#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	6	219603	219603	+	IGR	SNP	C	C	T	rs75024099	byFrequency	TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:219603C>T								RP3-416J7.5 (13211 upstream) : DUSP22 (72493 downstream)																							CAGTTATATCCCAGCAGGTTT	0.468													C|||	268	0.0535144	0.0	0.0029	5008	,	,		23181	0.124		0.005	False		,,,				2504	0.1391															0			6																																								164603	SO:0001628	intergenic_variant	645089																															6.37:g.219603C>T		Somatic		Capture	Illumina GAIIx	4	164603		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.468					LOC645089			C			164603	-1	pseudogene	XR_017608	genbank	human	model	54_36p	rna	SNP	0.000	T
ZNF596	169270	genome.wustl.edu	37	8	195538	195538	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr8:195538G>A	ENST00000398612.1	+	6	1074	c.691G>A	c.(691-693)Gcc>Acc	p.A231T	ZNF596_ENST00000320552.2_Missense_Mutation_p.A161T|ZNF596_ENST00000308811.4_Missense_Mutation_p.A231T	NM_001042415.1|NM_001042416.1	NP_001035880.1|NP_001035881.1	Q8TC21	ZN596_HUMAN	zinc finger protein 596	231					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(5)	14		all_cancers(2;4.81e-29)|all_epithelial(2;5.03e-19)|Lung NSC(2;8.68e-08)|all_lung(2;1.52e-07)|Ovarian(12;0.00965)|Colorectal(14;0.0367)|all_neural(12;0.0837)|Myeloproliferative disorder(644;0.116)|all_hematologic(2;0.138)|Acute lymphoblastic leukemia(644;0.242)		Epithelial(5;3.77e-18)|all cancers(2;5.2e-17)|OV - Ovarian serous cystadenocarcinoma(5;5.37e-09)|BRCA - Breast invasive adenocarcinoma(11;1.7e-06)|Colorectal(2;6.51e-05)|READ - Rectum adenocarcinoma(2;0.0276)|COAD - Colon adenocarcinoma(149;0.0702)		ATGTGGGAAAGCCTTTACTCA	0.423																																																0			8											79.0	75.0	77.0					8																	195538		2203	4300	6503	185538	SO:0001583	missense	169270			BC026190	CCDS5951.2	8p23.3	2013-01-08			ENSG00000172748	ENSG00000172748		"""Zinc fingers, C2H2-type"", ""-"""	27268	protein-coding gene	gene with protein product						12477932	Standard	NM_001287256		Approved		uc003wot.3	Q8TC21	OTTHUMG00000086931	ENST00000398612.1:c.691G>A	8.37:g.195538G>A	ENSP00000381613:p.Ala231Thr	Somatic		Capture	Illumina GAIIx	4	185538	B2R8P4|O95015|Q8N9X0	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.A231T	ENST00000398612.1	37	c.691	CCDS5951.2	8	.	.	.	.	.	.	.	.	.	.	.	11.29	1.595372	0.28445	.	.	ENSG00000172748	ENST00000308811;ENST00000320552;ENST00000398612	T;T;T	0.36157	1.27;1.27;1.27	2.63	1.72	0.24424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25494	0.0620	L	0.35593	1.075	0.22489	N	0.999055	B	0.31026	0.304	B	0.33196	0.159	T	0.20371	-1.0277	9	0.25751	T	0.34	.	7.2401	0.26092	0.0:0.0:0.4722:0.5278	.	231	Q8TC21	ZN596_HUMAN	T	231;161;231	ENSP00000310033:A231T;ENSP00000318719:A161T;ENSP00000381613:A231T	ENSP00000310033:A231T	A	+	1	0	ZNF596	185538	0.000000	0.05858	0.910000	0.35882	0.869000	0.49853	-0.222000	0.09190	0.649000	0.30751	0.591000	0.81541	GCC	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.423	ZNF596-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF596	protein_coding	OTTHUMT00000195858.4	G	NM_173539		185538	+1	no_errors	NM_001042415	genbank	human	validated	54_36p	missense	SNP	0.946	A
FABP5P13	106480712	genome.wustl.edu	37	X	484552	484552	+	IGR	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:484552C>T								AL732314.1 (59136 upstream) : SHOX (100526 downstream)																							TCACACAGTCCGACACTAATT	0.453													c|||	2838	0.566693	0.233	0.6542	5008	,	,		18926	0.9821		0.4771	False		,,,				2504	0.6196															0			X																																								404552	SO:0001628	intergenic_variant	644026																															X.37:g.484552C>T		Somatic		Capture	Illumina GAIIx	4	404552		Silent	SNP	NULL	p.S289		37	c.867		X																																																																																			-	NULL	0	0.453					LOC644026			C			404552	-1	no_start_codon:pseudogene:no_stop_codon	XM_001714036	genbank	human	model	54_36p	silent	SNP	0.667	T
SLC12A7	10723	genome.wustl.edu	37	5	1078822	1078822	+	Missense_Mutation	SNP	C	C	T	rs200454360	byFrequency	TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr5:1078822C>T	ENST00000264930.5	-	11	1491	c.1448G>A	c.(1447-1449)cGa>cAa	p.R483Q		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	483					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GTACTTATCTCGTAAGACCAC	0.522													C|||	2	0.000399361	0.0008	0.0	5008	,	,		11980	0.0		0.001	False		,,,				2504	0.0															0			5											115.0	86.0	96.0					5																	1078822		2200	4298	6498	1131822	SO:0001583	missense	10723			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1448G>A	5.37:g.1078822C>T	ENSP00000264930:p.Arg483Gln	Somatic		Capture	Illumina GAIIx	4	1131822	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	HMMPfam_AA_permease	p.R483Q	ENST00000264930.5	37	c.1448	CCDS34129.1	5	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	c	19.22	3.786139	0.70337	.	.	ENSG00000113504	ENST00000264930	D	0.98617	-5.03	3.71	3.71	0.42584	Amino acid permease domain (1);	0.303685	0.29321	N	0.012490	D	0.97904	0.9311	M	0.75777	2.31	0.54753	D	0.999986	P	0.52170	0.951	P	0.45428	0.48	D	0.98183	1.0458	10	0.56958	D	0.05	.	14.9789	0.71296	0.0:1.0:0.0:0.0	.	483	Q9Y666	S12A7_HUMAN	Q	483	ENSP00000264930:R483Q	ENSP00000264930:R483Q	R	-	2	0	SLC12A7	1131822	0.565000	0.26610	0.987000	0.45799	0.122000	0.20287	3.898000	0.56281	2.040000	0.60383	0.485000	0.47835	CGA	-	HMMPfam_AA_permease		0.522	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	protein_coding	OTTHUMT00000366446.2	C	NM_006598		1131822	-1	no_errors	NM_006598	genbank	human	validated	54_36p	missense	SNP	0.986	T
MUC5AC	4586	genome.wustl.edu	37	11	1213644	1213644	+	3'UTR	SNP	C	C	A	rs149860127	byFrequency	TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:1213644C>A	ENST00000358378.6	+	0	885							P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming						cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		TGGTATCCGCCTCCGTGGCAT	0.592													c|||	17	0.00339457	0.0	0.0072	5008	,	,		18873	0.0		0.0089	False		,,,				2504	0.0031															0			11						C		3,1747		0,3,872	227.0	217.0	220.0		3198	0.6	0.0	11	dbSNP_134	220	19,3961		0,19,1971	no	coding-synonymous	MUC5AC	XM_003403450.1		0,22,2843	AA,AC,CC		0.4774,0.1714,0.3839		1066/1963	1213644	22,5708	875	1990	2865	1170220	SO:0001624	3_prime_UTR_variant	4586			AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000358378.6:c.*882C>A	11.37:g.1213644C>A		Somatic		Capture	Illumina GAIIx	4	1170220	O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	Silent	SNP	HMMSmart_SM00214,HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,PatternScan_VWFC_1,HMMPfam_VWC,HMMPfam_Cys_knot,HMMSmart_SM00041,PatternScan_CTCK_1	p.A297	ENST00000358378.6	37	c.891		11																																																																																			-	NULL		0.592	MUC5AC-002	PUTATIVE	basic|exp_conf	processed_transcript	MUC5AC	protein_coding	OTTHUMT00000396096.2	C	XM_001130382		1170220	+1	no_start_codon	ENST00000358378	ensembl	human	known	54_36p	silent	SNP	0.001	A
TSPAN9	10867	genome.wustl.edu	37	12	3306455	3306455	+	Intron	SNP	C	C	T	rs76237234	byFrequency	TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr12:3306455C>T	ENST00000011898.5	+	3	144				TSPAN9_ENST00000537971.1_Intron	NM_006675.4	NP_006666.1	O75954	TSN9_HUMAN	tetraspanin 9							focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)				endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			AAGCGGCAGCCGTGGGCCCCT	0.527													C|||	533	0.10643	0.0514	0.0591	5008	,	,		18426	0.1528		0.0984	False		,,,				2504	0.1748															0			12																																								3176716	SO:0001627	intron_variant	732360			AF089749	CCDS8520.1	12p13.33-p13.32	2013-02-14			ENSG00000011105	ENSG00000011105		"""Tetraspanins"""	21640	protein-coding gene	gene with protein product		613137				10719184, 11739647	Standard	NM_006675		Approved	NET-5	uc021qtd.1	O75954	OTTHUMG00000150333	ENST00000011898.5:c.-17-3888C>T	12.37:g.3306455C>T		Somatic		Capture	Illumina GAIIx	4	3176716	D3DUQ7|Q53FV2|Q6FGJ8	RNA	SNP	-	NULL	ENST00000011898.5	37	NULL	CCDS8520.1	12																																																																																			-	-		0.527	TSPAN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC732360	protein_coding	OTTHUMT00000317606.2	C	NM_006675		3176716	+1	pseudogene	XR_038607	genbank	human	model	54_36p	rna	SNP	0.001	T
MEFV	4210	genome.wustl.edu	37	16	3297177	3297177	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr16:3297177G>T	ENST00000219596.1	-	5	1465	c.1426C>A	c.(1426-1428)Caa>Aaa	p.Q476K	MEFV_ENST00000339854.4_Missense_Mutation_p.Q296K|MEFV_ENST00000541159.1_Missense_Mutation_p.Q265K|MEFV_ENST00000536379.1_Missense_Mutation_p.Q265K	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	476	Required for homotrimerization and induction of pyroptosomes.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.Q475fs*37(1)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						AAATGCTCTTGCTGCTCCAGG	0.582																																																1	Deletion - Frameshift(1)	breast(1)	16											162.0	148.0	153.0					16																	3297177		2197	4300	6497	3237178	SO:0001583	missense	4210			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1426C>A	16.37:g.3297177G>T	ENSP00000219596:p.Gln476Lys	Somatic		Capture	Illumina GAIIx	4	3237178	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	superfamily_DEATH domain,HMMPfam_PAAD_DAPIN,HMMPfam_zf-B_box,HMMSmart_SM00336,superfamily_B-box zinc-binding domain,HMMSmart_SM00589,HMMPfam_SPRY,HMMSmart_SM00449	p.Q476K	ENST00000219596.1	37	c.1426	CCDS10498.1	16	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497154	0.44352	.	.	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000541159;ENST00000536379;ENST00000534868	T;T;T;T	0.63417	-0.04;0.39;0.31;0.39	5.29	5.29	0.74685	.	0.000000	0.49305	D	0.000144	T	0.77896	0.4199	M	0.70903	2.155	0.36668	D	0.878344	D	0.69078	0.997	D	0.77004	0.989	T	0.80955	-0.1151	10	0.48119	T	0.1	-15.9605	16.4785	0.84151	0.0:0.0:1.0:0.0	.	476	O15553	MEFV_HUMAN	K	476;476;296;265;265;265	ENSP00000219596:Q476K;ENSP00000339639:Q296K;ENSP00000438711:Q265K;ENSP00000445079:Q265K	ENSP00000219596:Q476K	Q	-	1	0	MEFV	3237178	0.986000	0.35501	0.905000	0.35620	0.557000	0.35523	3.118000	0.50414	2.767000	0.95098	0.655000	0.94253	CAA	-	NULL		0.582	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	protein_coding	OTTHUMT00000251464.1	G	NM_000243		3237178	-1	no_errors	NM_000243	genbank	human	reviewed	54_36p	missense	SNP	0.259	T
GLIS3	169792	genome.wustl.edu	37	9	4117803	4117803	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr9:4117803T>A	ENST00000324333.10	-	3	1403	c.1210A>T	c.(1210-1212)Aga>Tga	p.R404*	GLIS3_ENST00000381971.3_Nonsense_Mutation_p.R559*	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	404					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		GAGTGGACTCTCATGTGGATC	0.562																																																0			9											169.0	159.0	162.0					9																	4117803		2203	4300	6503	4107803	SO:0001587	stop_gained	169792			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.1210A>T	9.37:g.4117803T>A	ENSP00000325494:p.Arg404*	Somatic		Capture	Illumina GAIIx	4	4107803	B1AL19|Q1PHK5	Nonsense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.R559*	ENST00000324333.10	37	c.1675	CCDS6451.1	9	.	.	.	.	.	.	.	.	.	.	T	37	6.545672	0.97654	.	.	ENSG00000107249	ENST00000324333;ENST00000381971	.	.	.	5.7	-1.31	0.09230	.	0.000000	0.49916	D	0.000136	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.7889	0.91965	0.0:0.0:0.7094:0.2906	.	.	.	.	X	404;559	.	ENSP00000325494:R404X	R	-	1	2	GLIS3	4107803	1.000000	0.71417	0.989000	0.46669	0.991000	0.79684	1.064000	0.30579	-0.466000	0.06943	-0.313000	0.08912	AGA	-	HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers		0.562	GLIS3-003	KNOWN	basic|CCDS	protein_coding	GLIS3	protein_coding	OTTHUMT00000051559.1	T	NM_152629		4107803	-1	no_errors	NM_001042413	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
PPAPDC2	403313	genome.wustl.edu	37	9	4663126	4663126	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr9:4663126G>A	ENST00000381883.2	+	1	829	c.751G>A	c.(751-753)Gtc>Atc	p.V251I	SPATA6L_ENST00000223517.5_Intron|SPATA6L_ENST00000475086.1_Intron|SPATA6L_ENST00000381890.5_Intron|SPATA6L_ENST00000381895.5_Intron|SPATA6L_ENST00000454239.2_Intron	NM_203453.3	NP_982278.3	Q8IY26	PPAC2_HUMAN	phosphatidic acid phosphatase type 2 domain containing 2	251						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(2)|lung(1)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.026)		CCTATCCAGGGTCATGCTGGG	0.572																																					Melanoma(187;1057 3809 8526)											0			9											140.0	111.0	121.0					9																	4663126		2203	4300	6503	4653126	SO:0001583	missense	403313			AK128369	CCDS34981.1	9p24	2010-04-23			ENSG00000205808	ENSG00000205808			23682	protein-coding gene	gene with protein product	"""polyisoprenoid diphosphate phosphatase type 1"""	611666				16464866	Standard	NM_203453		Approved	FLJ90191, FLJ46512, PDP1	uc003zin.4	Q8IY26	OTTHUMG00000019466	ENST00000381883.2:c.751G>A	9.37:g.4663126G>A	ENSP00000371307:p.Val251Ile	Somatic		Capture	Illumina GAIIx	4	4653126	B3KY05|Q5JVJ6|Q8NCK9	Missense_Mutation	SNP	superfamily_AcPase_VanPerase,HMMSmart_acidPPc,HMMPfam_PAP2	p.V251I	ENST00000381883.2	37	c.751	CCDS34981.1	9	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284983	0.80803	.	.	ENSG00000205808	ENST00000381883;ENST00000537542	T	0.75154	-0.91	5.55	4.66	0.58398	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.64402	U	0.000001	T	0.64864	0.2637	L	0.35854	1.095	0.58432	D	0.999996	B	0.23442	0.085	B	0.25506	0.061	T	0.61372	-0.7076	10	0.34782	T	0.22	-37.9984	12.2652	0.54674	0.0811:0.0:0.9189:0.0	.	251	Q8IY26	PPAC2_HUMAN	I	251;160	ENSP00000371307:V251I	ENSP00000371307:V251I	V	+	1	0	PPAPDC2	4653126	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.207000	0.72159	1.587000	0.49959	0.655000	0.94253	GTC	-	superfamily_AcPase_VanPerase,HMMSmart_acidPPc,HMMPfam_PAP2		0.572	PPAPDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAPDC2	protein_coding	OTTHUMT00000051567.1	G	NM_203453		4653126	+1	no_errors	NM_203453	genbank	human	validated	54_36p	missense	SNP	1.000	A
PLD2	5338	genome.wustl.edu	37	17	4713274	4713274	+	Silent	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr17:4713274G>A	ENST00000263088.6	+	9	941	c.810G>A	c.(808-810)ggG>ggA	p.G270G	PLD2_ENST00000572940.1_Silent_p.G270G|RP11-81A22.5_ENST00000571067.1_lincRNA	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	270	PH.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	TGCAAGTGGGGAAAAGGAGCA	0.602																																																0			17											143.0	120.0	128.0					17																	4713274		2203	4300	6503	4660238	SO:0001819	synonymous_variant	5338			AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.810G>A	17.37:g.4713274G>A		Somatic		Capture	Illumina GAIIx	4	4660238	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Silent	SNP	superfamily_PX domain,HMMPfam_PX,HMMSmart_SM00312,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Phospholipase D/nuclease,HMMPfam_PLDc,HMMSmart_SM00155	p.G270	ENST00000263088.6	37	c.810	CCDS11057.1	17																																																																																			-	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233		0.602	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD2	protein_coding	OTTHUMT00000207561.3	G	NM_002663		4660238	+1	no_errors	NM_002663	genbank	human	validated	54_36p	silent	SNP	0.996	A
FARS2	10667	genome.wustl.edu	37	6	5771532	5771532	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:5771532A>G	ENST00000324331.6	+	7	1562	c.1226A>G	c.(1225-1227)aAg>aGg	p.K409R	FARS2_ENST00000274680.4_Missense_Mutation_p.K409R			O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2, mitochondrial	409	FDX-ACB. {ECO:0000255|PROSITE- ProRule:PRU00778}.				gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)|stomach(2)	15	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	AGGACGCACAAGACCAGCCAC	0.597																																																0			6											132.0	97.0	109.0					6																	5771532		2203	4300	6503	5716531	SO:0001583	missense	10667			AF097441	CCDS4494.1	6p25.1	2011-07-01	2007-02-23	2004-12-03	ENSG00000145982	ENSG00000145982	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	21062	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 2, mitochondrial"""	611592	"""phenylalanine-tRNA synthetase 1 (mitochondrial)"""	FARS1		10329163	Standard	NM_006567		Approved	dJ236A3.1	uc003mwr.2	O95363	OTTHUMG00000014178	ENST00000324331.6:c.1226A>G	6.37:g.5771532A>G	ENSP00000316335:p.Lys409Arg	Somatic		Capture	Illumina GAIIx	4	5716531	B2R664|Q53F66|Q5TCS3|Q6FG29|Q9NPY7|Q9P062	Missense_Mutation	SNP	superfamily_SSF55681,HMMPfam_tRNA-synt_2d,superfamily_Fdx_AntiC_bd,HMMPfam_FDX-ACB	p.K409R	ENST00000324331.6	37	c.1226	CCDS4494.1	6	.	.	.	.	.	.	.	.	.	.	A	5.322	0.244818	0.10077	.	.	ENSG00000145982	ENST00000274680;ENST00000324331	T;T	0.78126	-1.15;-1.15	5.81	-0.873	0.10635	Phenylalanyl-tRNA synthetase, beta subunit, ferrodoxin-fold anticodon-binding (5);	0.277274	0.34245	N	0.004134	T	0.30008	0.0751	N	0.10733	0.035	0.40073	D	0.976034	B	0.02656	0.0	B	0.04013	0.001	T	0.31752	-0.9932	10	0.06494	T	0.89	-13.0281	11.364	0.49660	0.4515:0.0:0.5485:0.0	.	409	O95363	SYFM_HUMAN	R	409	ENSP00000274680:K409R;ENSP00000316335:K409R	ENSP00000274680:K409R	K	+	2	0	FARS2	5716531	1.000000	0.71417	0.998000	0.56505	0.911000	0.54048	0.996000	0.29719	-0.051000	0.13334	0.533000	0.62120	AAG	-	superfamily_Fdx_AntiC_bd,HMMPfam_FDX-ACB		0.597	FARS2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FARS2	protein_coding	OTTHUMT00000467790.1	A	NM_006567		5716531	+1	no_errors	NM_006567	genbank	human	reviewed	54_36p	missense	SNP	0.955	G
GLDC	2731	genome.wustl.edu	37	9	6536105	6536105	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr9:6536105T>A	ENST00000321612.6	-	23	2947	c.2797A>T	c.(2797-2799)Att>Ttt	p.I933F		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	933					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	CCCTCCTCAATGTCAGCAATT	0.537																																																0			9											69.0	60.0	63.0					9																	6536105		2203	4300	6503	6526105	SO:0001583	missense	2731			D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.2797A>T	9.37:g.6536105T>A	ENSP00000370737:p.Ile933Phe	Somatic		Capture	Illumina GAIIx	4	6526105	Q2M2F8	Missense_Mutation	SNP	HMMPfam_GDC-P,superfamily_PyrdxlP-dep_Trfase_major	p.I933F	ENST00000321612.6	37	c.2797	CCDS34987.1	9	.	.	.	.	.	.	.	.	.	.	T	27.6	4.847838	0.91277	.	.	ENSG00000178445	ENST00000321612	D	0.84298	-1.83	5.33	5.33	0.75918	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.93618	0.7962	M	0.91406	3.205	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	D	0.94993	0.8136	10	0.87932	D	0	-17.9232	15.6066	0.76679	0.0:0.0:0.0:1.0	.	933	P23378	GCSP_HUMAN	F	933	ENSP00000370737:I933F	ENSP00000370737:I933F	I	-	1	0	GLDC	6526105	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	5.889000	0.69766	2.142000	0.66516	0.374000	0.22700	ATT	-	superfamily_PyrdxlP-dep_Trfase_major		0.537	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLDC	protein_coding	OTTHUMT00000051674.2	T	NM_000170		6526105	-1	no_errors	NM_000170	genbank	human	validated	54_36p	missense	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic		Capture	Illumina GAIIx	4	7519131	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7519131	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
OR10A3	26496	genome.wustl.edu	37	11	7960143	7960143	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:7960143C>A	ENST00000360759.3	-	1	998	c.925G>T	c.(925-927)Gtg>Ttg	p.V309L		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	309					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TGTAAAATCACTTTTCTTCGC	0.393																																																0			11											107.0	102.0	104.0					11																	7960143		2201	4296	6497	7916719	SO:0001583	missense	26496			BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.925G>T	11.37:g.7960143C>A	ENSP00000353988:p.Val309Leu	Somatic		Capture	Illumina GAIIx	4	7916719	B9EH39|Q6IF58|Q96R11	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V309L	ENST00000360759.3	37	c.925	CCDS31421.1	11	.	.	.	.	.	.	.	.	.	.	C	0.669	-0.802554	0.02841	.	.	ENSG00000170683	ENST00000360759	T	0.35789	1.29	4.65	1.56	0.23342	.	0.420193	0.17266	U	0.180572	T	0.11452	0.0279	N	0.04203	-0.255	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.32666	-0.9898	10	0.02654	T	1	.	3.8144	0.08809	0.272:0.5326:0.0:0.1954	.	309	P58181	O10A3_HUMAN	L	309	ENSP00000353988:V309L	ENSP00000353988:V309L	V	-	1	0	OR10A3	7916719	0.097000	0.21791	0.052000	0.19188	0.010000	0.07245	0.191000	0.17076	0.698000	0.31739	-0.237000	0.12165	GTG	-	NULL		0.393	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A3	protein_coding	OTTHUMT00000385704.1	C	NM_001003745		7916719	-1	no_errors	NM_001003745	genbank	human	provisional	54_36p	missense	SNP	0.001	A
BRPF1	7862	genome.wustl.edu	37	3	9786009	9786009	+	Silent	SNP	A	A	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr3:9786009A>C	ENST00000457855.1	+	8	2730	c.2719A>C	c.(2719-2721)Agg>Cgg	p.R907R	BRPF1_ENST00000383829.2_Silent_p.R913R|BRPF1_ENST00000424362.1_Silent_p.R906R|BRPF1_ENST00000433861.2_Intron|BRPF1_ENST00000302054.3_Silent_p.R907R			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	907	Required for RUNX1 and RUNX2 transcriptional activation.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					ACCGCCCAAGAGGCCGGGCCG	0.647																																																0			3											33.0	41.0	38.0					3																	9786009		2203	4300	6503	9761009	SO:0001819	synonymous_variant	7862			M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.2719A>C	3.37:g.9786009A>C		Somatic		Capture	Illumina GAIIx	4	9761009	B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Silent	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_EPL1,superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,PatternScan_ZF_PHD_1,superfamily_Bromodomain,HMMSmart_BROMO,HMMPfam_Bromodomain,superfamily_SSF63748,HMMPfam_PWWP,HMMSmart_PWWP	p.R913	ENST00000457855.1	37	c.2737	CCDS2575.1	3																																																																																			-	NULL		0.647	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRPF1	protein_coding	OTTHUMT00000338485.1	A	NM_001003694		9761009	+1	no_errors	NM_001003694	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
MYH8	4626	genome.wustl.edu	37	17	10309462	10309462	+	Silent	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr17:10309462C>G	ENST00000403437.2	-	21	2422	c.2328G>C	c.(2326-2328)ctG>ctC	p.L776L	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	776	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TCATTTCTTCCAGAAGACCCA	0.408									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																							0			17											108.0	104.0	106.0					17																	10309462		2203	4300	6503	10250187	SO:0001819	synonymous_variant	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.2328G>C	17.37:g.10309462C>G		Somatic		Capture	Illumina GAIIx	4	10250187	Q14910	Silent	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_IQ,HMMPfam_Myosin_tail_1	p.L776	ENST00000403437.2	37	c.2328	CCDS11153.1	17																																																																																			-	superfamily_SSF52540,HMMSmart_MYSc		0.408	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	protein_coding	OTTHUMT00000252724.2	C	NM_002472		10250187	-1	no_errors	NM_002472	genbank	human	validated	54_36p	silent	SNP	0.991	G
MYH1	4619	genome.wustl.edu	37	17	10398388	10398388	+	Nonsense_Mutation	SNP	C	C	A	rs141339850		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr17:10398388C>A	ENST00000226207.5	-	37	5420	c.5326G>T	c.(5326-5328)Gaa>Taa	p.E1776*	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1776					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E1776K(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GTGTCCTGTTCCTTCTTCAGC	0.507																																																1	Substitution - Missense(1)	skin(1)	17											165.0	159.0	161.0					17																	10398388		2203	4300	6503	10339113	SO:0001587	stop_gained	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5326G>T	17.37:g.10398388C>A	ENSP00000226207:p.Glu1776*	Somatic		Capture	Illumina GAIIx	4	10339113	Q14CA4|Q9Y622	Nonsense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_IQ,HMMPfam_Myosin_tail_1	p.E1776*	ENST00000226207.5	37	c.5326	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	C	45	11.786167	0.99602	.	.	ENSG00000109061	ENST00000226207	.	.	.	5.26	5.26	0.73747	.	0.000000	0.43579	U	0.000557	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.2282	0.93825	0.0:1.0:0.0:0.0	.	.	.	.	X	1776	.	ENSP00000226207:E1776X	E	-	1	0	MYH1	10339113	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.748000	0.85085	2.616000	0.88540	0.561000	0.74099	GAA	-	HMMPfam_Myosin_tail_1		0.507	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	C	NM_005963		10339113	-1	no_errors	NM_005963	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
TLR7	51284	genome.wustl.edu	37	X	12903901	12903901	+	Missense_Mutation	SNP	G	G	A	rs201304033		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:12903901G>A	ENST00000380659.3	+	3	413	c.274G>A	c.(274-276)Gta>Ata	p.V92I		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	92					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	GGACCATCTGGTAGAGATCGA	0.478																																																0			X						G	ILE/VAL	0,3835		0,0,0,1632,571	138.0	128.0	131.0		274	-0.0	0.0	X		131	3,6725		0,1,2,2427,1870	no	missense	TLR7	NM_016562.3	29	0,1,2,4059,2441	AA,AG,A,GG,G		0.0446,0.0,0.0284	benign	92/1050	12903901	3,10560	2203	4300	6503	12813822	SO:0001583	missense	51284			AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.274G>A	X.37:g.12903901G>A	ENSP00000370034:p.Val92Ile	Somatic		Capture	Illumina GAIIx	4	12813822	D1CS69|Q9NR98	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00365,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRCT,superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR	p.V92I	ENST00000380659.3	37	c.274	CCDS14151.1	X	.	.	.	.	.	.	.	.	.	.	G	4.901	0.167510	0.09339	0.0	4.46E-4	ENSG00000196664	ENST00000380659	T	0.02446	4.29	5.79	-0.015	0.13978	.	0.543908	0.18066	N	0.152766	T	0.02727	0.0082	L	0.41492	1.28	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.39375	-0.9617	10	0.44086	T	0.13	.	7.3791	0.26845	0.3455:0.1611:0.4934:0.0	.	92	Q9NYK1	TLR7_HUMAN	I	92	ENSP00000370034:V92I	ENSP00000370034:V92I	V	+	1	0	TLR7	12813822	0.001000	0.12720	0.008000	0.14137	0.200000	0.23975	0.307000	0.19296	-0.527000	0.06374	0.500000	0.49745	GTA	-	superfamily_L domain-like		0.478	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR7	protein_coding	OTTHUMT00000055769.1	G	NM_016562		12813822	+1	no_errors	NM_016562	genbank	human	reviewed	54_36p	missense	SNP	0.901	A
PRAMEF4	400735	genome.wustl.edu	37	1	12941996	12941996	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr1:12941996T>A	ENST00000235349.5	-	3	624	c.554A>T	c.(553-555)aAg>aTg	p.K185M		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	185					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTTCAGCTTCTTACAGCACAG	0.453																																																0			1											36.0	45.0	42.0					1																	12941996		1272	2369	3641	12864583	SO:0001583	missense	400735				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.554A>T	1.37:g.12941996T>A	ENSP00000235349:p.Lys185Met	Somatic		Capture	Illumina GAIIx	4	12864583	Q5LJB5	Missense_Mutation	SNP	superfamily_SSF52047	p.K185M	ENST00000235349.5	37	c.554	CCDS30592.1	1	.	.	.	.	.	.	.	.	.	.	t	10.59	1.394265	0.25205	.	.	ENSG00000243073	ENST00000235349	T	0.15952	2.38	1.48	-1.45	0.08828	.	0.894418	0.09587	N	0.782060	T	0.34337	0.0894	M	0.80616	2.505	0.09310	N	1	D	0.89917	1.0	D	0.75020	0.985	T	0.21075	-1.0256	10	0.62326	D	0.03	.	1.6088	0.02689	0.2947:0.2071:0.0:0.4981	.	185	O60810	PRAM4_HUMAN	M	185	ENSP00000235349:K185M	ENSP00000235349:K185M	K	-	2	0	PRAMEF4	12864583	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	-1.140000	0.03210	-0.404000	0.07610	0.329000	0.21502	AAG	-	superfamily_SSF52047		0.453	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	protein_coding	OTTHUMT00000005518.1	T	NM_001009611		12864583	-1	no_errors	NM_001009611	genbank	human	validated	54_36p	missense	SNP	0.086	A
PRAMEF14	729528	genome.wustl.edu	37	1	13669125	13669125	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr1:13669125C>T	ENST00000344998.3	-	4	1243	c.1061G>A	c.(1060-1062)aGt>aAt	p.S354N	PRAMEF14_ENST00000602491.1_5'UTR|PRAMEF14_ENST00000334600.6_Missense_Mutation_p.S402N			Q5SWL7	PRA14_HUMAN	PRAME family member 14	354					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCTCAGCCCACTGGTGTGGCA	0.547																																																0			1											93.0	107.0	102.0					1																	13669125		2153	4286	6439	13541712	SO:0001583	missense	729528					1p36.21	2014-04-01			ENSG00000204481	ENSG00000204481		"""-"""	13576	other	unknown							Standard	NM_001024661		Approved	OTTHUMG00000007916		Q5SWL7	OTTHUMG00000007916	ENST00000344998.3:c.1061G>A	1.37:g.13669125C>T	ENSP00000341333:p.Ser354Asn	Somatic		Capture	Illumina GAIIx	4	13541712		Missense_Mutation	SNP	superfamily_SSF52047	p.S354N	ENST00000344998.3	37	c.1061		1	.	.	.	.	.	.	.	.	.	.	C	0.912	-0.718759	0.03182	.	.	ENSG00000204481	ENST00000344998;ENST00000334600	T;T	0.10099	2.91;2.91	1.69	-3.38	0.04883	.	3.691650	0.00984	N	0.003435	T	0.10337	0.0253	L	0.54323	1.7	0.09310	N	1	B	0.26902	0.163	B	0.22601	0.04	T	0.16748	-1.0392	10	0.49607	T	0.09	.	1.353	0.02177	0.1613:0.3292:0.3295:0.18	.	354	Q5SWL7	PRA14_HUMAN	N	354;402	ENSP00000341333:S354N;ENSP00000334410:S402N	ENSP00000334410:S402N	S	-	2	0	PRAMEF14	13541712	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.259000	0.02861	-1.674000	0.01461	0.162000	0.16502	AGT	-	superfamily_SSF52047		0.547	PRAMEF14-201	KNOWN	basic|appris_candidate	protein_coding	PRAMEF14	protein_coding		C	NM_001099854		13541712	-1	no_errors	NM_001099854	genbank	human	provisional	54_36p	missense	SNP	0.001	T
USH1C	10083	genome.wustl.edu	37	11	17530977	17530977	+	Intron	SNP	A	A	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:17530977A>G	ENST00000318024.4	-	16	1393				USH1C_ENST00000005226.7_Missense_Mutation_p.W647R|USH1C_ENST00000527720.1_Intron|USH1C_ENST00000529563.1_Intron|USH1C_ENST00000527020.1_Intron	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)						auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						TTTGCCTCCCAGTCCTCCACT	0.597																																																0			11											88.0	77.0	81.0					11																	17530977		2200	4293	6493	17487553	SO:0001627	intron_variant	10083			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1285-7450T>C	11.37:g.17530977A>G		Somatic		Capture	Illumina GAIIx	4	17487553	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ	p.W647R	ENST00000318024.4	37	c.1939	CCDS31438.1	11	.	.	.	.	.	.	.	.	.	.	A	11.80	1.747260	0.30955	.	.	ENSG00000006611	ENST00000005226	T	0.37915	1.17	5.99	3.7	0.42460	.	0.517672	0.21961	N	0.066583	T	0.25901	0.0631	.	.	.	0.26530	N	0.974275	B	0.02656	0.0	B	0.06405	0.002	T	0.15752	-1.0426	9	0.40728	T	0.16	.	8.5659	0.33538	0.8478:0.0:0.1522:0.0	.	647	Q7RTU8	.	R	647	ENSP00000005226:W647R	ENSP00000005226:W647R	W	-	1	0	USH1C	17487553	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	2.791000	0.47829	0.532000	0.28657	0.529000	0.55759	TGG	-	NULL		0.597	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	protein_coding	OTTHUMT00000389146.1	A	NM_005709		17487553	-1	no_errors	NM_153676	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
NUP153	9972	genome.wustl.edu	37	6	17629080	17629080	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:17629080A>T	ENST00000262077.2	-	18	3349	c.3350T>A	c.(3349-3351)gTt>gAt	p.V1117D	NUP153_ENST00000537253.1_Missense_Mutation_p.V1148D	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	1117					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			CTTCCCAAAAACTAGGGAAGT	0.453																																																0			6											95.0	96.0	96.0					6																	17629080		2203	4300	6503	17737059	SO:0001583	missense	9972			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.3350T>A	6.37:g.17629080A>T	ENSP00000262077:p.Val1117Asp	Somatic		Capture	Illumina GAIIx	4	17737059	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	HMMPfam_Nup153,HMMPfam_zf-RanBP,HMMSmart_ZnF_RBZ,PatternScan_ZF_RANBP2_1,HMMPfam_Nup_retrotrp_bd	p.V1117D	ENST00000262077.2	37	c.3350	CCDS4541.1	6	.	.	.	.	.	.	.	.	.	.	A	18.36	3.606701	0.66558	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.08282	3.11;3.11	5.57	5.57	0.84162	.	0.000000	0.44902	D	0.000402	T	0.09512	0.0234	M	0.63428	1.95	0.53005	D	0.999964	D;P;P	0.55605	0.972;0.898;0.836	P;B;B	0.51615	0.675;0.372;0.296	T	0.05146	-1.0903	10	0.40728	T	0.16	-1.3456	11.6284	0.51160	0.9289:0.0:0.0711:0.0	.	1148;1097;1117	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	D	1117;1097;1148	ENSP00000262077:V1117D;ENSP00000444029:V1148D	ENSP00000262077:V1117D	V	-	2	0	NUP153	17737059	0.087000	0.21565	0.963000	0.40424	0.847000	0.48162	2.448000	0.44926	2.115000	0.64714	0.533000	0.62120	GTT	-	NULL		0.453	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP153	protein_coding	OTTHUMT00000039953.1	A			17737059	-1	no_errors	NM_005124	genbank	human	reviewed	54_36p	missense	SNP	0.418	T
GLTPP1	645312	genome.wustl.edu	37	11	18210844	18210844	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:18210844G>T	ENST00000527671.1	-	1	198	c.74C>A	c.(73-75)cCt>cAt	p.P25H																	lung(6)	6						GCTGAAAAGAGGCCTCCGCTT	0.587																																																0			11																																								18167420	SO:0001583	missense	645312																														ENST00000527671.1:c.74C>A	11.37:g.18210844G>T	ENSP00000436221:p.Pro25His	Somatic		Capture	Illumina GAIIx	4	18167420		Missense_Mutation	SNP	superfamily_Glycolipid transfer protein GLTP,HMMPfam_GLTP	p.G100C	ENST00000527671.1	37	c.298		11	.	.	.	.	.	.	.	.	.	.	g	11.72	1.722219	0.30503	.	.	ENSG00000255470	ENST00000527671	.	.	.	2.31	2.31	0.28768	.	.	.	.	.	T	0.59280	0.2182	.	.	.	.	.	.	.	.	.	.	.	.	T	0.71794	-0.4485	4	0.87932	D	0	.	10.3477	0.43916	0.0:0.0:1.0:0.0	.	.	.	.	H	25	.	ENSP00000436221:P25H	P	-	2	0	RP11-113D6.6	18167420	1.000000	0.71417	0.968000	0.41197	0.805000	0.45488	2.691000	0.47010	1.317000	0.45149	0.460000	0.39030	CCT	-	superfamily_Glycolipid transfer protein GLTP,HMMPfam_GLTP		0.587	RP11-113D6.6-001	NOVEL	basic|appris_principal	protein_coding	LOC645312	protein_coding	OTTHUMT00000389787.1	G			18167420	+1	pseudogene	XM_928351	genbank	human	model	54_36p	missense	SNP	0.998	T
PRPSAP2	5636	genome.wustl.edu	37	17	18769234	18769234	+	Missense_Mutation	SNP	T	T	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr17:18769234T>G	ENST00000268835.2	+	3	371	c.88T>G	c.(88-90)Tca>Gca	p.S30A	PRPSAP2_ENST00000536323.1_De_novo_Start_OutOfFrame|PRPSAP2_ENST00000542013.1_Missense_Mutation_p.S30A|PRPSAP2_ENST00000419071.2_Missense_Mutation_p.S30A	NM_002767.3	NP_002758.1	O60256	KPRB_HUMAN	phosphoribosyl pyrophosphate synthetase-associated protein 2	30					bone development (GO:0060348)|negative regulation of catalytic activity (GO:0043086)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide biosynthetic process (GO:0009165)	ribose phosphate diphosphokinase complex (GO:0002189)	enzyme inhibitor activity (GO:0004857)|magnesium ion binding (GO:0000287)|ribose phosphate diphosphokinase activity (GO:0004749)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11						CTCGAATTCATCATGTATGGA	0.333																																																0			17											85.0	81.0	82.0					17																	18769234		2203	4300	6503	18709959	SO:0001583	missense	5636			AB007851	CCDS11200.1, CCDS58525.1, CCDS58526.1, CCDS58527.1	17p12-p11.2	2008-05-14			ENSG00000141127	ENSG00000141127			9467	protein-coding gene	gene with protein product		603762				9806849	Standard	NM_002767		Approved	PAP41	uc002gup.2	O60256	OTTHUMG00000059406	ENST00000268835.2:c.88T>G	17.37:g.18769234T>G	ENSP00000268835:p.Ser30Ala	Somatic		Capture	Illumina GAIIx	4	18709959	B4E1M8|B4E329|B7ZKZ1|E7EMY2|Q6IAS2	Missense_Mutation	SNP	superfamily_SSF53271,HMMPfam_RelB,HMMPfam_Pribosyltran	p.S30A	ENST00000268835.2	37	c.88	CCDS11200.1	17	.	.	.	.	.	.	.	.	.	.	T	10.61	1.399545	0.25291	.	.	ENSG00000141127	ENST00000441887;ENST00000395656;ENST00000414602;ENST00000419071;ENST00000432893;ENST00000431320;ENST00000455992;ENST00000412418;ENST00000419284;ENST00000268835;ENST00000422237;ENST00000542013	D;D;D;D;D;D;D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97;-2.97;-2.97;-2.97;-2.97;-2.97;-2.97	5.81	5.81	0.92471	.	0.058911	0.64402	D	0.000001	T	0.74959	0.3785	N	0.00677	-1.265	0.80722	D	1	B;B;B	0.12013	0.003;0.005;0.003	B;B;B	0.17979	0.01;0.009;0.02	T	0.75099	-0.3437	10	0.02654	T	1	-15.6241	15.8274	0.78725	0.0:0.0:0.0:1.0	.	30;30;30	B7ZKZ1;E7EMY2;O60256	.;.;KPRB_HUMAN	A	30	ENSP00000395127:S30A;ENSP00000416964:S30A;ENSP00000392536:S30A;ENSP00000399625:S30A;ENSP00000416021:S30A;ENSP00000402612:S30A;ENSP00000415446:S30A;ENSP00000268835:S30A;ENSP00000401144:S30A;ENSP00000439129:S30A	ENSP00000268835:S30A	S	+	1	0	PRPSAP2	18709959	1.000000	0.71417	0.873000	0.34254	0.455000	0.32408	5.823000	0.69272	2.221000	0.72209	0.383000	0.25322	TCA	-	superfamily_SSF53271		0.333	PRPSAP2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPSAP2	protein_coding	OTTHUMT00000132112.3	T	NM_002767		18709959	+1	no_errors	NM_002767	genbank	human	reviewed	54_36p	missense	SNP	0.967	G
NSUN6	221078	genome.wustl.edu	37	10	18940111	18940111	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr10:18940111A>G	ENST00000377304.4	-	1	440	c.22T>C	c.(22-24)Tct>Cct	p.S8P	RP11-139J15.7_ENST00000606425.1_Intron	NM_182543.2	NP_872349.1	Q8TEA1	NSUN6_HUMAN	NOP2/Sun domain family, member 6	8							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15						GGTCTCAAAGATATCTTAGGG	0.318																																																0			10											94.0	95.0	95.0					10																	18940111		2202	4300	6502	18980117	SO:0001583	missense	221078			BC035778	CCDS7130.1	10p13	2014-06-23	2009-11-23	2004-08-26	ENSG00000241058	ENSG00000241058		"""NOP2/Sun domain containing"""	23529	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 6"", ""NOL1/NOP2/Sun domain family, member 6"", ""ARL5B antisense RNA 1"""	NOPD1, ARL5B-AS1			Standard	XM_005252394		Approved	FLJ23743	uc010qcp.1	Q8TEA1	OTTHUMG00000017767	ENST00000377304.4:c.22T>C	10.37:g.18940111A>G	ENSP00000366519:p.Ser8Pro	Somatic		Capture	Illumina GAIIx	4	18980117	B0YJ54	Missense_Mutation	SNP	superfamily_S-adenosyl-L-methionine-dependent methyltransferases,superfamily_PUA domain-like,HMMPfam_PUA,HMMPfam_Nol1_Nop2_Fmu,PatternScan_NOL1_NOP2_SUN	p.S8P	ENST00000377304.4	37	c.22	CCDS7130.1	10	.	.	.	.	.	.	.	.	.	.	A	15.15	2.748515	0.49257	.	.	ENSG00000241058	ENST00000377304	T	0.32988	1.43	5.32	1.22	0.21188	.	0.317235	0.36703	N	0.002446	T	0.25494	0.0620	M	0.72118	2.19	0.42430	D	0.992673	P	0.43169	0.8	B	0.35470	0.203	T	0.05194	-1.0900	10	0.40728	T	0.16	.	7.2107	0.25931	0.4778:0.4436:0.0786:0.0	.	8	Q8TEA1	NSUN6_HUMAN	P	8	ENSP00000366519:S8P	ENSP00000366519:S8P	S	-	1	0	NSUN6	18980117	0.495000	0.26051	0.983000	0.44433	0.939000	0.58152	0.322000	0.19576	0.360000	0.24265	0.533000	0.62120	TCT	-	NULL		0.318	NSUN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN6	protein_coding	OTTHUMT00000047083.1	A	NM_182543		18980117	-1	no_errors	NM_182543	genbank	human	validated	54_36p	missense	SNP	1.000	G
TEP1	7011	genome.wustl.edu	37	14	20876541	20876541	+	Missense_Mutation	SNP	G	G	A	rs145064396	byFrequency	TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr14:20876541G>A	ENST00000262715.5	-	2	98	c.58C>T	c.(58-60)Cgg>Tgg	p.R20W	TEP1_ENST00000556935.1_Missense_Mutation_p.R20W	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	20					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GCCAGGCACCGGTTCTCCAAG	0.498																																																0			14											87.0	83.0	84.0					14																	20876541		2203	4300	6503	19946381	SO:0001583	missense	7011				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.58C>T	14.37:g.20876541G>A	ENSP00000262715:p.Arg20Trp	Somatic		Capture	Illumina GAIIx	4	19946381	A0AUV9	Missense_Mutation	SNP	HMMPfam_TEP1_N,HMMPfam_TROVE,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_NACHT,HMMSmart_SM00320,superfamily_WD40 repeat-like,PatternScan_WD_REPEATS_1,HMMPfam_WD40	p.R20W	ENST00000262715.5	37	c.58	CCDS9548.1	14	.	.	.	.	.	.	.	.	.	.	G	15.63	2.891383	0.52014	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935;ENST00000556549	T;T;T	0.60424	0.19;0.19;0.19	4.02	2.06	0.26882	.	.	.	.	.	T	0.58235	0.2108	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	P;D	0.64595	0.88;0.927	T	0.57556	-0.7791	9	0.72032	D	0.01	.	8.8955	0.35460	0.0:0.0:0.5971:0.4029	.	20;20	G3V5X7;Q99973	.;TEP1_HUMAN	W	20	ENSP00000262715:R20W;ENSP00000452574:R20W;ENSP00000452240:R20W	ENSP00000262715:R20W	R	-	1	2	TEP1	19946381	0.983000	0.35010	0.958000	0.39756	0.741000	0.42261	1.077000	0.30741	0.402000	0.25451	0.305000	0.20034	CGG	-	HMMPfam_TEP1_N		0.498	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEP1	protein_coding	OTTHUMT00000073563.2	G	NM_007110		19946381	-1	no_errors	NM_007110	genbank	human	reviewed	54_36p	missense	SNP	0.992	A
APOB	338	genome.wustl.edu	37	2	21235422	21235422	+	Missense_Mutation	SNP	C	C	A	rs530601244		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr2:21235422C>A	ENST00000233242.1	-	26	4445	c.4318G>T	c.(4318-4320)Gta>Tta	p.V1440L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1440					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGTTTTTCTACATGACTGAAT	0.388																																																0			2											90.0	96.0	94.0					2																	21235422		2203	4300	6503	21088927	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4318G>T	2.37:g.21235422C>A	ENSP00000233242:p.Val1440Leu	Somatic		Capture	Illumina GAIIx	4	21088927	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	superfamily_Lipovitellin-phosvitin complex beta-sheet shell regions,HMMPfam_Vitellogenin_N,HMMSmart_SM00638,superfamily_Lipovitellin-phosvitin complex superhelical domain,HMMPfam_DUF1943,HMMPfam_DUF1081	p.V1440L	ENST00000233242.1	37	c.4318	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	11.75	1.731020	0.30684	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00724	5.78	5.62	3.82	0.43975	.	0.601234	0.15805	N	0.243772	T	0.00967	0.0032	M	0.63428	1.95	0.09310	N	0.999996	B	0.25719	0.132	B	0.17098	0.017	T	0.46527	-0.9185	10	0.29301	T	0.29	.	3.8043	0.08771	0.0:0.5173:0.1813:0.3014	.	1440	P04114	APOB_HUMAN	L	1440	ENSP00000233242:V1440L	ENSP00000233242:V1440L	V	-	1	0	APOB	21088927	0.049000	0.20398	0.994000	0.49952	0.973000	0.67179	0.997000	0.29731	1.364000	0.46038	0.655000	0.94253	GTA	-	NULL		0.388	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	C			21088927	-1	no_errors	NM_000384	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
FGF9	2254	genome.wustl.edu	37	13	22275396	22275396	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr13:22275396C>A	ENST00000382353.5	+	3	979	c.449C>A	c.(448-450)tCa>tAa	p.S150*	FGF9_ENST00000478546.1_3'UTR	NM_002010.2	NP_002001.1	P31371	FGF9_HUMAN	fibroblast growth factor 9	150					angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic digestive tract development (GO:0048566)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein import into nucleus (GO:0006606)|regulation of timing of cell differentiation (GO:0048505)|signal transduction (GO:0007165)|substantia nigra development (GO:0021762)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|skin(2)	9		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		ACGTACTCATCAAACCTATAT	0.408																																					Melanoma(195;1939 2127 12623 13963 52730)											0			13											98.0	87.0	90.0					13																	22275396		2203	4300	6503	21173396	SO:0001587	stop_gained	2254			D14838	CCDS9298.1	13q11-q12	2014-01-30	2013-06-18		ENSG00000102678	ENSG00000102678		"""Endogenous ligands"""	3687	protein-coding gene	gene with protein product	"""glia-activating factor"""	600921	"""fibroblast growth factor 9 (glia-activating factor)"""			8321227	Standard	NM_002010		Approved		uc001uog.2	P31371	OTTHUMG00000017412	ENST00000382353.5:c.449C>A	13.37:g.22275396C>A	ENSP00000371790:p.Ser150*	Somatic		Capture	Illumina GAIIx	4	21173396	A8K427|Q3SY32	Nonsense_Mutation	SNP	superfamily_Cytokine,HMMSmart_SM00442,HMMPfam_FGF,PatternScan_HBGF_FGF	p.S150*	ENST00000382353.5	37	c.449	CCDS9298.1	13	.	.	.	.	.	.	.	.	.	.	C	40	7.994819	0.98599	.	.	ENSG00000102678	ENST00000382353	.	.	.	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.5023	0.95100	0.0:1.0:0.0:0.0	.	.	.	.	X	150	.	ENSP00000371790:S150X	S	+	2	0	FGF9	21173396	1.000000	0.71417	0.888000	0.34837	0.885000	0.51271	7.487000	0.81328	2.605000	0.88082	0.591000	0.81541	TCA	-	superfamily_Cytokine,HMMSmart_SM00442,HMMPfam_FGF		0.408	FGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF9	protein_coding	OTTHUMT00000046002.2	C			21173396	+1	no_errors	NM_002010	genbank	human	reviewed	54_36p	nonsense	SNP	0.998	A
MKRN3	7681	genome.wustl.edu	37	15	23811058	23811058	+	Silent	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr15:23811058T>C	ENST00000314520.3	+	1	605	c.129T>C	c.(127-129)gcT>gcC	p.A43A	MKRN3_ENST00000568252.1_Silent_p.A43A|MKRN3_ENST00000564592.1_Silent_p.A43A|RP11-73C9.1_ENST00000563044.1_RNA	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	43					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		AATCTGCTGCTCCAGATTCAG	0.701																																																0			15											32.0	36.0	35.0					15																	23811058		2202	4299	6501	21362151	SO:0001819	synonymous_variant	7681			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.129T>C	15.37:g.23811058T>C		Somatic		Capture	Illumina GAIIx	4	21362151		Silent	SNP	HMMSmart_ZnF_C3H1,HMMPfam_zf-CCCH,superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1	p.A43	ENST00000314520.3	37	c.129	CCDS10013.1	15																																																																																			-	NULL		0.701	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	protein_coding	OTTHUMT00000251225.1	T	NM_005664		21362151	+1	no_errors	NM_005664	genbank	human	reviewed	54_36p	silent	SNP	0.000	C
NDN	4692	genome.wustl.edu	37	15	23931868	23931868	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr15:23931868G>A	ENST00000331837.4	-	1	582	c.497C>T	c.(496-498)gCg>gTg	p.A166V		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	166	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		TTTGACCAGCGCAAACTCCAT	0.632									Prader-Willi syndrome																																							0			15											28.0	28.0	28.0					15																	23931868		2203	4300	6503	21482961	SO:0001583	missense	4692	Familial Cancer Database	Prader-Labhart-Willi syndrome	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.497C>T	15.37:g.23931868G>A	ENSP00000332643:p.Ala166Val	Somatic		Capture	Illumina GAIIx	4	21482961	B2R6Z5	Missense_Mutation	SNP	HMMPfam_MAGE	p.A166V	ENST00000331837.4	37	c.497	CCDS10014.1	15	.	.	.	.	.	.	.	.	.	.	G	13.74	2.327563	0.41197	.	.	ENSG00000182636	ENST00000331837	T	0.03982	3.74	4.08	3.16	0.36331	.	0.190720	0.38663	N	0.001617	T	0.02047	0.0064	N	0.04116	-0.275	0.20703	N	0.999867	B	0.12630	0.006	B	0.15484	0.013	T	0.47923	-0.9079	10	0.07990	T	0.79	.	8.2949	0.31980	0.1147:0.0:0.8853:0.0	.	166	Q99608	NECD_HUMAN	V	166	ENSP00000332643:A166V	ENSP00000332643:A166V	A	-	2	0	NDN	21482961	0.998000	0.40836	0.675000	0.29917	0.989000	0.77384	3.928000	0.56506	1.017000	0.39495	0.561000	0.74099	GCG	-	HMMPfam_MAGE		0.632	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDN	protein_coding	OTTHUMT00000251226.2	G	NM_002487		21482961	-1	no_errors	NM_002487	genbank	human	reviewed	54_36p	missense	SNP	0.425	A
MLLT10	8028	genome.wustl.edu	37	10	22016812	22016812	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr10:22016812A>T	ENST00000307729.7	+	16	2196	c.2018A>T	c.(2017-2019)aAc>aTc	p.N673I	MLLT10_ENST00000377072.3_Missense_Mutation_p.N689I|MLLT10_ENST00000377059.3_Missense_Mutation_p.N673I|MLLT10_ENST00000446906.2_Missense_Mutation_p.N673I			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	673	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						AATAGCCGCAACCTAGTTGGC	0.433			T	"""MLL, PICALM, CDK6"""	AL																																		Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	0			10											62.0	60.0	61.0					10																	22016812		2203	4300	6503	22056818	SO:0001583	missense	8028			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.2018A>T	10.37:g.22016812A>T	ENSP00000307411:p.Asn673Ile	Somatic		Capture	Illumina GAIIx	4	22056818	B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,PatternScan_ZF_PHD_1	p.N689I	ENST00000307729.7	37	c.2066	CCDS55708.1	10	.	.	.	.	.	.	.	.	.	.	A	13.22	2.172448	0.38315	.	.	ENSG00000078403	ENST00000377072;ENST00000446906;ENST00000307729;ENST00000396529;ENST00000377059;ENST00000438473;ENST00000538639	T;T;T;T	0.09073	3.02;3.02;3.02;3.02	5.82	3.97	0.46021	.	0.129392	0.64402	D	0.000001	T	0.07458	0.0188	N	0.22421	0.69	0.35219	D	0.77587	D;B;B;B	0.53151	0.958;0.437;0.036;0.437	P;B;B;B	0.45506	0.483;0.143;0.063;0.143	T	0.31364	-0.9946	10	0.56958	D	0.05	.	9.054	0.36394	0.291:0.0:0.709:0.0	.	368;673;673;689	Q5HYC6;E9PBP4;Q5VX90;P55197	.;.;.;AF10_HUMAN	I	689;673;673;508;673;332;331	ENSP00000366272:N689I;ENSP00000401406:N673I;ENSP00000307411:N673I;ENSP00000366258:N673I	ENSP00000307411:N673I	N	+	2	0	MLLT10	22056818	1.000000	0.71417	0.987000	0.45799	0.991000	0.79684	3.128000	0.50492	0.783000	0.33636	-0.248000	0.11899	AAC	-	NULL		0.433	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT10	protein_coding	OTTHUMT00000047136.1	A			22056818	+1	no_errors	NM_004641	genbank	human	validated	54_36p	missense	SNP	1.000	T
PIWIL2	55124	genome.wustl.edu	37	8	22212974	22212974	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr8:22212974C>G	ENST00000454009.2	+	23	3387	c.2878C>G	c.(2878-2880)Cat>Gat	p.H960D	PIWIL2_ENST00000521356.1_Missense_Mutation_p.H924D|PIWIL2_ENST00000356766.6_Missense_Mutation_p.H960D	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	960					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		CATCTTGCATCATGAACCAGC	0.532																																																0			8											135.0	108.0	117.0					8																	22212974		2203	4300	6503	22268919	SO:0001583	missense	55124			AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.2878C>G	8.37:g.22212974C>G	ENSP00000406956:p.His960Asp	Somatic		Capture	Illumina GAIIx	4	22268919	A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Missense_Mutation	SNP	superfamily_PAZ domain,HMMPfam_PAZ,superfamily_Ribonuclease H-like,HMMPfam_Piwi	p.H960D	ENST00000454009.2	37	c.2878	CCDS6029.1	8	.	.	.	.	.	.	.	.	.	.	C	11.52	1.664649	0.29604	.	.	ENSG00000197181	ENST00000356766;ENST00000521356;ENST00000454009	T;T;T	0.13538	2.58;2.58;2.58	5.76	5.76	0.90799	Ribonuclease H-like (1);	0.271316	0.42548	D	0.000700	T	0.07052	0.0179	N	0.02539	-0.55	0.37940	D	0.932292	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.41680	-0.9495	10	0.21014	T	0.42	-21.8153	18.7434	0.91782	0.0:1.0:0.0:0.0	.	924;960	E7ECA4;Q8TC59	.;PIWL2_HUMAN	D	960;924;960	ENSP00000349208:H960D;ENSP00000428267:H924D;ENSP00000406956:H960D	ENSP00000349208:H960D	H	+	1	0	PIWIL2	22268919	0.997000	0.39634	1.000000	0.80357	0.814000	0.46013	1.660000	0.37397	2.718000	0.92993	0.650000	0.86243	CAT	-	superfamily_Ribonuclease H-like		0.532	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PIWIL2	protein_coding	OTTHUMT00000375438.1	C			22268919	+1	no_errors	NM_018068	genbank	human	validated	54_36p	missense	SNP	0.998	G
SNURF	8926	genome.wustl.edu	37	15	25207325	25207325	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr15:25207325C>G	ENST00000577949.1	+	2	142	c.79C>G	c.(79-81)Cgc>Ggc	p.R27G	SNRPN_ENST00000554227.2_5'UTR|SNRPN_ENST00000346403.6_5'UTR|SNURF_ENST00000338327.4_Missense_Mutation_p.R27G|SNRPN_ENST00000577565.1_5'UTR|SNRPN_ENST00000390687.4_5'UTR|SNRPN_ENST00000400100.1_5'UTR|SNURF_ENST00000551312.2_Missense_Mutation_p.R27G|SNRPN_ENST00000400098.1_5'UTR|SNURF_ENST00000338094.6_Missense_Mutation_p.R27G|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_5'UTR			Q9Y675	SNURF_HUMAN	SNRPN upstream reading frame	27						nucleus (GO:0005634)				breast(2)|large_intestine(2)|lung(1)	5		all_cancers(20;1.4e-21)|Breast(32;0.000625)		all cancers(64;3.48e-07)|Epithelial(43;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0142)		CCAAGTCAAACGCAGAAGGAC	0.448																																																0			15											151.0	117.0	129.0					15																	25207325		2203	4300	6503	22758418	SO:0001583	missense	8926				CCDS10016.1	15q11.2	2013-08-27			ENSG00000214265	ENSG00000214265			11171	protein-coding gene	gene with protein product						10318933	Standard	NM_022804		Approved		uc001ywu.3	Q9Y675	OTTHUMG00000129181	ENST00000577949.1:c.79C>G	15.37:g.25207325C>G	ENSP00000463201:p.Arg27Gly	Somatic		Capture	Illumina GAIIx	4	22758418	A6NCW2	Missense_Mutation	SNP	HMMPfam_SNURF	p.R27G	ENST00000577949.1	37	c.79	CCDS10016.1	15	.	.	.	.	.	.	.	.	.	.	C	12.07	1.827784	0.32329	.	.	ENSG00000214265	ENST00000338094;ENST00000338327	.	.	.	3.76	2.85	0.33270	.	.	.	.	.	T	0.26412	0.0645	.	.	.	0.26874	N	0.967697	B	0.16802	0.019	B	0.17433	0.018	T	0.16394	-1.0404	7	0.25106	T	0.35	-1.5756	7.291	0.26366	0.0:0.8804:0.0:0.1196	.	27	Q9Y675	SNURF_HUMAN	G	27	.	ENSP00000336543:R27G	R	+	1	0	SNURF	22758418	0.999000	0.42202	0.962000	0.40283	0.857000	0.48899	2.269000	0.43346	1.186000	0.42985	-0.136000	0.14681	CGC	-	HMMPfam_SNURF		0.448	SNURF-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SNURF	protein_coding	OTTHUMT00000446300.1	C	NM_005678		22758418	+1	no_errors	NM_005678	genbank	human	reviewed	54_36p	missense	SNP	0.996	G
WASF3	10810	genome.wustl.edu	37	13	27259836	27259836	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr13:27259836A>G	ENST00000335327.5	+	10	1541	c.1363A>G	c.(1363-1365)Aaa>Gaa	p.K455E	WASF3_ENST00000361042.4_Missense_Mutation_p.K452E	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	455	WH2. {ECO:0000255|PROSITE- ProRule:PRU00406}.				actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)				breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		AATTCAACTGAAAAAGGTGCA	0.507																																																0			13											107.0	94.0	98.0					13																	27259836		2203	4300	6503	26157836	SO:0001583	missense	10810			AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.1363A>G	13.37:g.27259836A>G	ENSP00000335055:p.Lys455Glu	Somatic		Capture	Illumina GAIIx	4	26157836	O94974|Q86VQ2	Missense_Mutation	SNP	HMMPfam_WH2,HMMSmart_SM00246	p.K455E	ENST00000335327.5	37	c.1363	CCDS9318.1	13	.	.	.	.	.	.	.	.	.	.	A	24.0	4.485500	0.84854	.	.	ENSG00000132970	ENST00000361042;ENST00000335327	T;T	0.70045	-0.45;-0.45	5.75	5.75	0.90469	Actin-binding WH2 (3);	0.045400	0.85682	D	0.000000	T	0.82130	0.4970	M	0.78801	2.425	0.80722	D	1	D;D	0.76494	0.999;0.989	D;P	0.81914	0.995;0.9	D	0.84574	0.0657	10	0.87932	D	0	-39.0663	16.0356	0.80625	1.0:0.0:0.0:0.0	.	452;455	Q86VQ2;Q9UPY6	.;WASF3_HUMAN	E	452;455	ENSP00000354325:K452E;ENSP00000335055:K455E	ENSP00000335055:K455E	K	+	1	0	WASF3	26157836	1.000000	0.71417	0.988000	0.46212	0.668000	0.39293	8.855000	0.92236	2.192000	0.70111	0.459000	0.35465	AAA	-	HMMPfam_WH2,HMMSmart_SM00246		0.507	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF3	protein_coding	OTTHUMT00000044258.1	A			26157836	+1	no_errors	NM_006646	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TCF23	150921	genome.wustl.edu	37	2	27375590	27375590	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr2:27375590G>T	ENST00000296096.5	+	3	630	c.500G>T	c.(499-501)gGc>gTc	p.G167V		NM_175769.2	NP_786951.1	Q7RTU1	TCF23_HUMAN	transcription factor 23	167					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	nucleus (GO:0005634)				large_intestine(2)|lung(11)|prostate(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TATGCTGGAGGCCTGGGGTAC	0.567																																																0			2											91.0	82.0	85.0					2																	27375590		2203	4300	6503	27229094	SO:0001583	missense	150921			AC013403	CCDS33163.1	2p23.3	2013-05-21			ENSG00000163792	ENSG00000163792		"""Basic helix-loop-helix proteins"""	18602	protein-coding gene	gene with protein product		609635				11701948, 10652346	Standard	NM_175769		Approved	OUT, bHLHa24	uc010ylg.2	Q7RTU1	OTTHUMG00000152031	ENST00000296096.5:c.500G>T	2.37:g.27375590G>T	ENSP00000296096:p.Gly167Val	Somatic		Capture	Illumina GAIIx	4	27229094	B2RNZ3	Missense_Mutation	SNP	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH	p.G167V	ENST00000296096.5	37	c.500	CCDS33163.1	2	.	.	.	.	.	.	.	.	.	.	G	15.95	2.982758	0.53827	.	.	ENSG00000163792	ENST00000296096	D	0.97209	-4.29	5.02	3.09	0.35607	.	0.155904	0.43579	D	0.000558	D	0.93795	0.8016	L	0.50919	1.6	0.48236	D	0.999612	B	0.32302	0.363	B	0.28232	0.087	D	0.92609	0.6098	10	0.54805	T	0.06	-22.5243	9.4529	0.38736	0.0:0.152:0.6923:0.1557	.	167	Q7RTU1	TCF23_HUMAN	V	167	ENSP00000296096:G167V	ENSP00000296096:G167V	G	+	2	0	TCF23	27229094	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	2.073000	0.41519	2.495000	0.84180	0.655000	0.94253	GGC	-	NULL		0.567	TCF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF23	protein_coding	OTTHUMT00000324980.1	G	NM_175769		27229094	+1	no_errors	NM_175769	genbank	human	provisional	54_36p	missense	SNP	0.998	T
PAN3	255967	genome.wustl.edu	37	13	28834642	28834642	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr13:28834642C>G	ENST00000380958.3	+	8	1459	c.1307C>G	c.(1306-1308)cCg>cGg	p.P436R	PAN3_ENST00000399613.1_Missense_Mutation_p.P236R|PAN3_ENST00000282391.5_Missense_Mutation_p.P124R	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		TATATGCAACCGAAAGCAAAC	0.403																																																0			13											168.0	145.0	152.0					13																	28834642		2203	4300	6503	27732642	SO:0001583	missense	255967			AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.1307C>G	13.37:g.28834642C>G	ENSP00000370345:p.Pro436Arg	Somatic		Capture	Illumina GAIIx	4	27732642		Missense_Mutation	SNP	superfamily_Kinase_like	p.P236R	ENST00000380958.3	37	c.707	CCDS9329.2	13	.	.	.	.	.	.	.	.	.	.	C	19.38	3.815718	0.70912	.	.	ENSG00000152520	ENST00000380958;ENST00000399613;ENST00000282391	T;T;T	0.06608	3.28;3.28;3.28	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.24509	0.0594	M	0.62723	1.935	0.80722	D	1	P;B;D;D	0.89917	0.619;0.388;1.0;1.0	B;B;D;D	0.87578	0.39;0.236;0.998;0.998	T	0.00079	-1.2111	10	0.36615	T	0.2	-10.7067	19.8535	0.96748	0.0:1.0:0.0:0.0	.	436;436;124;382	Q58A45-4;Q58A45;Q58A45-2;Q58A45-3	.;PAN3_HUMAN;.;.	R	436;236;124	ENSP00000370345:P436R;ENSP00000382522:P236R;ENSP00000282391:P124R	ENSP00000282391:P124R	P	+	2	0	PAN3	27732642	1.000000	0.71417	0.994000	0.49952	0.905000	0.53344	7.610000	0.82949	2.686000	0.91538	0.585000	0.79938	CCG	-	NULL		0.403	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN3	protein_coding	OTTHUMT00000044318.4	C	NM_175854		27732642	+1	no_errors	NM_175854	genbank	human	validated	54_36p	missense	SNP	1.000	G
N6AMT1	29104	genome.wustl.edu	37	21	30257615	30257615	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr21:30257615G>T	ENST00000303775.5	-	1	78	c.53C>A	c.(52-54)gCc>gAc	p.A18D	N6AMT1_ENST00000351429.3_Missense_Mutation_p.A18D	NM_013240.4	NP_037372	Q9Y5N5	HEMK2_HUMAN	N-6 adenine-specific DNA methyltransferase 1 (putative)	18					positive regulation of cell growth (GO:0030307)|protein methylation (GO:0006479)	protein complex (GO:0043234)	nucleic acid binding (GO:0003676)|protein methyltransferase activity (GO:0008276)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)	12						GTCGCTGAAGGCGCCGCGGCC	0.687																																																0			21											36.0	40.0	39.0					21																	30257615		2203	4298	6501	29179486	SO:0001583	missense	29104			AF139682	CCDS33525.1, CCDS33526.1	21q21.3	2006-12-14	2006-12-14	2006-12-14	ENSG00000156239	ENSG00000156239	2.1.1.72		16021	protein-coding gene	gene with protein product		614553	"""chromosome 21 open reading frame 127"", ""HemK methyltransferase family member 2"""	C21orf127, HEMK2			Standard	NM_013240		Approved	PRED28, N6AMT, MTQ2	uc002ymo.2	Q9Y5N5	OTTHUMG00000078750	ENST00000303775.5:c.53C>A	21.37:g.30257615G>T	ENSP00000303584:p.Ala18Asp	Somatic		Capture	Illumina GAIIx	4	29179486	Q96F73	Missense_Mutation	SNP	HMMPfam_MTS,superfamily_S-adenosyl-L-methionine-dependent methyltransferases,PatternScan_N6_MTASE	p.A18D	ENST00000303775.5	37	c.53	CCDS33526.1	21	.	.	.	.	.	.	.	.	.	.	G	2.551	-0.303987	0.05495	.	.	ENSG00000156239	ENST00000303775;ENST00000351429	T;T	0.20881	2.61;2.04	5.18	-1.57	0.08506	.	1.069530	0.07058	N	0.833180	T	0.04861	0.0131	N	0.01228	-0.945	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.32798	-0.9893	10	0.06891	T	0.86	0.6016	1.3346	0.02142	0.1723:0.1349:0.2791:0.4138	.	18;18	Q9Y5N5-2;Q9Y5N5	.;HEMK2_HUMAN	D	18	ENSP00000303584:A18D;ENSP00000286764:A18D	ENSP00000303584:A18D	A	-	2	0	N6AMT1	29179486	0.001000	0.12720	0.002000	0.10522	0.696000	0.40369	0.141000	0.16076	-0.510000	0.06523	-0.291000	0.09656	GCC	-	HMMPfam_MTS,superfamily_S-adenosyl-L-methionine-dependent methyltransferases		0.687	N6AMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N6AMT1	protein_coding	OTTHUMT00000171738.1	G	NM_013240		29179486	-1	no_errors	NM_013240	genbank	human	reviewed	54_36p	missense	SNP	0.101	T
GHRHR	2692	genome.wustl.edu	37	7	31008682	31008682	+	Silent	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr7:31008682C>T	ENST00000326139.2	+	3	211	c.165C>T	c.(163-165)tgC>tgT	p.C55C	GHRHR_ENST00000409316.1_5'Flank|GHRHR_ENST00000409904.3_5'Flank	NM_000823.3	NP_000814.2	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	55					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP-mediated signaling (GO:0019933)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|determination of adult lifespan (GO:0008340)|growth hormone secretion (GO:0030252)|hormone metabolic process (GO:0042445)|lactation (GO:0007595)|multicellular organismal reproductive process (GO:0048609)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of intracellular steroid hormone receptor signaling pathway (GO:0033143)|regulation of protein metabolic process (GO:0051246)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|somatotropin secreting cell development (GO:0060133)|water homeostasis (GO:0030104)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nuclear matrix (GO:0016363)|nuclear outer membrane (GO:0005640)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	G-protein coupled receptor activity (GO:0004930)|growth factor binding (GO:0019838)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35					Sermorelin(DB00010)|Tesamorelin(DB08869)	ATCCAGGCTGCCCTGCGACCT	0.607																																																0			7											21.0	21.0	21.0					7																	31008682		2201	4295	6496	30975207	SO:0001819	synonymous_variant	2692				CCDS5432.1	7p14	2012-08-10			ENSG00000106128	ENSG00000106128		"""GPCR / Class B : Glucagon receptors"""	4266	protein-coding gene	gene with protein product		139191				7680413, 7514564	Standard	NM_000823		Approved		uc003tbx.3	Q02643	OTTHUMG00000152801	ENST00000326139.2:c.165C>T	7.37:g.31008682C>T		Somatic		Capture	Illumina GAIIx	4	30975207	Q99863	Silent	SNP	superfamily_SSF111418,HMMSmart_HormR,HMMPfam_HRM,PatternScan_G_PROTEIN_RECEP_F2_1,superfamily_SSF81321,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.C55	ENST00000326139.2	37	c.165	CCDS5432.1	7																																																																																			-	superfamily_SSF111418,HMMSmart_HormR,HMMPfam_HRM,PatternScan_G_PROTEIN_RECEP_F2_1		0.607	GHRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHRHR	protein_coding	OTTHUMT00000327967.2	C			30975207	+1	no_errors	NM_000823	genbank	human	reviewed	54_36p	silent	SNP	0.738	T
PRRC2A	7916	genome.wustl.edu	37	6	31599151	31599151	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:31599151A>T	ENST00000376033.2	+	16	2935	c.2701A>T	c.(2701-2703)Aag>Tag	p.K901*	PRRC2A_ENST00000376007.4_Nonsense_Mutation_p.K901*	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	901	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						AGCAGGCCGAAAGCCTGCCCG	0.662																																																0			6											27.0	22.0	24.0					6																	31599151		1508	2708	4216	31707130	SO:0001587	stop_gained	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.2701A>T	6.37:g.31599151A>T	ENSP00000365201:p.Lys901*	Somatic		Capture	Illumina GAIIx	4	31707130	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Nonsense_Mutation	SNP	HMMPfam_BAT2_N	p.K901*	ENST00000376033.2	37	c.2701	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	A	42	9.189508	0.99094	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	.	.	.	4.93	4.93	0.64822	.	0.000000	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.8942	13.6907	0.62544	1.0:0.0:0.0:0.0	.	.	.	.	X	901;890;901;901;126	.	ENSP00000365175:K901X	K	+	1	0	PRRC2A	31707130	0.640000	0.27243	0.998000	0.56505	0.813000	0.45954	3.732000	0.55021	2.074000	0.62210	0.459000	0.35465	AAG	-	NULL		0.662	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BAT2	protein_coding	OTTHUMT00000259319.1	A	NM_080686		31707130	+1	no_errors	NM_080686	genbank	human	reviewed	54_36p	nonsense	SNP	0.211	T
TNXB	7148	genome.wustl.edu	37	6	32012919	32012919	+	Silent	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:32012919G>A	ENST00000375244.3	-	32	10992	c.10791C>T	c.(10789-10791)ccC>ccT	p.P3597P	TNXB_ENST00000451343.1_Silent_p.P26P|TNXB_ENST00000375247.2_Silent_p.P3595P			P22105	TENX_HUMAN	tenascin XB	3642					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GCAAGGCCTGGGGCTGCCCGT	0.627																																																0			6											58.0	50.0	53.0					6																	32012919		1507	2706	4213	32120897	SO:0001819	synonymous_variant	7148			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.10791C>T	6.37:g.32012919G>A		Somatic		Capture	Illumina GAIIx	4	32120897	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00181,HMMPfam_EGF_2,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,HMMSmart_SM00186,HMMPfam_Fibrinogen_C,superfamily_Fibrinogen C-terminal domain-like,PatternScan_FIBRIN_AG_C_DOMAIN	p.P3642	ENST00000375244.3	37	c.10926		6																																																																																			-	superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3		0.627	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	protein_coding	OTTHUMT00000268927.2	G	NM_019105		32120897	-1	no_errors	NM_019105	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
RASD2	23551	genome.wustl.edu	37	22	35947653	35947653	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr22:35947653C>G	ENST00000216127.4	+	3	1017	c.375C>G	c.(373-375)aaC>aaG	p.N125K		NM_014310.3	NP_055125.2	Q96D21	RHES_HUMAN	RASD family, member 2	125					locomotory behavior (GO:0007626)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein sumoylation (GO:0033235)|regulation of cAMP-mediated signaling (GO:0043949)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission, dopaminergic (GO:0001963)	plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	13						GCCTGAAGAACAAGACCAAGG	0.602																																																0			22											85.0	78.0	80.0					22																	35947653		2203	4300	6503	34277599	SO:0001583	missense	23551			AF279143	CCDS13916.1	22q13.1	2014-05-09			ENSG00000100302	ENSG00000100302			18229	protein-coding gene	gene with protein product	"""tumor endothelial marker 2"", ""Ras homolog enriched in striatum"""	612842				10947988, 10467249, 14724584	Standard	NM_014310		Approved	TEM2, Rhes, MGC:4834	uc003anx.3	Q96D21	OTTHUMG00000150607	ENST00000216127.4:c.375C>G	22.37:g.35947653C>G	ENSP00000216127:p.Asn125Lys	Somatic		Capture	Illumina GAIIx	4	34277599	O95520|Q5THY8	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_RAS,HMMPfam_Ras	p.N125K	ENST00000216127.4	37	c.375	CCDS13916.1	22	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839049	0.71373	.	.	ENSG00000100302	ENST00000216127	T	0.72725	-0.68	5.62	1.17	0.20885	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.69151	0.3079	L	0.29908	0.895	0.47065	D	0.999308	D	0.63046	0.992	P	0.61003	0.882	T	0.65529	-0.6146	10	0.46703	T	0.11	.	9.9608	0.41695	0.0:0.7326:0.0:0.2674	.	125	Q96D21	RHES_HUMAN	K	125	ENSP00000216127:N125K	ENSP00000216127:N125K	N	+	3	2	RASD2	34277599	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	1.925000	0.40074	0.051000	0.15978	-0.258000	0.10820	AAC	-	superfamily_SSF52540,HMMSmart_RAS,HMMPfam_Ras		0.602	RASD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASD2	protein_coding	OTTHUMT00000319063.1	C	NM_014310		34277599	+1	no_errors	NM_014310	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SLC5A3	6526	genome.wustl.edu	37	21	35445875	35445875	+	5'UTR	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr21:35445875C>G	ENST00000381151.3	+	0	6				MRPS6_ENST00000399312.2_5'UTR|AP000320.7_ENST00000362077.4_RNA|SLC5A3_ENST00000608209.1_5'UTR			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3						inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						GCTCTCGGACCGTGCTTTCGC	0.776																																																0			21																																								34367745	SO:0001623	5_prime_UTR_variant	64968				CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.-507C>G	21.37:g.35445875C>G		Somatic		Capture	Illumina GAIIx	4	34367745	O43489	Missense_Mutation	SNP	superfamily_Ribosomal protein S6	p.R20G	ENST00000381151.3	37	c.58	CCDS33549.1	21																																																																																			-	NULL		0.776	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	MRPS6	protein_coding	OTTHUMT00000141037.1	C			34367745	+1	no_start_codon	ENST00000399312	ensembl	human	known	54_36p	missense	SNP	0.001	G
TLN1	7094	genome.wustl.edu	37	9	35733472	35733472	+	5'Flank	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr9:35733472C>G	ENST00000314888.9	-	0	0				CREB3_ENST00000353704.2_Missense_Mutation_p.P142R|CREB3_ENST00000486056.1_3'UTR|TLN1_ENST00000540444.1_5'Flank	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GAGACACTTCCTCTCACTAAG	0.403																																																0			9											79.0	72.0	74.0					9																	35733472		2203	4300	6503	35723472	SO:0001631	upstream_gene_variant	10488			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874		9.37:g.35733472C>G	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	35723472	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	superfamily_Euk_transcr_DNA,HMMPfam_bZIP_1,HMMSmart_BRLZ,PatternScan_BZIP_BASIC	p.P142R	ENST00000314888.9	37	c.425	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	C	28.2	4.899249	0.91962	.	.	ENSG00000107175	ENST00000353704	D	0.85171	-1.95	4.88	4.88	0.63580	Eukaryotic transcription factor, Skn-1-like, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.91998	0.7465	M	0.76328	2.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.92979	0.6404	10	0.87932	D	0	.	16.9791	0.86322	0.0:1.0:0.0:0.0	.	166;142	O43889;O43889-2	CREB3_HUMAN;.	R	142	ENSP00000342136:P142R	ENSP00000342136:P142R	P	+	2	0	CREB3	35723472	1.000000	0.71417	0.999000	0.59377	0.814000	0.46013	6.294000	0.72738	2.433000	0.82419	0.650000	0.86243	CCT	-	superfamily_Euk_transcr_DNA		0.403	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREB3	protein_coding	OTTHUMT00000052353.2	C	NM_006289		35723472	+1	no_errors	NM_006368	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
ARPP21	10777	genome.wustl.edu	37	3	35778833	35778833	+	Missense_Mutation	SNP	G	G	T	rs149775645		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr3:35778833G>T	ENST00000187397.4	+	16	2079	c.1623G>T	c.(1621-1623)atG>atT	p.M541I	ARPP21_ENST00000417925.1_Missense_Mutation_p.M507I|ARPP21_ENST00000337271.5_Missense_Mutation_p.M487I|ARPP21_ENST00000458225.1_Missense_Mutation_p.M507I|ARPP21_ENST00000444190.1_Missense_Mutation_p.M487I	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	541	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						AGCCACAGATGGCAGGCCCTC	0.632																																																0			3											25.0	27.0	26.0					3																	35778833		2201	4286	6487	35753837	SO:0001583	missense	10777			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1623G>T	3.37:g.35778833G>T	ENSP00000187397:p.Met541Ile	Somatic		Capture	Illumina GAIIx	4	35753837	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	HMMSmart_SM00393,superfamily_R3H domain,HMMPfam_R3H	p.M541I	ENST00000187397.4	37	c.1623	CCDS2661.1	3	.	.	.	.	.	.	.	.	.	.	G	12.03	1.816895	0.32145	.	.	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	T;T;T;T;T	0.41400	1.01;1.01;1.01;1.0;1.01	5.91	5.91	0.95273	.	0.543163	0.20214	N	0.096821	T	0.40067	0.1102	L	0.57536	1.79	0.28699	N	0.904199	B;B;B;B	0.23650	0.089;0.002;0.024;0.089	B;B;B;B	0.23275	0.045;0.003;0.008;0.045	T	0.24584	-1.0156	10	0.22706	T	0.39	-3.4265	13.6934	0.62562	0.0:0.0:0.7306:0.2694	.	507;29;541;487	Q9UBL0-3;Q9UBL0-5;Q9UBL0;Q9UBL0-4	.;.;ARP21_HUMAN;.	I	507;487;487;541;507	ENSP00000414351:M507I;ENSP00000337792:M487I;ENSP00000405276:M487I;ENSP00000187397:M541I;ENSP00000412326:M507I	ENSP00000187397:M541I	M	+	3	0	ARPP21	35753837	1.000000	0.71417	0.519000	0.27824	0.936000	0.57629	2.209000	0.42806	2.808000	0.96608	0.655000	0.94253	ATG	-	NULL		0.632	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP-21	protein_coding	OTTHUMT00000253334.2	G	NM_198399		35753837	+1	no_errors	NM_016300	genbank	human	validated	54_36p	missense	SNP	0.543	T
PLCG1	5335	genome.wustl.edu	37	20	39794389	39794389	+	Missense_Mutation	SNP	C	C	G	rs146548575		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr20:39794389C>G	ENST00000373271.1	+	16	2127	c.1722C>G	c.(1720-1722)atC>atG	p.I574M	PLCG1_ENST00000373272.2_Missense_Mutation_p.I574M|PLCG1_ENST00000244007.3_Missense_Mutation_p.I574M	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	574	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				AGTACTGCATCGAGACCGGAG	0.597																																																0			20						C	MET/ILE,MET/ILE	1,4405	2.1+/-5.4	0,1,2202	66.0	65.0	65.0		1722,1722	-6.8	0.7	20	dbSNP_134	65	0,8600		0,0,4300	no	missense,missense	PLCG1	NM_002660.2,NM_182811.1	10,10	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	benign,benign	574/1292,574/1291	39794389	1,13005	2203	4300	6503	39227803	SO:0001583	missense	5335			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.1722C>G	20.37:g.39794389C>G	ENSP00000362368:p.Ile574Met	Somatic		Capture	Illumina GAIIx	4	39227803	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,PatternScan_EF_HAND_1,superfamily_SSF47473,HMMSmart_PLCXc,HMMPfam_PI-PLC-X,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_SSF55550,HMMSmart_SH2,HMMPfam_SH2,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,HMMPfam_PI-PLC-Y,HMMSmart_PLCYc,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.I574M	ENST00000373271.1	37	c.1722	CCDS13314.1	20	.	.	.	.	.	.	.	.	.	.	C	9.583	1.124018	0.20959	2.27E-4	0.0	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.67171	-0.25;-0.25;-0.25	4.95	-6.85	0.01681	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);Pleckstrin homology domain (1);SH2 motif (4);	0.217188	0.47852	D	0.000207	T	0.35595	0.0937	N	0.04508	-0.205	0.35902	D	0.830468	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.17722	0.011;0.019;0.019	T	0.02909	-1.1095	10	0.38643	T	0.18	.	10.6809	0.45813	0.1948:0.5751:0.0:0.2301	.	574;574;574	P19174-2;P19174;A2A284	.;PLCG1_HUMAN;.	M	574	ENSP00000244007:I574M;ENSP00000362368:I574M;ENSP00000362369:I574M	ENSP00000244007:I574M	I	+	3	3	PLCG1	39227803	0.003000	0.15002	0.696000	0.30242	0.914000	0.54420	-1.900000	0.01599	-1.779000	0.01280	-0.258000	0.10820	ATC	-	superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_SSF50729,HMMSmart_PH,superfamily_SSF55550,HMMSmart_SH2,HMMPfam_SH2		0.597	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	protein_coding	OTTHUMT00000080514.3	C	NM_182811		39227803	+1	no_errors	NM_002660	genbank	human	reviewed	54_36p	missense	SNP	0.826	G
DAB2	1601	genome.wustl.edu	37	5	39383071	39383071	+	Silent	SNP	C	C	T	rs199558080		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr5:39383071C>T	ENST00000320816.6	-	10	1457	c.990G>A	c.(988-990)ccG>ccA	p.P330P	DAB2_ENST00000545653.1_Silent_p.P309P|DAB2_ENST00000512525.1_5'Flank|DAB2_ENST00000339788.6_Intron|DAB2_ENST00000509337.1_Silent_p.P309P	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	330	Required for localization to clathrin- coated pits. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			CATTACTCAGCGGAGTAGACG	0.483													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19568	0.0		0.0	False		,,,				2504	0.0															0			5						C		1,4405	2.1+/-5.4	0,1,2202	94.0	98.0	96.0		990	-4.7	1.0	5		96	0,8600		0,0,4300	no	coding-synonymous	DAB2	NM_001343.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		330/771	39383071	1,13005	2203	4300	6503	39418828	SO:0001819	synonymous_variant	1601			U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.990G>A	5.37:g.39383071C>T		Somatic		Capture	Illumina GAIIx	4	39418828	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	superfamily_PH domain-like,HMMSmart_SM00462,HMMPfam_PID,PatternScan_PFKB_KINASES_1	p.P330	ENST00000320816.6	37	c.990	CCDS34149.1	5																																																																																			-	NULL		0.483	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAB2	protein_coding	OTTHUMT00000367014.1	C	NM_001343		39418828	-1	no_errors	NM_001343	genbank	human	validated	54_36p	silent	SNP	0.005	T
HDAC5	10014	genome.wustl.edu	37	17	42188140	42188140	+	Silent	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr17:42188140C>T	ENST00000393622.2	-	3	382	c.51G>A	c.(49-51)ttG>ttA	p.L17L	HDAC5_ENST00000586802.1_Silent_p.L17L|HDAC5_ENST00000336057.5_Silent_p.L17L|HDAC5_ENST00000225983.6_Silent_p.L18L	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	17					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		GCAGGATTTCCAAGGATGGTT	0.572																																																0			17											141.0	107.0	119.0					17																	42188140		2203	4300	6503	39543666	SO:0001819	synonymous_variant	10014			AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.51G>A	17.37:g.42188140C>T		Somatic		Capture	Illumina GAIIx	4	39543666	C9JFV9|O60340|O60528|Q96DY4	Silent	SNP	superfamily_Arginase/deacetylase,HMMPfam_Hist_deacetyl	p.L18	ENST00000393622.2	37	c.54	CCDS45696.1	17																																																																																			-	NULL		0.572	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC5	protein_coding	OTTHUMT00000457686.1	C	NM_001015053		39543666	-1	no_errors	NM_001015053	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
TCF20	6942	genome.wustl.edu	37	22	42610753	42610753	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr22:42610753G>A	ENST00000359486.3	-	1	695	c.559C>T	c.(559-561)Ctt>Ttt	p.L187F	TCF20_ENST00000335626.4_Missense_Mutation_p.L187F	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	187					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GACTGGTAAAGCTGTTGTCTC	0.587																																																0			22											70.0	53.0	59.0					22																	42610753		2203	4300	6503	40940697	SO:0001583	missense	6942			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.559C>T	22.37:g.42610753G>A	ENSP00000352463:p.Leu187Phe	Somatic		Capture	Illumina GAIIx	4	40940697	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	HMMSmart_SM00249	p.L187F	ENST00000359486.3	37	c.559	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	G	19.50	3.838681	0.71373	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.36699	1.24;1.24	5.17	5.17	0.71159	.	0.095451	0.45361	D	0.000366	T	0.38348	0.1037	N	0.19112	0.55	0.80722	D	1	D;D	0.63046	0.992;0.986	P;P	0.57101	0.813;0.655	T	0.07966	-1.0745	10	0.35671	T	0.21	-13.8356	14.7001	0.69150	0.0:0.0:0.846:0.154	.	187;187	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	F	187	ENSP00000352463:L187F;ENSP00000335561:L187F	ENSP00000335561:L187F	L	-	1	0	TCF20	40940697	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.885000	0.75606	2.685000	0.91497	0.655000	0.94253	CTT	-	NULL		0.587	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	protein_coding	OTTHUMT00000320531.1	G	NM_181492		40940697	-1	no_errors	NM_005650	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
C6	729	genome.wustl.edu	37	5	41153978	41153978	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr5:41153978A>T	ENST00000263413.3	-	15	2488	c.2224T>A	c.(2224-2226)Tca>Aca	p.S742T	C6_ENST00000337836.5_Missense_Mutation_p.S742T	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	742	C5b-binding domain.|CCP 2.|Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GTGTACCTTGATGGCCCAGCA	0.463																																																0			5											122.0	105.0	111.0					5																	41153978		2203	4300	6503	41189735	SO:0001583	missense	729			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.2224T>A	5.37:g.41153978A>T	ENSP00000263413:p.Ser742Thr	Somatic		Capture	Illumina GAIIx	4	41189735		Missense_Mutation	SNP	PatternScan_EGF_2,superfamily_TSP1,HMMSmart_TSP1,HMMPfam_TSP_1,superfamily_LDL_rcpt_classA_cys-rich,HMMPfam_Ldl_recept_a,HMMSmart_LDLa,PatternScan_LDLRA_1,HMMPfam_MACPF,HMMSmart_MACPF,PatternScan_MAC_PERFORIN,PatternScan_EGF_1,superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP,HMMSmart_FIMAC,HMMSmart_KAZAL,HMMPfam_Kazal_2	p.S742T	ENST00000263413.3	37	c.2224	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	A	7.782	0.709677	0.15239	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.66280	-0.2;-0.2	5.61	3.08	0.35506	Complement control module (2);Sushi/SCR/CCP (3);	0.709838	0.14255	N	0.331192	T	0.50871	0.1641	M	0.64170	1.965	0.34294	D	0.683637	B	0.19445	0.036	B	0.26310	0.068	T	0.53070	-0.8490	10	0.17369	T	0.5	-11.6326	1.1749	0.01833	0.4833:0.1371:0.0982:0.2814	.	742	P13671	CO6_HUMAN	T	742	ENSP00000338861:S742T;ENSP00000263413:S742T	ENSP00000263413:S742T	S	-	1	0	C6	41189735	0.753000	0.28349	0.993000	0.49108	0.422000	0.31414	0.465000	0.22004	2.138000	0.66242	0.454000	0.30748	TCA	-	superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP		0.463	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	protein_coding	OTTHUMT00000211592.1	A			41189735	-1	no_errors	NM_000065	genbank	human	reviewed	54_36p	missense	SNP	0.179	T
ZFP14	57677	genome.wustl.edu	37	19	36831637	36831637	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr19:36831637C>G	ENST00000270001.7	-	5	1206	c.1091G>C	c.(1090-1092)gGt>gCt	p.G364A		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	364					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					GGGTTTCTCACCAGTATGAAT	0.378																																																0			19											94.0	91.0	92.0					19																	36831637		2203	4300	6503	41523477	SO:0001583	missense	57677			AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.1091G>C	19.37:g.36831637C>G	ENSP00000270001:p.Gly364Ala	Somatic		Capture	Illumina GAIIx	4	41523477	A7MD23	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.G364A	ENST00000270001.7	37	c.1091	CCDS33002.1	19	.	.	.	.	.	.	.	.	.	.	c	18.28	3.590098	0.66105	.	.	ENSG00000142065	ENST00000270001;ENST00000392172	T	0.26373	1.74	3.91	3.91	0.45181	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.150576	0.31404	N	0.007714	T	0.47192	0.1432	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.989	T	0.48658	-0.9016	10	0.87932	D	0	.	9.0869	0.36587	0.0:0.8935:0.0:0.1065	.	364;364	A8KAN8;Q9HCL3	.;ZFP14_HUMAN	A	364	ENSP00000270001:G364A	ENSP00000270001:G364A	G	-	2	0	ZFP14	41523477	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	4.536000	0.60636	2.160000	0.67779	0.643000	0.83706	GGT	-	superfamily_SSF57667		0.378	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP14	protein_coding	OTTHUMT00000452528.1	C	NM_020917		41523477	-1	no_errors	NM_020917	genbank	human	provisional	54_36p	missense	SNP	0.980	G
ATP6V1E1P1	343515	genome.wustl.edu	37	1	43369562	43369562	+	IGR	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr1:43369562C>G								ZNF691 (51414 upstream) : SLC2A1 (21489 downstream)																							GTGCAAAAGCCAACAGGAAAT	0.443																																																0			1																																								43142149	SO:0001628	intergenic_variant	343515																															1.37:g.43369562C>G		Somatic		Capture	Illumina GAIIx	4	43142149		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.443					LOC343515			C			43142149	+1	pseudogene	XR_017310	genbank	human	model	54_36p	rna	SNP	0.968	G
TP53TG5	27296	genome.wustl.edu	37	20	44006229	44006229	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr20:44006229C>G	ENST00000372726.3	-	2	229	c.73G>C	c.(73-75)Gag>Cag	p.E25Q	SYS1-DBNDD2_ENST00000475242.1_Intron|SYS1-DBNDD2_ENST00000452133.1_Intron|TP53TG5_ENST00000537995.1_Missense_Mutation_p.E9Q|TP53TG5_ENST00000494455.1_5'UTR	NM_014477.2	NP_055292.1	Q9Y2B4	T53G5_HUMAN	TP53 target 5	25					intracellular signal transduction (GO:0035556)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	12						TGCTCTGTCTCGTCCCGCAGT	0.527																																																0			20											80.0	67.0	71.0					20																	44006229		2203	4300	6503	43439643	SO:0001583	missense	27296			AB017802	CCDS13352.1	20q13.12	2008-09-18	2008-09-18	2008-09-18	ENSG00000124251	ENSG00000124251			15856	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 10"""	C20orf10			Standard	NM_014477		Approved	CLG01, dJ453C12.5	uc002xny.3	Q9Y2B4	OTTHUMG00000032582	ENST00000372726.3:c.73G>C	20.37:g.44006229C>G	ENSP00000361811:p.Glu25Gln	Somatic		Capture	Illumina GAIIx	4	43439643		Missense_Mutation	SNP	NULL	p.E25Q	ENST00000372726.3	37	c.73	CCDS13352.1	20	.	.	.	.	.	.	.	.	.	.	C	6.925	0.540286	0.13250	.	.	ENSG00000124251	ENST00000372726;ENST00000537995	T;T	0.10005	2.92;2.92	4.18	3.08	0.35506	.	0.286994	0.29752	N	0.011292	T	0.05273	0.0140	N	0.08118	0	0.18873	N	0.999983	B	0.17038	0.02	B	0.17098	0.017	T	0.30937	-0.9961	10	0.56958	D	0.05	-10.4382	6.4046	0.21658	0.0:0.1098:0.0:0.8902	.	25	Q9Y2B4	T53G5_HUMAN	Q	25;9	ENSP00000361811:E25Q;ENSP00000438374:E9Q	ENSP00000361811:E25Q	E	-	1	0	TP53TG5	43439643	0.579000	0.26725	0.985000	0.45067	0.033000	0.12548	1.019000	0.30014	0.967000	0.38186	-0.238000	0.12139	GAG	-	NULL		0.527	TP53TG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53TG5	protein_coding	OTTHUMT00000079460.1	C	NM_014477		43439643	-1	no_errors	NM_014477	genbank	human	validated	54_36p	missense	SNP	0.016	G
NNT	23530	genome.wustl.edu	37	5	43659363	43659363	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr5:43659363G>T	ENST00000264663.5	+	17	2766	c.2545G>T	c.(2545-2547)Gag>Tag	p.E849*	NNT_ENST00000512996.2_Nonsense_Mutation_p.E718*|NNT_ENST00000344920.4_Nonsense_Mutation_p.E849*	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	849					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					CCTGTGTGCAGAGGGCTTCCT	0.522																																																0			5											166.0	147.0	154.0					5																	43659363		2203	4300	6503	43695120	SO:0001587	stop_gained	23530			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.2545G>T	5.37:g.43659363G>T	ENSP00000264663:p.Glu849*	Somatic		Capture	Illumina GAIIx	4	43695120	Q16796|Q2TB60|Q8N3V4	Nonsense_Mutation	SNP	superfamily_SSF52283,PatternScan_ALADH_PNT_1,HMMPfam_AlaDh_PNT_N,superfamily_NAD(P)-bd,HMMPfam_AlaDh_PNT_C,PatternScan_ALADH_PNT_2,HMMPfam_PNTB,superfamily_SSF52467	p.E849*	ENST00000264663.5	37	c.2545	CCDS3949.1	5	.	.	.	.	.	.	.	.	.	.	G	43	10.376018	0.99393	.	.	ENSG00000112992	ENST00000542759;ENST00000264663;ENST00000344920;ENST00000512996	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-19.9532	20.0099	0.97447	0.0:0.0:1.0:0.0	.	.	.	.	X	364;849;849;718	.	ENSP00000264663:E849X	E	+	1	0	NNT	43695120	1.000000	0.71417	0.965000	0.40720	0.984000	0.73092	9.476000	0.97823	2.725000	0.93324	0.655000	0.94253	GAG	-	HMMPfam_PNTB		0.522	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNT	protein_coding	OTTHUMT00000214026.1	G	NM_182977		43695120	+1	no_errors	NM_012343	genbank	human	reviewed	54_36p	nonsense	SNP	0.999	T
ZSWIM3	140831	genome.wustl.edu	37	20	44486545	44486545	+	Silent	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr20:44486545C>T	ENST00000255152.2	+	1	290	c.81C>T	c.(79-81)tcC>tcT	p.S27S	ACOT8_ENST00000217455.4_5'Flank|ZSWIM3_ENST00000454862.2_5'UTR	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	27							zinc ion binding (GO:0008270)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				ACAGGTGCTCCTTCATTCTCA	0.617																																																0			20											140.0	124.0	130.0					20																	44486545		2203	4300	6503	43919952	SO:0001819	synonymous_variant	140831			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.81C>T	20.37:g.44486545C>T		Somatic		Capture	Illumina GAIIx	4	43919952	Q9BR13	Silent	SNP	HMMPfam_MULE,HMMPfam_SWIM,HMMSmart_ZnF_PMZ	p.S27	ENST00000255152.2	37	c.81	CCDS13381.1	20																																																																																			-	NULL		0.617	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM3	protein_coding	OTTHUMT00000079540.1	C	NM_080752		43919952	+1	no_errors	NM_080752	genbank	human	validated	54_36p	silent	SNP	1.000	T
NFKBIB	4793	genome.wustl.edu	37	19	39399380	39399380	+	Missense_Mutation	SNP	G	G	T	rs141886159		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr19:39399380G>T	ENST00000313582.5	+	6	1013	c.979G>T	c.(979-981)Gac>Tac	p.D327Y	NFKBIB_ENST00000392079.3_3'UTR	NM_002503.4	NP_002494.2	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta	327					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|signal transduction (GO:0007165)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	8	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGATGAATACGACGACATTGT	0.597																																					Pancreas(165;1492 2005 6979 7739 34483)											0			19											79.0	83.0	82.0					19																	39399380		2203	4300	6503	44091220	SO:0001583	missense	4793			L40407	CCDS12524.1, CCDS74362.1	19q13.1	2013-01-10				ENSG00000104825		"""Ankyrin repeat domain containing"""	7798	protein-coding gene	gene with protein product		604495				9763672	Standard	NM_002503		Approved	IKBB, TRIP9	uc002ojw.3	Q15653		ENST00000313582.5:c.979G>T	19.37:g.39399380G>T	ENSP00000312988:p.Asp327Tyr	Somatic		Capture	Illumina GAIIx	4	44091220	A8K3F4|Q96BJ7	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.D327Y	ENST00000313582.5	37	c.979	CCDS12524.1	19	.	.	.	.	.	.	.	.	.	.	G	19.79	3.892981	0.72524	.	.	ENSG00000104825	ENST00000313582	T	0.58797	0.31	5.08	5.08	0.68730	.	0.000000	0.50627	D	0.000110	T	0.63331	0.2502	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66763	-0.5841	10	0.72032	D	0.01	-7.1572	13.836	0.63410	0.0:0.0:1.0:0.0	.	327	Q15653	IKBB_HUMAN	Y	327	ENSP00000312988:D327Y	ENSP00000312988:D327Y	D	+	1	0	NFKBIB	44091220	0.998000	0.40836	0.811000	0.32455	0.981000	0.71138	4.873000	0.63057	2.630000	0.89119	0.655000	0.94253	GAC	-	NULL		0.597	NFKBIB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NFKBIB	protein_coding	OTTHUMT00000438155.1	G	NM_002503		44091220	+1	no_errors	NM_002503	genbank	human	validated	54_36p	missense	SNP	0.996	T
TRPM2	7226	genome.wustl.edu	37	21	45789181	45789181	+	Silent	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr21:45789181C>T	ENST00000397928.1	+	5	1171	c.726C>T	c.(724-726)gcC>gcT	p.A242A	TRPM2_ENST00000397932.2_Silent_p.A242A|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300481.9_Silent_p.A242A|TRPM2_ENST00000300482.5_Silent_p.A242A	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	242					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						TCGGAGTCGCCACCTGGGGCA	0.667																																																0			21											51.0	44.0	46.0					21																	45789181		2203	4300	6503	44613609	SO:0001819	synonymous_variant	7226			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.726C>T	21.37:g.45789181C>T		Somatic		Capture	Illumina GAIIx	4	44613609	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	HMMPfam_Ion_trans,PatternScan_CHITINASE_18,superfamily_Nudix	p.A242	ENST00000397928.1	37	c.726	CCDS13710.1	21																																																																																			-	NULL		0.667	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	protein_coding	OTTHUMT00000098086.1	C	NM_003307		44613609	+1	no_errors	NM_003307	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
TRPM2	7226	genome.wustl.edu	37	21	45797639	45797639	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr21:45797639G>A	ENST00000397928.1	+	7	1442	c.997G>A	c.(997-999)Ggc>Agc	p.G333S	TRPM2_ENST00000397932.2_Missense_Mutation_p.G333S|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300481.9_Missense_Mutation_p.G333S|TRPM2_ENST00000300482.5_Missense_Mutation_p.G333S	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	333					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GCTGGAGGGCGGCCCGGGCAC	0.607																																																0			21											87.0	63.0	71.0					21																	45797639		2203	4300	6503	44622067	SO:0001583	missense	7226			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.997G>A	21.37:g.45797639G>A	ENSP00000381023:p.Gly333Ser	Somatic		Capture	Illumina GAIIx	4	44622067	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	PatternScan_CHITINASE_18,HMMPfam_Ion_trans,superfamily_Nudix	p.G333S	ENST00000397928.1	37	c.997	CCDS13710.1	21	.	.	.	.	.	.	.	.	.	.	G	27.3	4.819071	0.90873	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	3.96	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80223	-0.1471	10	0.72032	D	0.01	-24.7925	16.0255	0.80541	0.0:0.0:1.0:0.0	.	333;333	E9PGK7;O94759	.;TRPM2_HUMAN	S	333	ENSP00000300482:G333S;ENSP00000381023:G333S;ENSP00000300481:G333S;ENSP00000381026:G333S	ENSP00000300481:G333S	G	+	1	0	TRPM2	44622067	1.000000	0.71417	0.967000	0.41034	0.895000	0.52256	8.180000	0.89694	1.745000	0.51790	0.563000	0.77884	GGC	-	NULL		0.607	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	protein_coding	OTTHUMT00000098086.1	G	NM_003307		44622067	+1	no_errors	NM_003307	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
COL1A1	1277	genome.wustl.edu	37	17	48264224	48264224	+	Missense_Mutation	SNP	G	G	C	rs72656336		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr17:48264224G>C	ENST00000225964.5	-	48	3709	c.3591C>G	c.(3589-3591)gaC>gaG	p.D1197E		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	1197	Nonhelical region (C-terminal).				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	GGAAGCTGAAGTCGAAACCAG	0.632			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																																Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0			17											67.0	60.0	62.0					17																	48264224		2203	4300	6503	45619223	SO:0001583	missense	1277			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.3591C>G	17.37:g.48264224G>C	ENSP00000225964:p.Asp1197Glu	Somatic		Capture	Illumina GAIIx	4	45619223	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	HMMPfam_VWC,HMMSmart_SM00214,PatternScan_VWFC_1,HMMPfam_Collagen,HMMSmart_SM00038,HMMPfam_COLFI	p.D1197E	ENST00000225964.5	37	c.3591	CCDS11561.1	17	.	.	.	.	.	.	.	.	.	.	G	8.214	0.801073	0.16397	.	.	ENSG00000108821	ENST00000225964	D	0.88975	-2.45	3.88	2.91	0.33838	.	0.061943	0.64402	D	0.000008	D	0.85261	0.5656	M	0.76838	2.35	0.47862	D	0.999531	B	0.32245	0.361	B	0.32762	0.152	T	0.78028	-0.2364	10	0.02654	T	1	.	10.6046	0.45386	0.0992:0.0:0.9008:0.0	.	1197	P02452	CO1A1_HUMAN	E	1197	ENSP00000225964:D1197E	ENSP00000225964:D1197E	D	-	3	2	COL1A1	45619223	1.000000	0.71417	0.994000	0.49952	0.077000	0.17291	1.527000	0.35975	0.828000	0.34709	-0.657000	0.03884	GAC	-	NULL		0.632	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	protein_coding	OTTHUMT00000309036.2	G			45619223	-1	no_errors	NM_000088	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TDRD6	221400	genome.wustl.edu	37	6	46657503	46657503	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:46657503G>T	ENST00000316081.6	+	1	1638	c.1638G>T	c.(1636-1638)aaG>aaT	p.K546N	RP11-446F17.3_ENST00000422284.2_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.K546N|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	546	Tudor 3. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GCTGTGTCAAGTGGAAAGAAA	0.423																																																0			6											146.0	147.0	147.0					6																	46657503		2203	4300	6503	46765462	SO:0001583	missense	221400			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.1638G>T	6.37:g.46657503G>T	ENSP00000346065:p.Lys546Asn	Somatic		Capture	Illumina GAIIx	4	46765462	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	HMMSmart_TUDOR,HMMPfam_TUDOR,superfamily_SSF63748	p.K546N	ENST00000316081.6	37	c.1638	CCDS34470.1	6	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455516	0.43634	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.09911	2.93;2.93	6.02	-5.13	0.02884	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.186341	0.56097	D	0.000033	T	0.15869	0.0382	M	0.83774	2.66	0.24621	N	0.993677	D;D	0.76494	0.999;0.999	D;D	0.74674	0.973;0.984	T	0.08700	-1.0709	10	0.33940	T	0.23	-8.6161	14.7459	0.69490	0.2344:0.0:0.6653:0.1003	.	546;546	F5H5M3;O60522	.;TDRD6_HUMAN	N	546	ENSP00000443299:K546N;ENSP00000346065:K546N	ENSP00000346065:K546N	K	+	3	2	TDRD6	46765462	0.913000	0.31002	0.880000	0.34516	0.966000	0.64601	0.110000	0.15437	-0.827000	0.04278	-0.768000	0.03414	AAG	-	HMMPfam_TUDOR,superfamily_SSF63748,HMMSmart_TUDOR		0.423	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD6	protein_coding	OTTHUMT00000040800.1	G	XM_166443		46765462	+1	no_errors	NM_001010870	genbank	human	provisional	54_36p	missense	SNP	0.868	T
SOCS5	9655	genome.wustl.edu	37	2	46986359	46986359	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr2:46986359G>A	ENST00000306503.5	+	2	862	c.690G>A	c.(688-690)tgG>tgA	p.W230*	SOCS5_ENST00000394861.2_Nonsense_Mutation_p.W230*	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	230					cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CCCAAAAATGGCATTTGATTA	0.378																																																0			2											42.0	44.0	43.0					2																	46986359		2201	4292	6493	46839863	SO:0001587	stop_gained	9655			AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.690G>A	2.37:g.46986359G>A	ENSP00000305133:p.Trp230*	Somatic		Capture	Illumina GAIIx	4	46839863	Q53SD4|Q8IYZ4	Nonsense_Mutation	SNP	superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2,HMMSmart_SM00253,HMMPfam_SOCS_box	p.W230*	ENST00000306503.5	37	c.690	CCDS1830.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.974420	0.97162	.	.	ENSG00000171150	ENST00000306503;ENST00000394861	.	.	.	5.65	4.77	0.60923	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.4853	14.5778	0.68262	0.0703:0.0:0.9297:0.0	.	.	.	.	X	230	.	ENSP00000305133:W230X	W	+	3	0	SOCS5	46839863	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.615000	0.98356	1.626000	0.50381	0.655000	0.94253	TGG	-	NULL		0.378	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS5	protein_coding	OTTHUMT00000250791.2	G			46839863	+1	no_errors	NM_014011	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
PRMT2	3275	genome.wustl.edu	37	21	48080756	48080756	+	Missense_Mutation	SNP	T	T	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr21:48080756T>G	ENST00000397637.1	+	8	1796	c.842T>G	c.(841-843)gTt>gGt	p.V281G	PRMT2_ENST00000440086.1_Intron|PRMT2_ENST00000451211.2_Intron|PRMT2_ENST00000291705.6_Intron|PRMT2_ENST00000355680.3_Missense_Mutation_p.V281G|PRMT2_ENST00000397638.2_Missense_Mutation_p.V281G|PRMT2_ENST00000458387.2_Intron			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	281	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		TCTTTAGCAGTTAAGGAGTTT	0.448																																																0			21											129.0	134.0	132.0					21																	48080756		2203	4300	6503	46905184	SO:0001583	missense	3275			U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.842T>G	21.37:g.48080756T>G	ENSP00000380759:p.Val281Gly	Somatic		Capture	Illumina GAIIx	4	46905184	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Missense_Mutation	SNP	superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_MTS	p.V281G	ENST00000397637.1	37	c.842	CCDS13737.1	21	.	.	.	.	.	.	.	.	.	.	.	9.942	1.217863	0.22373	.	.	ENSG00000160310	ENST00000355680;ENST00000397638;ENST00000397637	T;T;T	0.79454	-1.27;-1.27;-1.27	5.29	5.29	0.74685	.	0.345800	0.32640	N	0.005825	T	0.73164	0.3552	M	0.69823	2.125	0.47476	D	0.999436	B;B	0.18461	0.004;0.028	B;B	0.18561	0.009;0.022	T	0.68416	-0.5414	9	.	.	.	-11.5346	8.1236	0.30986	0.0:0.0903:0.0:0.9097	.	167;281	Q49AF9;P55345	.;ANM2_HUMAN	G	281	ENSP00000347906:V281G;ENSP00000380760:V281G;ENSP00000380759:V281G	.	V	+	2	0	PRMT2	46905184	1.000000	0.71417	0.964000	0.40570	0.310000	0.27922	1.883000	0.39658	2.139000	0.66308	0.533000	0.62120	GTT	-	superfamily_S-adenosyl-L-methionine-dependent methyltransferases		0.448	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRMT2	protein_coding	OTTHUMT00000207401.1	T	NM_001535		46905184	+1	no_errors	NM_001535	genbank	human	validated	54_36p	missense	SNP	0.990	G
PTH1R	5745	genome.wustl.edu	37	3	46944896	46944896	+	Missense_Mutation	SNP	G	G	A	rs201315349	byFrequency	TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr3:46944896G>A	ENST00000313049.5	+	14	1735	c.1532G>A	c.(1531-1533)cGt>cAt	p.R511H	PTH1R_ENST00000430002.2_Missense_Mutation_p.R511H|PTH1R_ENST00000449590.1_Missense_Mutation_p.R511H|PTH1R_ENST00000418619.1_Missense_Mutation_p.R511H			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor	511					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	GTCGGCCCCCGTGTGGGACTC	0.667													G|||	2	0.000399361	0.0	0.0029	5008	,	,		15705	0.0		0.0	False		,,,				2504	0.0															0			3											49.0	42.0	44.0					3																	46944896		2203	4300	6503	46919900	SO:0001583	missense	5745				CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.1532G>A	3.37:g.46944896G>A	ENSP00000321999:p.Arg511His	Somatic		Capture	Illumina GAIIx	4	46919900	Q2M1U3	Missense_Mutation	SNP	superfamily_SSF111418,HMMSmart_HormR,HMMPfam_HRM,PatternScan_G_PROTEIN_RECEP_F2_1,superfamily_SSF81321,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.R511H	ENST00000313049.5	37	c.1532	CCDS2747.1	3	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	24.2	4.501462	0.85176	.	.	ENSG00000160801	ENST00000449590;ENST00000418619;ENST00000427125;ENST00000430002;ENST00000313049;ENST00000313063;ENST00000422115	T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68	5.1	5.1	0.69264	.	.	.	.	.	T	0.78868	0.4351	L	0.42245	1.32	0.80722	D	1	D	0.89917	1.0	D	0.66602	0.945	T	0.79040	-0.1966	9	0.54805	T	0.06	.	18.0461	0.89332	0.0:0.0:1.0:0.0	.	511	Q03431	PTH1R_HUMAN	H	511;511;511;511;511;816;100	ENSP00000402723:R511H;ENSP00000411424:R511H;ENSP00000400977:R511H;ENSP00000413774:R511H;ENSP00000321999:R511H;ENSP00000396176:R100H	ENSP00000321999:R511H	R	+	2	0	PTH1R	46919900	0.995000	0.38212	0.949000	0.38748	0.407000	0.30961	5.210000	0.65214	2.814000	0.96858	0.563000	0.77884	CGT	-	NULL		0.667	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH1R	protein_coding	OTTHUMT00000257481.1	G	NM_000316		46919900	+1	no_errors	NM_000316	genbank	human	reviewed	54_36p	missense	SNP	0.940	A
ARHGEF1	9138	genome.wustl.edu	37	19	42396676	42396676	+	Missense_Mutation	SNP	C	C	G	rs369826806		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr19:42396676C>G	ENST00000354532.3	+	7	518	c.370C>G	c.(370-372)Cgc>Ggc	p.R124G	ARHGEF1_ENST00000599846.1_Missense_Mutation_p.R124G|ARHGEF1_ENST00000378152.4_Missense_Mutation_p.R106G|ARHGEF1_ENST00000337665.4_Missense_Mutation_p.R139G|ARHGEF1_ENST00000347545.4_Missense_Mutation_p.R91G	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	124	RGSL.				cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R139C(1)		breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		CCCTGCAGACCGCACTAGGGC	0.657																																																1	Substitution - Missense(1)	endometrium(1)	19											33.0	35.0	34.0					19																	42396676		2203	4300	6503	47088516	SO:0001583	missense	9138			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.370C>G	19.37:g.42396676C>G	ENSP00000346532:p.Arg124Gly	Somatic		Capture	Illumina GAIIx	4	47088516	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	HMMPfam_RGS-like,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,HMMPfam_RhoGEF,HMMSmart_RhoGEF,superfamily_SSF50729,HMMSmart_PH	p.R139G	ENST00000354532.3	37	c.415	CCDS12591.1	19	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754734	0.49362	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000316079;ENST00000337665;ENST00000378152	D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97	4.32	3.19	0.36642	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	0.073913	0.51477	D	0.000095	D	0.89938	0.6860	M	0.66939	2.045	0.58432	D	0.999995	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.997;0.994;0.999;0.998	D	0.90089	0.4176	10	0.66056	D	0.02	-17.3333	10.9439	0.47289	0.188:0.812:0.0:0.0	.	106;139;91;124;184	Q6NX52;Q92888-3;Q92888-2;Q92888;Q8NF33	.;.;.;ARHG1_HUMAN;.	G	124;91;160;139;106	ENSP00000346532:R124G;ENSP00000344429:R91G;ENSP00000337261:R139G;ENSP00000367394:R106G	ENSP00000323044:R160G	R	+	1	0	ARHGEF1	47088516	1.000000	0.71417	1.000000	0.80357	0.408000	0.30992	2.402000	0.44521	2.157000	0.67596	0.306000	0.20318	CGC	-	HMMPfam_RGS-like,superfamily_Regulat_G_prot_signal_superfam		0.657	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	protein_coding	OTTHUMT00000463360.1	C	NM_199002		47088516	+1	no_errors	NM_199002	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TNFRSF21	27242	genome.wustl.edu	37	6	47254313	47254313	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:47254313T>C	ENST00000296861.2	-	2	508	c.115A>G	c.(115-117)Acc>Gcc	p.T39A		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	39					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			TGAGCTGTGGTGGTGCTAAGG	0.507																																																0			6											54.0	58.0	56.0					6																	47254313		2203	4300	6503	47362272	SO:0001583	missense	27242			AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.115A>G	6.37:g.47254313T>C	ENSP00000296861:p.Thr39Ala	Somatic		Capture	Illumina GAIIx	4	47362272	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	superfamily_SSF57586,HMMSmart_TNFR,PatternScan_TNFR_NGFR_1,HMMSmart_DEATH,superfamily_DEATH_like,HMMPfam_Death	p.T39A	ENST00000296861.2	37	c.115	CCDS4921.1	6	.	.	.	.	.	.	.	.	.	.	T	10.31	1.315538	0.23908	.	.	ENSG00000146072	ENST00000296861	T	0.63096	-0.02	5.73	1.94	0.25998	.	0.537042	0.22971	N	0.053422	T	0.21761	0.0524	L	0.35414	1.06	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.23013	-1.0200	10	0.22706	T	0.39	.	5.1539	0.15025	0.1243:0.2197:0.0:0.6561	.	39	O75509	TNR21_HUMAN	A	39	ENSP00000296861:T39A	ENSP00000296861:T39A	T	-	1	0	TNFRSF21	47362272	0.998000	0.40836	0.315000	0.25238	0.973000	0.67179	0.574000	0.23714	0.100000	0.17581	0.456000	0.33151	ACC	-	NULL		0.507	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF21	protein_coding	OTTHUMT00000040814.1	T	NM_014452		47362272	-1	no_errors	NM_014452	genbank	human	reviewed	54_36p	missense	SNP	0.905	C
ELK1	2002	genome.wustl.edu	37	X	47497543	47497543	+	Silent	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:47497543C>T	ENST00000247161.3	-	4	792	c.693G>A	c.(691-693)tcG>tcA	p.S231S	ELK1_ENST00000343894.4_Intron|ELK1_ENST00000376983.3_Silent_p.S231S|ELK1_ENST00000592066.1_Silent_p.S177S	NM_005229.4	NP_005220.2	P19419	ELK1_HUMAN	ELK1, member of ETS oncogene family	231					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	10						TAAGCTCTTCCGATTTCAGGT	0.577																																																0			X											9.0	10.0	10.0					X																	47497543		2169	4184	6353	47382487	SO:0001819	synonymous_variant	2002			M25269	CCDS14283.1, CCDS59165.1	Xp11.23	2010-07-20			ENSG00000126767	ENSG00000126767			3321	protein-coding gene	gene with protein product		311040				2539641	Standard	NM_001114123		Approved		uc010nhv.4	P19419	OTTHUMG00000021452	ENST00000247161.3:c.693G>A	X.37:g.47497543C>T		Somatic		Capture	Illumina GAIIx	4	47382487	B2R7H4|O75606|O95058|Q969X8|Q9UJM4	Silent	SNP	"superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Ets,HMMSmart_SM00413,PatternScan_ETS_DOMAIN_1,PatternScan_ETS_DOMAIN_2"	p.S231	ENST00000247161.3	37	c.693	CCDS14283.1	X																																																																																			-	NULL		0.577	ELK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELK1	protein_coding	OTTHUMT00000056436.1	C	NM_005229		47382487	-1	no_errors	NM_005229	genbank	human	reviewed	54_36p	silent	SNP	0.034	T
ZNF81	347344	genome.wustl.edu	37	X	47701035	47701035	+	Intron	SNP	A	A	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:47701035A>T	ENST00000376954.1	+	2	86				ZNF81_ENST00000338637.7_Intron|ZNF81_ENST00000334937.4_Intron			P51508	ZNF81_HUMAN	zinc finger protein 81						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				GGGCTTGATAAACCTTCCTCT	0.423																																																0			X																																								47585979	SO:0001627	intron_variant	643507			AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.-282-1014A>T	X.37:g.47701035A>T		Somatic		Capture	Illumina GAIIx	4	47585979	Q6RX22|Q96QH6	RNA	SNP	-	NULL	ENST00000376954.1	37	NULL	CCDS43933.1	X																																																																																			-	-		0.423	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643507	protein_coding	OTTHUMT00000056455.2	A	NM_007137		47585979	-1	pseudogene	XR_016898	genbank	human	model	54_36p	rna	SNP	0.996	T
OR4X2	119764	genome.wustl.edu	37	11	48267487	48267487	+	Missense_Mutation	SNP	A	A	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:48267487A>C	ENST00000302329.3	+	1	880	c.832A>C	c.(832-834)Atc>Ctc	p.I278L		NM_001004727.1	NP_001004727.1	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X, member 2	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(4)|lung(12)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	20						GAACCCTGTCATCTACTCTCT	0.473																																																0			11											108.0	99.0	102.0					11																	48267487		2201	4298	6499	48224063	SO:0001583	missense	119764			AB065847	CCDS31486.1	11p11.2	2012-08-09			ENSG00000172208	ENSG00000172208		"""GPCR / Class A : Olfactory receptors"""	15184	protein-coding gene	gene with protein product							Standard	NM_001004727		Approved		uc001ngs.1	Q8NGF9	OTTHUMG00000165302	ENST00000302329.3:c.832A>C	11.37:g.48267487A>C	ENSP00000307751:p.Ile278Leu	Somatic		Capture	Illumina GAIIx	4	48224063	B2RNK3|Q6IF73|Q96R63	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.I278L	ENST00000302329.3	37	c.832	CCDS31486.1	11	.	.	.	.	.	.	.	.	.	.	a	19.60	3.858769	0.71834	.	.	ENSG00000172208	ENST00000302329	T	0.51817	0.69	5.47	3.16	0.36331	GPCR, rhodopsin-like superfamily (1);	0.111576	0.39759	N	0.001267	T	0.65821	0.2728	M	0.81239	2.535	0.24577	N	0.993894	D	0.67145	0.996	D	0.77557	0.99	T	0.58306	-0.7659	10	0.87932	D	0	.	8.4574	0.32908	0.839:0.0:0.161:0.0	.	278	Q8NGF9	OR4X2_HUMAN	L	278	ENSP00000307751:I278L	ENSP00000307751:I278L	I	+	1	0	OR4X2	48224063	1.000000	0.71417	0.997000	0.53966	0.892000	0.51952	5.698000	0.68302	0.376000	0.24707	-0.266000	0.10368	ATC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.473	OR4X2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X2	protein_coding	OTTHUMT00000383376.2	A	NM_001004727		48224063	+1	no_errors	NM_001004727	genbank	human	provisional	54_36p	missense	SNP	0.999	C
SLC27A2	11001	genome.wustl.edu	37	15	50519219	50519219	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr15:50519219C>T	ENST00000267842.5	+	7	1533	c.1301C>T	c.(1300-1302)cCa>cTa	p.P434L	SLC27A2_ENST00000380902.4_Missense_Mutation_p.P381L|SLC27A2_ENST00000544960.1_Missense_Mutation_p.P199L	NM_003645.3	NP_003636.2	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid transporter), member 2	434					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)|very long-chain fatty acid catabolic process (GO:0042760)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of peroxisomal membrane (GO:0005779)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|phytanate-CoA ligase activity (GO:0050197)|pristanate-CoA ligase activity (GO:0070251)|receptor binding (GO:0005102)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		CAACTTACACCATTTAATGGC	0.368																																																0			15											67.0	66.0	66.0					15																	50519219		2196	4295	6491	48306511	SO:0001583	missense	11001			D88308	CCDS10133.1, CCDS53943.1	15q21.2	2013-05-22			ENSG00000140284	ENSG00000140284		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10996	protein-coding gene	gene with protein product		603247		FACVL1		9730624	Standard	NM_003645		Approved	FATP2, hFACVL1, VLACS, VLCS, HsT17226, ACSVL1	uc001zxw.3	O14975	OTTHUMG00000131643	ENST00000267842.5:c.1301C>T	15.37:g.50519219C>T	ENSP00000267842:p.Pro434Leu	Somatic		Capture	Illumina GAIIx	4	48306511	A8K2J7|Q53FY6|Q6PF09	Missense_Mutation	SNP	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding,PatternScan_AMP_BINDING	p.P434L	ENST00000267842.5	37	c.1301	CCDS10133.1	15	.	.	.	.	.	.	.	.	.	.	C	26.7	4.763283	0.89932	.	.	ENSG00000140284	ENST00000380902;ENST00000267842;ENST00000544960	T;T;T	0.39229	1.09;1.35;1.35	5.78	5.78	0.91487	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.67031	0.2850	M	0.77616	2.38	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.87578	0.99;0.998	T	0.68428	-0.5411	10	0.59425	D	0.04	.	17.5141	0.87768	0.0:1.0:0.0:0.0	.	381;434	Q6PF09;O14975	.;S27A2_HUMAN	L	381;434;199	ENSP00000370289:P381L;ENSP00000267842:P434L;ENSP00000444549:P199L	ENSP00000267842:P434L	P	+	2	0	SLC27A2	48306511	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	4.650000	0.61440	2.730000	0.93505	0.655000	0.94253	CCA	-	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding		0.368	SLC27A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A2	protein_coding	OTTHUMT00000254539.2	C	NM_003645		48306511	+1	no_errors	NM_003645	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TMEM89	440955	genome.wustl.edu	37	3	48658923	48658923	+	Silent	SNP	C	C	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr3:48658923C>A	ENST00000330862.3	-	1	365	c.267G>T	c.(265-267)cgG>cgT	p.R89R		NM_001008269.1	NP_001008270.1	A2RUT3	TMM89_HUMAN	transmembrane protein 89	89						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|lung(1)|stomach(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GTGAGCGCCGCCGCCCCTGCA	0.622																																																0			3											30.0	29.0	29.0					3																	48658923		2203	4299	6502	48633927	SO:0001819	synonymous_variant	440955			AX657016	CCDS33751.1	3p21.31	2005-11-02			ENSG00000183396	ENSG00000183396			32372	protein-coding gene	gene with protein product							Standard	NM_001008269		Approved		uc011bbo.2	A2RUT3	OTTHUMG00000156647	ENST00000330862.3:c.267G>T	3.37:g.48658923C>A		Somatic		Capture	Illumina GAIIx	4	48633927		Silent	SNP	NULL	p.R89	ENST00000330862.3	37	c.267	CCDS33751.1	3																																																																																			-	NULL		0.622	TMEM89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM89	protein_coding	OTTHUMT00000345046.1	C	NM_001008269		48633927	-1	no_errors	NM_001008269	genbank	human	provisional	54_36p	silent	SNP	0.003	A
PPP1R3F	89801	genome.wustl.edu	37	X	49142461	49142461	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:49142461C>A	ENST00000055335.6	+	4	1325	c.1309C>A	c.(1309-1311)Ccc>Acc	p.P437T	PPP1R3F_ENST00000438316.1_Missense_Mutation_p.P108T|PPP1R3F_ENST00000495799.1_Missense_Mutation_p.P91T|PPP1R3F_ENST00000466508.1_Missense_Mutation_p.P91T|PPP1R3F_ENST00000376188.1_Missense_Mutation_p.P91T	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	437					regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					GGCCTCAGGGCCCGATGCGAG	0.667																																																0			X											19.0	18.0	18.0					X																	49142461		2197	4293	6490	49029405	SO:0001583	missense	89801				CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.1309C>A	X.37:g.49142461C>A	ENSP00000055335:p.Pro437Thr	Somatic		Capture	Illumina GAIIx	4	49029405	A2VDJ8|B3KPW2|E9PCM3	Missense_Mutation	SNP	HMMPfam_CBM_21	p.P437T	ENST00000055335.6	37	c.1309	CCDS35254.1	X	.	.	.	.	.	.	.	.	.	.	C	14.94	2.686222	0.47991	.	.	ENSG00000049769	ENST00000466508;ENST00000438316;ENST00000055335;ENST00000495799;ENST00000376188	T;T;T;T;T	0.59364	0.71;0.7;0.27;0.71;0.71	5.49	3.63	0.41609	.	0.000000	0.48286	D	0.000182	T	0.56352	0.1979	L	0.27053	0.805	0.27694	N	0.946007	D;D;D	0.71674	0.998;0.998;0.991	D;D;P	0.66351	0.943;0.943;0.831	T	0.46721	-0.9171	10	0.51188	T	0.08	-4.4293	6.0665	0.19866	0.0:0.707:0.1884:0.1046	.	108;122;437	F5H262;A2VDJ8;Q6ZSY5	.;.;PPR3F_HUMAN	T	91;108;437;91;91	ENSP00000420687:P91T;ENSP00000415548:P108T;ENSP00000055335:P437T;ENSP00000417535:P91T;ENSP00000365359:P91T	ENSP00000055335:P437T	P	+	1	0	PPP1R3F	49029405	0.869000	0.29996	0.998000	0.56505	0.893000	0.52053	0.624000	0.24462	2.311000	0.77944	0.529000	0.55759	CCC	-	NULL		0.667	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R3F	protein_coding	OTTHUMT00000060819.2	C	NM_033215		49029405	+1	no_errors	NM_033215	genbank	human	validated	54_36p	missense	SNP	0.708	A
PPP6R2	9701	genome.wustl.edu	37	22	50869811	50869811	+	Splice_Site	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr22:50869811C>T	ENST00000216061.5	+	12	1705	c.1335C>T	c.(1333-1335)caC>caT	p.H445H	PPP6R2_ENST00000395741.3_Splice_Site_p.H446H|PPP6R2_ENST00000359139.3_Splice_Site_p.H445H|PPP6R2_ENST00000395744.3_Splice_Site_p.H445H			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	445						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						TGGTGACCCACGTGAGTCCAA	0.627																																																0			22											38.0	39.0	39.0					22																	50869811		2203	4299	6502	49216677	SO:0001630	splice_region_variant	9701			AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.1335+1C>T	22.37:g.50869811C>T		Somatic		Capture	Illumina GAIIx	4	49216677	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Silent	SNP	HMMPfam_SAPS	p.H445	ENST00000216061.5	37	c.1335		22																																																																																			-	HMMPfam_SAPS		0.627	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	SAPS2	protein_coding	OTTHUMT00000316809.1	C	NM_014678	Silent	49216677	+1	no_errors	NM_014678	genbank	human	validated	54_36p	silent	SNP	1.000	T
TRIM51DP	100419945	genome.wustl.edu	37	11	49896510	49896510	+	IGR	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:49896510T>C								RP11-707M1.1 (64539 upstream) : OR4C13 (77432 downstream)																							TATGAGTCCCTGCTGCTGCAA	0.463																																																0			11																																								49853086	SO:0001628	intergenic_variant	0																															11.37:g.49896510T>C		Somatic		Capture	Illumina GAIIx	4	49853086		Missense_Mutation	SNP	NULL	p.L49P		37	c.146		11																																																																																			-	NULL	0	0.463					ENSG00000205034			T			49853086	+1	no_start_codon:no_stop_codon	ENST00000334042	ensembl	human	known	54_36p	missense	SNP	0.942	C
SNTG1	54212	genome.wustl.edu	37	8	51351155	51351155	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr8:51351155T>C	ENST00000522124.1	+	5	876	c.215T>C	c.(214-216)aTa>aCa	p.I72T	SNTG1_ENST00000276467.5_Missense_Mutation_p.I72T|SNTG1_ENST00000517473.1_Missense_Mutation_p.I72T|SNTG1_ENST00000518864.1_Missense_Mutation_p.I72T	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	72	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				GGATTAAGCATAAAGGTAGCC	0.378																																																0			8											98.0	81.0	87.0					8																	51351155		2202	4300	6502	51513708	SO:0001583	missense	54212			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.215T>C	8.37:g.51351155T>C	ENSP00000429842:p.Ile72Thr	Somatic		Capture	Illumina GAIIx	4	51513708	Q2M3Q0|Q9NY98	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228,HMMSmart_SM00233,superfamily_PH domain-like	p.I72T	ENST00000522124.1	37	c.215	CCDS6147.1	8	.	.	.	.	.	.	.	.	.	.	T	18.04	3.535790	0.64972	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000523085;ENST00000276467	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	4.38	4.38	0.52667	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.70798	0.3265	H	0.96080	3.765	0.80722	D	1	D;B	0.58620	0.983;0.157	P;B	0.55011	0.766;0.229	T	0.79070	-0.1954	10	0.87932	D	0	.	10.0094	0.41977	0.0:0.0:0.0:1.0	.	72;72	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	T	72	ENSP00000429276:I72T;ENSP00000429842:I72T;ENSP00000431123:I72T;ENSP00000429363:I72T;ENSP00000276467:I72T	ENSP00000276467:I72T	I	+	2	0	SNTG1	51513708	1.000000	0.71417	0.985000	0.45067	0.997000	0.91878	4.263000	0.58853	1.621000	0.50320	0.528000	0.53228	ATA	-	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228		0.378	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	protein_coding	OTTHUMT00000377964.1	T			51513708	+1	no_errors	NM_018967	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PCBP2	5094	genome.wustl.edu	37	12	53861067	53861067	+	Silent	SNP	C	C	T	rs75582496	byFrequency	TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr12:53861067C>T	ENST00000439930.3	+	10	811	c.789C>T	c.(787-789)acC>acT	p.T263T	PCBP2_ENST00000552296.2_Silent_p.T259T|PCBP2_ENST00000447282.1_Silent_p.T232T|PCBP2_ENST00000455667.3_Silent_p.T228T|PCBP2_ENST00000603815.1_Silent_p.T263T|PCBP2_ENST00000359282.5_Silent_p.T228T|PCBP2_ENST00000437231.1_Silent_p.T228T|PCBP2_ENST00000552819.1_Silent_p.T232T|PCBP2_ENST00000541275.1_Silent_p.T259T|RP11-793H13.8_ENST00000547717.1_RNA|PCBP2_ENST00000549863.1_Silent_p.T218T|PCBP2_ENST00000548933.1_Silent_p.T232T|PCBP2_ENST00000359462.5_Silent_p.T263T|PCBP2_ENST00000546463.1_Silent_p.T259T			Q15366	PCBP2_HUMAN	poly(rC) binding protein 2	263					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of defense response to virus (GO:0050687)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15						ATGGCAACACCGGATTCAGTG	0.458													C|||	10	0.00199681	0.0076	0.0	5008	,	,		20944	0.0		0.0	False		,,,				2504	0.0															0			12						C	,,,,,,	16,4390	23.3+/-48.9	0,16,2187	166.0	141.0	150.0		684,789,777,696,684,789,777	5.7	1.0	12	dbSNP_132	150	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PCBP2	NM_001098620.2,NM_001128911.1,NM_001128912.1,NM_001128913.1,NM_001128914.1,NM_005016.5,NM_031989.4	,,,,,,	0,16,6487	TT,TC,CC		0.0,0.3631,0.123	,,,,,,	228/332,263/366,259/362,232/336,228/319,263/367,259/363	53861067	16,12990	2203	4300	6503	52147334	SO:0001819	synonymous_variant	5094			BC035420	CCDS8859.1, CCDS44900.1, CCDS44901.1, CCDS44902.1, CCDS44903.1, CCDS44904.1, CCDS55830.1	12q13.13	2013-10-30	2001-11-28		ENSG00000197111	ENSG00000197111			8648	protein-coding gene	gene with protein product	"""heterogenous nuclear ribonucleoprotein E2"""	601210	"""poly(rC)-binding protein 2"""			8833161	Standard	NM_001098620		Approved	HNRPE2, hnRNP-E2, HNRNPE2	uc001sdc.4	Q15366	OTTHUMG00000169439	ENST00000439930.3:c.789C>T	12.37:g.53861067C>T		Somatic		Capture	Illumina GAIIx	4	52147334	A8K7X6|F8VYL7|G3V0E8|I6L8F9|Q32Q82|Q59HD4|Q68Y55|Q6IPF4|Q6PKG5	Silent	SNP	HMMSmart_KH,superfamily_SSF54791,HMMPfam_KH_1	p.T263	ENST00000439930.3	37	c.789	CCDS44901.1	12																																																																																			-	NULL		0.458	PCBP2-027	NOVEL	NAGNAG_splice_site|non_canonical_conserved|basic|CCDS	protein_coding	PCBP2	protein_coding	OTTHUMT00000407545.2	C	NM_005016		52147334	+1	no_errors	NM_005016	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
CGB1	114335	genome.wustl.edu	37	19	49541879	49541879	+	Intron	SNP	C	C	G	rs529330465		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr19:49541879C>G	ENST00000391869.3	-	2	25				CGB1_ENST00000301407.7_5'Flank|CTB-60B18.6_ENST00000591656.1_5'Flank			A6NKQ9	CGB1_HUMAN	chorionic gonadotropin, beta polypeptide 1							extracellular region (GO:0005576)				liver(1)|lung(1)	2		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		ACCCAGTGCCCCCCGGTCCAC	0.627																																																0			19																																								54233691	SO:0001627	intron_variant	0			S80935	CCDS12751.2	19q13.32	2012-10-03				ENSG00000267631			16721	protein-coding gene	gene with protein product		608823				6194155	Standard	NM_033377		Approved		uc002plx.3	A6NKQ9	OTTHUMG00000150186	ENST00000391869.3:c.10-2319G>C	19.37:g.49541879C>G		Somatic		Capture	Illumina GAIIx	4	54233691	A4FVC8|A8MUK6	Missense_Mutation	SNP	superfamily_SSF57501,HMMPfam_NGF,HMMSmart_NGF	p.G211R	ENST00000391869.3	37	c.631		19																																																																																			-	superfamily_SSF57501,HMMPfam_NGF,HMMSmart_NGF		0.627	CGB1-201	KNOWN	basic|appris_candidate_longest	protein_coding	NTF6B	protein_coding		C	NM_033377		54233691	-1	no_start_codon	ENST00000391533	ensembl	human	known	54_36p	missense	SNP	0.382	G
MAGED2	10916	genome.wustl.edu	37	X	54836166	54836166	+	Silent	SNP	A	A	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:54836166A>T	ENST00000375068.1	+	3	290	c.57A>T	c.(55-57)tcA>tcT	p.S19S	MAGED2_ENST00000375062.4_Silent_p.S19S|MAGED2_ENST00000218439.4_Silent_p.S19S|MAGED2_ENST00000375053.2_Silent_p.S19S|MAGED2_ENST00000497484.1_3'UTR|MAGED2_ENST00000375060.1_Silent_p.S19S|MAGED2_ENST00000396224.1_Silent_p.S19S|MAGED2_ENST00000347546.4_Silent_p.S19S|MAGED2_ENST00000375058.1_Silent_p.S19S			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	19						membrane (GO:0016020)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						CTGAAGCTTCAGAAAAGGACA	0.517																																																0			X											121.0	106.0	111.0					X																	54836166		2203	4300	6503	54852891	SO:0001819	synonymous_variant	10916			AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.57A>T	X.37:g.54836166A>T		Somatic		Capture	Illumina GAIIx	4	54852891	A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	Silent	SNP	HMMPfam_MAGE	p.S19	ENST00000375068.1	37	c.57	CCDS14362.1	X																																																																																			-	NULL		0.517	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGED2	protein_coding	OTTHUMT00000056821.2	A	NM_014599		54852891	+1	no_errors	NM_014599	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
FAM83B	222584	genome.wustl.edu	37	6	54804748	54804748	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:54804748G>T	ENST00000306858.7	+	5	1095	c.979G>T	c.(979-981)Gac>Tac	p.D327Y		NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	327										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					TGGTAGACAAGACAAGATTCA	0.383																																																0			6											77.0	78.0	78.0					6																	54804748		2203	4300	6503	54912707	SO:0001583	missense	222584			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.979G>T	6.37:g.54804748G>T	ENSP00000304078:p.Asp327Tyr	Somatic		Capture	Illumina GAIIx	4	54912707	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	HMMPfam_DUF1669,superfamily_SSF56024	p.D327Y	ENST00000306858.7	37	c.979	CCDS34479.1	6	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289585	0.59976	.	.	ENSG00000168143	ENST00000306858	T	0.10288	2.89	5.42	5.42	0.78866	.	0.134198	0.51477	D	0.000088	T	0.27697	0.0681	M	0.73598	2.24	0.58432	D	0.999996	D	0.89917	1.0	D	0.69307	0.963	T	0.02037	-1.1225	10	0.87932	D	0	-26.391	19.5755	0.95441	0.0:0.0:1.0:0.0	.	327	Q5T0W9	FA83B_HUMAN	Y	327	ENSP00000304078:D327Y	ENSP00000304078:D327Y	D	+	1	0	FAM83B	54912707	1.000000	0.71417	0.992000	0.48379	0.943000	0.58893	5.579000	0.67457	2.700000	0.92200	0.585000	0.79938	GAC	-	NULL		0.383	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83B	protein_coding	OTTHUMT00000040994.1	G	XM_294139		54912707	+1	no_errors	NM_001010872	genbank	human	validated	54_36p	missense	SNP	1.000	T
OR8H3	390152	genome.wustl.edu	37	11	55890079	55890079	+	Silent	SNP	C	C	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:55890079C>A	ENST00000313472.3	+	1	231	c.231C>A	c.(229-231)gtC>gtA	p.V77V		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					ACTCAACTGTCGTCACACCTA	0.448																																																0			11											275.0	272.0	273.0					11																	55890079		2201	4293	6494	55646655	SO:0001819	synonymous_variant	390152			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.231C>A	11.37:g.55890079C>A		Somatic		Capture	Illumina GAIIx	4	55646655	Q6IFB7	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V77	ENST00000313472.3	37	c.231	CCDS31519.1	11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.448	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H3	protein_coding	OTTHUMT00000391541.1	C	NM_001005201		55646655	+1	no_errors	NM_001005201	genbank	human	provisional	54_36p	silent	SNP	0.000	A
OR8H1	219469	genome.wustl.edu	37	11	56058513	56058513	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:56058513A>G	ENST00000313022.2	-	1	53	c.26T>C	c.(25-27)gTg>gCg	p.V9A		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					GAAGTCAGGCACATTTGTGTT	0.373																																																0			11											95.0	90.0	92.0					11																	56058513		2201	4296	6497	55815089	SO:0001583	missense	219469			AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.26T>C	11.37:g.56058513A>G	ENSP00000323595:p.Val9Ala	Somatic		Capture	Illumina GAIIx	4	55815089	B2RNI7|Q6IFC5	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V9A	ENST00000313022.2	37	c.26	CCDS31526.1	11	.	.	.	.	.	.	.	.	.	.	A	13.24	2.178907	0.38511	.	.	ENSG00000181693	ENST00000313022;ENST00000395186	T	0.00892	5.57	3.77	2.58	0.30949	.	0.492159	0.17239	N	0.181633	T	0.01940	0.0061	M	0.66939	2.045	0.09310	N	1	P	0.38167	0.621	B	0.42653	0.394	T	0.33929	-0.9849	10	0.62326	D	0.03	.	9.1763	0.37114	0.8307:0.0:0.0:0.1692	.	9	Q8NGG4	OR8H1_HUMAN	A	9;5	ENSP00000323595:V9A	ENSP00000323595:V9A	V	-	2	0	OR8H1	55815089	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.429000	0.21412	0.545000	0.28902	0.472000	0.43445	GTG	-	superfamily_Family A G protein-coupled receptor-like		0.373	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H1	protein_coding	OTTHUMT00000370019.1	A	NM_001005199		55815089	-1	no_errors	NM_001005199	genbank	human	provisional	54_36p	missense	SNP	0.010	G
KIF5A	3798	genome.wustl.edu	37	12	57965903	57965903	+	Silent	SNP	A	A	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr12:57965903A>G	ENST00000455537.2	+	14	1696	c.1422A>G	c.(1420-1422)caA>caG	p.Q474Q	KIF5A_ENST00000286452.5_Silent_p.Q385Q	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	474					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						GCCACCTGCAATCAGAGAACG	0.582																																																0			12											83.0	74.0	77.0					12																	57965903		2202	4300	6502	56252170	SO:0001819	synonymous_variant	3798			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.1422A>G	12.37:g.57965903A>G		Somatic		Capture	Illumina GAIIx	4	56252170	A6H8M5|Q4LE26	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00129,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1,superfamily_Prefoldin	p.Q474	ENST00000455537.2	37	c.1422	CCDS8945.1	12																																																																																			-	NULL		0.582	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5A	protein_coding	OTTHUMT00000407634.1	A	NM_004984		56252170	+1	no_errors	NM_004984	genbank	human	reviewed	54_36p	silent	SNP	0.988	G
PPAT	5471	genome.wustl.edu	37	4	57261535	57261535	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr4:57261535C>G	ENST00000264220.2	-	11	1674	c.1537G>C	c.(1537-1539)Gta>Cta	p.V513L	RP11-646I6.6_ENST00000602749.1_lincRNA	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	513					'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	TCTAATTCTACAGGATATTTT	0.368																																																0			4											68.0	67.0	67.0					4																	57261535		2203	4297	6500	56956292	SO:0001583	missense	5471				CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.1537G>C	4.37:g.57261535C>G	ENSP00000264220:p.Val513Leu	Somatic		Capture	Illumina GAIIx	4	56956292		Missense_Mutation	SNP	HMMPfam_GATase_2,superfamily_N-terminal nucleophile aminohydrolases (Ntn hydrolases),superfamily_PRTase-like,HMMPfam_Pribosyltran	p.V513L	ENST00000264220.2	37	c.1537	CCDS3505.1	4	.	.	.	.	.	.	.	.	.	.	C	14.80	2.643328	0.47153	.	.	ENSG00000128059	ENST00000264220	.	.	.	5.28	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.57388	0.2050	L	0.48986	1.54	0.80722	D	1	B	0.24426	0.103	B	0.24848	0.056	T	0.56294	-0.8003	9	0.44086	T	0.13	-9.7189	14.2914	0.66281	0.0:0.9276:0.0:0.0724	.	513	Q06203	PUR1_HUMAN	L	513	.	ENSP00000264220:V513L	V	-	1	0	PPAT	56956292	1.000000	0.71417	0.977000	0.42913	0.739000	0.42172	5.769000	0.68865	1.356000	0.45884	0.650000	0.86243	GTA	-	superfamily_PRTase-like		0.368	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAT	protein_coding	OTTHUMT00000250781.2	C	NM_002703		56956292	-1	no_errors	NM_002703	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TMX2	51075	genome.wustl.edu	37	11	57505439	57505439	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:57505439C>G	ENST00000278422.4	+	3	317	c.305C>G	c.(304-306)aCa>aGa	p.T102R	TMX2_ENST00000378312.4_Intron|TMX2-CTNND1_ENST00000528395.1_Intron	NM_015959.3	NP_057043.1	Q9Y320	TMX2_HUMAN	thioredoxin-related transmembrane protein 2	102					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(2)	12						GTGGCCAACACAATTCTTTTC	0.423																																																0			11											165.0	151.0	156.0					11																	57505439		2201	4296	6497	57262015	SO:0001583	missense	51075			AF132965	CCDS7967.1, CCDS44601.1	11q12.1	2012-09-20	2009-02-23	2009-02-23	ENSG00000213593	ENSG00000213593		"""Protein disulfide isomerases"""	30739	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 12"""		"""thioredoxin domain containing 14"""	TXNDC14		12670024	Standard	NM_015959		Approved	PDIA12	uc001nlc.2	Q9Y320	OTTHUMG00000167200	ENST00000278422.4:c.305C>G	11.37:g.57505439C>G	ENSP00000278422:p.Thr102Arg	Somatic		Capture	Illumina GAIIx	4	57262015	B7Z4R4|Q53G73|Q561W0|Q5J7Q7|Q8NBP9|Q9H3L1	Missense_Mutation	SNP	superfamily_Thioredoxin-like,HMMPfam_Thioredoxin	p.T102R	ENST00000278422.4	37	c.305	CCDS7967.1	11	.	.	.	.	.	.	.	.	.	.	C	13.02	2.111777	0.37242	.	.	ENSG00000213593	ENST00000278422	.	.	.	6.16	5.26	0.73747	.	0.207707	0.40728	U	0.001024	T	0.31263	0.0791	N	0.22421	0.69	0.09310	N	0.999999	B	0.17038	0.02	B	0.21151	0.033	T	0.28138	-1.0053	9	0.59425	D	0.04	-10.3584	12.3186	0.54971	0.0:0.8633:0.0:0.1367	.	102	Q9Y320	TMX2_HUMAN	R	102	.	ENSP00000278422:T102R	T	+	2	0	TMX2	57262015	0.049000	0.20398	0.071000	0.20095	0.979000	0.70002	1.045000	0.30341	1.621000	0.50320	0.650000	0.86243	ACA	-	NULL		0.423	TMX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMX2	protein_coding	OTTHUMT00000393708.1	C	NM_015959		57262015	+1	no_errors	NM_015959	genbank	human	validated	54_36p	missense	SNP	0.982	G
GLYATL1	92292	genome.wustl.edu	37	11	58723114	58723114	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:58723114G>T	ENST00000317391.4	+	8	863	c.523G>T	c.(523-525)Gat>Tat	p.D175Y	GLYATL1_ENST00000300079.5_Missense_Mutation_p.D206Y|RP11-142C4.6_ENST00000525714.1_RNA|RP11-142C4.6_ENST00000533954.1_RNA	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	175						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	TGCCCAGCTGGATGTCTCTTA	0.458																																																0			11											70.0	68.0	69.0					11																	58723114		2201	4295	6496	58479690	SO:0001583	missense	92292			AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.523G>T	11.37:g.58723114G>T	ENSP00000322223:p.Asp175Tyr	Somatic		Capture	Illumina GAIIx	4	58479690	A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	HMMPfam_Gly_acyl_tr_N,superfamily_Acyl_CoA_acyltransferase,HMMPfam_Gly_acyl_tr_C	p.D206Y	ENST00000317391.4	37	c.616	CCDS55768.1	11	.	.	.	.	.	.	.	.	.	.	.	11.62	1.693032	0.30052	.	.	ENSG00000166840	ENST00000444580;ENST00000317391;ENST00000300079	T;T	0.20598	2.06;2.06	2.77	1.8	0.24995	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, N-terminal (1);	0.536026	0.16714	U	0.202550	T	0.27241	0.0668	M	0.67569	2.06	0.09310	N	1	P;B	0.35821	0.523;0.31	B;B	0.43783	0.424;0.431	T	0.18116	-1.0347	10	0.87932	D	0	.	6.4405	0.21847	0.0:0.0:0.7092:0.2908	.	206;175	Q969I3-2;Q969I3	.;GLYL1_HUMAN	Y	152;175;206	ENSP00000322223:D175Y;ENSP00000300079:D206Y	ENSP00000300079:D206Y	D	+	1	0	GLYATL1	58479690	0.119000	0.22226	0.005000	0.12908	0.010000	0.07245	2.187000	0.42602	0.314000	0.23086	0.411000	0.27672	GAT	-	HMMPfam_Gly_acyl_tr_N,superfamily_Acyl_CoA_acyltransferase		0.458	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL1	protein_coding	OTTHUMT00000393783.1	G	NM_080661		58479690	+1	no_errors	NM_080661	genbank	human	provisional	54_36p	missense	SNP	0.024	T
TANC2	26115	genome.wustl.edu	37	17	61498517	61498517	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr17:61498517A>G	ENST00000424789.2	+	25	5178	c.5174A>G	c.(5173-5175)tAt>tGt	p.Y1725C	TANC2_ENST00000389520.4_Missense_Mutation_p.Y1735C|RP11-269G24.3_ENST00000583552.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1725					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						TCAGCATCCTATTACCCAGTC	0.517																																																0			17											186.0	190.0	189.0					17																	61498517		2102	4229	6331	58852249	SO:0001583	missense	26115			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.5174A>G	17.37:g.61498517A>G	ENSP00000387593:p.Tyr1725Cys	Somatic		Capture	Illumina GAIIx	4	58852249	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00248,superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00028,superfamily_TPR-like,HMMPfam_TPR_1	p.Y1725C	ENST00000424789.2	37	c.5174	CCDS45754.1	17	.	.	.	.	.	.	.	.	.	.	A	15.15	2.746611	0.49257	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.79247	-1.25;-1.24	4.79	4.79	0.61399	.	0.308380	0.31188	N	0.008083	T	0.79782	0.4505	N	0.24115	0.695	0.58432	D	0.999996	D	0.76494	0.999	D	0.74674	0.984	T	0.82242	-0.0554	10	0.66056	D	0.02	.	13.3515	0.60605	1.0:0.0:0.0:0.0	.	1725	Q9HCD6	TANC2_HUMAN	C	1735;1725	ENSP00000374171:Y1735C;ENSP00000387593:Y1725C	ENSP00000374171:Y1735C	Y	+	2	0	TANC2	58852249	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.477000	0.90424	2.140000	0.66376	0.459000	0.35465	TAT	-	NULL		0.517	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TANC2	protein_coding	OTTHUMT00000444765.1	A			58852249	+1	no_errors	NM_025185	genbank	human	validated	54_36p	missense	SNP	1.000	G
CACNG6	59285	genome.wustl.edu	37	19	54502965	54502965	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr19:54502965G>T	ENST00000252729.2	+	3	1074	c.484G>T	c.(484-486)Gtg>Ttg	p.V162L	CACNG6_ENST00000352529.1_Intron|CACNG6_ENST00000346968.2_Intron	NM_145814.1	NP_665813.1	Q9BXT2	CCG6_HUMAN	calcium channel, voltage-dependent, gamma subunit 6	162					calcium ion transport (GO:0006816)	voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)		TATCATCATGGTGCTCAGTAA	0.577																																																0			19											241.0	210.0	221.0					19																	54502965		2203	4300	6503	59194777	SO:0001583	missense	59285			AF288386	CCDS12870.1, CCDS12871.1	19q13.4	2008-05-02			ENSG00000130433	ENSG00000130433		"""Calcium channel subunits"""	13625	protein-coding gene	gene with protein product		606898				11170751	Standard	NM_145814		Approved		uc002qct.3	Q9BXT2	OTTHUMG00000064907	ENST00000252729.2:c.484G>T	19.37:g.54502965G>T	ENSP00000252729:p.Val162Leu	Somatic		Capture	Illumina GAIIx	4	59194777		Missense_Mutation	SNP	NULL	p.V162L	ENST00000252729.2	37	c.484	CCDS12870.1	19	.	.	.	.	.	.	.	.	.	.	.	16.25	3.069012	0.55539	.	.	ENSG00000130433	ENST00000252729	T	0.67345	-0.26	4.92	3.89	0.44902	.	0.250559	0.31392	N	0.007740	T	0.57784	0.2077	L	0.36672	1.1	0.80722	D	1	P	0.42757	0.789	B	0.44224	0.444	T	0.56288	-0.8004	10	0.40728	T	0.16	-5.2134	9.3111	0.37905	0.0995:0.0:0.9005:0.0	.	162	Q9BXT2	CCG6_HUMAN	L	162	ENSP00000252729:V162L	ENSP00000252729:V162L	V	+	1	0	CACNG6	59194777	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.509000	0.45459	1.211000	0.43351	0.561000	0.74099	GTG	-	NULL		0.577	CACNG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG6	protein_coding	OTTHUMT00000139359.1	G			59194777	+1	no_errors	NM_145814	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
LILRA4	23547	genome.wustl.edu	37	19	54849490	54849490	+	Silent	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr19:54849490G>A	ENST00000291759.4	-	4	428	c.372C>T	c.(370-372)acC>acT	p.T124T	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	124	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		GTGCGGACAGGGTGGGTCTGC	0.572																																																0			19											43.0	47.0	46.0					19																	54849490		2202	4300	6502	59541302	SO:0001819	synonymous_variant	23547			AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.372C>T	19.37:g.54849490G>A		Somatic		Capture	Illumina GAIIx	4	59541302	Q32MC4	Silent	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig	p.T124	ENST00000291759.4	37	c.372	CCDS12890.1	19																																																																																			-	superfamily_Immunoglobulin		0.572	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA4	protein_coding	OTTHUMT00000140229.2	G	NM_012276		59541302	-1	no_errors	NM_012276	genbank	human	reviewed	54_36p	silent	SNP	0.045	A
ZSCAN4	201516	genome.wustl.edu	37	19	58190250	58190250	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr19:58190250C>T	ENST00000318203.5	+	5	1976	c.1279C>T	c.(1279-1281)Ccc>Tcc	p.P427S		NM_152677.2	NP_689890.1	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	427					telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	nuclear chromosome, telomeric region (GO:0000784)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|liver(2)|lung(17)|ovary(1)|skin(1)|stomach(1)	30		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GCCAAGTGTTCCCTCCACACC	0.398																																																0			19											63.0	62.0	62.0					19																	58190250		2203	4300	6503	62882062	SO:0001583	missense	201516			AK092424	CCDS12958.1	19q13.43	2013-01-08	2004-11-01	2004-11-02		ENSG00000180532		"""-"", ""Zinc fingers, C2H2-type"""	23709	protein-coding gene	gene with protein product		613419	"""zinc finger protein 494"""	ZNF494			Standard	NM_152677		Approved	FLJ35105	uc002qpu.3	Q8NAM6		ENST00000318203.5:c.1279C>T	19.37:g.58190250C>T	ENSP00000321963:p.Pro427Ser	Somatic		Capture	Illumina GAIIx	4	62882062	Q3MIQ2	Missense_Mutation	SNP	HMMPfam_SCAN,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.P427S	ENST00000318203.5	37	c.1279	CCDS12958.1	19	.	.	.	.	.	.	.	.	.	.	C	9.918	1.211341	0.22289	.	.	ENSG00000180532	ENST00000318203	T	0.08008	3.14	4.29	-1.97	0.07503	.	1.696030	0.03269	N	0.184485	T	0.07548	0.0190	L	0.33293	1	0.09310	N	1	B	0.24043	0.096	B	0.22386	0.039	T	0.40021	-0.9585	10	0.23891	T	0.37	-1.9055	8.8521	0.35206	0.0:0.4978:0.0:0.5022	.	427	Q8NAM6	ZSCA4_HUMAN	S	427	ENSP00000321963:P427S	ENSP00000321963:P427S	P	+	1	0	ZSCAN4	62882062	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.475000	0.06599	-0.222000	0.09958	-0.145000	0.13849	CCC	-	NULL		0.398	ZSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN4	protein_coding	OTTHUMT00000466812.1	C	NM_152677		62882062	+1	no_errors	NM_152677	genbank	human	validated	54_36p	missense	SNP	0.001	T
SLC22A9	114571	genome.wustl.edu	37	11	63137867	63137867	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:63137867G>T	ENST00000279178.3	+	1	588	c.339G>T	c.(337-339)atG>atT	p.M113I	SLC22A9_ENST00000310969.4_Missense_Mutation_p.M113I	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	113					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						ACGCAGACATGGAGCCCTGTG	0.522																																																0			11											126.0	105.0	112.0					11																	63137867		2201	4298	6499	62894443	SO:0001583	missense	114571			AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.339G>T	11.37:g.63137867G>T	ENSP00000279178:p.Met113Ile	Somatic		Capture	Illumina GAIIx	4	62894443	A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Missense_Mutation	SNP	superfamily_MFS general substrate transporter,HMMPfam_MFS_1	p.M113I	ENST00000279178.3	37	c.339	CCDS8043.1	11	.	.	.	.	.	.	.	.	.	.	g	4.591	0.109847	0.08780	.	.	ENSG00000149742	ENST00000310969;ENST00000279178	T;T	0.62639	0.57;0.01	3.3	-3.6	0.04570	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.397771	0.26265	N	0.025364	T	0.31389	0.0795	N	0.02802	-0.49	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.14839	-1.0458	10	0.56958	D	0.05	.	10.4064	0.44260	0.7628:0.0:0.2372:0.0	.	113	Q8IVM8	S22A9_HUMAN	I	113	ENSP00000311527:M113I;ENSP00000279178:M113I	ENSP00000279178:M113I	M	+	3	0	SLC22A9	62894443	0.000000	0.05858	0.572000	0.28498	0.107000	0.19398	-3.863000	0.00347	-0.924000	0.03780	0.134000	0.15878	ATG	-	superfamily_MFS general substrate transporter		0.522	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A9	protein_coding	OTTHUMT00000396371.1	G	NM_080866		62894443	+1	no_errors	NM_080866	genbank	human	validated	54_36p	missense	SNP	0.010	T
TBC1D30	23329	genome.wustl.edu	37	12	65237225	65237225	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr12:65237225T>C	ENST00000229088.6	+	9	1487	c.1487T>C	c.(1486-1488)aTg>aCg	p.M496T	TBC1D30_ENST00000539867.1_Missense_Mutation_p.M333T|TBC1D30_ENST00000542120.1_Missense_Mutation_p.M219T			Q9Y2I9	TBC30_HUMAN	TBC1 domain family, member 30	496					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)	ciliary basal body (GO:0036064)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			NS(3)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	5						ACCCAGGAGATGCTAGAGAAT	0.493																																																0			12																																								63523492	SO:0001583	missense	23329			AB023201	CCDS53813.1	12q14.3	2013-07-10			ENSG00000111490	ENSG00000111490			29164	protein-coding gene	gene with protein product		615077				12618308, 17646400	Standard	NM_015279		Approved	KIAA0984	uc010sst.2	Q9Y2I9	OTTHUMG00000168824	ENST00000229088.6:c.1487T>C	12.37:g.65237225T>C	ENSP00000229088:p.Met496Thr	Somatic		Capture	Illumina GAIIx	4	63523492	B3KP01|B9A6M9|E7EMW4|F5GYJ9	Missense_Mutation	SNP	superfamily_RabGAP_TBC,HMMPfam_TBC,HMMSmart_TBC	p.M496T	ENST00000229088.6	37	c.1487		12	.	.	.	.	.	.	.	.	.	.	T	18.11	3.550658	0.65311	.	.	ENSG00000111490	ENST00000229088;ENST00000542120;ENST00000539867;ENST00000455166;ENST00000411580	T;T;T	0.08807	3.05;3.12;3.08	4.76	4.76	0.60689	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.26048	0.0635	M	0.72894	2.215	0.80722	D	1	D;D;D	0.64830	0.994;0.991;0.979	D;P;P	0.67103	0.949;0.833;0.771	T	0.00907	-1.1519	9	.	.	.	-28.0543	14.4497	0.67376	0.0:0.0:0.0:1.0	.	333;496;333	F5GYJ9;Q9Y2I9;E7EMW4	.;TBC30_HUMAN;.	T	496;219;333;333;291	ENSP00000229088:M496T;ENSP00000440640:M219T;ENSP00000440207:M333T	.	M	+	2	0	TBC1D30	63523492	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.461000	0.80834	2.008000	0.58898	0.459000	0.35465	ATG	-	superfamily_RabGAP_TBC		0.493	TBC1D30-201	KNOWN	basic	protein_coding	KIAA0984	protein_coding		T	XM_037557		63523492	+1	no_errors	XM_037557	genbank	human	model	54_36p	missense	SNP	1.000	C
YWHAEP1	649395	genome.wustl.edu	37	7	63894620	63894620	+	IGR	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr7:63894620G>A								ZNF736 (79382 upstream) : ZNF680 (85641 downstream)																							AAATGAAAGGGGACTACCACA	0.428																																																0			7																																								63532055	SO:0001628	intergenic_variant	649395																															7.37:g.63894620G>A		Somatic		Capture	Illumina GAIIx	4	63532055		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.428					LOC649395			G			63532055	+1	pseudogene	XR_037228	genbank	human	model	54_36p	rna	SNP	0.998	A
AR	367	genome.wustl.edu	37	X	66942818	66942818	+	Missense_Mutation	SNP	G	G	C	rs137852564		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:66942818G>C	ENST00000374690.3	+	7	3123	c.2599G>C	c.(2599-2601)Gtg>Ctg	p.V867L	AR_ENST00000396044.3_Intron|AR_ENST00000396043.2_Missense_Mutation_p.V335L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	866	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CCTGGACTCCGTGCAGCCTGT	0.483									Androgen Insensitivity Syndrome																																							0			X	GRCh37	CM890012|CM920100	AR	M	rs137852564						84.0	79.0	81.0					X																	66942818		2203	4300	6503	66859543	SO:0001583	missense	367	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2599G>C	X.37:g.66942818G>C	ENSP00000363822:p.Val867Leu	Somatic		Capture	Illumina GAIIx	4	66859543	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	HMMPfam_Androgen_recep,HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.V867L	ENST00000374690.3	37	c.2599	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	-	7.552	0.662943	0.14710	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000396043	D;D	0.99418	-5.87;-5.87	5.19	5.19	0.71726	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.059197	0.64402	D	0.000002	D	0.92237	0.7538	N	0.00112	-2.095	0.80722	D	1	B;B	0.33919	0.001;0.432	B;B	0.28784	0.004;0.094	D	0.95191	0.8308	10	0.02654	T	1	.	14.971	0.71235	0.0:0.0:1.0:0.0	.	335;866	F1D8N5;P10275	.;ANDR_HUMAN	L	685;867;335	ENSP00000363822:V867L;ENSP00000379358:V335L	ENSP00000363822:V867L	V	+	1	0	AR	66859543	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.390000	0.59646	2.416000	0.81992	0.591000	0.81541	GTG	-	superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep		0.483	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	protein_coding	OTTHUMT00000057007.1	G	NM_000044		66859543	+1	no_errors	NM_000044	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
SLC8A3	6547	genome.wustl.edu	37	14	70515607	70515607	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr14:70515607T>C	ENST00000381269.2	-	7	3037	c.2284A>G	c.(2284-2286)Atc>Gtc	p.I762V	SLC8A3_ENST00000534137.1_Missense_Mutation_p.I759V|SLC8A3_ENST00000533541.1_Missense_Mutation_p.I119V|SLC8A3_ENST00000356921.2_Missense_Mutation_p.I756V|SLC8A3_ENST00000528359.1_Missense_Mutation_p.I760V|SLC8A3_ENST00000216568.7_Missense_Mutation_p.I133V|SLC8A3_ENST00000357887.3_Missense_Mutation_p.I760V|SLC8A3_ENST00000394330.2_Missense_Mutation_p.I119V	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	762					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		ATGATGAGGATGGAGACGGCG	0.562																																																0			14											77.0	64.0	69.0					14																	70515607		2203	4300	6503	69585360	SO:0001583	missense	6547			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.2284A>G	14.37:g.70515607T>C	ENSP00000370669:p.Ile762Val	Somatic		Capture	Illumina GAIIx	4	69585360	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	HMMPfam_Na_Ca_ex,HMMSmart_SM00237,HMMPfam_Calx-beta	p.I762V	ENST00000381269.2	37	c.2284	CCDS35498.1	14	.	.	.	.	.	.	.	.	.	.	T	25.8	4.679325	0.88542	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000216568;ENST00000394330;ENST00000534137;ENST00000528359;ENST00000533541	T;T;T;T;T;T;T;T	0.72282	1.16;1.08;1.22;-0.64;-0.63;1.16;1.22;0.59	5.52	5.52	0.82312	.	0.056739	0.64402	D	0.000001	D	0.85221	0.5647	M	0.89478	3.035	0.80722	D	1	B;P;P;P;P;P	0.46859	0.17;0.858;0.885;0.518;0.734;0.497	B;P;P;P;P;B	0.60012	0.327;0.867;0.801;0.558;0.651;0.134	D	0.87516	0.2443	10	0.59425	D	0.04	.	15.6396	0.76984	0.0:0.0:0.0:1.0	.	119;756;762;760;759;133	F2Z391;P57103-2;P57103;Q96QG2;Q96QG1;Q5K3P6	.;.;NAC3_HUMAN;.;.;.	V	756;762;760;133;119;759;760;119	ENSP00000349392:I756V;ENSP00000370669:I762V;ENSP00000350560:I760V;ENSP00000216568:I133V;ENSP00000377863:I119V;ENSP00000436688:I759V;ENSP00000433531:I760V;ENSP00000437103:I119V	ENSP00000216568:I133V	I	-	1	0	SLC8A3	69585360	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.977000	0.88081	2.095000	0.63458	0.374000	0.22700	ATC	-	NULL		0.562	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	protein_coding	OTTHUMT00000390736.1	T			69585360	-1	no_errors	NM_183002	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	6	71318877	71318877	+	IGR	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:71318877T>C								RP11-134K13.4 (12194 upstream) : SMAP1 (58601 downstream)																							GCTGCCGTTCTTTTTTGTGTA	0.483																																																0			6																																								71375598	SO:0001628	intergenic_variant	642590																															6.37:g.71318877T>C		Somatic		Capture	Illumina GAIIx	4	71375598		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.483					LOC642590			T			71375598	-1	pseudogene	XR_016251	genbank	human	model	54_36p	rna	SNP	1.000	C
TRIM50	135892	genome.wustl.edu	37	7	72727266	72727266	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr7:72727266C>T	ENST00000333149.2	-	7	1315	c.1115G>A	c.(1114-1116)cGt>cAt	p.R372H	TRIM50_ENST00000453152.1_Missense_Mutation_p.R372H	NM_178125.2	NP_835226.2	Q86XT4	TRI50_HUMAN	tripartite motif containing 50	372	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)	20						CTTGCCCTTACGGCTGGCTGT	0.692																																																0			7											17.0	18.0	17.0					7																	72727266		2201	4298	6499	72365202	SO:0001583	missense	135892			AY081948	CCDS34654.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000146755	ENSG00000146755		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19017	protein-coding gene	gene with protein product		612548	"""tripartite motif-containing 50A"", ""tripartite motif-containing 50"""	TRIM50A			Standard	NM_001281450		Approved	FLJ32804	uc003txy.1	Q86XT4	OTTHUMG00000156805	ENST00000333149.2:c.1115G>A	7.37:g.72727266C>T	ENSP00000327994:p.Arg372His	Somatic		Capture	Illumina GAIIx	4	72365202	Q86XT3	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_zf-B_box,HMMSmart_SM00336,HMMSmart_SM00589,HMMPfam_SPRY,HMMSmart_SM00449	p.R372H	ENST00000333149.2	37	c.1115	CCDS34654.1	7	.	.	.	.	.	.	.	.	.	.	C	26.7	4.767423	0.90020	.	.	ENSG00000146755	ENST00000333149;ENST00000453152	T;T	0.68765	-0.35;-0.35	4.62	4.62	0.57501	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000011	D	0.83815	0.5336	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.86618	0.1877	10	0.66056	D	0.02	.	16.5525	0.84476	0.0:1.0:0.0:0.0	.	371;372	Q86XT4-2;Q86XT4	.;TRI50_HUMAN	H	372	ENSP00000327994:R372H;ENSP00000413875:R372H	ENSP00000327994:R372H	R	-	2	0	TRIM50	72365202	1.000000	0.71417	0.997000	0.53966	0.725000	0.41563	7.609000	0.82925	2.573000	0.86826	0.561000	0.74099	CGT	-	HMMPfam_SPRY,HMMSmart_SM00449		0.692	TRIM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM50	protein_coding	OTTHUMT00000345925.1	C	NM_178125		72365202	-1	no_errors	NM_178125	genbank	human	provisional	54_36p	missense	SNP	0.914	T
GLIPR1L2	144321	genome.wustl.edu	37	12	75816702	75816702	+	Missense_Mutation	SNP	A	A	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr12:75816702A>C	ENST00000550916.1	+	4	650	c.603A>C	c.(601-603)agA>agC	p.R201S	GLIPR1L2_ENST00000378692.3_Missense_Mutation_p.R94S|GLIPR1L2_ENST00000441218.1_Missense_Mutation_p.R136S|GLIPR1L2_ENST00000435775.1_Missense_Mutation_p.T167P|GLIPR1L2_ENST00000547164.1_Missense_Mutation_p.T167P|GLIPR1L2_ENST00000320460.4_Missense_Mutation_p.R201S	NM_001270396.1	NP_001257325.1	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2	201						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16						TGACGAGAAGACCTTATGAAC	0.299																																																0			12											151.0	147.0	148.0					12																	75816702		2203	4300	6503	74102969	SO:0001583	missense	144321			BC029557	CCDS9010.1, CCDS58258.1	12q21.1	2014-06-03				ENSG00000180481			28592	protein-coding gene	gene with protein product		610394				12477932	Standard	NM_001270396		Approved	MGC39497	uc001sxr.2	Q4G1C9	OTTHUMG00000169756	ENST00000550916.1:c.603A>C	12.37:g.75816702A>C	ENSP00000448248:p.Arg201Ser	Somatic		Capture	Illumina GAIIx	4	74102969	Q6MZS1|Q8N6N0|Q8NA43	Missense_Mutation	SNP	superfamily_SCP-like_extracellular,HMMSmart_SCP,HMMPfam_SCP	p.R201S	ENST00000550916.1	37	c.603	CCDS58258.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.09|12.09	1.833019|1.833019	0.32421|0.32421	.|.	.|.	ENSG00000180481|ENSG00000180481	ENST00000550916;ENST00000378692;ENST00000320460;ENST00000441218|ENST00000435775;ENST00000547164	T;T;T;T|T;T	0.09445|0.18657	2.98;2.98;2.98;2.98|2.2;2.2	4.99|4.99	-2.16|-2.16	0.07080|0.07080	CAP domain (2);|.	0.436409|.	0.23263|.	N|.	0.050115|.	T|T	0.17704|0.17704	0.0425|0.0425	L|L	0.40543|0.40543	1.245|1.245	0.29568|0.29568	N|N	0.850133|0.850133	B;B|.	0.28208|.	0.079;0.203|.	B;B|.	0.29176|.	0.055;0.099|.	T|T	0.34825|0.34825	-0.9813|-0.9813	10|7	0.56958|0.87932	D|D	0.05|0	.|.	3.5144|3.5144	0.07719|0.07719	0.318:0.0:0.4008:0.2812|0.318:0.0:0.4008:0.2812	.|.	201;201|.	Q4G1C9;Q4G1C9-2|.	GRPL2_HUMAN;.|.	S|P	201;94;201;136|167	ENSP00000448248:R201S;ENSP00000367963:R94S;ENSP00000317385:R201S;ENSP00000405273:R136S|ENSP00000398328:T167P;ENSP00000447980:T167P	ENSP00000317385:R201S|ENSP00000398328:T167P	R|T	+|+	3|1	2|0	GLIPR1L2|GLIPR1L2	74102969|74102969	0.967000|0.967000	0.33354|0.33354	0.945000|0.945000	0.38365|0.38365	0.004000|0.004000	0.04260|0.04260	-0.251000|-0.251000	0.08818|0.08818	-0.425000|-0.425000	0.07371|0.07371	-0.263000|-0.263000	0.10527|0.10527	AGA|ACC	-	superfamily_SCP-like_extracellular		0.299	GLIPR1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIPR1L2	protein_coding	OTTHUMT00000405718.1	A	NM_152436		74102969	+1	no_errors	NM_152436	genbank	human	provisional	54_36p	missense	SNP	0.944	C
SALL3	27164	genome.wustl.edu	37	18	76753293	76753293	+	Silent	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr18:76753293G>A	ENST00000537592.2	+	2	1302	c.1302G>A	c.(1300-1302)gcG>gcA	p.A434A	SALL3_ENST00000575389.2_Silent_p.A434A|SALL3_ENST00000536229.3_Silent_p.A301A	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	434					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GCGACAGCGCGCTCCAGATCC	0.622																																																0			18											27.0	22.0	24.0					18																	76753293		2201	4298	6499	74854281	SO:0001819	synonymous_variant	27164			AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1302G>A	18.37:g.76753293G>A		Somatic		Capture	Illumina GAIIx	4	74854281	Q9UGH1	Silent	SNP	HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_C2H2 and C2HC zinc fingers	p.A434	ENST00000537592.2	37	c.1302	CCDS12013.1	18																																																																																			-	HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_C2H2 and C2HC zinc fingers		0.622	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	protein_coding	OTTHUMT00000256397.1	G	NM_171999		74854281	+1	no_errors	NM_171999	genbank	human	validated	54_36p	silent	SNP	0.999	A
MAGEE1	57692	genome.wustl.edu	37	X	75650185	75650185	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:75650185T>C	ENST00000361470.2	+	1	2140	c.1862T>C	c.(1861-1863)tTt>tCt	p.F621S		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	621	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						CTTTCCATTTTTGGGAACCCA	0.483																																																0			X											53.0	48.0	50.0					X																	75650185		2203	4300	6503	75566589	SO:0001583	missense	57692			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.1862T>C	X.37:g.75650185T>C	ENSP00000354912:p.Phe621Ser	Somatic		Capture	Illumina GAIIx	4	75566589	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	HMMPfam_MAGE	p.F621S	ENST00000361470.2	37	c.1862	CCDS14433.1	X	.	.	.	.	.	.	.	.	.	.	T	5.610	0.297206	0.10622	.	.	ENSG00000198934	ENST00000361470	T	0.05996	3.36	2.13	0.855	0.19013	.	.	.	.	.	T	0.21145	0.0509	M	0.83118	2.625	0.09310	N	0.999999	D	0.76494	0.999	D	0.81914	0.995	T	0.06588	-1.0818	9	0.87932	D	0	.	4.4444	0.11589	0.0:0.0:0.3479:0.6521	.	621	Q9HCI5	MAGE1_HUMAN	S	621	ENSP00000354912:F621S	ENSP00000354912:F621S	F	+	2	0	MAGEE1	75566589	0.995000	0.38212	0.068000	0.19968	0.032000	0.12392	2.127000	0.42035	0.134000	0.18681	0.481000	0.45027	TTT	-	HMMPfam_MAGE		0.483	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	protein_coding	OTTHUMT00000057298.1	T	NM_020932		75566589	+1	no_errors	NM_020932	genbank	human	validated	54_36p	missense	SNP	0.947	C
C11orf30	56946	genome.wustl.edu	37	11	76257032	76257032	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:76257032G>T	ENST00000529032.1	+	19	3465	c.3465G>T	c.(3463-3465)atG>atT	p.M1155I	C11orf30_ENST00000524767.1_Missense_Mutation_p.M1170I|C11orf30_ENST00000533248.1_Missense_Mutation_p.M1064I|C11orf30_ENST00000525038.1_Missense_Mutation_p.M1156I|C11orf30_ENST00000524490.1_Missense_Mutation_p.M1057I|C11orf30_ENST00000343878.3_Intron|C11orf30_ENST00000525919.1_Missense_Mutation_p.M1156I|C11orf30_ENST00000334736.3_Missense_Mutation_p.M1155I			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	1155					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						TGTCTTTGATGGAAGCTCAGA	0.448																																																0			11											100.0	94.0	96.0					11																	76257032		2200	4292	6492	75934680	SO:0001583	missense	56946			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.3465G>T	11.37:g.76257032G>T	ENSP00000432327:p.Met1155Ile	Somatic		Capture	Illumina GAIIx	4	75934680	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	HMMPfam_ENT	p.M1155I	ENST00000529032.1	37	c.3465	CCDS8244.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.72|14.72	2.621036|2.621036	0.46736|0.46736	.|.	.|.	ENSG00000158636|ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032|ENST00000531793	.|.	.|.	.|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	0.038550|.	0.85682|.	D|.	0.000000|.	T|T	0.55955|0.55955	0.1953|0.1953	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	B;B;B;B;B;B|.	0.30281|.	0.275;0.007;0.007;0.017;0.007;0.017|.	B;B;B;B;B;B|.	0.29785|.	0.107;0.01;0.01;0.009;0.006;0.009|.	T|T	0.48980|0.48980	-0.8986|-0.8986	9|5	0.09590|.	T|.	0.72|.	-10.8083|-10.8083	19.3464|19.3464	0.94365|0.94365	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1064;1156;1170;1156;1057;1155|.	B7ZKT8;B7ZKU2;B7ZKU0;Q17RM7;E9PMC9;Q7Z589|.	.;.;.;.;.;EMSY_HUMAN|.	I|L	1057;1155;837;1170;1064;1156;1156;1155|14	.|.	ENSP00000334130:M1155I|.	M|W	+|+	3|2	0|0	C11orf30|C11orf30	75934680|75934680	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.823000|8.823000	0.92018|0.92018	2.793000|2.793000	0.96121|0.96121	0.650000|0.650000	0.86243|0.86243	ATG|TGG	-	NULL		0.448	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf30	protein_coding	OTTHUMT00000383288.2	G	NM_020193		75934680	+1	no_errors	NM_020193	genbank	human	validated	54_36p	missense	SNP	1.000	T
DTX2	113878	genome.wustl.edu	37	7	76134842	76134842	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr7:76134842A>T	ENST00000324432.5	+	12	2303	c.1793A>T	c.(1792-1794)gAc>gTc	p.D598V	DTX2_ENST00000430490.2_Missense_Mutation_p.D598V|DTX2_ENST00000446820.2_Missense_Mutation_p.D551V|DTX2_ENST00000307569.8_Missense_Mutation_p.D551V|DTX2_ENST00000413936.2_Missense_Mutation_p.D598V|DTX2_ENST00000446600.1_Missense_Mutation_p.D507V	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	598					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						GGCTATCCCGACCCCAACTAC	0.647																																																0			7											153.0	84.0	107.0					7																	76134842		2201	4298	6499	75972778	SO:0001583	missense	113878				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.1793A>T	7.37:g.76134842A>T	ENSP00000322885:p.Asp598Val	Somatic		Capture	Illumina GAIIx	4	75972778	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Missense_Mutation	SNP	HMMPfam_WWE,HMMSmart_SM00678,superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4	p.D598V	ENST00000324432.5	37	c.1793	CCDS5587.1	7	.	.	.	.	.	.	.	.	.	.	.	18.17	3.563371	0.65651	.	.	ENSG00000091073	ENST00000324432;ENST00000307569;ENST00000541989;ENST00000446600;ENST00000413936;ENST00000430490;ENST00000446820	T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.80221	0.4583	H	0.95539	3.685	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	1.0;0.995;1.0;0.999	D	0.86249	0.1648	10	0.87932	D	0	-37.0012	14.2506	0.66016	1.0:0.0:0.0:0.0	.	507;229;551;598	F5GX89;Q6P2H0;Q86UW9-2;Q86UW9	.;.;.;DTX2_HUMAN	V	598;551;507;507;598;598;551	ENSP00000322885:D598V;ENSP00000305242:D551V;ENSP00000397648:D507V;ENSP00000390218:D598V;ENSP00000411986:D598V;ENSP00000392545:D551V	ENSP00000305242:D551V	D	+	2	0	AC005522.1	75972778	1.000000	0.71417	0.989000	0.46669	0.235000	0.25334	9.087000	0.94110	2.151000	0.67156	0.529000	0.55759	GAC	-	NULL		0.647	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DTX2	protein_coding	OTTHUMT00000253104.2	A			75972778	+1	no_errors	NM_001102594	genbank	human	validated	54_36p	missense	SNP	1.000	T
ADNP2	22850	genome.wustl.edu	37	18	77894081	77894081	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr18:77894081A>G	ENST00000262198.4	+	4	1240	c.785A>G	c.(784-786)aAg>aGg	p.K262R		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	262					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		GGACTCTTGAAGCAAACGCAC	0.458																																																0			18											69.0	70.0	70.0					18																	77894081		2203	4300	6503	75995072	SO:0001583	missense	22850			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.785A>G	18.37:g.77894081A>G	ENSP00000262198:p.Lys262Arg	Somatic		Capture	Illumina GAIIx	4	75995072	A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_Homeodomain-like,HMMSmart_SM00389	p.K262R	ENST00000262198.4	37	c.785	CCDS32853.1	18	.	.	.	.	.	.	.	.	.	.	A	19.97	3.925385	0.73213	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.65	4.49	0.54785	.	0.077059	0.53938	D	0.000052	T	0.39462	0.1079	L	0.29908	0.895	0.30283	N	0.791081	P	0.45715	0.865	P	0.49665	0.618	T	0.32929	-0.9888	8	.	.	.	-28.9081	11.517	0.50526	0.9306:0.0:0.0694:0.0	.	262	Q6IQ32	ADNP2_HUMAN	R	262	.	.	K	+	2	0	ADNP2	75995072	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	6.303000	0.72794	1.149000	0.42402	0.533000	0.62120	AAG	-	NULL		0.458	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	protein_coding	OTTHUMT00000418979.1	A	NM_014913		75995072	+1	no_errors	NM_014913	genbank	human	validated	54_36p	missense	SNP	0.995	G
RPTOR	57521	genome.wustl.edu	37	17	78933951	78933951	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr17:78933951G>C	ENST00000306801.3	+	30	3913	c.3551G>C	c.(3550-3552)gGc>gCc	p.G1184A	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Missense_Mutation_p.G1026A|CTD-2561B21.3_ENST00000571591.1_RNA	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1184					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						ATCGTGGCTGGCCTCGGTGAC	0.622																																																0			17											127.0	86.0	100.0					17																	78933951		2203	4300	6503	76548546	SO:0001583	missense	57521				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3551G>C	17.37:g.78933951G>C	ENSP00000307272:p.Gly1184Ala	Somatic		Capture	Illumina GAIIx	4	76548546	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40	p.G1184A	ENST00000306801.3	37	c.3551	CCDS11773.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.212203	0.95069	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.35973	1.28;1.28	5.18	5.18	0.71444	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.66177	0.2763	M	0.86268	2.805	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.994;1.0	T	0.71738	-0.4502	10	0.62326	D	0.03	.	18.6796	0.91541	0.0:0.0:1.0:0.0	.	1026;1184	F5H7J5;Q8N122	.;RPTOR_HUMAN	A	1184;1026	ENSP00000307272:G1184A;ENSP00000442479:G1026A	ENSP00000307272:G1184A	G	+	2	0	RPTOR	76548546	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	9.225000	0.95219	2.418000	0.82041	0.462000	0.41574	GGC	-	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40		0.622	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1303	protein_coding	OTTHUMT00000438125.1	G	NM_020761		76548546	+1	no_errors	NM_020761	genbank	human	validated	54_36p	missense	SNP	1.000	C
IMPG1	3617	genome.wustl.edu	37	6	76715085	76715085	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:76715085C>G	ENST00000369950.3	-	10	1243	c.1054G>C	c.(1054-1056)Gct>Cct	p.A352P	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				AGGTCTGTAGCTGTGAGATAG	0.423																																					Pancreas(37;839 1141 2599 26037)											0			6											215.0	186.0	196.0					6																	76715085		2203	4300	6503	76771805	SO:0001583	missense	3617			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1054G>C	6.37:g.76715085C>G	ENSP00000358966:p.Ala352Pro	Somatic		Capture	Illumina GAIIx	4	76771805		Missense_Mutation	SNP	superfamily_SSF82671,HMMPfam_SEA,HMMSmart_SEA	p.A352P	ENST00000369950.3	37	c.1054	CCDS4985.1	6	.	.	.	.	.	.	.	.	.	.	C	11.62	1.693268	0.30052	.	.	ENSG00000112706	ENST00000369950	T	0.21734	1.99	5.83	-1.07	0.09968	.	0.764374	0.12121	N	0.497637	T	0.12008	0.0292	L	0.56769	1.78	0.09310	N	1	P	0.52692	0.955	P	0.52710	0.707	T	0.07986	-1.0744	10	0.42905	T	0.14	.	3.38	0.07251	0.1158:0.5214:0.1021:0.2607	.	352	Q17R60	IMPG1_HUMAN	P	352	ENSP00000358966:A352P	ENSP00000358966:A352P	A	-	1	0	IMPG1	76771805	0.015000	0.18098	0.007000	0.13788	0.020000	0.10135	0.051000	0.14141	-0.094000	0.12374	0.591000	0.81541	GCT	-	NULL		0.423	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG1	protein_coding	OTTHUMT00000041288.1	C	NM_001563		76771805	-1	no_errors	NM_001563	genbank	human	provisional	54_36p	missense	SNP	0.002	G
BRWD3	254065	genome.wustl.edu	37	X	79932616	79932616	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:79932616T>A	ENST00000373275.4	-	41	5117	c.4901A>T	c.(4900-4902)gAt>gTt	p.D1634V	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1634					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						ATCTACGTAATCTTGATCTGT	0.393																																																0			X											235.0	216.0	223.0					X																	79932616		2203	4300	6503	79819272	SO:0001583	missense	254065				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.4901A>T	X.37:g.79932616T>A	ENSP00000362372:p.Asp1634Val	Somatic		Capture	Illumina GAIIx	4	79819272	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	HMMSmart_SM00320,HMMPfam_WD40,superfamily_YVTN repeat-like/Quinoprotein amine dehydrogenase,PatternScan_WD_REPEATS_1,superfamily_Bromodomain,HMMSmart_SM00297,HMMPfam_Bromodomain	p.D1634V	ENST00000373275.4	37	c.4901	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	T	13.28	2.189479	0.38707	.	.	ENSG00000165288	ENST00000373275	T	0.75938	-0.98	4.43	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.68256	0.2981	N	0.08118	0	0.58432	D	0.999999	D	0.69078	0.997	P	0.60789	0.879	T	0.68368	-0.5427	9	.	.	.	-12.3016	13.0073	0.58712	0.0:0.0:0.0:1.0	.	1634	Q6RI45	BRWD3_HUMAN	V	1634	ENSP00000362372:D1634V	.	D	-	2	0	BRWD3	79819272	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.700000	0.68318	1.639000	0.50556	0.412000	0.27726	GAT	-	NULL		0.393	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	protein_coding	OTTHUMT00000057344.1	T	NM_153252		79819272	-1	no_errors	NM_153252	genbank	human	validated	54_36p	missense	SNP	1.000	A
ACSS3	79611	genome.wustl.edu	37	12	81647107	81647107	+	Missense_Mutation	SNP	G	G	C	rs182895257		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr12:81647107G>C	ENST00000548058.1	+	14	2651	c.1741G>C	c.(1741-1743)Gtg>Ctg	p.V581L	ACSS3_ENST00000548324.1_Missense_Mutation_p.V263L|ACSS3_ENST00000261206.3_Missense_Mutation_p.V580L			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	581						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						CCATGGTACCGTGGCAGACTG	0.378																																																0			12											228.0	221.0	223.0					12																	81647107		2203	4300	6503	80171238	SO:0001583	missense	79611				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1741G>C	12.37:g.81647107G>C	ENSP00000449535:p.Val581Leu	Somatic		Capture	Illumina GAIIx	4	80171238	Q8NC66	Missense_Mutation	SNP	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding,PatternScan_AMP_BINDING	p.V581L	ENST00000548058.1	37	c.1741	CCDS9022.1	12	.	.	.	.	.	.	.	.	.	.	G	17.90	3.501777	0.64298	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.71817	-0.6;-0.6;-0.6	6.0	6.0	0.97389	AMP-dependent synthetase/ligase (1);	0.127074	0.51477	N	0.000089	D	0.86818	0.6024	M	0.91406	3.205	0.58432	D	0.999996	B;D	0.57257	0.048;0.979	B;P	0.59056	0.023;0.851	D	0.88456	0.3052	10	0.72032	D	0.01	-18.1396	20.5555	0.99287	0.0:0.0:1.0:0.0	.	263;581	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	L	581;580;263	ENSP00000449535:V581L;ENSP00000261206:V580L;ENSP00000448965:V263L	ENSP00000261206:V580L	V	+	1	0	ACSS3	80171238	1.000000	0.71417	0.429000	0.26710	0.976000	0.68499	7.342000	0.79310	2.864000	0.98301	0.551000	0.68910	GTG	-	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding		0.378	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	protein_coding	OTTHUMT00000407794.1	G	NM_024560		80171238	+1	no_errors	NM_024560	genbank	human	validated	54_36p	missense	SNP	1.000	C
KRT18P24	340460	genome.wustl.edu	37	9	81652082	81652082	+	IGR	SNP	A	A	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr9:81652082A>T								PSAT1 (707073 upstream) : RP11-165H23.1 (98254 downstream)																							GTCTTTCTCCACAGACTGGTG	0.512																																																0			9																																								80841902	SO:0001628	intergenic_variant	340460																															9.37:g.81652082A>T		Somatic		Capture	Illumina GAIIx	4	80841902		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.512					KRT18P24			A			80841902	-1	pseudogene	XR_016865	genbank	human	model	54_36p	rna	SNP	1.000	T
SEL1L	6400	genome.wustl.edu	37	14	81994074	81994074	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr14:81994074C>T	ENST00000336735.4	-	2	195	c.79G>A	c.(79-81)Ggc>Agc	p.G27S	SEL1L_ENST00000555824.1_Missense_Mutation_p.G27S	NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	27	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		TCCTGGCTGCCTTCTTCATCT	0.299																																																0			14											97.0	89.0	92.0					14																	81994074		2203	4298	6501	81063827	SO:0001583	missense	6400				CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.79G>A	14.37:g.81994074C>T	ENSP00000337053:p.Gly27Ser	Somatic		Capture	Illumina GAIIx	4	81063827	Q6UWT6|Q9P1T9|Q9UHK7	Missense_Mutation	SNP	superfamily_Kringle-like,HMMSmart_SM00059,HMMPfam_fn2,PatternScan_FN2_1,HMMPfam_Sel1,HMMSmart_SM00671,superfamily_HCP-like	p.G27S	ENST00000336735.4	37	c.79	CCDS9876.1	14	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313870	0.40996	.	.	ENSG00000071537	ENST00000336735;ENST00000555824;ENST00000557372	T;T;T	0.41400	1.61;1.3;1.0	4.82	3.92	0.45320	.	0.239116	0.33217	N	0.005158	T	0.27765	0.0683	N	0.24115	0.695	0.26670	N	0.971741	B;B	0.10296	0.0;0.003	B;B	0.12156	0.001;0.007	T	0.15037	-1.0451	10	0.36615	T	0.2	.	9.7561	0.40504	0.0:0.8984:0.0:0.1016	.	27;27	Q9UBV2;Q9UBV2-2	SE1L1_HUMAN;.	S	27	ENSP00000337053:G27S;ENSP00000450709:G27S;ENSP00000451144:G27S	ENSP00000337053:G27S	G	-	1	0	SEL1L	81063827	0.676000	0.27567	0.962000	0.40283	0.998000	0.95712	0.751000	0.26348	1.092000	0.41356	0.585000	0.79938	GGC	-	NULL		0.299	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L	protein_coding	OTTHUMT00000413325.1	C	NM_005065		81063827	-1	no_errors	NM_005065	genbank	human	validated	54_36p	missense	SNP	0.989	T
CCDC90B	60492	genome.wustl.edu	37	11	82972977	82972977	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:82972977C>G	ENST00000529689.1	-	9	1175	c.741G>C	c.(739-741)ttG>ttC	p.L247F	CCDC90B_ENST00000525504.1_5'UTR|CCDC90B_ENST00000529073.1_3'UTR|CCDC90B_ENST00000455220.2_Missense_Mutation_p.L238F|CCDC90B_ENST00000525503.1_Missense_Mutation_p.L146F|CCDC90B_ENST00000529611.1_Missense_Mutation_p.L146F			Q9GZT6	CC90B_HUMAN	coiled-coil domain containing 90B	247						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Acute lymphoblastic leukemia(157;0.103)				TATAAAATCCCAATGCTATTG	0.373																																																0			11											138.0	150.0	146.0					11																	82972977		2203	4300	6503	82650625	SO:0001583	missense	60492			BC048795	CCDS8266.1, CCDS66190.1, CCDS66191.1	11q14.1	2006-10-23			ENSG00000137500	ENSG00000137500			28108	protein-coding gene	gene with protein product						11230166	Standard	XM_005274154		Approved	MDS025, MDS011	uc001pae.3	Q9GZT6	OTTHUMG00000167078	ENST00000529689.1:c.741G>C	11.37:g.82972977C>G	ENSP00000434724:p.Leu247Phe	Somatic		Capture	Illumina GAIIx	4	82650625	A8K8I4|B3KP87|B4E3L2|Q3B781|Q9GZU6	Missense_Mutation	SNP	HMMPfam_DUF1640	p.L247F	ENST00000529689.1	37	c.741	CCDS8266.1	11	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551212	0.86127	.	.	ENSG00000137500	ENST00000529689;ENST00000455220;ENST00000525503;ENST00000529611	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.39	5.39	0.77823	.	0.071068	0.56097	D	0.000026	D	0.82536	0.5058	M	0.89534	3.04	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.77004	0.956;0.989	D	0.85711	0.1319	9	.	.	.	-3.4065	15.8681	0.79080	0.0:1.0:0.0:0.0	.	238;247	Q9GZT6-2;Q9GZT6	.;CC90B_HUMAN	F	247;238;146;146	ENSP00000434724:L247F;ENSP00000390990:L238F;ENSP00000431424:L146F;ENSP00000431345:L146F	.	L	-	3	2	CCDC90B	82650625	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.817000	0.62650	2.538000	0.85594	0.655000	0.94253	TTG	-	HMMPfam_DUF1640		0.373	CCDC90B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC90B	protein_coding	OTTHUMT00000392940.2	C	NM_021825		82650625	-1	no_errors	NM_021825	genbank	human	provisional	54_36p	missense	SNP	1.000	G
CD8B	926	genome.wustl.edu	37	2	87042774	87042774	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr2:87042774T>C	ENST00000349455.3	-	5	647	c.598A>G	c.(598-600)Aca>Gca	p.T200A	CD8B_ENST00000393759.2_3'UTR|CD8B_ENST00000393761.2_Silent_p.L187L|CD8B_ENST00000331469.2_Missense_Mutation_p.T230A	NM_172102.3	NP_742100.1	P10966	CD8B_HUMAN	CD8b molecule	0					immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						TGTGAGGTTGTAGTATTGCTG	0.448																																																0			2											423.0	386.0	399.0					2																	87042774		2203	4300	6503	86896285	SO:0001583	missense	926				CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000349455.3:c.598A>G	2.37:g.87042774T>C	ENSP00000340592:p.Thr200Ala	Somatic		Capture	Illumina GAIIx	4	86896285	P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_V-set,HMMSmart_IG	p.T230A	ENST00000349455.3	37	c.688	CCDS1994.1	2	.	.	.	.	.	.	.	.	.	.	T	8.093	0.774882	0.16051	.	.	ENSG00000172116	ENST00000349455;ENST00000331469;ENST00000534926	.	.	.	2.0	-4.01	0.04045	.	.	.	.	.	T	0.25754	0.0627	.	.	.	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.13282	-1.0515	7	0.87932	D	0	.	1.3636	0.02197	0.1362:0.3419:0.2713:0.2506	.	200;230	P10966-3;P10966-6	.;.	A	200;230;38	.	ENSP00000331172:T230A	T	-	1	0	CD8B	86896285	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.328000	0.02680	-3.030000	0.00266	-0.709000	0.03644	ACA	-	NULL		0.448	CD8B-004	KNOWN	basic|CCDS	protein_coding	CD8B	protein_coding	OTTHUMT00000252594.1	T	NM_172099		86896285	-1	no_errors	NM_172213	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
PTPN21	11099	genome.wustl.edu	37	14	88945477	88945477	+	Silent	SNP	G	G	A	rs376146786		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr14:88945477G>A	ENST00000556564.1	-	13	2582	c.2298C>T	c.(2296-2298)gaC>gaT	p.D766D	PTPN21_ENST00000328736.3_Silent_p.D766D	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	766					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TCTTCTCCGCGTCTGGGACGT	0.726																																																0			14						G		0,4400		0,0,2200	35.0	31.0	32.0		2298	2.1	0.0	14		32	1,8595		0,1,4297	no	coding-synonymous	PTPN21	NM_007039.3		0,1,6497	AA,AG,GG		0.0116,0.0,0.0077		766/1175	88945477	1,12995	2200	4298	6498	88015230	SO:0001819	synonymous_variant	11099			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.2298C>T	14.37:g.88945477G>A		Somatic		Capture	Illumina GAIIx	4	88015230		Silent	SNP	HMMSmart_SM00295,superfamily_Ubiquitin-like,HMMPfam_FERM_N,PatternScan_FERM_1,superfamily_Second domain of FERM,HMMPfam_FERM_M,PatternScan_FERM_2,superfamily_PH domain-like,HMMPfam_FERM_C,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.D766	ENST00000556564.1	37	c.2298	CCDS9884.1	14																																																																																			-	NULL		0.726	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN21	protein_coding	OTTHUMT00000410303.1	G			88015230	-1	no_errors	NM_007039	genbank	human	reviewed	54_36p	silent	SNP	0.005	A
AFF1	4299	genome.wustl.edu	37	4	88026961	88026961	+	Splice_Site	SNP	C	C	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr4:88026961C>A	ENST00000307808.6	+	9	1739	c.1319C>A	c.(1318-1320)aCc>aAc	p.T440N	AFF1_ENST00000395146.4_Splice_Site_p.T447N|AFF1_ENST00000544085.1_Splice_Site_p.T78N	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	440					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AATGCCTAGACCCCAGAGAAG	0.428																																																0			4											230.0	219.0	223.0					4																	88026961		2203	4300	6503	88245985	SO:0001630	splice_region_variant	4299			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.1318-1C>A	4.37:g.88026961C>A		Somatic		Capture	Illumina GAIIx	4	88245985	B4DTU1|E9PBM3	Missense_Mutation	SNP	HMMPfam_AF-4	p.T440N	ENST00000307808.6	37	c.1319	CCDS3616.1	4	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747872	0.49257	.	.	ENSG00000172493	ENST00000395146;ENST00000541943;ENST00000307808;ENST00000511722;ENST00000544085;ENST00000514970	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	5.91	4.17	0.49024	.	0.800265	0.11631	N	0.544840	T	0.52901	0.1763	L	0.44542	1.39	0.28081	N	0.932181	B;B;B	0.31503	0.326;0.326;0.326	B;B;B	0.37650	0.255;0.255;0.255	T	0.47045	-0.9147	10	0.18710	T	0.47	-1.9435	5.3844	0.16211	0.0:0.5995:0.1791:0.2213	.	447;440;440	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	N	447;101;440;78;78;131	ENSP00000378578:T447N;ENSP00000305689:T440N;ENSP00000424766:T78N;ENSP00000440843:T78N;ENSP00000424881:T131N	ENSP00000305689:T440N	T	+	2	0	AFF1	88245985	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	1.051000	0.30417	1.484000	0.48361	0.655000	0.94253	ACC	-	HMMPfam_AF-4		0.428	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	protein_coding	OTTHUMT00000253053.3	C	NM_005935	Missense_Mutation	88245985	+1	no_errors	NM_005935	genbank	human	validated	54_36p	missense	SNP	0.328	A
Unknown	0	genome.wustl.edu	37	X	89294812	89294812	+	IGR	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:89294812C>T								TGIF2LX (116930 upstream) : RNU6-555P (557421 downstream)																							GTTGAATTTGCGCCAGGCAGC	0.418																																																0			X																																								89181468	SO:0001628	intergenic_variant	0																															X.37:g.89294812C>T		Somatic		Capture	Illumina GAIIx	4	89181468		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.418					LOC100130134			C			89181468	-1	pseudogene	XR_037810	genbank	human	model	54_36p	rna	SNP	0.917	T
Unknown	0	genome.wustl.edu	37	11	90016617	90016617	+	IGR	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:90016617C>T								CHORDC1 (60085 upstream) : AP002364.1 (41326 downstream)																							ACTCCCACATCCACTTCCCTC	0.502																																																0			11																																								89656265	SO:0001628	intergenic_variant	0																															11.37:g.90016617C>T		Somatic		Capture	Illumina GAIIx	4	89656265		Missense_Mutation	SNP	NULL	p.D45N		37	c.133		11																																																																																			-	NULL	0	0.502					LOC100131364			C			89656265	-1	no_errors	XM_001725122	genbank	human	model	54_36p	missense	SNP	1.000	T
DECR1	1666	genome.wustl.edu	37	8	91057177	91057177	+	Missense_Mutation	SNP	T	T	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr8:91057177T>G	ENST00000220764.2	+	8	927	c.839T>G	c.(838-840)cTt>cGt	p.L280R	DECR1_ENST00000522161.1_Missense_Mutation_p.L271R	NM_001359.1	NP_001350.1	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1, mitochondrial	280					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|NADPH binding (GO:0070402)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	15			BRCA - Breast invasive adenocarcinoma(11;0.00953)			CTCGCAAATCTTGCTGCTTTC	0.448																																																0			8											194.0	169.0	178.0					8																	91057177		2203	4300	6503	91126353	SO:0001583	missense	1666			L26050	CCDS6250.1	8q21.3	2011-09-14			ENSG00000104325	ENSG00000104325		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2753	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 18C, member 1"""	222745		DECR		7818482, 19027726	Standard	NM_001359		Approved	SDR18C1	uc003yek.1	Q16698	OTTHUMG00000163829	ENST00000220764.2:c.839T>G	8.37:g.91057177T>G	ENSP00000220764:p.Leu280Arg	Somatic		Capture	Illumina GAIIx	4	91126353	B7Z6B8|Q2M304|Q93085	Missense_Mutation	SNP	PatternScan_ADH_SHORT,superfamily_NAD(P)-bd,HMMPfam_adh_short	p.L280R	ENST00000220764.2	37	c.839	CCDS6250.1	8	.	.	.	.	.	.	.	.	.	.	T	27.6	4.846024	0.91277	.	.	ENSG00000104325	ENST00000220764;ENST00000522161	T;T	0.24723	1.84;1.84	5.9	5.9	0.94986	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.66528	0.2798	H	0.97103	3.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79063	-0.1957	10	0.87932	D	0	.	16.3291	0.83001	0.0:0.0:0.0:1.0	.	271;280	B7Z6B8;Q16698	.;DECR_HUMAN	R	280;271	ENSP00000220764:L280R;ENSP00000429779:L271R	ENSP00000220764:L280R	L	+	2	0	DECR1	91126353	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.608000	0.82898	2.257000	0.74773	0.528000	0.53228	CTT	-	superfamily_NAD(P)-bd		0.448	DECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DECR1	protein_coding	OTTHUMT00000375822.1	T			91126353	+1	no_errors	NM_001359	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
GPC5	2262	genome.wustl.edu	37	13	92408650	92408650	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr13:92408650G>A	ENST00000377067.3	+	5	1628	c.1256G>A	c.(1255-1257)tGg>tAg	p.W419*	GPC5_ENST00000483422.1_3'UTR	NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	419					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				CTTCCCTGCTGGAATGGAGAA	0.388																																																0			13											150.0	147.0	148.0					13																	92408650		2203	4299	6502	91206651	SO:0001587	stop_gained	2262			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1256G>A	13.37:g.92408650G>A	ENSP00000366267:p.Trp419*	Somatic		Capture	Illumina GAIIx	4	91206651	B2R726|O60436|Q9BX27	Nonsense_Mutation	SNP	HMMPfam_Glypican,PatternScan_GLYPICAN	p.W419*	ENST00000377067.3	37	c.1256	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	G	38	7.240022	0.98157	.	.	ENSG00000179399	ENST00000377067	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5874	15.7506	0.77983	0.0:0.0:1.0:0.0	.	.	.	.	X	419	.	ENSP00000366267:W419X	W	+	2	0	GPC5	91206651	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	7.383000	0.79741	2.490000	0.84030	0.543000	0.68304	TGG	-	HMMPfam_Glypican		0.388	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	protein_coding	OTTHUMT00000045454.1	G	NM_004466		91206651	+1	no_errors	NM_004466	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
PHF2	5253	genome.wustl.edu	37	9	96439081	96439081	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr9:96439081C>T	ENST00000359246.4	+	21	3405	c.3038C>T	c.(3037-3039)cCg>cTg	p.P1013L	PHF2_ENST00000375376.4_Missense_Mutation_p.P244L	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	1013	Ser/Thr-rich.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CCAGAGCCCCCGCCTGAGTCG	0.726																																																0			9											30.0	28.0	29.0					9																	96439081		2128	4154	6282	95478902	SO:0001583	missense	5253			AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.3038C>T	9.37:g.96439081C>T	ENSP00000352185:p.Pro1013Leu	Somatic		Capture	Illumina GAIIx	4	95478902	Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,PatternScan_ZF_PHD_1,superfamily_SSF51197,HMMSmart_JmjC,HMMPfam_JmjC	p.P1013L	ENST00000359246.4	37	c.3038	CCDS35069.1	9	.	.	.	.	.	.	.	.	.	.	C	8.898	0.955665	0.18507	.	.	ENSG00000197724	ENST00000359246;ENST00000375376	T;T	0.17213	2.3;2.29	5.18	0.598	0.17512	.	0.454821	0.17648	N	0.166783	T	0.06917	0.0176	N	0.08118	0	0.33100	D	0.539092	B	0.06786	0.001	B	0.04013	0.001	T	0.11251	-1.0595	10	0.49607	T	0.09	-3.398	3.5256	0.07759	0.3119:0.3308:0.0:0.3572	.	1013	O75151	PHF2_HUMAN	L	1013;244	ENSP00000352185:P1013L;ENSP00000364525:P244L	ENSP00000352185:P1013L	P	+	2	0	PHF2	95478902	0.147000	0.22687	0.288000	0.24862	0.294000	0.27393	0.670000	0.25157	0.173000	0.19788	0.650000	0.86243	CCG	-	NULL		0.726	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF2	protein_coding	OTTHUMT00000053162.1	C	NM_005392		95478902	+1	no_errors	NM_005392	genbank	human	reviewed	54_36p	missense	SNP	0.970	T
COPS6	10980	genome.wustl.edu	37	7	99689372	99689372	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr7:99689372G>A	ENST00000303904.3	+	10	981	c.944G>A	c.(943-945)cGa>cAa	p.R315Q	MIR25_ENST00000384816.1_RNA|MIR93_ENST00000385024.1_RNA|COPS6_ENST00000418625.1_Missense_Mutation_p.R314Q|MIR106B_ENST00000385301.1_RNA	NM_006833.4	NP_006824.2	Q7L5N1	CSN6_HUMAN	COP9 signalosome subunit 6	315	Interaction with Vpr.				cullin deneddylation (GO:0010388)|viral process (GO:0016032)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|stomach(1)	12	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			CTCTACGACCGACAAGGCATC	0.547											OREG0018195	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			7											148.0	127.0	134.0					7																	99689372		2203	4300	6503	99527308	SO:0001583	missense	10980			BC002520	CCDS5682.1	7q22.1	2013-03-14	2013-03-14		ENSG00000168090	ENSG00000168090			21749	protein-coding gene	gene with protein product	"""COP9 subunit 6 (MOV34 homolog, 34 kD)"""	614729	"""COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)"""			12477932	Standard	NM_006833		Approved	MOV34-34KD, CSN6	uc003usu.3	Q7L5N1	OTTHUMG00000154632	ENST00000303904.3:c.944G>A	7.37:g.99689372G>A	ENSP00000304102:p.Arg315Gln	Somatic	1345	Capture	Illumina GAIIx	4	99527308	A4D2A3|O15387	Missense_Mutation	SNP	HMMPfam_Mov34,HMMSmart_SM00232	p.R315Q	ENST00000303904.3	37	c.944	CCDS5682.1	7	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144861	0.77888	.	.	ENSG00000168090	ENST00000303904;ENST00000418625	T;T	0.48201	0.82;0.82	5.14	4.26	0.50523	.	0.070743	0.56097	D	0.000022	T	0.69424	0.3109	M	0.85542	2.76	0.54753	D	0.999985	D	0.89917	1.0	D	0.76575	0.988	T	0.74699	-0.3577	10	0.87932	D	0	-3.4225	11.4866	0.50356	0.0866:0.0:0.9134:0.0	.	315	Q7L5N1	CSN6_HUMAN	Q	315;314	ENSP00000304102:R315Q;ENSP00000400617:R314Q	ENSP00000304102:R315Q	R	+	2	0	COPS6	99527308	1.000000	0.71417	0.997000	0.53966	0.624000	0.37722	8.162000	0.89657	1.537000	0.49254	0.655000	0.94253	CGA	-	NULL		0.547	COPS6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COPS6	protein_coding	OTTHUMT00000336412.3	G	NM_006833		99527308	+1	no_errors	NM_006833	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
HEMGN	55363	genome.wustl.edu	37	9	100692514	100692514	+	Missense_Mutation	SNP	G	G	A	rs201229826		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr9:100692514G>A	ENST00000259456.3	-	4	1306	c.1163C>T	c.(1162-1164)aCa>aTa	p.T388I		NM_018437.3|NM_197978.2	NP_060907.2|NP_932095.1	Q9BXL5	HEMGN_HUMAN	hemogen	388					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				NS(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|skin(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(62;0.0559)				AAGCTGGGATGTTTCTTGGTA	0.378																																																0			9											178.0	190.0	186.0					9																	100692514		2203	4300	6503	99732335	SO:0001583	missense	55363			AF228713	CCDS6731.1	9q22.33	2014-01-21			ENSG00000136929	ENSG00000136929			17509	protein-coding gene	gene with protein product		610715					Standard	NM_018437		Approved	EDAG, CT155, NDR	uc004axy.4	Q9BXL5	OTTHUMG00000020336	ENST00000259456.3:c.1163C>T	9.37:g.100692514G>A	ENSP00000259456:p.Thr388Ile	Somatic		Capture	Illumina GAIIx	4	99732335	Q6XAR3|Q86XY5|Q9NPC0	Missense_Mutation	SNP	NULL	p.T388I	ENST00000259456.3	37	c.1163	CCDS6731.1	9	.	.	.	.	.	.	.	.	.	.	G	13.28	2.188703	0.38609	.	.	ENSG00000136929	ENST00000375112;ENST00000259456	.	.	.	4.32	2.45	0.29901	.	0.685951	0.11881	U	0.520528	T	0.28962	0.0719	L	0.53249	1.67	0.24758	N	0.992944	P	0.37955	0.612	B	0.35470	0.203	T	0.11743	-1.0575	9	0.30078	T	0.28	-0.2622	6.0847	0.19960	0.2302:0.0:0.7698:0.0	.	388	Q9BXL5	HEMGN_HUMAN	I	388	.	ENSP00000259456:T388I	T	-	2	0	HEMGN	99732335	0.010000	0.17322	0.906000	0.35671	0.352000	0.29268	-0.105000	0.10907	1.170000	0.42753	0.655000	0.94253	ACA	-	NULL		0.378	HEMGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEMGN	protein_coding	OTTHUMT00000053344.2	G	NM_197978		99732335	-1	no_errors	NM_018437	genbank	human	validated	54_36p	missense	SNP	0.797	A
RNF149	284996	genome.wustl.edu	37	2	101905450	101905450	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr2:101905450C>T	ENST00000295317.3	-	4	955	c.848G>A	c.(847-849)aGa>aAa	p.R283K		NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	283					cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						TGGCAGAATTCTAATAATATC	0.279																																					Colon(25;331 612 6521 7355 31028)											0			2											79.0	84.0	83.0					2																	101905450		2202	4298	6500	101271882	SO:0001583	missense	284996			AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.848G>A	2.37:g.101905450C>T	ENSP00000295317:p.Arg283Lys	Somatic		Capture	Illumina GAIIx	4	101271882	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	PatternScan_ZF_RING_1,superfamily_SSF52025,HMMPfam_PA,superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4	p.R283K	ENST00000295317.3	37	c.848	CCDS2051.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.289075	0.95517	.	.	ENSG00000163162	ENST00000295317	T	0.46063	0.88	5.08	5.08	0.68730	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.000000	0.64402	D	0.000001	T	0.61286	0.2335	L	0.49513	1.565	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.63959	-0.6519	10	0.87932	D	0	.	18.8669	0.92296	0.0:1.0:0.0:0.0	.	283	Q8NC42	RN149_HUMAN	K	283	ENSP00000295317:R283K	ENSP00000295317:R283K	R	-	2	0	RNF149	101271882	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.643000	0.67895	2.528000	0.85240	0.591000	0.81541	AGA	-	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4		0.279	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF149	protein_coding	OTTHUMT00000253180.2	C	NM_173647		101271882	-1	no_errors	NM_173647	genbank	human	provisional	54_36p	missense	SNP	1.000	T
Y_RNA	0	genome.wustl.edu	37	7	101979475	101979475	+	RNA	SNP	C	C	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr7:101979475C>A	ENST00000363682.1	+	0	102																											CCTACCCCCACCCCAGAGGGA	0.468																																																0			7																																								101766195			392713																															7.37:g.101979475C>A		Somatic		Capture	Illumina GAIIx	4	101766195		Missense_Mutation	SNP	superfamily_ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase	p.H114Q	ENST00000363682.1	37	c.342		7																																																																																			-	superfamily_ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase		0.468	Y_RNA.173-201	NOVEL	basic	misc_RNA	LOC392713	misc_RNA		C			101766195	+1	pseudogene	XM_001718158	genbank	human	model	54_36p	missense	SNP	0.986	A
NT5DC3	51559	genome.wustl.edu	37	12	104171610	104171610	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr12:104171610C>A	ENST00000392876.3	-	14	1684	c.1644G>T	c.(1642-1644)aaG>aaT	p.K548N		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	548						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						CCCTTGGCTACTTGGCCTGGG	0.567																																																0			12											52.0	57.0	56.0					12																	104171610		2203	4300	6503	102695740	SO:0001583	missense	51559			AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.1644G>T	12.37:g.104171610C>A	ENSP00000376615:p.Lys548Asn	Somatic		Capture	Illumina GAIIx	4	102695740	Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	superfamily_HAD-like,HMMPfam_5_nucleotid	p.K548N	ENST00000392876.3	37	c.1644	CCDS41824.1	12	.	.	.	.	.	.	.	.	.	.	C	14.26	2.483083	0.44147	.	.	ENSG00000111696	ENST00000392876	T	0.24350	1.86	5.8	3.97	0.46021	.	0.451004	0.23937	N	0.043089	T	0.12135	0.0295	N	0.08118	0	0.24481	N	0.994344	B	0.20671	0.047	B	0.16289	0.015	T	0.16837	-1.0389	10	0.87932	D	0	.	5.8623	0.18754	0.0:0.6671:0.16:0.1728	.	548	Q86UY8	NT5D3_HUMAN	N	548	ENSP00000376615:K548N	ENSP00000376615:K548N	K	-	3	2	NT5DC3	102695740	0.996000	0.38824	0.997000	0.53966	0.727000	0.41649	0.955000	0.29188	0.785000	0.33685	0.655000	0.94253	AAG	-	NULL		0.567	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5DC3	protein_coding	OTTHUMT00000347118.2	C	NM_016575		102695740	-1	no_errors	NM_001031701	genbank	human	validated	54_36p	missense	SNP	0.689	A
POU3F3	5455	genome.wustl.edu	37	2	105472801	105472801	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr2:105472801C>T	ENST00000361360.2	+	1	833	c.833C>T	c.(832-834)gCg>gTg	p.A278V	RP11-13J10.1_ENST00000598623.1_RNA	NM_006236.1	NP_006227.1	P20264	PO3F3_HUMAN	POU class 3 homeobox 3	278	Gly-rich.|His-rich.				central nervous system development (GO:0007417)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain ventricular zone progenitor cell division (GO:0021869)|metanephric ascending thin limb development (GO:0072218)|metanephric DCT cell differentiation (GO:0072240)|metanephric loop of Henle development (GO:0072236)|metanephric macula densa development (GO:0072227)|metanephric thick ascending limb development (GO:0072233)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						caccaccacGCGCATCCTCAC	0.781																																																0			2											2.0	2.0	2.0					2																	105472801		1279	2532	3811	104839233	SO:0001583	missense	5455				CCDS33265.1	2q12.1	2011-06-20	2007-07-13		ENSG00000198914	ENSG00000198914		"""Homeoboxes / POU class"""	9216	protein-coding gene	gene with protein product		602480	"""POU domain class 3, transcription factor 3"""				Standard	NM_006236		Approved	BRN1, OTF8	uc010ywg.2	P20264	OTTHUMG00000153067	ENST00000361360.2:c.833C>T	2.37:g.105472801C>T	ENSP00000355001:p.Ala278Val	Somatic		Capture	Illumina GAIIx	4	104839233	P78379|Q4ZG25	Missense_Mutation	SNP	HMMPfam_Pou,HMMSmart_POU,superfamily_Lambda_like_DNA,PatternScan_POU_1,PatternScan_POU_2,superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.A278V	ENST00000361360.2	37	c.833	CCDS33265.1	2	.	.	.	.	.	.	.	.	.	.	C	11.38	1.621021	0.28889	.	.	ENSG00000198914	ENST00000361360	D	0.83591	-1.74	2.8	2.8	0.32819	.	1.113020	0.07239	U	0.863978	T	0.71945	0.3400	N	0.22421	0.69	0.22066	N	0.999381	B	0.13145	0.007	B	0.10450	0.005	T	0.56098	-0.8035	10	0.21014	T	0.42	.	9.3099	0.37898	0.0:1.0:0.0:0.0	.	278	P20264	PO3F3_HUMAN	V	278	ENSP00000355001:A278V	ENSP00000355001:A278V	A	+	2	0	POU3F3	104839233	0.999000	0.42202	0.999000	0.59377	0.860000	0.49131	3.716000	0.54904	1.600000	0.50102	0.391000	0.25812	GCG	-	NULL		0.781	POU3F3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	POU3F3	protein_coding	OTTHUMT00000329335.2	C			104839233	+1	no_errors	NM_006236	genbank	human	provisional	54_36p	missense	SNP	1.000	T
RGPD3	653489	genome.wustl.edu	37	2	107040641	107040641	+	Missense_Mutation	SNP	T	T	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr2:107040641T>G	ENST00000409886.3	-	20	3869	c.3782A>C	c.(3781-3783)gAt>gCt	p.D1261A	RGPD3_ENST00000304514.7_Missense_Mutation_p.D1261A	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1261					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						ACTGACACTATCATCCAAAGC	0.433																																																0			2											35.0	30.0	32.0					2																	107040641		662	1519	2181	106407073	SO:0001583	missense	653489				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.3782A>C	2.37:g.107040641T>G	ENSP00000386588:p.Asp1261Ala	Somatic		Capture	Illumina GAIIx	4	106407073	B8ZZM4	Missense_Mutation	SNP	superfamily_SSF48452,HMMPfam_TPR_1,superfamily_SSF50729,HMMSmart_RanBD,HMMPfam_Ran_BP1,HMMPfam_GRIP,HMMSmart_Grip	p.D1261A	ENST00000409886.3	37	c.3782	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	2.947	-0.217517	0.06101	.	.	ENSG00000153165	ENST00000409886;ENST00000304514	T;T	0.39997	1.05;1.05	2.35	2.35	0.29111	.	.	.	.	.	T	0.34048	0.0884	L	0.29908	0.895	0.21579	N	0.99963	D	0.58970	0.984	P	0.50970	0.655	T	0.09662	-1.0664	9	0.25751	T	0.34	-9.3041	4.1458	0.10215	0.0:0.1765:0.0:0.8235	.	1261	A6NKT7	RGPD3_HUMAN	A	1261	ENSP00000386588:D1261A;ENSP00000303659:D1261A	ENSP00000303659:D1261A	D	-	2	0	RGPD3	106407073	1.000000	0.71417	0.974000	0.42286	0.201000	0.24016	3.882000	0.56160	1.080000	0.41073	0.156000	0.16432	GAT	-	NULL		0.433	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	protein_coding	OTTHUMT00000329975.1	T	XM_929931		106407073	-1	no_errors	ENST00000304514	ensembl	human	known	54_36p	missense	SNP	0.772	G
ZNF462	58499	genome.wustl.edu	37	9	109685767	109685767	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr9:109685767G>T	ENST00000277225.5	+	2	392	c.103G>T	c.(103-105)Gat>Tat	p.D35Y	RP11-508N12.4_ENST00000451160.2_Missense_Mutation_p.D35Y|ZNF462_ENST00000457913.1_Missense_Mutation_p.D35Y			Q96JM2	ZN462_HUMAN	zinc finger protein 462	35					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GCAGCCAACTGATGTTGCTGA	0.478																																																0			9											236.0	213.0	221.0					9																	109685767		2203	4300	6503	108725588	SO:0001583	missense	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.103G>T	9.37:g.109685767G>T	ENSP00000277225:p.Asp35Tyr	Somatic		Capture	Illumina GAIIx	4	108725588	Q5T0T4|Q8N408	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_beta-sandwich domain of Sec23/24	p.D35Y	ENST00000277225.5	37	c.103	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	G	16.11	3.029385	0.54790	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.10288	2.89;3.35	5.93	5.93	0.95920	.	0.047288	0.85682	D	0.000000	T	0.24160	0.0585	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	T	0.00773	-1.1572	10	0.87932	D	0	.	20.3437	0.98782	0.0:0.0:1.0:0.0	.	35	Q96JM2	ZN462_HUMAN	Y	35	ENSP00000277225:D35Y;ENSP00000414570:D35Y	ENSP00000277225:D35Y	D	+	1	0	ZNF462	108725588	1.000000	0.71417	0.976000	0.42696	0.900000	0.52787	9.434000	0.97515	2.815000	0.96918	0.561000	0.74099	GAT	-	NULL		0.478	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	protein_coding	OTTHUMT00000053532.2	G	NM_021224		108725588	+1	no_errors	NM_021224	genbank	human	validated	54_36p	missense	SNP	1.000	T
ATXN2	6311	genome.wustl.edu	37	12	111923092	111923092	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr12:111923092G>T	ENST00000377617.3	-	18	3142	c.2981C>A	c.(2980-2982)gCc>gAc	p.A994D	ATXN2_ENST00000389153.4_Missense_Mutation_p.A729D|ATXN2_ENST00000542287.2_Missense_Mutation_p.A729D|ATXN2_ENST00000535949.1_Missense_Mutation_p.A705D|ATXN2_ENST00000608853.1_Missense_Mutation_p.A834D|AC002395.1_ENST00000581907.1_RNA|ATXN2_ENST00000550104.1_Intron	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	994	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						ATATGTCTTGGCTTGATTCAC	0.348																																																0			12											226.0	210.0	216.0					12																	111923092		2203	4300	6503	110407475	SO:0001583	missense	6311			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.2981C>A	12.37:g.111923092G>T	ENSP00000366843:p.Ala994Asp	Somatic		Capture	Illumina GAIIx	4	110407475	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	superfamily_Sm-like ribonucleoproteins,HMMPfam_LsmAD,HMMPfam_PAM2	p.A994D	ENST00000377617.3	37	c.2981	CCDS31902.1	12	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703456	0.88924	.	.	ENSG00000204842	ENST00000389154;ENST00000389153;ENST00000377617;ENST00000542287;ENST00000535949	T	0.66638	-0.22	5.78	5.78	0.91487	.	0.105837	0.64402	D	0.000003	T	0.69314	0.3097	N	0.22421	0.69	0.80722	D	1	D;P;D;P	0.58268	0.979;0.816;0.982;0.952	P;B;P;P	0.57324	0.63;0.382;0.818;0.677	T	0.68021	-0.5519	10	0.38643	T	0.18	-9.3315	19.9987	0.97401	0.0:0.0:1.0:0.0	.	994;705;729;729	Q99700;Q24JQ7;F8VQP2;F8WB06	ATX2_HUMAN;.;.;.	D	47;729;994;729;705	ENSP00000366843:A994D	ENSP00000366843:A994D	A	-	2	0	ATXN2	110407475	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.650000	0.83521	2.738000	0.93877	0.591000	0.81541	GCC	-	NULL		0.348	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN2	protein_coding	OTTHUMT00000257351.3	G	NM_002973		110407475	-1	no_errors	NM_002973	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
LRRN3	54674	genome.wustl.edu	37	7	110762876	110762876	+	Silent	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr7:110762876C>T	ENST00000422987.3	+	2	879	c.48C>T	c.(46-48)atC>atT	p.I16I	IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|LRRN3_ENST00000451085.1_Silent_p.I16I|IMMP2L_ENST00000450877.1_Intron|LRRN3_ENST00000308478.5_Silent_p.I16I|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000415362.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	16					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		GCCTAGCTATCACTACACTAG	0.423																																																0			7											127.0	113.0	117.0					7																	110762876		2203	4300	6503	110550112	SO:0001819	synonymous_variant	54674			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.48C>T	7.37:g.110762876C>T		Somatic		Capture	Illumina GAIIx	4	110550112	O43377|Q6I9V8|Q8IYQ6	Silent	SNP	superfamily_L domain-like,HMMSmart_SM00013,HMMSmart_SM00365,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRCT,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_fn3,superfamily_Fibronectin type III	p.I16	ENST00000422987.3	37	c.48	CCDS5754.1	7																																																																																			-	NULL		0.423	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN3	protein_coding	OTTHUMT00000338171.2	C	NM_018334		110550112	+1	no_errors	NM_001099658	genbank	human	validated	54_36p	silent	SNP	1.000	T
ARHGEF7	8874	genome.wustl.edu	37	13	111953827	111953827	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr13:111953827G>T	ENST00000218789.5	+	20	2440	c.1943G>T	c.(1942-1944)aGt>aTt	p.S648I	ARHGEF7_ENST00000375736.4_Missense_Mutation_p.S589I|ARHGEF7_ENST00000375737.5_Missense_Mutation_p.S664I|ARHGEF7_ENST00000370623.3_Missense_Mutation_p.S674I|ARHGEF7_ENST00000426073.2_Missense_Mutation_p.S589I			Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	0					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			TGTTTCAGGAGTCTTGTGGAT	0.408																																																0			13											309.0	257.0	275.0					13																	111953827		2203	4300	6503	110751828	SO:0001583	missense	8874			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000218789.5:c.1943G>T	13.37:g.111953827G>T	ENSP00000218789:p.Ser648Ile	Somatic		Capture	Illumina GAIIx	4	110751828	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,superfamily_DH-domain,HMMPfam_RhoGEF,HMMSmart_RhoGEF,PatternScan_DH_1,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.S589I	ENST00000218789.5	37	c.1766		13	.	.	.	.	.	.	.	.	.	.	G	16.17	3.046702	0.55110	.	.	ENSG00000102606	ENST00000370623;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737	T;T;T;T;T	0.68765	-0.02;-0.35;0.0;0.0;-0.01	4.62	4.62	0.57501	.	.	.	.	.	T	0.79992	0.4542	M	0.73217	2.22	0.80722	D	1	D	0.63046	0.992	D	0.63192	0.912	T	0.83200	-0.0079	9	0.87932	D	0	.	17.9048	0.88915	0.0:0.0:1.0:0.0	.	664	B7Z6G2	.	I	674;648;589;589;664	ENSP00000359657:S674I;ENSP00000218789:S648I;ENSP00000364888:S589I;ENSP00000397068:S589I;ENSP00000364889:S664I	ENSP00000218789:S648I	S	+	2	0	ARHGEF7	110751828	1.000000	0.71417	0.990000	0.47175	0.101000	0.19017	8.829000	0.92055	2.306000	0.77630	0.555000	0.69702	AGT	-	NULL		0.408	ARHGEF7-001	NOVEL	basic	protein_coding	ARHGEF7	protein_coding	OTTHUMT00000045805.3	G	NM_001113511		110751828	+1	no_errors	NM_003899	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PTPN11	5781	genome.wustl.edu	37	12	112926907	112926907	+	Silent	SNP	A	A	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr12:112926907A>T	ENST00000351677.2	+	13	1725	c.1527A>T	c.(1525-1527)gcA>gcT	p.A509A		NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	513	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						AGACAGAAGCACAGTACCGAT	0.493			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																														Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	0			12											182.0	171.0	174.0					12																	112926907		2203	4300	6503	111411290	SO:0001819	synonymous_variant	5781	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.1527A>T	12.37:g.112926907A>T		Somatic		Capture	Illumina GAIIx	4	111411290	A8K1D9|Q96HD7	Silent	SNP	superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.A509	ENST00000351677.2	37	c.1527	CCDS9163.1	12																																																																																			-	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404		0.493	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN11	protein_coding	OTTHUMT00000259496.2	A			111411290	+1	no_errors	NM_002834	genbank	human	reviewed	54_36p	silent	SNP	0.868	T
ALPK1	80216	genome.wustl.edu	37	4	113303690	113303690	+	Silent	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr4:113303690C>T	ENST00000458497.1	+	4	537	c.258C>T	c.(256-258)gcC>gcT	p.A86A	ALPK1_ENST00000504176.2_Intron|ALPK1_ENST00000177648.9_Silent_p.A86A	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	86							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		TGATTGGCGCCGGGTTGCAGC	0.488																																																0			4											86.0	71.0	76.0					4																	113303690		2203	4300	6503	113523139	SO:0001819	synonymous_variant	80216			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.258C>T	4.37:g.113303690C>T		Somatic		Capture	Illumina GAIIx	4	113523139	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Silent	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00811,HMMPfam_Alpha_kinase	p.A86	ENST00000458497.1	37	c.258	CCDS3697.1	4																																																																																			-	NULL		0.488	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	protein_coding	OTTHUMT00000256421.2	C	NM_025144		113523139	+1	no_errors	NM_001102406	genbank	human	validated	54_36p	silent	SNP	0.988	T
HS3ST5	222537	genome.wustl.edu	37	6	114378544	114378544	+	Silent	SNP	C	C	T	rs143401516		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:114378544C>T	ENST00000312719.5	-	5	2106	c.918G>A	c.(916-918)gcG>gcA	p.A306A	RP3-399L15.3_ENST00000519104.1_RNA|HS3ST5_ENST00000411826.1_Silent_p.A306A|RP3-399L15.3_ENST00000519270.1_RNA|RP3-399L15.3_ENST00000523087.1_RNA			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	306					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		CCTTGCTGCCCGCCAGGCACT	0.398													C|||	1	0.000199681	0.0	0.0	5008	,	,		18154	0.0		0.001	False		,,,				2504	0.0															0			6						C		0,4406		0,0,2203	58.0	62.0	61.0		918	2.7	1.0	6	dbSNP_134	61	9,8591	7.1+/-27.0	0,9,4291	no	coding-synonymous	HS3ST5	NM_153612.3		0,9,6494	TT,TC,CC		0.1047,0.0,0.0692		306/347	114378544	9,12997	2203	4300	6503	114485237	SO:0001819	synonymous_variant	222537			AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.918G>A	6.37:g.114378544C>T		Somatic		Capture	Illumina GAIIx	4	114485237	A8K1J2|Q52LI2|Q8N285	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Sulfotransfer_1	p.A306	ENST00000312719.5	37	c.918	CCDS34517.1	6																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Sulfotransfer_1		0.398	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST5	protein_coding	OTTHUMT00000041911.2	C	NM_153612		114485237	-1	no_errors	NM_153612	genbank	human	validated	54_36p	silent	SNP	1.000	T
TNC	3371	genome.wustl.edu	37	9	117826306	117826306	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr9:117826306C>G	ENST00000350763.4	-	12	3940	c.3529G>C	c.(3529-3531)Ggc>Cgc	p.G1177R	TNC_ENST00000346706.3_Intron|TNC_ENST00000535648.1_Intron|TNC_ENST00000341037.4_Missense_Mutation_p.G1177R|TNC_ENST00000537320.1_Intron|TNC_ENST00000542877.1_Intron|TNC_ENST00000345230.3_Intron|TNC_ENST00000423613.2_Missense_Mutation_p.G1177R|TNC_ENST00000340094.3_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1177	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GCATCCCAGCCCACCTCGGCC	0.517																																																0			9											107.0	113.0	111.0					9																	117826306		2203	4300	6503	116866127	SO:0001583	missense	3371				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.3529G>C	9.37:g.117826306C>G	ENSP00000265131:p.Gly1177Arg	Somatic		Capture	Illumina GAIIx	4	116866127	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_EGF,HMMPfam_EGF_2,HMMPfam_EGF,HMMPfam_fn3,HMMSmart_FN3,superfamily_FN_III-like,HMMSmart_FBG,HMMPfam_Fibrinogen_C,superfamily_Fibrinogen_a/b/g_C	p.G1177R	ENST00000350763.4	37	c.3529	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	C	16.39	3.110943	0.56398	.	.	ENSG00000041982	ENST00000350763;ENST00000341037;ENST00000423613	T;T;T	0.04862	3.54;3.54;3.54	5.78	4.78	0.61160	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.239355	0.35903	N	0.002912	T	0.15349	0.0370	M	0.68593	2.085	0.80722	D	1	D;P	0.53151	0.958;0.775	P;P	0.58266	0.836;0.606	T	0.00084	-1.2099	10	0.54805	T	0.06	.	6.2747	0.20973	0.0:0.6568:0.1742:0.1691	.	1177;1177	E9PC84;P24821	.;TENA_HUMAN	R	1177	ENSP00000265131:G1177R;ENSP00000339553:G1177R;ENSP00000411406:G1177R	ENSP00000339553:G1177R	G	-	1	0	TNC	116866127	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	1.093000	0.30939	2.740000	0.93945	0.655000	0.94253	GGC	-	HMMPfam_fn3,HMMSmart_FN3,superfamily_FN_III-like		0.517	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	protein_coding	OTTHUMT00000055418.2	C	NM_002160		116866127	-1	no_errors	NM_002160	genbank	human	validated	54_36p	missense	SNP	0.996	G
RFC5	5985	genome.wustl.edu	37	12	118456889	118456889	+	Silent	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr12:118456889C>T	ENST00000454402.2	+	2	196	c.78C>T	c.(76-78)taC>taT	p.Y26Y	RFC5_ENST00000229043.3_5'UTR|RFC5_ENST00000392542.2_Silent_p.Y5Y	NM_001206801.1|NM_007370.5	NP_001193730.1|NP_031396.1	P40937	RFC5_HUMAN	replication factor C (activator 1) 5, 36.5kDa	26					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTGAAAAATACCGGCCACAGA	0.388																																																0			12											102.0	97.0	99.0					12																	118456889		2203	4300	6503	116941272	SO:0001819	synonymous_variant	5985				CCDS9185.1, CCDS41843.2	12q24.3	2010-04-21	2002-08-29		ENSG00000111445	ENSG00000111445		"""ATPases / AAA-type"""	9973	protein-coding gene	gene with protein product		600407	"""replication factor C (activator 1) 5 (36.5kD)"""			7774928	Standard	NM_007370		Approved	RFC36	uc001twq.3	P40937	OTTHUMG00000156438	ENST00000454402.2:c.78C>T	12.37:g.118456889C>T		Somatic		Capture	Illumina GAIIx	4	116941272	A8MZ62|B3KSX8	Silent	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA,HMMPfam_Rep_fac_C,superfamily_Pol_clamp_load_C	p.Y26	ENST00000454402.2	37	c.78	CCDS9185.1	12																																																																																			-	NULL		0.388	RFC5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC5	protein_coding	OTTHUMT00000344196.2	C	NM_007370		116941272	+1	no_errors	NM_007370	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
SPPL3	121665	genome.wustl.edu	37	12	121202821	121202821	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr12:121202821G>A	ENST00000353487.2	-	11	1639	c.1136C>T	c.(1135-1137)tCc>tTc	p.S379F		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	380	Poly-Ser.					Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)					all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CAGGAATCGGGAGCTGCTGGA	0.502																																																0			12											75.0	67.0	70.0					12																	121202821		2203	4300	6503	119687204	SO:0001583	missense	121665				CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.1136C>T	12.37:g.121202821G>A	ENSP00000288680:p.Ser379Phe	Somatic		Capture	Illumina GAIIx	4	119687204	Q3MJ04|Q8TAU4|Q96DD9	Missense_Mutation	SNP	HMMPfam_Peptidase_A22B,HMMSmart_SM00730	p.S379F	ENST00000353487.2	37	c.1136	CCDS9208.1	12	.	.	.	.	.	.	.	.	.	.	G	26.5	4.742959	0.89573	.	.	ENSG00000157837	ENST00000353487;ENST00000405631	T	0.18960	2.18	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.30230	0.0758	M	0.62723	1.935	0.80722	D	1	P;P	0.51653	0.859;0.947	B;B	0.43360	0.417;0.355	T	0.07539	-1.0767	10	0.66056	D	0.02	-13.7053	19.8195	0.96586	0.0:0.0:1.0:0.0	.	380;379	Q8TCT6;Q3MJ04	PSL4_HUMAN;.	F	379;378	ENSP00000288680:S379F	ENSP00000288680:S379F	S	-	2	0	AC069214.1	119687204	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.230000	0.95299	2.756000	0.94617	0.655000	0.94253	TCC	-	NULL		0.502	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL3	protein_coding	OTTHUMT00000402980.2	G	NM_139015		119687204	-1	no_errors	NM_139015	genbank	human	validated	54_36p	missense	SNP	1.000	A
HSD3B1	3283	genome.wustl.edu	37	1	120050202	120050202	+	Silent	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr1:120050202T>C	ENST00000369413.3	+	2	248	c.103T>C	c.(103-105)Ttg>Ctg	p.L35L	HSD3B1_ENST00000235547.6_Silent_p.L37L|HSD3B1_ENST00000528909.1_Silent_p.L35L			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	35					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	GATCAGGGTCTTGGACAAGGC	0.517																																																0			1											171.0	145.0	154.0					1																	120050202		2203	4300	6503	119851725	SO:0001819	synonymous_variant	3283			S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.103T>C	1.37:g.120050202T>C		Somatic		Capture	Illumina GAIIx	4	119851725	A8K691|Q14545|Q8IV65	Silent	SNP	superfamily_NAD(P)-bd,HMMPfam_3Beta_HSD	p.L35	ENST00000369413.3	37	c.103	CCDS903.1	1																																																																																			-	superfamily_NAD(P)-bd,HMMPfam_3Beta_HSD		0.517	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HSD3B1	protein_coding	OTTHUMT00000034993.3	T	NM_000862		119851725	+1	no_errors	NM_000862	genbank	human	validated	54_36p	silent	SNP	0.379	C
SORL1	6653	genome.wustl.edu	37	11	121348939	121348939	+	Missense_Mutation	SNP	C	C	G	rs201798962		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr11:121348939C>G	ENST00000260197.7	+	3	644	c.515C>G	c.(514-516)gCg>gGg	p.A172G	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	172					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CACAGCCCTGCGGACAACAAG	0.488																																																0			11											76.0	64.0	68.0					11																	121348939		2203	4299	6502	120854149	SO:0001583	missense	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.515C>G	11.37:g.121348939C>G	ENSP00000260197:p.Ala172Gly	Somatic		Capture	Illumina GAIIx	4	120854149	B2RNX7|Q92856	Missense_Mutation	SNP	superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase,HMMSmart_SM00602,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b,PatternScan_EGF_2,superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,PatternScan_COPPER_BLUE,superfamily_Fibronectin type III,HMMPfam_fn3,HMMSmart_SM00060	p.A172G	ENST00000260197.7	37	c.515	CCDS8436.1	11	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551387	0.65311	.	.	ENSG00000137642	ENST00000260197	T	0.30714	1.52	5.39	4.48	0.54585	VPS10 (1);	0.407399	0.26297	N	0.025188	T	0.31544	0.0800	L	0.54323	1.7	0.80722	D	1	P	0.42941	0.794	B	0.40534	0.332	T	0.07083	-1.0791	10	0.42905	T	0.14	.	13.7947	0.63164	0.0:0.9266:0.0:0.0734	.	172	Q92673	SORL_HUMAN	G	172	ENSP00000260197:A172G	ENSP00000260197:A172G	A	+	2	0	SORL1	120854149	0.979000	0.34478	0.571000	0.28486	0.988000	0.76386	2.534000	0.45676	1.273000	0.44346	0.551000	0.68910	GCG	-	superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase,HMMSmart_SM00602		0.488	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	protein_coding	OTTHUMT00000387626.2	C	NM_003105		120854149	+1	no_errors	NM_003105	genbank	human	reviewed	54_36p	missense	SNP	0.902	G
SLC41A3	54946	genome.wustl.edu	37	3	125726056	125726056	+	Silent	SNP	G	G	A	rs371601677		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr3:125726056G>A	ENST00000315891.6	-	11	1505	c.1267C>T	c.(1267-1269)Ctg>Ttg	p.L423L	SLC41A3_ENST00000346785.5_Silent_p.L387L|SLC41A3_ENST00000383598.2_Silent_p.L397L|SLC41A3_ENST00000360370.4_Silent_p.L423L|SLC41A3_ENST00000508835.1_Silent_p.L306L	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	423						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		GCGAGGTACAGCAGGATTGTC	0.547																																																0			3											59.0	55.0	56.0					3																	125726056		2203	4300	6503	127208746	SO:0001819	synonymous_variant	54946				CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.1267C>T	3.37:g.125726056G>A		Somatic		Capture	Illumina GAIIx	4	127208746	A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Silent	SNP	HMMPfam_MgtE,PatternScan_PEROXIDASE_2	p.L423	ENST00000315891.6	37	c.1267	CCDS33843.1	3																																																																																			-	NULL		0.547	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	SLC41A3	protein_coding	OTTHUMT00000370886.1	G	NM_017836		127208746	-1	no_errors	NM_001008485	genbank	human	validated	54_36p	silent	SNP	0.996	A
BIN1	274	genome.wustl.edu	37	2	127825762	127825762	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr2:127825762G>C	ENST00000316724.5	-	7	1000	c.589C>G	c.(589-591)Caa>Gaa	p.Q197E	BIN1_ENST00000351659.3_Missense_Mutation_p.Q197E|BIN1_ENST00000357970.3_Missense_Mutation_p.Q197E|BIN1_ENST00000376113.2_Intron|BIN1_ENST00000259238.4_Intron|BIN1_ENST00000393040.3_Intron|BIN1_ENST00000346226.3_Intron|BIN1_ENST00000348750.4_Intron|BIN1_ENST00000352848.3_Intron|BIN1_ENST00000409400.1_Intron|BIN1_ENST00000393041.3_Intron	NM_139343.2	NP_647593.1	O00499	BIN1_HUMAN	bridging integrator 1	197	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|lipid tube assembly (GO:0060988)|muscle cell differentiation (GO:0042692)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of endocytosis (GO:0045807)|positive regulation of GTPase activity (GO:0043547)|regulation of cell cycle arrest (GO:0071156)|regulation of neuron differentiation (GO:0045664)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon initial segment (GO:0043194)|axon terminus (GO:0043679)|cerebellar mossy fiber (GO:0044300)|cytoplasm (GO:0005737)|I band (GO:0031674)|lipid tube (GO:0060987)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)|T-tubule (GO:0030315)|varicosity (GO:0043196)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|tau protein binding (GO:0048156)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)	24	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		AGGTTAGTTTGAGCTACGAGA	0.597											OREG0014963	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			2											115.0	92.0	100.0					2																	127825762		2203	4300	6503	127542232	SO:0001583	missense	274			U68485	CCDS2137.1, CCDS2138.1, CCDS2139.1, CCDS2140.1, CCDS2141.1, CCDS2142.1, CCDS2143.1, CCDS42743.1, CCDS42744.1, CCDS46403.1	2q14	2014-09-17			ENSG00000136717	ENSG00000136717			1052	protein-coding gene	gene with protein product	"""amphiphysin II"""	601248		AMPHL		8725406, 8782822, 17676042	Standard	NM_004305		Approved	SH3P9, AMPH2	uc002tns.2	O00499	OTTHUMG00000131465	ENST00000316724.5:c.589C>G	2.37:g.127825762G>C	ENSP00000316779:p.Gln197Glu	Somatic	1560	Capture	Illumina GAIIx	4	127542232	O00297|O00545|O43867|O60552|O60553|O60554|O60555|O75514|O75515|O75516|O75517|O75518|Q659B7|Q92944|Q99688	Missense_Mutation	SNP	HMMSmart_SM00721,HMMPfam_BAR,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326	p.Q197E	ENST00000316724.5	37	c.589	CCDS2138.1	2	.	.	.	.	.	.	.	.	.	.	.	25.9	4.680549	0.88542	.	.	ENSG00000136717	ENST00000357970;ENST00000351659;ENST00000316724	T;T;T	0.64438	-0.1;0.55;-0.09	4.87	4.87	0.63330	BAR (3);	0.331495	0.26867	N	0.022091	T	0.72112	0.3420	L	0.40543	1.245	0.80722	D	1	D;D;D;P	0.67145	0.983;0.996;0.996;0.79	D;P;D;P	0.76071	0.938;0.895;0.987;0.535	T	0.72472	-0.4283	10	0.48119	T	0.1	-8.9474	16.9534	0.86251	0.0:0.0:1.0:0.0	.	197;197;197;197	B7Z2Z2;O00499-3;O00499-5;O00499	.;.;.;BIN1_HUMAN	E	197	ENSP00000350654:Q197E;ENSP00000315388:Q197E;ENSP00000316779:Q197E	ENSP00000316779:Q197E	Q	-	1	0	BIN1	127542232	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.437000	0.90302	2.532000	0.85374	0.549000	0.68633	CAA	-	HMMSmart_SM00721,HMMPfam_BAR		0.597	BIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIN1	protein_coding	OTTHUMT00000254298.2	G	NM_139343		127542232	-1	no_errors	NM_139343	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
XPNPEP2	7512	genome.wustl.edu	37	X	128901659	128901659	+	Silent	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:128901659T>C	ENST00000371106.3	+	20	2013	c.1821T>C	c.(1819-1821)tcT>tcC	p.S607S		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	607						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						GCCTGCTGTCTCCCGAGCATG	0.582																																																0			X											239.0	159.0	187.0					X																	128901659		2203	4300	6503	128729340	SO:0001819	synonymous_variant	7512			U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1821T>C	X.37:g.128901659T>C		Somatic		Capture	Illumina GAIIx	4	128729340	A0AV16|O75994	Silent	SNP	superfamily_SSF53092,HMMPfam_Creatinase_N,superfamily_Peptidase_M24_cat_core,HMMPfam_Peptidase_M24,PatternScan_PROLINE_PEPTIDASE	p.S607	ENST00000371106.3	37	c.1821	CCDS14613.1	X																																																																																			-	superfamily_Peptidase_M24_cat_core		0.582	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP2	protein_coding	OTTHUMT00000058210.1	T	NM_003399		128729340	+1	no_errors	NM_003399	genbank	human	reviewed	54_36p	silent	SNP	0.547	C
Unknown	0	genome.wustl.edu	37	3	128567083	128567083	+	IGR	SNP	G	G	C	rs75754370	byFrequency	TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr3:128567083G>C								RAB7A (33444 upstream) : RP11-723O4.9 (11475 downstream)																							TGGAGGGAGAGGCCATGGAGT	0.602													G|||	584	0.116613	0.112	0.1354	5008	,	,		15260	0.0575		0.1461	False		,,,				2504	0.1401															0			3																																								130049773	SO:0001628	intergenic_variant	0																															3.37:g.128567083G>C		Somatic		Capture	Illumina GAIIx	4	130049773		Silent	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST,superfamily_Kinase associated domain 1 KA1	p.A439		37	c.1317		3																																																																																			-	HMMSmart_SM00220	0	0.602					LOC100128615			G			130049773	-1	no_errors	XM_001717892	genbank	human	model	54_36p	silent	SNP	0.021	C
SAMD3	154075	genome.wustl.edu	37	6	130536361	130536361	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:130536361C>A	ENST00000368134.2	-	5	666	c.58G>T	c.(58-60)Gag>Tag	p.E20*	SAMD3_ENST00000457563.2_Nonsense_Mutation_p.E44*|SAMD3_ENST00000437477.2_Nonsense_Mutation_p.E20*|SAMD3_ENST00000324172.6_Nonsense_Mutation_p.E20*|SAMD3_ENST00000533296.1_5'UTR|SAMD3_ENST00000532763.1_Nonsense_Mutation_p.E20*|SAMD3_ENST00000439090.2_Nonsense_Mutation_p.E20*	NM_001258275.1	NP_001245204.1	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3	20	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.									breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(15)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	29				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		TGAACTAGCTCTCCTAAATTT	0.393																																																0			6											101.0	101.0	101.0					6																	130536361		2203	4300	6503	130578054	SO:0001587	stop_gained	154075			AK091351	CCDS34539.1, CCDS64525.1	6q23.1	2013-01-10			ENSG00000164483	ENSG00000164483		"""Sterile alpha motif (SAM) domain containing"""	21574	protein-coding gene	gene with protein product							Standard	NM_001017373		Approved	bA73O6.2, FLJ34032	uc031spp.1	Q8N6K7	OTTHUMG00000015556	ENST00000368134.2:c.58G>T	6.37:g.130536361C>A	ENSP00000357116:p.Glu20*	Somatic		Capture	Illumina GAIIx	4	130578054	B4DY20|E1P576|J3KQK4|Q4VXD8|Q8NAY1|Q8NB96	Nonsense_Mutation	SNP	superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_1	p.E20*	ENST00000368134.2	37	c.58	CCDS34539.1	6	.	.	.	.	.	.	.	.	.	.	C	38	7.032559	0.98017	.	.	ENSG00000164483	ENST00000368134;ENST00000457563;ENST00000439090;ENST00000437477;ENST00000532763;ENST00000324172;ENST00000532309;ENST00000531544;ENST00000529723	.	.	.	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.4605	0.90736	0.0:1.0:0.0:0.0	.	.	.	.	X	20;44;20;20;20;20;20;20;20	.	ENSP00000324874:E20X	E	-	1	0	SAMD3	130578054	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.038000	0.64177	2.800000	0.96347	0.643000	0.83706	GAG	-	superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_1		0.393	SAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD3	protein_coding	OTTHUMT00000042197.3	C	NM_152552		130578054	-1	no_errors	NM_001017373	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
ATP2C1	27032	genome.wustl.edu	37	3	130682849	130682849	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr3:130682849A>T	ENST00000510168.1	+	13	1484	c.934A>T	c.(934-936)Att>Ttt	p.I312F	ATP2C1_ENST00000513801.1_Missense_Mutation_p.I296F|ATP2C1_ENST00000505330.1_Missense_Mutation_p.I296F|ATP2C1_ENST00000428331.2_Missense_Mutation_p.I312F|ATP2C1_ENST00000393221.4_Missense_Mutation_p.I346F|ATP2C1_ENST00000533801.2_Missense_Mutation_p.I307F|ATP2C1_ENST00000504948.1_Missense_Mutation_p.I296F|ATP2C1_ENST00000422190.2_Missense_Mutation_p.I312F|ATP2C1_ENST00000504381.1_Missense_Mutation_p.I257F|ATP2C1_ENST00000359644.3_Missense_Mutation_p.I312F|ATP2C1_ENST00000507488.2_Missense_Mutation_p.I296F|ATP2C1_ENST00000328560.8_Missense_Mutation_p.I312F|ATP2C1_ENST00000508532.1_Missense_Mutation_p.I312F			P98194	AT2C1_HUMAN	ATPase, Ca++ transporting, type 2C, member 1	312					actin cytoskeleton reorganization (GO:0031532)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cellular calcium ion homeostasis (GO:0006874)|cellular manganese ion homeostasis (GO:0030026)|epidermis development (GO:0008544)|Golgi calcium ion homeostasis (GO:0032468)|Golgi calcium ion transport (GO:0032472)|ion transmembrane transport (GO:0034220)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|manganese ion binding (GO:0030145)|manganese-transporting ATPase activity (GO:0015410)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|prostate(2)|skin(2)|urinary_tract(1)	39					Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AGGTCTCCCCATTGTGGTCAC	0.398									Hailey-Hailey disease																												Esophageal Squamous(99;456 1443 27647 34099 42636)											0			3											189.0	181.0	184.0					3																	130682849		2203	4300	6503	132165539	SO:0001583	missense	27032	Familial Cancer Database	HHD, Familial Benign Chronic Pemphigus, Benign Familial Pemphigus	AF181120	CCDS33856.1, CCDS46912.1, CCDS46913.1, CCDS46914.1, CCDS56278.1, CCDS56279.1, CCDS56280.1, CCDS56281.1, CCDS75006.1	3q21.3	2012-10-22			ENSG00000017260	ENSG00000017260	3.6.3.8	"""ATPases / P-type"""	13211	protein-coding gene	gene with protein product	"""secretory pathway Ca2+/Mn2+ ATPase 1"", ""calcium-transporting ATPase type 2C member 1"""	604384	"""benign chronic pemphigus (Hailey-Hailey disease)"""	BCPM		10615129, 10767338	Standard	NM_001001485		Approved	KIAA1347, ATP2C1A, PMR1, SPCA1	uc011bli.2	P98194	OTTHUMG00000136802	ENST00000510168.1:c.934A>T	3.37:g.130682849A>T	ENSP00000427461:p.Ile312Phe	Somatic		Capture	Illumina GAIIx	4	132165539	B2RAT7|B4DSW3|B7Z3X9|G3XAH8|G8JLN9|O76005|Q86V72|Q86V73|Q8N6V1|Q8NCJ7	Missense_Mutation	SNP	HMMPfam_Cation_ATPase_N,superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Cation_ATPase_C	p.I312F	ENST00000510168.1	37	c.934	CCDS46914.1	3	.	.	.	.	.	.	.	.	.	.	A	23.1	4.374528	0.82573	.	.	ENSG00000017260	ENST00000505330;ENST00000504381;ENST00000507488;ENST00000393221;ENST00000533801;ENST00000510168;ENST00000508532;ENST00000504948;ENST00000513801;ENST00000328560;ENST00000428331;ENST00000359644;ENST00000422190;ENST00000347421;ENST00000515854	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91295	-2.82;-2.82;-2.82;-2.82;-2.82;-2.82;-2.82;-2.82;-2.82;-2.82;-2.82;-2.82;-2.82;-2.82	5.85	3.46	0.39613	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.94984	0.8377	M	0.86343	2.81	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.999;0.999;0.998;0.999;0.998;0.999;0.999	D;D;D;D;D;D;D	0.81914	0.988;0.993;0.995;0.988;0.995;0.988;0.993	D	0.93883	0.7173	10	0.62326	D	0.03	.	10.1213	0.42623	0.8645:0.0:0.1355:0.0	.	346;307;346;312;346;312;312	G3XAH8;B4DSW3;B4E2Q0;P98194-5;B7Z3X9;P98194-2;P98194	.;.;.;.;.;.;AT2C1_HUMAN	F	296;257;296;346;307;312;312;296;296;312;312;312;312;311;51	ENSP00000423774:I296F;ENSP00000425320:I257F;ENSP00000421326:I296F;ENSP00000376914:I346F;ENSP00000432956:I307F;ENSP00000427461:I312F;ENSP00000424783:I312F;ENSP00000423330:I296F;ENSP00000422872:I296F;ENSP00000329664:I312F;ENSP00000395809:I312F;ENSP00000352665:I312F;ENSP00000402677:I312F;ENSP00000422890:I51F	ENSP00000329664:I312F	I	+	1	0	ATP2C1	132165539	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	8.962000	0.93254	0.475000	0.27415	0.402000	0.26972	ATT	-	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase		0.398	ATP2C1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATP2C1	protein_coding	OTTHUMT00000356648.2	A	NM_001001486		132165539	+1	no_errors	NM_001001486	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
NACC2	138151	genome.wustl.edu	37	9	138903816	138903816	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr9:138903816G>T	ENST00000371753.1	-	5	1368	c.1310C>A	c.(1309-1311)gCc>gAc	p.A437D	NACC2_ENST00000277554.2_Missense_Mutation_p.A437D			Q96BF6	NACC2_HUMAN	NACC family member 2, BEN and BTB (POZ) domain containing	437	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.				cellular protein complex localization (GO:0034629)|histone deacetylation (GO:0016575)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle by negative regulation of transcription from RNA polymerase II promoter (GO:1900477)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|posttranscriptional regulation of gene expression (GO:0010608)|protein homooligomerization (GO:0051260)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)			endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5						CATGTCCGCGGCGATCACGTT	0.647																																																0			9											44.0	37.0	39.0					9																	138903816		2201	4297	6498	138043637	SO:0001583	missense	138151			BC015649	CCDS6993.1	9q34.3	2013-01-09	2008-10-03	2008-10-03	ENSG00000148411	ENSG00000148411		"""BEN domain containing"", ""BTB/POZ domain containing"""	23846	protein-coding gene	gene with protein product	"""BEN domain containing 9"""	615786	"""BTB (POZ) domain containing 14A"""	BTBD14A		12477932	Standard	NM_144653		Approved	MGC23427, BEND9, BTBD31	uc004cgv.4	Q96BF6	OTTHUMG00000020921	ENST00000371753.1:c.1310C>A	9.37:g.138903816G>T	ENSP00000360818:p.Ala437Asp	Somatic		Capture	Illumina GAIIx	4	138043637		Missense_Mutation	SNP	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB,HMMPfam_BEN	p.A437D	ENST00000371753.1	37	c.1310	CCDS6993.1	9	.	.	.	.	.	.	.	.	.	.	G	31	5.093357	0.94149	.	.	ENSG00000148411	ENST00000371753;ENST00000277554	T;T	0.46819	0.86;0.86	5.23	5.23	0.72850	BEN domain (2);	0.000000	0.85682	D	0.000000	T	0.57272	0.2042	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63019	-0.6730	10	0.87932	D	0	.	17.7707	0.88491	0.0:0.0:1.0:0.0	.	437	Q96BF6	NACC2_HUMAN	D	437	ENSP00000360818:A437D;ENSP00000277554:A437D	ENSP00000277554:A437D	A	-	2	0	NACC2	138043637	1.000000	0.71417	0.498000	0.27564	0.925000	0.55904	9.611000	0.98342	2.432000	0.82394	0.313000	0.20887	GCC	-	HMMPfam_BEN		0.647	NACC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACC2	protein_coding	OTTHUMT00000055040.1	G	NM_144653		138043637	-1	no_errors	NM_144653	genbank	human	validated	54_36p	missense	SNP	0.987	T
ESYT3	83850	genome.wustl.edu	37	3	138174076	138174076	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr3:138174076A>G	ENST00000389567.4	+	3	596	c.410A>G	c.(409-411)gAa>gGa	p.E137G	ESYT3_ENST00000289135.4_Missense_Mutation_p.E137G	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	137	Glycerophospholipid-binding barrel-like domain. {ECO:0000250}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						ATGATCATGGAAAGCAAGTTC	0.522																																																0			3											145.0	139.0	141.0					3																	138174076		2203	4300	6503	139656766	SO:0001583	missense	83850			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.410A>G	3.37:g.138174076A>G	ENSP00000374218:p.Glu137Gly	Somatic		Capture	Illumina GAIIx	4	139656766	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.E137G	ENST00000389567.4	37	c.410	CCDS3101.2	3	.	.	.	.	.	.	.	.	.	.	A	23.6	4.436862	0.83885	.	.	ENSG00000158220	ENST00000389567;ENST00000289135	D;D	0.91996	-2.95;-2.95	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.95875	0.8657	M	0.81497	2.545	0.58432	D	0.999991	D	0.89917	1.0	D	0.83275	0.996	D	0.96169	0.9121	10	0.66056	D	0.02	-9.0989	13.9228	0.63942	1.0:0.0:0.0:0.0	.	137	A0FGR9	ESYT3_HUMAN	G	137	ENSP00000374218:E137G;ENSP00000289135:E137G	ENSP00000289135:E137G	E	+	2	0	ESYT3	139656766	1.000000	0.71417	0.959000	0.39883	0.764000	0.43329	7.634000	0.83273	2.180000	0.69256	0.379000	0.24179	GAA	-	NULL		0.522	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM62C	protein_coding	OTTHUMT00000303993.1	A	NM_031913		139656766	+1	no_errors	NM_031913	genbank	human	validated	54_36p	missense	SNP	1.000	G
EHMT1	79813	genome.wustl.edu	37	9	140707940	140707940	+	Silent	SNP	G	G	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr9:140707940G>C	ENST00000460843.1	+	21	3165	c.3138G>C	c.(3136-3138)gtG>gtC	p.V1046V		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1046					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		AGAACTGCGTGACGTCCCCCA	0.572																																																0			9											143.0	91.0	109.0					9																	140707940		2203	4300	6503	139827761	SO:0001819	synonymous_variant	79813			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3138G>C	9.37:g.140707940G>C		Somatic		Capture	Illumina GAIIx	4	139827761	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Silent	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,superfamily_SET domain,HMMSmart_SM00468,HMMPfam_Pre-SET,HMMPfam_SET,HMMSmart_SM00317	p.V1015	ENST00000460843.1	37	c.3045	CCDS7050.2	9																																																																																			-	superfamily_SET domain,HMMSmart_SM00468,HMMPfam_Pre-SET		0.572	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	protein_coding	OTTHUMT00000055371.2	G	NM_024757		139827761	+1	no_errors	NM_024757	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
PIK3CB	5291	genome.wustl.edu	37	3	138413688	138413688	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr3:138413688T>A	ENST00000477593.1	-	13	1905	c.1832A>T	c.(1831-1833)gAt>gTt	p.D611V	PIK3CB_ENST00000289153.2_Missense_Mutation_p.D611V|PIK3CB_ENST00000544716.1_Missense_Mutation_p.D57V			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	611	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	ATAGTTGAAATCCAGAAGCTC	0.488																																																0			3											65.0	72.0	70.0					3																	138413688		2203	4300	6503	139896378	SO:0001583	missense	5291				CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.1832A>T	3.37:g.138413688T>A	ENSP00000418143:p.Asp611Val	Somatic		Capture	Illumina GAIIx	4	139896378	D3DNF0|Q24JU2	Missense_Mutation	SNP	HMMPfam_PI3K_p85B,HMMSmart_PI3K_p85B,superfamily_SSF54236,HMMPfam_PI3K_rbd,HMMSmart_PI3K_rbd,HMMSmart_PI3K_C2,superfamily_C2_CaLB,HMMPfam_PI3K_C2,superfamily_ARM-type_fold,HMMSmart_PI3Ka,HMMPfam_PI3Ka,superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2	p.D611V	ENST00000477593.1	37	c.1832	CCDS3104.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.8|25.8	4.671520|4.671520	0.88348|0.88348	.|.	.|.	ENSG00000051382|ENSG00000051382	ENST00000477593;ENST00000544716;ENST00000289153|ENST00000493568	T;T;T|.	0.66638|.	-0.22;-0.22;-0.22|.	6.17|6.17	6.17|6.17	0.99709|0.99709	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86096|0.86096	0.5851|0.5851	M|M	0.92691|0.92691	3.335|3.335	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;0.997;1.0|.	D|D	0.89232|0.89232	0.3578|0.3578	10|5	0.87932|.	D|.	0|.	-22.6557|-22.6557	16.8222|16.8222	0.85835|0.85835	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	611;198;57|.	P42338;B4DZI3;Q68DL0|.	PK3CB_HUMAN;.;.|.	V|F	611;57;611|243	ENSP00000418143:D611V;ENSP00000438259:D57V;ENSP00000289153:D611V|.	ENSP00000289153:D611V|.	D|I	-|-	2|1	0|0	PIK3CB|PIK3CB	139896378|139896378	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.802000|0.802000	0.45316|0.45316	7.581000|7.581000	0.82535|0.82535	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	GAT|ATT	-	superfamily_ARM-type_fold,HMMSmart_PI3Ka,HMMPfam_PI3Ka		0.488	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CB	protein_coding	OTTHUMT00000358019.1	T			139896378	-1	no_errors	NM_006219	genbank	human	provisional	54_36p	missense	SNP	1.000	A
PCDHB4	56131	genome.wustl.edu	37	5	140503211	140503211	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr5:140503211C>T	ENST00000194152.1	+	1	1631	c.1631C>T	c.(1630-1632)gCg>gTg	p.A544V	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	544	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A544V(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCAGCGAGGCGCTGGTGCGC	0.687																																																1	Substitution - Missense(1)	large_intestine(1)	5											40.0	45.0	43.0					5																	140503211		2202	4294	6496	140483395	SO:0001583	missense	56131			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1631C>T	5.37:g.140503211C>T	ENSP00000194152:p.Ala544Val	Somatic		Capture	Illumina GAIIx	4	140483395	Q4V761	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,PatternScan_CADHERIN_1,HMMPfam_Cadherin,HMMSmart_CA	p.A544V	ENST00000194152.1	37	c.1631	CCDS4246.1	5	.	.	.	.	.	.	.	.	.	.	C	12.55	1.972665	0.34848	.	.	ENSG00000081818	ENST00000194152	T	0.01787	4.64	3.88	3.88	0.44766	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.01489	0.0048	N	0.20685	0.6	0.39162	D	0.962431	P	0.45078	0.85	P	0.45232	0.474	T	0.66300	-0.5958	9	0.13853	T	0.58	.	5.2581	0.15558	0.0:0.733:0.0:0.267	.	544	Q9Y5E5	PCDB4_HUMAN	V	544	ENSP00000194152:A544V	ENSP00000194152:A544V	A	+	2	0	PCDHB4	140483395	0.049000	0.20398	1.000000	0.80357	0.989000	0.77384	0.401000	0.20948	2.189000	0.69895	0.485000	0.47835	GCG	-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.687	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	protein_coding	OTTHUMT00000251812.2	C	NM_018938		140483395	+1	no_errors	NM_018938	genbank	human	reviewed	54_36p	missense	SNP	0.969	T
ZFP41	286128	genome.wustl.edu	37	8	144356997	144356997	+	Intron	SNP	G	G	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr8:144356997G>A	ENST00000522452.1	+	3	2390				GLI4_ENST00000517468.1_Intron|GLI4_ENST00000523812.1_3'UTR|GLI4_ENST00000344692.3_3'UTR|GLI4_ENST00000340042.1_Intron|GLI4_ENST00000521682.1_Intron|GLI4_ENST00000523522.1_Intron			Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			TCGGGTTACTGGGGGACCAGA	0.632																																																0			8											34.0	25.0	28.0					8																	144356997		2173	4238	6411	144428372	SO:0001627	intron_variant	2738				CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000522452.1:c.594+25G>A	8.37:g.144356997G>A		Somatic		Capture	Illumina GAIIx	4	144428372	D3DWJ5	Nonsense_Mutation	SNP	HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.W6*	ENST00000522452.1	37	c.17	CCDS6397.1	8																																																																																			-	NULL		0.632	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|readthrough_transcript|CCDS	protein_coding	GLI4	protein_coding	OTTHUMT00000381125.2	G	NM_173832		144428372	+1	no_start_codon:no_stop_codon	ENST00000344692	ensembl	human	known	54_36p	nonsense	SNP	0.000	A
ZNF623	9831	genome.wustl.edu	37	8	144732524	144732524	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr8:144732524G>T	ENST00000501748.2	+	1	571	c.482G>T	c.(481-483)gGc>gTc	p.G161V	ZNF623_ENST00000526926.1_Missense_Mutation_p.G121V|ZNF623_ENST00000458270.2_Missense_Mutation_p.G121V	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	161					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			AAAGGCTTTGGCCAGAGCTCA	0.478																																																0			8											93.0	76.0	82.0					8																	144732524		2203	4300	6503	144803667	SO:0001583	missense	9831			AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.482G>T	8.37:g.144732524G>T	ENSP00000445979:p.Gly161Val	Somatic		Capture	Illumina GAIIx	4	144803667	A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.G161V	ENST00000501748.2	37	c.482	CCDS34957.1	8	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043959	0.36085	.	.	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	T;T;T	0.03982	3.74;3.74;3.74	3.8	2.83	0.33086	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03564	0.0102	N	0.16037	0.36	0.09310	N	1	B	0.23990	0.095	B	0.29077	0.098	T	0.35574	-0.9783	9	0.62326	D	0.03	-3.5918	6.1878	0.20508	0.0:0.2029:0.5879:0.2091	.	161	O75123	ZN623_HUMAN	V	121;121;121;161;161	ENSP00000435232:G121V;ENSP00000411139:G121V;ENSP00000445979:G161V	ENSP00000330358:G121V	G	+	2	0	ZNF623	144803667	0.000000	0.05858	0.119000	0.21687	0.990000	0.78478	-0.607000	0.05648	2.132000	0.65825	0.655000	0.94253	GGC	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.478	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF623	protein_coding	OTTHUMT00000382522.3	G	NM_014789		144803667	+1	no_errors	NM_014789	genbank	human	validated	54_36p	missense	SNP	0.005	T
HMGB3	3149	genome.wustl.edu	37	X	150154644	150154644	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:150154644A>T	ENST00000325307.7	+	3	367	c.271A>T	c.(271-273)Aat>Tat	p.N91Y	HMGB3_ENST00000448905.2_Missense_Mutation_p.N91Y	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	91					DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					GAAGGATCCTAATGCTCCCAA	0.403																																																0			X											37.0	32.0	33.0					X																	150154644		2203	4299	6502	149905302	SO:0001583	missense	3149			AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.271A>T	X.37:g.150154644A>T	ENSP00000359393:p.Asn91Tyr	Somatic		Capture	Illumina GAIIx	4	149905302	O95556|Q6NS40	Missense_Mutation	SNP	superfamily_HMG-box,HMMPfam_HMG_box,HMMSmart_HMG,PatternScan_HMG_BOX_1	p.N91Y	ENST00000325307.7	37	c.271	CCDS35428.1	X	.	.	.	.	.	.	.	.	.	.	a	20.7	4.041975	0.75732	.	.	ENSG00000029993	ENST00000419110;ENST00000325307;ENST00000455596;ENST00000448905;ENST00000430118	D;D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49;-3.49	5.2	5.2	0.72013	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (1);	0.059697	0.64402	D	0.000005	D	0.98134	0.9384	H	0.97940	4.11	0.50039	D	0.999847	D	0.63880	0.993	D	0.64595	0.927	D	0.99035	1.0822	10	0.87932	D	0	.	13.2343	0.59961	1.0:0.0:0.0:0.0	.	91	O15347	HMGB3_HUMAN	Y	91	ENSP00000410354:N91Y;ENSP00000359393:N91Y;ENSP00000405601:N91Y;ENSP00000442758:N91Y;ENSP00000417027:N91Y	ENSP00000359393:N91Y	N	+	1	0	HMGB3	149905302	1.000000	0.71417	0.910000	0.35882	0.996000	0.88848	9.189000	0.94928	1.717000	0.51406	0.486000	0.48141	AAT	-	superfamily_HMG-box		0.403	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HMGB3	protein_coding	OTTHUMT00000060867.1	A	NM_005342		149905302	+1	no_errors	NM_005342	genbank	human	validated	54_36p	missense	SNP	1.000	T
MAGEA4	4103	genome.wustl.edu	37	X	151092588	151092588	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:151092588T>A	ENST00000360243.2	+	3	719	c.452T>A	c.(451-453)aTc>aAc	p.I151N	MAGEA4_ENST00000370335.1_Missense_Mutation_p.I151N|MAGEA4_ENST00000370337.4_Missense_Mutation_p.I151N|MAGEA4_ENST00000370340.3_Missense_Mutation_p.I151N|MAGEA4_ENST00000393920.1_Missense_Mutation_p.I151N|MAGEA4_ENST00000393921.1_Missense_Mutation_p.I151N|MAGEA4_ENST00000276344.2_Missense_Mutation_p.I151N	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	151	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					TTTCCTGTGATCTTCGGCAAA	0.527																																																0			X											97.0	97.0	97.0					X																	151092588		2203	4300	6503	150843244	SO:0001583	missense	4103				CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.452T>A	X.37:g.151092588T>A	ENSP00000353379:p.Ile151Asn	Somatic		Capture	Illumina GAIIx	4	150843244	Q14798	Missense_Mutation	SNP	HMMPfam_MAGE	p.I151N	ENST00000360243.2	37	c.452	CCDS14702.1	X	.	.	.	.	.	.	.	.	.	.	T	14.09	2.431048	0.43122	.	.	ENSG00000147381	ENST00000431963;ENST00000276344;ENST00000448295;ENST00000393921;ENST00000430273;ENST00000370337;ENST00000441865;ENST00000393920;ENST00000370340;ENST00000416020;ENST00000425182;ENST00000457310;ENST00000370335;ENST00000360243;ENST00000431971	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.07908	3.15;3.15;3.15;3.15;3.15;3.15;3.15;3.15;3.15;3.15;3.15;3.15;3.15;3.15;3.15	2.37	2.37	0.29283	.	0.156968	0.56097	D	0.000037	T	0.34774	0.0909	H	0.96518	3.835	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.17379	-1.0371	10	0.87932	D	0	.	5.9372	0.19173	0.0:0.0:0.0:1.0	.	151	P43358	MAGA4_HUMAN	N	151	ENSP00000387777:I151N;ENSP00000276344:I151N;ENSP00000391904:I151N;ENSP00000377498:I151N;ENSP00000394149:I151N;ENSP00000359362:I151N;ENSP00000402624:I151N;ENSP00000377497:I151N;ENSP00000359365:I151N;ENSP00000394073:I151N;ENSP00000400900:I151N;ENSP00000402186:I151N;ENSP00000359360:I151N;ENSP00000353379:I151N;ENSP00000390096:I151N	ENSP00000276344:I151N	I	+	2	0	MAGEA4	150843244	0.339000	0.24784	0.012000	0.15200	0.242000	0.25591	2.864000	0.48404	1.190000	0.43042	0.242000	0.17961	ATC	-	HMMPfam_MAGE		0.527	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA4	protein_coding	OTTHUMT00000060898.1	T	NM_002362		150843244	+1	no_errors	NM_001011548	genbank	human	reviewed	54_36p	missense	SNP	0.069	A
ARHGAP4	393	genome.wustl.edu	37	X	153175368	153175368	+	Silent	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chrX:153175368C>G	ENST00000350060.5	-	19	2282	c.2241G>C	c.(2239-2241)ggG>ggC	p.G747G	ARHGAP4_ENST00000537206.1_Silent_p.G724G|ARHGAP4_ENST00000467421.1_5'UTR|ARHGAP4_ENST00000370016.1_Silent_p.G726G|ARHGAP4_ENST00000370028.3_Silent_p.G787G|ARHGAP4_ENST00000393721.1_Silent_p.G569G	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	747	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCTCCACGACCCCCTCCAGGT	0.692																																																0			X											13.0	14.0	14.0					X																	153175368		2179	4249	6428	152828562	SO:0001819	synonymous_variant	393			X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.2241G>C	X.37:g.153175368C>G		Somatic		Capture	Illumina GAIIx	4	152828562	Q14144|Q86UY3	Silent	SNP	HMMPfam_FCH,HMMSmart_FCH,superfamily_Rho_GAP,HMMSmart_RhoGAP,HMMPfam_RhoGAP,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.G747	ENST00000350060.5	37	c.2241	CCDS14736.1	X	.	.	.	.	.	.	.	.	.	.	C	11.04	1.520821	0.27211	.	.	ENSG00000089820	ENST00000454164;ENST00000442172	T;T	0.29917	1.55;1.55	4.44	-7.15	0.01521	.	0.000000	0.35646	N	0.003075	T	0.28499	0.0705	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37888	-0.9686	7	0.87932	D	0	.	3.4546	0.07511	0.0995:0.2585:0.4076:0.2345	.	.	.	.	A	169;236	ENSP00000412437:G169A;ENSP00000408656:G236A	ENSP00000397533:G608A	G	-	2	0	ARHGAP4	152828562	0.000000	0.05858	0.001000	0.08648	0.472000	0.32918	-0.844000	0.04345	-1.347000	0.02208	0.525000	0.51046	GGG	-	superfamily_SH3		0.692	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGAP4	protein_coding	OTTHUMT00000061119.1	C	NM_001666		152828562	-1	no_errors	NM_001666	genbank	human	validated	54_36p	silent	SNP	0.020	G
ADAM15	8751	genome.wustl.edu	37	1	155028902	155028902	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr1:155028902C>G	ENST00000356955.2	+	10	1056	c.955C>G	c.(955-957)Cag>Gag	p.Q319E	ADAM15_ENST00000368413.1_Intron|ADAM15_ENST00000360674.4_Missense_Mutation_p.Q319E|ADAM15_ENST00000359280.4_Missense_Mutation_p.Q319E|ADAM15_ENST00000355956.2_Missense_Mutation_p.Q319E|ADAM15_ENST00000271836.6_Missense_Mutation_p.Q319E|ADAM15_ENST00000531455.1_Missense_Mutation_p.Q329E|ADAM15_ENST00000447332.3_Missense_Mutation_p.Q303E|ADAM15_ENST00000368410.2_Intron|ADAM15_ENST00000449910.2_Missense_Mutation_p.Q319E|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000368412.3_Missense_Mutation_p.Q319E	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	319	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			CATGGCCATTCAGAACTCCAT	0.532																																																0			1											131.0	115.0	121.0					1																	155028902		2203	4300	6503	153295526	SO:0001583	missense	8751			U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.955C>G	1.37:g.155028902C>G	ENSP00000349436:p.Gln319Glu	Somatic		Capture	Illumina GAIIx	4	153295526	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMPfam_Disintegrin,HMMSmart_SM00050,superfamily_Blood coagulation inhibitor (disintegrin),HMMSmart_SM00608,HMMPfam_ADAM_CR,HMMPfam_EGF_2,PatternScan_EGF_2"	p.Q319E	ENST00000356955.2	37	c.955	CCDS1087.1	1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376684	0.82682	.	.	ENSG00000143537	ENST00000356955;ENST00000449910;ENST00000359280;ENST00000360674;ENST00000368412;ENST00000355956;ENST00000271836;ENST00000531455	T;T;T;T;T;T;T;T	0.09630	2.96;2.96;2.96;2.96;2.96;2.96;2.96;2.96	5.11	5.11	0.69529	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.42682	D	0.000675	T	0.17662	0.0424	L	0.40543	1.245	0.80722	D	1	D;D;D;D;D;D;D;D;P;D;D	0.71674	0.998;0.998;0.996;0.988;0.976;0.998;0.998;0.998;0.947;0.99;0.998	D;D;D;D;D;D;D;D;P;D;D	0.85130	0.997;0.997;0.966;0.992;0.943;0.995;0.995;0.995;0.882;0.996;0.997	T	0.00599	-1.1651	10	0.66056	D	0.02	.	16.0708	0.80928	0.0:1.0:0.0:0.0	.	329;336;303;319;319;319;319;319;319;319;316	E9PN65;B7Z390;B4DMH8;Q13444-10;Q13444-2;Q13444-4;Q13444-5;Q13444-3;Q13444-9;Q13444;Q59GF2	.;.;.;.;.;.;.;.;.;ADA15_HUMAN;.	E	319;319;319;319;319;319;319;329	ENSP00000349436:Q319E;ENSP00000403843:Q319E;ENSP00000352226:Q319E;ENSP00000353892:Q319E;ENSP00000357397:Q319E;ENSP00000348227:Q319E;ENSP00000271836:Q319E;ENSP00000432927:Q329E	ENSP00000271836:Q319E	Q	+	1	0	ADAM15	153295526	0.882000	0.30256	0.998000	0.56505	0.997000	0.91878	2.072000	0.41510	2.659000	0.90383	0.655000	0.94253	CAG	-	"superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin"		0.532	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM15	protein_coding	OTTHUMT00000387168.1	C	NM_003815		153295526	+1	no_errors	NM_207197	genbank	human	reviewed	54_36p	missense	SNP	0.998	G
FAM114A2	10827	genome.wustl.edu	37	5	153372545	153372545	+	Silent	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr5:153372545T>C	ENST00000351797.4	-	14	1585	c.1509A>G	c.(1507-1509)ttA>ttG	p.L503L	FAM114A2_ENST00000520313.1_Silent_p.L433L|FAM114A2_ENST00000522858.1_Silent_p.L503L|FAM114A2_ENST00000518946.1_5'UTR|FAM114A2_ENST00000520667.1_Silent_p.L503L	NM_018691.2	NP_061161.2	Q9NRY5	F1142_HUMAN	family with sequence similarity 114, member A2	503							purine nucleotide binding (GO:0017076)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)|urinary_tract(1)	18						TTCAATGTTCTAACAAAGGTT	0.468																																																0			5											174.0	164.0	167.0					5																	153372545		2203	4300	6503	153352738	SO:0001819	synonymous_variant	10827			AF159700	CCDS4323.1	5q31-q33	2008-06-13	2008-06-13	2008-06-13	ENSG00000055147	ENSG00000055147			1333	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 3"""	C5orf3		10843801	Standard	XM_005268359		Approved	133K02	uc003lvc.3	Q9NRY5	OTTHUMG00000130147	ENST00000351797.4:c.1509A>G	5.37:g.153372545T>C		Somatic		Capture	Illumina GAIIx	4	153352738	B2R8D8|Q9H7E0	Silent	SNP	HMMPfam_DUF719	p.L503	ENST00000351797.4	37	c.1509	CCDS4323.1	5																																																																																			-	NULL		0.468	FAM114A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM114A2	protein_coding	OTTHUMT00000252455.1	T	NM_018691		153352738	-1	no_errors	NM_018691	genbank	human	validated	54_36p	silent	SNP	0.000	C
ESYT2	57488	genome.wustl.edu	37	7	158526938	158526938	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr7:158526938T>A	ENST00000251527.5	-	22	2707	c.2642A>T	c.(2641-2643)gAc>gTc	p.D881V	ESYT2_ENST00000435514.2_Missense_Mutation_p.D316V	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	909	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						TTCCGTGAGGTCATACCTGAG	0.572																																																0			7											94.0	63.0	73.0					7																	158526938		2203	4300	6503	158219699	SO:0001583	missense	57488			AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.2642A>T	7.37:g.158526938T>A	ENSP00000251527:p.Asp881Val	Somatic		Capture	Illumina GAIIx	4	158219699	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Missense_Mutation	SNP	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.D881V	ENST00000251527.5	37	c.2642	CCDS34791.1	7	.	.	.	.	.	.	.	.	.	.	T	18.82	3.705214	0.68615	.	.	ENSG00000117868	ENST00000251527;ENST00000421679;ENST00000275418;ENST00000435514	T;T;T	0.09817	2.94;2.94;2.94	5.91	5.91	0.95273	C2 calcium/lipid-binding domain, CaLB (1);	0.102278	0.64402	D	0.000003	T	0.24431	0.0592	L	0.47716	1.5	0.80722	D	1	D;P	0.57571	0.98;0.586	P;P	0.60682	0.878;0.72	T	0.00194	-1.1933	10	0.52906	T	0.07	-26.7655	15.5295	0.75942	0.0:0.0:0.0:1.0	.	881;909	A0FGR8-2;A0FGR8	.;ESYT2_HUMAN	V	881;930;872;316	ENSP00000251527:D881V;ENSP00000275418:D872V;ENSP00000411488:D316V	ENSP00000251527:D881V	D	-	2	0	ESYT2	158219699	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	5.997000	0.70646	2.267000	0.75376	0.533000	0.62120	GAC	-	superfamily_C2_CaLB		0.572	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM62B	protein_coding	OTTHUMT00000322647.1	T	NM_020728		158219699	-1	no_errors	NM_020728	genbank	human	validated	54_36p	missense	SNP	1.000	A
FCGR3A	2214	genome.wustl.edu	37	1	161595976	161595976	+	Intron	SNP	T	T	G			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr1:161595976T>G	ENST00000540048.1	-	2	94				FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR3B_ENST00000294800.3_Missense_Mutation_p.K179T|FCGR2B_ENST00000428605.2_Intron|FCGR3B_ENST00000367964.2_Missense_Mutation_p.K179T|FCGR3B_ENST00000531221.1_Missense_Mutation_p.K215T|FCGR2B_ENST00000367962.4_Intron			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGACACATTTTTACTCCCAAC	0.483																																																0			1											101.0	108.0	106.0					1																	161595976		2200	4300	6500	159862600	SO:0001627	intron_variant	2215			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+4181A>C	1.37:g.161595976T>G		Somatic		Capture	Illumina GAIIx	4	159862600	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig	p.K179T	ENST00000540048.1	37	c.536		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	1.253|1.253	-0.618121|-0.618121	0.03663|0.03663	.|.	.|.	ENSG00000162747|ENSG00000162747	ENST00000367964;ENST00000294800;ENST00000531221|ENST00000421702	T;T;T|.	0.11063|.	2.81;2.81;2.81|.	2.47|2.47	-1.03|-1.03	0.10102|0.10102	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);|.	1.852830|.	0.02724|.	N|.	0.114292|.	T|.	0.13628|.	0.0330|.	L|L	0.37630|0.37630	1.12|1.12	0.09310|0.09310	N|N	1|1	P|.	0.39940|.	0.696|.	B|.	0.43251|.	0.413|.	T|.	0.32134|.	-0.9918|.	10|.	0.15499|.	T|.	0.54|.	.|.	5.3182|5.3182	0.15866|0.15866	0.0:0.4884:0.0:0.5116|0.0:0.4884:0.0:0.5116	.|.	179|.	O75015|.	FCG3B_HUMAN|.	T|Y	179;179;215|199	ENSP00000356941:K179T;ENSP00000294800:K179T;ENSP00000433642:K215T|.	ENSP00000294800:K179T|.	K|X	-|-	2|3	0|2	FCGR3B|FCGR3B	159862600|159862600	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.027000|0.027000	0.11550|0.11550	-2.198000|-2.198000	0.01239|0.01239	-0.159000|-0.159000	0.11021|0.11021	0.324000|0.324000	0.21423|0.21423	AAA|TAA	-	superfamily_Immunoglobulin,HMMSmart_SM00409		0.483	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	FCGR3B	protein_coding		T	NM_000569		159862600	-1	no_errors	NM_000570	genbank	human	validated	54_36p	missense	SNP	0.000	G
LPA	4018	genome.wustl.edu	37	6	161027642	161027642	+	Silent	SNP	A	A	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr6:161027642A>C	ENST00000316300.5	-	17	2696	c.2652T>G	c.(2650-2652)ccT>ccG	p.P884P	LPA_ENST00000447678.1_Silent_p.P884P			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3392	Kringle 8. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TATAACAATAAGGGGCTGCCA	0.522																																																0			6											127.0	131.0	130.0					6																	161027642		2095	4272	6367	160947632	SO:0001819	synonymous_variant	4018			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2652T>G	6.37:g.161027642A>C		Somatic		Capture	Illumina GAIIx	4	160947632	Q5VTD7|Q9UD88	Silent	SNP	superfamily_Kringle-like,HMMSmart_SM00130,HMMPfam_Kringle,PatternScan_KRINGLE_1,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.P884	ENST00000316300.5	37	c.2652	CCDS43523.1	6																																																																																			-	superfamily_Kringle-like,HMMSmart_SM00130,HMMPfam_Kringle,PatternScan_KRINGLE_1		0.522	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	protein_coding	OTTHUMT00000042957.1	A	NM_005577		160947632	-1	no_errors	NM_005577	genbank	human	validated	54_36p	silent	SNP	0.421	C
SLC9C2	284525	genome.wustl.edu	37	1	173552738	173552738	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr1:173552738G>C	ENST00000367714.3	-	6	969	c.547C>G	c.(547-549)Ctc>Gtc	p.L183V	RP3-436N22.3_ENST00000431459.1_RNA|SLC9C2_ENST00000536496.1_Missense_Mutation_p.L81V	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	183					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										CCTCTAATGAGATCAATGTAT	0.328																																																0			1											50.0	56.0	54.0					1																	173552738		2201	4293	6494	171819361	SO:0001583	missense	284525			AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.547C>G	1.37:g.173552738G>C	ENSP00000356687:p.Leu183Val	Somatic		Capture	Illumina GAIIx	4	171819361	Q86UF3	Missense_Mutation	SNP	PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2,HMMPfam_Na_H_Exchanger,HMMPfam_Ion_trans,HMMSmart_cNMP,superfamily_cNMP_binding,HMMPfam_cNMP_binding	p.L183V	ENST00000367714.3	37	c.547	CCDS1308.1	1	.	.	.	.	.	.	.	.	.	.	G	8.845	0.943176	0.18281	.	.	ENSG00000162753	ENST00000367714;ENST00000536496	T;T	0.15256	2.44;2.44	5.37	-1.78	0.07957	Cation/H+ exchanger (1);	0.646194	0.14300	N	0.328345	T	0.02455	0.0075	N	0.14661	0.345	0.22666	N	0.99888	B	0.25351	0.124	B	0.24701	0.055	T	0.41910	-0.9482	10	0.41790	T	0.15	-9.0439	5.4365	0.16484	0.4053:0.0:0.2875:0.3072	.	183	Q5TAH2	S9A11_HUMAN	V	183;81	ENSP00000356687:L183V;ENSP00000445437:L81V	ENSP00000356687:L183V	L	-	1	0	SLC9A11	171819361	0.992000	0.36948	0.980000	0.43619	0.111000	0.19643	0.252000	0.18278	-0.228000	0.09869	-1.099000	0.02127	CTC	-	HMMPfam_Na_H_Exchanger		0.328	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A11	protein_coding	OTTHUMT00000084205.1	G	NM_178527		171819361	-1	no_errors	NM_178527	genbank	human	validated	54_36p	missense	SNP	0.202	C
COL5A2	1290	genome.wustl.edu	37	2	189899804	189899804	+	Silent	SNP	G	G	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr2:189899804G>C	ENST00000374866.3	-	53	4465	c.4191C>G	c.(4189-4191)gcC>gcG	p.A1397A		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1397	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TGTTCTGGGAGGCTTCTTTTG	0.398																																																0			2											123.0	119.0	120.0					2																	189899804		2203	4300	6503	189608049	SO:0001819	synonymous_variant	1290			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.4191C>G	2.37:g.189899804G>C		Somatic		Capture	Illumina GAIIx	4	189608049	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Silent	SNP	HMMPfam_VWC,HMMSmart_VWC,PatternScan_VWFC_1,HMMPfam_Collagen,HMMSmart_COLFI,HMMPfam_COLFI	p.A1397	ENST00000374866.3	37	c.4191	CCDS33350.1	2																																																																																			-	HMMSmart_COLFI,HMMPfam_COLFI		0.398	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	protein_coding	OTTHUMT00000313523.1	G	NM_000393		189608049	-1	no_errors	NM_000393	genbank	human	reviewed	54_36p	silent	SNP	0.914	C
MUC20	200958	genome.wustl.edu	37	3	195452805	195452805	+	Missense_Mutation	SNP	T	T	C	rs138659995	byFrequency	TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr3:195452805T>C	ENST00000447234.2	+	2	1457	c.1331T>C	c.(1330-1332)cTc>cCc	p.L444P	MUC20_ENST00000445522.2_Missense_Mutation_p.L409P|MUC20_ENST00000436408.1_Missense_Mutation_p.L444P|MUC20_ENST00000320736.6_Missense_Mutation_p.L273P	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	444				L -> P (in Ref. 5; AAH29267). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		GACACAGATCTCATCCCCACG	0.532																																																0			3											33.0	29.0	31.0					3																	195452805		2032	4172	6204	196938476	SO:0001583	missense	200958			AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1331T>C	3.37:g.195452805T>C	ENSP00000414350:p.Leu444Pro	Somatic		Capture	Illumina GAIIx	4	196938476	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	NULL	p.L273P	ENST00000447234.2	37	c.818		3	304	0.1391941391941392	136	0.2764227642276423	44	0.12154696132596685	1	0.0017482517482517483	123	0.16226912928759896	A	5.982	0.365171	0.11296	.	.	ENSG00000176945	ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	T;T;T;T	0.15487	2.84;2.85;3.01;2.42	4.27	-8.54	0.00912	.	1.966210	0.02326	N	0.073463	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	B	0.09022	0.002	B	0.06405	0.002	T	0.24512	-1.0158	9	0.35671	T	0.21	11.8641	1.0464	0.01570	0.1498:0.2084:0.2288:0.413	.	273	E9PH32	.	P	444;273;444;409	ENSP00000414350:L444P;ENSP00000325431:L273P;ENSP00000396774:L444P;ENSP00000405629:L409P	ENSP00000325431:L273P	L	+	2	0	MUC20	196938476	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.973000	0.03798	-3.119000	0.00239	-0.454000	0.05498	CTC	-	NULL		0.532	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	MUC20	protein_coding	OTTHUMT00000341835.1	T	NM_152673		196938476	+1	no_errors	NM_152673	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
REN	5972	genome.wustl.edu	37	1	204124169	204124169	+	Missense_Mutation	SNP	C	C	T	rs145852603		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr1:204124169C>T	ENST00000272190.8	-	10	1224	c.1196G>A	c.(1195-1197)cGc>cAc	p.R399H	REN_ENST00000367195.2_Missense_Mutation_p.R396H|ETNK2_ENST00000367199.2_5'Flank	NM_000537.3	NP_000528.1	P00797	RENI_HUMAN	renin	399					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cell maturation (GO:0048469)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|drinking behavior (GO:0042756)|hormone-mediated signaling pathway (GO:0009755)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mesonephros development (GO:0001823)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of MAPK cascade (GO:0043408)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cAMP (GO:0051591)|response to cGMP (GO:0070305)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|peptidase activity (GO:0008233)|receptor binding (GO:0005102)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(4)|urinary_tract(1)	19	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	GAAGCCAATGCGGTTGTTACG	0.632																																																0			1						C	HIS/ARG	0,4406		0,0,2203	67.0	64.0	65.0		1196	4.2	1.0	1	dbSNP_134	65	1,8599	1.2+/-3.3	0,1,4299	no	missense	REN	NM_000537.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	399/407	204124169	1,13005	2203	4300	6503	202390792	SO:0001583	missense	5972			BC047752	CCDS30981.1	1q32	2008-02-05			ENSG00000143839	ENSG00000143839	3.4.23.15		9958	protein-coding gene	gene with protein product		179820					Standard	NM_000537		Approved		uc001haq.2	P00797	OTTHUMG00000036059	ENST00000272190.8:c.1196G>A	1.37:g.204124169C>T	ENSP00000272190:p.Arg399His	Somatic		Capture	Illumina GAIIx	4	202390792	Q6FI38|Q6T5C2	Missense_Mutation	SNP	superfamily_Acid proteases,HMMPfam_A1_Propeptide,HMMPfam_Asp,PatternScan_ASP_PROTEASE	p.R399H	ENST00000272190.8	37	c.1196	CCDS30981.1	1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.632178	0.87660	0.0	1.16E-4	ENSG00000143839	ENST00000367195;ENST00000545733;ENST00000272190	T;T	0.60672	0.17;0.17	5.14	4.22	0.49857	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.85115	0.5623	H	0.98594	4.275	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91235	0.5017	10	0.87932	D	0	.	15.5371	0.76013	0.0:0.8609:0.1391:0.0	.	399	P00797	RENI_HUMAN	H	396;318;399	ENSP00000356163:R396H;ENSP00000272190:R399H	ENSP00000272190:R399H	R	-	2	0	REN	202390792	1.000000	0.71417	0.999000	0.59377	0.869000	0.49853	5.604000	0.67626	1.278000	0.44430	0.591000	0.81541	CGC	-	superfamily_Acid proteases,HMMPfam_Asp		0.632	REN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REN	protein_coding	OTTHUMT00000087891.1	C	NM_000537		202390792	-1	no_errors	NM_000537	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PARD3B	117583	genome.wustl.edu	37	2	205986410	205986410	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr2:205986410T>C	ENST00000406610.2	+	8	1109	c.902T>C	c.(901-903)aTt>aCt	p.I301T	PARD3B_ENST00000349953.3_Missense_Mutation_p.I301T|PARD3B_ENST00000462231.1_Missense_Mutation_p.I301T|PARD3B_ENST00000358768.2_Missense_Mutation_p.I301T|PARD3B_ENST00000351153.1_Missense_Mutation_p.I301T	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	301					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		AAGTCAGTCATTGGCTCTCTT	0.458																																																0			2											126.0	120.0	122.0					2																	205986410		1923	4155	6078	205694655	SO:0001583	missense	117583			AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.902T>C	2.37:g.205986410T>C	ENSP00000385848:p.Ile301Thr	Somatic		Capture	Illumina GAIIx	4	205694655	E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	superfamily_PDZ,HMMSmart_PDZ,HMMPfam_PDZ	p.I301T	ENST00000406610.2	37	c.902		2	.	.	.	.	.	.	.	.	.	.	T	6.653	0.488913	0.12641	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53	6.16	3.8	0.43715	.	0.000000	0.85682	D	0.000000	D	0.85115	0.5623	M	0.68952	2.095	0.47341	D	0.99939	D;D;D;D;D	0.89917	0.998;1.0;0.991;0.999;0.999	D;D;D;D;D	0.97110	0.995;0.996;0.914;0.999;1.0	T	0.80982	-0.1139	10	0.10902	T	0.67	.	9.5822	0.39495	0.0:0.1361:0.0:0.8639	.	301;301;301;301;301	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	T	301	ENSP00000385848:I301T;ENSP00000351618:I301T;ENSP00000317261:I301T;ENSP00000340280:I301T	ENSP00000340280:I301T	I	+	2	0	PARD3B	205694655	1.000000	0.71417	0.948000	0.38648	0.029000	0.11900	3.930000	0.56522	0.564000	0.29238	-0.256000	0.11100	ATT	-	superfamily_PDZ		0.458	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	PARD3B	protein_coding	OTTHUMT00000335992.1	T	NM_057177		205694655	+1	no_errors	NM_152526	genbank	human	validated	54_36p	missense	SNP	0.999	C
ADCK3	56997	genome.wustl.edu	37	1	227169789	227169789	+	Silent	SNP	G	G	C			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr1:227169789G>C	ENST00000366779.1	+	11	3563	c.792G>C	c.(790-792)gtG>gtC	p.V264V	ADCK3_ENST00000478406.1_3'UTR|ADCK3_ENST00000366778.1_Silent_p.V212V|ADCK3_ENST00000458507.2_5'UTR|ADCK3_ENST00000433743.2_5'UTR|ADCK3_ENST00000366777.3_Silent_p.V264V			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	264					cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						AGCGGATCGTGCGCACGCTCT	0.687																																																0			1											35.0	33.0	33.0					1																	227169789		2201	4299	6500	225236412	SO:0001819	synonymous_variant	56997			AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.792G>C	1.37:g.227169789G>C		Somatic		Capture	Illumina GAIIx	4	225236412	Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	Silent	SNP	HMMPfam_ABC1,superfamily_Protein kinase-like (PK-like)	p.V264	ENST00000366779.1	37	c.792	CCDS1557.1	1																																																																																			-	NULL		0.687	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CABC1	protein_coding	OTTHUMT00000091712.1	G	NM_020247		225236412	+1	no_errors	NM_020247	genbank	human	reviewed	54_36p	silent	SNP	0.985	C
URB2	9816	genome.wustl.edu	37	1	229772557	229772557	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr1:229772557C>T	ENST00000258243.2	+	4	2333	c.2197C>T	c.(2197-2199)Ctc>Ttc	p.L733F		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	733						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GGTGAGTGGACTCACATACCC	0.473																																																0			1											123.0	123.0	123.0					1																	229772557		2203	4300	6503	227839180	SO:0001583	missense	9816			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.2197C>T	1.37:g.229772557C>T	ENSP00000258243:p.Leu733Phe	Somatic		Capture	Illumina GAIIx	4	227839180	Q5VYC9	Missense_Mutation	SNP	HMMPfam_Urb2	p.L733F	ENST00000258243.2	37	c.2197	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	C	8.559	0.877334	0.17395	.	.	ENSG00000135763	ENST00000258243	T	0.32023	1.47	5.23	-0.93	0.10441	.	1.435330	0.03679	N	0.245263	T	0.28863	0.0716	M	0.62723	1.935	0.09310	N	1	P	0.41748	0.761	B	0.35971	0.215	T	0.33979	-0.9847	9	.	.	.	0.0043	6.3952	0.21609	0.0:0.4059:0.3489:0.2452	.	733	Q14146	URB2_HUMAN	F	733	ENSP00000258243:L733F	.	L	+	1	0	URB2	227839180	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.259000	0.18405	-0.091000	0.12440	-0.225000	0.12378	CTC	-	NULL		0.473	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	protein_coding	OTTHUMT00000095232.1	C	NM_014777		227839180	+1	no_errors	NM_014777	genbank	human	provisional	54_36p	missense	SNP	0.000	T
SH3BP4	23677	genome.wustl.edu	37	2	235951006	235951006	+	Silent	SNP	G	G	A	rs148242042		TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr2:235951006G>A	ENST00000409212.1	+	4	2100	c.1593G>A	c.(1591-1593)ttG>ttA	p.L531L	SH3BP4_ENST00000344528.4_Silent_p.L531L|SH3BP4_ENST00000392011.2_Silent_p.L531L			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	531					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		AGTTCGTTTTGTCCAGGCCCC	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		20712	0.0		0.0	False		,,,				2504	0.001															0			2						G		3,4403	8.1+/-20.4	0,3,2200	68.0	71.0	70.0		1593	4.1	0.1	2	dbSNP_134	70	0,8600		0,0,4300	yes	coding-synonymous	SH3BP4	NM_014521.2		0,3,6500	AA,AG,GG		0.0,0.0681,0.0231		531/964	235951006	3,13003	2203	4300	6503	235615745	SO:0001819	synonymous_variant	23677			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.1593G>A	2.37:g.235951006G>A		Somatic		Capture	Illumina GAIIx	4	235615745	O95082|Q309A3|Q53QD0|Q53TD1	Silent	SNP	superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,HMMPfam_SH3_2	p.L531	ENST00000409212.1	37	c.1593	CCDS2513.1	2																																																																																			-	NULL		0.587	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SH3BP4	protein_coding	OTTHUMT00000329763.1	G			235615745	+1	no_errors	NM_014521	genbank	human	reviewed	54_36p	silent	SNP	0.766	A
MAP1LC3C	440738	genome.wustl.edu	37	1	242162259	242162259	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2057-01A-02D-1526-09	TCGA-13-2057-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	e2da306d-5b3b-40dc-bcf2-85c2cdf48a4c	0440ebfb-764d-448f-9bba-e7a42e7fac80	g.chr1:242162259T>A	ENST00000357246.3	-	1	116	c.52A>T	c.(52-54)Agc>Tgc	p.S18C		NM_001004343.2	NP_001004343.1	Q9BXW4	MLP3C_HUMAN	microtubule-associated protein 1 light chain 3 gamma	18					autophagy (GO:0006914)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|microtubule (GO:0005874)|organelle membrane (GO:0031090)				endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TTACCCAAGCTTTTCCTCTGC	0.438											OREG0014354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			1											82.0	88.0	86.0					1																	242162259		2202	4300	6502	240228882	SO:0001583	missense	440738			AF276659	CCDS31074.1	1q43	2014-02-12			ENSG00000197769	ENSG00000197769			13353	protein-coding gene	gene with protein product		609605				12740394	Standard	NM_001004343		Approved	ATG8J	uc001hzk.2	Q9BXW4	OTTHUMG00000039865	ENST00000357246.3:c.52A>T	1.37:g.242162259T>A	ENSP00000349785:p.Ser18Cys	Somatic	2432	Capture	Illumina GAIIx	4	240228882	A0PJY8|A2RUP0	Missense_Mutation	SNP	superfamily_SSF54236,HMMPfam_MAP1_LC3	p.S18C	ENST00000357246.3	37	c.52	CCDS31074.1	1	.	.	.	.	.	.	.	.	.	.	T	14.20	2.463449	0.43736	.	.	ENSG00000197769	ENST00000357246	T	0.50813	0.73	3.95	3.95	0.45737	.	0.085867	0.85682	D	0.000000	T	0.47078	0.1426	M	0.66506	2.035	0.42590	D	0.993248	B	0.18863	0.031	B	0.24006	0.05	T	0.52026	-0.8630	10	0.59425	D	0.04	.	11.7803	0.52010	0.0:0.0:0.0:1.0	.	18	Q9BXW4	MLP3C_HUMAN	C	18	ENSP00000349785:S18C	ENSP00000349785:S18C	S	-	1	0	MAP1LC3C	240228882	0.975000	0.34042	0.961000	0.40146	0.940000	0.58332	2.932000	0.48940	1.654000	0.50703	0.519000	0.50382	AGC	-	superfamily_SSF54236		0.438	MAP1LC3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1LC3C	protein_coding	OTTHUMT00000096185.1	T	NM_001004343		240228882	-1	no_errors	NM_001004343	genbank	human	validated	54_36p	missense	SNP	1.000	A
