#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								6976	SO:0001628	intergenic_variant	4512																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	6976		Silent	SNP	superfamily_Cytochrome c oxidase subunit I-like,HMMPfam_COX1,PatternScan_COX1_CUB	p.L358		37	c.1072		MT																																																																																			-	superfamily_Cytochrome c oxidase subunit I-like,HMMPfam_COX1	0	0					MT-CO1			T			6976	+1	no_stop_codon	ENST00000361624	ensembl	human	known	54_36p	silent	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								15636	SO:0001628	intergenic_variant	4519																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	15636		Missense_Mutation	SNP	superfamily_Transmembr_di-haem_cytochrome,HMMPfam_Cytochrom_B_N,HMMPfam_Cytochrom_B_C,superfamily_Cytochrome_b/b6_C	p.S297P		37	c.889		MT																																																																																			-	HMMPfam_Cytochrom_B_C,superfamily_Cytochrome_b/b6_C	0	0					MT-CYB			T			15636	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361789	ensembl	human	known	54_36p	missense	SNP	NULL	C
LOC285766	285766	genome.wustl.edu	37	6	203509	203509	+	lincRNA	SNP	G	G	T	rs535674482		TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr6:203509G>T	ENST00000580119.1	-	0	598				RP3-416J7.5_ENST00000381078.1_lincRNA																							GAAAGAAAGTGCCCAGAGAAA	0.517													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20103	0.0		0.0	False		,,,				2504	0.0															0			6																																								148509			0																															6.37:g.203509G>T		Somatic		Capture	Illumina GAIIx	4	148509		Missense_Mutation	SNP	NULL	p.C26F	ENST00000580119.1	37	c.77		6	.	.	.	.	.	.	.	.	.	.	G	10.41	1.341334	0.24339	.	.	ENSG00000205653	ENST00000381078	.	.	.	2.39	-3.7	0.04437	.	.	.	.	.	T	0.17619	0.0423	.	.	.	0.26267	N	0.978481	.	.	.	.	.	.	T	0.31052	-0.9957	4	0.87932	D	0	.	3.7801	0.08677	0.5183:0.0:0.2945:0.1872	.	.	.	.	F	26	.	ENSP00000370468:C26F	C	+	2	0	AL035696.1	148509	0.000000	0.05858	0.000000	0.03702	0.733000	0.41908	-0.938000	0.03938	-1.101000	0.03027	-0.794000	0.03295	TGC	-	NULL		0.517	RP3-416J7.4-001	KNOWN	basic	lincRNA	ENSG00000205653	lincRNA	OTTHUMT00000445711.1	G			148509	+1	no_errors	ENST00000381078	ensembl	human	known	54_36p	missense	SNP	0.002	T
AXIN1	8312	genome.wustl.edu	37	16	343716	343716	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr16:343716G>C	ENST00000262320.3	-	8	2329	c.1958C>G	c.(1957-1959)tCt>tGt	p.S653C	AXIN1_ENST00000354866.3_Missense_Mutation_p.S653C	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	653	Interaction with PPP2CA.|Interaction with RNF111.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CGTCCCCGAAGACCTTGGGGA	0.642																																																0			16											85.0	92.0	90.0					16																	343716		2203	4300	6503	283717	SO:0001583	missense	8312			AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1958C>G	16.37:g.343716G>C	ENSP00000262320:p.Ser653Cys	Somatic		Capture	Illumina GAIIx	4	283717	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	superfamily_Regulator of G-protein signaling RGS,HMMPfam_RGS,HMMSmart_SM00315,HMMPfam_Axin_b-cat_bind,HMMPfam_DIX,HMMSmart_SM00021	p.S653C	ENST00000262320.3	37	c.1958	CCDS10405.1	16	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438774	0.62955	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.62232	0.04;0.04	4.17	4.17	0.49024	.	0.382828	0.31370	N	0.007769	T	0.75042	0.3796	M	0.65498	2.005	0.40946	D	0.984509	D;D	0.71674	0.998;0.966	D;P	0.64144	0.922;0.711	T	0.78922	-0.2013	10	0.56958	D	0.05	-1.5803	15.6374	0.76966	0.0:0.0:1.0:0.0	.	653;653	O15169-2;O15169	.;AXIN1_HUMAN	C	653	ENSP00000262320:S653C;ENSP00000346935:S653C	ENSP00000262320:S653C	S	-	2	0	AXIN1	283717	1.000000	0.71417	0.906000	0.35671	0.117000	0.20001	3.845000	0.55880	2.185000	0.69588	0.478000	0.44815	TCT	-	NULL		0.642	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXIN1	protein_coding	OTTHUMT00000139441.3	G			283717	-1	no_errors	NM_003502	genbank	human	reviewed	54_36p	missense	SNP	0.993	C
SLC52A3	113278	genome.wustl.edu	37	20	742441	742441	+	Silent	SNP	G	G	A	rs539208778		TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr20:742441G>A	ENST00000217254.7	-	4	1342	c.1101C>T	c.(1099-1101)tcC>tcT	p.S367S	SLC52A3_ENST00000473664.1_5'UTR|SLC52A3_ENST00000381944.3_Silent_p.S367S	NM_033409.3	NP_212134.3	Q9NQ40	S52A3_HUMAN	solute carrier family 52 (riboflavin transporter), member 3	367					cellular response to heat (GO:0034605)|riboflavin metabolic process (GO:0006771)|riboflavin transport (GO:0032218)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	riboflavin transporter activity (GO:0032217)										TCCCAAGCACGGAGAGGACCC	0.637													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16148	0.0		0.0	False		,,,				2504	0.0															0			20											72.0	76.0	75.0					20																	742441		2203	4300	6503	690441	SO:0001819	synonymous_variant	113278			AL118502	CCDS13007.1	20p13	2013-07-17	2013-07-17	2012-02-29	ENSG00000101276	ENSG00000101276		"""Solute carriers"""	16187	protein-coding gene	gene with protein product	"""hypothetical protein LOC113278"""	613350	"""chromosome 20 open reading frame 54"""	C20orf54		11780052, 19122205	Standard	NM_033409		Approved	bA371L19.1, hRFT2, RFVT3	uc002wed.4	Q9NQ40	OTTHUMG00000031647	ENST00000217254.7:c.1101C>T	20.37:g.742441G>A		Somatic		Capture	Illumina GAIIx	4	690441	A8K6P1|Q5W1A0|Q5W1A1|Q8NCL7|Q96GD5	Silent	SNP	HMMPfam_DUF1011	p.S367	ENST00000217254.7	37	c.1101	CCDS13007.1	20																																																																																			-	HMMPfam_DUF1011		0.637	SLC52A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf54	protein_coding	OTTHUMT00000077482.2	G	NM_033409		690441	-1	no_errors	NM_033409	genbank	human	validated	54_36p	silent	SNP	0.000	A
PALM	5064	genome.wustl.edu	37	19	746346	746346	+	Silent	SNP	G	G	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr19:746346G>A	ENST00000338448.5	+	9	742	c.696G>A	c.(694-696)gtG>gtA	p.V232V	PALM_ENST00000593172.1_3'UTR|PALM_ENST00000264560.7_Silent_p.V188V	NM_002579.2	NP_002570.2	O75781	PALM_HUMAN	paralemmin	232					cellular component movement (GO:0006928)|cellular response to electrical stimulus (GO:0071257)|cytoskeleton organization (GO:0007010)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of filopodium assembly (GO:0051491)|protein targeting to plasma membrane (GO:0072661)|regulation of cell shape (GO:0008360)|synapse maturation (GO:0060074)	apicolateral plasma membrane (GO:0016327)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cytoplasmic membrane-bounded vesicle (GO:0016023)|dendrite membrane (GO:0032590)|dendritic spine membrane (GO:0032591)|filopodium membrane (GO:0031527)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)|Lung(535;0.201)		CCTCCGAGGTGGACGAACTCA	0.672																																																0			19											48.0	50.0	49.0					19																	746346		2203	4300	6503	697346	SO:0001819	synonymous_variant	5064			Y16270	CCDS32857.1, CCDS32858.1	19p13.3	2008-07-17				ENSG00000099864			8594	protein-coding gene	gene with protein product		608134				9615234, 9813098	Standard	XM_005259565		Approved	KIAA0270	uc002lpm.1	O75781		ENST00000338448.5:c.696G>A	19.37:g.746346G>A		Somatic		Capture	Illumina GAIIx	4	697346	O43359|O95673|Q92559|Q9UPJ4|Q9UQS2|Q9UQS3	Silent	SNP	HMMPfam_Paralemmin	p.V232	ENST00000338448.5	37	c.696	CCDS32857.1	19																																																																																			-	HMMPfam_Paralemmin		0.672	PALM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALM	protein_coding	OTTHUMT00000457592.1	G	NM_002579		697346	+1	no_errors	NM_002579	genbank	human	reviewed	54_36p	silent	SNP	0.982	A
LOC100130417	100130417	genome.wustl.edu	37	1	856042	856042	+	lincRNA	SNP	C	C	T	rs115560414	byFrequency	TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr1:856042C>T	ENST00000417705.1	-	0	0																											GTGTCCTGCGCGCGTCGGGAG	0.627													c|||	204	0.0407348	0.1392	0.0202	5008	,	,		21130	0.0		0.005	False		,,,				2504	0.001															0			1																																								845905			0																															1.37:g.856042C>T		Somatic		Capture	Illumina GAIIx	4	845905		Missense_Mutation	SNP	PatternScan_ASP_PROTEASE	p.R92H	ENST00000417705.1	37	c.275		1																																																																																			-	NULL		0.627	RP11-54O7.3-001	KNOWN	basic	lincRNA	LOC100128838	lincRNA	OTTHUMT00000097858.1	C			845905	-1	no_errors	XM_001724524	genbank	human	model	54_36p	missense	SNP	0.000	T
SCNN1D	6339	genome.wustl.edu	37	1	1225674	1225674	+	Silent	SNP	G	G	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr1:1225674G>A	ENST00000338555.2	+	10	2338	c.1194G>A	c.(1192-1194)caG>caA	p.Q398Q	SCNN1D_ENST00000325425.8_Silent_p.Q464Q|SCNN1D_ENST00000379116.5_Silent_p.Q562Q|SCNN1D_ENST00000400928.3_Silent_p.Q398Q			P51172	SCNND_HUMAN	sodium channel, non-voltage-gated 1, delta subunit	398					ion transmembrane transport (GO:0034220)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ligand-gated sodium channel activity (GO:0015280)			lung(6)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	Amiloride(DB00594)|Triamterene(DB00384)	CCTGCTTCCAGCAGCTGATGG	0.677																																																0			1											48.0	48.0	48.0					1																	1225674		2191	4289	6480	1215537	SO:0001819	synonymous_variant	6339			U38254	CCDS44037.1, CCDS44037.2	1p36.3-p36.2	2012-02-28	2012-02-28		ENSG00000162572	ENSG00000162572		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10601	protein-coding gene	gene with protein product		601328	"""sodium channel, nonvoltage-gated 1, delta"", ""sodium channel, non-voltage-gated 1, delta"""			8661065	Standard	NM_001130413		Approved	ENaCdelta, dNaCh	uc001adt.1	P51172	OTTHUMG00000002081	ENST00000338555.2:c.1194G>A	1.37:g.1225674G>A		Somatic		Capture	Illumina GAIIx	4	1215537	A9Z1X6|B1PS44|Q08AQ3|Q09HT0|Q5T7L3|Q8NA24	Silent	SNP	HMMPfam_ASC,PatternScan_ASC	p.Q398	ENST00000338555.2	37	c.1194		1	.	.	.	.	.	.	.	.	.	.	G	2.132	-0.398907	0.04865	.	.	ENSG00000162572	ENST00000379099	.	.	.	3.53	3.53	0.40419	.	.	.	.	.	T	0.68485	0.3006	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68458	-0.5403	4	.	.	.	.	14.1199	0.65180	0.0:0.0:1.0:0.0	.	.	.	.	T	215	.	.	A	+	1	0	SCNN1D	1215537	0.996000	0.38824	0.998000	0.56505	0.747000	0.42532	3.092000	0.50207	1.527000	0.49086	0.306000	0.20318	GCA	-	HMMPfam_ASC,PatternScan_ASC		0.677	SCNN1D-001	KNOWN	basic|appris_candidate	protein_coding	SCNN1D	protein_coding	OTTHUMT00000005802.2	G	NM_002978		1215537	+1	no_errors	NM_002978	genbank	human	validated	54_36p	silent	SNP	0.939	A
PANK4	55229	genome.wustl.edu	37	1	2444334	2444334	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr1:2444334C>T	ENST00000378466.3	-	13	1732	c.1720G>A	c.(1720-1722)Gtg>Atg	p.V574M	PANK4_ENST00000435556.3_Missense_Mutation_p.V535M	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	574					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TACGCAGACACGGCTTTGGCC	0.697																																																0			1											73.0	85.0	81.0					1																	2444334		2203	4298	6501	2434194	SO:0001583	missense	55229			AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.1720G>A	1.37:g.2444334C>T	ENSP00000367727:p.Val574Met	Somatic		Capture	Illumina GAIIx	4	2434194	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Missense_Mutation	SNP	HMMPfam_Fumble,superfamily_Hypothetical protein At2g17340,HMMPfam_DUF89	p.V574M	ENST00000378466.3	37	c.1720	CCDS42.1	1	.	.	.	.	.	.	.	.	.	.	C	19.00	3.741657	0.69304	.	.	ENSG00000157881	ENST00000378466;ENST00000435556	T;T	0.06849	3.25;3.25	5.33	4.41	0.53225	Domain of unknown function DUF89 (2);	0.000000	0.85682	D	0.000000	T	0.28400	0.0702	M	0.80422	2.495	0.58432	D	0.999995	D;D	0.76494	0.999;0.999	D;D	0.67900	0.954;0.954	T	0.03795	-1.1003	10	0.72032	D	0.01	-47.92	12.8052	0.57610	0.0:0.9211:0.0:0.0789	.	535;574	E9PHT6;Q9NVE7	.;PANK4_HUMAN	M	574;535	ENSP00000367727:V574M;ENSP00000421433:V535M	ENSP00000367727:V574M	V	-	1	0	PANK4	2434194	1.000000	0.71417	0.988000	0.46212	0.487000	0.33371	4.522000	0.60539	1.242000	0.43836	0.561000	0.74099	GTG	-	superfamily_Hypothetical protein At2g17340,HMMPfam_DUF89		0.697	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK4	protein_coding	OTTHUMT00000002082.1	C			2434194	-1	no_errors	NM_018216	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MEFV	4210	genome.wustl.edu	37	16	3294554	3294554	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr16:3294554T>C	ENST00000219596.1	-	7	1684	c.1645A>G	c.(1645-1647)Act>Gct	p.T549A	MEFV_ENST00000339854.4_Missense_Mutation_p.T369A|MEFV_ENST00000536379.1_Missense_Mutation_p.T338A|MEFV_ENST00000541159.1_Missense_Mutation_p.T338A	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	549	Required for homotrimerization and induction of pyroptosomes.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						TCTTGAGGAGTGGTCCACTTT	0.512																																																0			16											147.0	136.0	140.0					16																	3294554		2197	4300	6497	3234555	SO:0001583	missense	4210			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1645A>G	16.37:g.3294554T>C	ENSP00000219596:p.Thr549Ala	Somatic		Capture	Illumina GAIIx	4	3234555	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	superfamily_DEATH domain,HMMPfam_PAAD_DAPIN,HMMPfam_zf-B_box,HMMSmart_SM00336,superfamily_B-box zinc-binding domain,HMMSmart_SM00589,HMMPfam_SPRY,HMMSmart_SM00449	p.T549A	ENST00000219596.1	37	c.1645	CCDS10498.1	16	.	.	.	.	.	.	.	.	.	.	T	1.193	-0.634791	0.03584	.	.	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000541159;ENST00000536379;ENST00000534868	T;T;T;T	0.63744	-0.06;0.37;0.27;0.39	5.07	-0.0244	0.13939	.	0.715122	0.12693	N	0.447022	T	0.44932	0.1317	L	0.33485	1.01	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.26155	-1.0111	10	0.25751	T	0.34	-24.6849	6.895	0.24251	0.0:0.0836:0.4544:0.462	.	549	O15553	MEFV_HUMAN	A	549;549;369;338;338;338	ENSP00000219596:T549A;ENSP00000339639:T369A;ENSP00000438711:T338A;ENSP00000445079:T338A	ENSP00000219596:T549A	T	-	1	0	MEFV	3234555	0.015000	0.18098	0.002000	0.10522	0.001000	0.01503	-0.090000	0.11163	0.088000	0.17205	-1.698000	0.00723	ACT	-	NULL		0.512	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	protein_coding	OTTHUMT00000251464.1	T	NM_000243		3234555	-1	no_errors	NM_000243	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
CORO7	79585	genome.wustl.edu	37	16	4414870	4414870	+	Missense_Mutation	SNP	C	C	G	rs556405302		TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr16:4414870C>G	ENST00000251166.4	-	12	1095	c.950G>C	c.(949-951)cGg>cCg	p.R317P	CORO7_ENST00000423908.2_Missense_Mutation_p.R149P|CORO7_ENST00000537233.2_Missense_Mutation_p.R299P|CORO7_ENST00000539968.1_Missense_Mutation_p.R97P|CORO7-PAM16_ENST00000572467.1_Missense_Mutation_p.R317P|CORO7_ENST00000574025.1_Missense_Mutation_p.R232P	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	317					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						CAGCGCCTGCCGGGGCACAAG	0.662																																																0			16											30.0	26.0	27.0					16																	4414870		2194	4293	6487	4354871	SO:0001583	missense	79585			AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.950G>C	16.37:g.4414870C>G	ENSP00000251166:p.Arg317Pro	Somatic		Capture	Illumina GAIIx	4	4354871	B4DFD6|B4DL18|I3L416|Q17RK4	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,HMMPfam_DUF1900,PatternScan_WD_REPEATS_1	p.R317P	ENST00000251166.4	37	c.950	CCDS10513.1	16	.	.	.	.	.	.	.	.	.	.	C	17.28	3.348625	0.61183	.	.	ENSG00000103426	ENST00000251166;ENST00000537233;ENST00000539968;ENST00000423908	T;T;T	0.32272	1.46;1.46;1.46	5.31	4.35	0.52113	Domain of unknown function DUF1900 (1);	0.629307	0.13136	N	0.411018	T	0.51295	0.1666	M	0.62088	1.915	0.41784	D	0.989833	D;D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;0.998;0.999	D;D;D;D;D;D	0.91635	0.99;0.999;0.976;0.999;0.967;0.985	T	0.47674	-0.9099	10	0.87932	D	0	-28.9619	9.8148	0.40846	0.0:0.8408:0.0:0.1592	.	232;299;97;97;317;298	P57737-2;B4DFD6;B3KSY4;B3KUH7;P57737;B4DKU9	.;.;.;.;CORO7_HUMAN;.	P	317;232;97;149	ENSP00000251166:R317P;ENSP00000446221:R97P;ENSP00000391530:R149P	ENSP00000251166:R317P	R	-	2	0	CORO7	4354871	1.000000	0.71417	1.000000	0.80357	0.296000	0.27459	3.055000	0.49916	1.224000	0.43551	0.455000	0.32223	CGG	-	HMMPfam_DUF1900		0.662	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO7	protein_coding	OTTHUMT00000251628.2	C	NM_024535		4354871	-1	no_errors	NM_024535	genbank	human	validated	54_36p	missense	SNP	0.998	G
FBXO18	84893	genome.wustl.edu	37	10	5948407	5948407	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr10:5948407C>G	ENST00000362091.4	+	3	680	c.565C>G	c.(565-567)Cct>Gct	p.P189A	FBXO18_ENST00000470089.1_3'UTR|FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000379999.5_Missense_Mutation_p.P240A	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	189					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GGACGTGGGTCCTGATCCCAT	0.582																																																0			10											79.0	62.0	68.0					10																	5948407		2203	4300	6503	5988413	SO:0001583	missense	84893			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.565C>G	10.37:g.5948407C>G	ENSP00000355415:p.Pro189Ala	Somatic		Capture	Illumina GAIIx	4	5988413	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	superfamily_SSF81383,HMMPfam_F-box,HMMSmart_FBOX,superfamily_SSF52540	p.P240A	ENST00000362091.4	37	c.718	CCDS7072.1	10	.	.	.	.	.	.	.	.	.	.	C	1.586	-0.530208	0.04112	.	.	ENSG00000134452	ENST00000362091;ENST00000379999	.	.	.	5.76	5.76	0.90799	.	0.376195	0.28062	N	0.016747	T	0.57359	0.2048	L	0.57536	1.79	0.50313	D	0.99986	B;B;B	0.26547	0.152;0.017;0.011	B;B;B	0.24394	0.053;0.004;0.014	T	0.52079	-0.8623	9	0.20519	T	0.43	-4.1469	14.4137	0.67135	0.1843:0.8157:0.0:0.0	.	240;189;115	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	A	189;240	.	ENSP00000355415:P189A	P	+	1	0	FBXO18	5988413	0.008000	0.16893	0.027000	0.17364	0.002000	0.02628	1.541000	0.36126	2.713000	0.92767	0.655000	0.94253	CCT	-	NULL		0.582	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	protein_coding	OTTHUMT00000046596.1	C	NM_032807		5988413	+1	no_errors	NM_032807	genbank	human	reviewed	54_36p	missense	SNP	0.683	G
THUMPD3	25917	genome.wustl.edu	37	3	9416212	9416212	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr3:9416212A>T	ENST00000345094.3	+	5	1154	c.820A>T	c.(820-822)Atc>Ttc	p.I274F	THUMPD3_ENST00000452837.2_Missense_Mutation_p.I274F|SETD5-AS1_ENST00000468186.1_RNA|THUMPD3_ENST00000515662.2_Missense_Mutation_p.I274F	NM_001114092.1|NM_015453.2	NP_001107564.1|NP_056268.2	Q9BV44	THUM3_HUMAN	THUMP domain containing 3	274	THUMP. {ECO:0000255|PROSITE- ProRule:PRU00529}.					cytoplasm (GO:0005737)|nucleolus (GO:0005730)	methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	19	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.101)		TCTTTTGAACATCCATGATAA	0.388																																																0			3											164.0	154.0	157.0					3																	9416212		2203	4300	6503	9391212	SO:0001583	missense	25917			AL117483	CCDS2573.1	3p25.3	2004-06-04			ENSG00000134077	ENSG00000134077			24493	protein-coding gene	gene with protein product						12477932	Standard	NM_015453		Approved	DKFZP434F091	uc003brn.4	Q9BV44	OTTHUMG00000097031	ENST00000345094.3:c.820A>T	3.37:g.9416212A>T	ENSP00000339532:p.Ile274Phe	Somatic		Capture	Illumina GAIIx	4	9391212	Q9H8V6|Q9NVC1|Q9UFS3	Missense_Mutation	SNP	HMMPfam_THUMP,HMMPfam_UPF0020,superfamily_SSF53335,PatternScan_UPF0020	p.I274F	ENST00000345094.3	37	c.820	CCDS2573.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.1|20.1	3.940243|3.940243	0.73557|0.73557	.|.	.|.	ENSG00000134077|ENSG00000134077	ENST00000416603|ENST00000452837;ENST00000345094;ENST00000515662	.|T;T;T	.|0.54279	.|0.58;0.58;0.58	5.57|5.57	4.21|4.21	0.49690|0.49690	.|THUMP (3);	.|0.043563	.|0.85682	.|D	.|0.000000	T|T	0.70228|0.70228	0.3200|0.3200	M|M	0.81682|0.81682	2.555|2.555	0.80722|0.80722	D|D	1|1	.|D	.|0.61080	.|0.989	.|D	.|0.69654	.|0.965	T|T	0.72707|0.72707	-0.4212|-0.4212	5|10	.|0.48119	.|T	.|0.1	-11.6329|-11.6329	11.8003|11.8003	0.52122|0.52122	0.9187:0.0:0.0813:0.0|0.9187:0.0:0.0813:0.0	.|.	.|274	.|Q9BV44	.|THUM3_HUMAN	L|F	106|274	.|ENSP00000395893:I274F;ENSP00000339532:I274F;ENSP00000424064:I274F	.|ENSP00000339532:I274F	H|I	+|+	2|1	0|0	THUMPD3|THUMPD3	9391212|9391212	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.716000|0.716000	0.41182|0.41182	7.467000|7.467000	0.80930|0.80930	2.107000|2.107000	0.64212|0.64212	0.477000|0.477000	0.44152|0.44152	CAT|ATC	-	HMMPfam_THUMP		0.388	THUMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THUMPD3	protein_coding	OTTHUMT00000214127.1	A	NM_015453		9391212	+1	no_errors	NM_015453	genbank	human	validated	54_36p	missense	SNP	1.000	T
MYH4	4622	genome.wustl.edu	37	17	10363542	10363542	+	Missense_Mutation	SNP	G	G	T	rs111500941	byFrequency	TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr17:10363542G>T	ENST00000255381.2	-	13	1354	c.1244C>A	c.(1243-1245)aCc>aAc	p.T415N	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	415	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CTGGCCTTTGGTTACGAACTC	0.423																																																0			17											123.0	112.0	116.0					17																	10363542		2203	4300	6503	10304267	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.1244C>A	17.37:g.10363542G>T	ENSP00000255381:p.Thr415Asn	Somatic		Capture	Illumina GAIIx	4	10304267		Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_Myosin_tail_1	p.T415N	ENST00000255381.2	37	c.1244	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878193	0.91664	.	.	ENSG00000141048	ENST00000255381	D	0.87809	-2.3	5.56	5.56	0.83823	Myosin head, motor domain (2);	0.000000	0.38492	U	0.001676	D	0.94430	0.8208	M	0.85777	2.775	0.80722	D	1	D	0.64830	0.994	D	0.77557	0.99	D	0.94596	0.7792	10	0.87932	D	0	.	19.8925	0.96935	0.0:0.0:1.0:0.0	.	415	Q9Y623	MYH4_HUMAN	N	415	ENSP00000255381:T415N	ENSP00000255381:T415N	T	-	2	0	MYH4	10304267	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	9.801000	0.99128	2.787000	0.95880	0.650000	0.86243	ACC	-	superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head		0.423	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	protein_coding	OTTHUMT00000252731.1	G	NM_017533		10304267	-1	no_errors	NM_017533	genbank	human	validated	54_36p	missense	SNP	1.000	T
ZNF440	126070	genome.wustl.edu	37	19	11943370	11943370	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr19:11943370G>A	ENST00000304060.5	+	4	1543	c.1379G>A	c.(1378-1380)tGt>tAt	p.C460Y		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	460					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						CGTTATAAATGTAAGATATGT	0.363																																																0			19											61.0	66.0	64.0					19																	11943370		2201	4300	6501	11804370	SO:0001583	missense	126070			AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	ENST00000304060.5:c.1379G>A	19.37:g.11943370G>A	ENSP00000305373:p.Cys460Tyr	Somatic		Capture	Illumina GAIIx	4	11804370	Q8N1R9	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.C460Y	ENST00000304060.5	37	c.1379	CCDS42503.1	19	.	.	.	.	.	.	.	.	.	.	g	13.55	2.272037	0.40194	.	.	ENSG00000171295	ENST00000304060	D	0.85088	-1.94	0.725	0.725	0.18242	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92189	0.7523	M	0.90759	3.145	0.29310	N	0.868067	D	0.89917	1.0	D	0.80764	0.994	D	0.84904	0.0844	9	0.87932	D	0	.	8.9993	0.36072	0.0:0.0:1.0:0.0	.	460	Q8IYI8	ZN440_HUMAN	Y	460	ENSP00000305373:C460Y	ENSP00000305373:C460Y	C	+	2	0	ZNF440	11804370	1.000000	0.71417	0.078000	0.20375	0.070000	0.16714	6.961000	0.76042	0.688000	0.31529	0.194000	0.17425	TGT	-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.363	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF440	protein_coding	OTTHUMT00000344508.1	G	NM_152357		11804370	+1	no_errors	NM_152357	genbank	human	validated	54_36p	missense	SNP	0.098	A
TLR8	51311	genome.wustl.edu	37	X	12938969	12938969	+	Missense_Mutation	SNP	A	A	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chrX:12938969A>T	ENST00000218032.6	+	2	1897	c.1810A>T	c.(1810-1812)Aac>Tac	p.N604Y	TLR8_ENST00000311912.5_Missense_Mutation_p.N622Y	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	604					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	AGATAAGTATAACCTGGAAAG	0.343																																																0			X											54.0	54.0	54.0					X																	12938969		2202	4298	6500	12848890	SO:0001583	missense	51311			AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.1810A>T	X.37:g.12938969A>T	ENSP00000218032:p.Asn604Tyr	Somatic		Capture	Illumina GAIIx	4	12848890	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRR_1,superfamily_SSF52047,HMMSmart_LRR_TYP,HMMSmart_LRRCT,superfamily_TIR,HMMPfam_TIR	p.N604Y	ENST00000218032.6	37	c.1810	CCDS14152.1	X	.	.	.	.	.	.	.	.	.	.	A	3.570	-0.087857	0.07097	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.79454	-1.27;-1.27	5.97	-11.9	0.00025	.	3.018720	0.01344	N	0.011670	T	0.54334	0.1852	N	0.11560	0.145	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.49263	-0.8958	10	0.62326	D	0.03	.	7.911	0.29791	0.1562:0.2993:0.4682:0.0763	.	604;622	Q9NR97;D1CS70	TLR8_HUMAN;.	Y	604;622	ENSP00000218032:N604Y;ENSP00000312082:N622Y	ENSP00000218032:N604Y	N	+	1	0	TLR8	12848890	0.061000	0.20836	0.000000	0.03702	0.005000	0.04900	0.107000	0.15375	-1.937000	0.01047	0.486000	0.48141	AAC	-	superfamily_SSF52058		0.343	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR8	protein_coding	OTTHUMT00000055784.2	A	NM_016610		12848890	+1	no_errors	NM_138636	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
CROCCP2	84809	genome.wustl.edu	37	1	16959836	16959836	+	lincRNA	SNP	G	G	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr1:16959836G>A	ENST00000412962.1	-	0	21							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CAGCTGCAGCGGGTCCCTTGG	0.632																																																0			1																																								16832423			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16959836G>A		Somatic		Capture	Illumina GAIIx	4	16832423	Q8NF65|Q96FR5|Q9BRE8	Silent	SNP	NULL	p.P10	ENST00000412962.1	37	c.30		1																																																																																			-	NULL		0.632	CROCCP2-003	KNOWN	basic	lincRNA	ENSG00000186543	lincRNA	OTTHUMT00000092784.1	G	NR_026752.1		16832423	-1	no_errors	ENST00000362058	ensembl	human	known	54_36p	silent	SNP	0.988	A
ANO8	57719	genome.wustl.edu	37	19	17435753	17435753	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr19:17435753G>T	ENST00000159087.4	-	17	3262	c.3104C>A	c.(3103-3105)aCc>aAc	p.T1035N		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	1035					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						GTCCCGCCGGGTCTCGGGTGA	0.682																																																0			19											70.0	87.0	81.0					19																	17435753		2203	4300	6503	17296753	SO:0001583	missense	57719			AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.3104C>A	19.37:g.17435753G>T	ENSP00000159087:p.Thr1035Asn	Somatic		Capture	Illumina GAIIx	4	17296753	A6NIJ0	Missense_Mutation	SNP	HMMPfam_DUF590	p.T1035N	ENST00000159087.4	37	c.3104	CCDS32949.1	19	.	.	.	.	.	.	.	.	.	.	G	5.483	0.274113	0.10403	.	.	ENSG00000074855	ENST00000159087	T	0.61040	0.14	3.8	2.72	0.32119	.	0.354001	0.26000	U	0.026954	T	0.30135	0.0755	N	0.04508	-0.205	0.22796	N	0.998729	B	0.29909	0.261	B	0.23574	0.047	T	0.14008	-1.0488	10	0.23891	T	0.37	.	10.7906	0.46429	0.0:0.1951:0.8048:0.0	.	1035	Q9HCE9	ANO8_HUMAN	N	1035	ENSP00000159087:T1035N	ENSP00000159087:T1035N	T	-	2	0	ANO8	17296753	1.000000	0.71417	0.997000	0.53966	0.083000	0.17756	4.379000	0.59575	0.550000	0.28991	0.478000	0.44815	ACC	-	NULL		0.682	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO8	protein_coding	OTTHUMT00000462943.1	G	XM_050644		17296753	-1	no_errors	NM_020959	genbank	human	provisional	54_36p	missense	SNP	0.998	T
SH3KBP1	30011	genome.wustl.edu	37	X	19606656	19606656	+	Intron	SNP	C	C	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chrX:19606656C>T	ENST00000397821.3	-	12	1589				SH3KBP1_ENST00000541422.1_Intron|SH3KBP1_ENST00000379698.4_Intron|SH3KBP1_ENST00000379716.1_Intron|SH3KBP1_ENST00000379697.3_Missense_Mutation_p.G512E	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1						apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						TTGAGCACCCCCTTCTCCTCT	0.582																																																0			X																																								19516577	SO:0001627	intron_variant	30011			AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.1298+104G>A	X.37:g.19606656C>T		Somatic		Capture	Illumina GAIIx	4	19516577	B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Missense_Mutation	SNP	superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.G512E	ENST00000397821.3	37	c.1535	CCDS14193.1	X	.	.	.	.	.	.	.	.	.	.	C	0.071	-1.201831	0.01581	.	.	ENSG00000147010	ENST00000379697	T	0.50001	0.76	4.45	-8.91	0.00778	.	.	.	.	.	T	0.38401	0.1039	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.57087	-0.7871	6	0.87932	D	0	.	5.8092	0.18457	0.2343:0.5508:0.1369:0.078	.	.	.	.	E	512	ENSP00000369019:G512E	ENSP00000369019:G512E	G	-	2	0	SH3KBP1	19516577	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.077000	0.03416	-5.838000	0.00009	-2.752000	0.00124	GGG	-	NULL		0.582	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3KBP1	protein_coding	OTTHUMT00000055992.1	C	NM_031892		19516577	-1	no_errors	ENST00000379697	ensembl	human	known	54_36p	missense	SNP	0.000	T
STK31	56164	genome.wustl.edu	37	7	23794028	23794028	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr7:23794028G>T	ENST00000355870.3	+	10	1347	c.1228G>T	c.(1228-1230)Gga>Tga	p.G410*	STK31_ENST00000428484.1_Nonsense_Mutation_p.G387*|STK31_ENST00000433467.2_Nonsense_Mutation_p.G410*|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000354639.3_Nonsense_Mutation_p.G387*	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	410			G -> E (in dbSNP:rs4722266). {ECO:0000269|PubMed:17344846}.			acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TTCTTTGAATGGATTAGAGAT	0.383																																																0			7											169.0	169.0	169.0					7																	23794028		2203	4300	6503	23760553	SO:0001587	stop_gained	56164			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.1228G>T	7.37:g.23794028G>T	ENSP00000348132:p.Gly410*	Somatic		Capture	Illumina GAIIx	4	23760553	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Nonsense_Mutation	SNP	HMMPfam_TUDOR,superfamily_Tudor/PWWP/MBT,HMMSmart_SM00333,HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like)	p.G410*	ENST00000355870.3	37	c.1228	CCDS5386.1	7	.	.	.	.	.	.	.	.	.	.	G	39	7.503317	0.98325	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	.	.	.	5.76	3.91	0.45181	.	0.639291	0.16334	N	0.218991	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-3.9124	6.7093	0.23268	0.1492:0.1529:0.6979:0.0	.	.	.	.	X	410;410;387;387	.	ENSP00000346660:G387X	G	+	1	0	STK31	23760553	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	2.050000	0.41297	1.407000	0.46875	0.585000	0.79938	GGA	-	NULL		0.383	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK31	protein_coding	OTTHUMT00000214036.2	G	NM_031414		23760553	+1	no_errors	NM_031414	genbank	human	reviewed	54_36p	nonsense	SNP	0.989	T
TRAPPC8	22878	genome.wustl.edu	37	18	29497613	29497613	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr18:29497613C>A	ENST00000283351.4	-	3	705	c.370G>T	c.(370-372)Gag>Tag	p.E124*	TRAPPC8_ENST00000582539.1_Nonsense_Mutation_p.E70*|TRAPPC8_ENST00000582513.1_Nonsense_Mutation_p.E124*	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	124					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CTGTAAGACTCAAACCATGGA	0.333																																																0			18											129.0	135.0	133.0					18																	29497613		2203	4300	6503	27751611	SO:0001587	stop_gained	22878			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.370G>T	18.37:g.29497613C>A	ENSP00000283351:p.Glu124*	Somatic		Capture	Illumina GAIIx	4	27751611	A0JP15|B3KME5|Q9H0L2	Nonsense_Mutation	SNP	superfamily_TPR-like	p.E124*	ENST00000283351.4	37	c.370	CCDS11901.1	18	.	.	.	.	.	.	.	.	.	.	C	37	6.068195	0.97251	.	.	ENSG00000153339	ENST00000283351	.	.	.	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	20.6013	0.99457	0.0:1.0:0.0:0.0	.	.	.	.	X	124	.	ENSP00000283351:E124X	E	-	1	0	TRAPPC8	27751611	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.487000	0.81328	2.878000	0.98634	0.650000	0.86243	GAG	-	NULL		0.333	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	KIAA1012	protein_coding	OTTHUMT00000255355.1	C	NM_014939		27751611	-1	no_errors	NM_014939	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
NOTCH4	4855	genome.wustl.edu	37	6	32188188	32188188	+	Missense_Mutation	SNP	G	G	C	rs370312303		TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr6:32188188G>C	ENST00000375023.3	-	6	1291	c.1153C>G	c.(1153-1155)Cgc>Ggc	p.R385G		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	385	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						ATACCTGTGCGTCCAGGTGGG	0.592																																																0			6											133.0	142.0	139.0					6																	32188188		1511	2709	4220	32296166	SO:0001583	missense	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1153C>G	6.37:g.32188188G>C	ENSP00000364163:p.Arg385Gly	Somatic		Capture	Illumina GAIIx	4	32296166	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	HMMSmart_SM00181,HMMPfam_EGF,HMMSmart_SM00179,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_ASX_HYDROXYL,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00004,HMMPfam_Notch,superfamily_Notch domain,HMMPfam_NODP,superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248	p.R385G	ENST00000375023.3	37	c.1153	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816503	0.50527	.	.	ENSG00000204301	ENST00000375023	D	0.91631	-2.88	4.36	4.36	0.52297	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.193071	0.25875	N	0.027725	D	0.93693	0.7985	M	0.75264	2.295	0.80722	D	1	D;B	0.61697	0.99;0.188	P;B	0.58970	0.849;0.004	D	0.94112	0.7372	10	0.62326	D	0.03	.	14.4145	0.67139	0.0:0.0:1.0:0.0	.	385;385	Q6P3V5;Q99466	.;NOTC4_HUMAN	G	385	ENSP00000364163:R385G	ENSP00000364163:R385G	R	-	1	0	NOTCH4	32296166	0.997000	0.39634	1.000000	0.80357	0.905000	0.53344	2.450000	0.44943	2.241000	0.73720	0.313000	0.20887	CGC	-	superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,PatternScan_EGF_1		0.592	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	protein_coding	OTTHUMT00000076045.2	G			32296166	-1	no_errors	NM_004557	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
GOLGA8A	23015	genome.wustl.edu	37	15	34782058	34782058	+	Intron	SNP	T	T	C			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr15:34782058T>C	ENST00000543376.1	-	8	1158							A7E2F4	GOG8A_HUMAN	golgin A8 family, member A							Golgi apparatus (GO:0005794)|membrane (GO:0016020)							all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		GGGCTGCCTCTGGCGTTTGTT	0.582																																																0			15																																								32569350	SO:0001627	intron_variant	644390			BX648160	CCDS10038.1	15q14	2011-10-25	2010-02-12		ENSG00000175265	ENSG00000175265			31972	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 8A"""			10660574, 10677249	Standard	NM_181077		Approved	GM88, GOLGIN-67	uc001zii.3	A7E2F4	OTTHUMG00000129447	ENST00000543376.1:c.1596+47486A>G	15.37:g.34782058T>C		Somatic		Capture	Illumina GAIIx	4	32569350	A7MCY9|B7ZMK5|O94937|Q52M46|Q68DK6|Q9NZG8|Q9NZW0|Q9NZW3	RNA	SNP	-	NULL	ENST00000543376.1	37	NULL		15																																																																																			-	-		0.582	GOLGA8A-203	KNOWN	basic|appris_candidate	protein_coding	LOC644390	protein_coding		T	NM_181076		32569350	-1	pseudogene	XR_016623	genbank	human	model	54_36p	rna	SNP	1.000	C
TULP1	7287	genome.wustl.edu	37	6	35479548	35479548	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr6:35479548G>C	ENST00000229771.6	-	4	305	c.226C>G	c.(226-228)Cca>Gca	p.P76A	TULP1_ENST00000322263.4_Intron	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	76					dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						GCTGGGTCTGGGGAAGGCTCC	0.721																																					GBM(55;1027 1091 11115 23439)											0			6											6.0	8.0	7.0					6																	35479548		2156	4229	6385	35587526	SO:0001583	missense	7287			U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.226C>G	6.37:g.35479548G>C	ENSP00000229771:p.Pro76Ala	Somatic		Capture	Illumina GAIIx	4	35587526	O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	superfamily_Transcriptional factor tubby C-terminal domain,HMMPfam_Tub,PatternScan_TUB_1,PatternScan_TUB_2	p.P76A	ENST00000229771.6	37	c.226	CCDS4807.1	6	.	.	.	.	.	.	.	.	.	.	G	11.19	1.566788	0.28003	.	.	ENSG00000112041	ENST00000229771	T	0.79653	-1.29	3.53	2.62	0.31277	.	10.136700	0.00520	N	0.000181	T	0.43456	0.1248	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36601	-0.9741	10	0.40728	T	0.16	.	9.6499	0.39890	0.0:0.4404:0.5596:0.0	.	76	O00294	TULP1_HUMAN	A	76	ENSP00000229771:P76A	ENSP00000229771:P76A	P	-	1	0	TULP1	35587526	0.000000	0.05858	0.002000	0.10522	0.774000	0.43823	-0.635000	0.05471	0.764000	0.33197	0.313000	0.20887	CCA	-	NULL		0.721	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP1	protein_coding	OTTHUMT00000040307.2	G			35587526	-1	no_errors	NM_003322	genbank	human	reviewed	54_36p	missense	SNP	0.001	C
KRT28	162605	genome.wustl.edu	37	17	38955772	38955772	+	Missense_Mutation	SNP	T	T	C			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr17:38955772T>C	ENST00000306658.7	-	1	439	c.374A>G	c.(373-375)tAc>tGc	p.Y125C		NM_181535.3	NP_853513.2			keratin 28											NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				TCCAGGTCCGTATTTTTCATA	0.413																																					Melanoma(19;789 869 15380 26882 39836)											0			17											150.0	148.0	148.0					17																	38955772		2203	4300	6503	36209298	SO:0001583	missense	162605			AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.374A>G	17.37:g.38955772T>C	ENSP00000305263:p.Tyr125Cys	Somatic		Capture	Illumina GAIIx	4	36209298		Missense_Mutation	SNP	HMMPfam_Filament	p.Y125C	ENST00000306658.7	37	c.374	CCDS11376.1	17	.	.	.	.	.	.	.	.	.	.	T	10.72	1.429408	0.25726	.	.	ENSG00000173908	ENST00000306658	D	0.88509	-2.39	5.18	4.04	0.47022	Filament (1);	0.248759	0.28694	N	0.014455	T	0.81861	0.4912	L	0.28740	0.885	0.34299	D	0.684087	B	0.11235	0.004	B	0.13407	0.009	T	0.82676	-0.0339	10	0.44086	T	0.13	.	11.1378	0.48386	0.1376:0.0:0.0:0.8624	.	125	Q7Z3Y7	K1C28_HUMAN	C	125	ENSP00000305263:Y125C	ENSP00000305263:Y125C	Y	-	2	0	KRT28	36209298	0.016000	0.18221	0.728000	0.30774	0.850000	0.48378	2.072000	0.41510	2.094000	0.63399	0.528000	0.53228	TAC	-	HMMPfam_Filament		0.413	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT28	protein_coding	OTTHUMT00000257201.2	T	NM_181535		36209298	-1	no_errors	NM_181535	genbank	human	validated	54_36p	missense	SNP	0.953	C
EIF3L	51386	genome.wustl.edu	37	22	38245380	38245380	+	5'UTR	SNP	C	C	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr22:38245380C>A	ENST00000412331.2	+	0	506				MIR659_ENST00000384963.1_RNA|EIF3L_ENST00000406934.1_5'Flank|ANKRD54_ENST00000609454.1_5'Flank|EIF3L_ENST00000381683.6_5'Flank	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L											kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CCGAGTGGGGCTGAACTTCCG	0.627																																																0			22											21.0	21.0	21.0					22																	38245380		692	1591	2283	36575326	SO:0001623	5_prime_UTR_variant	51386			AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.-77C>A	22.37:g.38245380C>A		Somatic		Capture	Illumina GAIIx	4	36575326		Missense_Mutation	SNP	HMMPfam_Paf67	p.A18D	ENST00000412331.2	37	c.53	CCDS13960.1	22	.	.	.	.	.	.	.	.	.	.	C	19.63	3.864392	0.71949	.	.	ENSG00000100129	ENST00000425539	.	.	.	4.73	-8.03	0.01114	.	.	.	.	.	T	0.34308	0.0893	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.52124	-0.8617	5	0.87932	D	0	7.3259	7.1526	0.25618	0.0:0.2345:0.4401:0.3254	.	.	.	.	D	18	.	ENSP00000400645:A18D	A	+	2	0	EIF3L	36575326	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.240000	0.08952	-1.247000	0.02507	-0.894000	0.02916	GCT	-	NULL		0.627	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3EIP	protein_coding	OTTHUMT00000319551.2	C	NM_016091		36575326	+1	no_errors	ENST00000262832	ensembl	human	known	54_36p	missense	SNP	0.000	A
PAX5	5079	genome.wustl.edu	37	9	37006474	37006474	+	Missense_Mutation	SNP	G	G	C	rs371911756		TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr9:37006474G>C	ENST00000358127.4	-	4	545	c.471C>G	c.(469-471)agC>agG	p.S157R	PAX5_ENST00000520281.1_Missense_Mutation_p.S157R|RP11-297B17.3_ENST00000509911.2_RNA|PAX5_ENST00000523241.1_Missense_Mutation_p.S157R|PAX5_ENST00000523145.1_Missense_Mutation_p.S49R|PAX5_ENST00000377847.2_Missense_Mutation_p.S157R|PAX5_ENST00000520154.1_Missense_Mutation_p.S157R|PAX5_ENST00000377853.2_Missense_Mutation_p.S157R|PAX5_ENST00000377852.2_Missense_Mutation_p.S157R|PAX5_ENST00000446742.1_Missense_Mutation_p.S91R|PAX5_ENST00000414447.1_Missense_Mutation_p.S157R|PAX5_ENST00000522003.1_Missense_Mutation_p.S49R	NM_001280554.1|NM_001280556.1|NM_016734.1	NP_001267483.1|NP_001267485.1|NP_057953.1	Q02548	PAX5_HUMAN	paired box 5	157					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(40)	PAX5/JAK2(18)	NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(151)|kidney(1)|lung(10)|prostate(1)|skin(1)	171		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		TCTTACCTATGCTGTGACTGG	0.368			"""T, Mis, D, F, S"""	"""IGH@, ETV6, PML, FOXP1, ZNF521, ELN"""	"""NHL, ALL, B-ALL"""																																		Dom	yes		9	9p13	5079	paired box gene 5 (B-cell lineage specific activator protein)		L	40	Unknown(40)	haematopoietic_and_lymphoid_tissue(40)	9											164.0	162.0	162.0					9																	37006474		2203	4300	6503	36996474	SO:0001583	missense	5079				CCDS6607.1, CCDS65039.1, CCDS65040.1, CCDS65041.1, CCDS65042.1, CCDS65043.1, CCDS65044.1, CCDS65045.1, CCDS65046.1, CCDS65047.1, CCDS65048.1	9p13.2	2011-06-20	2007-07-12		ENSG00000196092	ENSG00000196092		"""Paired boxes"", ""Homeoboxes / PRD class"""	8619	protein-coding gene	gene with protein product	"""B-cell lineage specific activator"""	167414	"""paired box gene 5 (B-cell lineage specific activator protein)"", ""paired box gene 5 (B-cell lineage specific activator)"""			1516825, 8431641	Standard	NM_016734		Approved	BSAP	uc003zzo.1	Q02548	OTTHUMG00000019907	ENST00000358127.4:c.471C>G	9.37:g.37006474G>C	ENSP00000350844:p.Ser157Arg	Somatic		Capture	Illumina GAIIx	4	36996474	A3QVP6|A3QVP7|A3QVP8|C0KTF6|C0KTF7|C0KTF8|C0KTF9|C0KTG0|O75933|Q5SFM2|Q6S728|Q6S729|Q6S730|Q6S731|Q6S732	Missense_Mutation	SNP	HMMPfam_PAX,HMMSmart_SM00351,superfamily_Homeodomain-like,PatternScan_PAIRED_1	p.S157R	ENST00000358127.4	37	c.471	CCDS6607.1	9	.	.	.	.	.	.	.	.	.	.	G	12.86	2.063725	0.36373	.	.	ENSG00000196092	ENST00000358127;ENST00000377849;ENST00000377853;ENST00000377852;ENST00000523241;ENST00000520154;ENST00000520281;ENST00000446742;ENST00000522003;ENST00000523145;ENST00000414447;ENST00000377847	D;D;D;D;D;D;D;D;D;D;D	0.97924	-4.13;-4.13;-4.12;-4.61;-4.61;-4.61;-3.63;-1.92;-2.48;-4.6;-4.61	5.32	2.13	0.27403	.	0.090839	0.85682	D	0.000000	D	0.96987	0.9016	L	0.40543	1.245	0.39496	D	0.968123	B;P;D;B;B;P;P;P;P	0.76494	0.244;0.454;0.999;0.244;0.389;0.791;0.895;0.895;0.895	B;B;D;B;B;B;B;P;P	0.73380	0.055;0.153;0.98;0.055;0.25;0.368;0.264;0.514;0.514	D	0.94245	0.7488	10	0.24483	T	0.36	.	9.4413	0.38670	0.2581:0.0:0.7419:0.0	.	157;157;91;157;157;157;157;157;157	C0KTF8;C0KTF7;C0KTF9;C0KTF6;E7ERW5;E7EQT0;Q6S730;Q6S731;Q02548	.;.;.;.;.;.;.;.;PAX5_HUMAN	R	157;49;157;157;157;157;157;91;49;49;157;157	ENSP00000350844:S157R;ENSP00000367084:S157R;ENSP00000367083:S157R;ENSP00000429637:S157R;ENSP00000429291:S157R;ENSP00000430773:S157R;ENSP00000404687:S91R;ENSP00000429359:S49R;ENSP00000429197:S49R;ENSP00000412188:S157R;ENSP00000367078:S157R	ENSP00000350844:S157R	S	-	3	2	PAX5	36996474	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.758000	0.38410	0.193000	0.20303	0.650000	0.86243	AGC	-	NULL		0.368	PAX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX5	protein_coding	OTTHUMT00000052433.1	G			36996474	-1	no_errors	NM_016734	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
L3MBTL1	26013	genome.wustl.edu	37	20	42143412	42143412	+	Silent	SNP	G	G	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr20:42143412G>A	ENST00000427442.2	+	4	591	c.432G>A	c.(430-432)caG>caA	p.Q144Q	L3MBTL1_ENST00000373135.3_Silent_p.Q76Q|L3MBTL1_ENST00000373134.1_Silent_p.Q76Q|L3MBTL1_ENST00000457824.1_3'UTR|L3MBTL1_ENST00000418998.1_Silent_p.Q144Q|L3MBTL1_ENST00000444063.1_Silent_p.Q76Q			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	76					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						GCCCCCAACAGGCGGGTAGGA	0.761																																																0			20											3.0	5.0	4.0					20																	42143412		1914	3818	5732	41576826	SO:0001819	synonymous_variant	26013			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.432G>A	20.37:g.42143412G>A		Somatic		Capture	Illumina GAIIx	4	41576826	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Silent	SNP	superfamily_Tudor/PWWP/MBT,HMMSmart_SM00561,HMMPfam_MBT,superfamily_CCHHC domain,HMMPfam_zf-C2HC	p.Q76	ENST00000427442.2	37	c.228	CCDS46602.2	20																																																																																			-	NULL		0.761	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL	protein_coding	OTTHUMT00000079300.3	G	NM_032107		41576826	+1	no_errors	NM_015478	genbank	human	reviewed	54_36p	silent	SNP	0.001	A
SPTBN4	57731	genome.wustl.edu	37	19	41081446	41081446	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr19:41081446G>T	ENST00000352632.3	+	36	7752	c.7666G>T	c.(7666-7668)Gat>Tat	p.D2556Y	SPTBN4_ENST00000598249.1_Missense_Mutation_p.D2556Y|SHKBP1_ENST00000600733.1_5'Flank|SPTBN4_ENST00000392025.1_Missense_Mutation_p.D1299Y|SHKBP1_ENST00000291842.5_5'Flank|SPTBN4_ENST00000593816.1_3'UTR			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2556					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGAAGGCGGAGATCGCAGGGC	0.602																																																0			19											47.0	35.0	39.0					19																	41081446		2202	4300	6502	45773286	SO:0001583	missense	57731			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.7666G>T	19.37:g.41081446G>T	ENSP00000263373:p.Asp2556Tyr	Somatic		Capture	Illumina GAIIx	4	45773286	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.D2556Y	ENST00000352632.3	37	c.7666	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762978	0.31228	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	T;T	0.76060	-0.99;0.34	4.65	4.65	0.58169	.	0.633680	0.14081	U	0.342702	T	0.56963	0.2021	N	0.08118	0	0.80722	D	1	B;B	0.27732	0.187;0.187	B;B	0.24974	0.057;0.03	T	0.59600	-0.7424	10	0.66056	D	0.02	.	13.3879	0.60805	0.0:0.0:1.0:0.0	.	1299;2556	C9JY79;Q9H254	.;SPTN4_HUMAN	Y	2556;2556;1299	ENSP00000263373:D2556Y;ENSP00000375879:D1299Y	ENSP00000263373:D2556Y	D	+	1	0	SPTBN4	45773286	0.999000	0.42202	0.988000	0.46212	0.128000	0.20619	1.183000	0.32041	2.296000	0.77279	0.462000	0.41574	GAT	-	NULL		0.602	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	protein_coding	OTTHUMT00000462559.2	G			45773286	+1	no_errors	NM_020971	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
EPAS1	2034	genome.wustl.edu	37	2	46608769	46608769	+	Missense_Mutation	SNP	G	G	A	rs375544083		TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr2:46608769G>A	ENST00000263734.3	+	13	2590	c.2080G>A	c.(2080-2082)Gtg>Atg	p.V694M		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	694					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			AGGCCCAGACGTGCTGAGTCC	0.592																																																0			2											54.0	54.0	54.0					2																	46608769		2203	4300	6503	46462273	SO:0001583	missense	2034			U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.2080G>A	2.37:g.46608769G>A	ENSP00000263734:p.Val694Met	Somatic		Capture	Illumina GAIIx	4	46462273	Q86VA2|Q99630	Missense_Mutation	SNP	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH,HMMSmart_PAS,superfamily_SSF55785,HMMPfam_PAS_3,HMMSmart_PAC,HMMPfam_HIF-1a_CTAD	p.V694M	ENST00000263734.3	37	c.2080	CCDS1825.1	2	.	.	.	.	.	.	.	.	.	.	G	3.947	-0.012961	0.07727	.	.	ENSG00000116016	ENST00000263734	T	0.48522	0.81	4.67	-1.87	0.07737	.	3.063880	0.00754	N	0.001081	T	0.30510	0.0767	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.32188	-0.9916	10	0.45353	T	0.12	.	10.8587	0.46815	0.6552:0.0:0.3448:0.0	.	694	Q99814	EPAS1_HUMAN	M	694	ENSP00000263734:V694M	ENSP00000263734:V694M	V	+	1	0	EPAS1	46462273	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.119000	0.10676	-0.265000	0.09352	-0.244000	0.11960	GTG	-	NULL		0.592	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPAS1	protein_coding	OTTHUMT00000250752.2	G	NM_001430		46462273	+1	no_errors	NM_001430	genbank	human	validated	54_36p	missense	SNP	0.034	A
SYN1	6853	genome.wustl.edu	37	X	47433449	47433449	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chrX:47433449G>A	ENST00000295987.7	-	12	2058	c.1934C>T	c.(1933-1935)cCg>cTg	p.P645L	SYN1_ENST00000340666.4_Missense_Mutation_p.P645L	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	645	D; Pro-rich linker.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						GGCGGGTGGCGGCACGTCCTG	0.726																																																0			X											6.0	7.0	7.0					X																	47433449		1986	3859	5845	47318393	SO:0001583	missense	6853				CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.1934C>T	X.37:g.47433449G>A	ENSP00000295987:p.Pro645Leu	Somatic		Capture	Illumina GAIIx	4	47318393	B1AJQ1|O75825|Q5H9A9	Missense_Mutation	SNP	HMMPfam_Synapsin_N,PatternScan_SYNAPSIN_1,HMMPfam_Synapsin,superfamily_PreATP-grasp domain,superfamily_Glutathione synthetase ATP-binding domain-like,HMMPfam_Synapsin_C,PatternScan_SYNAPSIN_2	p.P645L	ENST00000295987.7	37	c.1934	CCDS14280.1	X	.	.	.	.	.	.	.	.	.	.	g	13.73	2.325523	0.41197	.	.	ENSG00000008056	ENST00000295987;ENST00000340666	T;T	0.33865	1.8;1.39	4.4	3.54	0.40534	.	0.579380	0.15749	N	0.246511	T	0.23532	0.0569	N	0.19112	0.55	0.43907	D	0.996546	B;B	0.21688	0.035;0.059	B;B	0.12837	0.003;0.008	T	0.04041	-1.0982	10	0.52906	T	0.07	-2.3278	9.6571	0.39932	0.1076:0.0:0.8923:0.0	.	645;645	P17600;P17600-2	SYN1_HUMAN;.	L	645	ENSP00000295987:P645L;ENSP00000343206:P645L	ENSP00000295987:P645L	P	-	2	0	SYN1	47318393	0.994000	0.37717	0.896000	0.35187	0.822000	0.46500	1.470000	0.35354	0.792000	0.33850	-0.430000	0.05897	CCG	-	NULL		0.726	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYN1	protein_coding	OTTHUMT00000056445.1	G	NM_006950		47318393	-1	no_errors	NM_006950	genbank	human	reviewed	54_36p	missense	SNP	0.985	A
CORIN	10699	genome.wustl.edu	37	4	47679958	47679958	+	Missense_Mutation	SNP	C	C	G	rs149563697	byFrequency	TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr4:47679958C>G	ENST00000273857.4	-	9	1245	c.1246G>C	c.(1246-1248)Gtc>Ctc	p.V416L	CORIN_ENST00000508498.1_Missense_Mutation_p.V277L|CORIN_ENST00000502252.1_Missense_Mutation_p.V349L|CORIN_ENST00000504584.1_Missense_Mutation_p.V379L|CORIN_ENST00000505909.1_Missense_Mutation_p.V379L	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	416					female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						CACTTACTGACGCTGCAGTTC	0.493																																																0			4											143.0	119.0	128.0					4																	47679958		2203	4300	6503	47374715	SO:0001583	missense	10699			AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.1246G>C	4.37:g.47679958C>G	ENSP00000273857:p.Val416Leu	Somatic		Capture	Illumina GAIIx	4	47374715	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	HMMPfam_Fz,superfamily_Frizzled cysteine-rich domain,HMMSmart_SM00063,superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,superfamily_SRCR-like,HMMSmart_SM00202,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_SRCR_1,PatternScan_TRYPSIN_SER	p.V416L	ENST00000273857.4	37	c.1246	CCDS3477.1	4	.	.	.	.	.	.	.	.	.	.	C	8.387	0.838754	0.16891	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	D;D;D;D;D	0.89196	-2.24;-2.24;-2.24;-2.48;-2.24	5.83	0.433	0.16534	.	0.895862	0.09856	N	0.746869	T	0.72342	0.3448	N	0.08118	0	0.09310	N	1	B;B;B;B	0.14012	0.001;0.006;0.009;0.0	B;B;B;B	0.17722	0.005;0.005;0.019;0.002	T	0.57406	-0.7817	10	0.12766	T	0.61	.	4.0723	0.09887	0.2697:0.4438:0.0:0.2865	.	379;379;349;416	B7Z4R1;B4E2W9;B4E1Y7;Q9Y5Q5	.;.;.;CORIN_HUMAN	L	416;277;349;379;379	ENSP00000273857:V416L;ENSP00000425597:V277L;ENSP00000424212:V349L;ENSP00000425401:V379L;ENSP00000423216:V379L	ENSP00000273857:V416L	V	-	1	0	CORIN	47374715	0.000000	0.05858	0.004000	0.12327	0.544000	0.35116	-0.172000	0.09868	0.078000	0.16900	0.591000	0.81541	GTC	-	HMMSmart_SM00192,superfamily_LDL receptor-like module		0.493	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORIN	protein_coding	OTTHUMT00000216906.2	C			47374715	-1	no_errors	NM_006587	genbank	human	reviewed	54_36p	missense	SNP	0.356	G
FTSJ1	24140	genome.wustl.edu	37	X	48340873	48340873	+	Silent	SNP	G	G	T	rs140074225	byFrequency	TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chrX:48340873G>T	ENST00000348411.2	+	10	1061	c.738G>T	c.(736-738)tcG>tcT	p.S246S	FTSJ1_ENST00000496365.1_3'UTR|FTSJ1_ENST00000456787.1_Silent_p.S244S|FTSJ1_ENST00000396894.4_Silent_p.S109S|FTSJ1_ENST00000019019.2_Silent_p.S244S	NM_012280.2	NP_036412.1			FtsJ RNA methyltransferase homolog 1 (E. coli)											breast(1)|central_nervous_system(1)|lung(4)|skin(1)	7						CCTATGATTCGGACCGCAGTT	0.577																																																0			X											123.0	82.0	96.0					X																	48340873		2203	4300	6503	48225817	SO:0001819	synonymous_variant	24140			AJ005892	CCDS14294.1, CCDS14295.1, CCDS75972.1	Xp11.23	2012-06-12	2012-06-12		ENSG00000068438	ENSG00000068438			13254	protein-coding gene	gene with protein product	"""tRNA methyltransferase 7 homolog (S. cerevisiae)"""	300499	"""mental retardation, X-linked 9"", ""mental retardation, X-linked 44"""	MRX9, MRX44		15342698, 15162322	Standard	XR_246715		Approved	JM23, CDLIV, SPB1, TRM7, TRMT7	uc004djo.1	Q9UET6	OTTHUMG00000024118	ENST00000348411.2:c.738G>T	X.37:g.48340873G>T		Somatic		Capture	Illumina GAIIx	4	48225817		Silent	SNP	superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_FtsJ	p.S246	ENST00000348411.2	37	c.738	CCDS14294.1	X																																																																																			-	NULL		0.577	FTSJ1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FTSJ1	protein_coding	OTTHUMT00000060726.1	G			48225817	+1	no_errors	NM_012280	genbank	human	reviewed	54_36p	silent	SNP	0.923	T
PCDH15	65217	genome.wustl.edu	37	10	55849749	55849749	+	Silent	SNP	T	T	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr10:55849749T>A	ENST00000320301.6	-	16	2386	c.1992A>T	c.(1990-1992)tcA>tcT	p.S664S	PCDH15_ENST00000409834.1_Silent_p.S275S|PCDH15_ENST00000395446.1_Silent_p.S664S|PCDH15_ENST00000373955.1_Silent_p.S664S|PCDH15_ENST00000437009.1_Intron|PCDH15_ENST00000395438.1_Silent_p.S664S|PCDH15_ENST00000395445.1_Silent_p.S671S|PCDH15_ENST00000373965.2_Silent_p.S671S|PCDH15_ENST00000395432.2_Silent_p.S627S|PCDH15_ENST00000395433.1_Silent_p.S642S|PCDH15_ENST00000373957.3_Silent_p.S642S|PCDH15_ENST00000395430.1_Silent_p.S664S|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000414778.1_Silent_p.S669S|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000361849.3_Silent_p.S664S	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	664	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CTTACGTTTCTGAAAGATTAA	0.348										HNSCC(58;0.16)																																						0			10											58.0	60.0	60.0					10																	55849749		2203	4298	6501	55519755	SO:0001819	synonymous_variant	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1992A>T	10.37:g.55849749T>A		Somatic		Capture	Illumina GAIIx	4	55519755	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Cadherin-like,HMMPfam_Cadherin	p.S664	ENST00000320301.6	37	c.1992	CCDS7248.1	10																																																																																			-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.348	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	protein_coding	OTTHUMT00000048121.2	T	NM_033056		55519755	-1	no_errors	NM_033056	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
C8A	731	genome.wustl.edu	37	1	57351812	57351812	+	Silent	SNP	G	G	C	rs200084020		TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr1:57351812G>C	ENST00000361249.3	+	7	1164	c.1068G>C	c.(1066-1068)gtG>gtC	p.V356V		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	356	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						ATATCCTGGTGATTGACAAAG	0.398													G|||	1	0.000199681	0.0	0.0	5008	,	,		18601	0.001		0.0	False		,,,				2504	0.0															0			1											113.0	99.0	104.0					1																	57351812		2203	4300	6503	57124400	SO:0001819	synonymous_variant	731			M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1068G>C	1.37:g.57351812G>C		Somatic		Capture	Illumina GAIIx	4	57124400	A2RUI4|A2RUI5|Q13668|Q9H130	Silent	SNP	PatternScan_EGF_2,superfamily_TSP1,HMMSmart_TSP1,HMMPfam_TSP_1,superfamily_LDL_rcpt_classA_cys-rich,HMMPfam_Ldl_recept_a,HMMSmart_LDLa,PatternScan_LDLRA_1,HMMPfam_MACPF,HMMSmart_MACPF,PatternScan_MAC_PERFORIN,superfamily_SSF57196,PatternScan_EGF_1	p.V356	ENST00000361249.3	37	c.1068	CCDS606.1	1																																																																																			-	HMMPfam_MACPF,HMMSmart_MACPF		0.398	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8A	protein_coding	OTTHUMT00000022890.1	G	NM_000562		57124400	+1	no_errors	NM_000562	genbank	human	reviewed	54_36p	silent	SNP	0.915	C
KANK4	163782	genome.wustl.edu	37	1	62739570	62739570	+	Silent	SNP	G	G	A	rs142146326		TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr1:62739570G>A	ENST00000371153.4	-	3	1584	c.1206C>T	c.(1204-1206)aaC>aaT	p.N402N	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	402						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						TGTCTTTGGCGTTCTCTTGGT	0.522																																																0			1						G		1,4405	2.1+/-5.4	0,1,2202	175.0	146.0	156.0		1206	-4.5	0.0	1	dbSNP_134	156	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KANK4	NM_181712.4		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		402/996	62739570	2,13004	2203	4300	6503	62512158	SO:0001819	synonymous_variant	163782			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.1206C>T	1.37:g.62739570G>A		Somatic		Capture	Illumina GAIIx	4	62512158	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Silent	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.N402	ENST00000371153.4	37	c.1206	CCDS620.1	1																																																																																			-	NULL		0.522	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK4	protein_coding	OTTHUMT00000024877.1	G	NM_181712		62512158	-1	no_errors	NM_181712	genbank	human	validated	54_36p	silent	SNP	0.000	A
Unknown	0	genome.wustl.edu	37	7	63466606	63466606	+	IGR	SNP	T	T	G			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr7:63466606T>G								AC092634.2 (79327 upstream) : LINC01005 (21623 downstream)																							AAACAGGTATTGCTGACTCTA	0.328																																																0			7																																								63104041	SO:0001628	intergenic_variant	728898																															7.37:g.63466606T>G		Somatic		Capture	Illumina GAIIx	4	63104041		Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.I56M		37	c.168		7																																																																																			-	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMSmart_SM00349	0	0.328					ZNF735			T			63104041	+1	no_stop_codon	ENST00000398732	ensembl	human	known	54_36p	missense	SNP	0.762	G
STARD8	9754	genome.wustl.edu	37	X	67943669	67943669	+	Missense_Mutation	SNP	G	G	A	rs148586208	byFrequency	TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chrX:67943669G>A	ENST00000252336.6	+	12	3133	c.2761G>A	c.(2761-2763)Gac>Aac	p.D921N	STARD8_ENST00000374599.3_Missense_Mutation_p.D1001N|STARD8_ENST00000374597.3_Missense_Mutation_p.D921N	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	921	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						TCCCTGCCGCGACTTTGTGGT	0.627																																																0			X						G	ASN/ASP,ASN/ASP,ASN/ASP	6,3818		0,5,1,1625,563	34.0	28.0	30.0		3001,2761,2761	4.2	1.0	X	dbSNP_134	30	0,6714		0,0,0,2428,1858	yes	missense,missense,missense	STARD8	NM_001142503.2,NM_001142504.2,NM_014725.4	23,23,23	0,5,1,4053,2421	AA,AG,A,GG,G		0.0,0.1569,0.0569	possibly-damaging,possibly-damaging,possibly-damaging	1001/1104,921/1024,921/1024	67943669	6,10532	2194	4286	6480	67860394	SO:0001583	missense	9754			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.2761G>A	X.37:g.67943669G>A	ENSP00000252336:p.Asp921Asn	Somatic		Capture	Illumina GAIIx	4	67860394	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP,superfamily_Bet v1-like,HMMPfam_START,HMMSmart_SM00234	p.D921N	ENST00000252336.6	37	c.2761	CCDS14390.1	X	.	.	.	.	.	.	.	.	.	.	G	18.96	3.733484	0.69189	0.001569	0.0	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.60299	0.2;0.2;0.2	4.25	4.25	0.50352	Lipid-binding START (3);START-like domain (1);	0.234666	0.34802	N	0.003666	T	0.65428	0.2690	M	0.68593	2.085	0.45330	D	0.998322	D;D	0.61697	0.988;0.99	P;P	0.55824	0.627;0.785	T	0.68243	-0.5460	10	0.59425	D	0.04	.	9.2446	0.37518	0.0:0.2153:0.7847:0.0	.	1001;921	Q92502-2;Q92502	.;STAR8_HUMAN	N	921;1001;921	ENSP00000252336:D921N;ENSP00000363727:D1001N;ENSP00000363725:D921N	ENSP00000252336:D921N	D	+	1	0	STARD8	67860394	1.000000	0.71417	0.961000	0.40146	0.735000	0.41995	5.946000	0.70234	1.971000	0.57363	0.594000	0.82650	GAC	-	superfamily_Bet v1-like,HMMPfam_START,HMMSmart_SM00234		0.627	STARD8-201	KNOWN	basic|CCDS	protein_coding	STARD8	protein_coding	OTTHUMT00000057026.2	G	NM_014725		67860394	+1	no_errors	NM_014725	genbank	human	validated	54_36p	missense	SNP	0.990	A
ZFHX3	463	genome.wustl.edu	37	16	72822428	72822428	+	Silent	SNP	C	C	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr16:72822428C>A	ENST00000268489.5	-	10	10419	c.9747G>T	c.(9745-9747)ggG>ggT	p.G3249G	RP5-991G20.1_ENST00000563328.2_RNA|AC004943.1_ENST00000584072.1_RNA|RP5-991G20.4_ENST00000569195.1_RNA|ZFHX3_ENST00000397992.5_Silent_p.G2335G	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3249					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GTTCCCCTTTCCCTTTGTGTG	0.597																																																0			16											143.0	155.0	151.0					16																	72822428		2198	4300	6498	71379929	SO:0001819	synonymous_variant	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.9747G>T	16.37:g.72822428C>A		Somatic		Capture	Illumina GAIIx	4	71379929	D3DWS8|O15101|Q13719	Silent	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2,HMMSmart_SM00451,HMMSmart_SM00389,superfamily_Homeodomain-like,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.G3249	ENST00000268489.5	37	c.9747	CCDS10908.1	16																																																																																			-	NULL		0.597	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	protein_coding	OTTHUMT00000269008.1	C	NM_006885		71379929	-1	no_errors	NM_006885	genbank	human	validated	54_36p	silent	SNP	1.000	A
RNF213	57674	genome.wustl.edu	37	17	78265425	78265425	+	Splice_Site	SNP	A	A	G			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr17:78265425A>G	ENST00000582970.1	+	8	1414		c.e8-1		RNF213_ENST00000508628.2_Splice_Site|RNF213_ENST00000319921.4_Splice_Site|RNF213_ENST00000456466.1_Splice_Site	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213						ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GTTCATTCACAGAGACTTGGG	0.408																																																0			17											124.0	117.0	120.0					17																	78265425		2203	4300	6503	75880020	SO:0001630	splice_region_variant	57714			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.1272-1A>G	17.37:g.78265425A>G		Somatic		Capture	Illumina GAIIx	4	75880020	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Splice_Site	SNP	-	e7-2	ENST00000582970.1	37	c.1272-2	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	A	12.47	1.947871	0.34377	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9321	0.47224	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RNF213	75880020	1.000000	0.71417	0.286000	0.24833	0.007000	0.05969	5.189000	0.65098	1.836000	0.53414	0.374000	0.22700	.	-	-		0.408	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1618	protein_coding	OTTHUMT00000443298.1	A	NM_020914	Intron	75880020	+1	no_errors	NM_020954	genbank	human	validated	54_36p	splice_site	SNP	0.101	G
SLC16A3	9123	genome.wustl.edu	37	17	80194035	80194035	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr17:80194035C>G	ENST00000581287.1	+	1	2473	c.151C>G	c.(151-153)Cag>Gag	p.Q51E	SLC16A3_ENST00000584781.1_3'UTR|SLC16A3_ENST00000392341.1_Missense_Mutation_p.Q51E|SLC16A3_ENST00000392339.1_Missense_Mutation_p.Q51E|SLC16A3_ENST00000582743.1_Missense_Mutation_p.Q51E	NM_001206951.1|NM_001206952.1	NP_001193880.1|NP_001193881.1	O15427	MOT4_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 3	51					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|leukocyte migration (GO:0050900)|monocarboxylic acid transport (GO:0015718)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|poly(A) RNA binding (GO:0044822)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Gamma Hydroxybutyric Acid(DB01440)|Niacin(DB00627)|Pyruvic acid(DB00119)	GGAGCTCATACAGGAGTTTGG	0.627																																					Pancreas(52;652 1135 19190 37282 52456)											0			17											104.0	95.0	98.0					17																	80194035		2203	4300	6503	77787324	SO:0001583	missense	9123			U81800	CCDS11804.1	17q25.3	2013-07-18	2013-07-18		ENSG00000141526	ENSG00000141526		"""Solute carriers"""	10924	protein-coding gene	gene with protein product		603877	"""solute carrier family 16 (monocarboxylic acid transporters), member 3"", ""solute carrier family 16, member 3 (monocarboxylic acid transporter 4)"""			9425115	Standard	NM_004207		Approved	MCT3, MCT4	uc021ufm.1	O15427	OTTHUMG00000178832	ENST00000581287.1:c.151C>G	17.37:g.80194035C>G	ENSP00000463978:p.Gln51Glu	Somatic		Capture	Illumina GAIIx	4	77787324	B3KXG8|Q2M1P8	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1	p.Q51E	ENST00000581287.1	37	c.151	CCDS11804.1	17	.	.	.	.	.	.	.	.	.	.	C	6.406	0.443007	0.12164	.	.	ENSG00000141526	ENST00000392341;ENST00000392339	T;T	0.18960	2.18;2.18	5.31	3.26	0.37387	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.808128	0.11050	N	0.605142	T	0.06234	0.0161	N	0.01086	-1.025	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.19946	0.005;0.027	T	0.35871	-0.9771	10	0.02654	T	1	.	9.0131	0.36153	0.3288:0.5384:0.1329:0.0	.	51;51	Q53G91;O15427	.;MOT4_HUMAN	E	51	ENSP00000376152:Q51E;ENSP00000376150:Q51E	ENSP00000376150:Q51E	Q	+	1	0	SLC16A3	77787324	0.011000	0.17503	0.008000	0.14137	0.392000	0.30506	0.915000	0.28638	0.558000	0.29135	0.563000	0.77884	CAG	-	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1		0.627	SLC16A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A3	protein_coding	OTTHUMT00000443498.1	C	NM_004207		77787324	+1	no_errors	NM_001042422	genbank	human	validated	54_36p	missense	SNP	0.983	G
MYF6	4618	genome.wustl.edu	37	12	81101735	81101735	+	Silent	SNP	C	C	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr12:81101735C>T	ENST00000228641.3	+	1	459	c.237C>T	c.(235-237)atC>atT	p.I79I		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	79					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						AGTGTCTGATCTGGGCTTGCA	0.632																																																0			12											30.0	37.0	34.0					12																	81101735		2202	4300	6502	79625866	SO:0001819	synonymous_variant	4618				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.237C>T	12.37:g.81101735C>T		Somatic		Capture	Illumina GAIIx	4	79625866	B2R898|Q53X80|Q6FHI9	Silent	SNP	HMMPfam_Basic,HMMSmart_SM00520,superfamily_HLH helix-loop-helix DNA-binding domain,HMMPfam_HLH,HMMSmart_SM00353	p.I79	ENST00000228641.3	37	c.237	CCDS9019.1	12																																																																																			-	HMMPfam_Basic,HMMSmart_SM00520		0.632	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF6	protein_coding	OTTHUMT00000407756.1	C	NM_002469		79625866	+1	no_errors	NM_002469	genbank	human	provisional	54_36p	silent	SNP	1.000	T
FAXC	84553	genome.wustl.edu	37	6	99797000	99797000	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr6:99797000G>C	ENST00000389677.5	-	1	531	c.249C>G	c.(247-249)caC>caG	p.H83Q		NM_032511.2	NP_115900.1	Q5TGI0	FAXC_HUMAN	failed axon connections homolog (Drosophila)	83						integral component of membrane (GO:0016021)											CCAGGAGTTCGTGGAGCAGAT	0.667																																																0			6											45.0	50.0	48.0					6																	99797000		2203	4300	6503	99903721	SO:0001583	missense	84553			BC011583	CCDS34500.1	6q16.3	2012-02-07	2012-02-07	2012-02-07	ENSG00000146267	ENSG00000146267			20742	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 168"""	C6orf168		12477932	Standard	NM_032511		Approved	MGC2817, dJ273F20	uc003ppj.4	Q5TGI0	OTTHUMG00000015261	ENST00000389677.5:c.249C>G	6.37:g.99797000G>C	ENSP00000374328:p.His83Gln	Somatic		Capture	Illumina GAIIx	4	99903721	B3KU39|Q96F61|Q96LU3|Q9BR58|Q9BSS2	Missense_Mutation	SNP	superfamily_Thioredoxin-like,HMMPfam_Tom37,superfamily_Glutathione S-transferase (GST) C-terminal domain	p.H83Q	ENST00000389677.5	37	c.249	CCDS34500.1	6	.	.	.	.	.	.	.	.	.	.	G	19.72	3.880297	0.72294	.	.	ENSG00000146267	ENST00000389677	.	.	.	3.87	3.87	0.44632	.	0.000000	0.85682	D	0.000000	T	0.55497	0.1924	L	0.57536	1.79	0.80722	D	1	D	0.71674	0.998	P	0.60949	0.881	T	0.55244	-0.8171	9	0.33940	T	0.23	-24.9044	9.9805	0.41811	0.0955:0.0:0.9045:0.0	.	83	Q5TGI0	CF168_HUMAN	Q	83	.	ENSP00000374328:H83Q	H	-	3	2	C6orf168	99903721	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.080000	0.57620	1.846000	0.53633	0.555000	0.69702	CAC	-	NULL		0.667	FAXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf168	protein_coding	OTTHUMT00000041589.4	G	NM_032511		99903721	-1	no_errors	NM_032511	genbank	human	validated	54_36p	missense	SNP	1.000	C
SLCO6A1	133482	genome.wustl.edu	37	5	101755572	101755572	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr5:101755572C>G	ENST00000506729.1	-	8	1601	c.1430G>C	c.(1429-1431)tGt>tCt	p.C477S	SLCO6A1_ENST00000389019.3_Missense_Mutation_p.C415S|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.C477S|SLCO6A1_ENST00000513675.1_Intron|SLCO6A1_ENST00000514551.1_5'Flank|SLCO6A1_ENST00000379810.1_Intron			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	477						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CACTGGATTACAGCGTACAAA	0.328																																																0			5											110.0	116.0	114.0					5																	101755572		2203	4300	6503	101783471	SO:0001583	missense	133482			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1430G>C	5.37:g.101755572C>G	ENSP00000421339:p.Cys477Ser	Somatic		Capture	Illumina GAIIx	4	101783471	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	HMMPfam_OATP,superfamily_MFS general substrate transporter,superfamily_Kazal-type serine protease inhibitors,HMMPfam_Kazal_2	p.C477S	ENST00000506729.1	37	c.1430	CCDS34206.1	5	.	.	.	.	.	.	.	.	.	.	C	15.21	2.765691	0.49574	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019	T;T;T	0.78126	-1.15;-1.15;-1.15	4.99	4.11	0.48088	Major facilitator superfamily domain, general substrate transporter (1);	0.159778	0.43747	D	0.000527	D	0.89469	0.6724	M	0.91872	3.25	0.44061	D	0.996804	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91252	0.5030	10	0.87932	D	0	.	12.2113	0.54381	0.1713:0.8287:0.0:0.0	.	415;477	Q86UG4-2;Q86UG4	.;SO6A1_HUMAN	S	477;477;415	ENSP00000421339:C477S;ENSP00000369135:C477S;ENSP00000373671:C415S	ENSP00000369135:C477S	C	-	2	0	SLCO6A1	101783471	0.980000	0.34600	0.039000	0.18376	0.012000	0.07955	4.405000	0.59741	1.430000	0.47334	0.655000	0.94253	TGT	-	HMMPfam_OATP,superfamily_MFS general substrate transporter		0.328	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO6A1	protein_coding	OTTHUMT00000370335.1	C	NM_173488		101783471	-1	no_errors	NM_173488	genbank	human	validated	54_36p	missense	SNP	0.006	G
CASP4	837	genome.wustl.edu	37	11	104819342	104819342	+	Silent	SNP	C	C	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr11:104819342C>T	ENST00000444739.2	-	6	1753	c.843G>A	c.(841-843)caG>caA	p.Q281Q	CASP4_ENST00000531333.1_5'Flank|CASP4_ENST00000393150.3_Silent_p.Q225Q	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	281					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		TCTCAGATGACTGTGAAGAGG	0.498																																																0			11											157.0	119.0	132.0					11																	104819342		2202	4299	6501	104324552	SO:0001819	synonymous_variant	837			U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.843G>A	11.37:g.104819342C>T		Somatic		Capture	Illumina GAIIx	4	104324552	A2NHL8|A2NHM0	Silent	SNP	HMMSmart_SM00114,superfamily_DEATH domain,HMMPfam_CARD,superfamily_Caspase-like,HMMSmart_SM00115,HMMPfam_Peptidase_C14,PatternScan_CASPASE_HIS,PatternScan_CASPASE_CYS	p.Q281	ENST00000444739.2	37	c.843	CCDS8327.1	11																																																																																			-	superfamily_Caspase-like,HMMSmart_SM00115,HMMPfam_Peptidase_C14		0.498	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP4	protein_coding	OTTHUMT00000387751.1	C	NM_001225		104324552	-1	no_errors	NM_001225	genbank	human	reviewed	54_36p	silent	SNP	0.000	T
RGPD3	653489	genome.wustl.edu	37	2	107075744	107075744	+	Silent	SNP	A	A	G			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr2:107075744A>G	ENST00000409886.3	-	2	204	c.117T>C	c.(115-117)gcT>gcC	p.A39A	RGPD3_ENST00000304514.7_Silent_p.A39A	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	39					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						CATATTCTTTAGCTTCATAAT	0.254																																																0			2											2.0	2.0	2.0					2																	107075744		133	546	679	106442176	SO:0001819	synonymous_variant	653489				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.117T>C	2.37:g.107075744A>G		Somatic		Capture	Illumina GAIIx	4	106442176	B8ZZM4	Silent	SNP	superfamily_SSF48452,HMMPfam_TPR_1,superfamily_SSF50729,HMMSmart_RanBD,HMMPfam_Ran_BP1,HMMPfam_GRIP,HMMSmart_Grip	p.A39	ENST00000409886.3	37	c.117	CCDS46379.1	2																																																																																			-	superfamily_SSF48452		0.254	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	protein_coding	OTTHUMT00000329975.1	A	XM_929931		106442176	-1	no_errors	ENST00000304514	ensembl	human	known	54_36p	silent	SNP	0.999	G
MID2	11043	genome.wustl.edu	37	X	107097870	107097870	+	Missense_Mutation	SNP	T	T	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chrX:107097870T>A	ENST00000262843.6	+	3	1300	c.752T>A	c.(751-753)gTt>gAt	p.V251D	MID2_ENST00000443968.2_Missense_Mutation_p.V251D	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	251					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						ACCAACCTGGTTAAGCGCAAC	0.453																																																0			X											140.0	114.0	123.0					X																	107097870		2203	4300	6503	106984526	SO:0001583	missense	11043				CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.752T>A	X.37:g.107097870T>A	ENSP00000262843:p.Val251Asp	Somatic		Capture	Illumina GAIIx	4	106984526	A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMSmart_SM00336,HMMPfam_zf-B_box,superfamily_B-box zinc-binding domain,HMMSmart_SM00502,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,HMMPfam_SPRY,HMMSmart_SM00449	p.V231D	ENST00000262843.6	37	c.692	CCDS14532.2	X	.	.	.	.	.	.	.	.	.	.	T	17.27	3.346676	0.61073	.	.	ENSG00000080561	ENST00000262843;ENST00000443968	T;T	0.59638	0.25;0.27	5.17	5.17	0.71159	B-box, C-terminal (1);	0.060991	0.64402	D	0.000004	T	0.50735	0.1633	L	0.43152	1.355	0.80722	D	1	B;B	0.27140	0.167;0.169	B;B	0.29598	0.104;0.062	T	0.53585	-0.8418	10	0.66056	D	0.02	.	11.7749	0.51981	0.0:0.0:0.0:1.0	.	251;251	Q9UJV3;Q9UJV3-2	TRIM1_HUMAN;.	D	251	ENSP00000262843:V251D;ENSP00000413976:V251D	ENSP00000262843:V251D	V	+	2	0	MID2	106984526	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.218000	0.77991	1.909000	0.55274	0.486000	0.48141	GTT	-	HMMSmart_SM00502		0.453	MID2-001	KNOWN	basic|CCDS	protein_coding	MID2	protein_coding	OTTHUMT00000057852.2	T	NM_012216		106984526	+1	no_errors	NM_012216	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SOX1	6656	genome.wustl.edu	37	13	112721999	112721999	+	Silent	SNP	C	C	T	rs200478519	byFrequency	TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr13:112721999C>T	ENST00000330949.1	+	1	87	c.27C>T	c.(25-27)gaC>gaT	p.D9D		NM_005986.2	NP_005977.2	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	9					chromatin organization (GO:0006325)|forebrain neuron development (GO:0021884)|lens morphogenesis in camera-type eye (GO:0002089)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		TGGAGACCGACCTGCACTCGC	0.791													c|||	63	0.0125799	0.0446	0.0058	5008	,	,		3200	0.0		0.0	False		,,,				2504	0.0															0			13								125,3921		0,125,1898	8.0	11.0	10.0		27	0.9	0.9	13		10	0,8254		0,0,4127	yes	coding-synonymous	SOX1	NM_005986.2		0,125,6025	TT,TC,CC		0.0,3.0895,1.0163		9/392	112721999	125,12175	2023	4127	6150	111770000	SO:0001819	synonymous_variant	6656				CCDS9523.1	13q34	2008-07-18			ENSG00000182968	ENSG00000182968		"""SRY (sex determining region Y)-boxes"""	11189	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 1"""	602148				9337405	Standard	NM_005986		Approved		uc001vsb.1	O00570	OTTHUMG00000017362	ENST00000330949.1:c.27C>T	13.37:g.112721999C>T		Somatic		Capture	Illumina GAIIx	4	111770000	Q5W0Q1	Silent	SNP	superfamily_HMG-box,HMMSmart_HMG,HMMPfam_HMG_box	p.D9	ENST00000330949.1	37	c.27	CCDS9523.1	13																																																																																			-	NULL		0.791	SOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX1	protein_coding	OTTHUMT00000045817.3	C	NM_005986		111770000	+1	no_errors	NM_005986	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
CD200	4345	genome.wustl.edu	37	3	112066608	112066608	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr3:112066608G>A	ENST00000315711.8	+	4	682	c.625G>A	c.(625-627)Ggg>Agg	p.G209R	CD200_ENST00000383681.3_Missense_Mutation_p.G135R|CD200_ENST00000473539.1_Missense_Mutation_p.G234R	NM_005944.5	NP_005935.4	P41217	OX2G_HUMAN	CD200 molecule	209	Ig-like C2-type.				regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				GAATCAGGTGGGGAAGGAGGT	0.502																																																0			3											112.0	110.0	111.0					3																	112066608		2203	4300	6503	113549298	SO:0001583	missense	4345				CCDS2965.1, CCDS33818.1	3q13.2	2013-09-20	2006-03-28	2004-09-01	ENSG00000091972	ENSG00000091972		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7203	protein-coding gene	gene with protein product		155970	"""antigen identified by monoclonal antibody MRC OX-2"", ""CD200 antigen"""	MOX1, MOX2			Standard	XM_005247482		Approved	MRC, OX-2	uc003dyw.3	P41217	OTTHUMG00000159248	ENST00000315711.8:c.625G>A	3.37:g.112066608G>A	ENSP00000312766:p.Gly209Arg	Somatic		Capture	Illumina GAIIx	4	113549298	B3KQI1|B4DLW9|D3DN65|Q6J2Q6|Q6PIQ4|Q8TB85|Q9H3J3	Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig	p.G234R	ENST00000315711.8	37	c.700	CCDS2965.1	3	.	.	.	.	.	.	.	.	.	.	G	12.79	2.042179	0.35989	.	.	ENSG00000091972	ENST00000315711;ENST00000473539;ENST00000383681	T;T;T	0.24151	1.87;1.87;1.87	5.66	5.66	0.87406	Immunoglobulin (1);Immunoglobulin-like fold (1);	0.123897	0.37012	N	0.002297	T	0.35828	0.0945	L	0.29908	0.895	0.40618	D	0.98173	P;D;D;D;P	0.67145	0.941;0.993;0.994;0.996;0.928	P;P;D;D;P	0.66497	0.779;0.865;0.917;0.944;0.671	T	0.03354	-1.1045	10	0.22706	T	0.39	-17.0782	15.2504	0.73539	0.0:0.0:1.0:0.0	.	209;135;135;209;234	P41217;F8W7G1;B4DDZ6;P41217-2;P41217-3	OX2G_HUMAN;.;.;.;.	R	209;234;135	ENSP00000312766:G209R;ENSP00000420298:G234R;ENSP00000373179:G135R	ENSP00000312766:G209R	G	+	1	0	CD200	113549298	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	5.238000	0.65366	2.648000	0.89879	0.655000	0.94253	GGG	-	superfamily_SSF48726,HMMPfam_ig		0.502	CD200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD200	protein_coding	OTTHUMT00000354078.1	G			113549298	+1	no_errors	NM_001004196	genbank	human	reviewed	54_36p	missense	SNP	0.961	A
CCDC186	55088	genome.wustl.edu	37	10	115896971	115896971	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr10:115896971A>G	ENST00000369287.3	-	7	1566	c.1300T>C	c.(1300-1302)Tgt>Cgt	p.C434R	C10orf118_ENST00000543782.1_Missense_Mutation_p.C32R	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		434										NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		ATATCCTGACAGTTTTTTCGT	0.289																																																0			10											281.0	233.0	249.0					10																	115896971		2203	4299	6502	115886961	SO:0001583	missense	55088																														ENST00000369287.3:c.1300T>C	10.37:g.115896971A>G	ENSP00000358293:p.Cys434Arg	Somatic		Capture	Illumina GAIIx	4	115886961	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.C434R	ENST00000369287.3	37	c.1300	CCDS7587.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.3|23.3	4.403300|4.403300	0.83230|0.83230	.|.	.|.	ENSG00000165813|ENSG00000165813	ENST00000369287;ENST00000543782;ENST00000430353|ENST00000428953	T;T|.	0.61040|.	0.14;0.14|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73528|0.73528	0.3598|0.3598	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.998;0.999|.	T|T	0.73395|0.73395	-0.3996|-0.3996	10|5	0.54805|.	T|.	0.06|.	.|.	14.9617|14.9617	0.71161|0.71161	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	32;434|.	F6VCB7;Q7Z3E2|.	.;CJ118_HUMAN|.	R|P	434;32;540|62	ENSP00000358293:C434R;ENSP00000441576:C32R|.	ENSP00000358293:C434R|.	C|L	-|-	1|2	0|0	C10orf118|C10orf118	115886961|115886961	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.213000|9.213000	0.95133|0.95133	2.269000|2.269000	0.75478|0.75478	0.456000|0.456000	0.33151|0.33151	TGT|CTG	-	NULL		0.289	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf118	protein_coding	OTTHUMT00000050455.1	A			115886961	-1	no_errors	NM_018017	genbank	human	validated	54_36p	missense	SNP	1.000	G
NKRF	55922	genome.wustl.edu	37	X	118723534	118723534	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chrX:118723534G>T	ENST00000371527.1	-	2	2506	c.1854C>A	c.(1852-1854)agC>agA	p.S618R	NKRF_ENST00000542113.1_Missense_Mutation_p.S633R|NKRF_ENST00000304449.5_Missense_Mutation_p.S618R|NKRF_ENST00000487600.1_Intron	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor	618	R3H. {ECO:0000255|PROSITE- ProRule:PRU00382}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						AATCTGTGTGGCTCTCGGAGC	0.453																																																0			X											152.0	133.0	140.0					X																	118723534		2203	4300	6503	118607562	SO:0001583	missense	55922			AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.1854C>A	X.37:g.118723534G>T	ENSP00000360582:p.Ser618Arg	Somatic		Capture	Illumina GAIIx	4	118607562	G3V1N1|Q4VC41|Q9UJ91	Missense_Mutation	SNP	superfamily_dsRNA-binding domain-like,HMMPfam_dsrm,HMMSmart_SM00358,HMMSmart_SM00443,HMMPfam_G-patch,HMMSmart_SM00393,superfamily_R3H domain,HMMPfam_R3H	p.S618R	ENST00000371527.1	37	c.1854	CCDS35375.1	X	.	.	.	.	.	.	.	.	.	.	G	1.699	-0.502122	0.04261	.	.	ENSG00000186416	ENST00000371527;ENST00000304449;ENST00000542113	T;T;T	0.43294	0.95;0.95;0.95	5.77	4.9	0.64082	Single-stranded nucleic acid binding R3H (3);	0.082013	0.85682	D	0.000000	T	0.22627	0.0546	N	0.16903	0.455	0.46096	D	0.998863	B	0.06786	0.001	B	0.12156	0.007	T	0.11324	-1.0592	10	0.12103	T	0.63	-15.1731	7.5402	0.27733	0.2531:0.0:0.7469:0.0	.	618	O15226	NKRF_HUMAN	R	618;618;633	ENSP00000360582:S618R;ENSP00000304803:S618R;ENSP00000442308:S633R	ENSP00000304803:S618R	S	-	3	2	NKRF	118607562	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.204000	0.32296	2.424000	0.82194	0.600000	0.82982	AGC	-	HMMSmart_SM00393,superfamily_R3H domain,HMMPfam_R3H		0.453	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKRF	protein_coding	OTTHUMT00000058044.1	G	NM_017544		118607562	-1	no_errors	NM_017544	genbank	human	validated	54_36p	missense	SNP	1.000	T
CIT	11113	genome.wustl.edu	37	12	120195206	120195206	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr12:120195206C>T	ENST00000261833.7	-	21	2601	c.2549G>A	c.(2548-2550)cGg>cAg	p.R850Q	CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Missense_Mutation_p.R892Q	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	850					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TTCCAGCAGCCGATTCTTGTC	0.552																																																0			12											268.0	262.0	264.0					12																	120195206		2203	4300	6503	118679589	SO:0001583	missense	11113			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.2549G>A	12.37:g.120195206C>T	ENSP00000261833:p.Arg850Gln	Somatic		Capture	Illumina GAIIx	4	118679589	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_SM00133,HMMPfam_Pkinase_C,PatternScan_CPSASE_2,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,HMMSmart_SM00036,HMMPfam_CNH	p.R850Q	ENST00000261833.7	37	c.2549	CCDS9192.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.303778|5.303778	0.95601|0.95601	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392520|ENST00000392521;ENST00000261833	.|T;T	.|0.66099	.|-0.19;-0.02	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68796|0.68796	0.3040|0.3040	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.997;0.998	.|P;D;D	.|0.75484	.|0.788;0.968;0.986	T|T	0.63129|0.63129	-0.6706|-0.6706	5|10	.|0.19590	.|T	.|0.45	.|.	19.4686|19.4686	0.94952|0.94952	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|892;850;383	.|Q2M5E1;O14578;O14578-3	.|.;CTRO_HUMAN;.	S|Q	478|892;850	.|ENSP00000376306:R892Q;ENSP00000261833:R850Q	.|ENSP00000261833:R850Q	G|R	-|-	1|2	0|0	CIT|CIT	118679589|118679589	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.995000|0.995000	0.86356|0.86356	7.277000|7.277000	0.78572|0.78572	2.608000|2.608000	0.88229|0.88229	0.655000|0.655000	0.94253|0.94253	GGC|CGG	-	NULL		0.552	CIT-001	KNOWN	basic|CCDS	protein_coding	CIT	protein_coding	OTTHUMT00000259410.4	C	NM_007174		118679589	-1	no_errors	NM_007174	genbank	human	validated	54_36p	missense	SNP	0.997	T
TRMT11	60487	genome.wustl.edu	37	6	126333934	126333934	+	Nonsense_Mutation	SNP	G	G	T	rs549437612		TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr6:126333934G>T	ENST00000334379.5	+	10	1064	c.943G>T	c.(943-945)Gaa>Taa	p.E315*	TRMT11_ENST00000368332.3_Nonsense_Mutation_p.E315*	NM_001031712.2	NP_001026882.2	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11 homolog (S. cerevisiae)	315					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)|tRNA binding (GO:0000049)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				GBM - Glioblastoma multiforme(226;0.0356)		TGGTATCAGAGAATCTACAAG	0.378																																																0			6											120.0	119.0	119.0					6																	126333934		2203	4300	6503	126375627	SO:0001587	stop_gained	60487			AF182423	CCDS35496.1	6q11.1-q22.33	2009-06-15	2006-11-28	2006-11-28	ENSG00000066651	ENSG00000066651			21080	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 75"""	C6orf75			Standard	XM_006715546		Approved	MDS024, dJ187J11.2, TRM11, TRMT11-1	uc003qam.3	Q7Z4G4	OTTHUMG00000015515	ENST00000334379.5:c.943G>T	6.37:g.126333934G>T	ENSP00000333934:p.Glu315*	Somatic		Capture	Illumina GAIIx	4	126375627	E1P570|Q5JY11|Q6PGQ5|Q9HC13	Nonsense_Mutation	SNP	HMMPfam_UPF0020,superfamily_S-adenosyl-L-methionine-dependent methyltransferases,PatternScan_N6_MTASE	p.E315*	ENST00000334379.5	37	c.943	CCDS35496.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.659576|6.659576	0.97743|0.97743	.|.	.|.	ENSG00000066651|ENSG00000066651	ENST00000334379;ENST00000368332|ENST00000453993	.|T	.|0.38887	.|1.11	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.59473	.|0.2196	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.63849	.|-0.6544	.|6	0.48119|0.87932	T|D	0.1|0	-20.3745|-20.3745	19.6241|19.6241	0.95671|0.95671	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	315|113	.|ENSP00000410498:R113I	ENSP00000333934:E315X|ENSP00000410498:R113I	E|R	+|+	1|2	0|0	TRMT11|TRMT11	126375627|126375627	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.289000|9.289000	0.96061|0.96061	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	GAA|AGA	-	HMMPfam_UPF0020,superfamily_S-adenosyl-L-methionine-dependent methyltransferases		0.378	TRMT11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRMT11	protein_coding		G	NM_021820		126375627	+1	no_errors	NM_001031712	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
SMO	6608	genome.wustl.edu	37	7	128846006	128846006	+	Silent	SNP	G	G	T			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr7:128846006G>T	ENST00000249373.3	+	5	1216	c.936G>T	c.(934-936)ctG>ctT	p.L312L		NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor	312					adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	ATGAGACTCTGTCCTGCGTCA	0.562			Mis		skin basal cell																																		Dom	yes		7	7q31-q32	6608	smoothened homolog (Drosophila)		E	0			7											285.0	238.0	254.0					7																	128846006		2203	4300	6503	128633242	SO:0001819	synonymous_variant	6608			U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.936G>T	7.37:g.128846006G>T		Somatic		Capture	Illumina GAIIx	4	128633242	A4D1K5	Silent	SNP	HMMPfam_Fz,superfamily_Frizzled cysteine-rich domain,HMMSmart_SM00063,HMMPfam_Frizzled	p.L312	ENST00000249373.3	37	c.936	CCDS5811.1	7																																																																																			-	HMMPfam_Frizzled		0.562	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMO	protein_coding	OTTHUMT00000350986.1	G	NM_005631		128633242	+1	no_errors	NM_005631	genbank	human	provisional	54_36p	silent	SNP	1.000	T
ENOX2	10495	genome.wustl.edu	37	X	129822875	129822875	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chrX:129822875A>G	ENST00000370927.1	-	3	323	c.302T>C	c.(301-303)aTa>aCa	p.I101T	ENOX2_ENST00000370935.1_Missense_Mutation_p.I72T|ENOX2_ENST00000492263.1_5'UTR|ENOX2_ENST00000394363.1_Missense_Mutation_p.I72T|ENOX2_ENST00000338144.3_Missense_Mutation_p.I101T			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	101	Pro-rich.				cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						TTTACAGTGTATGATCTCTTT	0.398																																					Ovarian(101;828 1506 2951 9500 35258)											0			X											275.0	225.0	242.0					X																	129822875		2203	4300	6503	129650556	SO:0001583	missense	10495			AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.302T>C	X.37:g.129822875A>G	ENSP00000359965:p.Ile101Thr	Somatic		Capture	Illumina GAIIx	4	129650556	A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.I101T	ENST00000370927.1	37	c.302	CCDS14626.1	X	.	.	.	.	.	.	.	.	.	.	A	19.10	3.761447	0.69763	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927;ENST00000432489	.	.	.	5.25	4.07	0.47477	.	0.123265	0.53938	D	0.000058	T	0.68449	0.3002	M	0.73962	2.25	0.45342	D	0.998333	D	0.71674	0.998	P	0.59546	0.859	T	0.67810	-0.5574	8	.	.	.	-16.9648	8.7101	0.34378	0.8278:0.0:0.0:0.1722	.	101	Q16206	ENOX2_HUMAN	T	72;72;101;72;129;101;72	.	.	I	-	2	0	ENOX2	129650556	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	8.761000	0.91691	0.788000	0.33755	0.486000	0.48141	ATA	-	NULL		0.398	ENOX2-004	KNOWN	basic|CCDS	protein_coding	ENOX2	protein_coding	OTTHUMT00000058277.1	A	NM_182314		129650556	-1	no_errors	NM_182314	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
VAV2	7410	genome.wustl.edu	37	9	136640099	136640099	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr9:136640099C>A	ENST00000371850.3	-	25	2124	c.2093G>T	c.(2092-2094)aGg>aTg	p.R698M	VAV2_ENST00000406606.3_Missense_Mutation_p.R688M|VAV2_ENST00000371851.1_Missense_Mutation_p.R688M	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	698	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		AGGCCGCTCCCTGATCAGGTA	0.612																																																0			9											68.0	63.0	65.0					9																	136640099		2203	4300	6503	135629920	SO:0001583	missense	7410				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.2093G>T	9.37:g.136640099C>A	ENSP00000360916:p.Arg698Met	Somatic		Capture	Illumina GAIIx	4	135629920	A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	HMMPfam_CH,superfamily_Calponin-homology,HMMSmart_CH,superfamily_DH-domain,HMMPfam_RhoGEF,HMMSmart_RhoGEF,PatternScan_DH_1,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMSmart_C1,PatternScan_ZF_DAG_PE_1,superfamily_SSF57889,HMMPfam_C1_1,superfamily_SH3,HMMSmart_SH3,HMMPfam_SH3_2,superfamily_SSF55550,HMMSmart_SH2,HMMPfam_SH2,HMMPfam_SH3_1	p.R688M	ENST00000371850.3	37	c.2063	CCDS48053.1	9	.	.	.	.	.	.	.	.	.	.	C	22.0	4.237120	0.79800	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	D;D;D	0.99292	-5.7;-5.7;-5.7	5.28	5.28	0.74379	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.99654	0.9872	H	0.97077	3.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.97556	1.0095	10	0.87932	D	0	.	17.9	0.88900	0.0:1.0:0.0:0.0	.	688;698;688	P52735-2;P52735;P52735-3	.;VAV2_HUMAN;.	M	698;688;688;688	ENSP00000360916:R698M;ENSP00000360917:R688M;ENSP00000385362:R688M	ENSP00000317258:R688M	R	-	2	0	VAV2	135629920	1.000000	0.71417	0.974000	0.42286	0.435000	0.31806	7.189000	0.77747	2.474000	0.83562	0.655000	0.94253	AGG	-	superfamily_SSF55550,HMMSmart_SH2,HMMPfam_SH2		0.612	VAV2-001	KNOWN	basic|CCDS	protein_coding	VAV2	protein_coding	OTTHUMT00000054939.1	C			135629920	-1	no_errors	NM_003371	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SF3B4	10262	genome.wustl.edu	37	1	149895559	149895559	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr1:149895559C>G	ENST00000271628.8	-	6	1734	c.1150G>C	c.(1150-1152)Gga>Cga	p.G384R		NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	384					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CCAGTGTATCCATGGGGGGGC	0.632																																																0			1											18.0	22.0	21.0					1																	149895559		2203	4296	6499	148162183	SO:0001583	missense	10262			L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.1150G>C	1.37:g.149895559C>G	ENSP00000271628:p.Gly384Arg	Somatic		Capture	Illumina GAIIx	4	148162183	Q5SZ63	Missense_Mutation	SNP	HMMSmart_RRM,superfamily_SSF54928,HMMPfam_RRM_1	p.G384R	ENST00000271628.8	37	c.1150	CCDS941.1	1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265496	0.59431	.	.	ENSG00000143368	ENST00000271628	T	0.25749	1.78	4.47	4.47	0.54385	.	0.167322	0.52532	D	0.000061	T	0.29126	0.0724	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.05194	-1.0900	10	0.62326	D	0.03	.	13.9872	0.64343	0.0:1.0:0.0:0.0	.	384	Q15427	SF3B4_HUMAN	R	384	ENSP00000271628:G384R	ENSP00000271628:G384R	G	-	1	0	SF3B4	148162183	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.052000	0.71080	2.308000	0.77769	0.650000	0.86243	GGA	-	NULL		0.632	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B4	protein_coding	OTTHUMT00000033753.1	C	NM_005850		148162183	-1	no_errors	NM_005850	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TSC22D2	9819	genome.wustl.edu	37	3	150128592	150128592	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr3:150128592G>C	ENST00000361875.3	+	1	2471	c.1455G>C	c.(1453-1455)caG>caC	p.Q485H	TSC22D2_ENST00000361136.2_Missense_Mutation_p.Q485H	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	485					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CTCCGCCGCAGATGGGTGGCA	0.721																																																0			3											29.0	28.0	28.0					3																	150128592		2203	4298	6501	151611282	SO:0001583	missense	9819			AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.1455G>C	3.37:g.150128592G>C	ENSP00000354543:p.Gln485His	Somatic		Capture	Illumina GAIIx	4	151611282	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	PatternScan_TSC22,HMMPfam_TSC22	p.Q485H	ENST00000361875.3	37	c.1455	CCDS3149.1	3	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081851	0.36758	.	.	ENSG00000196428	ENST00000361875;ENST00000361136	T;T	0.37752	1.18;1.22	4.41	2.54	0.30619	.	0.000000	0.39834	N	0.001256	T	0.20292	0.0488	N	0.19112	0.55	0.26302	N	0.977963	B;B	0.21606	0.058;0.034	B;B	0.25884	0.064;0.029	T	0.13019	-1.0525	10	0.56958	D	0.05	.	3.7491	0.08559	0.2851:0.0:0.5354:0.1795	.	485;485	O75157-2;O75157	.;T22D2_HUMAN	H	485	ENSP00000354543:Q485H;ENSP00000354893:Q485H	ENSP00000354893:Q485H	Q	+	3	2	TSC22D2	151611282	0.997000	0.39634	0.998000	0.56505	0.949000	0.60115	0.966000	0.29331	0.818000	0.34468	0.563000	0.77884	CAG	-	NULL		0.721	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	TSC22D2	protein_coding	OTTHUMT00000357123.2	G	NM_014779		151611282	+1	no_errors	NM_014779	genbank	human	provisional	54_36p	missense	SNP	1.000	C
S100A7L2	645922	genome.wustl.edu	37	1	153409673	153409673	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr1:153409673G>C	ENST00000368725.2	-	3	199	c.200C>G	c.(199-201)tCc>tGc	p.S67C		NM_001045479.1	NP_001038944.2	Q5SY68	S1A7B_HUMAN	S100 calcium binding protein A7-like 2	56	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			NS(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAGGGCATTGGACAAGTAATC	0.373																																																0			1											84.0	84.0	84.0					1																	153409673		2203	4300	6503	151676297	SO:0001583	missense	645922					1q21.3	2013-01-10			ENSG00000197364	ENSG00000197364		"""EF-hand domain containing"""	21655	protein-coding gene	gene with protein product							Standard	NM_001045479		Approved	s100a7b	uc010pdx.2	Q5SY68	OTTHUMG00000013129	ENST00000368725.2:c.200C>G	1.37:g.153409673G>C	ENSP00000357714:p.Ser67Cys	Somatic		Capture	Illumina GAIIx	4	151676297		Missense_Mutation	SNP	PatternScan_S100_CABP,superfamily_SSF47473,PatternScan_EF_HAND_1	p.S56C	ENST00000368725.2	37	c.167		1	.	.	.	.	.	.	.	.	.	.	.	8.779	0.927764	0.18056	.	.	ENSG00000197364	ENST00000368725;ENST00000368724;ENST00000453814	T;T;T	0.06849	3.25;3.25;3.25	1.35	0.341	0.15991	EF-hand-like domain (1);	.	.	.	.	T	0.02929	0.0087	L	0.36672	1.1	0.09310	N	1	D	0.58268	0.982	P	0.46758	0.526	T	0.37244	-0.9714	9	0.66056	D	0.02	.	4.61	0.12397	0.0:0.0:0.627:0.373	.	56	Q5SY68	S1A7B_HUMAN	C	56;56;67	ENSP00000357714:S56C;ENSP00000357713:S56C;ENSP00000405610:S67C	ENSP00000357713:S56C	S	-	2	0	S100A7L2	151676297	0.003000	0.15002	0.009000	0.14445	0.001000	0.01503	0.334000	0.19787	0.097000	0.17492	-0.723000	0.03601	TCC	-	superfamily_SSF47473		0.373	S100A7L2-001	KNOWN	basic|appris_principal	protein_coding	S100A7L2	protein_coding	OTTHUMT00000036797.2	G	NM_001045479		151676297	-1	no_errors	NM_001045479	genbank	human	validated	54_36p	missense	SNP	0.006	C
PALLD	23022	genome.wustl.edu	37	4	169432917	169432917	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr4:169432917G>A	ENST00000505667.1	+	2	435	c.262G>A	c.(262-264)Gaa>Aaa	p.E88K	PALLD_ENST00000335742.7_5'UTR|PALLD_ENST00000333488.4_5'UTR|PALLD_ENST00000261509.6_Missense_Mutation_p.E88K			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	88					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CAAATTGGGTGAACACGCCTC	0.463									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)											0			4											42.0	44.0	43.0					4																	169432917		2203	4300	6503	169669492	SO:0001583	missense	23022	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.262G>A	4.37:g.169432917G>A	ENSP00000425556:p.Glu88Lys	Somatic		Capture	Illumina GAIIx	4	169669492	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,PatternScan_DEHYDRATASE_SER_THR	p.E88K	ENST00000505667.1	37	c.262	CCDS54818.1	4	.	.	.	.	.	.	.	.	.	.	G	7.592	0.670960	0.14776	.	.	ENSG00000129116	ENST00000261509;ENST00000505667;ENST00000508898	T;T;T	0.64803	0.02;0.29;-0.12	5.37	2.71	0.32032	.	1.825750	0.04112	N	0.314848	T	0.55289	0.1911	L	0.54323	1.7	0.18873	N	0.999981	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.33675	-0.9859	10	0.07175	T	0.84	.	8.4465	0.32845	0.299:0.0:0.701:0.0	.	88;88	B7ZMM5;B2RTX2	.;.	K	88;88;67	ENSP00000261509:E88K;ENSP00000425556:E88K;ENSP00000423063:E67K	ENSP00000261509:E88K	E	+	1	0	PALLD	169669492	0.046000	0.20272	0.000000	0.03702	0.003000	0.03518	2.020000	0.41010	0.256000	0.21614	0.591000	0.81541	GAA	-	NULL		0.463	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PALLD	protein_coding	OTTHUMT00000363762.1	G	NM_016081		169669492	+1	no_errors	NM_016081	genbank	human	validated	54_36p	missense	SNP	0.002	A
TLR5	7100	genome.wustl.edu	37	1	223286034	223286034	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr1:223286034C>A	ENST00000540964.1	-	4	801	c.340G>T	c.(340-342)Gct>Tct	p.A114S	TLR5_ENST00000342210.6_Missense_Mutation_p.A114S			O60602	TLR5_HUMAN	toll-like receptor 5	114					cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		CCCTGAAAAGCATCTGGATGC	0.408																																																0			1											95.0	93.0	94.0					1																	223286034		2203	4300	6503	221352657	SO:0001583	missense	7100				CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.340G>T	1.37:g.223286034C>A	ENSP00000440643:p.Ala114Ser	Somatic		Capture	Illumina GAIIx	4	221352657	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Missense_Mutation	SNP	superfamily_SSF52058,HMMSmart_LRR_TYP,HMMPfam_LRR_1,HMMSmart_LRRCT,HMMPfam_LRRCT,superfamily_TIR,HMMSmart_TIR,HMMPfam_TIR	p.A114S	ENST00000540964.1	37	c.340	CCDS31033.1	1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878891	0.72294	.	.	ENSG00000187554	ENST00000540964;ENST00000366881;ENST00000342210	D;D;D	0.84146	-1.81;-1.81;-1.81	5.03	5.03	0.67393	.	0.172940	0.49305	D	0.000141	D	0.89357	0.6692	L	0.55103	1.725	0.41859	D	0.990218	P	0.50272	0.933	D	0.67900	0.954	D	0.86817	0.2002	10	0.24483	T	0.36	.	15.1656	0.72821	0.1414:0.8586:0.0:0.0	.	114	O60602	TLR5_HUMAN	S	114	ENSP00000440643:A114S;ENSP00000355846:A114S;ENSP00000340089:A114S	ENSP00000340089:A114S	A	-	1	0	TLR5	221352657	0.988000	0.35896	0.902000	0.35471	0.963000	0.63663	2.579000	0.46059	2.483000	0.83821	0.655000	0.94253	GCT	-	superfamily_SSF52058,HMMSmart_LRR_TYP		0.408	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR5	protein_coding		C	NM_003268		221352657	-1	no_errors	NM_003268	genbank	human	validated	54_36p	missense	SNP	0.638	A
ALPI	248	genome.wustl.edu	37	2	233323797	233323797	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2065-01A-01D-1526-09	TCGA-13-2065-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	66351632-e3d9-47dc-8545-6546d5679167	f717ca27-9130-4659-a79e-34732875288b	g.chr2:233323797G>A	ENST00000295463.3	+	11	1605	c.1528G>A	c.(1528-1530)Gcg>Acg	p.A510T		NM_001631.3	NP_001622.2	P09923	PPBI_HUMAN	alkaline phosphatase, intestinal	510					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(2)|upper_aerodigestive_tract(1)	24		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CCCAGTTGCCGCGTCGCTGCC	0.721																																																0			2											6.0	8.0	7.0					2																	233323797		1975	3893	5868	233032041	SO:0001583	missense	248			M15694	CCDS2492.1	2q37.1	2008-02-05			ENSG00000163295	ENSG00000163295	3.1.3.1		437	protein-coding gene	gene with protein product		171740				3468508, 3469665	Standard	NM_001631		Approved		uc002vst.4	P09923	OTTHUMG00000133258	ENST00000295463.3:c.1528G>A	2.37:g.233323797G>A	ENSP00000295463:p.Ala510Thr	Somatic		Capture	Illumina GAIIx	4	233032041	B2R7Y4|Q53S80|Q9UBV5|Q9UCL2	Missense_Mutation	SNP	superfamily_Alkaline phosphatase-like,HMMPfam_Alk_phosphatase,HMMSmart_SM00098,PatternScan_ALKALINE_PHOSPHATASE	p.A510T	ENST00000295463.3	37	c.1528	CCDS2492.1	2	.	.	.	.	.	.	.	.	.	.	G	1.649	-0.514412	0.04200	.	.	ENSG00000163295	ENST00000295463	D	0.95622	-3.76	3.83	-3.27	0.05048	.	2.653370	0.01489	N	0.016989	D	0.85788	0.5778	N	0.08118	0	0.09310	N	1	B	0.32071	0.355	B	0.21708	0.036	T	0.82744	-0.0306	10	0.08599	T	0.76	.	7.8872	0.29656	0.0:0.1519:0.5992:0.2488	.	510	P09923	PPBI_HUMAN	T	510	ENSP00000295463:A510T	ENSP00000295463:A510T	A	+	1	0	ALPI	233032041	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.488000	0.06497	-0.583000	0.05921	-1.012000	0.02466	GCG	-	NULL		0.721	ALPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPI	protein_coding	OTTHUMT00000257035.2	G	NM_001631		233032041	+1	no_errors	NM_001631	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
