS46597.1	20q11.23	2013-07-03	2013-07-03	2006-11-07	ENSG00000149636	ENSG00000149636			16165	protein-coding gene	gene with protein product	"""kinetochore null 3 homolog (C. elegans)"""	609175	"""chromosome 20 open reading frame 172"", ""DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C20orf172		16585270, 20819937	Standard	NM_001145315		Approved	dJ469A13.2, MIS13, KNL3, hKNL-3	uc002xfz.3	Q9H410	OTTHUMG00000032396	ENST00000426836.1:c.388G>T	20.37:g.35396413C>A	ENSP00000389810:p.Glu130*	Somatic		Capture	Illumina GAIIx	4	34829827	B4DWT2|E1P5U9|Q5JW55|Q5JW56|Q9H8P4	Nonsense_Mutation	SNP	HMMPfam_Mis12_component	p.E130*	ENST00000426836.1	37	c.388	CCDS13286.1	20	.	.	.	.	.	.	.	.	.	.	C	39	7.614934	0.98390	.	.	ENSG00000149636	ENST00000426836;ENST00000373745;ENST00000448110;ENST00000373733;ENST00000373750;ENST00000373740;ENST00000373734;ENST00000449595;ENST00000447406;ENST00000438549	.	.	.	5.37	4.41	0.53225	.	0.197940	0.42172	D	0.000758	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-27.2972	11.6341	0.51194	0.0:0.8132:0.1867:0.0	.	.	.	.	X	130;130;114;63;130;58;23;114;130;30	.	ENSP00000362838:E63X	E	-	1	0	DSN1	34829827	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	2.431000	0.44775	1.471000	0.48121	0.650000	0.86243	GAA	-	HMMPfam_Mis12_component		0.388	DSN1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSN1	protein_coding	OTTHUMT00000079043.2	C	NM_024918		34829827	-1	no_errors	NM_024918	genbank	human	reviewed	54_36p	nonsense	SNP	0.99	A
XRCC6	2547	genome.wustl.edu	37	22	42049657	42049657	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr22:42049657A>C	ENST00000359308.4	+	8	1909	c.1254A>C	c.(1252-1254)gaA>gaC	p.E418D	XRCC6_ENST00000405506.1_Missense_Mutation_p.E368D|XRCC6_ENST00000405878.1_Missense_Mutation_p.E418D|XRCC6_ENST00000402580.3_Missense_Mutation_p.E377D|XRCC6_ENST00000360079.3_Missense_Mutation_p.E418D|XRCC6_ENST00000428575.2_Missense_Mutation_p.E285D			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	418	Ku.				brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)	p.E418D(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						CACAGGAAGAAGAGTTGGATG	0.488								Non-homologous end-joining																																								1	Substitution - Missense(1)	ovary(1)	22											106.0	101.0	103.0					22																	42049657		2203	4300	6503	40379603	SO:0001583	missense	2547			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.1254A>C	22.37:g.42049657A>C	ENSP00000352257:p.Glu418Asp	Somatic		Capture	Illumina GAIIx	4	40379603	B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	HMMPfam_SAP;HMMPfam_Ku_C;HMMPfam_Ku_N;HMMPfam_Ku;superfamily_SPOC domain-like;superfamily_vWA-like;superfamily_SAP domain	p.E418D	ENST00000359308.4	37	c.1254	CCDS14021.1	22	.	.	.	.	.	.	.	.	.	.	A	16.10	3.026940	0.54683	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	.	.	.	4.95	2.74	0.32292	Spen Paralogue and Orthologue SPOC, C-terminal-like (2);DNA helicase, ATP-dependent, Ku type (2);	0.000000	0.85682	D	0.000000	T	0.75510	0.3859	M	0.83603	2.65	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;1.0	T	0.73452	-0.3978	9	0.37606	T	0.19	-31.8109	7.1484	0.25595	0.3105:0.0:0.6895:0.0	.	368;418;377;418	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	D	418;377;285;418;418;418;368	.	ENSP00000352257:E418D	E	+	3	2	XRCC6	40379603	0.989000	0.36119	0.998000	0.56505	0.299000	0.27559	0.272000	0.18644	1.061000	0.40601	-0.337000	0.08149	GAA	-	HMMPfam_Ku		0.488	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC6	protein_coding	OTTHUMT00000321688.1	A	NM_001469		40379603	1	no_errors	NM_001469	genbank	human	reviewed	54_36p	missense	SNP	1	C
TRPC1	7220	genome.wustl.edu	37	3	142511801	142511801	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr3:142511801C>T	ENST00000476941.1	+	9	2059	c.1573C>T	c.(1573-1575)Cca>Tca	p.P525S	TRPC1_ENST00000273482.6_Missense_Mutation_p.P491S	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	525					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)	p.P491S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						TATCTTGGGTCCATTACAGGT	0.338																																																1	Substitution - Missense(1)	ovary(1)	3											89.0	83.0	85.0					3																	142511801		2203	4300	6503	143994491	SO:0001583	missense	7220			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1573C>T	3.37:g.142511801C>T	ENSP00000419313:p.Pro525Ser	Somatic		Capture	Illumina GAIIx	4	143994491	Q14CE4	Missense_Mutation	SNP	-	p.P491S	ENST00000476941.1	37	c.1471	CCDS58856.1	3	.	.	.	.	.	.	.	.	.	.	C	27.0	4.790228	0.90367	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	D;D	0.98512	-4.97;-4.97	5.28	5.28	0.74379	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98865	0.9616	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99878	1.1108	10	0.87932	D	0	-13.2298	19.2782	0.94040	0.0:1.0:0.0:0.0	.	525;491	P48995;P48995-2	TRPC1_HUMAN;.	S	525;491	ENSP00000419313:P525S;ENSP00000273482:P491S	ENSP00000273482:P491S	P	+	1	0	TRPC1	143994491	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.622000	0.88805	0.557000	0.71058	CCA	-	NULL		0.338	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC1	protein_coding	OTTHUMT00000354520.1	C	NM_003304		143994491	1	no_errors	NM_003304	genbank	human	validated	54_36p	missense	SNP	1	T
SCN5A	6331	genome.wustl.edu	37	3	38627206	38627206	+	Silent	SNP	A	A	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr3:38627206A>G	ENST00000333535.4	-	16	2912	c.2763T>C	c.(2761-2763)ctT>ctC	p.L921L	SCN5A_ENST00000449557.2_Silent_p.L921L|SCN5A_ENST00000451551.2_Silent_p.L921L|SCN5A_ENST00000413689.1_Silent_p.L921L|SCN5A_ENST00000423572.2_Silent_p.L921L|SCN5A_ENST00000443581.1_Silent_p.L921L|SCN5A_ENST00000450102.2_Silent_p.L921L|SCN5A_ENST00000425664.1_Silent_p.L921L|SCN5A_ENST00000414099.2_Silent_p.L921L|SCN5A_ENST00000455624.2_Silent_p.L921L			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	921					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.L921L(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	TGACCATAACAAGCAAGAAGA	0.517																																																1	Substitution - coding silent(1)	ovary(1)	3											91.0	90.0	90.0					3																	38627206		2179	4296	6475	38602210	SO:0001819	synonymous_variant	6331			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.2763T>C	3.37:g.38627206A>G		Somatic		Capture	Illumina GAIIx	4	38602210	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	-	p.L921	ENST00000333535.4	37	c.2763	CCDS46796.1	3																																																																																			-	NULL		0.517	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	protein_coding	OTTHUMT00000377958.1	A	NM_198056		38602210	-1	no_errors	NM_001099404	genbank	human	reviewed	54_36p	silent	SNP	0.99	G
ZKSCAN7	55888	genome.wustl.edu	37	3	44611782	44611782	+	Missense_Mutation	SNP	C	C	T	rs201321192		TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr3:44611782C>T	ENST00000273320.3	+	6	1609	c.1180C>T	c.(1180-1182)Cgg>Tgg	p.R394W	ZKSCAN7_ENST00000431636.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000341840.3_Intron|ZKSCAN7_ENST00000426540.1_Missense_Mutation_p.R394W|RP11-944L7.5_ENST00000419137.1_Intron	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	394					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R394W(1)									AGCTTTCAATCGGAGTTCTCA	0.463													.|||	0	0.0	0.0	0.0	5008	,	,		18214	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3											94.0	97.0	96.0					3																	44611782		2203	4300	6503	44586786	SO:0001583	missense	55888			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1180C>T	3.37:g.44611782C>T	ENSP00000273320:p.Arg394Trp	Somatic		Capture	Illumina GAIIx	4	44586786	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Missense_Mutation	SNP	-	p.R394W	ENST00000273320.3	37	c.1180	CCDS2715.1	3	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	.	1.037	-0.679924	0.03353	.	.	ENSG00000196345	ENST00000426540;ENST00000273320;ENST00000447279	T;T;T	0.07444	5.4;5.4;3.19	4.35	-0.97	0.10306	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.611750	0.04506	N	0.382110	T	0.08179	0.0204	L	0.53561	1.675	0.09310	N	1	B;B	0.27450	0.179;0.028	B;B	0.19946	0.027;0.005	T	0.37454	-0.9705	10	0.27785	T	0.31	-6.6519	3.4116	0.07360	0.295:0.2846:0.0:0.4204	.	264;394	A7MAY2;Q9P0L1	.;ZN167_HUMAN	W	394;394;243	ENSP00000395524:R394W;ENSP00000273320:R394W;ENSP00000405034:R243W	ENSP00000273320:R394W	R	+	1	2	ZNF167	44586786	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-8.802000	0.00016	-0.093000	0.12396	-0.157000	0.13467	CGG	-	NULL		0.463	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF167	protein_coding	OTTHUMT00000256752.4	C	NM_018651		44586786	1	no_errors	NM_018651	genbank	human	validated	54_36p	missense	SNP	0.39	T
Unknown	0	genome.wustl.edu	37	3	180041707	180041707	+	IGR	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr3:180041707G>A								RNA5SP149 (161942 upstream) : RP11-420J11.2 (90254 downstream)																							GTATTTGTGAGACCTTCCAGA	0.463																																																0			3																																								181524401	SO:0001628	intergenic_variant	131054																															3.37:g.180041707G>A		Somatic		Capture	Illumina GAIIx	4	181524401		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.463					LOC131054			G			181524401	1	pseudogene	XR_017452	genbank	human	model	54_36p	rna	SNP	1	A
PROM1	8842	genome.wustl.edu	37	4	15991388	15991388	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr4:15991388G>T	ENST00000510224.1	-	19	2291	c.2043C>A	c.(2041-2043)caC>caA	p.H681Q	PROM1_ENST00000540805.1_Missense_Mutation_p.H681Q|PROM1_ENST00000505450.1_Missense_Mutation_p.H672Q|PROM1_ENST00000447510.2_Missense_Mutation_p.H681Q|PROM1_ENST00000543373.1_Missense_Mutation_p.H672Q|PROM1_ENST00000508167.1_Missense_Mutation_p.H672Q|PROM1_ENST00000539194.1_Missense_Mutation_p.H681Q			O43490	PROM1_HUMAN	prominin 1	681					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)	p.H680Q(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						CTCGTTGCTGGTGAATTGTTT	0.388																																																1	Substitution - Missense(1)	ovary(1)	4											140.0	133.0	135.0					4																	15991388		1873	4104	5977	15600486	SO:0001583	missense	8842			AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.2043C>A	4.37:g.15991388G>T	ENSP00000426809:p.His681Gln	Somatic		Capture	Illumina GAIIx	4	15600486	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	HMMPfam_Prominin	p.H681Q	ENST00000510224.1	37	c.2043	CCDS47029.1	4	.	.	.	.	.	.	.	.	.	.	G	13.49	2.252371	0.39797	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12;1.12;1.12	5.03	1.03	0.20045	.	0.137977	0.64402	D	0.000003	T	0.37758	0.1015	L	0.46885	1.475	0.26758	N	0.970069	D;D;P;D;B;P	0.55172	0.97;0.97;0.92;0.97;0.433;0.78	P;P;P;P;B;P	0.53224	0.721;0.721;0.615;0.721;0.068;0.531	T	0.30208	-0.9986	10	0.10111	T	0.7	-2.9036	6.2868	0.21037	0.455:0.0:0.545:0.0	.	672;681;672;681;672;681	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	Q	681;681;681;672;672;681;672	ENSP00000415481:H681Q;ENSP00000438045:H681Q;ENSP00000443620:H681Q;ENSP00000426090:H672Q;ENSP00000427346:H672Q;ENSP00000426809:H681Q;ENSP00000445526:H672Q	ENSP00000415481:H681Q	H	-	3	2	PROM1	15600486	0.046000	0.20272	0.002000	0.10522	0.010000	0.07245	0.105000	0.15333	0.294000	0.22547	-0.140000	0.14226	CAC	-	HMMPfam_Prominin		0.388	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PROM1	protein_coding	OTTHUMT00000359595.2	G	NM_006017		15600486	-1	no_errors	NM_006017	genbank	human	reviewed	54_36p	missense	SNP	0.17	T
MUC7	4589	genome.wustl.edu	37	4	71346827	71346827	+	Silent	SNP	A	A	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr4:71346827A>G	ENST00000304887.5	+	3	556	c.366A>G	c.(364-366)aaA>aaG	p.K122K	MUC7_ENST00000514512.1_3'UTR|MUC7_ENST00000456088.1_Silent_p.K122K|MUC7_ENST00000413702.1_Silent_p.K122K	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	122	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.K122K(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			CTTCCACCAAAATTACTACCC	0.423																																																1	Substitution - coding silent(1)	ovary(1)	4											132.0	124.0	127.0					4																	71346827		2203	4300	6503	71381416	SO:0001819	synonymous_variant	4589			BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.366A>G	4.37:g.71346827A>G		Somatic		Capture	Illumina GAIIx	4	71381416	Q9UCD7|Q9UCD8	Silent	SNP	-	p.K122	ENST00000304887.5	37	c.366	CCDS3541.1	4																																																																																			-	NULL		0.423	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC7	protein_coding	OTTHUMT00000252168.2	A	NM_152291		71381416	1	no_errors	NM_152291	genbank	human	reviewed	54_36p	silent	SNP		G
TLL1	7092	genome.wustl.edu	37	4	166916241	166916241	+	Silent	SNP	C	C	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr4:166916241C>T	ENST00000061240.2	+	5	1190	c.543C>T	c.(541-543)gcC>gcT	p.A181A	TLL1_ENST00000507499.1_Silent_p.A181A|TLL1_ENST00000513213.1_Silent_p.A181A	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	181	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A181A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TCAAGCAGGCCATGAGGCACT	0.448																																																1	Substitution - coding silent(1)	ovary(1)	4											153.0	153.0	153.0					4																	166916241		2203	4300	6503	167135691	SO:0001819	synonymous_variant	7092			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.543C>T	4.37:g.166916241C>T		Somatic		Capture	Illumina GAIIx	4	167135691	B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	-	p.A181	ENST00000061240.2	37	c.543	CCDS3811.1	4																																																																																			-	NULL		0.448	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	protein_coding	OTTHUMT00000363821.1	C			167135691	1	no_errors	NM_012464	genbank	human	reviewed	54_36p	silent	SNP	1	T
PCDHA4	56144	genome.wustl.edu	37	5	140188833	140188833	+	Silent	SNP	G	G	C			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr5:140188833G>C	ENST00000530339.1	+	1	2061	c.2061G>C	c.(2059-2061)gtG>gtC	p.V687V	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Silent_p.V687V|PCDHA4_ENST00000356878.4_Silent_p.V687V|PCDHA1_ENST00000504120.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	687					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V687V(1)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGCGCTGTGGGTCCCGATG	0.647																																																1	Substitution - coding silent(1)	ovary(1)	5											62.0	58.0	59.0					5																	140188833		2203	4300	6503	140169017	SO:0001819	synonymous_variant	56144			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.2061G>C	5.37:g.140188833G>C		Somatic		Capture	Illumina GAIIx	4	140169017	O75285|Q2M253	Silent	SNP	-	p.V687	ENST00000530339.1	37	c.2061	CCDS54916.1	5																																																																																			-	NULL		0.647	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	protein_coding	OTTHUMT00000372864.2	G	NM_018907		140169017	1	no_errors	NM_018907	genbank	human	reviewed	54_36p	silent	SNP		C
PCDHA10	56139	genome.wustl.edu	37	5	140237743	140237743	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr5:140237743G>A	ENST00000307360.5	+	1	2110	c.2110G>A	c.(2110-2112)Gcg>Acg	p.A704T	PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	704					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A704T(1)		NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCATCTGCGCGGTGTCCAG	0.687																																																1	Substitution - Missense(1)	ovary(1)	5											31.0	25.0	27.0					5																	140237743		1322	2291	3613	140217927	SO:0001583	missense	56139			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.2110G>A	5.37:g.140237743G>A	ENSP00000304234:p.Ala704Thr	Somatic		Capture	Illumina GAIIx	4	140217927	A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	-	p.A704T	ENST00000307360.5	37	c.2110	CCDS54921.1	5	.	.	.	.	.	.	.	.	.	.	G	11.32	1.604821	0.28623	.	.	ENSG00000250120	ENST00000307360	T	0.17213	2.29	3.66	0.421	0.16451	.	.	.	.	.	T	0.35008	0.0917	M	0.89534	3.04	0.20975	N	0.999811	P;D	0.58620	0.871;0.983	B;P	0.50109	0.306;0.631	T	0.34329	-0.9833	9	0.42905	T	0.14	.	12.61	0.56546	0.0:0.0:0.4068:0.5932	.	704;704	Q9Y5I2-3;Q9Y5I2	.;PCDAA_HUMAN	T	704	ENSP00000304234:A704T	ENSP00000304234:A704T	A	+	1	0	PCDHA10	140217927	0.624000	0.27102	0.999000	0.59377	0.173000	0.22820	0.945000	0.29056	0.299000	0.22661	-0.500000	0.04577	GCG	-	NULL		0.687	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA10	protein_coding	OTTHUMT00000372895.2	G	NM_018901		140217927	1	no_errors	NM_018901	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
PLEKHG4B	153478	genome.wustl.edu	37	5	156279	156279	+	Missense_Mutation	SNP	G	G	T	rs534336026		TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr5:156279G>T	ENST00000283426.6	+	8	1284	c.1234G>T	c.(1234-1236)Gtc>Ttc	p.V412F		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	412							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V412F(1)		endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		GGGGGGCACCGTCCTGGCGCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	5											69.0	65.0	66.0					5																	156279		2203	4300	6503	209279	SO:0001583	missense	153478			BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.1234G>T	5.37:g.156279G>T	ENSP00000283426:p.Val412Phe	Somatic		Capture	Illumina GAIIx	4	209279		Missense_Mutation	SNP	-	p.V412F	ENST00000283426.6	37	c.1234	CCDS34124.1	5	.	.	.	.	.	.	.	.	.	.	g	12.04	1.819777	0.32145	.	.	ENSG00000153404	ENST00000283426;ENST00000502646	T;T	0.31510	1.49;2.96	3.65	0.826	0.18829	.	.	.	.	.	T	0.38427	0.1040	L	0.43152	1.355	0.09310	N	0.999999	D	0.65815	0.995	P	0.61328	0.887	T	0.18398	-1.0338	9	0.59425	D	0.04	.	6.1234	0.20165	0.3557:0.0:0.6443:0.0	.	412	Q96PX9	PKH4B_HUMAN	F	412;326	ENSP00000283426:V412F;ENSP00000422493:V326F	ENSP00000283426:V412F	V	+	1	0	PLEKHG4B	209279	0.012000	0.17670	0.009000	0.14445	0.737000	0.42083	-0.185000	0.09684	-0.182000	0.10602	-1.200000	0.01667	GTC	-	NULL		0.622	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG4B	protein_coding	OTTHUMT00000365359.1	G	NM_052909		209279	1	no_errors	NM_052909	genbank	human	validated	54_36p	missense	SNP	0.83	T
CDH10	1008	genome.wustl.edu	37	5	24535261	24535261	+	Silent	SNP	C	C	T	rs188355658		TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr5:24535261C>T	ENST00000264463.4	-	5	1281	c.774G>A	c.(772-774)acG>acA	p.T258T		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	258	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T258T(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		CATCTGTCAGCGTGATGTTCA	0.488										HNSCC(23;0.051)			C|||	1	0.000199681	0.0	0.0014	5008	,	,		14653	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	5											195.0	155.0	169.0					5																	24535261		2203	4300	6503	24571018	SO:0001819	synonymous_variant	1008			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.774G>A	5.37:g.24535261C>T		Somatic		Capture	Illumina GAIIx	4	24571018	Q9ULB3	Silent	SNP	HMMPfam_Cadherin_C;HMMPfam_Cadherin;superfamily_Cadherin-like	p.T258	ENST00000264463.4	37	c.774	CCDS3892.1	5																																																																																			-	HMMPfam_Cadherin		0.488	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	protein_coding	OTTHUMT00000207345.2	C	NM_006727		24571018	-1	no_errors	NM_006727	genbank	human	reviewed	54_36p	silent	SNP	0.98	T
DHX29	54505	genome.wustl.edu	37	5	54581181	54581181	+	Silent	SNP	A	A	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr5:54581181A>G	ENST00000251636.5	-	10	1444	c.1296T>C	c.(1294-1296)gaT>gaC	p.D432D	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	432						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)	p.D432D(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				CTTGCATGCCATCTTCTGTTA	0.403																																																1	Substitution - coding silent(1)	ovary(1)	5											73.0	65.0	68.0					5																	54581181		2203	4300	6503	54616938	SO:0001819	synonymous_variant	54505			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.1296T>C	5.37:g.54581181A>G		Somatic		Capture	Illumina GAIIx	4	54616938	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Silent	SNP	-	p.D432	ENST00000251636.5	37	c.1296	CCDS34158.1	5																																																																																			-	NULL		0.403	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX29	protein_coding	OTTHUMT00000368532.1	A	NM_019030		54616938	-1	no_errors	NM_019030	genbank	human	validated	54_36p	silent	SNP	1	G
PCDHGA5	56110	genome.wustl.edu	37	5	140745301	140745301	+	Silent	SNP	T	T	G	rs145748099	byFrequency	TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr5:140745301T>G	ENST00000518069.1	+	1	1404	c.1404T>G	c.(1402-1404)ggT>ggG	p.G468G	PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	468	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G468G(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCCCAGAGGTGTCTCTATCT	0.537																																																1	Substitution - coding silent(1)	ovary(1)	5											111.0	120.0	117.0					5																	140745301		1953	4159	6112	140725485	SO:0001819	synonymous_variant	56110			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.1404T>G	5.37:g.140745301T>G		Somatic		Capture	Illumina GAIIx	4	140725485	Q2M3F5|Q9Y5D2	Silent	SNP	-	p.G468	ENST00000518069.1	37	c.1404	CCDS54925.1	5																																																																																			-	NULL		0.537	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA5	protein_coding	OTTHUMT00000374742.1	T	NM_018918		140725485	1	no_errors	NM_018918	genbank	human	reviewed	54_36p	silent	SNP	0.18	G
NQO2	4835	genome.wustl.edu	37	6	3015782	3015782	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr6:3015782A>T	ENST00000338130.2	+	8	1034	c.322A>T	c.(322-324)Agc>Tgc	p.S108C	NQO2_ENST00000380455.4_Missense_Mutation_p.S108C|NQO2_ENST00000380430.1_Missense_Mutation_p.S108C|NQO2_ENST00000380454.4_Intron|NQO2_ENST00000380441.1_Intron			P16083	NQO2_HUMAN	NAD(P)H dehydrogenase, quinone 2	108					memory (GO:0007613)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	dihydronicotinamide riboside quinone reductase activity (GO:0001512)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADPH dehydrogenase (quinone) activity (GO:0008753)	p.S108C(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Dabigatran etexilate(DB06695)|Flavin adenine dinucleotide(DB03147)|Melatonin(DB01065)|Menadione(DB00170)|Primaquine(DB01087)	GTACTGGTTCAGCGTGCCAGC	0.542																																																1	Substitution - Missense(1)	ovary(1)	6											77.0	73.0	75.0					6																	3015782		2203	4300	6503	2960781	SO:0001583	missense	4835			U07736	CCDS4481.1, CCDS75388.1	6p25.2	2012-09-20	2001-11-30	2001-12-07	ENSG00000124588	ENSG00000124588	1.6.5.2		7856	protein-coding gene	gene with protein product		160998	"""NAD(P)H menadione oxidoreductase 2, dioxin-inducible"""	NMOR2		1691923	Standard	XM_005249152		Approved	QR2, DHQV, DIA6	uc003mus.2	P16083	OTTHUMG00000014130	ENST00000338130.2:c.322A>T	6.37:g.3015782A>T	ENSP00000337773:p.Ser108Cys	Somatic		Capture	Illumina GAIIx	4	2960781	B2R492|Q5TD04	Missense_Mutation	SNP	-	p.S108C	ENST00000338130.2	37	c.322	CCDS4481.1	6	.	.	.	.	.	.	.	.	.	.	A	22.7	4.326386	0.81690	.	.	ENSG00000124588	ENST00000380472;ENST00000397717;ENST00000338130;ENST00000380455;ENST00000380430	T;T;T;T;T	0.12465	2.68;2.68;2.78;2.78;2.78	5.52	4.33	0.51752	Flavodoxin-like fold (1);	0.171014	0.64402	D	0.000006	T	0.35566	0.0936	H	0.94385	3.53	0.39923	D	0.974185	D	0.89917	1.0	D	0.80764	0.994	T	0.50215	-0.8854	10	0.72032	D	0.01	-24.6106	10.5148	0.44883	0.8555:0.0:0.0:0.1445	.	108	P16083	NQO2_HUMAN	C	108	ENSP00000369839:S108C;ENSP00000380829:S108C;ENSP00000337773:S108C;ENSP00000369822:S108C;ENSP00000369795:S108C	ENSP00000337773:S108C	S	+	1	0	NQO2	2960781	1.000000	0.71417	0.967000	0.41034	0.982000	0.71751	4.556000	0.60775	0.892000	0.36259	0.460000	0.39030	AGC	-	NULL		0.542	NQO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NQO2	protein_coding	OTTHUMT00000039651.1	A			2960781	1	no_errors	NM_000904	genbank	human	validated	54_36p	missense	SNP	1	T
SLC17A3	10786	genome.wustl.edu	37	6	25862239	25862239	+	Intron	SNP	A	A	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr6:25862239A>T	ENST00000360657.3	-	3	589				SLC17A3_ENST00000361703.6_Intron|SLC17A3_ENST00000397060.4_Missense_Mutation_p.S108T			O00476	NPT4_HUMAN	solute carrier family 17 (organic anion transporter), member 3						drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|glucose-6-phosphate transport (GO:0015760)|ion transmembrane transport (GO:0034220)|organic acid transport (GO:0015849)|organic anion transport (GO:0015711)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of anion transport (GO:0044070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|efflux transmembrane transporter activity (GO:0015562)|organic anion transmembrane transporter activity (GO:0008514)|sodium:phosphate symporter activity (GO:0005436)|toxin transporter activity (GO:0019534)|urate transmembrane transporter activity (GO:0015143)|voltage-gated anion channel activity (GO:0008308)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)	20						ATTTGAGGAGACCAGTCATAC	0.458																																																0			6											67.0	65.0	65.0					6																	25862239		2076	4203	6279	25970218	SO:0001627	intron_variant	10786			U90545	CCDS4566.2, CCDS47385.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124564	ENSG00000124564		"""Solute carriers"""	10931	protein-coding gene	gene with protein product		611034	"""solute carrier family 17 (sodium phosphate), member 3"""			9149941	Standard	NM_006632		Approved	NPT4	uc003nfk.4	O00476	OTTHUMG00000014412	ENST00000360657.3:c.303+221T>A	6.37:g.25862239A>T		Somatic		Capture	Illumina GAIIx	4	25970218	B7WNJ5|B7Z511|Q8WWC7|Q9H533	Missense_Mutation	SNP	-	p.S108T	ENST00000360657.3	37	c.322	CCDS4566.2	6	.	.	.	.	.	.	.	.	.	.	A	12.40	1.925706	0.34002	.	.	ENSG00000124564	ENST00000397060	T	0.63417	-0.04	3.58	2.38	0.29361	.	.	.	.	.	T	0.45175	0.1329	L	0.58925	1.835	0.58432	D	0.999999	P;P	0.41313	0.725;0.745	P;P	0.46275	0.51;0.491	T	0.38757	-0.9646	9	0.33141	T	0.24	.	6.2241	0.20698	0.2284:0.0:0.0:0.7716	.	89;108	B7Z3L7;B7Z511	.;.	T	108	ENSP00000380250:S108T	ENSP00000380250:S108T	S	-	1	0	SLC17A3	25970218	0.978000	0.34361	0.709000	0.30452	0.313000	0.28021	0.806000	0.27126	0.717000	0.32145	-0.445000	0.05633	TCT	-	NULL		0.458	SLC17A3-001	KNOWN	basic|CCDS	protein_coding	SLC17A3	protein_coding	OTTHUMT00000040070.2	A			25970218	-1	no_errors	NM_001098486	genbank	human	validated	54_36p	missense	SNP	0.73	T
HIST1H4H	8365	genome.wustl.edu	37	6	26285681	26285681	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr6:26285681G>A	ENST00000377727.1	-	1	56	c.47C>T	c.(46-48)gCt>gTt	p.A16V	HIST1H4H_ENST00000289352.1_Missense_Mutation_p.A16V	NM_003543.3	NP_003534.1	P62805	H4_HUMAN	histone cluster 1, H4h	16					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.A16V(1)		lung(2)|ovary(2)|upper_aerodigestive_tract(3)	7						ATGACGCTTAGCTCCTCCCTT	0.512										HNSCC(76;0.23)																																						1	Substitution - Missense(1)	ovary(1)	6											98.0	96.0	97.0					6																	26285681		2203	4300	6503	26393660	SO:0001583	missense	8365			X60487	CCDS4604.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158406	ENSG00000158406		"""Histones / Replication-dependent"""	4788	protein-coding gene	gene with protein product		602828	"""H4 histone family, member H"", ""histone 1, H4h"""	H4FH		9119399, 12408966	Standard	NM_003543		Approved	H4/h	uc003nhm.2	P62805	OTTHUMG00000014454	ENST00000377727.1:c.47C>T	6.37:g.26285681G>A	ENSP00000366956:p.Ala16Val	Somatic		Capture	Illumina GAIIx	4	26393660	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	-	p.A16V	ENST00000377727.1	37	c.47	CCDS4604.1	6	.	.	.	.	.	.	.	.	.	.	.	18.68	3.675643	0.67928	.	.	ENSG00000158406	ENST00000289352;ENST00000377727	.	.	.	4.4	4.4	0.53042	.	0.000000	0.50627	U	0.000110	T	0.67571	0.2907	.	.	.	0.40381	D	0.979443	.	.	.	.	.	.	T	0.72459	-0.4287	6	0.62326	D	0.03	.	14.8602	0.70376	0.0:0.0:1.0:0.0	.	.	.	.	V	16	.	ENSP00000289352:A16V	A	-	2	0	HIST1H4H	26393660	1.000000	0.71417	0.133000	0.22050	0.002000	0.02628	9.724000	0.98775	2.181000	0.69327	0.491000	0.48974	GCT	-	NULL		0.512	HIST1H4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4H	protein_coding	OTTHUMT00000040119.1	G	NM_003543		26393660	-1	no_errors	NM_003543	genbank	human	reviewed	54_36p	missense	SNP	1	A
FANCE	2178	genome.wustl.edu	37	6	35423981	35423981	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr6:35423981C>T	ENST00000229769.2	+	2	891	c.706C>T	c.(706-708)Cat>Tat	p.H236Y		NM_021922.2	NP_068741.1	Q9HB96	FANCE_HUMAN	Fanconi anemia, complementation group E	236	Interaction with FANCC.				DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.H236Y(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)|skin(2)	13						GAGACCCGAACATAAGTCACT	0.527			"""N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													yes	Rec		Fanconi anaemia E	6	6p21-p22	2178	"""Fanconi anemia, complementation group E"""		L	1	Substitution - Missense(1)	ovary(1)	6											118.0	106.0	110.0					6																	35423981		2203	4300	6503	35531959	SO:0001583	missense	2178	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF265210	CCDS4805.1	6p22-p21	2014-09-17			ENSG00000112039	ENSG00000112039		"""Fanconi anemia, complementation groups"""	3586	protein-coding gene	gene with protein product		613976		FACE		7662964, 11001585	Standard	XM_005248885		Approved	FAE	uc003oko.1	Q9HB96	OTTHUMG00000014565	ENST00000229769.2:c.706C>T	6.37:g.35423981C>T	ENSP00000229769:p.His236Tyr	Somatic		Capture	Illumina GAIIx	4	35531959	A8K907|Q4ZGH2	Missense_Mutation	SNP	-	p.H236Y	ENST00000229769.2	37	c.706	CCDS4805.1	6	.	.	.	.	.	.	.	.	.	.	C	9.091	1.001694	0.19121	.	.	ENSG00000112039	ENST00000229769	T	0.42900	0.96	4.47	1.56	0.23342	.	2.595200	0.01109	N	0.005556	T	0.08891	0.0220	N	0.14661	0.345	0.09310	N	1	B	0.32829	0.386	B	0.23018	0.043	T	0.10590	-1.0623	10	0.41790	T	0.15	.	4.0543	0.09810	0.1836:0.6137:0.0:0.2027	.	236	Q9HB96	FANCE_HUMAN	Y	236	ENSP00000229769:H236Y	ENSP00000229769:H236Y	H	+	1	0	FANCE	35531959	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.651000	0.05372	0.528000	0.28580	-0.258000	0.10820	CAT	-	NULL		0.527	FANCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCE	protein_coding	OTTHUMT00000040282.1	C			35531959	1	no_errors	NM_021922	genbank	human	reviewed	54_36p	missense	SNP		T
MDN1	23195	genome.wustl.edu	37	6	90422426	90422426	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr6:90422426C>A	ENST00000369393.3	-	48	7413	c.7298G>T	c.(7297-7299)gGa>gTa	p.G2433V	MDN1_ENST00000428876.1_Missense_Mutation_p.G2433V			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2433					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.G2433V(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGGCCACAGTCCCATGCCAAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	6											95.0	93.0	94.0					6																	90422426		2203	4300	6503	90479147	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.7298G>T	6.37:g.90422426C>A	ENSP00000358400:p.Gly2433Val	Somatic		Capture	Illumina GAIIx	4	90479147	O15019|Q5T794	Missense_Mutation	SNP	-	p.G2433V	ENST00000369393.3	37	c.7298	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	19.18	3.777378	0.70107	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03553	3.89;3.89	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.02767	0.0083	N	0.24115	0.695	0.80722	D	1	P	0.43024	0.798	B	0.43478	0.421	T	0.56372	-0.7990	10	0.72032	D	0.01	.	19.9336	0.97129	0.0:1.0:0.0:0.0	.	2433	Q9NU22	MDN1_HUMAN	V	2433	ENSP00000358400:G2433V;ENSP00000413970:G2433V	ENSP00000358400:G2433V	G	-	2	0	MDN1	90479147	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.027000	0.76463	2.717000	0.92951	0.563000	0.77884	GGA	-	NULL		0.463	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	protein_coding	OTTHUMT00000041514.2	C			90479147	-1	no_errors	NM_014611	genbank	human	provisional	54_36p	missense	SNP	1	A
TIAM2	26230	genome.wustl.edu	37	6	155450467	155450467	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr6:155450467C>T	ENST00000461783.3	+	6	1383	c.110C>T	c.(109-111)gCa>gTa	p.A37V	TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000360366.4_Missense_Mutation_p.A37V|TIAM2_ENST00000529824.2_Missense_Mutation_p.A37V|TIAM2_ENST00000318981.5_Missense_Mutation_p.A37V|TIAM2_ENST00000456144.1_Missense_Mutation_p.A37V			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	37					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A37V(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GGCATTCATGCAAAAGAGGAA	0.463																																																1	Substitution - Missense(1)	ovary(1)	6											86.0	81.0	83.0					6																	155450467		2203	4300	6503	155492159	SO:0001583	missense	26230				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.110C>T	6.37:g.155450467C>T	ENSP00000437188:p.Ala37Val	Somatic		Capture	Illumina GAIIx	4	155492159	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	HMMPfam_RhoGEF;HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_PH;superfamily_HR1 repeat;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like	p.A37V	ENST00000461783.3	37	c.110	CCDS34558.1	6	.	.	.	.	.	.	.	.	.	.	C	11.57	1.678944	0.29783	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000545347;ENST00000538270;ENST00000535231;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000535583;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.05649	3.52;3.41;3.48;3.52;3.52;3.48	5.63	4.75	0.60458	.	0.164580	0.53938	D	0.000044	T	0.03390	0.0098	L	0.42245	1.32	0.80722	D	1	B	0.19200	0.034	B	0.17098	0.017	T	0.16188	-1.0411	10	0.72032	D	0.01	.	12.2616	0.54652	0.0:0.9219:0.0:0.0781	.	37	Q8IVF5	TIAM2_HUMAN	V	37;283;37;37;37;37;37;37;37;37;37	ENSP00000437188:A37V;ENSP00000434901:A37V;ENSP00000407746:A37V;ENSP00000327315:A37V;ENSP00000353528:A37V;ENSP00000433348:A37V	ENSP00000327315:A37V	A	+	2	0	TIAM2	155492159	0.518000	0.26234	0.170000	0.22879	0.148000	0.21650	2.147000	0.42226	2.659000	0.90383	0.561000	0.74099	GCA	-	NULL		0.463	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	TIAM2	protein_coding	OTTHUMT00000387980.2	C	NM_012454		155492159	1	no_errors	NM_012454	genbank	human	reviewed	54_36p	missense	SNP	0.95	T
NPM1P35	100129067	genome.wustl.edu	37	11	62098623	62098623	+	IGR	SNP	A	A	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr11:62098623A>T								SCGB1D4 (32087 upstream) : RP11-703H8.7 (5759 downstream)																							TGAATTACGAAGGCAGTCCAA	0.433																																																0			11																																								61855199	SO:0001628	intergenic_variant	100129067																															11.37:g.62098623A>T		Somatic		Capture	Illumina GAIIx	4	61855199		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.433					LOC100129067			A			61855199	1	pseudogene	XR_038268	genbank	human	model	54_36p	rna	SNP	1	T
Unknown	0	genome.wustl.edu	37	7	57005197	57005197	+	IGR	SNP	G	G	A	rs189863024		TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr7:57005197G>A								RP13-580B18.1 (55358 upstream) : MIR4283-1 (18294 downstream)																							CAGCCAGTGTGCCCTTGGGGT	0.493																																																0			7																																								57009139	SO:0001628	intergenic_variant	728500																															7.37:g.57005197G>A		Somatic		Capture	Illumina GAIIx	4	57009139		Missense_Mutation	SNP	-	p.H183Y		37	c.547		7																																																																																			-	NULL	0	0.493					LOC728500			G			57009139	-1	no_errors	XM_001127570	genbank	human	model	54_36p	missense	SNP	0	A
SPDYE7P	441251	genome.wustl.edu	37	7	72339306	72339306	+	IGR	SNP	T	T	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr7:72339306T>G								RN7SL625P (27001 upstream) : POM121 (10629 downstream)																							AGAACAGGATTGGAGGTGCTC	0.527																																																0			7											1.0	2.0	2.0					7																	72339306		452	1296	1748	71977242	SO:0001628	intergenic_variant	441251																															7.37:g.72339306T>G		Somatic		Capture	Illumina GAIIx	4	71977242		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.527					SPDYE7P			T			71977242	-1	pseudogene	NR_003666	genbank	human	provisional	54_36p	rna	SNP	0.05	G
ZFPM2	23414	genome.wustl.edu	37	8	106456538	106456538	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr8:106456538A>G	ENST00000407775.2	+	3	480	c.230A>G	c.(229-231)gAa>gGa	p.E77G	ZFPM2_ENST00000520492.1_5'UTR	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	77					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E77G(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GAGACAGCAGAATCAGATGGG	0.468																																																1	Substitution - Missense(1)	ovary(1)	8											78.0	83.0	81.0					8																	106456538		1940	4159	6099	106525714	SO:0001583	missense	23414			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.230A>G	8.37:g.106456538A>G	ENSP00000384179:p.Glu77Gly	Somatic		Capture	Illumina GAIIx	4	106525714	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.E77G	ENST00000407775.2	37	c.230	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	A	21.4	4.147582	0.77888	.	.	ENSG00000169946	ENST00000407775	T	0.21543	2.0	5.87	5.87	0.94306	.	0.086984	0.41712	D	0.000835	T	0.19967	0.0480	L	0.38175	1.15	0.80722	D	1	P	0.34522	0.455	B	0.32211	0.142	T	0.02093	-1.1215	10	0.87932	D	0	.	16.2496	0.82475	1.0:0.0:0.0:0.0	.	77	Q8WW38	FOG2_HUMAN	G	77	ENSP00000384179:E77G	ENSP00000384179:E77G	E	+	2	0	ZFPM2	106525714	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.649000	0.91067	2.371000	0.80710	0.533000	0.62120	GAA	-	NULL		0.468	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	protein_coding	OTTHUMT00000380614.1	A			106525714	1	no_errors	NM_012082	genbank	human	reviewed	54_36p	missense	SNP	1	G
RPL4P5	158345	genome.wustl.edu	37	9	7477699	7477699	+	IGR	SNP	A	A	T			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr9:7477699A>T								KDM4C (302051 upstream) : RP11-77E14.2 (308405 downstream)																							TAGATGATGCACGGGCCCCTG	0.473																																																0			9																																								7467699	SO:0001628	intergenic_variant	158345																															9.37:g.7477699A>T		Somatic		Capture	Illumina GAIIx	4	7467699		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.473					LOC158345			A			7467699	-1	pseudogene	XR_017130	genbank	human	model	54_36p	rna	SNP	1	T
FANCC	2176	genome.wustl.edu	37	9	98002989	98002989	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr9:98002989C>A	ENST00000289081.3	-	4	541	c.287G>T	c.(286-288)tGt>tTt	p.C96F	FANCC_ENST00000375305.1_Missense_Mutation_p.C96F	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	96					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.C96F(1)		kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				GTTAATTAGACAACATAAGCA	0.289			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	1	Substitution - Missense(1)	ovary(1)	9											76.0	79.0	78.0					9																	98002989		2201	4298	6499	97042810	SO:0001583	missense	2176	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.287G>T	9.37:g.98002989C>A	ENSP00000289081:p.Cys96Phe	Somatic		Capture	Illumina GAIIx	4	97042810	B1ALR8	Missense_Mutation	SNP	HMMPfam_Fanconi_C	p.C96F	ENST00000289081.3	37	c.287	CCDS35071.1	9	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639789	0.67244	.	.	ENSG00000158169	ENST00000289081;ENST00000375305;ENST00000433829	T;T;T	0.66280	-0.2;-0.2;-0.2	5.25	5.25	0.73442	.	0.051694	0.85682	D	0.000000	T	0.78136	0.4236	M	0.65498	2.005	0.54753	D	0.999983	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79843	-0.1632	10	0.87932	D	0	-11.5466	17.2177	0.86948	0.0:1.0:0.0:0.0	.	96;96	B1ALR7;Q00597	.;FANCC_HUMAN	F	96	ENSP00000289081:C96F;ENSP00000364454:C96F;ENSP00000406908:C96F	ENSP00000289081:C96F	C	-	2	0	FANCC	97042810	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.383000	0.44354	2.724000	0.93272	0.563000	0.77884	TGT	-	HMMPfam_Fanconi_C		0.289	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCC	protein_coding	OTTHUMT00000053219.1	C	NM_000136		97042810	-1	no_errors	NM_000136	genbank	human	reviewed	54_36p	missense	SNP	1	A
PTPN3	5774	genome.wustl.edu	37	9	112185023	112185023	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chr9:112185023G>A	ENST00000374541.2	-	13	1215	c.1111C>T	c.(1111-1113)Cgt>Tgt	p.R371C	PTPN3_ENST00000412145.1_Missense_Mutation_p.R240C|PTPN3_ENST00000262539.3_Intron|PTPN3_ENST00000446349.1_Intron	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	371					negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)	p.R371C(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						GGAGGGGAACGAGAAGGCAGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	9											179.0	162.0	168.0					9																	112185023		2203	4300	6503	111224844	SO:0001583	missense	5774				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.1111C>T	9.37:g.112185023G>A	ENSP00000363667:p.Arg371Cys	Somatic		Capture	Illumina GAIIx	4	111224844	A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	HMMPfam_Y_phosphatase;HMMPfam_Band_41;HMMPfam_PDZ;superfamily_PDZ domain-like;superfamily_Second domain of FERM;superfamily_PH domain-like;superfamily_(Phosphotyrosine protein) phosphatases II;superfamily_Ubiquitin-like	p.R371C	ENST00000374541.2	37	c.1111	CCDS6776.1	9	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491005	0.84962	.	.	ENSG00000070159	ENST00000394831;ENST00000412145;ENST00000374541	T;T	0.61859	0.07;0.07	5.77	4.87	0.63330	.	0.054357	0.64402	N	0.000001	T	0.71863	0.3390	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.67725	0.953	T	0.75150	-0.3419	10	0.66056	D	0.02	.	16.2034	0.82103	0.0:0.0:0.8659:0.1341	.	371	P26045	PTN3_HUMAN	C	371;240;371	ENSP00000416654:R240C;ENSP00000363667:R371C	ENSP00000363667:R371C	R	-	1	0	PTPN3	111224844	1.000000	0.71417	0.983000	0.44433	0.916000	0.54674	3.347000	0.52200	1.438000	0.47492	-0.188000	0.12872	CGT	-	NULL		0.418	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN3	protein_coding	OTTHUMT00000053598.4	G			111224844	-1	no_errors	NM_002829	genbank	human	reviewed	54_36p	missense	SNP	0.99	A
TCEAL8	90843	genome.wustl.edu	37	X	102508779	102508779	+	Silent	SNP	G	G	A			TCGA-13-1499-01A-01W-0549-09	TCGA-13-1499-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b4ce07b1-677e-4a9c-8f8e-2b7762487692	55f3ced3-2b89-4067-b0b6-7b282de945a2	g.chrX:102508779G>A	ENST00000372685.3	-	3	365	c.129C>T	c.(127-129)agC>agT	p.S43S	TCEAL8_ENST00000360000.4_Silent_p.S43S	NM_153333.2	NP_699164.1	Q8IYN2	TCAL8_HUMAN	transcription elongation factor A (SII)-like 8	43					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.S43S(1)		kidney(2)|lung(1)|ovary(1)	4						CTGCTTCCTGGCTTACGCCTT	0.522																																																1	Substitution - coding silent(1)	ovary(1)	X											156.0	136.0	143.0					X																	102508779		2203	4300	6503	102395435	SO:0001819	synonymous_variant	90843			AL833632	CCDS14504.1	Xq22.1	2014-03-21			ENSG00000180964	ENSG00000180964			28683	protein-coding gene	gene with protein product						16221301	Standard	NM_001006684		Approved	MGC45400, WEX3	uc004ejy.3	Q8IYN2	OTTHUMG00000022094	ENST00000372685.3:c.129C>T	X.37:g.102508779G>A		Somatic		Capture	Illumina GAIIx	4	102395435		Silent	SNP	-	p.S43	ENST00000372685.3	37	c.129	CCDS14504.1	X																																																																																			-	NULL		0.522	TCEAL8-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TCEAL8	protein_coding	OTTHUMT00000057698.1	G	NM_153333		102395435	-1	no_errors	NM_001006684	genbank	human	reviewed	54_36p	silent	SNP	0.83	A
