#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
HIST2H3PS2	440686	genome.wustl.edu	37	1	149400518	149400518	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:149400518G>A	ENST00000392948.2	-	1	24	c.25C>T	c.(25-27)Cgc>Tgc	p.R9C	RP5-998N21.10_ENST00000609879.1_RNA|HIST2H2BB_ENST00000609585.1_RNA|RP5-998N21.7_ENST00000444624.1_RNA					histone cluster 2, H3, pseudogene 2									p.R9C(1)		lung(1)|ovary(1)	2						GTCGACTTGCGGGCAGTCTGC	0.612																																																1	Substitution - Missense(1)	ovary(1)	1																																								147667142	SO:0001583	missense	440686			AL109948		1q21.1	2012-04-11	2006-10-11		ENSG00000203818	ENSG00000203818		"""Histones / Replication-dependent"""	32060	pseudogene	pseudogene			"""histone 2, H3, pseudogene 2"""				Standard	NG_012783		Approved	p06			OTTHUMG00000041033	ENST00000392948.2:c.25C>T	1.37:g.149400518G>A	ENSP00000476960:p.Arg9Cys	Somatic		Capture	Illumina GAIIx	4	147667142		Missense_Mutation	SNP	-	p.R9C	ENST00000392948.2	37	c.25		1	.	.	.	.	.	.	.	.	.	.	g	5.427	0.263853	0.10294	.	.	ENSG00000203818	ENST00000392948	.	.	.	2.3	2.3	0.28687	.	0.094665	0.38959	U	0.001504	T	0.55449	0.1921	.	.	.	0.40129	D	0.976691	.	.	.	.	.	.	T	0.60984	-0.7154	6	0.56958	D	0.05	.	10.7312	0.46098	0.0:0.0:1.0:0.0	.	.	.	.	C	9	.	ENSP00000376675:R9C	R	-	1	0	HIST2H3PS2	147667142	1.000000	0.71417	1.000000	0.80357	0.186000	0.23388	3.933000	0.56545	1.605000	0.50152	0.449000	0.29647	CGC	-	NULL		0.612	HIST2H3PS2-001	PUTATIVE	basic|appris_principal	protein_coding	HIST2H3PS2	protein_coding	OTTHUMT00000098436.3	G	NG_012783		147667142	-1	no_errors	ENST00000369176	ensembl	human	known	54_36p	missense	SNP	1	A
ZNF687	57592	genome.wustl.edu	37	1	151259272	151259272	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:151259272G>A	ENST00000368879.2	+	2	603	c.505G>A	c.(505-507)Gag>Aag	p.E169K		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	169	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E169K(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTTTGGCCCTGAGCCAGGGGA	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											48.0	52.0	51.0					1																	151259272		2203	4300	6503	149525896	SO:0001583	missense	57592				CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.505G>A	1.37:g.151259272G>A	ENSP00000357874:p.Glu169Lys	Somatic		Capture	Illumina GAIIx	4	149525896	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers;HMMPfam_zf-C2H2	p.E169K	ENST00000368879.2	37	c.505		1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.664028	0.29604	.	.	ENSG00000143373	ENST00000336715;ENST00000324048;ENST00000368879	T;T;T	0.00824	5.65;5.65;5.99	4.65	3.7	0.42460	.	0.000000	0.35739	N	0.003014	T	0.00815	0.0027	L	0.29908	0.895	0.31200	N	0.699868	D;D;D	0.67145	0.996;0.97;0.996	D;P;D	0.76071	0.987;0.676;0.987	T	0.55585	-0.8118	9	.	.	.	.	4.5566	0.12140	0.1804:0.1964:0.6232:0.0	.	169;169;169	Q8N1G0-2;Q8N1G0;F8WCX2	.;ZN687_HUMAN;.	K	169	ENSP00000336620:E169K;ENSP00000319829:E169K;ENSP00000357874:E169K	.	E	+	1	0	ZNF687	149525896	1.000000	0.71417	0.985000	0.45067	0.176000	0.22953	3.156000	0.50708	1.142000	0.42291	0.462000	0.41574	GAG	-	NULL		0.612	ZNF687-201	KNOWN	basic	protein_coding	ZNF687	protein_coding		G	NM_020832		149525896	1	no_errors	NM_020832	genbank	human	provisional	54_36p	missense	SNP	1	A
FLAD1	80308	genome.wustl.edu	37	1	154960800	154960800	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:154960800G>C	ENST00000292180.3	+	2	914	c.592G>C	c.(592-594)Gag>Cag	p.E198Q	FLAD1_ENST00000368428.1_5'Flank|FLAD1_ENST00000315144.10_Missense_Mutation_p.E101Q|FLAD1_ENST00000295530.2_5'UTR|FLAD1_ENST00000368433.1_Missense_Mutation_p.E198Q|FLAD1_ENST00000368432.1_Missense_Mutation_p.E101Q|FLAD1_ENST00000405236.2_Missense_Mutation_p.E99Q|FLAD1_ENST00000487371.1_3'UTR|FLAD1_ENST00000368431.3_Missense_Mutation_p.E99Q	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	198	Molybdenum cofactor biosynthesis protein- like.				FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)	p.E198Q(1)		endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CTTTGGAGATGAGCTGAAGCC	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											94.0	95.0	95.0					1																	154960800		2203	4300	6503	153227424	SO:0001583	missense	80308				CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.592G>C	1.37:g.154960800G>C	ENSP00000292180:p.Glu198Gln	Somatic		Capture	Illumina GAIIx	4	153227424	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	HMMPfam_MoCF_biosynth;superfamily_Molybdenum cofactor biosynthesis proteins;HMMPfam_PAPS_reduct;superfamily_Adenine nucleotide alpha hydrolases-like	p.E198Q	ENST00000292180.3	37	c.592	CCDS1078.1	1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213675	0.39102	.	.	ENSG00000160688	ENST00000368433;ENST00000315144;ENST00000368432;ENST00000368431;ENST00000292180;ENST00000405236	T;T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15;-1.15	5.71	2.4	0.29515	Molybdopterin binding (4);	0.341926	0.33691	N	0.004653	T	0.53626	0.1808	L	0.56340	1.77	0.39892	D	0.973787	B;B	0.18610	0.006;0.029	B;B	0.18871	0.023;0.017	T	0.54523	-0.8281	10	0.30854	T	0.27	-14.9615	6.5718	0.22543	0.148:0.5878:0.2642:0.0	.	198;99	Q8NFF5;Q8NFF5-4	FAD1_HUMAN;.	Q	198;101;101;99;198;99	ENSP00000357418:E198Q;ENSP00000317296:E101Q;ENSP00000357417:E101Q;ENSP00000357416:E99Q;ENSP00000292180:E198Q;ENSP00000384323:E99Q	ENSP00000292180:E198Q	E	+	1	0	FLAD1	153227424	0.807000	0.29009	1.000000	0.80357	0.995000	0.86356	0.990000	0.29642	1.397000	0.46682	0.563000	0.77884	GAG	-	HMMPfam_MoCF_biosynth		0.577	FLAD1-001	NOVEL	basic|CCDS	protein_coding	FLAD1	protein_coding	OTTHUMT00000091089.1	G	NM_025207		153227424	1	no_errors	NM_025207	genbank	human	reviewed	54_36p	missense	SNP	0.31	C
FCRL3	115352	genome.wustl.edu	37	1	157667154	157667154	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:157667154A>T	ENST00000368184.3	-	6	911	c.620T>A	c.(619-621)aTg>aAg	p.M207K	FCRL3_ENST00000473231.1_5'UTR|RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000368186.5_Missense_Mutation_p.M207K	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	207	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.M207K(1)		autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					GGTCAGGGTCATGGGACTCCC	0.552																																																1	Substitution - Missense(1)	ovary(1)	1											68.0	73.0	71.0					1																	157667154		2203	4300	6503	155933778	SO:0001583	missense	115352			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.620T>A	1.37:g.157667154A>T	ENSP00000357167:p.Met207Lys	Somatic		Capture	Illumina GAIIx	4	155933778	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	-	p.M207K	ENST00000368184.3	37	c.620	CCDS1167.1	1	.	.	.	.	.	.	.	.	.	.	A	18.64	3.668207	0.67814	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.11169	2.8;2.8	5.54	4.4	0.53042	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.778438	0.10426	U	0.676119	T	0.16085	0.0387	M	0.74546	2.27	0.26911	N	0.96689	P;P	0.46987	0.888;0.864	P;P	0.57283	0.817;0.721	T	0.12268	-1.0554	10	0.87932	D	0	.	10.8897	0.46988	0.8418:0.1582:0.0:0.0	.	207;207	Q96P31;Q96P31-6	FCRL3_HUMAN;.	K	207	ENSP00000357169:M207K;ENSP00000357167:M207K	ENSP00000292392:M207K	M	-	2	0	FCRL3	155933778	0.923000	0.31300	0.731000	0.30826	0.721000	0.41392	4.883000	0.63128	0.908000	0.36671	0.402000	0.26972	ATG	-	NULL		0.552	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	protein_coding	OTTHUMT00000051419.2	A	NM_052939		155933778	-1	no_errors	NM_052939	genbank	human	reviewed	54_36p	missense	SNP	0.91	T
SZRD1	26099	genome.wustl.edu	37	1	16719768	16719769	+	Frame_Shift_Ins	INS	-	-	ATTGT			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:16719768_16719769insATTGT	ENST00000401088.4	+	3	322_323	c.147_148insATTGT	c.(148-150)gatfs	p.D50fs	SZRD1_ENST00000492354.1_Frame_Shift_Ins_p.D30fs|SZRD1_ENST00000375590.3_Frame_Shift_Ins_p.D30fs|SZRD1_ENST00000401089.3_Frame_Shift_Ins_p.D31fs|SZRD1_ENST00000471507.1_Frame_Shift_Ins_p.D49fs|SZRD1_ENST00000472461.1_3'UTR|SPATA21_ENST00000466212.1_5'Flank	NM_001114600.1|NM_001271869.1	NP_001108072.1|NP_001258798.1	Q7Z422	SZRD1_HUMAN	SUZ RNA binding domain containing 1	50	SUZ. {ECO:0000255|PROSITE- ProRule:PRU01009}.							p.D31fs*41(1)									TGATTCAGGACGATAGCCTTCC	0.579																																																1	Insertion - Frameshift(1)	ovary(1)	1																																								16592356	SO:0001589	frameshift_variant	26099			BC010631	CCDS44065.1, CCDS60000.1	1p36.13	2012-07-23	2012-07-23	2012-07-23	ENSG00000055070	ENSG00000055070			30232	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 144"""	C1orf144		12761501	Standard	NM_001114600		Approved	DKFZp566C0424	uc001aym.5	Q7Z422	OTTHUMG00000002217	Exception_encountered	1.37:g.16719768_16719769insATTGT	ENSP00000383866:p.Asp50fs	Somatic		Capture	Illumina GAIIx	4	16592355	A8MXJ2|C9K0U0|Q7Z424|Q8IVM2|Q8TBV3|Q9Y403	Frame_Shift_Ins	INS	-	p.D30fs	ENST00000401088.4	37	c.90_91	CCDS44065.1	1																																																																																			-	NULL		0.579	SZRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C1orf144	protein_coding	OTTHUMT00000006283.2	-	NM_015609		16592356	1	no_errors	NM_015609	genbank	human	provisional	54_36p	frame_shift_ins	INS	1.000:1.000	ATTGT
PIGM	93183	genome.wustl.edu	37	1	160000753	160000753	+	Silent	SNP	A	A	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:160000753A>G	ENST00000368090.2	-	1	1030	c.777T>C	c.(775-777)ttT>ttC	p.F259F		NM_145167.2	NP_660150.1	Q9H3S5	PIGM_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class M	259					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)	p.F259F(1)		kidney(1)|large_intestine(4)|lung(9)|ovary(2)|skin(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCAGGTGATAAAAGTAGGTGT	0.453																																																1	Substitution - coding silent(1)	ovary(1)	1											133.0	133.0	133.0					1																	160000753		2203	4300	6503	158267377	SO:0001819	synonymous_variant	93183			AB028127	CCDS1192.1	1q23.2	2013-02-26	2006-06-28		ENSG00000143315	ENSG00000143315		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	18858	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 1"", ""DPM:GlcN-(acyl-)PI mannosyltransferase"", ""dol-P-Man dependent GPI mannosyltransferase"""	610273	"""phosphatidylinositol glycan, class M"""			11226175	Standard	NM_145167		Approved	GPI-MT-I	uc001fuv.1	Q9H3S5	OTTHUMG00000024081	ENST00000368090.2:c.777T>C	1.37:g.160000753A>G		Somatic		Capture	Illumina GAIIx	4	158267377		Silent	SNP	HMMPfam_Mannosyl_trans	p.F259	ENST00000368090.2	37	c.777	CCDS1192.1	1																																																																																			-	HMMPfam_Mannosyl_trans		0.453	PIGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGM	protein_coding	OTTHUMT00000060643.2	A	NM_145167		158267377	-1	no_errors	NM_145167	genbank	human	reviewed	54_36p	silent	SNP	0.99	G
LAMC1	3915	genome.wustl.edu	37	1	183079748	183079748	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:183079748C>G	ENST00000258341.4	+	4	1237	c.980C>G	c.(979-981)cCg>cGg	p.P327R		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	327	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.P327R(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						AATGACCGGCCGTGGAGGAGG	0.473																																																1	Substitution - Missense(1)	ovary(1)	1											183.0	180.0	181.0					1																	183079748		2203	4300	6503	181346371	SO:0001583	missense	3915			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.980C>G	1.37:g.183079748C>G	ENSP00000258341:p.Pro327Arg	Somatic		Capture	Illumina GAIIx	4	181346371	Q5VYE7	Missense_Mutation	SNP	HMMPfam_Laminin_B;HMMPfam_Laminin_EGF;HMMPfam_Laminin_N;superfamily_Growth factor receptor domain;superfamily_EGF/Laminin	p.P327R	ENST00000258341.4	37	c.980	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617569	0.87359	.	.	ENSG00000135862	ENST00000258341	T	0.62232	0.04	4.72	4.72	0.59763	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	T	0.81640	0.4865	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85411	0.1137	10	0.72032	D	0.01	.	17.6574	0.88181	0.0:1.0:0.0:0.0	.	327	P11047	LAMC1_HUMAN	R	327	ENSP00000258341:P327R	ENSP00000258341:P327R	P	+	2	0	LAMC1	181346371	1.000000	0.71417	0.971000	0.41717	0.867000	0.49689	7.529000	0.81952	2.161000	0.67846	0.305000	0.20034	CCG	-	HMMPfam_Laminin_EGF		0.473	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	protein_coding	OTTHUMT00000085954.2	C	NM_002293		181346371	1	no_errors	NM_002293	genbank	human	reviewed	54_36p	missense	SNP	1	G
NCF2	4688	genome.wustl.edu	37	1	183543622	183543622	+	Splice_Site	SNP	C	C	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:183543622C>G	ENST00000367535.3	-	4	752	c.501G>C	c.(499-501)tgG>tgC	p.W167C	NCF2_ENST00000367536.1_Splice_Site_p.W167C|NCF2_ENST00000413720.1_Intron|NCF2_ENST00000418089.1_Intron	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	167					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)	p.W167C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	ATACGCTTACCCAGACACACT	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											347.0	318.0	327.0					1																	183543622		2203	4300	6503	181810245	SO:0001630	splice_region_variant	4688			BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.501+1G>C	1.37:g.183543622C>G		Somatic		Capture	Illumina GAIIx	4	181810245	B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense_Mutation	SNP	HMMPfam_PB1;HMMPfam_TPR_1;HMMPfam_SH3_1;superfamily_SH3-domain;superfamily_TPR-like;superfamily_CAD  PB1 domains	p.W167C	ENST00000367535.3	37	c.501	CCDS1356.1	1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.467939	0.63625	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000367535	T;T	0.65364	-0.15;-0.15	5.32	5.32	0.75619	Tetratricopeptide-like helical (1);	0.060187	0.64402	D	0.000002	T	0.69151	0.3079	L	0.51422	1.61	0.80722	D	1	D	0.76494	0.999	P	0.61003	0.882	T	0.67499	-0.5655	9	.	.	.	0.018	11.7759	0.51985	0.0:0.9194:0.0:0.0806	.	167	P19878	NCF2_HUMAN	C	167;195;167	ENSP00000356506:W167C;ENSP00000356505:W167C	.	W	-	3	0	NCF2	181810245	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.670000	0.46833	2.647000	0.89833	0.655000	0.94253	TGG	-	NULL		0.463	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF2	protein_coding	OTTHUMT00000085483.1	C	NM_000433	Missense_Mutation	181810245	-1	no_errors	NM_000433	genbank	human	reviewed	54_36p	missense	SNP	1	G
LMOD1	25802	genome.wustl.edu	37	1	201869210	201869210	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:201869210C>T	ENST00000367288.4	-	2	1177	c.931G>A	c.(931-933)Gag>Aag	p.E311K	RP11-307B6.3_ENST00000414927.1_RNA|RP11-307B6.3_ENST00000458139.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	311					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)		p.E311K(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GCTGCCTCCTCCTCCACCTTG	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											66.0	66.0	66.0					1																	201869210		2046	4193	6239	200135833	SO:0001583	missense	25802			X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.931G>A	1.37:g.201869210C>T	ENSP00000356257:p.Glu311Lys	Somatic		Capture	Illumina GAIIx	4	200135833	B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	-	p.E311K	ENST00000367288.4	37	c.931	CCDS53457.1	1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.672553	0.67928	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	D	0.91686	-2.89	5.19	5.19	0.71726	.	0.000000	0.40385	N	0.001120	D	0.94235	0.8149	M	0.70903	2.155	0.42318	D	0.992249	D;D	0.62365	0.988;0.991	P;P	0.57204	0.76;0.815	D	0.94643	0.7832	10	0.62326	D	0.03	-35.2165	14.2045	0.65725	0.0:1.0:0.0:0.0	.	260;311	B4E3S9;P29536	.;LMOD1_HUMAN	K	311;311;260	ENSP00000356257:E311K	ENSP00000356257:E311K	E	-	1	0	LMOD1	200135833	1.000000	0.71417	1.000000	0.80357	0.217000	0.24651	5.824000	0.69279	2.427000	0.82271	0.505000	0.49811	GAG	-	NULL		0.542	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	LMOD1	protein_coding	OTTHUMT00000087085.2	C			200135833	-1	no_errors	ENST00000367288	ensembl	human	known	54_36p	missense	SNP	1	T
ARL8A	127829	genome.wustl.edu	37	1	202104865	202104865	+	Silent	SNP	T	T	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:202104865T>C	ENST00000272217.2	-	4	510	c.342A>G	c.(340-342)ctA>ctG	p.L114L	ARL8A_ENST00000486225.1_5'UTR	NM_001256129.1|NM_138795.3	NP_001243058.1|NP_620150.1	Q96BM9	ARL8A_HUMAN	ADP-ribosylation factor-like 8A	114					chromosome segregation (GO:0007059)|GTP catabolic process (GO:0006184)|mitotic nuclear division (GO:0007067)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|midbody (GO:0030496)|spindle midzone (GO:0051233)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L114L(1)		large_intestine(1)|lung(2)|ovary(2)|skin(1)	6						GTTTGTCCAGTAGGTTGTGGA	0.592											OREG0012976	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	1											115.0	99.0	105.0					1																	202104865		2203	4300	6503	200371488	SO:0001819	synonymous_variant	127829			BC015408	CCDS1421.1, CCDS73004.1	1q32.1	2014-05-09	2005-11-03	2005-11-03	ENSG00000143862	ENSG00000143862		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25192	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10B"""	ARL10B		8889548	Standard	NM_001256129		Approved	FLJ45195, Gie2	uc001gxk.2	Q96BM9	OTTHUMG00000035923	ENST00000272217.2:c.342A>G	1.37:g.202104865T>C		Somatic	2126	Capture	Illumina GAIIx	4	200371488	B3KXD0	Silent	SNP	HMMPfam_Arf;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.L114	ENST00000272217.2	37	c.342	CCDS1421.1	1																																																																																			-	HMMPfam_Arf		0.592	ARL8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL8A	protein_coding	OTTHUMT00000087493.1	T	NM_138795		200371488	-1	no_errors	NM_138795	genbank	human	validated	54_36p	silent	SNP	0.86	C
CENPF	1063	genome.wustl.edu	37	1	214815579	214815579	+	Silent	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:214815579C>T	ENST00000366955.3	+	12	4066	c.3898C>T	c.(3898-3900)Ctg>Ttg	p.L1300L		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.L1300L(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AATGAACAAGCTGAATGAGCT	0.403																																					Colon(80;575 1284 11000 14801 43496)											1	Substitution - coding silent(1)	ovary(1)	1											71.0	70.0	70.0					1																	214815579		2203	4300	6503	212882202	SO:0001819	synonymous_variant	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3898C>T	1.37:g.214815579C>T		Somatic		Capture	Illumina GAIIx	4	212882202	Q13171|Q13246|Q5VVM7	Silent	SNP	Spectrin repeat;superfamily_Spectrin repeat;BAG domain;superfamily_BAG domain	p.L1300	ENST00000366955.3	37	c.3898	CCDS31023.1	1																																																																																			-	NULL		0.403	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	protein_coding	OTTHUMT00000089749.1	C	NM_016343		212882202	1	no_errors	NM_016343	genbank	human	reviewed	54_36p	silent	SNP	0.01	T
BRDT	676	genome.wustl.edu	37	1	92441891	92441891	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:92441891T>G	ENST00000362005.3	+	6	932	c.514T>G	c.(514-516)Ttt>Gtt	p.F172V	BRDT_ENST00000394530.3_Missense_Mutation_p.F126V|BRDT_ENST00000370389.2_Missense_Mutation_p.F99V|BRDT_ENST00000402388.1_Missense_Mutation_p.F172V|BRDT_ENST00000399546.2_Missense_Mutation_p.F172V	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	172					cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)	p.F172V(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		AGAAAAAGTATTTAAGCAGCA	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											81.0	81.0	81.0					1																	92441891		2203	4300	6503	92214479	SO:0001583	missense	676			AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.514T>G	1.37:g.92441891T>G	ENSP00000354568:p.Phe172Val	Somatic		Capture	Illumina GAIIx	4	92214479	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Missense_Mutation	SNP	HMMPfam_Bromodomain;superfamily_Bromodomain	p.F172V	ENST00000362005.3	37	c.514	CCDS735.1	1	.	.	.	.	.	.	.	.	.	.	T	2.052	-0.417503	0.04766	.	.	ENSG00000137948	ENST00000362005;ENST00000370389;ENST00000399546;ENST00000539070;ENST00000423434;ENST00000394530;ENST00000440509;ENST00000426141;ENST00000402388	T;T;T;T;T;T;T;T	0.17854	3.41;3.41;3.41;2.25;3.47;2.27;3.08;3.41	4.97	-6.57	0.01842	.	1.076080	0.07168	N	0.851913	T	0.01765	0.0056	L	0.27053	0.805	0.09310	N	1	B;B;B;B	0.15473	0.005;0.013;0.002;0.005	B;B;B;B	0.11329	0.006;0.005;0.003;0.006	T	0.39643	-0.9604	10	0.06625	T	0.88	-0.9143	2.6067	0.04880	0.1229:0.3547:0.3169:0.2055	.	126;126;176;172	B7ZAX7;B7Z811;B7Z890;Q58F21	.;.;.;BRDT_HUMAN	V	172;99;172;172;172;126;172;172;172	ENSP00000354568:F172V;ENSP00000359416:F99V;ENSP00000387822:F172V;ENSP00000396351:F172V;ENSP00000378038:F126V;ENSP00000416714:F172V;ENSP00000404969:F172V;ENSP00000384051:F172V	ENSP00000354568:F172V	F	+	1	0	BRDT	92214479	0.027000	0.19231	0.000000	0.03702	0.167000	0.22549	-0.231000	0.09069	-0.861000	0.04094	0.454000	0.30748	TTT	-	NULL		0.403	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRDT	protein_coding	OTTHUMT00000027980.2	T	NM_207189		92214479	1	no_errors	NM_001726	genbank	human	validated	54_36p	missense	SNP		G
KIF26B	55083	genome.wustl.edu	37	1	245862232	245862232	+	Missense_Mutation	SNP	G	G	A	rs199933797		TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr1:245862232G>A	ENST00000407071.2	+	14	6511	c.6071G>A	c.(6070-6072)cGc>cAc	p.R2024H	KIF26B_ENST00000366518.4_Missense_Mutation_p.R1643H	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2024					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.R2024H(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CTGGAACACCGCCAGCAGAGG	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		19181	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1											73.0	78.0	76.0					1																	245862232		2085	4213	6298	243928855	SO:0001583	missense	55083			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.6071G>A	1.37:g.245862232G>A	ENSP00000385545:p.Arg2024His	Somatic		Capture	Illumina GAIIx	4	243928855	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	-	p.R2024H	ENST00000407071.2	37	c.6071	CCDS44342.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	21.7	4.184039	0.78677	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.87103	-2.21;-2.2	5.82	5.82	0.92795	.	.	.	.	.	D	0.93462	0.7914	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93435	0.6789	9	0.87932	D	0	.	20.099	0.97865	0.0:0.0:1.0:0.0	.	2024	Q2KJY2	KI26B_HUMAN	H	2024;1643;1640	ENSP00000385545:R2024H;ENSP00000355475:R1643H	ENSP00000355475:R1643H	R	+	2	0	KIF26B	243928855	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	8.033000	0.88852	2.752000	0.94435	0.655000	0.94253	CGC	-	NULL		0.572	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	protein_coding	OTTHUMT00000381037.1	G	XM_371354		243928855	1	no_errors	NM_018012	genbank	human	provisional	54_36p	missense	SNP	1	A
CUBN	8029	genome.wustl.edu	37	10	17085895	17085895	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr10:17085895T>A	ENST00000377833.4	-	26	3825	c.3760A>T	c.(3760-3762)Agc>Tgc	p.S1254C		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1254	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.S1254C(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATAAACATGCTGTCTCCACTA	0.448																																																1	Substitution - Missense(1)	ovary(1)	10											165.0	141.0	149.0					10																	17085895		2203	4300	6503	17125901	SO:0001583	missense	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.3760A>T	10.37:g.17085895T>A	ENSP00000367064:p.Ser1254Cys	Somatic		Capture	Illumina GAIIx	4	17125901	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	HMMPfam_CUB;superfamily_Spermadhesin CUB domain;HMMPfam_EGF;HMMPfam_EGF_CA;superfamily_EGF/Laminin	p.S1254C	ENST00000377833.4	37	c.3760	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	T	19.21	3.783873	0.70222	.	.	ENSG00000107611	ENST00000377833	T	0.19532	2.14	5.5	4.33	0.51752	CUB (5);	0.415908	0.20343	N	0.094186	T	0.48132	0.1483	M	0.86097	2.795	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	T	0.49753	-0.8906	10	0.59425	D	0.04	.	11.3067	0.49340	0.0:0.0731:0.0:0.9269	.	1254	O60494	CUBN_HUMAN	C	1254	ENSP00000367064:S1254C	ENSP00000367064:S1254C	S	-	1	0	CUBN	17125901	0.838000	0.29461	0.945000	0.38365	0.914000	0.54420	2.498000	0.45363	0.890000	0.36211	0.397000	0.26171	AGC	-	HMMPfam_CUB		0.448	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	protein_coding	OTTHUMT00000047009.1	T	NM_001081		17125901	-1	no_errors	NM_001081	genbank	human	reviewed	54_36p	missense	SNP	0.94	A
ARHGAP21	57584	genome.wustl.edu	37	10	24886885	24886885	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr10:24886885G>C	ENST00000396432.2	-	15	3672	c.3186C>G	c.(3184-3186)aaC>aaG	p.N1062K	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.N849K|ARHGAP21_ENST00000493154.1_5'UTR	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1061	Interaction with ARF1 and ARF6.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.N1061K(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TCATCAGATTGTTGTATTCTT	0.358																																																1	Substitution - Missense(1)	ovary(1)	10											185.0	177.0	180.0					10																	24886885		2203	4300	6503	24926891	SO:0001583	missense	57584			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.3186C>G	10.37:g.24886885G>C	ENSP00000379709:p.Asn1062Lys	Somatic		Capture	Illumina GAIIx	4	24926891	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	HMMPfam_RhoGAP;HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_PH;superfamily_GTPase activation domain GAP;superfamily_PH domain-like	p.N1061K	ENST00000396432.2	37	c.3183	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	G	12.39	1.922936	0.33908	.	.	ENSG00000107863	ENST00000396432;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.43294	2.89;3.02;0.97;0.95	5.87	2.73	0.32206	.	0.139992	0.64402	D	0.000002	T	0.26593	0.0650	L	0.38175	1.15	0.43953	D	0.996624	B;B	0.26744	0.046;0.158	B;B	0.16722	0.01;0.016	T	0.04855	-1.0922	10	0.17369	T	0.5	.	7.8419	0.29403	0.431:0.0:0.569:0.0	.	1052;1061	F8W9U9;Q5T5U3	.;RHG21_HUMAN	K	1062;849;1052;1062;897	ENSP00000379709:N1062K;ENSP00000365604:N849K;ENSP00000365592:N1052K;ENSP00000405018:N1062K	ENSP00000365604:N849K	N	-	3	2	ARHGAP21	24926891	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.580000	0.36547	0.813000	0.34350	0.655000	0.94253	AAC	-	NULL		0.358	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	protein_coding	OTTHUMT00000047229.4	G	NM_020824		24926891	-1	no_errors	NM_020824	genbank	human	validated	54_36p	missense	SNP	1	C
GPR158	57512	genome.wustl.edu	37	10	25887606	25887606	+	Silent	SNP	T	T	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr10:25887606T>C	ENST00000376351.3	+	11	3410	c.3051T>C	c.(3049-3051)ggT>ggC	p.G1017G	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	1017					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G1017G(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TGACCCCTGGTCCTGTGCCTT	0.473																																																1	Substitution - coding silent(1)	ovary(1)	10											58.0	58.0	58.0					10																	25887606		2203	4300	6503	25927612	SO:0001819	synonymous_variant	57512			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.3051T>C	10.37:g.25887606T>C		Somatic		Capture	Illumina GAIIx	4	25927612	Q6QR81|Q9ULT3	Silent	SNP	HMMPfam_7tm_3;superfamily_EGF/Laminin	p.G1017	ENST00000376351.3	37	c.3051	CCDS31166.1	10																																																																																			-	NULL		0.473	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	protein_coding	OTTHUMT00000047248.2	T	XM_166110		25927612	1	no_errors	NM_020752	genbank	human	validated	54_36p	silent	SNP	0.9	C
COL13A1	1305	genome.wustl.edu	37	10	71678073	71678073	+	Splice_Site	SNP	G	G	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr10:71678073G>A	ENST00000398978.3	+	19	1521	c.1029G>A	c.(1027-1029)aaG>aaA	p.K343K	COL13A1_ENST00000398969.3_Splice_Site_p.K286K|COL13A1_ENST00000398974.3_Splice_Site_p.K331K|COL13A1_ENST00000522165.1_Splice_Site_p.K324K|COL13A1_ENST00000398973.3_Splice_Site_p.K343K|COL13A1_ENST00000356340.3_Splice_Site_p.K343K|COL13A1_ENST00000520267.1_Splice_Site_p.K286K|COL13A1_ENST00000398968.3_Splice_Site_p.K324K|COL13A1_ENST00000398972.3_Splice_Site_p.K343K|COL13A1_ENST00000398971.3_Splice_Site_p.K343K|COL13A1_ENST00000517713.1_Splice_Site_p.K321K|COL13A1_ENST00000520133.1_Splice_Site_p.K292K|COL13A1_ENST00000357811.3_Splice_Site_p.K321K|COL13A1_ENST00000398964.3_Splice_Site_p.K314K|COL13A1_ENST00000354547.3_Splice_Site_p.K321K|COL13A1_ENST00000398966.3_Splice_Site_p.K321K	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1									p.K326K(1)		endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						CTGGGATGAAGGTCAGTGGAC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	10											51.0	55.0	54.0					10																	71678073		1900	4129	6029	71348079	SO:0001630	splice_region_variant	1305			AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.1029+1G>A	10.37:g.71678073G>A		Somatic		Capture	Illumina GAIIx	4	71348079		Silent	SNP	HMMPfam_Collagen	p.K343	ENST00000398978.3	37	c.1029	CCDS44419.1	10																																																																																			-	HMMPfam_Collagen		0.597	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL13A1	protein_coding	OTTHUMT00000048468.1	G	NM_005203	Silent	71348079	1	no_errors	NM_005203	genbank	human	reviewed	54_36p	silent	SNP	1	A
SNHG24	101929369	genome.wustl.edu	37	14	101434515	101434515	+	lincRNA	SNP	A	A	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr14:101434515A>T	ENST00000554693.2	+	0	135				SNORD114-10_ENST00000363409.1_RNA|SNORD114-13_ENST00000364377.1_RNA|SNORD114-11_ENST00000363738.1_RNA|SNORD114-9_ENST00000364370.1_RNA|AL132709.8_ENST00000423708.3_lincRNA|SNORD114-12_ENST00000365400.1_RNA																							TGGAACTCTGAGGTCCAATAC	0.428																																																0			14											35.0	31.0	32.0					14																	101434515		876	1991	2867	100504268			767589																															14.37:g.101434515A>T		Somatic		Capture	Illumina GAIIx	4	100504268		RNA	SNP	-	NULL	ENST00000554693.2	37	NULL		14																																																																																			-	-		0.428	RP11-909M7.3-001	KNOWN	basic	lincRNA	SNORD114-11	lincRNA	OTTHUMT00000468646.1	A			100504268	1	no_errors	NR_003204	genbank	human	provisional	54_36p	rna	SNP	0.02	T
OR51A4	401666	genome.wustl.edu	37	11	4967789	4967789	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr11:4967789C>T	ENST00000380373.2	-	1	567	c.542G>A	c.(541-543)tGt>tAt	p.C181Y	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C181Y(1)		large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTGGTGGAGACAGTAGGAATG	0.398																																																1	Substitution - Missense(1)	ovary(1)	11											103.0	99.0	101.0					11																	4967789		2195	4284	6479	4924365	SO:0001583	missense	401666			AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.542G>A	11.37:g.4967789C>T	ENSP00000369731:p.Cys181Tyr	Somatic		Capture	Illumina GAIIx	4	4924365		Missense_Mutation	SNP	-	p.C181Y	ENST00000380373.2	37	c.542	CCDS31367.1	11	.	.	.	.	.	.	.	.	.	.	C	10.79	1.448673	0.26074	.	.	ENSG00000205497	ENST00000380373	T	0.61980	0.06	3.44	2.53	0.30540	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.82756	0.5106	H	0.94183	3.505	0.30815	N	0.738452	D	0.89917	1.0	D	0.97110	1.0	T	0.81223	-0.1030	9	0.72032	D	0.01	.	10.5611	0.45146	0.0:0.8996:0.0:0.1004	.	181	Q8NGJ6	O51A4_HUMAN	Y	181	ENSP00000369731:C181Y	ENSP00000369731:C181Y	C	-	2	0	OR51A4	4924365	1.000000	0.71417	0.054000	0.19295	0.125000	0.20455	5.319000	0.65835	0.760000	0.33108	-0.706000	0.03657	TGT	-	NULL		0.398	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A4	protein_coding	OTTHUMT00000142821.1	C	NM_001005329		4924365	-1	no_errors	NM_001005329	genbank	human	provisional	54_36p	missense	SNP	0.99	T
TRIM53CP	340970	genome.wustl.edu	37	11	49009074	49009074	+	IGR	SNP	G	G	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr11:49009074G>T								OR4A47 (497742 upstream) : TRIM49B (41429 downstream)																							AGATTCAGAGGCTGGGGCATG	0.463																																																0			11																																								48965650	SO:0001628	intergenic_variant	340970																															11.37:g.49009074G>T		Somatic		Capture	Illumina GAIIx	4	48965650		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.463					LOC340970			G			48965650	-1	pseudogene	XR_042351	genbank	human	model	54_36p	rna	SNP		T
FAT3	120114	genome.wustl.edu	37	11	92532882	92532882	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr11:92532882T>G	ENST00000298047.6	+	9	6720	c.6703T>G	c.(6703-6705)Ttt>Gtt	p.F2235V	FAT3_ENST00000409404.2_Missense_Mutation_p.F2235V|FAT3_ENST00000525166.1_Missense_Mutation_p.F2085V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2235	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F2235V(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TAACATTGACTTTGACACTGG	0.448										TCGA Ovarian(4;0.039)																																						1	Substitution - Missense(1)	ovary(1)	11											56.0	52.0	53.0					11																	92532882		1889	4127	6016	92172530	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6703T>G	11.37:g.92532882T>G	ENSP00000298047:p.Phe2235Val	Somatic		Capture	Illumina GAIIx	4	92172530	B5MDB0|Q96AU6	Missense_Mutation	SNP	-	p.F2235V	ENST00000298047.6	37	c.6703		11	.	.	.	.	.	.	.	.	.	.	T	18.45	3.626866	0.66901	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.50277	0.75;0.75;0.75	5.94	5.94	0.96194	.	.	.	.	.	T	0.64583	0.2611	L	0.49455	1.56	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65825	-0.6074	9	0.62326	D	0.03	.	16.4075	0.83691	0.0:0.0:0.0:1.0	.	2235	Q8TDW7-3	.	V	2235;2235;2085	ENSP00000298047:F2235V;ENSP00000387040:F2235V;ENSP00000432586:F2085V	ENSP00000298047:F2235V	F	+	1	0	FAT3	92172530	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.975000	0.88055	2.275000	0.75901	0.528000	0.53228	TTT	-	NULL		0.448	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		T	NM_001008781		92172530	1	no_errors	NM_001008781	genbank	human	validated	54_36p	missense	SNP	1	G
CACNA1C	775	genome.wustl.edu	37	12	2788812	2788812	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr12:2788812C>A	ENST00000347598.4	+	44	5438	c.5438C>A	c.(5437-5439)gCc>gAc	p.A1813D	CACNA1C_ENST00000406454.3_Missense_Mutation_p.A1765D|CACNA1C_ENST00000399637.1_Missense_Mutation_p.A1784D|CACNA1C_ENST00000344100.3_Missense_Mutation_p.A1806D|CACNA1C_ENST00000399655.1_Missense_Mutation_p.A1765D|CACNA1C_ENST00000399606.1_Missense_Mutation_p.A1785D|CACNA1C_ENST00000327702.7_Missense_Mutation_p.A1765D|CACNA1C_ENST00000399634.1_Missense_Mutation_p.A1765D|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000335762.5_Missense_Mutation_p.A1790D|CACNA1C_ENST00000399621.1_Missense_Mutation_p.A1784D|CACNA1C_ENST00000399617.1_Missense_Mutation_p.A1765D|CACNA1C_ENST00000399644.1_Missense_Mutation_p.A1765D|CACNA1C_ENST00000399638.1_Missense_Mutation_p.A1793D|CACNA1C_ENST00000399597.1_Missense_Mutation_p.A1765D|CACNA1C_ENST00000399603.1_Missense_Mutation_p.A1765D|CACNA1C_ENST00000399601.1_Missense_Mutation_p.A1765D|CACNA1C_ENST00000402845.3_Missense_Mutation_p.A1784D|CACNA1C_ENST00000399649.1_Missense_Mutation_p.A1771D|CACNA1C_ENST00000399595.1_Missense_Mutation_p.A1773D|CACNA1C_ENST00000399629.1_Missense_Mutation_p.A1782D|CACNA1C_ENST00000399591.1_Missense_Mutation_p.A1773D|CACNA1C_ENST00000399641.1_Missense_Mutation_p.A1765D	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1813					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.A1843D(1)|p.A1300D(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCTCCAACGCCAACATCAAC	0.682																																																2	Substitution - Missense(2)	ovary(2)	12											86.0	100.0	95.0					12																	2788812		2167	4254	6421	2659073	SO:0001583	missense	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5438C>A	12.37:g.2788812C>A	ENSP00000266376:p.Ala1813Asp	Somatic		Capture	Illumina GAIIx	4	2659073	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	HMMPfam_Ion_trans;HMMPfam_Ca_chan_IQ;superfamily_EF-hand;superfamily_Voltage-gated potassium channels	p.A1765D	ENST00000347598.4	37	c.5294	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	C	18.44	3.625536	0.66901	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97186	-4.11;-4.11;-4.11;-4.09;-4.11;-4.11;-4.0;-4.04;-4.11;-4.02;-4.04;-4.11;-4.14;-4.04;-4.01;-4.15;-4.11;-4.11;-4.27;-4.11;-4.28;-4.15	4.39	4.39	0.52855	.	1.849990	0.02594	N	0.100245	D	0.98645	0.9546	M	0.76328	2.33	0.80722	D	1	D;D;D;P;D;D;D;D;P;P;D;D;D;D;D;D;D;B;D;D;D;D;D;D;D	0.89917	0.992;1.0;0.999;0.655;1.0;1.0;0.999;1.0;0.877;0.935;1.0;0.999;1.0;0.999;0.999;0.999;1.0;0.12;1.0;0.982;0.999;1.0;1.0;1.0;0.999	P;D;D;B;D;D;D;D;P;P;D;D;D;D;D;D;D;B;D;P;D;D;D;D;D	0.91635	0.791;0.998;0.992;0.231;0.998;0.999;0.991;0.999;0.467;0.604;0.999;0.996;0.996;0.999;0.996;0.998;0.996;0.064;0.999;0.881;0.996;0.999;0.999;0.999;0.992	D	0.93150	0.6549	10	0.46703	T	0.11	.	17.145	0.86764	0.0:1.0:0.0:0.0	.	456;1806;1762;1813;1765;1784;1765;1782;1793;1765;1785;1765;1725;1813;1765;1765;1765;1773;1771;1773;1754;1784;1784;1765;1765	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	D	1790;1765;1765;1793;1765;1784;1784;1773;1765;1813;1785;1765;1806;1782;1765;1771;1784;1765;1765;1765;1765;1773;1595	ENSP00000336982:A1790D;ENSP00000382563:A1765D;ENSP00000382552:A1765D;ENSP00000382547:A1793D;ENSP00000382506:A1765D;ENSP00000382530:A1784D;ENSP00000382546:A1784D;ENSP00000382500:A1773D;ENSP00000382549:A1765D;ENSP00000266376:A1813D;ENSP00000382515:A1785D;ENSP00000382510:A1765D;ENSP00000341092:A1806D;ENSP00000382537:A1782D;ENSP00000329877:A1765D;ENSP00000382557:A1771D;ENSP00000385724:A1784D;ENSP00000382512:A1765D;ENSP00000382542:A1765D;ENSP00000382526:A1765D;ENSP00000385896:A1765D;ENSP00000382504:A1773D	ENSP00000323129:A1595D	A	+	2	0	CACNA1C	2659073	1.000000	0.71417	0.998000	0.56505	0.286000	0.27126	6.890000	0.75633	2.276000	0.75962	0.305000	0.20034	GCC	-	NULL		0.682	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	protein_coding	OTTHUMT00000317035.1	C	NM_000719		2659073	1	no_errors	NM_000719	genbank	human	reviewed	54_36p	missense	SNP	1	A
CMAS	55907	genome.wustl.edu	37	12	22214388	22214388	+	Splice_Site	SNP	T	T	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr12:22214388T>G	ENST00000229329.2	+	6	1090		c.e6+2			NM_018686.4	NP_061156.1	Q8NFW8	NEUA_HUMAN	cytidine monophosphate N-acetylneuraminic acid synthetase						lipopolysaccharide biosynthetic process (GO:0009103)|N-acetylneuraminate metabolic process (GO:0006054)	membrane (GO:0016020)|nucleus (GO:0005634)	N-acylneuraminate cytidylyltransferase activity (GO:0008781)	p.?(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24						GGTATTGAGGTATGTGCTCCC	0.284																																																1	Unknown(1)	ovary(1)	12											47.0	48.0	48.0					12																	22214388		2203	4299	6502	22105655	SO:0001630	splice_region_variant	55907			AF271388	CCDS8696.1	12p12.1	2008-08-04			ENSG00000111726	ENSG00000111726			18290	protein-coding gene	gene with protein product	"""CMP-Neu5Ac synthetase"""	603316				8889549, 7566098	Standard	NM_018686		Approved		uc001rfm.4	Q8NFW8	OTTHUMG00000169097	ENST00000229329.2:c.960+2T>G	12.37:g.22214388T>G		Somatic		Capture	Illumina GAIIx	4	22105655	Q96AX5|Q9NQZ0	Splice_Site	SNP	-	e6+2	ENST00000229329.2	37	c.960+2	CCDS8696.1	12	.	.	.	.	.	.	.	.	.	.	T	19.65	3.868056	0.72065	.	.	ENSG00000111726	ENST00000229329	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3919	0.74751	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CMAS	22105655	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.412000	0.73303	2.223000	0.72356	0.482000	0.46254	.	-	-		0.284	CMAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMAS	protein_coding	OTTHUMT00000402235.1	T	NM_018686	Intron	22105655	1	no_errors	NM_018686	genbank	human	reviewed	54_36p	splice_site	SNP	1	G
DDX23	9416	genome.wustl.edu	37	12	49227241	49227241	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr12:49227241C>A	ENST00000308025.3	-	13	1701	c.1622G>T	c.(1621-1623)aGc>aTc	p.S541I		NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	541	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)	p.S541I(1)		NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						GGTACAGCGGCTCAGCACCAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	12											111.0	107.0	108.0					12																	49227241		2203	4300	6503	47513508	SO:0001583	missense	9416			AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.1622G>T	12.37:g.49227241C>A	ENSP00000310723:p.Ser541Ile	Somatic		Capture	Illumina GAIIx	4	47513508	B2R600|B4DH15|O43188	Missense_Mutation	SNP	HMMPfam_Helicase_C;HMMPfam_DEAD;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.S541I	ENST00000308025.3	37	c.1622	CCDS8770.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.331564	0.95733	.	.	ENSG00000174243	ENST00000308025	T	0.17528	2.27	6.07	6.07	0.98685	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.043903	0.85682	D	0.000000	T	0.41026	0.1141	M	0.80847	2.515	0.80722	D	1	P	0.52463	0.953	P	0.54431	0.752	T	0.18967	-1.0320	10	0.72032	D	0.01	-20.7873	19.4154	0.94694	0.0:1.0:0.0:0.0	.	541	Q9BUQ8	DDX23_HUMAN	I	541	ENSP00000310723:S541I	ENSP00000310723:S541I	S	-	2	0	DDX23	47513508	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.015000	0.70791	2.884000	0.98904	0.655000	0.94253	AGC	-	HMMPfam_DEAD		0.507	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX23	protein_coding	OTTHUMT00000408897.2	C	NM_004818		47513508	-1	no_errors	NM_004818	genbank	human	reviewed	54_36p	missense	SNP	1	A
OS9	10956	genome.wustl.edu	37	12	58111997	58111998	+	Nonsense_Mutation	DNP	GA	GA	TT			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	GA	GA	GA	TT	GA	GA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr12:58111997_58111998GA>TT	ENST00000315970.7	+	11	1244_1245	c.1203_1204GA>TT	c.(1201-1206)gaGAag>gaTTag	p.401_402EK>D*	OS9_ENST00000552285.1_Nonsense_Mutation_p.401_402EK>D*|OS9_ENST00000389146.6_Nonsense_Mutation_p.401_402EK>D*|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000413095.2_Nonsense_Mutation_p.195_196EK>D*|OS9_ENST00000389142.5_Nonsense_Mutation_p.401_402EK>D*|OS9_ENST00000257966.8_Nonsense_Mutation_p.402_403EK>D*|OS9_ENST00000551035.1_Nonsense_Mutation_p.369_370EK>D*|OS9_ENST00000435406.2_Nonsense_Mutation_p.349_350EK>D*|OS9_ENST00000439210.2_Nonsense_Mutation_p.342_343EK>D*	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	401					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GGGAACCAGAGAAGGAAAGGGG	0.535																																																0			12																																								56398265	SO:0001587	stop_gained	10956			AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	Exception_encountered	12.37:g.58111997_58111998delinsTT	ENSP00000318165:p.E401_K402delinsD*	Somatic		Capture	Illumina GAIIx	4	56398264	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Nonsense_Mutation	DNP	superfamily_Mannose 6-phosphate receptor domain;HMMPfam_PRKCSH	p.EKE401D*	ENST00000315970.7	37	c.1203_1204	CCDS31843.1	12																																																																																			-	NULL		0.535	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OS9	protein_coding	OTTHUMT00000408344.1	GA	NM_006812		56398265	1	no_errors	NM_006812	genbank	human	reviewed	54_36p	nonsense	DNP	0.035:0.194	TT
MDM1	56890	genome.wustl.edu	37	12	68720731	68720731	+	Silent	SNP	A	A	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr12:68720731A>C	ENST00000303145.7	-	3	290	c.204T>G	c.(202-204)tcT>tcG	p.S68S	MDM1_ENST00000540418.1_Intron|MDM1_ENST00000393543.3_3'UTR|MDM1_ENST00000430606.2_Silent_p.S68S|MDM1_ENST00000545724.1_5'UTR|MDM1_ENST00000411698.2_Silent_p.S68S	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	68					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)		p.S68S(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		TCCACTCCAGAGATTTTGAAA	0.423																																																1	Substitution - coding silent(1)	ovary(1)	12											99.0	103.0	102.0					12																	68720731		2203	4300	6503	67006998	SO:0001819	synonymous_variant	56890			AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.204T>G	12.37:g.68720731A>C		Somatic		Capture	Illumina GAIIx	4	67006998	B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Silent	SNP	-	p.S68	ENST00000303145.7	37	c.204	CCDS8983.1	12																																																																																			-	NULL		0.423	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDM1	protein_coding	OTTHUMT00000402402.1	A	NM_020128		67006998	-1	no_errors	NM_017440	genbank	human	reviewed	54_36p	silent	SNP	1	C
RB1	5925	genome.wustl.edu	37	13	49039405	49039421	+	Frame_Shift_Del	DEL	TACGGATTCCTGGAGGG	TACGGATTCCTGGAGGG	-	rs187912365|rs374523971	byFrequency	TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	TACGGATTCCTGGAGGG	TACGGATTCCTGGAGGG	TACGGATTCCTGGAGGG	-	TACGGATTCCTGGAGGG	TACGGATTCCTGGAGGG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr13:49039405_49039421delTACGGATTCCTGGAGGG	ENST00000267163.4	+	23	2528_2544	c.2390_2406delTACGGATTCCTGGAGGG	c.(2389-2406)ttacggattcctggagggfs	p.LRIPGG797fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	797	Domain C; mediates interaction with E4F1.|Interaction with LIMD1.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)|p.L797fs*1(1)|p.R798W(1)|p.R798fs*17(1)|p.G801*(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AGTTCACCCTTACGGATTCCTGGAGGGAACATCTATA	0.396		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	30	Whole gene deletion(15)|Unknown(11)|Insertion - Frameshift(1)|Substitution - Nonsense(1)|Deletion - Frameshift(1)|Substitution - Missense(1)	bone(11)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|eye(2)|lung(2)|ovary(2)|adrenal_gland(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|liver(1)	13	GRCh37	CI012716|CM023820	RB1	I|M																																				47937422	SO:0001589	frameshift_variant	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2390_2406delTACGGATTCCTGGAGGG	13.37:g.49039405_49039421delTACGGATTCCTGGAGGG	ENSP00000267163:p.Leu797fs	Somatic		Capture	Illumina GAIIx	Phase_III	47937406	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	RB_B,HMMPfam_RB_B,RB_A,HMMPfam_RB_A,Rb_C,HMMPfam_Rb_C	p.L797fs	ENST00000267163.4	37	c.2390_2406	CCDS31973.1	13																																																																																			(deletion:cds_exon[47937342,47937505])	HMMPfam_Rb_C		0.396	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	TACGGATTCCTGGAGGG			47937422	1	no_errors	NM_000321	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.997:0.978:1.000:1.000:0.968:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.958:0.443:0.994:1.000:0.997	-
G2E3	55632	genome.wustl.edu	37	14	31058619	31058623	+	Frame_Shift_Del	DEL	AAAGA	AAAGA	-			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	AAAGA	AAAGA	AAAGA	-	AAAGA	AAAGA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr14:31058619_31058623delAAAGA	ENST00000206595.6	+	4	320_324	c.166_170delAAAGA	c.(166-171)aaagaafs	p.KE56fs	G2E3_ENST00000553504.1_Frame_Shift_Del_p.KE86fs|G2E3_ENST00000544007.1_3'UTR|G2E3_ENST00000438909.2_Frame_Shift_Del_p.KE10fs	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	56					apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K56fs*18(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GCAGAGAGGCAAAGAAGAAGAAGGA	0.293																																																1	Deletion - Frameshift(1)	ovary(1)	14																																								30128374	SO:0001589	frameshift_variant	55632			AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.166_170delAAAGA	14.37:g.31058619_31058623delAAAGA	ENSP00000206595:p.Lys56fs	Somatic		Capture	Illumina GAIIx	4	30128370	Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Frame_Shift_Del	DEL	-	p.K56fs	ENST00000206595.6	37	c.166_170	CCDS9638.1	14																																																																																			(deletion:cds_exon[30128340;30128441])	NULL		0.293	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G2E3	protein_coding	OTTHUMT00000276613.2	AAAGA	NM_017769		30128374	1	no_errors	NM_017769	genbank	human	validated	54_36p	frame_shift_del	DEL	0.997:1.000:1.000:1.000:1.000	-
EML5	161436	genome.wustl.edu	37	14	89205266	89205266	+	Silent	SNP	T	T	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr14:89205266T>C	ENST00000380664.5	-	6	803	c.804A>G	c.(802-804)ccA>ccG	p.P268P	EML5_ENST00000554922.1_Silent_p.P268P|EML5_ENST00000352093.5_Silent_p.P268P			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	268						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)	p.P268P(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TCACAGTAATTGGTTTAAAAG	0.368																																																1	Substitution - coding silent(1)	ovary(1)	14											72.0	65.0	67.0					14																	89205266		1862	4106	5968	88275019	SO:0001819	synonymous_variant	161436			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.804A>G	14.37:g.89205266T>C		Somatic		Capture	Illumina GAIIx	4	88275019	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Silent	SNP	HMMPfam_WD40;HMMPfam_HELP;superfamily_YVTN repeat-like/Quinoprotein amine dehydrogenase;superfamily_WD40 repeat-like	p.P268	ENST00000380664.5	37	c.804	CCDS45148.1	14																																																																																			-	NULL		0.368	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	protein_coding	OTTHUMT00000410491.1	T			88275019	-1	no_errors	NM_183387	genbank	human	validated	54_36p	silent	SNP	1	C
IGHM	3507	genome.wustl.edu	37	14	106320716	106320716	+	RNA	SNP	C	C	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr14:106320716C>A	ENST00000390559.2	-	0	1093				hsa-mir-4539_ENST00000579784.1_RNA			P01871	IGHM_HUMAN	immunoglobulin heavy constant mu						adaptive immune response (GO:0002250)|antibacterial humoral response (GO:0019731)|defense response to Gram-negative bacterium (GO:0050829)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|hexameric IgM immunoglobulin complex (GO:0071757)|integral component of membrane (GO:0016021)|pentameric IgM immunoglobulin complex (GO:0071756)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										CCTCTGCATCCACTGCACGAA	0.667																																																0			14											28.0	34.0	32.0					14																	106320716		2086	4193	6279	105391761			3507			X14940		14q32.33	2012-10-02			ENSG00000211899	ENSG00000211899		"""Immunoglobulins / IGH locus"""	5541	other	immunoglobulin gene		147020				2115996	Standard	NG_001019		Approved			P01871	OTTHUMG00000152452		14.37:g.106320716C>A		Somatic		Capture	Illumina GAIIx	4	105391761	P20769	Nonsense_Mutation	SNP	-	p.G365*	ENST00000390559.2	37	c.1093		14																																																																																			-	NULL		0.667	IGHM-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHM	IG_C_gene	OTTHUMT00000326272.1	C	NG_001019		105391761	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390558	ensembl	human	known	54_36p	nonsense	SNP	1	A
B2M	567	genome.wustl.edu	37	15	45003745	45003745	+	Start_Codon_SNP	SNP	A	A	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr15:45003745A>G	ENST00000558401.1	+	1	71	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	B2M_ENST00000544417.1_Start_Codon_SNP_p.M1V|PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000559916.1_Start_Codon_SNP_p.M1V	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	1					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.M1L(3)|p.M1V(2)|p.?(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		TCGGGCCGAGATGTCTCGCTC	0.612																																																6	Substitution - Missense(5)|Unknown(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(2)|lung(1)|large_intestine(1)	15											126.0	92.0	104.0					15																	45003745		2198	4298	6496	42791037	SO:0001582	initiator_codon_variant	567			AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.1A>G	15.37:g.45003745A>G	ENSP00000452780:p.Met1Val	Somatic		Capture	Illumina GAIIx	4	42791037	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	-	p.M1V	ENST00000558401.1	37	c.1	CCDS10113.1	15	.	.	.	.	.	.	.	.	.	.	A	19.48	3.836331	0.71373	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.01228	5.14	5.35	5.35	0.76521	.	.	.	.	.	T	0.02119	0.0066	.	.	.	0.80722	D	1	P;P;P	0.48407	0.86;0.91;0.78	B;B;B	0.41271	0.352;0.294;0.192	T	0.58912	-0.7552	8	0.87932	D	0	.	11.9	0.52678	1.0:0.0:0.0:0.0	.	1;1;1	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	V	1	ENSP00000437604:M1V	ENSP00000340858:M1V	M	+	1	0	B2M	42791037	0.891000	0.30450	0.406000	0.26421	0.024000	0.10985	1.849000	0.39318	2.371000	0.80710	0.533000	0.62120	ATG	-	NULL		0.612	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	B2M	protein_coding	OTTHUMT00000254007.2	A	NM_004048	Missense_Mutation	42791037	1	no_errors	NM_004048	genbank	human	validated	54_36p	missense	SNP	0.06	G
SLC28A2	9153	genome.wustl.edu	37	15	45559871	45559871	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr15:45559871C>T	ENST00000347644.3	+	12	1141	c.1076C>T	c.(1075-1077)gCa>gTa	p.A359V	CTD-2651B20.3_ENST00000561404.1_RNA|CTD-2651B20.3_ENST00000560344.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2	359					nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)	p.A359V(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	CAGGTTGATGCATCATCCCTG	0.527																																					NSCLC(92;493 1501 26361 28917 47116)											1	Substitution - Missense(1)	ovary(1)	15											148.0	134.0	139.0					15																	45559871		2198	4298	6496	43347163	SO:0001583	missense	9153			U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.1076C>T	15.37:g.45559871C>T	ENSP00000315006:p.Ala359Val	Somatic		Capture	Illumina GAIIx	4	43347163	A8K7F9|O43239|Q52LZ0	Missense_Mutation	SNP	-	p.A359V	ENST00000347644.3	37	c.1076	CCDS10121.1	15	.	.	.	.	.	.	.	.	.	.	C	19.44	3.827154	0.71143	.	.	ENSG00000137860	ENST00000347644	T	0.02140	4.43	5.94	5.94	0.96194	.	0.171581	0.56097	D	0.000034	T	0.13756	0.0333	M	0.79805	2.47	0.80722	D	1	D	0.67145	0.996	D	0.68039	0.955	T	0.00007	-1.2498	10	0.72032	D	0.01	-0.9678	17.853	0.88754	0.0:1.0:0.0:0.0	.	359	O43868	S28A2_HUMAN	V	359	ENSP00000315006:A359V	ENSP00000315006:A359V	A	+	2	0	SLC28A2	43347163	0.993000	0.37304	0.031000	0.17742	0.165000	0.22458	5.400000	0.66320	2.816000	0.96949	0.561000	0.74099	GCA	-	NULL		0.527	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC28A2	protein_coding	OTTHUMT00000254219.2	C	NM_004212		43347163	1	no_errors	NM_004212	genbank	human	provisional	54_36p	missense	SNP	1	T
MAGEA12	4111	genome.wustl.edu	37	X	151896709	151896709	+	IGR	SNP	G	G	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chrX:151896709G>T	ENST00000357916.4	-	0	1664				CSAG4_ENST00000361201.4_RNA	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12											breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					caggccagcaggctagaaact	0.478																																																0			X																																								151647365	SO:0001628	intergenic_variant	100130935				CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650		X.37:g.151896709G>T		Somatic		Capture	Illumina GAIIx	4	151647365	Q9NSD3	Silent	SNP	-	p.A38	ENST00000357916.4	37	c.114	CCDS14710.1	X																																																																																			-	NULL		0.478	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100130935	protein_coding	OTTHUMT00000058764.1	G	NM_005367		151647365	-1	no_errors	XM_001721280	genbank	human	model	54_36p	silent	SNP		T
WDR24	84219	genome.wustl.edu	37	16	739275	739275	+	Silent	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr16:739275C>T	ENST00000248142.6	-	3	551	c.552G>A	c.(550-552)acG>acA	p.T184T	WDR24_ENST00000293883.4_Silent_p.T122T|LA16c-313D11.12_ENST00000566927.1_RNA			Q96S15	WDR24_HUMAN	WD repeat domain 24	184								p.T122T(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				CTTTGTTTACCGTGCGCTTGT	0.597																																																1	Substitution - coding silent(1)	ovary(1)	16											128.0	100.0	109.0					16																	739275		2200	4299	6499	679276	SO:0001819	synonymous_variant	84219			AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.552G>A	16.37:g.739275C>T		Somatic		Capture	Illumina GAIIx	4	679276	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Silent	SNP	-	p.T122	ENST00000248142.6	37	c.366		16																																																																																			-	NULL		0.597	WDR24-201	KNOWN	basic	protein_coding	WDR24	protein_coding		C	NM_032259		679276	-1	no_errors	NM_032259	genbank	human	provisional	54_36p	silent	SNP	0.889	T
TP53	7157	genome.wustl.edu	37	17	7576858	7576858	+	Frame_Shift_Del	DEL	G	G	-			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr17:7576858delG	ENST00000269305.4	-	9	1177	c.988delC	c.(988-990)cttfs	p.L330fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.L330fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.L330fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.L330fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.L330fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	330	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		L -> H (in sporadic cancers; somatic mutation).|L -> P (in a sporadic cancer; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.L330fs*15(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGTACCTGAAGGGTGAAATAT	0.453		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	10	Whole gene deletion(8)|Unknown(1)|Deletion - Frameshift(1)	bone(4)|haematopoietic_and_lymphoid_tissue(2)|central_nervous_system(2)|ovary(1)|stomach(1)	17											119.0	112.0	114.0					17																	7576858		2203	4300	6503	7517583	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.988delC	17.37:g.7576858delG	ENSP00000269305:p.Leu330fs	Somatic		Capture	Illumina GAIIx	4	7517583	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.L330fs	ENST00000269305.4	37	c.988	CCDS11118.1	17																																																																																			(deletion:cds_exon[7517578;7517651])	HMMPfam_P53_tetramer		0.453	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7517583	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1	-
SLC4A1	6521	genome.wustl.edu	37	17	42335417	42335418	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	CC	CC	CC	AG	CC	CC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr17:42335417_42335418CC>AG	ENST00000262418.6	-	11	1373_1374	c.1218_1219GG>CT	c.(1216-1221)ctGGct>ctCTct	p.A407S	AC003043.1_ENST00000597382.1_Intron|SLC4A1_ENST00000471005.1_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	407	Membrane (anion exchange).		Missing (in EL4; increased rigidity of the erythrocyte membrane leading to increased resistance to shear stress and increased resistance to P.falciparum). {ECO:0000269|PubMed:1538405, ECO:0000269|PubMed:1722314}.		anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		ATGACGGCAGCCAGGACCTGGG	0.594																																																0			17																																								39690944	SO:0001583	missense	6521				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.1218_1219delinsAG	17.37:g.42335417_42335418delinsAG	ENSP00000262418:p.Ala407Ser	Somatic		Capture	Illumina GAIIx	4	39690943	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	DNP	-	p.A407S	ENST00000262418.6	37	c.1219_1218	CCDS11481.1	17																																																																																			-	NULL		0.594	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1	protein_coding	OTTHUMT00000346194.1	CC	NM_000342		39690944	-1	no_errors	NM_000342	genbank	human	reviewed	54_36p	missense	DNP	1.000:1.000	AG
KLHL26	55295	genome.wustl.edu	37	19	18779040	18779040	+	Missense_Mutation	SNP	G	G	A	rs143852465		TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr19:18779040G>A	ENST00000300976.4	+	3	923	c.833G>A	c.(832-834)cGc>cAc	p.R278H	KLHL26_ENST00000599006.1_Intron	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	278								p.R278H(1)		breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						GTGCTGTGCCGCCAGTATCTG	0.647																																																1	Substitution - Missense(1)	ovary(1)	19						G	HIS/ARG	0,4366		0,0,2183	57.0	61.0	59.0		833	5.0	1.0	19	dbSNP_134	59	1,8543		0,1,4271	no	missense	KLHL26	NM_018316.1	29	0,1,6454	AA,AG,GG		0.0117,0.0,0.0077	probably-damaging	278/616	18779040	1,12909	2183	4272	6455	18640040	SO:0001583	missense	55295				CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487		"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""				Standard	XM_006722785		Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.833G>A	19.37:g.18779040G>A	ENSP00000300976:p.Arg278His	Somatic		Capture	Illumina GAIIx	4	18640040	Q8TAP0|Q9NUX3	Missense_Mutation	SNP	HMMPfam_Kelch_1,superfamily_Galactose oxidase central domain,HMMPfam_BACK,HMMPfam_BTB,superfamily_POZ domain	p.R278H	ENST00000300976.4	37	c.833	CCDS12384.1	19	.	.	.	.	.	.	.	.	.	.	G	15.35	2.806519	0.50421	0.0	1.17E-4	ENSG00000167487	ENST00000300976	T	0.77229	-1.08	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.71467	0.3343	L	0.43152	1.355	0.80722	D	1	B	0.15719	0.014	B	0.11329	0.006	T	0.66073	-0.6014	9	.	.	.	.	17.3648	0.87360	0.0:0.0:1.0:0.0	.	278	Q53HC5	KLH26_HUMAN	H	278	ENSP00000300976:R278H	.	R	+	2	0	KLHL26	18640040	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	7.704000	0.84595	2.341000	0.79615	0.591000	0.81541	CGC	-	NULL		0.647	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL26	protein_coding	OTTHUMT00000465145.1	G	NM_018316		18640040	1	no_errors	NM_018316	genbank	human	provisional	54_36p	missense	SNP	1	A
NPHS1	4868	genome.wustl.edu	37	19	36335134	36335134	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr19:36335134G>A	ENST00000378910.5	-	16	2082	c.2083C>T	c.(2083-2085)Cgg>Tgg	p.R695W	NPHS1_ENST00000353632.6_Missense_Mutation_p.R695W	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	695					cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)	p.R695W(1)		NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ATGCGATGCCGGGGGCCGCCC	0.672																																																1	Substitution - Missense(1)	ovary(1)	19											20.0	25.0	24.0					19																	36335134		2202	4298	6500	41026974	SO:0001583	missense	4868				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2083C>T	19.37:g.36335134G>A	ENSP00000368190:p.Arg695Trp	Somatic		Capture	Illumina GAIIx	4	41026974	A6NDH2|C3RX61	Missense_Mutation	SNP	HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_I-set;HMMPfam_V-set;HMMPfam_ig;HMMPfam_C2-set_2;superfamily_Immunoglobulin	p.R695W	ENST00000378910.5	37	c.2083	CCDS32996.1	19	.	.	.	.	.	.	.	.	.	.	G	22.0	4.232405	0.79688	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.75821	-0.97;-0.97	4.66	3.55	0.40652	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.079191	0.53938	D	0.000044	D	0.85712	0.5760	M	0.87758	2.905	0.45747	D	0.998645	D	0.89917	1.0	D	0.79108	0.992	D	0.86816	0.2001	10	0.59425	D	0.04	-27.7624	10.602	0.45373	0.0:0.0:0.8088:0.1911	.	695	O60500	NPHN_HUMAN	W	695	ENSP00000368190:R695W;ENSP00000343634:R695W	ENSP00000343634:R695W	R	-	1	2	NPHS1	41026974	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.018000	0.40991	2.306000	0.77630	0.561000	0.74099	CGG	-	HMMPfam_I-set		0.672	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	protein_coding	OTTHUMT00000452553.1	G			41026974	-1	no_errors	NM_004646	genbank	human	validated	54_36p	missense	SNP	1	A
LTBP4	8425	genome.wustl.edu	37	19	41115542	41115542	+	Silent	SNP	C	C	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr19:41115542C>G	ENST00000308370.7	+	13	1734	c.1734C>G	c.(1732-1734)ctC>ctG	p.L578L	LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000545697.1_Silent_p.L31L|LTBP4_ENST00000204005.9_Silent_p.L541L|RN7SL758P_ENST00000580450.1_RNA|LTBP4_ENST00000396819.3_Silent_p.L511L	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	578	Cys-rich.|EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.L578L(1)		central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTTCCGGCTCAGCCCCCAGG	0.701																																																1	Substitution - coding silent(1)	ovary(1)	19											21.0	26.0	24.0					19																	41115542		2095	4216	6311	45807382	SO:0001819	synonymous_variant	8425			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.1734C>G	19.37:g.41115542C>G		Somatic		Capture	Illumina GAIIx	4	45807382	O00508|O75412|O75413	Silent	SNP	-	p.L578	ENST00000308370.7	37	c.1734		19																																																																																			-	NULL		0.701	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	protein_coding		C	NM_003573		45807382	1	no_errors	ENST00000308370	ensembl	human	known	54_36p	silent	SNP	1	G
CYP2B6	1555	genome.wustl.edu	37	19	41518370	41518370	+	Nonsense_Mutation	SNP	C	C	T	rs34097093		TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr19:41518370C>T	ENST00000324071.4	+	7	1139	c.1132C>T	c.(1132-1134)Cga>Tga	p.R378*	CYP2B6_ENST00000593831.1_Nonsense_Mutation_p.R142*|CYP2B6_ENST00000330446.5_Nonsense_Mutation_p.R178*	NM_000767.4	NP_000758.1	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B, polypeptide 6	378					cellular ketone metabolic process (GO:0042180)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)	p.R378*(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(20;0.00322)		Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Antipyrine(DB01435)|Artemether(DB06697)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Brompheniramine(DB00835)|Bupropion(DB01156)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Citalopram(DB00215)|Clobazam(DB00349)|Clofibrate(DB00636)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Doxorubicin(DB00997)|Efavirenz(DB00625)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erythromycin(DB00199)|Estrone(DB00655)|Ethanol(DB00898)|Ethylmorphine(DB01466)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosphenytoin(DB01320)|Halothane(DB01159)|Ifosfamide(DB01181)|Imipramine(DB00458)|Irinotecan(DB00762)|Isoflurane(DB00753)|Itraconazole(DB01167)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lidocaine(DB00281)|Loperamide(DB00836)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Malathion(DB00772)|Memantine(DB01043)|Methadone(DB00333)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyltestosterone(DB06710)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitric Oxide(DB00435)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Paroxetine(DB00715)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Prasugrel(DB06209)|Primidone(DB00794)|Promethazine(DB01069)|Propofol(DB00818)|Quinidine(DB00908)|Raloxifene(DB00481)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Ropivacaine(DB00296)|Roxithromycin(DB00778)|Selegiline(DB01037)|Sertraline(DB01104)|Sevoflurane(DB01236)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Temazepam(DB00231)|Testosterone(DB00624)|Thiotepa(DB04572)|Ticlopidine(DB00208)|Tramadol(DB00193)|Tretinoin(DB00755)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)	CACCAGCTTCCGAGGGTACAT	0.512																																																1	Substitution - Nonsense(1)	ovary(1)	19						C	stop/ARG	2,4404		0,2,2201	93.0	79.0	84.0		1132	0.7	0.2	19	dbSNP_126	84	0,8600		0,0,4300	yes	stop-gained	CYP2B6	NM_000767.4		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		378/492	41518370	2,13004	2203	4300	6503	46210210	SO:0001587	stop_gained	1555			AF182277	CCDS12570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000197408	ENSG00000197408		"""Cytochrome P450s"""	2615	protein-coding gene	gene with protein product		123930	"""cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6"", ""cytochrome P450, family 2, subfamily B"", ""cytochrome P450, subfamily IIB (phenobarbital-inducible)"""	CYP2B		7668294, 15128046	Standard	NM_000767		Approved	CPB6, CYPIIB6	uc002opr.1	P20813	OTTHUMG00000182714	ENST00000324071.4:c.1132C>T	19.37:g.41518370C>T	ENSP00000324648:p.Arg378*	Somatic		Capture	Illumina GAIIx	Phase_III	46210210	B4DWP3|Q2V565|Q9UK46	Nonsense_Mutation	SNP	-	p.R378*	ENST00000324071.4	37	c.1132	CCDS12570.1	19	.	.	.	.	.	.	.	.	.	.	.	18.25	3.583312	0.65992	4.54E-4	0.0	ENSG00000197408	ENST00000324071;ENST00000330446	.	.	.	4.3	0.691	0.18045	.	0.062472	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.8902	0.18909	0.4929:0.4106:0.0:0.0965	rs34097093	.	.	.	X	378;178	.	ENSP00000324648:R378X	R	+	1	2	CYP2B6	46210210	0.003000	0.15002	0.243000	0.24186	0.217000	0.24651	-0.553000	0.06012	0.421000	0.25980	0.298000	0.19748	CGA	-	NULL		0.512	CYP2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2B6	protein_coding	OTTHUMT00000463260.1	C	NM_000767		46210210	1	no_errors	NM_000767	genbank	human	reviewed	54_36p	nonsense	SNP	0.81	T
ZNF577	84765	genome.wustl.edu	37	19	52376611	52376611	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr19:52376611T>C	ENST00000301399.5	-	7	997	c.632A>G	c.(631-633)gAg>gGg	p.E211G	ZNF577_ENST00000420592.1_Missense_Mutation_p.E152G|ZNF577_ENST00000451628.2_Missense_Mutation_p.E152G|ZNF577_ENST00000412216.1_Intron|ZNF577_ENST00000485702.1_Intron	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	211					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E204G(1)		breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		ATGGGGCTTCTCTCCTGTGTG	0.468																																																1	Substitution - Missense(1)	ovary(1)	19											104.0	95.0	98.0					19																	52376611		2203	4300	6503	57068423	SO:0001583	missense	84765			AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.632A>G	19.37:g.52376611T>C	ENSP00000301399:p.Glu211Gly	Somatic		Capture	Illumina GAIIx	4	57068423	A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	-	p.E204G	ENST00000301399.5	37	c.611	CCDS12842.2	19	.	.	.	.	.	.	.	.	.	.	.	13.59	2.283778	0.40394	.	.	ENSG00000161551	ENST00000301399;ENST00000420592;ENST00000451628;ENST00000458390	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	3.1	3.1	0.35709	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50633	0.1627	M	0.66506	2.035	0.29904	N	0.824165	D;P	0.89917	1.0;0.887	D;B	0.78314	0.991;0.402	T	0.47446	-0.9117	9	0.54805	T	0.06	.	10.7161	0.46013	0.0:0.0:0.0:1.0	.	211;152	Q9BSK1;Q9BSK1-2	ZN577_HUMAN;.	G	211;152;152;211	ENSP00000301399:E211G;ENSP00000413476:E152G;ENSP00000389652:E152G;ENSP00000404509:E211G	ENSP00000301399:E211G	E	-	2	0	ZNF577	57068423	0.986000	0.35501	0.831000	0.32960	0.165000	0.22458	2.442000	0.44873	1.392000	0.46585	0.533000	0.62120	GAG	-	NULL		0.468	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF577	protein_coding	OTTHUMT00000347243.1	T	NM_032679		57068423	-1	no_errors	NM_032679	genbank	human	validated	54_36p	missense	SNP	1	C
ZNF83	55769	genome.wustl.edu	37	19	53117889	53117889	+	5'UTR	SNP	A	A	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr19:53117889A>C	ENST00000597597.1	-	0	2182				ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000594682.2_Missense_Mutation_p.W102G|ZNF83_ENST00000541777.2_5'UTR|ZNF83_ENST00000301096.3_5'UTR|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000544146.1_5'UTR|ZNF83_ENST00000536937.1_5'UTR|ZNF83_ENST00000391789.4_5'Flank|ZNF83_ENST00000545872.1_5'UTR			P51522	ZNF83_HUMAN	zinc finger protein 83						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		TCATGTTTCCACAGACACTGA	0.393																																																1	Unknown(1)	ovary(1)	19																																								57809701	SO:0001623	5_prime_UTR_variant	55769			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.-72T>G	19.37:g.53117889A>C		Somatic		Capture	Illumina GAIIx	4	57809701	A8MT75|Q3ZCX0|Q6PI08	RNA	SNP	-	NULL	ENST00000597597.1	37	NULL	CCDS12854.1	19																																																																																			-	-		0.393	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	protein_coding	OTTHUMT00000463700.1	A	NM_018300		57809701	-1	no_errors	NR_003936	genbank	human	validated	54_36p	rna	SNP		C
PRPF31	26121	genome.wustl.edu	37	19	54628017	54628017	+	Silent	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr19:54628017C>T	ENST00000321030.4	+	8	1186	c.837C>T	c.(835-837)atC>atT	p.I279I	PRPF31_ENST00000498612.1_3'UTR|AC012314.8_ENST00000452097.1_RNA|PRPF31_ENST00000391755.1_Silent_p.I279I|PRPF31_ENST00000419967.1_Silent_p.I279I	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31	279	Nop. {ECO:0000255|PROSITE- ProRule:PRU00690}.				mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)	p.I279I(1)		breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					ACAGTGACATCGTGCAGTCCC	0.672																																																1	Substitution - coding silent(1)	ovary(1)	19											86.0	71.0	76.0					19																	54628017		2203	4300	6503	59319829	SO:0001819	synonymous_variant	26121			AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.837C>T	19.37:g.54628017C>T		Somatic		Capture	Illumina GAIIx	4	59319829	Q17RB4|Q8N7F9|Q9H271|Q9Y439	Silent	SNP	HMMPfam_Nop;HMMPfam_NOSIC;superfamily_Nop domain	p.I279	ENST00000321030.4	37	c.837	CCDS12879.1	19																																																																																			-	HMMPfam_Nop		0.672	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF31	protein_coding	OTTHUMT00000141417.2	C			59319829	1	no_errors	NM_015629	genbank	human	reviewed	54_36p	silent	SNP	0.75	T
ST6GAL2	84620	genome.wustl.edu	37	2	107449085	107449085	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr2:107449085G>A	ENST00000409382.3	-	4	1689	c.1079C>T	c.(1078-1080)tCa>tTa	p.S360L	AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.S360L|ST6GAL2_ENST00000409087.3_Missense_Mutation_p.S360L	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	360					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.S360L(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						TTTATACAGTGAACTGTCAAT	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											93.0	92.0	92.0					2																	107449085		2203	4300	6503	106815517	SO:0001583	missense	84620			AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1079C>T	2.37:g.107449085G>A	ENSP00000386942:p.Ser360Leu	Somatic		Capture	Illumina GAIIx	4	106815517	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	HMMPfam_Glyco_transf_29;superfamily_Glycoside hydrolase/deacetylase	p.S360L	ENST00000409382.3	37	c.1079	CCDS2073.1	2	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483833	0.84854	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.78924	-1.22;-1.22;-1.22	6.17	6.17	0.99709	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);	0.291647	0.39985	N	0.001207	T	0.79203	0.4406	L	0.58669	1.825	0.58432	D	0.999998	B;B	0.31209	0.313;0.082	B;B	0.35114	0.097;0.196	T	0.76846	-0.2808	10	0.62326	D	0.03	-5.8642	19.8676	0.96824	0.0:0.0:1.0:0.0	.	360;360	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	L	360	ENSP00000355273:S360L;ENSP00000386942:S360L;ENSP00000387332:S360L	ENSP00000355273:S360L	S	-	2	0	ST6GAL2	106815517	1.000000	0.71417	0.926000	0.36857	0.936000	0.57629	9.441000	0.97557	2.941000	0.99782	0.655000	0.94253	TCA	-	HMMPfam_Glyco_transf_29		0.443	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ST6GAL2	protein_coding	OTTHUMT00000330065.1	G	NM_032528		106815517	-1	no_errors	NM_032528	genbank	human	validated	54_36p	missense	SNP	1	A
DDX18	8886	genome.wustl.edu	37	2	118586875	118586875	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr2:118586875T>C	ENST00000263239.2	+	13	1831	c.1703T>C	c.(1702-1704)tTg>tCg	p.L568S		NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	568	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)	p.L568S(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CTTGAGAAATTGATTGAAAAG	0.328																																																1	Substitution - Missense(1)	ovary(1)	2											59.0	63.0	62.0					2																	118586875		2202	4299	6501	118303345	SO:0001583	missense	8886			X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.1703T>C	2.37:g.118586875T>C	ENSP00000263239:p.Leu568Ser	Somatic		Capture	Illumina GAIIx	4	118303345	Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Missense_Mutation	SNP	HMMPfam_Helicase_C;HMMPfam_DEAD;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.L568S	ENST00000263239.2	37	c.1703	CCDS2120.1	2	.	.	.	.	.	.	.	.	.	.	T	20.8	4.056694	0.76074	.	.	ENSG00000088205	ENST00000263239;ENST00000539346	T	0.02631	4.22	4.67	4.67	0.58626	Helicase, C-terminal (1);	1.868490	0.02616	N	0.102648	T	0.27063	0.0663	M	0.93854	3.465	0.80722	D	1	D	0.67145	0.996	D	0.75020	0.985	T	0.00128	-1.2017	10	0.87932	D	0	.	13.1247	0.59346	0.0:0.0:0.0:1.0	.	568	Q9NVP1	DDX18_HUMAN	S	568;307	ENSP00000263239:L568S	ENSP00000263239:L568S	L	+	2	0	DDX18	118303345	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.275000	0.78548	2.098000	0.63641	0.528000	0.53228	TTG	-	NULL		0.328	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX18	protein_coding	OTTHUMT00000129632.3	T	NM_006773		118303345	1	no_errors	NM_006773	genbank	human	reviewed	54_36p	missense	SNP	1	C
MAP3K2	10746	genome.wustl.edu	37	2	128072395	128072395	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr2:128072395G>C	ENST00000409947.1	-	15	1673	c.1391C>G	c.(1390-1392)aCc>aGc	p.T464S	MAP3K2_ENST00000344908.5_Missense_Mutation_p.T464S|RNU6-1147P_ENST00000363380.1_RNA			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	464	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.T465S(1)		central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	AATCTGACGGGTGTATTTCCT	0.343																																																1	Substitution - Missense(1)	ovary(1)	2											99.0	95.0	96.0					2																	128072395		1832	4074	5906	127788865	SO:0001583	missense	10746			AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.1391C>G	2.37:g.128072395G>C	ENSP00000387246:p.Thr464Ser	Somatic		Capture	Illumina GAIIx	4	127788865	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Missense_Mutation	SNP	PB1;HMMPfam_PB1;Pkinase;HMMPfam_Pkinase	p.T464S	ENST00000409947.1	37	c.1391	CCDS46404.1	2	.	.	.	.	.	.	.	.	.	.	G	18.60	3.659213	0.67586	.	.	ENSG00000169967	ENST00000409947;ENST00000344908	T;T	0.64991	-0.13;-0.13	5.22	5.22	0.72569	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.045018	0.85682	D	0.000000	T	0.65565	0.2703	L	0.49455	1.56	0.58432	D	0.999999	P	0.34997	0.479	B	0.41813	0.367	T	0.68135	-0.5489	10	0.62326	D	0.03	.	18.7661	0.91873	0.0:0.0:1.0:0.0	.	464	Q9Y2U5	M3K2_HUMAN	S	464	ENSP00000387246:T464S;ENSP00000343463:T464S	ENSP00000343463:T464S	T	-	2	0	MAP3K2	127788865	1.000000	0.71417	0.995000	0.50966	0.929000	0.56500	7.844000	0.86867	2.452000	0.82932	0.591000	0.81541	ACC	-	HMMPfam_Pkinase		0.343	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K2	protein_coding	OTTHUMT00000331014.1	G	NM_006609		127788865	-1	no_errors	NM_006609	genbank	human	reviewed	54_36p	missense	SNP	1	C
MBD5	55777	genome.wustl.edu	37	2	149247806	149247806	+	Silent	SNP	A	A	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr2:149247806A>C	ENST00000407073.1	+	12	4903	c.3906A>C	c.(3904-3906)ggA>ggC	p.G1302G	MBD5_ENST00000404807.1_Silent_p.G1535G	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1302					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.G1302G(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GGGGATTTGGAGAGCTGCTAA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	2											60.0	62.0	61.0					2																	149247806		2203	4300	6503	148964276	SO:0001819	synonymous_variant	55777			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3906A>C	2.37:g.149247806A>C		Somatic		Capture	Illumina GAIIx	4	148964276	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Silent	SNP	-	p.G1302	ENST00000407073.1	37	c.3906	CCDS33302.1	2																																																																																			-	NULL		0.433	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	protein_coding	OTTHUMT00000318111.2	A			148964276	1	no_errors	NM_018328	genbank	human	validated	54_36p	silent	SNP	1	C
SCN2A	6326	genome.wustl.edu	37	2	166170174	166170174	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr2:166170174C>T	ENST00000375437.2	+	9	1369	c.1079C>T	c.(1078-1080)cCc>cTc	p.P360L	SCN2A_ENST00000283256.6_Missense_Mutation_p.P360L|SCN2A_ENST00000357398.3_Missense_Mutation_p.P360L|SCN2A_ENST00000375427.2_Missense_Mutation_p.P360L	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	360					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.P360L(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGTAGAAACCCCAACTATGGC	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											151.0	141.0	144.0					2																	166170174		2203	4300	6503	165878420	SO:0001583	missense	6326			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1079C>T	2.37:g.166170174C>T	ENSP00000364586:p.Pro360Leu	Somatic		Capture	Illumina GAIIx	4	165878420	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Ion_trans;HMMPfam_Na_trans_assoc;superfamily_EF-hand;superfamily_Voltage-gated potassium channels	p.P360L	ENST00000375437.2	37	c.1079	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.235749	0.95240	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D;D	0.98762	-5.12;-5.12;-5.12;-5.12;-5.12	5.77	5.77	0.91146	Ion transport (1);	0.178028	0.40385	N	0.001114	D	0.99396	0.9787	M	0.92604	3.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98886	1.0771	10	0.87932	D	0	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	360;360	Q99250-2;Q99250	.;SCN2A_HUMAN	L	360	ENSP00000406454:P360L;ENSP00000364586:P360L;ENSP00000349973:P360L;ENSP00000283256:P360L;ENSP00000364576:P360L	ENSP00000283256:P360L	P	+	2	0	SCN2A	165878420	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	CCC	-	HMMPfam_Ion_trans		0.433	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	protein_coding	OTTHUMT00000102659.2	C	NM_021007		165878420	1	no_errors	NM_001040142	genbank	human	reviewed	54_36p	missense	SNP	1	T
SCN1A	6323	genome.wustl.edu	37	2	166852529	166852529	+	Silent	SNP	T	T	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr2:166852529T>A	ENST00000303395.4	-	24	4574	c.4575A>T	c.(4573-4575)cgA>cgT	p.R1525R	AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000409050.1_Silent_p.R1497R|SCN1A_ENST00000375405.3_Silent_p.R1514R|SCN1A_ENST00000423058.2_Silent_p.R1525R|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1525					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.R1514R(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTACTCCTGGTCGAGGTATAG	0.343																																																1	Substitution - coding silent(1)	ovary(1)	2											116.0	112.0	113.0					2																	166852529		2203	4299	6502	166560775	SO:0001819	synonymous_variant	6323			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4575A>T	2.37:g.166852529T>A		Somatic		Capture	Illumina GAIIx	4	166560775	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	HMMPfam_IQ;HMMPfam_Ion_trans;HMMPfam_Na_trans_assoc;superfamily_EF-hand;superfamily_Voltage-gated potassium channels	p.R1514	ENST00000303395.4	37	c.4542	CCDS54413.1	2																																																																																			-	NULL		0.343	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	protein_coding	OTTHUMT00000102661.1	T	NM_006920		166560775	-1	no_errors	NM_006920	genbank	human	validated	54_36p	silent	SNP	1	A
TTN	7273	genome.wustl.edu	37	2	179616505	179616505	+	Intron	SNP	T	T	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr2:179616505T>A	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.N3541I|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.N3541I(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGGGCCGATTGTTATGAAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											81.0	82.0	82.0					2																	179616505		2203	4300	6503	179324750	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+1345A>T	2.37:g.179616505T>A		Somatic		Capture	Illumina GAIIx	4	179324750	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	HMMPfam_I-set,HMMPfam_ig,HMMPfam_Titin_Z,superfamily_Immunoglobulin,superfamily_beta-sandwich domain of Sec23/24	p.N3541I	ENST00000591111.1	37	c.10622		2	.	.	.	.	.	.	.	.	.	.	T	13.71	2.317138	0.40996	.	.	ENSG00000155657	ENST00000360870	T	0.45668	0.89	5.86	3.49	0.39957	.	.	.	.	.	T	0.65186	0.2667	M	0.88570	2.965	0.80722	D	1	P	0.50369	0.934	P	0.60286	0.872	T	0.67150	-0.5743	9	0.59425	D	0.04	.	12.2643	0.54668	0.0:0.128:0.0:0.872	.	3541	Q8WZ42-6	.	I	3541	ENSP00000354117:N3541I	ENSP00000354117:N3541I	N	-	2	0	TTN	179324750	1.000000	0.71417	0.341000	0.25589	0.621000	0.37620	2.894000	0.48640	0.137000	0.18759	-1.139000	0.01908	AAT	-	HMMPfam_I-set		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378		179324750	-1	no_errors	NM_133379	genbank	human	reviewed	54_36p	missense	SNP	0.93	A
RHBDD1	84236	genome.wustl.edu	37	2	227778996	227778996	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr2:227778996A>G	ENST00000341329.3	+	6	1027	c.785A>G	c.(784-786)gAc>gGc	p.D262G	RHBDD1_ENST00000392062.2_Missense_Mutation_p.D262G|RHBDD1_ENST00000409053.1_Missense_Mutation_p.D96G|RHBDD1_ENST00000493526.1_3'UTR	NM_032276.3	NP_115652.2	Q8TEB9	RHBL4_HUMAN	rhomboid domain containing 1	262					apoptotic process (GO:0006915)|cellular response to unfolded protein (GO:0034620)|cellular response to UV (GO:0034644)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|membrane protein intracellular domain proteolysis (GO:0031293)|membrane protein proteolysis (GO:0033619)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein processing (GO:0010954)|positive regulation of secretion (GO:0051047)|post-translational protein modification (GO:0043687)|spermatid differentiation (GO:0048515)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of endoplasmic reticulum membrane (GO:0030176)|mitochondrion (GO:0005739)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.D262G(1)		breast(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		AGGAACTATGACACGTACACA	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											123.0	119.0	121.0					2																	227778996		2203	4300	6503	227487240	SO:0001583	missense	84236			AK074258	CCDS2464.1	2q36.3	2012-07-09			ENSG00000144468	ENSG00000144468			23081	protein-coding gene	gene with protein product						12838346	Standard	NM_032276		Approved	DKFZp547E052	uc002voi.3	Q8TEB9	OTTHUMG00000133178	ENST00000341329.3:c.785A>G	2.37:g.227778996A>G	ENSP00000344779:p.Asp262Gly	Somatic		Capture	Illumina GAIIx	4	227487240	Q495B9|Q53S43|Q5EBM8|Q6P5V8|Q8IV60|Q9H057	Missense_Mutation	SNP	HMMPfam_Rhomboid	p.D262G	ENST00000341329.3	37	c.785	CCDS2464.1	2	.	.	.	.	.	.	.	.	.	.	A	11.52	1.662232	0.29515	.	.	ENSG00000144468	ENST00000341329;ENST00000392062;ENST00000409053	T;T	0.45668	0.89;0.89	6.06	4.9	0.64082	.	0.326994	0.34676	N	0.003766	T	0.43366	0.1244	L	0.56769	1.78	0.23314	N	0.997922	P;B	0.51351	0.944;0.009	P;B	0.47075	0.536;0.005	T	0.31251	-0.9950	10	0.27082	T	0.32	-11.713	10.4493	0.44513	0.8366:0.1634:0.0:0.0	.	53;262	Q8TEB9-2;Q8TEB9	.;RHBD1_HUMAN	G	262;262;96	ENSP00000344779:D262G;ENSP00000375914:D262G	ENSP00000344779:D262G	D	+	2	0	RHBDD1	227487240	0.761000	0.28439	0.194000	0.23346	0.426000	0.31534	2.084000	0.41625	1.087000	0.41251	0.528000	0.53228	GAC	-	NULL		0.488	RHBDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDD1	protein_coding	OTTHUMT00000256885.2	A			227487240	1	no_errors	NM_032276	genbank	human	provisional	54_36p	missense	SNP	0.65	G
SP110	3431	genome.wustl.edu	37	2	231036820	231036820	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr2:231036820T>A	ENST00000358662.4	-	16	1855	c.1777A>T	c.(1777-1779)Aag>Tag	p.K593*	SP110_ENST00000258381.6_Nonsense_Mutation_p.K593*|AC009950.2_ENST00000609120.1_RNA|AC009950.2_ENST00000600787.1_RNA|AC009950.2_ENST00000595586.2_RNA|AC009950.2_ENST00000594622.1_RNA|AC009950.2_ENST00000454058.1_RNA	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	593	Bromo.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.K593*(1)		breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		TCCAGGGTCTTAGATACATGA	0.522																																																1	Substitution - Nonsense(1)	ovary(1)	2											162.0	151.0	155.0					2																	231036820		2203	4300	6503	230745064	SO:0001587	stop_gained	3431			L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.1777A>T	2.37:g.231036820T>A	ENSP00000351488:p.Lys593*	Somatic		Capture	Illumina GAIIx	4	230745064	B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Nonsense_Mutation	SNP	HMMPfam_SAND;HMMPfam_Bromodomain;HMMPfam_PHD;HMMPfam_Sp100;superfamily_SAND domain-like;superfamily_FYVE/PHD zinc finger;superfamily_Bromodomain	p.K593*	ENST00000358662.4	37	c.1777	CCDS2474.1	2	.	.	.	.	.	.	.	.	.	.	T	35	5.532640	0.96446	.	.	ENSG00000135899	ENST00000258381;ENST00000358662	.	.	.	3.42	1.29	0.21616	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	3.7056	0.08400	0.0:0.5852:0.2591:0.1556	.	.	.	.	X	593	.	ENSP00000258381:K593X	K	-	1	0	SP110	230745064	0.023000	0.18921	0.027000	0.17364	0.020000	0.10135	-0.045000	0.12003	0.707000	0.31934	-0.468000	0.05107	AAG	-	NULL		0.522	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SP110	protein_coding	OTTHUMT00000332414.1	T	NM_080424		230745064	-1	no_errors	NM_080424	genbank	human	reviewed	54_36p	nonsense	SNP	0.01	A
PPM1F	9647	genome.wustl.edu	37	22	22287785	22287785	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr22:22287785A>G	ENST00000263212.5	-	5	830	c.725T>C	c.(724-726)tTt>tCt	p.F242S	PPM1F_ENST00000397495.4_Missense_Mutation_p.F242S|PPM1F_ENST00000407142.1_Missense_Mutation_p.F74S|PPM1F_ENST00000538191.1_Missense_Mutation_p.F138S	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	242					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)	p.F242S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		TTTCCTGAGAAACATCTGGTC	0.647																																																1	Substitution - Missense(1)	ovary(1)	22											51.0	48.0	49.0					22																	22287785		2203	4300	6503	20617785	SO:0001583	missense	9647			D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.725T>C	22.37:g.22287785A>G	ENSP00000263212:p.Phe242Ser	Somatic		Capture	Illumina GAIIx	4	20617785	A8K6G3|B7Z2C3|Q96PM2	Missense_Mutation	SNP	HMMPfam_PP2C,superfamily_Protein serine/threonine phosphatase 2C catalytic domain	p.F242S	ENST00000263212.5	37	c.725	CCDS13796.1	22	.	.	.	.	.	.	.	.	.	.	A	17.34	3.364670	0.61513	.	.	ENSG00000100034	ENST00000263212;ENST00000407142;ENST00000406981;ENST00000538191;ENST00000397495;ENST00000445205	T;T;T;T;T	0.10960	2.82;2.82;2.82;2.82;2.82	4.81	4.81	0.61882	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.38348	0.1037	M	0.86805	2.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.996;0.999	T	0.43702	-0.9375	10	0.87932	D	0	-5.8303	14.53	0.67917	1.0:0.0:0.0:0.0	.	138;242;242	B7Z2C3;A8MX49;P49593	.;.;PPM1F_HUMAN	S	242;74;74;138;242;74	ENSP00000263212:F242S;ENSP00000384930:F74S;ENSP00000439915:F138S;ENSP00000380632:F242S;ENSP00000392372:F74S	ENSP00000263212:F242S	F	-	2	0	PPM1F	20617785	1.000000	0.71417	0.996000	0.52242	0.094000	0.18550	8.920000	0.92779	2.025000	0.59659	0.459000	0.35465	TTT	-	HMMPfam_PP2C		0.647	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1F	protein_coding	OTTHUMT00000320267.2	A	NM_014634		20617785	-1	no_errors	NM_014634	genbank	human	reviewed	54_36p	missense	SNP	0.992	G
PHF21B	112885	genome.wustl.edu	37	22	45291957	45291957	+	Missense_Mutation	SNP	C	C	T	rs114160106		TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr22:45291957C>T	ENST00000313237.5	-	6	988	c.838G>A	c.(838-840)Gcc>Acc	p.A280T	PHF21B_ENST00000403565.1_Missense_Mutation_p.A76T|PHF21B_ENST00000396103.3_Missense_Mutation_p.A238T|PHF21B_ENST00000447824.3_Missense_Mutation_p.A226T|PHF21B_ENST00000404079.2_Missense_Mutation_p.A226T	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	280							zinc ion binding (GO:0008270)	p.A280T(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		ACCATGAAGGCGATTTTCTGA	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		22545	0.001		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|kidney(1)	22											207.0	177.0	187.0					22																	45291957		2203	4300	6503	43670621	SO:0001583	missense	112885			AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.838G>A	22.37:g.45291957C>T	ENSP00000324403:p.Ala280Thr	Somatic		Capture	Illumina GAIIx	4	43670621	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	HMMPfam_PHD;superfamily_FYVE/PHD zinc finger	p.A280T	ENST00000313237.5	37	c.838	CCDS14061.1	22	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	31	5.086356	0.94100	.	.	ENSG00000056487	ENST00000403565;ENST00000313237;ENST00000396103;ENST00000404079;ENST00000447824;ENST00000414269	T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000003	T	0.70202	0.3197	L	0.57536	1.79	0.53005	D	0.999965	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.997;0.999;0.998;0.997;0.997	T	0.73170	-0.4067	10	0.87932	D	0	-22.9051	17.5745	0.87944	0.0:1.0:0.0:0.0	.	226;238;226;280;76	B7Z657;Q96EK2-3;B7Z4F8;Q96EK2;B1AHC5	.;.;.;PF21B_HUMAN;.	T	76;280;238;226;226;76	ENSP00000385053:A76T;ENSP00000324403:A280T;ENSP00000379410:A238T;ENSP00000385105:A226T;ENSP00000388619:A226T;ENSP00000401091:A76T	ENSP00000324403:A280T	A	-	1	0	PHF21B	43670621	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.541000	0.73865	2.412000	0.81896	0.563000	0.77884	GCC	-	NULL		0.522	PHF21B-001	KNOWN	basic|CCDS	protein_coding	PHF21B	protein_coding	OTTHUMT00000321731.2	C	NM_138415		43670621	-1	no_errors	NM_138415	genbank	human	validated	54_36p	missense	SNP	1	T
TTLL8	164714	genome.wustl.edu	37	22	50479675	50479675	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr22:50479675T>C	ENST00000266182.6	-	8	861	c.862A>G	c.(862-864)Atc>Gtc	p.I288V	TTLL8_ENST00000440475.1_Intron			A6PVC2	TTLL8_HUMAN	tubulin tyrosine ligase-like family, member 8	317	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)	p.I288V(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(4)	12		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		ATTTTGAAGATGCACAAGACA	0.567																																																1	Substitution - Missense(1)	ovary(1)	22											149.0	160.0	157.0					22																	50479675		1960	4155	6115	48821802	SO:0001583	missense	164714					22q13.33	2013-02-14			ENSG00000138892	ENSG00000138892		"""Tubulin tyrosine ligase-like family"""	34000	protein-coding gene	gene with protein product						15890843	Standard	XM_003403745		Approved			A6PVC2	OTTHUMG00000150241	ENST00000266182.6:c.862A>G	22.37:g.50479675T>C	ENSP00000266182:p.Ile288Val	Somatic		Capture	Illumina GAIIx	4	48821802	B5MDV0	Missense_Mutation	SNP	-	p.I288V	ENST00000266182.6	37	c.862		22	.	.	.	.	.	.	.	.	.	.	T	1.120	-0.655490	0.03480	.	.	ENSG00000138892	ENST00000266182	T	0.04156	3.69	2.1	-0.538	0.11868	.	3.869540	0.02509	U	0.091310	T	0.02929	0.0087	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.40961	-0.9535	9	0.19590	T	0.45	.	2.8342	0.05509	0.2378:0.0:0.3455:0.4167	.	288	B5MDV0	.	V	288	ENSP00000266182:I288V	ENSP00000266182:I288V	I	-	1	0	TTLL8	48821802	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.255000	0.02872	-0.183000	0.10585	-0.686000	0.03744	ATC	-	NULL		0.567	TTLL8-201	KNOWN	basic|appris_candidate_longest	protein_coding	TTLL8	protein_coding		T	NM_001080447		48821802	-1	no_errors	NM_001080447	genbank	human	provisional	54_36p	missense	SNP		C
MOV10L1	54456	genome.wustl.edu	37	22	50563959	50563959	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr22:50563959G>T	ENST00000262794.5	+	11	1791	c.1708G>T	c.(1708-1710)Gtc>Ttc	p.V570F	MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000540615.1_Missense_Mutation_p.V550F|MOV10L1_ENST00000545383.1_Missense_Mutation_p.V570F|MOV10L1_ENST00000395858.3_Missense_Mutation_p.V570F	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	570					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)	p.V570F(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GGTTCTGGAGGTCCCAGGGTT	0.483																																																1	Substitution - Missense(1)	ovary(1)	22											134.0	135.0	134.0					22																	50563959		2203	4300	6503	48906086	SO:0001583	missense	54456			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.1708G>T	22.37:g.50563959G>T	ENSP00000262794:p.Val570Phe	Somatic		Capture	Illumina GAIIx	4	48906086	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases	p.V570F	ENST00000262794.5	37	c.1708	CCDS14084.1	22	.	.	.	.	.	.	.	.	.	.	G	19.27	3.795243	0.70452	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615	D;D;D;D	0.93547	-3.06;-3.06;-2.65;-3.24	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.97049	0.9036	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.83275	0.996;0.991;0.979;0.979	D	0.97476	1.0044	10	0.87932	D	0	-39.7167	18.3108	0.90199	0.0:0.0:1.0:0.0	.	331;550;570;570	B7Z893;F5H403;A8MXC6;Q9BXT6	.;.;.;M10L1_HUMAN	F	570;570;570;550	ENSP00000438978:V570F;ENSP00000262794:V570F;ENSP00000379199:V570F;ENSP00000438542:V550F	ENSP00000262794:V570F	V	+	1	0	MOV10L1	48906086	1.000000	0.71417	1.000000	0.80357	0.420000	0.31355	7.303000	0.78871	2.679000	0.91253	0.544000	0.68410	GTC	-	NULL		0.483	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	protein_coding	OTTHUMT00000075009.2	G	NM_018995		48906086	1	no_errors	NM_018995	genbank	human	reviewed	54_36p	missense	SNP	1	T
ARHGAP31	57514	genome.wustl.edu	37	3	119133103	119133103	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr3:119133103A>C	ENST00000264245.4	+	12	2859	c.2327A>C	c.(2326-2328)aAt>aCt	p.N776T		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	776	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)	p.N776T(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GGCCCAGGCAATCTGTCTCCT	0.582																																					Pancreas(7;176 297 5394 51128 51241)											1	Substitution - Missense(1)	ovary(1)	3											54.0	58.0	56.0					3																	119133103		1948	4147	6095	120615793	SO:0001583	missense	57514				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2327A>C	3.37:g.119133103A>C	ENSP00000264245:p.Asn776Thr	Somatic		Capture	Illumina GAIIx	4	120615793	Q9ULL6	Missense_Mutation	SNP	-	p.N776T	ENST00000264245.4	37	c.2327	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	A	13.78	2.340695	0.41498	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.07327	3.2	5.3	4.11	0.48088	.	0.363586	0.26522	N	0.023912	T	0.06690	0.0171	L	0.29908	0.895	0.09310	N	1	B	0.32573	0.376	B	0.30401	0.115	T	0.26677	-1.0096	10	0.72032	D	0.01	.	9.3552	0.38161	0.9175:0.0:0.0825:0.0	.	776	Q2M1Z3	RHG31_HUMAN	T	776	ENSP00000264245:N776T	ENSP00000264245:N776T	N	+	2	0	ARHGAP31	120615793	0.087000	0.21565	0.024000	0.17045	0.101000	0.19017	1.302000	0.33459	2.225000	0.72522	0.533000	0.62120	AAT	-	NULL		0.582	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDGAP	protein_coding	OTTHUMT00000354942.2	A			120615793	1	no_errors	NM_020754	genbank	human	reviewed	54_36p	missense	SNP	0.02	C
HPS3	84343	genome.wustl.edu	37	3	148885694	148885694	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr3:148885694A>C	ENST00000296051.2	+	16	2951	c.2811A>C	c.(2809-2811)aaA>aaC	p.K937N	HPS3_ENST00000460120.1_Missense_Mutation_p.K772N	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	937					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)		p.K937N(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TGTGGTGGAAAAAACTGTTGC	0.318									Hermansky-Pudlak syndrome																																							1	Substitution - Missense(1)	ovary(1)	3											91.0	96.0	94.0					3																	148885694		2203	4299	6502	150368384	SO:0001583	missense	84343	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.2811A>C	3.37:g.148885694A>C	ENSP00000296051:p.Lys937Asn	Somatic		Capture	Illumina GAIIx	4	150368384	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	-	p.K937N	ENST00000296051.2	37	c.2811	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	A	12.38	1.920076	0.33908	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.66460	-0.21;-0.21	5.68	2.07	0.26955	.	0.235751	0.50627	D	0.000103	T	0.41903	0.1179	L	0.27053	0.805	0.80722	D	1	B;B	0.28880	0.226;0.126	B;B	0.21151	0.033;0.018	T	0.13683	-1.0500	10	0.27785	T	0.31	-16.7649	1.3034	0.02083	0.453:0.1851:0.2403:0.1217	.	772;937	G5E9V4;Q969F9	.;HPS3_HUMAN	N	937;772	ENSP00000296051:K937N;ENSP00000418230:K772N	ENSP00000296051:K937N	K	+	3	2	HPS3	150368384	0.997000	0.39634	1.000000	0.80357	0.939000	0.58152	0.386000	0.20702	0.431000	0.26258	0.528000	0.53228	AAA	-	NULL		0.318	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	protein_coding	OTTHUMT00000356151.1	A	NM_032383		150368384	1	no_errors	NM_032383	genbank	human	reviewed	54_36p	missense	SNP	1	C
CP	1356	genome.wustl.edu	37	3	148930323	148930323	+	Silent	SNP	A	A	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr3:148930323A>G	ENST00000264613.6	-	2	571	c.309T>C	c.(307-309)gaT>gaC	p.D103D		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	103	F5/8 type A 1.|Plastocyanin-like 1.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.D103D(1)		breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	CATAAACTTTATCTCCAGTTT	0.388																																																1	Substitution - coding silent(1)	ovary(1)	3											119.0	120.0	119.0					3																	148930323		2203	4300	6503	150413013	SO:0001819	synonymous_variant	1356			M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.309T>C	3.37:g.148930323A>G		Somatic		Capture	Illumina GAIIx	4	150413013	Q14063|Q2PP18|Q9UKS4	Silent	SNP	superfamily_Cupredoxins;HMMPfam_Cu-oxidase_2;HMMPfam_Cu-oxidase_3;HMMPfam_Cu-oxidase	p.D103	ENST00000264613.6	37	c.309	CCDS3141.1	3																																																																																			-	HMMPfam_Cu-oxidase_3		0.388	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CP	protein_coding	OTTHUMT00000317498.1	A	NM_000096		150413013	-1	no_errors	NM_000096	genbank	human	reviewed	54_36p	silent	SNP	0.04	G
CNTN4	152330	genome.wustl.edu	37	3	3030054	3030054	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr3:3030054C>T	ENST00000397461.1	+	13	1768	c.1384C>T	c.(1384-1386)Ctc>Ttc	p.L462F	CNTN4_ENST00000448906.2_Missense_Mutation_p.L134F|CNTN4_ENST00000358480.3_Missense_Mutation_p.L243F|CNTN4_ENST00000418658.1_Missense_Mutation_p.L462F|CNTN4_ENST00000427331.1_Missense_Mutation_p.L462F|CNTN4_ENST00000397459.2_Missense_Mutation_p.L134F|CNTN4_ENST00000475817.1_3'UTR	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	462	Ig-like C2-type 5.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.L134F(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		AGATGGAAACCTCAGAATCAT	0.358																																																1	Substitution - Missense(1)	ovary(1)	3											86.0	86.0	86.0					3																	3030054		2203	4300	6503	3005054	SO:0001583	missense	152330			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.1384C>T	3.37:g.3030054C>T	ENSP00000380602:p.Leu462Phe	Somatic		Capture	Illumina GAIIx	4	3005054	B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	fn3;HMMPfam_fn3;I-set;HMMPfam_I-set;ig;HMMPfam_ig	p.L462F	ENST00000397461.1	37	c.1384	CCDS43041.1	3	.	.	.	.	.	.	.	.	.	.	C	24.5	4.533869	0.85812	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67;-0.67;-0.67	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.85894	0.5803	M	0.89030	3	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.996;0.997	D	0.87623	0.2511	10	0.87932	D	0	.	13.5594	0.61779	0.0:0.9289:0.0:0.0711	.	462;462;462	Q8IWV2-3;B3KTK4;Q8IWV2	.;.;CNTN4_HUMAN	F	462;462;462;243;134;134	ENSP00000396010:L462F;ENSP00000380602:L462F;ENSP00000413642:L462F;ENSP00000351267:L243F;ENSP00000380600:L134F;ENSP00000392077:L134F	ENSP00000351267:L243F	L	+	1	0	CNTN4	3005054	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.576000	0.67437	2.885000	0.99019	0.655000	0.94253	CTC	-	HMMPfam_I-set		0.358	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	protein_coding	OTTHUMT00000239236.2	C			3005054	1	no_errors	NM_175607	genbank	human	reviewed	54_36p	missense	SNP	1	T
AZI2	64343	genome.wustl.edu	37	3	28380107	28380107	+	Splice_Site	SNP	C	C	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr3:28380107C>G	ENST00000479665.1	-	3	748		c.e3-1		AZI2_ENST00000295748.3_Splice_Site|AZI2_ENST00000334100.6_Splice_Site|AZI2_ENST00000457172.1_Splice_Site|AZI2_ENST00000420543.2_Splice_Site	NM_022461.3	NP_071906.1	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2						dendritic cell differentiation (GO:0097028)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-alpha production (GO:0032607)|interferon-gamma production (GO:0032609)|interleukin-6 production (GO:0032635)|mitotic cell cycle (GO:0000278)|T cell activation (GO:0042110)|tumor necrosis factor production (GO:0032640)	cytoplasm (GO:0005737)		p.?(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15						GAGCTATTAGCTAACGGTATG	0.343																																																1	Unknown(1)	ovary(1)	3											82.0	74.0	77.0					3																	28380107		2201	4300	6501	28355111	SO:0001630	splice_region_variant	64343			AC093142	CCDS2647.1, CCDS46782.1, CCDS46783.1	3p23	2006-03-01			ENSG00000163512	ENSG00000163512			24002	protein-coding gene	gene with protein product		609916				10580148	Standard	NM_001134432		Approved	NAP1, FLJ21939, AZ2	uc003ceb.4	Q9H6S1	OTTHUMG00000130573	ENST00000479665.1:c.217-1G>C	3.37:g.28380107C>G		Somatic		Capture	Illumina GAIIx	4	28355111	A8K3M2|C9JB40|H7BXU6|Q86W99|Q9BQF1	Splice_Site	SNP	-	e2-1	ENST00000479665.1	37	c.217-1	CCDS2647.1	3	.	.	.	.	.	.	.	.	.	.	C	14.82	2.650147	0.47362	.	.	ENSG00000163512	ENST00000479665;ENST00000334100;ENST00000420543;ENST00000457172;ENST00000414162;ENST00000415852	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.98	0.86324	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AZI2	28355111	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	3.488000	0.53229	2.699000	0.92147	0.591000	0.81541	.	-	-		0.343	AZI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZI2	protein_coding	OTTHUMT00000252998.2	C	NM_203326	Intron	28355111	-1	no_errors	NM_022461	genbank	human	validated	54_36p	splice_site	SNP	1	G
SCN10A	6336	genome.wustl.edu	37	3	38793973	38793973	+	Missense_Mutation	SNP	G	G	A	rs377467259		TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr3:38793973G>A	ENST00000449082.2	-	11	1491	c.1492C>T	c.(1492-1494)Cgg>Tgg	p.R498W		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	498					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R498W(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TGACTAGCCCGGCGTTTTCCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	3						G	TRP/ARG	0,4406		0,0,2203	27.0	30.0	29.0		1492	0.4	1.0	3		29	1,8599	1.2+/-3.3	0,1,4299	no	missense	SCN10A	NM_006514.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	498/1957	38793973	1,13005	2203	4300	6503	38768977	SO:0001583	missense	6336			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.1492C>T	3.37:g.38793973G>A	ENSP00000390600:p.Arg498Trp	Somatic		Capture	Illumina GAIIx	4	38768977	A6NDQ1	Missense_Mutation	SNP	-	p.R498W	ENST00000449082.2	37	c.1492	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	G	17.51	3.407818	0.62399	0.0	1.16E-4	ENSG00000185313	ENST00000449082	D	0.96745	-4.11	4.8	0.377	0.16198	.	1.287940	0.05801	N	0.612182	D	0.97445	0.9164	L	0.56769	1.78	0.24767	N	0.992891	D	0.89917	1.0	D	0.63957	0.92	D	0.91242	0.5022	10	0.87932	D	0	.	15.8281	0.78730	0.0:0.0:0.3752:0.6247	.	498	Q9Y5Y9	SCNAA_HUMAN	W	498	ENSP00000390600:R498W	ENSP00000390600:R498W	R	-	1	2	SCN10A	38768977	0.549000	0.26481	0.985000	0.45067	0.912000	0.54170	0.212000	0.17497	0.248000	0.21435	0.455000	0.32223	CGG	-	NULL		0.552	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	protein_coding	OTTHUMT00000109745.3	G	NM_006514		38768977	-1	no_errors	NM_006514	genbank	human	validated	54_36p	missense	SNP	0.877	A
BSN	8927	genome.wustl.edu	37	3	49695017	49695017	+	Silent	SNP	G	G	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr3:49695017G>A	ENST00000296452.4	+	5	8142	c.8028G>A	c.(8026-8028)acG>acA	p.T2676T		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2676					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.T2676T(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CCGTGCAGACGGAGCCTGACC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	3											45.0	46.0	46.0					3																	49695017		2203	4300	6503	49670021	SO:0001819	synonymous_variant	8927			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.8028G>A	3.37:g.49695017G>A		Somatic		Capture	Illumina GAIIx	4	49670021	O43161|Q7LGH3	Silent	SNP	HMMPfam_zf-piccolo;superfamily_Actin-crosslinking proteins;superfamily_FYVE/PHD zinc finger	p.T2676	ENST00000296452.4	37	c.8028	CCDS2800.1	3																																																																																			-	NULL		0.607	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	protein_coding	OTTHUMT00000258164.1	G	NM_003458		49670021	1	no_errors	NM_003458	genbank	human	validated	54_36p	silent	SNP	0.7	A
LRCH3	84859	genome.wustl.edu	37	3	197559135	197559135	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr3:197559135G>C	ENST00000425562.2	+	8	1049	c.1049G>C	c.(1048-1050)aGa>aCa	p.R350T	LRCH3_ENST00000414675.2_Missense_Mutation_p.R350T|LRCH3_ENST00000441090.2_Missense_Mutation_p.R224T|LRCH3_ENST00000438796.2_Missense_Mutation_p.R350T|AC055764.1_ENST00000454526.1_RNA|LRCH3_ENST00000536618.1_5'UTR|LRCH3_ENST00000334859.4_Missense_Mutation_p.R350T			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	350						cytoplasm (GO:0005737)|extracellular region (GO:0005576)		p.R350T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		AGACTACGAAGAGAAAGCCAG	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											86.0	81.0	83.0					3																	197559135		2203	4300	6503	199043532	SO:0001583	missense	84859			AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.1049G>C	3.37:g.197559135G>C	ENSP00000393579:p.Arg350Thr	Somatic		Capture	Illumina GAIIx	4	199043532	B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	HMMPfam_LRR_1;superfamily_Calponin-homology domain CH-domain;superfamily_L domain-like	p.R350T	ENST00000425562.2	37	c.1049		3	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975941	0.92982	.	.	ENSG00000186001	ENST00000438796;ENST00000441090;ENST00000414675;ENST00000334859;ENST00000425562	T;T;T;T;T	0.32988	2.01;1.43;2.05;2.26;2.03	5.51	5.51	0.81932	.	0.051413	0.85682	D	0.000000	T	0.47432	0.1445	L	0.34521	1.04	0.80722	D	1	D;D;D;B	0.89917	1.0;0.997;0.994;0.198	D;D;D;B	0.77004	0.959;0.989;0.925;0.171	T	0.40251	-0.9573	10	0.52906	T	0.07	-14.7564	19.4531	0.94876	0.0:0.0:1.0:0.0	.	224;350;350;350	E9PD99;B4E0T7;Q96II8-2;Q96II8-3	.;.;.;.	T	350;224;350;350;350	ENSP00000399751:R350T;ENSP00000394609:R224T;ENSP00000394965:R350T;ENSP00000334375:R350T;ENSP00000393579:R350T	ENSP00000334375:R350T	R	+	2	0	LRCH3	199043532	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	8.428000	0.90278	2.601000	0.87937	0.585000	0.79938	AGA	-	NULL		0.398	LRCH3-006	KNOWN	basic	protein_coding	LRCH3	protein_coding	OTTHUMT00000339965.1	G	NM_032773		199043532	1	no_errors	NM_032773	genbank	human	provisional	54_36p	missense	SNP	1	C
CENPE	1062	genome.wustl.edu	37	4	104030037	104030037	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr4:104030037A>G	ENST00000265148.3	-	48	8023	c.7934T>C	c.(7933-7935)tTt>tCt	p.F2645S	CENPE_ENST00000380026.3_Missense_Mutation_p.F2524S	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2645	Globular autoinhibitory domain. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.F2608S(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TCGGCTATCAAAAAAACAAGA	0.373																																																1	Substitution - Missense(1)	ovary(1)	4											167.0	165.0	166.0					4																	104030037		2203	4300	6503	104249486	SO:0001583	missense	1062			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.7934T>C	4.37:g.104030037A>G	ENSP00000265148:p.Phe2645Ser	Somatic		Capture	Illumina GAIIx	4	104249486	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	HMMPfam_Kinesin;superfamily_Domain of the SRP/SRP receptor G-proteins;superfamily_STAT;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.F2645S	ENST00000265148.3	37	c.7934	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	A	15.57	2.872802	0.51695	.	.	ENSG00000138778	ENST00000265148;ENST00000380026	T;T	0.76186	-1.0;-0.95	5.19	3.95	0.45737	.	.	.	.	.	T	0.81470	0.4829	M	0.63843	1.955	0.19775	N	0.999954	D;B	0.71674	0.998;0.275	D;B	0.66351	0.943;0.076	T	0.69957	-0.5004	9	0.87932	D	0	.	8.4117	0.32646	0.8272:0.0:0.0:0.1728	.	2524;2645	Q02224-3;Q02224	.;CENPE_HUMAN	S	2645;2524	ENSP00000265148:F2645S;ENSP00000369365:F2524S	ENSP00000265148:F2645S	F	-	2	0	CENPE	104249486	0.996000	0.38824	0.531000	0.27976	0.562000	0.35680	1.204000	0.32296	1.959000	0.56917	0.533000	0.62120	TTT	-	NULL		0.373	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	protein_coding		A			104249486	-1	no_errors	NM_001813	genbank	human	validated	54_36p	missense	SNP	0.15	G
MGST2	4258	genome.wustl.edu	37	4	140625270	140625270	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr4:140625270A>T	ENST00000265498.1	+	5	664	c.412A>T	c.(412-414)Aat>Tat	p.N138Y	MGST2_ENST00000506797.1_3'UTR|MGST2_ENST00000515137.1_3'UTR	NM_001204366.1|NM_002413.4	NP_001191295.1|NP_002404.1	Q99735	MGST2_HUMAN	microsomal glutathione S-transferase 2	138					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|leukotriene biosynthetic process (GO:0019370)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)|glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|leukotriene-C4 synthase activity (GO:0004464)	p.N138Y(1)		lung(1)|ovary(1)	2	all_hematologic(180;0.162)				Busulfan(DB01008)|Glutathione(DB00143)	TCTGGACCTCAATATTGCCAA	0.448																																																1	Substitution - Missense(1)	ovary(1)	4											119.0	113.0	115.0					4																	140625270		2203	4300	6503	140844720	SO:0001583	missense	4258			U77604	CCDS3749.1, CCDS56339.1	4q28.3	2012-06-21			ENSG00000085871	ENSG00000085871	2.5.1.18	"""Glutathione S-transferases / Microsomal"""	7063	protein-coding gene	gene with protein product		601733				8703034	Standard	NM_002413		Approved	MGST-II	uc003ihy.3	Q99735	OTTHUMG00000133382	ENST00000265498.1:c.412A>T	4.37:g.140625270A>T	ENSP00000265498:p.Asn138Tyr	Somatic		Capture	Illumina GAIIx	4	140844720	D6RBB5|Q7Z5B8	Missense_Mutation	SNP	HMMPfam_MAPEG	p.N138Y	ENST00000265498.1	37	c.412	CCDS3749.1	4	.	.	.	.	.	.	.	.	.	.	A	17.98	3.519782	0.64634	.	.	ENSG00000085871	ENST00000265498	T	0.65549	-0.16	5.6	-3.48	0.04739	.	1.630570	0.03380	N	0.200329	T	0.53270	0.1786	L	0.50333	1.59	0.09310	N	1	B	0.26318	0.146	B	0.21917	0.037	T	0.44802	-0.9304	10	0.66056	D	0.02	-4.336	6.0493	0.19777	0.3364:0.331:0.3326:0.0	.	138	Q99735	MGST2_HUMAN	Y	138	ENSP00000265498:N138Y	ENSP00000265498:N138Y	N	+	1	0	MGST2	140844720	0.000000	0.05858	0.000000	0.03702	0.848000	0.48234	0.036000	0.13819	-0.891000	0.03940	0.533000	0.62120	AAT	-	NULL		0.448	MGST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGST2	protein_coding	OTTHUMT00000257232.2	A	NM_002413		140844720	1	no_errors	NM_002413	genbank	human	reviewed	54_36p	missense	SNP	0.01	T
AASDH	132949	genome.wustl.edu	37	4	57204629	57204629	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr4:57204629A>G	ENST00000205214.6	-	15	3416	c.3236T>C	c.(3235-3237)aTt>aCt	p.I1079T	AASDH_ENST00000434343.2_Missense_Mutation_p.I594T|AASDH_ENST00000513376.1_Missense_Mutation_p.I979T|AASDH_ENST00000451613.1_3'UTR	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	1079					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)	p.I1079T(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				ACACCCAATAATGAGCATTGA	0.353																																																1	Substitution - Missense(1)	ovary(1)	4											68.0	69.0	68.0					4																	57204629		2203	4300	6503	56899386	SO:0001583	missense	132949			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.3236T>C	4.37:g.57204629A>G	ENSP00000205214:p.Ile1079Thr	Somatic		Capture	Illumina GAIIx	4	56899386	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	-	p.I1079T	ENST00000205214.6	37	c.3236	CCDS3504.1	4	.	.	.	.	.	.	.	.	.	.	A	18.07	3.541888	0.65198	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000434343	T;T;T	0.58506	0.33;0.33;0.33	6.04	6.04	0.98038	Quinonprotein alcohol dehydrogenase-like (2);	0.357028	0.33772	N	0.004576	T	0.54175	0.1842	M	0.66939	2.045	0.80722	D	1	P	0.38922	0.651	B	0.27887	0.084	T	0.61811	-0.6986	10	0.72032	D	0.01	-7.5725	16.6244	0.84952	1.0:0.0:0.0:0.0	.	1079	Q4L235	ACSF4_HUMAN	T	1079;979;594	ENSP00000205214:I1079T;ENSP00000423760:I979T;ENSP00000392158:I594T	ENSP00000205214:I1079T	I	-	2	0	AASDH	56899386	0.991000	0.36638	0.938000	0.37757	0.997000	0.91878	4.686000	0.61700	2.323000	0.78572	0.529000	0.55759	ATT	-	NULL		0.353	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDH	protein_coding	OTTHUMT00000250780.1	A	NM_181806		56899386	-1	no_errors	NM_181806	genbank	human	validated	54_36p	missense	SNP	0.99	G
SLC4A4	8671	genome.wustl.edu	37	4	72316985	72316985	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr4:72316985A>T	ENST00000264485.5	+	11	1406	c.1289A>T	c.(1288-1290)cAt>cTt	p.H430L	SLC4A4_ENST00000425175.1_Missense_Mutation_p.H430L|SLC4A4_ENST00000512686.1_Missense_Mutation_p.H386L|SLC4A4_ENST00000351898.6_Missense_Mutation_p.H430L|SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000340595.3_Missense_Mutation_p.H386L	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	430					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.H386L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	GGAGGAGGACATGGGGATTGT	0.453																																																1	Substitution - Missense(1)	ovary(1)	4											223.0	179.0	194.0					4																	72316985		2203	4300	6503	72535849	SO:0001583	missense	8671			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.1289A>T	4.37:g.72316985A>T	ENSP00000264485:p.His430Leu	Somatic		Capture	Illumina GAIIx	4	72535849	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	-	p.H430L	ENST00000264485.5	37	c.1289	CCDS43236.1	4	.	.	.	.	.	.	.	.	.	.	A	20.6	4.019353	0.75275	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000512686;ENST00000340595	T;T;T;T;T	0.78595	-1.19;-1.19;-0.83;0.01;-1.19	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.86952	0.6057	M	0.73962	2.25	0.80722	D	1	D;B;B;B;B;B	0.56287	0.975;0.342;0.097;0.203;0.008;0.048	P;B;B;B;B;B	0.62649	0.905;0.182;0.225;0.153;0.013;0.081	D	0.87313	0.2313	10	0.52906	T	0.07	.	16.6438	0.85155	1.0:0.0:0.0:0.0	.	430;430;386;386;410;430	A5JJ20;Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1-3;Q9Y6R3;Q9Y6R1	.;.;.;.;.;S4A4_HUMAN	L	430;430;430;386;386	ENSP00000264485:H430L;ENSP00000393557:H430L;ENSP00000307349:H430L;ENSP00000422400:H386L;ENSP00000344272:H386L	ENSP00000264485:H430L	H	+	2	0	SLC4A4	72535849	1.000000	0.71417	0.199000	0.23439	0.493000	0.33554	8.932000	0.92897	2.333000	0.79357	0.533000	0.62120	CAT	-	NULL		0.453	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	protein_coding	OTTHUMT00000362090.1	A	NM_003759		72535849	1	no_errors	NM_001098484	genbank	human	reviewed	54_36p	missense	SNP	1	T
INPP4B	8821	genome.wustl.edu	37	4	143043396	143043396	+	Missense_Mutation	SNP	C	C	A	rs554325579		TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr4:143043396C>A	ENST00000513000.1	-	22	2453	c.2020G>T	c.(2020-2022)Gat>Tat	p.D674Y	INPP4B_ENST00000508116.1_Missense_Mutation_p.D674Y|INPP4B_ENST00000262992.4_Missense_Mutation_p.D674Y|INPP4B_ENST00000509777.1_Missense_Mutation_p.D674Y|INPP4B_ENST00000308502.4_Missense_Mutation_p.D674Y	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	674					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.D674Y(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					CCAATTTCATCGCCTAAACAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	4											74.0	72.0	72.0					4																	143043396		2203	4300	6503	143262846	SO:0001583	missense	8821			U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.2020G>T	4.37:g.143043396C>A	ENSP00000425487:p.Asp674Tyr	Somatic		Capture	Illumina GAIIx	4	143262846	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	-	p.D674Y	ENST00000513000.1	37	c.2020	CCDS3757.1	4	.	.	.	.	.	.	.	.	.	.	C	21.3	4.126960	0.77549	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16	5.87	5.87	0.94306	.	0.105664	0.64402	D	0.000006	T	0.45617	0.1351	M	0.67397	2.05	0.80722	D	1	D	0.67145	0.996	P	0.61275	0.886	T	0.31558	-0.9939	10	0.87932	D	0	.	20.2119	0.98289	0.0:1.0:0.0:0.0	.	674	O15327	INP4B_HUMAN	Y	674;674;674;545;674;674;489;489;674;545	ENSP00000425487:D674Y;ENSP00000262992:D674Y;ENSP00000308441:D674Y;ENSP00000423954:D674Y;ENSP00000422793:D674Y;ENSP00000426207:D489Y;ENSP00000427250:D674Y;ENSP00000421065:D545Y	ENSP00000262992:D674Y	D	-	1	0	INPP4B	143262846	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	7.473000	0.81007	2.784000	0.95788	0.585000	0.79938	GAT	-	NULL		0.373	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP4B	protein_coding	OTTHUMT00000364587.1	C	NM_003866		143262846	-1	no_errors	NM_001101669	genbank	human	reviewed	54_36p	missense	SNP	1	A
PCDHB18	54660	genome.wustl.edu	37	5	140615021	140615021	+	RNA	SNP	G	G	A	rs565876538	byFrequency	TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr5:140615021G>A	ENST00000526308.1	+	0	1084					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E246K(1)		endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						AATTTCTGGCGAAGTCTATTT	0.368																																																1	Substitution - Missense(1)	ovary(1)	5																																								140595205			54660			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615021G>A		Somatic		Capture	Illumina GAIIx	4	140595205	B3KTF8	Missense_Mutation	SNP	-	p.E246K	ENST00000526308.1	37	c.736		5																																																																																			-	NULL		0.368	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	pseudogene	OTTHUMT00000394776.1	G			140595205	1	no_errors	ENST00000274705	ensembl	human	known	54_36p	missense	SNP	0.99	A
SPEF2	79925	genome.wustl.edu	37	5	35774001	35774001	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr5:35774001C>T	ENST00000356031.3	+	28	4110	c.3956C>T	c.(3955-3957)tCa>tTa	p.S1319L	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Missense_Mutation_p.S1314L	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1319					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.S1319L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCAGGTAAATCACCACCTATG	0.373																																																1	Substitution - Missense(1)	ovary(1)	5											71.0	64.0	66.0					5																	35774001		1862	4098	5960	35809758	SO:0001583	missense	79925			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3956C>T	5.37:g.35774001C>T	ENSP00000348314:p.Ser1319Leu	Somatic		Capture	Illumina GAIIx	4	35809758	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	-	p.S1319L	ENST00000356031.3	37	c.3956	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113259	0.77210	.	.	ENSG00000152582	ENST00000356031;ENST00000440995	T;T	0.06687	3.28;3.27	5.76	4.9	0.64082	.	0.504369	0.20299	N	0.095073	T	0.12817	0.0311	M	0.65975	2.015	0.40168	D	0.97714	B;B	0.19073	0.033;0.011	B;B	0.22601	0.04;0.008	T	0.02015	-1.1229	10	0.62326	D	0.03	.	12.2155	0.54404	0.0:0.9199:0.0:0.0801	.	1314;1319	Q9C093-2;Q9C093	.;SPEF2_HUMAN	L	1319;1314	ENSP00000348314:S1319L;ENSP00000412125:S1314L	ENSP00000348314:S1319L	S	+	2	0	SPEF2	35809758	0.433000	0.25562	0.265000	0.24526	0.405000	0.30901	3.993000	0.56987	1.575000	0.49775	0.650000	0.86243	TCA	-	NULL		0.373	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	protein_coding	OTTHUMT00000367199.1	C	NM_144722		35809758	1	no_errors	NM_024867	genbank	human	validated	54_36p	missense	SNP	0.02	T
HK3	3101	genome.wustl.edu	37	5	176323126	176323126	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr5:176323126C>T	ENST00000292432.5	-	2	126	c.35G>A	c.(34-36)gGg>gAg	p.G12E		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	12	Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)	p.G12E(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGTTTCTTCCCCCTGCCGCAA	0.552																																																1	Substitution - Missense(1)	ovary(1)	5											52.0	53.0	53.0					5																	176323126		2203	4300	6503	176255732	SO:0001583	missense	3101				CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.35G>A	5.37:g.176323126C>T	ENSP00000292432:p.Gly12Glu	Somatic		Capture	Illumina GAIIx	4	176255732	Q8N1E7	Missense_Mutation	SNP	HMMPfam_Hexokinase_1;HMMPfam_Hexokinase_2;superfamily_Actin-like ATPase domain	p.G12E	ENST00000292432.5	37	c.35	CCDS4407.1	5	.	.	.	.	.	.	.	.	.	.	C	7.735	0.700147	0.15106	.	.	ENSG00000160883	ENST00000292432	D	0.97279	-4.32	3.25	2.38	0.29361	.	0.431851	0.19939	N	0.102684	D	0.91436	0.7297	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	D	0.84130	0.0411	10	0.42905	T	0.14	.	6.4807	0.22061	0.0:0.8647:0.0:0.1353	.	12	P52790	HXK3_HUMAN	E	12	ENSP00000292432:G12E	ENSP00000292432:G12E	G	-	2	0	HK3	176255732	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.536000	0.23129	0.941000	0.37499	-0.258000	0.10820	GGG	-	NULL		0.552	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK3	protein_coding	OTTHUMT00000253428.1	C			176255732	-1	no_errors	NM_002115	genbank	human	reviewed	54_36p	missense	SNP		T
PSMC1P11	442153	genome.wustl.edu	37	6	4703033	4703033	+	IGR	SNP	A	A	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr6:4703033A>G								snoU13 (58945 upstream) : CDYL (3359 downstream)																							ACCTTGGAAGAGATCAATGAC	0.483																																																0			6																																								4648032	SO:0001628	intergenic_variant	442153																															6.37:g.4703033A>G		Somatic		Capture	Illumina GAIIx	4	4648032		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.483					LOC442153			A			4648032	1	pseudogene	XR_016425	genbank	human	model	54_36p	rna	SNP	1	G
HLA-A	3105	genome.wustl.edu	37	6	29910582	29910597	+	Frame_Shift_Del	DEL	GCGGGGAGCCCCGCTT	GCGGGGAGCCCCGCTT	-	rs41560112|rs45514001|rs281864729|rs386698550|rs199474366|rs72555395|rs1059426|rs281864728|rs199474365|rs61759956|rs41549014|rs45442596|rs199474364|rs199474367|rs12721672	byFrequency	TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	GCGGGGAGCCCCGCTT	GCGGGGAGCCCCGCTT	GCGGGGAGCCCCGCTT	-	GCGGGGAGCCCCGCTT	GCGGGGAGCCCCGCTT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr6:29910582_29910597delGCGGGGAGCCCCGCTT	ENST00000396634.1	+	4	463_478	c.122_137delGCGGGGAGCCCCGCTT	c.(121-138)cgcggggagccccgcttcfs	p.RGEPRF41fs	HLA-A_ENST00000376802.2_Frame_Shift_Del_p.RGEPRF41fs|HLA-A_ENST00000376809.5_Frame_Shift_Del_p.RGEPRF41fs|HLA-A_ENST00000376806.5_Frame_Shift_Del_p.RGEPRF41fs			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	41	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.E43*(1)|p.R41fs*31(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTG	0.704									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																																						2	Substitution - Nonsense(1)|Deletion - Frameshift(1)	cervix(1)|ovary(1)	6																																								30018576	SO:0001589	frameshift_variant	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.122_137delGCGGGGAGCCCCGCTT	6.37:g.29910582_29910597delGCGGGGAGCCCCGCTT	ENSP00000379873:p.Arg41fs	Somatic		Capture	Illumina GAIIx	Phase_III	30018561	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Frame_Shift_Del	DEL	-	p.R41fs	ENST00000396634.1	37	c.122_137	CCDS34373.1	6																																																																																			(deletion:cds_exon[30018513,30018782])	NULL		0.704	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-A	protein_coding	OTTHUMT00000252909.1	GCGGGGAGCCCCGCTT	NM_002116		30018576	1	no_errors	NM_002116	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.001:0.001:0.003:0.003:0.002:0.000:0.000:0.000:0.002:0.002:0.000:0.000:0.000:0.001:0.006:0.008	-
SRPK1	6732	genome.wustl.edu	37	6	35837268	35837268	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr6:35837268C>T	ENST00000373825.2	-	11	1687	c.1402G>A	c.(1402-1404)Gac>Aac	p.D468N	SRPK1_ENST00000373822.1_Missense_Mutation_p.D361N|SRPK1_ENST00000423325.2_Missense_Mutation_p.D452N					SRSF protein kinase 1									p.D468N(1)		endometrium(2)|large_intestine(10)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21						CCTTTGTTGTCCAGTGGTCCG	0.408																																					NSCLC(31;67 978 16289 24856 26454)											1	Substitution - Missense(1)	ovary(1)	6											334.0	314.0	321.0					6																	35837268		1991	4175	6166	35945246	SO:0001583	missense	6732			U09564	CCDS47415.1	6p21.31	2010-06-23	2010-06-23		ENSG00000096063	ENSG00000096063			11305	protein-coding gene	gene with protein product	"""SR protein kinase 1"", ""serine/arginine-rich splicing factor kinase 1"""	601939	"""SFRS protein kinase 1"""			8208298, 10198174	Standard	NM_003137		Approved	SFRSK1	uc003olj.3	Q96SB4	OTTHUMG00000014583	ENST00000373825.2:c.1402G>A	6.37:g.35837268C>T	ENSP00000362931:p.Asp468Asn	Somatic		Capture	Illumina GAIIx	4	35945246		Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.D468N	ENST00000373825.2	37	c.1402	CCDS47415.1	6	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448747	0.43531	.	.	ENSG00000096063	ENST00000373825;ENST00000361690;ENST00000423325;ENST00000373822	T;T;T;T	0.27890	1.64;1.64;1.64;1.69	5.44	5.44	0.79542	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.36303	0.0962	L	0.34521	1.04	0.51482	D	0.999926	B;D	0.63880	0.003;0.993	B;D	0.74674	0.004;0.984	T	0.03750	-1.1007	9	0.40728	T	0.16	-15.4689	17.8192	0.88645	0.0:1.0:0.0:0.0	.	452;468	B4DS61;Q96SB4	.;SRPK1_HUMAN	N	468;484;452;361	ENSP00000362931:D468N;ENSP00000354674:D484N;ENSP00000391069:D452N;ENSP00000362928:D361N	ENSP00000354674:D484N	D	-	1	0	SRPK1	35945246	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.970000	0.63742	2.715000	0.92844	0.655000	0.94253	GAC	-	HMMPfam_Pkinase		0.408	SRPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPK1	protein_coding	OTTHUMT00000040319.3	C	NM_003137		35945246	-1	no_errors	NM_003137	genbank	human	reviewed	54_36p	missense	SNP	0.96	T
SLC26A8	116369	genome.wustl.edu	37	6	35911700	35911700	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr6:35911700C>T	ENST00000490799.1	-	20	3243	c.2890G>A	c.(2890-2892)Ggc>Agc	p.G964S	SLC26A8_ENST00000394602.2_Missense_Mutation_p.G859S|SLC26A8_ENST00000355574.2_Missense_Mutation_p.G964S	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8									p.G964S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						TTGCTGTTGCCCTCTGGTGAG	0.483																																																1	Substitution - Missense(1)	ovary(1)	6											160.0	147.0	151.0					6																	35911700		2203	4300	6503	36019678	SO:0001583	missense	116369			AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.2890G>A	6.37:g.35911700C>T	ENSP00000417638:p.Gly964Ser	Somatic		Capture	Illumina GAIIx	4	36019678		Missense_Mutation	SNP	HMMPfam_STAS;superfamily_Anti-sigma factor antagonist SpoIIaa;HMMPfam_Sulfate_transp	p.G964S	ENST00000490799.1	37	c.2890	CCDS4813.1	6	.	.	.	.	.	.	.	.	.	.	C	17.55	3.416744	0.62511	.	.	ENSG00000112053	ENST00000490799;ENST00000394602;ENST00000355574	D;D;D	0.95001	-3.24;-3.58;-3.24	5.01	-0.822	0.10819	.	1.337080	0.05113	N	0.489291	T	0.78502	0.4293	N	0.24115	0.695	0.09310	N	1	B;B;B	0.28998	0.147;0.23;0.111	B;B;B	0.20955	0.014;0.032;0.032	T	0.72491	-0.4277	10	0.72032	D	0.01	.	3.7484	0.08556	0.176:0.3483:0.0:0.4757	.	964;859;546	Q96RN1;Q96RN1-2;Q96RN1-3	S26A8_HUMAN;.;.	S	964;859;964	ENSP00000417638:G964S;ENSP00000378100:G859S;ENSP00000347778:G964S	ENSP00000347778:G964S	G	-	1	0	SLC26A8	36019678	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-0.314000	0.08092	-0.063000	0.13065	0.561000	0.74099	GGC	-	NULL		0.483	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A8	protein_coding	OTTHUMT00000040325.2	C			36019678	-1	no_errors	NM_052961	genbank	human	reviewed	54_36p	missense	SNP		T
ZFAND3	60685	genome.wustl.edu	37	6	38084454	38084454	+	Silent	SNP	G	G	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr6:38084454G>T	ENST00000287218.4	+	5	915	c.468G>T	c.(466-468)cgG>cgT	p.R156R	ZFAND3_ENST00000373391.2_Silent_p.R134R	NM_021943.2	NP_068762.1	Q9H8U3	ZFAN3_HUMAN	zinc finger, AN1-type domain 3	156							DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R156R(1)		endometrium(2)|large_intestine(4)|lung(2)|ovary(1)	9						GTCGACGTCGGTGCTTCCAGT	0.532																																																1	Substitution - coding silent(1)	ovary(1)	6											123.0	106.0	112.0					6																	38084454		2203	4300	6503	38192432	SO:0001819	synonymous_variant	60685			AK023284	CCDS4836.1	6p21.2	2013-09-19	2005-12-15	2005-12-15	ENSG00000156639	ENSG00000156639		"""Zinc fingers, AN1-type domain containing"""	18019	protein-coding gene	gene with protein product		607455	"""testis expressed sequence 27"""	TEX27			Standard	NM_021943		Approved	FLJ13222	uc003onx.3	Q9H8U3	OTTHUMG00000014629	ENST00000287218.4:c.468G>T	6.37:g.38084454G>T		Somatic		Capture	Illumina GAIIx	4	38192432	Q5SZZ0|Q5SZZ1	Silent	SNP	-	p.R156	ENST00000287218.4	37	c.468	CCDS4836.1	6	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636381	0.29068	.	.	ENSG00000156639	ENST00000373389	.	.	.	5.28	0.0837	0.14434	.	.	.	.	.	T	0.36496	0.0969	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25745	-1.0123	4	.	.	.	-6.8626	6.0557	0.19811	0.3048:0.3514:0.3438:0.0	.	.	.	.	L	133	.	.	V	+	1	0	ZFAND3	38192432	0.989000	0.36119	1.000000	0.80357	0.999000	0.98932	0.277000	0.18734	0.292000	0.22492	0.650000	0.86243	GTG	-	NULL		0.532	ZFAND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND3	protein_coding	OTTHUMT00000040424.3	G	NM_021943		38192432	1	no_errors	NM_021943	genbank	human	validated	54_36p	silent	SNP	0.98	T
UBR2	23304	genome.wustl.edu	37	6	42573531	42573531	+	Silent	SNP	T	T	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr6:42573531T>C	ENST00000372899.1	+	6	993	c.735T>C	c.(733-735)acT>acC	p.T245T	UBR2_ENST00000372901.1_Silent_p.T245T|UBR2_ENST00000372903.2_Silent_p.T245T	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	245					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T245T(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TTATTTATACTCTTCAGAAAG	0.313																																																1	Substitution - coding silent(1)	ovary(1)	6											87.0	90.0	89.0					6																	42573531		2203	4300	6503	42681509	SO:0001819	synonymous_variant	23304			BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.735T>C	6.37:g.42573531T>C		Somatic		Capture	Illumina GAIIx	4	42681509	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Silent	SNP	-	p.T245	ENST00000372899.1	37	c.735	CCDS4870.1	6																																																																																			-	NULL		0.313	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	protein_coding	OTTHUMT00000040558.2	T	NM_015255		42681509	1	no_errors	NM_015255	genbank	human	provisional	54_36p	silent	SNP	0.99	C
CD2AP	23607	genome.wustl.edu	37	6	47573993	47573993	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr6:47573993C>T	ENST00000359314.5	+	14	1966	c.1510C>T	c.(1510-1512)Cgt>Tgt	p.R504C		NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	504					mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)	p.R504C(1)		kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			GTTGCCGGGCCGTTTCAATGG	0.393																																																1	Substitution - Missense(1)	ovary(1)	6											117.0	109.0	112.0					6																	47573993		2203	4300	6503	47681952	SO:0001583	missense	23607			AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.1510C>T	6.37:g.47573993C>T	ENSP00000352264:p.Arg504Cys	Somatic		Capture	Illumina GAIIx	4	47681952	A6NL34|Q5VYA3|Q9UG97	Missense_Mutation	SNP	HMMPfam_SH3_1;superfamily_SH3-domain	p.R504C	ENST00000359314.5	37	c.1510	CCDS34472.1	6	.	.	.	.	.	.	.	.	.	.	C	28.4	4.915324	0.92178	.	.	ENSG00000198087	ENST00000359314	T	0.27402	1.67	5.72	5.72	0.89469	.	2.303170	0.01581	N	0.021094	T	0.56262	0.1973	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	T	0.46176	-0.9210	10	0.56958	D	0.05	-4.1985	19.8711	0.96851	0.0:1.0:0.0:0.0	.	504	Q9Y5K6	CD2AP_HUMAN	C	504	ENSP00000352264:R504C	ENSP00000352264:R504C	R	+	1	0	CD2AP	47681952	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.675000	0.68123	2.689000	0.91719	0.591000	0.81541	CGT	-	NULL		0.393	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2AP	protein_coding	OTTHUMT00000040817.2	C			47681952	1	no_errors	NM_012120	genbank	human	reviewed	54_36p	missense	SNP	1	T
MMS22L	253714	genome.wustl.edu	37	6	97620943	97620943	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr6:97620943C>G	ENST00000275053.4	-	19	3100	c.2835G>C	c.(2833-2835)atG>atC	p.M945I	MMS22L_ENST00000369251.2_Missense_Mutation_p.M905I	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	945					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)		p.M945I(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						ACATACCCATCATTCCATAAG	0.363																																																1	Substitution - Missense(1)	ovary(1)	6											71.0	66.0	68.0					6																	97620943		2203	4300	6503	97727664	SO:0001583	missense	253714				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.2835G>C	6.37:g.97620943C>G	ENSP00000275053:p.Met945Ile	Somatic		Capture	Illumina GAIIx	4	97727664	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	-	p.M945I	ENST00000275053.4	37	c.2835	CCDS5039.1	6	.	.	.	.	.	.	.	.	.	.	C	3.390	-0.124539	0.06795	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.26810	1.71;1.71	5.43	1.48	0.22813	.	0.330485	0.38111	N	0.001801	T	0.02012	0.0063	N	0.04880	-0.145	0.21220	N	0.999751	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40905	-0.9538	10	0.09590	T	0.72	-18.7675	1.065	0.01608	0.3133:0.3455:0.1166:0.2246	.	905;945	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	I	945;905	ENSP00000275053:M945I;ENSP00000358254:M905I	ENSP00000275053:M945I	M	-	3	0	MMS22L	97727664	0.890000	0.30428	0.995000	0.50966	0.997000	0.91878	-0.228000	0.09114	0.311000	0.23014	0.655000	0.94253	ATG	-	NULL		0.363	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf167	protein_coding	OTTHUMT00000041573.3	C	NM_198468		97727664	-1	no_errors	NM_198468	genbank	human	predicted	54_36p	missense	SNP	1	G
LAMA2	3908	genome.wustl.edu	37	6	129712776	129712776	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr6:129712776G>A	ENST00000421865.2	+	36	5261	c.5212G>A	c.(5212-5214)Gaa>Aaa	p.E1738K		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1738	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.E1738K(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GACACAAAAGGAAATTGCTGA	0.343																																																1	Substitution - Missense(1)	ovary(1)	6											111.0	124.0	120.0					6																	129712776		2203	4300	6503	129754469	SO:0001583	missense	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.5212G>A	6.37:g.129712776G>A	ENSP00000400365:p.Glu1738Lys	Somatic		Capture	Illumina GAIIx	4	129754469	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	HMMPfam_Laminin_B;HMMPfam_Laminin_EGF;HMMPfam_Laminin_N;superfamily_Galactose-binding domain-like;superfamily_Concanavalin A-like lectins/glucanases;superfamily_Prefoldin;HMMPfam_Laminin_I;HMMPfam_Laminin_II;HMMPfam_Laminin_G_1;HMMPfam_Laminin_G_2;superfamily_ADP-ribosylation;superfamily_EGF/Laminin	p.E1738K	ENST00000421865.2	37	c.5212	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	10.26	1.300704	0.23650	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.23348	1.91	6.06	6.06	0.98353	Laminin I (1);	0.238690	0.44688	D	0.000428	T	0.08582	0.0213	L	0.29908	0.895	0.29589	N	0.848584	B;B	0.16166	0.016;0.007	B;B	0.16289	0.015;0.015	T	0.07443	-1.0772	10	0.35671	T	0.21	.	10.5668	0.45177	0.146:0.0:0.854:0.0	.	1738;1738	A6NF00;P24043	.;LAMA2_HUMAN	K	1738	ENSP00000400365:E1738K	ENSP00000346769:E1738K	E	+	1	0	LAMA2	129754469	1.000000	0.71417	1.000000	0.80357	0.184000	0.23303	1.770000	0.38532	2.880000	0.98712	0.650000	0.86243	GAA	-	HMMPfam_Laminin_I		0.343	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	protein_coding	OTTHUMT00000042180.1	G			129754469	1	no_errors	NM_000426	genbank	human	reviewed	54_36p	missense	SNP	1	A
MIR7162	102466227	genome.wustl.edu	37	15	62539521	62539521	+	RNA	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr15:62539521C>T	ENST00000570077.1	-	0	261																		p.R115Q(1)									TGACATCTCCCGCATCCTCTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	15																																								60326813			0																															15.37:g.62539521C>T		Somatic		Capture	Illumina GAIIx	4	60326813		Missense_Mutation	SNP	-	p.R84Q	ENST00000570077.1	37	c.251		15	.	.	.	.	.	.	.	.	.	.	C	6.270	0.417912	0.11870	.	.	ENSG00000166104	ENST00000429274	.	.	.	1.89	-0.625	0.11548	.	.	.	.	.	T	0.21186	0.0510	.	.	.	.	.	.	B	0.27416	0.178	B	0.21360	0.034	T	0.28870	-1.0030	6	0.19590	T	0.45	.	5.9307	0.19138	0.0:0.5696:0.0:0.4304	.	115	Q8N8X6-2	.	Q	115	.	ENSP00000396161:R115Q	R	-	2	0	AC126323.1	60326813	0.547000	0.26465	0.017000	0.16124	0.183000	0.23260	0.729000	0.26028	-0.180000	0.10637	0.297000	0.19635	CGG	-	NULL		0.537	hsa-mir-7162.1-004	KNOWN	basic	processed_transcript	ENSG00000166104	pseudogene	OTTHUMT00000422143.1	C			60326813	-1	no_start_codon	ENST00000299125	ensembl	human	known	54_36p	missense	SNP	0.09	T
PIK3CG	5294	genome.wustl.edu	37	7	106509141	106509141	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr7:106509141C>A	ENST00000359195.3	+	2	1445	c.1135C>A	c.(1135-1137)Ctc>Atc	p.L379I	PIK3CG_ENST00000440650.2_Missense_Mutation_p.L379I|PIK3CG_ENST00000496166.1_Missense_Mutation_p.L379I	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	379	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L379I(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						GAACACCGACCTCACAGTTTT	0.547																																																1	Substitution - Missense(1)	ovary(1)	7											78.0	76.0	77.0					7																	106509141		2203	4300	6503	106296377	SO:0001583	missense	5294				CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.1135C>A	7.37:g.106509141C>A	ENSP00000352121:p.Leu379Ile	Somatic		Capture	Illumina GAIIx	4	106296377	A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	PI3K_rbd;HMMPfam_PI3K_rbd;PI3_PI4_kinase;HMMPfam_PI3_PI4_kinase;PI3Ka;HMMPfam_PI3Ka;PI3K_C2;HMMPfam_PI3K_C2	p.L379I	ENST00000359195.3	37	c.1135	CCDS5739.1	7	.	.	.	.	.	.	.	.	.	.	C	10.76	1.442209	0.25987	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.76709	-1.04;-1.04;-1.04	5.73	5.73	0.89815	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.190384	0.49916	D	0.000122	T	0.77308	0.4111	L	0.54323	1.7	0.58432	D	0.999998	B	0.24132	0.098	B	0.30943	0.122	T	0.71013	-0.4715	10	0.28530	T	0.3	-26.6489	19.9036	0.96999	0.0:1.0:0.0:0.0	.	379	P48736	PK3CG_HUMAN	I	379	ENSP00000392258:L379I;ENSP00000419260:L379I;ENSP00000352121:L379I	ENSP00000352121:L379I	L	+	1	0	PIK3CG	106296377	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	2.458000	0.45014	2.706000	0.92434	0.655000	0.94253	CTC	-	HMMPfam_PI3K_C2		0.547	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIK3CG	protein_coding	OTTHUMT00000349294.1	C			106296377	1	no_errors	NM_002649	genbank	human	reviewed	54_36p	missense	SNP	1	A
SLC37A3	84255	genome.wustl.edu	37	7	140082260	140082260	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr7:140082260C>T	ENST00000326232.9	-	2	270	c.67G>A	c.(67-69)Gtg>Atg	p.V23M	SLC37A3_ENST00000447932.2_Missense_Mutation_p.V23M|SLC37A3_ENST00000429996.2_Missense_Mutation_p.V23M|SLC37A3_ENST00000461089.1_5'UTR|SLC37A3_ENST00000340308.3_Missense_Mutation_p.V23M	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	23					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.V23M(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					AGCAGGAACACTACAACATGA	0.443																																					Esophageal Squamous(133;211 1716 4665 11387 37873)											1	Substitution - Missense(1)	ovary(1)	7											214.0	185.0	194.0					7																	140082260		2203	4300	6503	139728729	SO:0001583	missense	84255			AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.67G>A	7.37:g.140082260C>T	ENSP00000321498:p.Val23Met	Somatic		Capture	Illumina GAIIx	4	139728729	Q6PIU7|Q86SS4|Q9BQG7	Missense_Mutation	SNP	HMMPfam_MFS_1;superfamily_MFS general substrate transporter	p.V23M	ENST00000326232.9	37	c.67	CCDS5859.1	7	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797068	0.70567	.	.	ENSG00000157800	ENST00000340308;ENST00000447932;ENST00000326232;ENST00000429996;ENST00000539816;ENST00000469193	T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.16	5.11	5.11	0.69529	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.296207	0.32901	N	0.005507	T	0.74749	0.3757	M	0.73598	2.24	0.34933	D	0.749574	D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;0.999	D;D;D;D;D	0.76575	0.954;0.979;0.979;0.987;0.988	D	0.83420	0.0032	10	0.87932	D	0	-25.1497	14.0468	0.64710	0.0:1.0:0.0:0.0	.	23;23;23;23;23	B4DKF5;F5H743;Q8NCC5-2;Q8NCC5-3;Q8NCC5	.;.;.;.;SPX3_HUMAN	M	23	ENSP00000343358:V23M;ENSP00000397481:V23M;ENSP00000321498:V23M;ENSP00000412208:V23M;ENSP00000419024:V23M	ENSP00000321498:V23M	V	-	1	0	SLC37A3	139728729	0.997000	0.39634	0.716000	0.30569	0.844000	0.47949	4.728000	0.62000	2.373000	0.80994	0.585000	0.79938	GTG	-	NULL		0.443	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC37A3	protein_coding	OTTHUMT00000348492.1	C	NM_032295		139728729	-1	no_errors	NM_207113	genbank	human	validated	54_36p	missense	SNP	0.84	T
OR2F1	26211	genome.wustl.edu	37	7	143657510	143657510	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr7:143657510G>T	ENST00000392899.1	+	1	484	c.447G>T	c.(445-447)tgG>tgT	p.W149C	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	149					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W149C(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					TCACATCCTGGGTCAGTGGCT	0.527																																																1	Substitution - Missense(1)	ovary(1)	7											139.0	117.0	125.0					7																	143657510		2203	4300	6503	143288443	SO:0001583	missense	26211			U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.447G>T	7.37:g.143657510G>T	ENSP00000376633:p.Trp149Cys	Somatic		Capture	Illumina GAIIx	4	143288443	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Missense_Mutation	SNP	-	p.W149C	ENST00000392899.1	37	c.447	CCDS5887.1	7	.	.	.	.	.	.	.	.	.	.	G	14.09	2.431499	0.43122	.	.	ENSG00000213215	ENST00000392899	T	0.59638	0.25	5.53	5.53	0.82687	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000128	T	0.72867	0.3514	M	0.66439	2.03	0.54753	D	0.999983	D	0.89917	1.0	D	0.97110	1.0	T	0.74423	-0.3670	10	0.87932	D	0	-12.7388	12.5119	0.56009	0.0:0.1672:0.8328:0.0	.	149	Q13607	OR2F1_HUMAN	C	149	ENSP00000376633:W149C	ENSP00000376633:W149C	W	+	3	0	OR2F1	143288443	0.892000	0.30473	0.943000	0.38184	0.593000	0.36681	2.014000	0.40951	2.871000	0.98454	0.655000	0.94253	TGG	-	NULL		0.527	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2F1	protein_coding	OTTHUMT00000349581.1	G			143288443	1	no_errors	NM_012369	genbank	human	provisional	54_36p	missense	SNP	0.99	T
ALG1L5P	647415	genome.wustl.edu	37	7	6965302	6965302	+	IGR	SNP	C	C	A	rs75134246		TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr7:6965302C>A								AC079804.2 (47039 upstream) : AC079804.1 (69543 downstream)																							GCAACTGACTCTTGATGGACA	0.443																																																0			7																																								6931827	SO:0001628	intergenic_variant	647415																															7.37:g.6965302C>A		Somatic		Capture	Illumina GAIIx	4	6931827		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.443					LOC647415			C			6931827	1	pseudogene	XR_037564	genbank	human	model	54_36p	rna	SNP	0	A
PKD1L1	168507	genome.wustl.edu	37	7	47876559	47876559	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr7:47876559G>C	ENST00000289672.2	-	37	5953	c.5903C>G	c.(5902-5904)gCg>gGg	p.A1968G		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1968					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.A1968G(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AGTGAGACACGCGTAGACGCA	0.602																																																1	Substitution - Missense(1)	ovary(1)	7											57.0	51.0	53.0					7																	47876559		2203	4300	6503	47843084	SO:0001583	missense	168507			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.5903C>G	7.37:g.47876559G>C	ENSP00000289672:p.Ala1968Gly	Somatic		Capture	Illumina GAIIx	4	47843084	Q6UWK1	Missense_Mutation	SNP	-	p.A1968G	ENST00000289672.2	37	c.5903	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	G	10.98	1.503559	0.26949	.	.	ENSG00000158683	ENST00000289672	T	0.20738	2.05	5.1	1.85	0.25348	.	1.317330	0.05138	N	0.493754	T	0.19927	0.0479	L	0.43152	1.355	0.09310	N	1	D	0.56035	0.974	P	0.44990	0.466	T	0.17992	-1.0351	10	0.20046	T	0.44	-7.3893	5.2613	0.15576	0.5248:0.0:0.4752:0.0	.	1968	Q8TDX9	PK1L1_HUMAN	G	1968	ENSP00000289672:A1968G	ENSP00000289672:A1968G	A	-	2	0	PKD1L1	47843084	0.000000	0.05858	0.000000	0.03702	0.146000	0.21551	0.507000	0.22675	0.547000	0.28938	0.655000	0.94253	GCG	-	NULL		0.602	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	protein_coding	OTTHUMT00000340974.1	G	NM_138295		47843084	-1	no_errors	NM_138295	genbank	human	reviewed	54_36p	missense	SNP	0.06	C
ZSCAN21	7589	genome.wustl.edu	37	7	99661781	99661781	+	Silent	SNP	C	C	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr7:99661781C>G	ENST00000292450.4	+	4	1127	c.963C>G	c.(961-963)acC>acG	p.T321T	ZNF3_ENST00000413658.2_3'UTR|ZSCAN21_ENST00000543588.1_Missense_Mutation_p.P287R|ZSCAN21_ENST00000477297.1_3'UTR|ZSCAN21_ENST00000456748.2_Missense_Mutation_p.P287R	NM_145914.2	NP_666019.1	Q9Y5A6	ZSC21_HUMAN	zinc finger and SCAN domain containing 21	321					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T321T(1)		breast(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|skin(1)	21	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			CAAACCTCACCCTCCACTACA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	7											72.0	75.0	74.0					7																	99661781		2203	4300	6503	99499717	SO:0001819	synonymous_variant	7589			AL136865	CCDS5681.1	7q11.1	2013-01-08	2006-10-06	2006-10-06	ENSG00000166529	ENSG00000166529		"""-"", ""Zinc fingers, C2H2-type"""	13104	protein-coding gene	gene with protein product		601261	"""zinc finger protein 38 (KOX 25)"", ""zinc finger protein 38"""	ZNF38		2288909, 2014798	Standard	NM_145914		Approved	DKFZp434L134, NY-REN-21, Zipro1	uc003uso.3	Q9Y5A6	OTTHUMG00000154583	ENST00000292450.4:c.963C>G	7.37:g.99661781C>G		Somatic		Capture	Illumina GAIIx	4	99499717	A4D2A6|D6W5T9|Q9H0B5	Silent	SNP	HMMPfam_SCAN;HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.T321	ENST00000292450.4	37	c.963	CCDS5681.1	7	.	.	.	.	.	.	.	.	.	.	C	7.427	0.637857	0.14386	.	.	ENSG00000166529	ENST00000543588;ENST00000456748	T;T	0.02216	4.39;4.39	4.08	3.19	0.36642	.	.	.	.	.	T	0.01523	0.0049	.	.	.	0.09310	N	0.999999	B	0.14438	0.01	B	0.15052	0.012	T	0.43442	-0.9391	8	0.08179	T	0.78	.	12.2057	0.54350	0.0:0.8265:0.1735:0.0	.	287	G3V1M0	.	R	287	ENSP00000441212:P287R;ENSP00000390960:P287R	ENSP00000390960:P287R	P	+	2	0	ZSCAN21	99499717	0.000000	0.05858	1.000000	0.80357	0.908000	0.53690	-0.826000	0.04429	1.302000	0.44855	-0.165000	0.13383	CCC	-	HMMPfam_zf-C2H2		0.488	ZSCAN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN21	protein_coding	OTTHUMT00000336166.1	C	NM_145914		99499717	1	no_errors	NM_145914	genbank	human	validated	54_36p	silent	SNP		G
CNTNAP2	26047	genome.wustl.edu	37	7	146829424	146829424	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr7:146829424A>C	ENST00000361727.3	+	8	1687	c.1171A>C	c.(1171-1173)Aac>Cac	p.N391H		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	391					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.N391H(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CGGACGGCTTAACCAGGACCT	0.468										HNSCC(39;0.1)																																						1	Substitution - Missense(1)	ovary(1)	7											130.0	121.0	124.0					7																	146829424		2203	4300	6503	146460357	SO:0001583	missense	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1171A>C	7.37:g.146829424A>C	ENSP00000354778:p.Asn391His	Somatic		Capture	Illumina GAIIx	4	146460357	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	HMMPfam_F5_F8_type_C;HMMPfam_EGF;superfamily_Galactose-binding domain-like;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_Fibrinogen C-terminal domain-like	p.N391H	ENST00000361727.3	37	c.1171	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	A	13.50	2.256423	0.39896	.	.	ENSG00000174469	ENST00000361727	T	0.79247	-1.25	5.7	-6.44	0.01920	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.941563	0.08809	N	0.890628	T	0.55417	0.1919	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.38845	-0.9642	10	0.48119	T	0.1	.	2.5936	0.04848	0.322:0.2207:0.3497:0.1076	.	391	Q9UHC6	CNTP2_HUMAN	H	391	ENSP00000354778:N391H	ENSP00000354778:N391H	N	+	1	0	CNTNAP2	146460357	0.000000	0.05858	0.001000	0.08648	0.991000	0.79684	-0.026000	0.12392	-1.227000	0.02571	0.482000	0.46254	AAC	-	NULL		0.468	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	protein_coding	OTTHUMT00000327668.1	A			146460357	1	no_errors	NM_014141	genbank	human	reviewed	54_36p	missense	SNP	0.02	C
ADAM2	2515	genome.wustl.edu	37	8	39602414	39602414	+	Splice_Site	SNP	T	T	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr8:39602414T>A	ENST00000265708.4	-	20	2278		c.e20-2		ADAM2_ENST00000347580.4_Splice_Site|ADAM2_ENST00000521880.1_Splice_Site|ADAM2_ENST00000379853.2_Splice_Site	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2						adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.?(2)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TCAGGTTGCCTGCatattaaa	0.299																																																2	Unknown(2)	ovary(1)|lung(1)	8											65.0	74.0	71.0					8																	39602414		2203	4300	6503	39721571	SO:0001630	splice_region_variant	2515			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.2175-2A>T	8.37:g.39602414T>A		Somatic		Capture	Illumina GAIIx	4	39721571	P78326|Q9UQQ8	Splice_Site	SNP	-	e20-2	ENST00000265708.4	37	c.2175-2	CCDS34884.1	8	.	.	.	.	.	.	.	.	.	.	T	6.517	0.463679	0.12402	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	.	.	.	3.46	3.46	0.39613	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6212	0.33861	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAM2	39721571	0.973000	0.33851	0.909000	0.35828	0.012000	0.07955	2.517000	0.45529	1.807000	0.52817	0.477000	0.44152	.	-	-		0.299	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM2	protein_coding	OTTHUMT00000376926.1	T	NM_001464	Intron	39721571	-1	no_errors	NM_001464	genbank	human	reviewed	54_36p	splice_site	SNP	0.7	A
FAM90A10P	441328	genome.wustl.edu	37	8	7627264	7627264	+	IGR	SNP	C	C	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr8:7627264C>A								RP11-1118M6.1 (227292 upstream) : AC084121.16 (8848 downstream)																							CGGGGTGAAGCCAACCCGGGG	0.572																																																0			8																																								7664674	SO:0001628	intergenic_variant	441328																															8.37:g.7627264C>A		Somatic		Capture	Illumina GAIIx	4	7664674		Missense_Mutation	SNP	-	p.A91D		37	c.272		8																																																																																			-	NULL	0	0.572					FAM90A10			C			7664674	1	no_errors	XM_496957	genbank	human	model	54_36p	missense	SNP	0	A
OPRK1	4986	genome.wustl.edu	37	8	54141967	54141967	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr8:54141967A>G	ENST00000265572.3	-	4	1330	c.1033T>C	c.(1033-1035)Tgc>Cgc	p.C345R	OPRK1_ENST00000524278.1_Missense_Mutation_p.C256R|OPRK1_ENST00000520287.1_Missense_Mutation_p.C345R|RP11-162D9.3_ENST00000524425.1_RNA	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	345					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)	p.C345R(1)		NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AGTGGAAAGCAGAAGTCCCGG	0.478																																																1	Substitution - Missense(1)	ovary(1)	8											86.0	80.0	82.0					8																	54141967		2203	4300	6503	54304520	SO:0001583	missense	4986				CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.1033T>C	8.37:g.54141967A>G	ENSP00000265572:p.Cys345Arg	Somatic		Capture	Illumina GAIIx	4	54304520	E5RHC9|Q499G4	Missense_Mutation	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.C345R	ENST00000265572.3	37	c.1033	CCDS6152.1	8	.	.	.	.	.	.	.	.	.	.	A	21.6	4.172310	0.78452	.	.	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	T;T;T	0.37235	1.21;1.21;1.21	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.66317	0.2777	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72972	-0.4129	10	0.87932	D	0	.	16.1435	0.81544	1.0:0.0:0.0:0.0	.	345	P41145	OPRK_HUMAN	R	345;256;345;331	ENSP00000265572:C345R;ENSP00000430923:C256R;ENSP00000429706:C345R	ENSP00000265572:C345R	C	-	1	0	OPRK1	54304520	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	9.268000	0.95675	2.212000	0.71576	0.528000	0.53228	TGC	-	NULL		0.478	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPRK1	protein_coding	OTTHUMT00000378048.1	A			54304520	-1	no_errors	NM_000912	genbank	human	validated	54_36p	missense	SNP	1	G
DMRT2	10655	genome.wustl.edu	37	9	1056470	1056470	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr9:1056470C>G	ENST00000358146.2	+	3	883	c.883C>G	c.(883-885)Cca>Gca	p.P295A	DMRT2_ENST00000302441.6_Missense_Mutation_p.P295A|DMRT2_ENST00000382255.3_3'UTR|DMRT2_ENST00000259622.6_3'UTR|DMRT2_ENST00000382251.3_Missense_Mutation_p.P295A			Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor 2	295					embryonic skeletal system development (GO:0048706)|positive regulation of myotome development (GO:2000287)|regulation of somitogenesis (GO:0014807)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P295A(1)		large_intestine(1)|lung(1)|prostate(2)	4		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		AGTGGAACCACCAAGCAAGGA	0.478																																																1	Substitution - Missense(1)	ovary(1)	9											82.0	79.0	80.0					9																	1056470		2203	4300	6503	1046470	SO:0001583	missense	10655			AF130729	CCDS6444.1, CCDS6445.1	9p24.3	2008-07-21			ENSG00000173253	ENSG00000173253			2935	protein-coding gene	gene with protein product	"""terra-like protein"""	604935				10332030	Standard	NM_181872		Approved		uc003zha.3	Q9Y5R5	OTTHUMG00000019437	ENST00000358146.2:c.883C>G	9.37:g.1056470C>G	ENSP00000350865:p.Pro295Ala	Somatic		Capture	Illumina GAIIx	4	1046470	B1ANC0|B9EGJ1|Q9NPG6|Q9NQR6	Missense_Mutation	SNP	HMMPfam_DM;superfamily_Cysteine-rich DNA binding domain (DM domain)	p.P295A	ENST00000358146.2	37	c.883	CCDS6444.1	9	.	.	.	.	.	.	.	.	.	.	C	0.316	-0.965052	0.02249	.	.	ENSG00000173253	ENST00000382251;ENST00000302441;ENST00000358146	T;T;T	0.22336	1.96;1.96;1.96	5.53	2.61	0.31194	.	0.229944	0.45361	N	0.000371	T	0.11750	0.0286	L	0.34521	1.04	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.12156	0.002;0.007	T	0.40270	-0.9572	10	0.02654	T	1	-0.6919	7.7655	0.28978	0.0:0.5891:0.2675:0.1434	.	295;139	Q9Y5R5;Q5HYK2	DMRT2_HUMAN;.	A	295	ENSP00000371686:P295A;ENSP00000305785:P295A;ENSP00000350865:P295A	ENSP00000305785:P295A	P	+	1	0	DMRT2	1046470	0.103000	0.21917	0.001000	0.08648	0.004000	0.04260	0.972000	0.29409	0.269000	0.21961	-0.237000	0.12165	CCA	-	NULL		0.478	DMRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT2	protein_coding	OTTHUMT00000051492.1	C	NM_006557		1046470	1	no_errors	NM_181872	genbank	human	validated	54_36p	missense	SNP	0.01	G
IFNB1	3456	genome.wustl.edu	37	9	21077536	21077536	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr9:21077536A>T	ENST00000380232.2	-	1	407	c.333T>A	c.(331-333)aaT>aaA	p.N111K		NM_002176.2	NP_002167.1	P01574	IFNB_HUMAN	interferon, beta 1, fibroblast	111					adaptive immune response (GO:0002250)|B cell activation involved in immune response (GO:0002312)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of viral genome replication (GO:0045071)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of innate immune response (GO:0045089)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.N111K(1)		breast(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	12				GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)		GATGATAGACATTAGCCAGGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	9											174.0	173.0	174.0					9																	21077536		2203	4300	6503	21067536	SO:0001583	missense	3456				CCDS6495.1	9p22	2008-07-21			ENSG00000171855	ENSG00000171855		"""Interferons"""	5434	protein-coding gene	gene with protein product		147640		IFNB			Standard	NM_002176		Approved	IFB, IFF	uc003zok.3	P01574	OTTHUMG00000019652	ENST00000380232.2:c.333T>A	9.37:g.21077536A>T	ENSP00000369581:p.Asn111Lys	Somatic		Capture	Illumina GAIIx	4	21067536	Q5VWC9	Missense_Mutation	SNP	HMMPfam_Interferon;superfamily_4-helical cytokines	p.N111K	ENST00000380232.2	37	c.333	CCDS6495.1	9	.	.	.	.	.	.	.	.	.	.	A	1.964	-0.438104	0.04636	.	.	ENSG00000171855	ENST00000380232	T	0.03181	4.02	5.42	-2.85	0.05734	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.592902	0.17868	N	0.159274	T	0.01156	0.0038	N	0.02315	-0.6	0.09310	N	1	B	0.16396	0.017	B	0.12837	0.008	T	0.41197	-0.9522	10	0.34782	T	0.22	-0.7601	1.0804	0.01641	0.1315:0.2498:0.2375:0.3811	.	111	P01574	IFNB_HUMAN	K	111	ENSP00000369581:N111K	ENSP00000369581:N111K	N	-	3	2	IFNB1	21067536	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.584000	0.05800	-0.676000	0.05238	-1.313000	0.01306	AAT	-	HMMPfam_Interferon		0.418	IFNB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNB1	protein_coding	OTTHUMT00000051881.1	A	NM_002176		21067536	-1	no_errors	NM_002176	genbank	human	validated	54_36p	missense	SNP		T
AGTPBP1	23287	genome.wustl.edu	37	9	88200414	88200414	+	Silent	SNP	T	T	A			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr9:88200414T>A	ENST00000357081.3	-	23	3273	c.3129A>T	c.(3127-3129)gcA>gcT	p.A1043A	AGTPBP1_ENST00000432218.1_Intron|AGTPBP1_ENST00000376083.3_Silent_p.A1003A|AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000376109.3_Silent_p.A1055A			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	1043					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.A1003A(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						CACATGAAGTTGCATTATCAT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	9											194.0	169.0	177.0					9																	88200414		2203	4300	6503	87390234	SO:0001819	synonymous_variant	23287			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.3129A>T	9.37:g.88200414T>A		Somatic		Capture	Illumina GAIIx	4	87390234	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Silent	SNP	HMMPfam_Peptidase_M14;superfamily_ARM repeat;superfamily_Zn-dependent exopeptidases	p.A1003	ENST00000357081.3	37	c.3009		9																																																																																			-	HMMPfam_Peptidase_M14		0.348	AGTPBP1-004	KNOWN	basic	protein_coding	AGTPBP1	protein_coding	OTTHUMT00000052893.1	T	NM_015239		87390234	-1	no_errors	NM_015239	genbank	human	validated	54_36p	silent	SNP		A
MAPKAP1	79109	genome.wustl.edu	37	9	128230361	128230361	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chr9:128230361T>C	ENST00000373498.1	-	9	1303	c.1235A>G	c.(1234-1236)gAc>gGc	p.D412G	MAPKAP1_ENST00000350766.3_Missense_Mutation_p.D376G|MAPKAP1_ENST00000265960.3_Missense_Mutation_p.D412G|MAPKAP1_ENST00000373503.3_Missense_Mutation_p.D220G|MAPKAP1_ENST00000394063.1_Missense_Mutation_p.D220G|MAPKAP1_ENST00000373511.2_Missense_Mutation_p.D365G|MAPKAP1_ENST00000483937.1_5'UTR|MAPKAP1_ENST00000373497.5_Missense_Mutation_p.D125G			Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated protein 1	412					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of Ras protein signal transduction (GO:0046580)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein kinase binding (GO:0019901)|Ras GTPase binding (GO:0017016)	p.D376G(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(3)	23						CGTAACAGGGTCTATCTCTAC	0.433																																																1	Substitution - Missense(1)	ovary(1)	9											171.0	160.0	163.0					9																	128230361		2203	4300	6503	127270182	SO:0001583	missense	79109			M37191	CCDS6864.1, CCDS35139.1, CCDS35140.1, CCDS35141.1, CCDS48020.1	9q34.11	2008-02-05			ENSG00000119487	ENSG00000119487			18752	protein-coding gene	gene with protein product	"""stress-activated protein kinase-interacting 1"""	610558				15363842	Standard	NM_001006620		Approved	MGC2745, SIN1, MIP1	uc004bpv.3	Q9BPZ7	OTTHUMG00000020683	ENST00000373498.1:c.1235A>G	9.37:g.128230361T>C	ENSP00000362597:p.Asp412Gly	Somatic		Capture	Illumina GAIIx	4	127270182	A8K1Z5|B1AMA4|B7Z309|Q00426|Q5JSV5|Q5JSV6|Q5JSV9|Q658R0|Q699U1|Q699U2|Q699U3|Q699U4|Q6GVJ0|Q6GVJ1|Q6GVJ2	Missense_Mutation	SNP	HMMPfam_SIN1	p.D412G	ENST00000373498.1	37	c.1235	CCDS35140.1	9	.	.	.	.	.	.	.	.	.	.	T	27.0	4.787625	0.90367	.	.	ENSG00000119487	ENST00000373511;ENST00000350766;ENST00000373503;ENST00000373498;ENST00000265960;ENST00000394063;ENST00000373497;ENST00000420643	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.79076	0.4385	M	0.79926	2.475	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;1.0;0.998	D;D;D;D	0.91635	0.953;0.999;0.998;0.937	T	0.76580	-0.2907	9	0.20046	T	0.44	-8.1008	16.2792	0.82664	0.0:0.0:0.0:1.0	.	125;365;376;412	B7Z5E5;Q9BPZ7-3;Q9BPZ7-2;Q9BPZ7	.;.;.;SIN1_HUMAN	G	365;376;220;412;412;220;125;184	.	ENSP00000265960:D412G	D	-	2	0	MAPKAP1	127270182	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.243000	0.73865	0.533000	0.62120	GAC	-	HMMPfam_SIN1		0.433	MAPKAP1-009	KNOWN	basic|CCDS	protein_coding	MAPKAP1	protein_coding	OTTHUMT00000054092.1	T			127270182	-1	no_errors	NM_001006617	genbank	human	reviewed	54_36p	missense	SNP	1	C
Unknown	0	genome.wustl.edu	37	X	9379130	9379130	+	IGR	SNP	G	G	C	rs375142789		TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chrX:9379130G>C								GS1-519E5.1 (135884 upstream) : TBL1X (52204 downstream)																							CCAGTCAGCCGCCCAGCCATT	0.463																																																0			X																																								9339130	SO:0001628	intergenic_variant	100132243																															X.37:g.9379130G>C		Somatic		Capture	Illumina GAIIx	4	9339130		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.463					LOC100132243			G			9339130	1	pseudogene	XR_037396	genbank	human	model	54_36p	rna	SNP	1	C
ZNF711	7552	genome.wustl.edu	37	X	84526379	84526379	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chrX:84526379T>C	ENST00000373165.3	+	9	2137	c.1831T>C	c.(1831-1833)Tct>Cct	p.S611P	ZNF711_ENST00000542798.1_Missense_Mutation_p.S453P|ZNF711_ENST00000276123.3_Missense_Mutation_p.S611P|ZNF711_ENST00000360700.4_Missense_Mutation_p.S657P|ZNF711_ENST00000395402.1_Missense_Mutation_p.S619P	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	611					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.S621P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						GCACATCATATCTGTCCATAC	0.418																																																1	Substitution - Missense(1)	ovary(1)	X											83.0	64.0	70.0					X																	84526379		2203	4300	6503	84413035	SO:0001583	missense	7552			BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.1831T>C	X.37:g.84526379T>C	ENSP00000362260:p.Ser611Pro	Somatic		Capture	Illumina GAIIx	4	84413035	B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	HMMPfam_Zfx_Zfy_act;HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.S611P	ENST00000373165.3	37	c.1831	CCDS35344.1	X	.	.	.	.	.	.	.	.	.	.	T	16.84	3.234609	0.58886	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41	5.5	4.3	0.51218	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.42682	D	0.000669	T	0.33235	0.0856	L	0.48877	1.53	0.52501	D	0.999958	D;D	0.76494	0.992;0.999	D;D	0.81914	0.981;0.995	T	0.01993	-1.1233	10	0.72032	D	0.01	-11.3456	11.7771	0.51991	0.0:0.0:0.1451:0.8549	.	657;611	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	P	619;611;611;657;453	ENSP00000378798:S619P;ENSP00000362260:S611P;ENSP00000276123:S611P;ENSP00000353922:S657P;ENSP00000442071:S453P	ENSP00000276123:S611P	S	+	1	0	ZNF711	84413035	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.040000	0.89188	0.701000	0.31803	0.417000	0.27973	TCT	-	HMMPfam_zf-C2H2		0.418	ZNF711-001	KNOWN	basic|CCDS	protein_coding	ZNF711	protein_coding	OTTHUMT00000057388.2	T	NM_021998		84413035	1	no_errors	NM_021998	genbank	human	reviewed	54_36p	missense	SNP	1	C
CXorf57	55086	genome.wustl.edu	37	X	105868476	105868476	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1509-01A-01W-0549-09	TCGA-13-1509-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	4d3fab96-bc22-48d0-a3ef-1844ad894d0f	e0bcad8c-d151-47f7-8236-e274a281c56e	g.chrX:105868476C>T	ENST00000372548.4	+	3	1052	c.943C>T	c.(943-945)Ccc>Tcc	p.P315S	CXorf57_ENST00000372544.2_Missense_Mutation_p.P315S	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	315							poly(A) RNA binding (GO:0044822)	p.P315S(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						ACAGCCTGTCCCCGTGGATCC	0.368																																																1	Substitution - Missense(1)	ovary(1)	X											125.0	110.0	115.0					X																	105868476		2203	4300	6503	105755132	SO:0001583	missense	55086			AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.943C>T	X.37:g.105868476C>T	ENSP00000361628:p.Pro315Ser	Somatic		Capture	Illumina GAIIx	4	105755132	H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Missense_Mutation	SNP	superfamily_Nucleic acid-binding proteins	p.P315S	ENST00000372548.4	37	c.943	CCDS14519.1	X	.	.	.	.	.	.	.	.	.	.	C	10.57	1.388357	0.25118	.	.	ENSG00000147231	ENST00000372544;ENST00000372548;ENST00000421550	T;T;T	0.46063	0.89;0.88;0.92	3.89	3.02	0.34903	Nucleic acid-binding, OB-fold-like (1);	0.238642	0.42172	D	0.000750	T	0.48484	0.1502	L	0.41236	1.265	0.35581	D	0.806287	B;B;D	0.76494	0.297;0.297;0.999	B;B;D	0.85130	0.134;0.134;0.997	T	0.51092	-0.8749	10	0.13108	T	0.6	-9.1425	10.2285	0.43241	0.0:0.8931:0.0:0.1069	.	315;315;315	A8K6R5;Q6NSI4;Q6NSI4-2	.;CX057_HUMAN;.	S	315;315;123	ENSP00000361623:P315S;ENSP00000361628:P315S;ENSP00000405866:P123S	ENSP00000361623:P315S	P	+	1	0	CXorf57	105755132	0.350000	0.24878	0.389000	0.26208	0.162000	0.22319	2.922000	0.48860	0.755000	0.32990	-0.192000	0.12808	CCC	-	NULL		0.368	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf57	protein_coding	OTTHUMT00000057800.2	C	NM_018015		105755132	1	no_errors	NM_018015	genbank	human	validated	54_36p	missense	SNP	0.96	T
