#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chrUnknown:0C>T								None (None upstream) : None (None downstream)																								0.0																																																0			NT_113889																																								40716	SO:0001628	intergenic_variant	0																															Unknown.37:g.0C>T		Somatic		Capture	Illumina GAIIx	4	40716		Missense_Mutation	SNP	HMMPfam_Tektin	p.V72M		37	c.214		NT_113889																																																																																			-	HMMPfam_Tektin	0	0					ENSG00000215615			C			40716	-1	no_stop_codon	ENST00000400681	ensembl	human	known	54_36p	missense	SNP	NULL	T
SCRT2	85508	genome.wustl.edu	37	20	656181	656181	+	Missense_Mutation	SNP	G	G	A	rs76595598	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr20:656181G>A	ENST00000246104.6	-	1	642	c.65C>T	c.(64-66)gCc>gTc	p.A22V	RP5-850E9.3_ENST00000488788.2_Missense_Mutation_p.A22V	NM_033129.3	NP_149120.1	Q9NQ03	SCRT2_HUMAN	scratch family zinc finger 2	22					negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron migration (GO:2001222)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			kidney(1)|liver(1)|ovary(1)	3						GTAGGTGGGGGCCGGCACCCC	0.746													G|||	174	0.0347444	0.0219	0.036	5008	,	,		9468	0.001		0.0944	False		,,,				2504	0.0245															0			20						G	VAL/ALA	158,4136		5,148,1994	6.0	8.0	8.0		65	2.2	1.0	20	dbSNP_131	8	750,7640		32,686,3477	yes	missense	SCRT2	NM_033129.3	64	37,834,5471	AA,AG,GG		8.9392,3.6796,7.1586	possibly-damaging	22/308	656181	908,11776	2147	4195	6342	604181	SO:0001583	missense	85508				CCDS13006.1	20p13	2013-10-09	2013-10-09		ENSG00000215397	ENSG00000215397		"""Zinc fingers, C2H2-type"""	15952	protein-coding gene	gene with protein product			"""scratch (drosophila homolog) 2, zinc finger protein"", ""scratch homolog 2, zinc finger protein (Drosophila)"""			11274425	Standard	NM_033129		Approved	ZNF898B	uc002wec.3	Q9NQ03	OTTHUMG00000130829	ENST00000246104.6:c.65C>T	20.37:g.656181G>A	ENSP00000246104:p.Ala22Val	Somatic		Capture	Illumina GAIIx	4	604181		Missense_Mutation	SNP	HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667	p.A22V	ENST00000246104.6	37	c.65	CCDS13006.1	20	106	0.048534798534798536	7	0.014227642276422764	16	0.04419889502762431	3	0.005244755244755245	80	0.10554089709762533	G	14.23	2.472889	0.43942	0.036796	0.089392	ENSG00000215397	ENST00000246104	T	0.09255	3.0	4.24	2.18	0.27775	.	0.425364	0.19905	U	0.103422	T	0.00178	0.0005	L	0.43152	1.355	0.38947	P	0.04172100000000001	B	0.28470	0.213	B	0.18871	0.023	T	0.23940	-1.0174	9	0.37606	T	0.19	-7.6146	6.9152	0.24355	0.0:0.1932:0.6071:0.1997	.	22	Q9NQ03	SCRT2_HUMAN	V	22	ENSP00000246104:A22V	ENSP00000246104:A22V	A	-	2	0	SCRT2	604181	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.401000	0.44513	0.370000	0.24538	0.484000	0.47621	GCC	-	NULL		0.746	SCRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCRT2	protein_coding	OTTHUMT00000253383.2	G	NM_033129		604181	-1	no_errors	NM_033129	genbank	human	validated	54_36p	missense	SNP	1.000	A
DEAF1	10522	genome.wustl.edu	37	11	676486	676486	+	Intron	SNP	C	C	T	rs143676584	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr11:676486C>T	ENST00000382409.3	-	10	1740				RP11-754B17.1_ENST00000527799.1_RNA|DEAF1_ENST00000525904.1_Intron|DEAF1_ENST00000338675.6_Intron	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor						anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		CTGAAATGTTCGCAGAATCAG	0.587													C|||	9	0.00179712	0.0	0.0029	5008	,	,		14327	0.0		0.007	False		,,,				2504	0.0															0			11																																								666486	SO:0001627	intron_variant	0			AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.1256-1703G>A	11.37:g.676486C>T		Somatic		Capture	Illumina GAIIx	4	666486	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Missense_Mutation	SNP	NULL	p.E357K	ENST00000382409.3	37	c.1069	CCDS31327.1	11																																																																																			-	NULL		0.587	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100133432	protein_coding	OTTHUMT00000383614.3	C	NM_021008		666486	-1	no_start_codon:pseudogene:no_stop_codon	XM_001714734	genbank	human	model	54_36p	missense	SNP	0.052	T
IL3RA	3563	genome.wustl.edu	37	X	1497644	1497644	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chrX:1497644G>C	ENST00000331035.4	+	10	1316	c.967G>C	c.(967-969)Gtg>Ctg	p.V323L	IL3RA_ENST00000381469.2_Missense_Mutation_p.V245L	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	323			V -> L (in dbSNP:rs17883366). {ECO:0000269|Ref.5}.		cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)			lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	CTGTGTCTTCGTGATCTGCAG	0.592													g|||	525	0.104832	0.0378	0.1297	5008	,	,		16681	0.0694		0.2058	False		,,,				2504	0.1104															0			X							LEU/VAL	293,4109		12,269,1920	130.0	106.0	114.0		967	-1.6	0.0	X	dbSNP_134	114	1580,7012		144,1292,2860	no	missense	IL3RA	NM_002183.2	32	156,1561,4780	CC,CG,GG		18.3892,6.6561,14.4143	benign	323/379	1497644	1873,11121	2201	4296	6497	1457644	SO:0001583	missense	3563			M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.967G>C	X.37:g.1497644G>C	ENSP00000327890:p.Val323Leu	Somatic		Capture	Illumina GAIIx	4	1457644	A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Missense_Mutation	SNP	superfamily_FN_III-like,HMMPfam_Haemat_rec_S_F2,PatternScan_HEMATOPO_REC_S_F2	p.V323L	ENST00000331035.4	37	c.967	CCDS14113.1	X	283	0.1295787545787546	21	0.042682926829268296	54	0.14917127071823205	53	0.09265734265734266	155	0.20448548812664907	.	0	-2.808565	0.00074	0.066561	0.183892	ENSG00000185291	ENST00000331035;ENST00000381469	T;D	0.96522	1.74;-4.04	0.798	-1.6	0.08426	.	0.471891	0.15240	N	0.272951	T	0.00271	0.0008	N	0.00841	-1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.51957	-0.8639	9	0.06757	T	0.87	.	.	.	.	.	244;323	P26951-2;P26951	.;IL3RA_HUMAN	L	323;245	ENSP00000327890:V323L;ENSP00000370878:V245L	ENSP00000327890:V323L	V	+	1	0	IL3RA	1457644	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.991000	0.03728	-2.554000	0.00477	-2.540000	0.00180	GTG	-	NULL		0.592	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL3RA	protein_coding	OTTHUMT00000055600.3	G			1457644	+1	no_errors	NM_002183	genbank	human	reviewed	54_36p	missense	SNP	0.001	C
ASMT	438	genome.wustl.edu	37	X	1755404	1755404	+	Silent	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chrX:1755404C>T	ENST00000381229.4	+	7	813	c.777C>T	c.(775-777)gaC>gaT	p.D259D	ASMT_ENST00000381241.3_Silent_p.D287D|ASMT_ENST00000381233.3_Silent_p.D212D			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	259					cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	ACTGGGCAGACGGAAAGTGCT	0.557													.|||	666	0.132987	0.1157	0.1138	5008	,	,		18401	0.2956		0.0825	False		,,,				2504	0.0542															0			X							,,	548,3858		29,490,1684	365.0	322.0	337.0		861,636,861	1.1	0.0	X	dbSNP_134	337	702,7890		32,638,3626	no	coding-synonymous,coding-synonymous,coding-synonymous	ASMT	NM_001171038.1,NM_001171039.1,NM_004043.2	,,	61,1128,5310	TT,TC,CC		8.1704,12.4376,9.6169	,,	287/374,212/299,287/374	1755404	1250,11748	2203	4296	6499	1715404	SO:0001819	synonymous_variant	438			M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.777C>T	X.37:g.1755404C>T		Somatic		Capture	Illumina GAIIx	4	1715404	B2RC33|Q16598|Q5JQ72|Q5JQ73	Silent	SNP	superfamily_SSF46785,HMMPfam_Methyltransf_2,superfamily_SSF53335	p.D287	ENST00000381229.4	37	c.861		X																																																																																			-	HMMPfam_Methyltransf_2,superfamily_SSF53335		0.557	ASMT-002	KNOWN	basic|appris_principal	protein_coding	ASMT	protein_coding	OTTHUMT00000055612.1	C	NM_004043		1715404	+1	no_errors	NM_004043	genbank	human	validated	54_36p	silent	SNP	0.994	T
ABCA3	21	genome.wustl.edu	37	16	2348448	2348448	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr16:2348448G>A	ENST00000301732.5	-	15	2535	c.1835C>T	c.(1834-1836)cCg>cTg	p.P612L	ABCA3_ENST00000382381.3_Missense_Mutation_p.P554L	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	612	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GTCGTGCTGCGGGCACAGGCC	0.582																																																0			16											133.0	126.0	128.0					16																	2348448		2198	4300	6498	2288449	SO:0001583	missense	21			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.1835C>T	16.37:g.2348448G>A	ENSP00000301732:p.Pro612Leu	Somatic		Capture	Illumina GAIIx	4	2288449	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.P612L	ENST00000301732.5	37	c.1835	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	G	18.46	3.627919	0.66901	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.94184	-3.37	6.17	6.17	0.99709	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96661	0.8910	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.998;1.0	D	0.95006	0.8147	10	0.33141	T	0.24	.	19.4575	0.94900	0.0:0.0:1.0:0.0	.	612;616;612	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	L	612;616	ENSP00000301732:P612L	ENSP00000301732:P612L	P	-	2	0	ABCA3	2288449	1.000000	0.71417	0.973000	0.42090	0.011000	0.07611	8.027000	0.88791	2.941000	0.99782	0.655000	0.94253	CCG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran		0.582	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	protein_coding	OTTHUMT00000250784.2	G	NM_001089		2288449	-1	no_errors	NM_001089	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
STS	412	genome.wustl.edu	37	X	7268186	7268186	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chrX:7268186G>A	ENST00000217961.4	+	10	1856	c.1636G>A	c.(1636-1638)Gat>Aat	p.D546N		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	546					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	AGAGGTGCCCGATCAGTTTTC	0.517									Ichthyosis																																							0			X											58.0	54.0	55.0					X																	7268186		2203	4299	6502	7278186	SO:0001583	missense	412	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.1636G>A	X.37:g.7268186G>A	ENSP00000217961:p.Asp546Asn	Somatic		Capture	Illumina GAIIx	4	7278186	B2RA47	Missense_Mutation	SNP	superfamily_Alkaline_phosphatase_core,HMMPfam_Sulfatase,PatternScan_SULFATASE_1,PatternScan_SULFATASE_2	p.D546N	ENST00000217961.4	37	c.1636	CCDS14127.1	X	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.647889	0.00785	.	.	ENSG00000101846	ENST00000217961	D	0.88975	-2.45	4.22	-1.29	0.09288	Alkaline-phosphatase-like, core domain (1);	0.293314	0.37437	N	0.002096	T	0.53530	0.1802	N	0.00099	-2.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.61412	-0.7068	10	0.06494	T	0.89	.	9.4691	0.38831	0.541:0.0:0.459:0.0	.	546	P08842	STS_HUMAN	N	546	ENSP00000217961:D546N	ENSP00000217961:D546N	D	+	1	0	STS	7278186	0.000000	0.05858	0.029000	0.17559	0.050000	0.14768	-0.560000	0.05964	-0.707000	0.05022	-0.296000	0.09543	GAT	-	superfamily_Alkaline_phosphatase_core		0.517	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STS	protein_coding	OTTHUMT00000055686.1	G	NM_000351		7278186	+1	no_errors	NM_000351	genbank	human	reviewed	54_36p	missense	SNP	0.957	A
TP53	7157	genome.wustl.edu	37	17	7577547	7577547	+	Missense_Mutation	SNP	C	C	T	rs121912656|rs397516437		TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr17:7577547C>T	ENST00000269305.4	-	7	923	c.734G>A	c.(733-735)gGc>gAc	p.G245D	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G245D|TP53_ENST00000445888.2_Missense_Mutation_p.G245D|TP53_ENST00000413465.2_Missense_Mutation_p.G245D|TP53_ENST00000420246.2_Missense_Mutation_p.G245D|TP53_ENST00000455263.2_Missense_Mutation_p.G245D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245D(104)|p.G245V(66)|p.G245A(8)|p.0?(8)|p.?(5)|p.G152V(4)|p.G244_M246>V(3)|p.G152D(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.G245fs*2(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.C238_M246delCNSSCMGGM(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTTCATGCCGCCCATGCA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	219	Substitution - Missense(191)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	large_intestine(37)|lung(32)|oesophagus(23)|breast(22)|ovary(18)|upper_aerodigestive_tract(16)|haematopoietic_and_lymphoid_tissue(15)|liver(9)|prostate(7)|stomach(6)|central_nervous_system(6)|skin(6)|biliary_tract(5)|urinary_tract(5)|bone(5)|pancreas(4)|cervix(1)|vulva(1)|endometrium(1)	17	GRCh37	CM010464|CM900209	TP53	M	rs121912656						151.0	113.0	126.0					17																	7577547		2203	4300	6503	7518272	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.734G>A	17.37:g.7577547C>T	ENSP00000269305:p.Gly245Asp	Somatic		Capture	Illumina GAIIx	4	7518272	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.G245D	ENST00000269305.4	37	c.734	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838149	0.91117	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	A	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;1.0;1.0	D	0.96045	0.9027	9	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	D	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245D;ENSP00000352610:G245D;ENSP00000269305:G245D;ENSP00000398846:G245D;ENSP00000391127:G245D;ENSP00000391478:G245D;ENSP00000425104:G113D;ENSP00000423862:G152D	ENSP00000269305:G245D	G	-	2	0	TP53	7518272	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	-	HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7518272	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SLC35B3	51000	genome.wustl.edu	37	6	8421051	8421051	+	Nonsense_Mutation	SNP	A	A	C			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr6:8421051A>C	ENST00000379660.4	-	6	1034	c.585T>G	c.(583-585)taT>taG	p.Y195*	SLC35B3_ENST00000339306.5_Nonsense_Mutation_p.Y195*	NM_001142540.1|NM_001142541.1|NM_015948.3	NP_001136012.1|NP_001136013.1|NP_057032.2	Q9H1N7	S35B3_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B3	195					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(1)|prostate(1)	15	Ovarian(93;0.0569)					CTGCAACATTATAACGCTTTC	0.413																																					Melanoma(83;700 1353 9357 11478 30548)											0			6											97.0	95.0	95.0					6																	8421051		2203	4300	6503	8366050	SO:0001587	stop_gained	51000			AF132953	CCDS4508.1	6p24.3	2013-07-17	2013-07-17	2003-09-10	ENSG00000124786	ENSG00000124786		"""Solute carriers"""	21601	protein-coding gene	gene with protein product	"""3' phosphoadenosine 5' phosphosulfate transporter 2"""	610845	"""chromosome 6 open reading frame 196"", ""solute carrier family 35, member B3"""	C6orf196		10810093	Standard	XM_005249156		Approved	CGI-19, dJ453H5.1, PAPST2	uc010joe.3	Q9H1N7	OTTHUMG00000014224	ENST00000379660.4:c.585T>G	6.37:g.8421051A>C	ENSP00000368981:p.Tyr195*	Somatic		Capture	Illumina GAIIx	4	8366050	A6NKX9|Q1XH11|Q6MZJ0|Q7Z662|Q9Y308	Nonsense_Mutation	SNP	HMMPfam_UAA,superfamily_Multidrug resistance efflux transporter EmrE	p.Y195*	ENST00000379660.4	37	c.585	CCDS4508.1	6	.	.	.	.	.	.	.	.	.	.	A	23.7	4.443447	0.83993	.	.	ENSG00000124786	ENST00000379660;ENST00000339306	.	.	.	5.47	-6.23	0.02052	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.8889	17.1722	0.86833	0.7066:0.0:0.2934:0.0	.	.	.	.	X	195	.	.	Y	-	3	2	SLC35B3	8366050	0.003000	0.15002	0.010000	0.14722	0.089000	0.18198	-1.311000	0.02723	-1.219000	0.02597	-1.973000	0.00462	TAT	-	HMMPfam_UAA,superfamily_Multidrug resistance efflux transporter EmrE		0.413	SLC35B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35B3	protein_coding	OTTHUMT00000039802.1	A	NM_015948		8366050	-1	no_errors	NM_015948	genbank	human	validated	54_36p	nonsense	SNP	0.918	C
ECHDC3	79746	genome.wustl.edu	37	10	11784633	11784633	+	Missense_Mutation	SNP	C	C	T	rs11558855	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr10:11784633C>T	ENST00000379215.4	+	1	269	c.58C>T	c.(58-60)Cgc>Tgc	p.R20C	ECHDC3_ENST00000496136.1_3'UTR	NM_024693.4	NP_078969	Q96DC8	ECHD3_HUMAN	enoyl CoA hydratase domain containing 3	20						mitochondrion (GO:0005739)	catalytic activity (GO:0003824)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)	4						GTGTCTCCGGCGCGGCCCCTG	0.781													C|||	460	0.091853	0.0424	0.1254	5008	,	,		5907	0.0169		0.17	False		,,,				2504	0.1319															0			10						C	CYS/ARG	141,2883		1,139,1372	2.0	2.0	2.0		58	2.0	0.0	10	dbSNP_120	2	838,5418		38,762,2328	no	missense	ECHDC3	NM_024693.4	180	39,901,3700	TT,TC,CC		13.3951,4.6627,10.5496	probably-damaging	20/304	11784633	979,8301	1512	3128	4640	11824639	SO:0001583	missense	79746			AF275677	CCDS7084.1	10p14	2010-04-30	2010-04-30		ENSG00000134463	ENSG00000134463			23489	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 3"""			12477932	Standard	NM_024693		Approved	FLJ20909	uc001ikw.4	Q96DC8	OTTHUMG00000017675	ENST00000379215.4:c.58C>T	10.37:g.11784633C>T	ENSP00000368517:p.Arg20Cys	Somatic		Capture	Illumina GAIIx	4	11824639	Q53HR9|Q5W0J7|Q8WYY8|Q9BVL8|Q9H7G4	Missense_Mutation	SNP	superfamily_ClpP/crotonase,HMMPfam_ECH	p.R20C	ENST00000379215.4	37	c.58	CCDS7084.1	10	266	0.12179487179487179	44	0.08943089430894309	44	0.12154696132596685	31	0.05419580419580419	147	0.19393139841688653	C	16.93	3.258520	0.59321	0.046627	0.133951	ENSG00000134463	ENST00000379215;ENST00000420401	T;T	0.73258	-0.14;-0.73	4.08	2.03	0.26663	.	0.616622	0.16841	N	0.197355	T	0.00144	0.0004	L	0.29908	0.895	0.80722	P	0.0	D	0.69078	0.997	B	0.44315	0.446	T	0.04307	-1.0961	9	0.62326	D	0.03	.	7.364	0.26762	0.1877:0.6294:0.1829:0.0	rs11558855	20	Q96DC8	ECHD3_HUMAN	C	20	ENSP00000368517:R20C;ENSP00000405584:R20C	ENSP00000368517:R20C	R	+	1	0	ECHDC3	11824639	0.021000	0.18746	0.013000	0.15412	0.002000	0.02628	0.149000	0.16243	0.834000	0.34852	-0.326000	0.08463	CGC	-	NULL		0.781	ECHDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECHDC3	protein_coding	OTTHUMT00000046771.1	C	NM_024693		11824639	+1	no_errors	NM_024693	genbank	human	validated	54_36p	missense	SNP	0.006	T
Unknown	0	genome.wustl.edu	37	1	12987949	12987949	+	IGR	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr1:12987949C>T								RNU6-1072P (5469 upstream) : PRAMEF6 (10231 downstream)																							AGATCTTCGCCCCACTTCGGG	0.572																																																0			1																																								12910536	SO:0001628	intergenic_variant	729356																															1.37:g.12987949C>T		Somatic		Capture	Illumina GAIIx	4	12910536		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.572					LOC729356			C			12910536	+1	pseudogene	XR_015521	genbank	human	model	54_36p	rna	SNP	0.000	T
NUP210	23225	genome.wustl.edu	37	3	13373834	13373834	+	Missense_Mutation	SNP	T	T	C	rs375652396		TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr3:13373834T>C	ENST00000254508.5	-	29	3976	c.3894A>G	c.(3892-3894)atA>atG	p.I1298M		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1298					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GCGACATTAATATTTGTTCTG	0.483																																																0			3											251.0	246.0	247.0					3																	13373834		2203	4300	6503	13348834	SO:0001583	missense	23225			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.3894A>G	3.37:g.13373834T>C	ENSP00000254508:p.Ile1298Met	Somatic		Capture	Illumina GAIIx	4	13348834	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	superfamily_Invasin/intimin cell-adhesion fragments,HMMPfam_Big_2,HMMSmart_SM00635	p.I1298M	ENST00000254508.5	37	c.3894	CCDS33704.1	3	.	.	.	.	.	.	.	.	.	.	T	6.954	0.545875	0.13312	.	.	ENSG00000132182	ENST00000254508	T	0.08807	3.05	5.13	-0.51	0.11973	.	0.111526	0.64402	D	0.000017	T	0.11367	0.0277	M	0.80746	2.51	0.46954	D	0.999263	B	0.32245	0.361	B	0.27608	0.081	T	0.09773	-1.0659	10	0.66056	D	0.02	-9.3655	11.547	0.50698	0.0:0.0768:0.6545:0.2687	.	1298	Q8TEM1	PO210_HUMAN	M	1298	ENSP00000254508:I1298M	ENSP00000254508:I1298M	I	-	3	3	NUP210	13348834	0.964000	0.33143	0.046000	0.18839	0.069000	0.16628	0.548000	0.23314	-0.237000	0.09739	-0.461000	0.05368	ATA	-	NULL		0.483	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	protein_coding	OTTHUMT00000340085.1	T	NM_024923		13348834	-1	no_errors	NM_024923	genbank	human	reviewed	54_36p	missense	SNP	0.953	C
NWD1	284434	genome.wustl.edu	37	19	16918641	16918641	+	Missense_Mutation	SNP	C	C	G			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr19:16918641C>G	ENST00000552788.1	+	16	3981	c.3981C>G	c.(3979-3981)atC>atG	p.I1327M	NWD1_ENST00000379808.3_Missense_Mutation_p.I1327M|NWD1_ENST00000549814.1_Missense_Mutation_p.I1285M|NWD1_ENST00000524140.2_Missense_Mutation_p.I1327M|NWD1_ENST00000523826.1_Missense_Mutation_p.I1121M|NWD1_ENST00000339803.6_Missense_Mutation_p.I1192M			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1327							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGCTGGACATCACCTCCGGGG	0.617																																																0			19											90.0	77.0	82.0					19																	16918641		2203	4300	6503	16779641	SO:0001583	missense	284434			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.3981C>G	19.37:g.16918641C>G	ENSP00000447224:p.Ile1327Met	Somatic		Capture	Illumina GAIIx	4	16779641	C9J021|Q68CT3	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.I1192M	ENST00000552788.1	37	c.3576		19	.	.	.	.	.	.	.	.	.	.	C	10.14	1.269708	0.23221	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.71817	-0.31;-0.6;-0.31;2.15;1.45;2.15	4.95	-0.404	0.12396	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.283823	0.32987	N	0.005406	T	0.72120	0.3421	L	0.54323	1.7	0.26606	N	0.972932	D;D;D	0.67145	0.974;0.996;0.993	P;D;P	0.65010	0.694;0.931;0.855	T	0.61392	-0.7072	10	0.41790	T	0.15	-20.921	4.9163	0.13847	0.0:0.4687:0.1564:0.3748	.	1327;1327;1192	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	M	1192;1327;1285;1327;1121;1327;1192	ENSP00000428579:I1327M;ENSP00000447548:I1285M;ENSP00000369136:I1327M;ENSP00000428955:I1121M;ENSP00000447224:I1327M;ENSP00000340159:I1192M	ENSP00000340159:I1192M	I	+	3	3	NWD1	16779641	0.625000	0.27111	0.397000	0.26308	0.013000	0.08279	0.501000	0.22578	0.123000	0.18342	-0.136000	0.14681	ATC	-	superfamily_WD40 repeat-like		0.617	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	protein_coding	OTTHUMT00000403569.1	C	NM_001007525		16779641	+1	no_errors	NM_001007525	genbank	human	validated	54_36p	missense	SNP	0.999	G
NF1P1	100419006	genome.wustl.edu	37	15	21138111	21138111	+	IGR	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr15:21138111C>T								POTEB2 (66468 upstream) : MIR5701-1 (7469 downstream)																							AGGTCCTTAACATTGGCCCGT	0.438																																																0			15																																								19402770	SO:0001628	intergenic_variant	440225																															15.37:g.21138111C>T		Somatic		Capture	Illumina GAIIx	4	19402770		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.438					LOC440225			C			19402770	-1	pseudogene	XR_042334	genbank	human	model	54_36p	rna	SNP	1.000	T
FANCF	2188	genome.wustl.edu	37	11	22646800	22646800	+	Missense_Mutation	SNP	G	G	A	rs113910234	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr11:22646800G>A	ENST00000327470.3	-	1	587	c.557C>T	c.(556-558)gCc>gTc	p.A186V	AC103801.2_ENST00000428556.2_5'Flank	NM_022725.3	NP_073562.1	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	186					DNA repair (GO:0006281)|ovarian follicle development (GO:0001541)|spermatogenesis (GO:0007283)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			kidney(3)|large_intestine(3)|lung(6)|skin(1)	13						GAGAAACCTGGCGGGACGCTC	0.622			"""N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	26	0.00519169	0.0	0.0058	5008	,	,		14439	0.001		0.005	False		,,,				2504	0.0164					yes	Rec		Fanconi anaemia F	11	11p15	2188	"""Fanconi anemia, complementation group F"""		L	0			11						G	VAL/ALA	2,4404	2.1+/-5.4	0,2,2201	58.0	68.0	65.0		557	1.8	0.0	11	dbSNP_132	65	72,8528	42.6+/-100.3	0,72,4228	yes	missense	FANCF	NM_022725.3	64	0,74,6429	AA,AG,GG		0.8372,0.0454,0.569	benign	186/375	22646800	74,12932	2203	4300	6503	22603376	SO:0001583	missense	2188	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)		CCDS7857.1	11p15	2014-09-17				ENSG00000183161		"""Fanconi anemia, complementation groups"""	3587	protein-coding gene	gene with protein product		613897				9382107	Standard	NM_022725		Approved	FAF	uc001mql.1	Q9NPI8		ENST00000327470.3:c.557C>T	11.37:g.22646800G>A	ENSP00000330875:p.Ala186Val	Somatic	757	Capture	Illumina GAIIx	4	22603376	Q52LM0	Missense_Mutation	SNP	NULL	p.A186V	ENST00000327470.3	37	c.557	CCDS7857.1	11	6	0.0027472527472527475	0	0.0	3	0.008287292817679558	0	0.0	3	0.00395778364116095	G	11.21	1.572775	0.28092	4.54E-4	0.008372	ENSG00000183161	ENST00000327470	T	0.31247	1.5	4.87	1.82	0.25136	.	2.075460	0.01813	N	0.033578	T	0.15262	0.0368	N	0.14661	0.345	0.09310	N	1	B	0.19935	0.04	B	0.25614	0.062	T	0.20773	-1.0265	10	0.13108	T	0.6	-0.0561	9.4974	0.38997	0.0:0.503:0.4183:0.0787	.	186	Q9NPI8	FANCF_HUMAN	V	186	ENSP00000330875:A186V	ENSP00000330875:A186V	A	-	2	0	FANCF	22603376	0.000000	0.05858	0.005000	0.12908	0.012000	0.07955	0.410000	0.21098	0.656000	0.30886	-1.083000	0.02208	GCC	-	NULL		0.622	FANCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCF	protein_coding	OTTHUMT00000387712.2	G	NM_022725		22603376	-1	no_errors	NM_022725	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
ATP10A	57194	genome.wustl.edu	37	15	25972310	25972310	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr15:25972310C>T	ENST00000356865.6	-	4	955	c.844G>A	c.(844-846)Gca>Aca	p.A282T		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	282					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		AGCCTACCTGCGTAGATGACA	0.527																																																0			15											106.0	83.0	91.0					15																	25972310		2203	4300	6503	23523403	SO:0001583	missense	57194			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.844G>A	15.37:g.25972310C>T	ENSP00000349325:p.Ala282Thr	Somatic		Capture	Illumina GAIIx	4	23523403	Q4G0S9|Q969I4	Missense_Mutation	SNP	HMMPfam_E1-E2_ATPase,superfamily_SSF81653,superfamily_SSF56784,PatternScan_ATPASE_E1_E2,superfamily_SSF81660,HMMPfam_Hydrolase_3	p.A282T	ENST00000356865.6	37	c.844	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.472719	0.96274	.	.	ENSG00000206190	ENST00000356865	D	0.88277	-2.36	5.34	5.34	0.76211	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.88078	0.6340	L	0.33137	0.985	0.80722	D	1	D	0.56521	0.976	P	0.51895	0.683	D	0.85362	0.1108	10	0.20046	T	0.44	.	19.0349	0.92972	0.0:1.0:0.0:0.0	.	282	O60312	AT10A_HUMAN	T	282	ENSP00000349325:A282T	ENSP00000349325:A282T	A	-	1	0	ATP10A	23523403	1.000000	0.71417	0.965000	0.40720	0.843000	0.47879	7.193000	0.77780	2.513000	0.84729	0.563000	0.77884	GCA	-	HMMPfam_E1-E2_ATPase,superfamily_SSF81653		0.527	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	protein_coding	OTTHUMT00000414830.1	C	NM_024490		23523403	-1	no_errors	NM_024490	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
KIAA1551	55196	genome.wustl.edu	37	12	32136831	32136831	+	Missense_Mutation	SNP	C	C	T	rs74831632	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr12:32136831C>T	ENST00000312561.4	+	4	3356	c.2942C>T	c.(2941-2943)tCa>tTa	p.S981L	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	981																	CCCTTAGAGTCATCTTTTAAC	0.368													C|||	32	0.00638978	0.0227	0.0029	5008	,	,		21733	0.0		0.0	False		,,,				2504	0.0															0			12						C	LEU/SER	70,4336	59.9+/-96.7	1,68,2134	48.0	52.0	51.0		2942	3.5	0.0	12	dbSNP_131	51	1,8597	1.2+/-3.3	0,1,4298	yes	missense	C12orf35	NM_018169.3	145	1,69,6432	TT,TC,CC		0.0116,1.5887,0.546	benign	981/1748	32136831	71,12933	2203	4299	6502	32028098	SO:0001583	missense	55196			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.2942C>T	12.37:g.32136831C>T	ENSP00000310338:p.Ser981Leu	Somatic		Capture	Illumina GAIIx	4	32028098	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.S981L	ENST00000312561.4	37	c.2942	CCDS8725.2	12	13	0.005952380952380952	12	0.024390243902439025	1	0.0027624309392265192	0	0.0	0	0.0	C	9.776	1.173997	0.21704	0.015887	1.16E-4	ENSG00000174718	ENST00000312561	T	0.14266	2.52	5.37	3.53	0.40419	.	2.494330	0.01461	N	0.015876	T	0.05364	0.0142	N	0.17474	0.49	0.09310	N	1	B	0.25390	0.125	B	0.21917	0.037	T	0.34153	-0.9840	9	.	.	.	.	10.5656	0.45171	0.0:0.8459:0.0:0.1541	.	981	Q9HCM1	CL035_HUMAN	L	981	ENSP00000310338:S981L	.	S	+	2	0	C12orf35	32028098	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.696000	0.05104	0.735000	0.32537	0.655000	0.94253	TCA	-	NULL		0.368	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf35	protein_coding	OTTHUMT00000250307.2	C	NM_018169		32028098	+1	no_errors	NM_018169	genbank	human	validated	54_36p	missense	SNP	0.000	T
HERC2P4	100289574	genome.wustl.edu	37	16	32163525	32163525	+	IGR	SNP	G	G	A	rs461744	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr16:32163525G>A								RP11-1166P10.6 (67419 upstream) : HERC2P4 (17779 downstream)																							TGCCAGTCACGGTGCCTTCTC	0.567																																																0			16																																								32071026	SO:0001628	intergenic_variant	440362																															16.37:g.32163525G>A		Somatic		Capture	Illumina GAIIx	4	32071026		RNA	SNP	-	NULL		37	NULL		16																																																																																			-	-	0	0.567					HERC2P4			G			32071026	-1	pseudogene	NR_002827	genbank	human	provisional	54_36p	rna	SNP	0.960	A
HMGXB4	10042	genome.wustl.edu	37	22	35660878	35660878	+	Missense_Mutation	SNP	C	C	G	rs534928094		TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr22:35660878C>G	ENST00000216106.5	+	5	625	c.497C>G	c.(496-498)tCc>tGc	p.S166C	HMGXB4_ENST00000444518.2_Missense_Mutation_p.S57C	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	166					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GATGGTGGCTCCCACAAATCG	0.458																																																0			22											77.0	78.0	78.0					22																	35660878		2203	4300	6503	33990878	SO:0001583	missense	10042			AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.497C>G	22.37:g.35660878C>G	ENSP00000216106:p.Ser166Cys	Somatic		Capture	Illumina GAIIx	4	33990878	O75672|O75673|Q9UMT5	Missense_Mutation	SNP	superfamily_HMG-box,HMMSmart_HMG,HMMPfam_HMG_box	p.S166C	ENST00000216106.5	37	c.497	CCDS33641.1	22	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019288	0.35606	.	.	ENSG00000100281	ENST00000420166;ENST00000444518;ENST00000455359;ENST00000216106	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.58	2.13	0.27403	.	0.461317	0.26563	N	0.023664	T	0.27866	0.0686	N	0.08118	0	0.24931	N	0.991917	B	0.09022	0.002	B	0.08055	0.003	T	0.19877	-1.0292	10	0.72032	D	0.01	-1.1458	6.2401	0.20785	0.1203:0.6478:0.1173:0.1147	.	166	Q9UGU5	HMGX4_HUMAN	C	57;57;57;166	ENSP00000401658:S57C;ENSP00000398302:S57C;ENSP00000415500:S57C;ENSP00000216106:S166C	ENSP00000216106:S166C	S	+	2	0	HMGXB4	33990878	0.559000	0.26562	0.900000	0.35374	0.939000	0.58152	0.842000	0.27627	1.458000	0.47871	0.557000	0.71058	TCC	-	NULL		0.458	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HMGXB4	protein_coding	OTTHUMT00000318104.2	C	NM_005487		33990878	+1	no_errors	NM_001003681	genbank	human	validated	54_36p	missense	SNP	0.462	G
MYH9	4627	genome.wustl.edu	37	22	36698623	36698623	+	Silent	SNP	G	G	A			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr22:36698623G>A	ENST00000216181.5	-	20	2720	c.2490C>T	c.(2488-2490)ctC>ctT	p.L830L		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	830					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CCTTGGTGAAGAGCCGCCACC	0.562			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0			22											69.0	67.0	67.0					22																	36698623		2203	4300	6503	35028569	SO:0001819	synonymous_variant	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2490C>T	22.37:g.36698623G>A		Somatic		Capture	Illumina GAIIx	4	35028569	A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	HMMPfam_Myosin_N,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMSmart_SM00015,HMMPfam_IQ,superfamily_Prefoldin,HMMPfam_Myosin_tail_1,superfamily_Regulator of G-protein signaling RGS	p.L830	ENST00000216181.5	37	c.2490	CCDS13927.1	22																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.562	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	protein_coding	OTTHUMT00000259110.3	G	NM_002473		35028569	-1	no_errors	NM_002473	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
RET	5979	genome.wustl.edu	37	10	43612144	43612144	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr10:43612144C>T	ENST00000355710.3	+	12	2481	c.2249C>T	c.(2248-2250)gCa>gTa	p.A750V	RET_ENST00000340058.5_Missense_Mutation_p.A750V	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	750	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			A -> G (in Ref. 9; AAA36524). {ECO:0000305}.	activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	AAAGGCAGAGCAGGGTACACC	0.592		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0			10											120.0	127.0	125.0					10																	43612144		2203	4300	6503	42932150	SO:0001583	missense	5979	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2249C>T	10.37:g.43612144C>T	ENSP00000347942:p.Ala750Val	Somatic		Capture	Illumina GAIIx	4	42932150	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.A750V	ENST00000355710.3	37	c.2249	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	C	33	5.288383	0.95517	.	.	ENSG00000165731	ENST00000355710;ENST00000340058	D;D	0.83075	-1.68;-1.68	5.65	5.65	0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.047585	0.85682	D	0.000000	D	0.83303	0.5225	L	0.38953	1.18	0.80722	D	1	P;D;D	0.57899	0.785;0.972;0.981	B;P;P	0.50109	0.391;0.631;0.575	D	0.84560	0.0649	10	0.59425	D	0.04	.	19.7216	0.96145	0.0:1.0:0.0:0.0	.	496;750;750	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	V	750	ENSP00000347942:A750V;ENSP00000344798:A750V	ENSP00000344798:A750V	A	+	2	0	RET	42932150	1.000000	0.71417	0.947000	0.38551	0.997000	0.91878	7.818000	0.86416	2.664000	0.90586	0.655000	0.94253	GCA	-	superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP		0.592	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	protein_coding	OTTHUMT00000047694.2	C	NM_020975		42932150	+1	no_errors	NM_020975	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ABCG8	64241	genome.wustl.edu	37	2	44099244	44099244	+	Missense_Mutation	SNP	C	C	T	rs140778634	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr2:44099244C>T	ENST00000272286.2	+	7	1184	c.1094C>T	c.(1093-1095)aCg>aTg	p.T365M		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	365					ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	AAAGCAGAGACGAAGGATCTT	0.547													C|||	11	0.00219649	0.0076	0.0014	5008	,	,		20538	0.0		0.0	False		,,,				2504	0.0															0			2						C	MET/THR	21,4385	29.0+/-57.7	0,21,2182	118.0	115.0	116.0		1094	-6.5	0.0	2	dbSNP_134	116	0,8600		0,0,4300	yes	missense	ABCG8	NM_022437.2	81	0,21,6482	TT,TC,CC		0.0,0.4766,0.1615	possibly-damaging	365/674	44099244	21,12985	2203	4300	6503	43952748	SO:0001583	missense	64241			AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1094C>T	2.37:g.44099244C>T	ENSP00000272286:p.Thr365Met	Somatic		Capture	Illumina GAIIx	4	43952748	Q53QN8	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1,HMMPfam_ABC2_membrane	p.T365M	ENST00000272286.2	37	c.1094	CCDS1815.1	2	4	0.0018315018315018315	3	0.006097560975609756	1	0.0027624309392265192	0	0.0	0	0.0	C	11.35	1.612989	0.28712	0.004766	0.0	ENSG00000143921	ENST00000272286	D	0.88509	-2.39	4.9	-6.49	0.01890	.	1.295300	0.04997	N	0.468452	T	0.67306	0.2879	N	0.08118	0	0.09310	N	1	P;P	0.49961	0.93;0.884	P;B	0.44477	0.451;0.264	T	0.67209	-0.5728	10	0.48119	T	0.1	.	1.3222	0.02118	0.3906:0.1544:0.2851:0.1698	.	365;365	Q9H221-2;Q9H221	.;ABCG8_HUMAN	M	365	ENSP00000272286:T365M	ENSP00000272286:T365M	T	+	2	0	ABCG8	43952748	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.975000	0.03790	-0.877000	0.04012	-1.089000	0.02181	ACG	-	NULL		0.547	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG8	protein_coding	OTTHUMT00000250671.1	C	NM_022437		43952748	+1	no_errors	NM_022437	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
CDH22	64405	genome.wustl.edu	37	20	44856216	44856216	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr20:44856216C>T	ENST00000372262.3	-	3	1001	c.601G>A	c.(601-603)Ggc>Agc	p.G201S	CDH22_ENST00000537909.1_Missense_Mutation_p.G201S	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	201	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GCGCTGCTGCCGTACGTGGGG	0.701																																																0			20											33.0	28.0	29.0					20																	44856216		2202	4299	6501	44289623	SO:0001583	missense	64405			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.601G>A	20.37:g.44856216C>T	ENSP00000361336:p.Gly201Ser	Somatic		Capture	Illumina GAIIx	4	44289623	B9EGK7|O43205	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.G201S	ENST00000372262.3	37	c.601	CCDS13395.1	20	.	.	.	.	.	.	.	.	.	.	C	35	5.593874	0.96602	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.55588	0.51;0.51	5.0	5.0	0.66597	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.76004	0.3927	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79928	-0.1596	10	0.66056	D	0.02	.	17.4676	0.87638	0.0:1.0:0.0:0.0	.	201	Q9UJ99	CAD22_HUMAN	S	201	ENSP00000361336:G201S;ENSP00000437790:G201S	ENSP00000361336:G201S	G	-	1	0	CDH22	44289623	1.000000	0.71417	0.989000	0.46669	0.889000	0.51656	7.646000	0.83445	2.586000	0.87340	0.563000	0.77884	GGC	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.701	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH22	protein_coding	OTTHUMT00000080491.1	C	NM_021248		44289623	-1	no_errors	NM_021248	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ZNF502	91392	genome.wustl.edu	37	3	44763287	44763287	+	Silent	SNP	C	C	T	rs115852283	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr3:44763287C>T	ENST00000296091.4	+	4	1234	c.978C>T	c.(976-978)gaC>gaT	p.D326D	ZNF502_ENST00000449836.1_Silent_p.D326D|ZNF502_ENST00000436624.2_Silent_p.D326D	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	326					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		ATAAATGTGACGAATGTGGGA	0.403													T|||	88	0.0175719	0.0461	0.0187	5008	,	,		21577	0.0		0.0139	False		,,,				2504	0.0															0			3						T	,,,	170,4234	796.8+/-415.4	4,162,2036	76.0	82.0	80.0		978,978,978,978	-5.1	0.0	3	dbSNP_132	80	89,8511	806.4+/-407.2	1,87,4212	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ZNF502	NM_001134440.1,NM_001134441.1,NM_001134442.1,NM_033210.4	,,,	5,249,6248	TT,TC,CC		1.0349,3.8601,1.9917	,,,	326/545,326/545,326/545,326/545	44763287	259,12745	2202	4300	6502	44738291	SO:0001819	synonymous_variant	91392			AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.978C>T	3.37:g.44763287C>T		Somatic		Capture	Illumina GAIIx	4	44738291		Silent	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.D326	ENST00000296091.4	37	c.978	CCDS2719.1	3	43	0.019688644688644688	23	0.046747967479674794	8	0.022099447513812154	0	0.0	12	0.0158311345646438	T	4.748	0.139015	0.09083	0.038601	0.010349	ENSG00000196653	ENST00000427783	.	.	.	4.27	-5.12	0.02893	.	.	.	.	.	T	0.03434	0.0099	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.22417	-1.0217	5	0.45353	T	0.12	-0.9719	0.9874	0.01449	0.3247:0.2956:0.1105:0.2693	.	.	.	.	M	326	.	ENSP00000397812:T326M	T	+	2	0	ZNF502	44738291	0.000000	0.05858	0.001000	0.08648	0.994000	0.84299	-5.830000	0.00096	-1.051000	0.03226	-0.254000	0.11334	ACG	-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.403	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF502	protein_coding	OTTHUMT00000256744.4	C	NM_033210		44738291	+1	no_errors	NM_033210	genbank	human	validated	54_36p	silent	SNP	0.000	T
TUBGCP6	85378	genome.wustl.edu	37	22	50659598	50659598	+	Missense_Mutation	SNP	C	C	T	rs149231425	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr22:50659598C>T	ENST00000248846.5	-	16	3294	c.3190G>A	c.(3190-3192)Ggg>Agg	p.G1064R	TUBGCP6_ENST00000439308.2_Missense_Mutation_p.G1064R|TUBGCP6_ENST00000491449.1_5'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1064	9 X 27 AA tandem repeats.				G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		ACATTCTCCCCGACCCTGATG	0.607													C|||	66	0.0131789	0.0015	0.0259	5008	,	,		23347	0.0		0.0408	False		,,,				2504	0.0051															0			22						C	ARG/GLY	24,4382	31.7+/-61.6	0,24,2179	135.0	137.0	136.0		3190	3.1	0.9	22	dbSNP_134	136	240,8360	97.0+/-158.7	4,232,4064	no	missense	TUBGCP6	NM_020461.3	125	4,256,6243	TT,TC,CC		2.7907,0.5447,2.0298	probably-damaging	1064/1820	50659598	264,12742	2203	4300	6503	49001725	SO:0001583	missense	85378			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.3190G>A	22.37:g.50659598C>T	ENSP00000248846:p.Gly1064Arg	Somatic		Capture	Illumina GAIIx	4	49001725	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	HMMPfam_Spc97_Spc98	p.G1064R	ENST00000248846.5	37	c.3190	CCDS14087.1	22	36	0.016483516483516484	1	0.0020325203252032522	14	0.03867403314917127	0	0.0	21	0.027704485488126648	C	18.10	3.549414	0.65311	0.005447	0.027907	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.20069	2.46;2.1	4.2	3.07	0.35406	.	0.000000	0.85682	D	0.000000	T	0.12603	0.0306	L	0.59436	1.845	0.50171	D	0.999851	D;P;D	0.89917	1.0;0.948;1.0	D;P;D	0.91635	0.999;0.597;0.999	T	0.01894	-1.1252	10	0.45353	T	0.12	.	13.7504	0.62904	0.0:0.8442:0.1558:0.0	.	1056;1064;1064	B2RWN4;Q96RT7;Q96RT7-3	.;GCP6_HUMAN;.	R	1064	ENSP00000248846:G1064R;ENSP00000397387:G1064R	ENSP00000248846:G1064R	G	-	1	0	TUBGCP6	49001725	0.730000	0.28100	0.882000	0.34594	0.145000	0.21501	3.255000	0.51484	2.283000	0.76528	0.655000	0.94253	GGG	-	HMMPfam_Spc97_Spc98		0.607	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP6	protein_coding	OTTHUMT00000075004.3	C	NM_020461		49001725	-1	no_errors	NM_020461	genbank	human	reviewed	54_36p	missense	SNP	0.323	T
SSX7	280658	genome.wustl.edu	37	X	52674514	52674514	+	Missense_Mutation	SNP	G	G	T	rs112382781		TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chrX:52674514G>T	ENST00000298181.5	-	7	704	c.546C>A	c.(544-546)gaC>gaA	p.D182E		NM_173358.2	NP_775494.1	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|skin(1)	16	Ovarian(276;0.236)					CTTCTTCAGGGTCGCTGATCT	0.498													.|||	213	0.0564238	0.0053	0.0447	3775	,	,		13809	0.0218		0.1064	False		,,,				2504	0.047															0			X						G	GLU/ASP	74,3759		4,52,14,1575,557	85.0	69.0	74.0		546	-0.7	0.0	X	dbSNP_134	74	841,5854		40,512,249,1863,1616	no	missense	SSX7	NM_173358.2	45	44,564,263,3438,2173	TT,TG,T,GG,G		12.5616,1.9306,8.6911	probably-damaging	182/189	52674514	915,9613	2202	4280	6482	52691239	SO:0001583	missense	280658			BK000687	CCDS14343.1	Xp11.23	2011-02-10			ENSG00000187754	ENSG00000187754			19653	protein-coding gene	gene with protein product		300542				12216073	Standard	NM_173358		Approved		uc004dqx.1	Q7RTT5	OTTHUMG00000021572	ENST00000298181.5:c.546C>A	X.37:g.52674514G>T	ENSP00000298181:p.Asp182Glu	Somatic		Capture	Illumina GAIIx	4	52691239		Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMSmart_KRAB,HMMPfam_SSXRD	p.D182E	ENST00000298181.5	37	c.546	CCDS14343.1	X	111	0.06690777576853527	6	0.012195121951219513	13	0.03672316384180791	7	0.012455516014234875	61	0.08567415730337079	g	12.49	1.953243	0.34471	0.019306	0.125616	ENSG00000187754	ENST00000298181	T	0.09723	2.95	0.541	-0.687	0.11320	SSXRD motif (1);	0.424262	0.20161	N	0.097952	T	0.00210	0.0006	L	0.58101	1.795	0.80722	P	0.0	D	0.89917	1.0	D	0.91635	0.999	T	0.10613	-1.0622	8	0.15952	T	0.53	.	.	.	.	.	182	Q7RTT5	SSX7_HUMAN	E	182	ENSP00000298181:D182E	ENSP00000298181:D182E	D	-	3	2	SSX7	52691239	0.016000	0.18221	0.008000	0.14137	0.369000	0.29798	-0.783000	0.04638	-0.355000	0.08199	0.164000	0.16699	GAC	-	HMMPfam_SSXRD		0.498	SSX7-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	SSX7	protein_coding	OTTHUMT00000056671.1	G	NM_173358		52691239	-1	no_errors	NM_173358	genbank	human	reviewed	54_36p	missense	SNP	0.011	T
OR4P4	81300	genome.wustl.edu	37	11	55406022	55406022	+	Nonsense_Mutation	SNP	C	C	G	rs76160133	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr11:55406022C>G	ENST00000314612.2	+	1	189	c.189C>G	c.(187-189)taC>taG	p.Y63*		NM_001004124.1	NP_001004124.1	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P, member 4	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(4)|large_intestine(4)|lung(28)|ovary(1)|upper_aerodigestive_tract(1)	40						TCCTCAATTACCTCTCACTCT	0.403													c|||	1428	0.285144	0.0968	0.2968	5008	,	,		14249	0.4563		0.165	False		,,,				2504	0.4785															0			11						C	stop/TYR	475,3887		79,317,1785	176.0	151.0	160.0		189	1.1	0.2	11	dbSNP_131	160	1193,6873		309,575,3149	yes	stop-gained	OR4P4	NM_001004124.1		388,892,4934	GG,GC,CC		14.7905,10.8895,13.4213		63/313	55406022	1668,10760	2181	4033	6214	55162598	SO:0001587	stop_gained	81300			AB065775	CCDS31504.1	11q11	2012-08-09			ENSG00000181927	ENSG00000181927		"""GPCR / Class A : Olfactory receptors"""	15180	protein-coding gene	gene with protein product				OR4P3P			Standard	NM_001004124		Approved		uc010rij.2	Q8NGL7	OTTHUMG00000165300	ENST00000314612.2:c.189C>G	11.37:g.55406022C>G	ENSP00000324831:p.Tyr63*	Somatic		Capture	Illumina GAIIx	4	55162598		Nonsense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.Y63*	ENST00000314612.2	37	c.189	CCDS31504.1	11	411	0.18818681318681318	36	0.07317073170731707	76	0.20994475138121546	211	0.3688811188811189	88	0.11609498680738786	C	9.130	1.011142	0.19277	0.108895	0.147905	ENSG00000181927	ENST00000314612	.	.	.	5.18	1.15	0.20763	.	0.212673	0.23912	N	0.043330	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.5722	5.6068	0.17385	0.0:0.5623:0.1312:0.3066	.	.	.	.	X	63	.	ENSP00000324831:Y63X	Y	+	3	2	OR4P4	55162598	0.000000	0.05858	0.215000	0.23724	0.045000	0.14185	-1.856000	0.01662	-0.045000	0.13468	-0.170000	0.13304	TAC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.403	OR4P4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4P4	protein_coding	OTTHUMT00000383356.1	C	NM_001004124		55162598	+1	no_errors	NM_001004124	genbank	human	provisional	54_36p	nonsense	SNP	0.299	G
COQ9	57017	genome.wustl.edu	37	16	57486726	57486726	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr16:57486726G>A	ENST00000262507.6	+	3	325	c.256G>A	c.(256-258)Ggc>Agc	p.G86S	COQ9_ENST00000567933.1_Missense_Mutation_p.G86S|COQ9_ENST00000567072.1_Missense_Mutation_p.G86S|COQ9_ENST00000567384.1_3'UTR	NM_020312.3	NP_064708.1	O75208	COQ9_HUMAN	coenzyme Q9	86					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)	16						TACAGACCAGGGCGGCGAGGA	0.577																																																0			16											122.0	106.0	112.0					16																	57486726		2198	4300	6498	56044227	SO:0001583	missense	57017			BC064946	CCDS32459.1	16q13	2013-10-18	2013-10-18	2006-01-13	ENSG00000088682	ENSG00000088682			25302	protein-coding gene	gene with protein product		612837	"""chromosome 16 open reading frame 49"", ""coenzyme Q9 homolog (yeast)"", ""coenzyme Q9 homolog (S. cerevisiae)"""	C16orf49		19375058	Standard	NM_020312		Approved	DKFZP434K046	uc002elq.3	O75208		ENST00000262507.6:c.256G>A	16.37:g.57486726G>A	ENSP00000262507:p.Gly86Ser	Somatic		Capture	Illumina GAIIx	4	56044227	A8K3L2|Q7L5V7|Q7Z5T6|Q8NBL4|Q9NTJ2|Q9P056	Missense_Mutation	SNP	HMMPfam_COQ9	p.G86S	ENST00000262507.6	37	c.256	CCDS32459.1	16	.	.	.	.	.	.	.	.	.	.	G	5.412	0.261268	0.10239	.	.	ENSG00000088682	ENST00000262507	.	.	.	5.2	4.19	0.49359	.	0.607246	0.18487	N	0.139761	T	0.25344	0.0616	L	0.28344	0.845	0.23787	N	0.996849	B;B;B;B;B	0.29162	0.003;0.235;0.047;0.001;0.047	B;B;B;B;B	0.31812	0.009;0.136;0.019;0.003;0.015	T	0.27468	-1.0073	9	0.05525	T	0.97	-5.9147	8.0564	0.30608	0.1372:0.0:0.8628:0.0	.	86;86;86;86;86	B4E0U3;B4DIV2;B4DEE3;O75208;O75208-2	.;.;.;COQ9_HUMAN;.	S	86	.	ENSP00000262507:G86S	G	+	1	0	COQ9	56044227	1.000000	0.71417	0.914000	0.36105	0.247000	0.25773	4.176000	0.58269	1.006000	0.39211	0.650000	0.86243	GGC	-	NULL		0.577	COQ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ9	protein_coding	OTTHUMT00000432598.3	G	NM_020312		56044227	+1	no_errors	NM_020312	genbank	human	provisional	54_36p	missense	SNP	0.989	A
PLK2	10769	genome.wustl.edu	37	5	57752905	57752905	+	Missense_Mutation	SNP	G	G	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr5:57752905G>T	ENST00000274289.3	-	8	1323	c.1023C>A	c.(1021-1023)gaC>gaA	p.D341E	PLK2_ENST00000502671.1_5'UTR	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	341					G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		AAGACAGTCTGTCCGGAGTGA	0.413																																																0			5											57.0	61.0	60.0					5																	57752905		2203	4300	6503	57788662	SO:0001583	missense	10769				CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.1023C>A	5.37:g.57752905G>T	ENSP00000274289:p.Asp341Glu	Somatic		Capture	Illumina GAIIx	4	57788662	O60679|Q96CV7|Q9UE61	Missense_Mutation	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,superfamily_SSF82615,HMMPfam_POLO_box	p.D341E	ENST00000274289.3	37	c.1023	CCDS3974.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.182|9.182	1.023816|1.023816	0.19433|0.19433	.|.	.|.	ENSG00000145632|ENSG00000145632	ENST00000274289;ENST00000537944|ENST00000442330	T|.	0.24538|.	1.85|.	5.28|5.28	1.0|1.0	0.19881|0.19881	Protein kinase-like domain (1);|.	0.143965|.	0.64402|.	D|.	0.000007|.	T|T	0.24624|0.24624	0.0597|0.0597	N|N	0.12887|0.12887	0.27|0.27	0.44055|0.44055	D|D	0.996792|0.996792	B|.	0.12013|.	0.005|.	B|.	0.17979|.	0.02|.	T|T	0.05989|0.05989	-1.0852|-1.0852	10|6	0.17369|0.23891	T|T	0.5|0.37	-26.968|-26.968	1.739|1.739	0.02948|0.02948	0.2943:0.219:0.369:0.1177|0.2943:0.219:0.369:0.1177	.|.	341|.	Q9NYY3|.	PLK2_HUMAN|.	E|K	341|327	ENSP00000274289:D341E|.	ENSP00000274289:D341E|ENSP00000401861:T327K	D|T	-|-	3|2	2|0	PLK2|PLK2	57788662|57788662	0.707000|0.707000	0.27866|0.27866	1.000000|1.000000	0.80357|0.80357	0.935000|0.935000	0.57460|0.57460	-0.070000|-0.070000	0.11523|0.11523	0.625000|0.625000	0.30304|0.30304	0.655000|0.655000	0.94253|0.94253	GAC|ACA	-	superfamily_Kinase_like		0.413	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK2	protein_coding	OTTHUMT00000214150.1	G	NM_006622		57788662	-1	no_errors	NM_006622	genbank	human	validated	54_36p	missense	SNP	0.999	T
OR5AN1	390195	genome.wustl.edu	37	11	59132147	59132147	+	Silent	SNP	C	C	G			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr11:59132147C>G	ENST00000313940.2	+	1	263	c.216C>G	c.(214-216)gtC>gtG	p.V72V		NM_001004729.1	NP_001004729.1	Q8NGI8	O5AN1_HUMAN	olfactory receptor, family 5, subfamily AN, member 1	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	21						TCATAGATGTCTGCTATATCA	0.423																																																0			11											186.0	177.0	180.0					11																	59132147		2201	4295	6496	58888723	SO:0001819	synonymous_variant	390195			AB065806	CCDS31559.1	11q12.1	2012-08-09			ENSG00000176495	ENSG00000176495		"""GPCR / Class A : Olfactory receptors"""	15255	protein-coding gene	gene with protein product		615702					Standard	NM_001004729		Approved		uc010rks.2	Q8NGI8	OTTHUMG00000167337	ENST00000313940.2:c.216C>G	11.37:g.59132147C>G		Somatic		Capture	Illumina GAIIx	4	58888723	B9EIS2|Q6IEV4	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V72	ENST00000313940.2	37	c.216	CCDS31559.1	11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.423	OR5AN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AN1	protein_coding	OTTHUMT00000394231.1	C	NM_001004729		58888723	+1	no_errors	NM_001004729	genbank	human	provisional	54_36p	silent	SNP	0.368	G
CDH7	1005	genome.wustl.edu	37	18	63547744	63547744	+	Missense_Mutation	SNP	G	G	A	rs116566190	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr18:63547744G>A	ENST00000397968.2	+	12	2398	c.1972G>A	c.(1972-1974)Ggg>Agg	p.G658R	CDH7_ENST00000323011.3_Missense_Mutation_p.G658R	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	658					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TGACGAGGGCGGGGGAGAGGA	0.488																																																0			18											70.0	72.0	71.0					18																	63547744		2203	4300	6503	61698724	SO:0001583	missense	1005			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1972G>A	18.37:g.63547744G>A	ENSP00000381058:p.Gly658Arg	Somatic		Capture	Illumina GAIIx	4	61698724	Q9H157	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.G658R	ENST00000397968.2	37	c.1972	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	G	15.97	2.988557	0.53934	.	.	ENSG00000081138	ENST00000323011;ENST00000397966;ENST00000397968	D;D	0.82255	-1.59;-1.59	5.61	5.61	0.85477	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.93585	0.7952	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94407	0.7628	10	0.66056	D	0.02	.	19.6378	0.95744	0.0:0.0:1.0:0.0	.	658	Q9ULB5	CADH7_HUMAN	R	658	ENSP00000319166:G658R;ENSP00000381058:G658R	ENSP00000319166:G658R	G	+	1	0	CDH7	61698724	1.000000	0.71417	0.455000	0.27031	0.068000	0.16541	9.869000	0.99810	2.631000	0.89168	0.655000	0.94253	GGG	-	HMMPfam_Cadherin_C		0.488	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	protein_coding	OTTHUMT00000256217.2	G	NM_033646		61698724	+1	no_errors	NM_004361	genbank	human	reviewed	54_36p	missense	SNP	0.994	A
Unknown	0	genome.wustl.edu	37	7	65983713	65983713	+	IGR	SNP	C	C	G			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr7:65983713C>G								GS1-124K5.4 (23252 upstream) : GS1-124K5.11 (7361 downstream)																							CACTTGGCTTCTCTCCCCCTG	0.607																																																0			7																																								65621148	SO:0001628	intergenic_variant	641765																															7.37:g.65983713C>G		Somatic		Capture	Illumina GAIIx	4	65621148		Missense_Mutation	SNP	HMMPfam_GTF2I	p.F161L		37	c.483		7																																																																																			-	NULL	0	0.607					LOC641765			C			65621148	+1	no_errors	XM_001129421	genbank	human	model	54_36p	missense	SNP	0.133	G
CCDC158	339965	genome.wustl.edu	37	4	77265844	77265844	+	Intron	SNP	G	G	A			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr4:77265844G>A	ENST00000388914.3	-	17	2817					NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158											breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						AGAGTTTTCTGTTACAAGGCA	0.438																																																0			4																																								77484868	SO:0001627	intron_variant	0			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.2664+6304C>T	4.37:g.77265844G>A		Somatic		Capture	Illumina GAIIx	4	77484868	Q8IYQ1|Q8N7D4|Q8N7E3	RNA	SNP	-	NULL	ENST00000388914.3	37	NULL	CCDS43242.1	4																																																																																			-	-		0.438	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100131940	protein_coding	OTTHUMT00000362694.2	G	NM_001042784		77484868	+1	pseudogene	XR_037574	genbank	human	model	54_36p	rna	SNP	1.000	A
KCTD21	283219	genome.wustl.edu	37	11	77885210	77885210	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr11:77885210G>A	ENST00000340067.3	-	2	669	c.391C>T	c.(391-393)Ccc>Tcc	p.P131S	KCTD21-AS1_ENST00000600795.1_RNA|KCTD21-AS1_ENST00000528468.1_RNA|KCTD21-AS1_ENST00000523626.2_RNA|KCTD21-AS1_ENST00000530261.1_RNA	NM_001029859.1	NP_001025030.1	Q4G0X4	KCD21_HUMAN	potassium channel tetramerization domain containing 21	131					protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(2)	11	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			TAGATCTGGGGTGCCTCGCGC	0.557																																																0			11											134.0	111.0	119.0					11																	77885210		2200	4292	6492	77562858	SO:0001583	missense	283219			AK095233	CCDS31645.1	11q14.1	2013-06-20	2013-06-20			ENSG00000188997			27452	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 21"""			21472142	Standard	XM_005273925		Approved	KCASH2	uc001ozb.3	Q4G0X4		ENST00000340067.3:c.391C>T	11.37:g.77885210G>A	ENSP00000339340:p.Pro131Ser	Somatic		Capture	Illumina GAIIx	4	77562858	B4DTR0	Missense_Mutation	SNP	superfamily_BTB/POZ_fold,HMMSmart_BTB,HMMPfam_K_tetra	p.P131S	ENST00000340067.3	37	c.391	CCDS31645.1	11	.	.	.	.	.	.	.	.	.	.	G	15.22	2.767725	0.49574	.	.	ENSG00000188997	ENST00000340067;ENST00000526208;ENST00000525447	T;T;T	0.56103	0.48;0.64;0.74	6.03	6.03	0.97812	.	0.000000	0.56097	D	0.000028	T	0.57725	0.2073	L	0.27053	0.805	0.45318	D	0.998317	D	0.89917	1.0	D	0.69307	0.963	T	0.44802	-0.9304	10	0.07644	T	0.81	.	18.7374	0.91761	0.0:0.0:1.0:0.0	.	131	Q4G0X4	KCD21_HUMAN	S	131	ENSP00000339340:P131S;ENSP00000431789:P131S;ENSP00000434174:P131S	ENSP00000339340:P131S	P	-	1	0	KCTD21	77562858	1.000000	0.71417	0.980000	0.43619	0.870000	0.49936	6.704000	0.74639	2.861000	0.98227	0.655000	0.94253	CCC	-	NULL		0.557	KCTD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD21	protein_coding	OTTHUMT00000390057.1	G	NM_001029859		77562858	-1	no_errors	NM_001029859	genbank	human	provisional	54_36p	missense	SNP	0.961	A
TBCD	6904	genome.wustl.edu	37	17	80785898	80785898	+	Intron	SNP	C	C	T	rs75044636	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr17:80785898C>T	ENST00000355528.4	+	13	1448				TBCD_ENST00000397466.2_Intron|TBCD_ENST00000539345.2_Intron	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D						'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			gatatgtacacgtggacacgc	0.512													C|||	600	0.119808	0.0038	0.0821	5008	,	,		26997	0.0714		0.1451	False		,,,				2504	0.3272															0			17																																								78379187	SO:0001627	intron_variant	0			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.1318+13088C>T	17.37:g.80785898C>T		Somatic		Capture	Illumina GAIIx	4	78379187	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	NULL	p.T57M	ENST00000355528.4	37	c.170	CCDS45818.1	17																																																																																			-	NULL		0.512	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000214069	protein_coding	OTTHUMT00000439415.1	C	NM_005993		78379187	+1	no_stop_codon	ENST00000397438	ensembl	human	known	54_36p	missense	SNP	0.980	T
CHM	1121	genome.wustl.edu	37	X	85233820	85233820	+	Missense_Mutation	SNP	T	T	A	rs145707160	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chrX:85233820T>A	ENST00000357749.2	-	4	294	c.265A>T	c.(265-267)Agc>Tgc	p.S89C	CHM_ENST00000358786.4_Missense_Mutation_p.S89C|CHM_ENST00000537751.1_Intron|CHM_ENST00000467744.2_Intron	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	89					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				TCCTTCCTGCTAAGAGCAATG	0.358													T|||	28	0.00741722	0.0008	0.0043	3775	,	,		14262	0.0		0.0189	False		,,,				2504	0.0051															0			X						T	CYS/SER,CYS/SER	8,3827		0,7,1,1625,570	129.0	106.0	114.0		265,265	2.7	0.9	X	dbSNP_134	114	133,6595		0,94,39,2334,1833	yes	missense,missense	CHM	NM_000390.2,NM_001145414.1	112,112	0,101,40,3959,2403	AA,AT,A,TT,T		1.9768,0.2086,1.3348	benign,benign	89/654,89/111	85233820	141,10422	2203	4300	6503	85120476	SO:0001583	missense	1121			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.265A>T	X.37:g.85233820T>A	ENSP00000350386:p.Ser89Cys	Somatic		Capture	Illumina GAIIx	4	85120476	A1L4D2|O43732	Missense_Mutation	SNP	superfamily_SSF51905,HMMPfam_GDI,superfamily_SSF54373	p.S89C	ENST00000357749.2	37	c.265	CCDS14454.1	X	12	0.007233273056057866	0	0.0	1	0.002777777777777778	0	0.0	7	0.009308510638297872	T	12.30	1.896999	0.33535	0.002086	0.019768	ENSG00000188419	ENST00000357749;ENST00000358786	T;T	0.59502	0.26;0.26	5.27	2.72	0.32119	.	0.219936	0.44902	D	0.000408	T	0.22360	0.0539	N	0.22421	0.69	0.19300	N	0.999976	B;B	0.25809	0.135;0.034	B;B	0.25614	0.062;0.055	T	0.10428	-1.0630	10	0.40728	T	0.16	-21.1794	6.5124	0.22228	0.1509:0.0:0.1528:0.6963	.	89;89	A1L4D2;P24386	.;RAE1_HUMAN	C	89	ENSP00000350386:S89C;ENSP00000362228:S89C	ENSP00000350386:S89C	S	-	1	0	CHM	85120476	0.997000	0.39634	0.872000	0.34217	0.959000	0.62525	2.178000	0.42519	1.732000	0.51606	0.412000	0.27726	AGC	-	superfamily_SSF51905,HMMPfam_GDI		0.358	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	protein_coding	OTTHUMT00000057396.3	T	NM_000390		85120476	-1	no_errors	NM_000390	genbank	human	reviewed	54_36p	missense	SNP	0.993	A
HAPLN3	145864	genome.wustl.edu	37	15	89424833	89424833	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr15:89424833C>T	ENST00000359595.3	-	3	462	c.248G>A	c.(247-249)cGt>cAt	p.R83H	HAPLN3_ENST00000562889.1_Missense_Mutation_p.R145H	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	83	Ig-like V-type. {ECO:0000305}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	GACACGCACACGCCGCGGGGA	0.657																																																0			15											73.0	70.0	71.0					15																	89424833		2200	4299	6499	87225837	SO:0001583	missense	145864			AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.248G>A	15.37:g.89424833C>T	ENSP00000352606:p.Arg83His	Somatic		Capture	Illumina GAIIx	4	87225837	A8K7P0	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409,HMMSmart_SM00406,HMMSmart_SM00445,HMMPfam_Xlink,superfamily_C-type lectin-like,PatternScan_LINK_1	p.R83H	ENST00000359595.3	37	c.248	CCDS10346.1	15	.	.	.	.	.	.	.	.	.	.	C	4.290	0.052971	0.08291	.	.	ENSG00000140511	ENST00000359595	T	0.64991	-0.13	4.22	1.13	0.20643	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.478425	0.18864	N	0.129039	T	0.38692	0.1050	N	0.11927	0.2	0.09310	N	1	B;B	0.22983	0.078;0.078	B;B	0.21546	0.035;0.035	T	0.19484	-1.0304	10	0.37606	T	0.19	-2.6237	7.3451	0.26658	0.0:0.2601:0.2903:0.4496	.	83;83	A8K7T8;Q96S86	.;HPLN3_HUMAN	H	83	ENSP00000352606:R83H	ENSP00000352606:R83H	R	-	2	0	HAPLN3	87225837	0.540000	0.26410	0.013000	0.15412	0.006000	0.05464	0.918000	0.28678	-0.072000	0.12864	-0.823000	0.03104	CGT	-	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409,HMMSmart_SM00406		0.657	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN3	protein_coding	OTTHUMT00000309070.1	C	NM_178232		87225837	-1	no_errors	NM_178232	genbank	human	reviewed	54_36p	missense	SNP	0.147	T
DEGS2	123099	genome.wustl.edu	37	14	100615945	100615945	+	Missense_Mutation	SNP	C	C	T	rs367704730		TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr14:100615945C>T	ENST00000305631.5	-	2	760	c.185G>A	c.(184-186)cGc>cAc	p.R62H	DEGS2_ENST00000553834.1_Intron|DEGS2_ENST00000557117.1_5'UTR	NM_206918.2	NP_996801.2			delta(4)-desaturase, sphingolipid 2											breast(1)|lung(6)|skin(1)	8		Melanoma(154;0.212)				GGCCAGCCCGCGCACCAGCCA	0.677																																																0			14						C	HIS/ARG	0,4382		0,0,2191	21.0	23.0	22.0		185	-0.3	0.3	14		22	1,8555		0,1,4277	no	missense	DEGS2	NM_206918.2	29	0,1,6468	TT,TC,CC		0.0117,0.0,0.0077	benign	62/324	100615945	1,12937	2191	4278	6469	99685698	SO:0001583	missense	123099				CCDS9956.1	14q32.2	2013-09-02	2011-12-09	2004-12-14	ENSG00000168350	ENSG00000168350		"""Fatty acid desaturases"""	20113	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 2"", ""dihydroceramide desaturase 2"""	610862	"""chromosome 14 open reading frame 66"", ""degenerative spermatocyte homolog 2, lipid desaturase (Drosophila)"""	C14orf66			Standard	NM_206918		Approved	DES2, FADS8	uc001ygx.2	Q6QHC5	OTTHUMG00000171537	ENST00000305631.5:c.185G>A	14.37:g.100615945C>T	ENSP00000307126:p.Arg62His	Somatic		Capture	Illumina GAIIx	4	99685698		Missense_Mutation	SNP	HMMPfam_Lipid_DES,HMMPfam_FA_desaturase	p.R62H	ENST00000305631.5	37	c.185	CCDS9956.1	14	.	.	.	.	.	.	.	.	.	.	C	10.33	1.320480	0.23994	0.0	1.17E-4	ENSG00000168350	ENST00000305631	T	0.32988	1.43	4.4	-0.29	0.12847	.	0.552818	0.19167	N	0.121045	T	0.19886	0.0478	L	0.35542	1.07	0.30155	N	0.802687	B	0.11235	0.004	B	0.04013	0.001	T	0.14200	-1.0481	10	0.34782	T	0.22	-11.2954	9.4389	0.38657	0.0:0.5327:0.0:0.4673	.	62	Q6QHC5	DEGS2_HUMAN	H	62	ENSP00000307126:R62H	ENSP00000307126:R62H	R	-	2	0	DEGS2	99685698	0.002000	0.14202	0.303000	0.25071	0.741000	0.42261	-0.024000	0.12435	0.087000	0.17167	-0.291000	0.09656	CGC	-	NULL		0.677	DEGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEGS2	protein_coding	OTTHUMT00000414003.1	C	NM_206918		99685698	-1	no_errors	NM_206918	genbank	human	reviewed	54_36p	missense	SNP	0.757	T
MUC17	140453	genome.wustl.edu	37	7	100680104	100680104	+	Missense_Mutation	SNP	C	C	A			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr7:100680104C>A	ENST00000306151.4	+	3	5471	c.5407C>A	c.(5407-5409)Ctt>Att	p.L1803I		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1803	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACCTCGACTCTTAGTGAAGG	0.498																																																0			7											258.0	261.0	260.0					7																	100680104		2203	4300	6503	100466824	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5407C>A	7.37:g.100680104C>A	ENSP00000302716:p.Leu1803Ile	Somatic		Capture	Illumina GAIIx	4	100466824	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	superfamily_EGF/Laminin,PatternScan_EGF_1,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.L1803I	ENST00000306151.4	37	c.5407	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	c	0.015	-1.548495	0.00926	.	.	ENSG00000169876	ENST00000306151	T	0.02140	4.43	0.726	-1.45	0.08828	.	.	.	.	.	T	0.01222	0.0040	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45775	-0.9238	9	0.33141	T	0.24	.	3.606	0.08042	0.2466:0.2595:0.494:0.0	.	1803	Q685J3	MUC17_HUMAN	I	1803	ENSP00000302716:L1803I	ENSP00000302716:L1803I	L	+	1	0	MUC17	100466824	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.646000	0.05403	-2.390000	0.00586	-1.421000	0.01109	CTT	-	NULL		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	C	NM_001040105		100466824	+1	no_errors	NM_001040105	genbank	human	provisional	54_36p	missense	SNP	0.004	A
GRIK2	2898	genome.wustl.edu	37	6	102307199	102307199	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr6:102307199C>T	ENST00000421544.1	+	10	1845	c.1355C>T	c.(1354-1356)cCt>cTt	p.P452L	GRIK2_ENST00000369137.3_Missense_Mutation_p.P452L|GRIK2_ENST00000369134.4_Missense_Mutation_p.P403L|GRIK2_ENST00000369138.1_Missense_Mutation_p.P452L|GRIK2_ENST00000318991.6_Missense_Mutation_p.P452L|GRIK2_ENST00000413795.1_Missense_Mutation_p.P452L	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	452					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TCTGACAAACCTCTCTATGGT	0.343																																																0			6											123.0	117.0	119.0					6																	102307199		2203	4300	6503	102413892	SO:0001583	missense	2898				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.1355C>T	6.37:g.102307199C>T	ENSP00000397026:p.Pro452Leu	Somatic		Capture	Illumina GAIIx	4	102413892	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,HMMSmart_SM00079,superfamily_Periplasmic binding protein-like II,HMMPfam_Lig_chan-Glu_bd,HMMPfam_Lig_chan	p.P452L	ENST00000421544.1	37	c.1355	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584494	0.65992	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076;ENST00000455610;ENST00000436862	T;T;T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	4.91	4.91	0.64330	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.057523	0.64402	D	0.000001	T	0.64338	0.2589	L	0.46741	1.465	0.80722	D	1	B;B;B	0.12630	0.005;0.006;0.005	B;B;B	0.16289	0.013;0.015;0.013	T	0.63051	-0.6723	10	0.42905	T	0.14	.	18.456	0.90721	0.0:1.0:0.0:0.0	.	452;452;452	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	L	452;452;452;452;452;452;403;414;165;51	ENSP00000397026:P452L;ENSP00000405596:P452L;ENSP00000358134:P452L;ENSP00000358133:P452L;ENSP00000313276:P452L;ENSP00000358130:P403L;ENSP00000391988:P165L;ENSP00000407140:P51L	ENSP00000313276:P452L	P	+	2	0	GRIK2	102413892	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.377000	0.79668	2.401000	0.81631	0.591000	0.81541	CCT	-	HMMSmart_SM00079,superfamily_Periplasmic binding protein-like II,HMMPfam_Lig_chan-Glu_bd		0.343	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	protein_coding	OTTHUMT00000043718.1	C			102413892	+1	no_errors	NM_021956	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MCC	4163	genome.wustl.edu	37	5	112630026	112630026	+	Splice_Site	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr5:112630026C>T	ENST00000302475.4	-	1	620	c.57G>A	c.(55-57)gaG>gaA	p.E19E	MCC_ENST00000514701.3_5'UTR|MCC_ENST00000408903.3_Intron	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	19					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		TGTTTCTTACCTCACTCAGCT	0.567																																																0			5											110.0	110.0	110.0					5																	112630026		2202	4300	6502	112657925	SO:0001630	splice_region_variant	4163				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.57+1G>A	5.37:g.112630026C>T		Somatic		Capture	Illumina GAIIx	4	112657925	D3DT05|Q6ZR04	Silent	SNP	HMMPfam_MCC-bdg_PDZ	p.E19	ENST00000302475.4	37	c.57	CCDS4111.1	5																																																																																			-	NULL		0.567	MCC-001	KNOWN	basic|CCDS	protein_coding	MCC	protein_coding	OTTHUMT00000250736.3	C	NM_001085377	Silent	112657925	-1	no_errors	NM_002387	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
F10	2159	genome.wustl.edu	37	13	113803622	113803622	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr13:113803622G>A	ENST00000375559.3	+	8	1296	c.1258G>A	c.(1258-1260)Ggg>Agg	p.G420R	F10_ENST00000375551.3_3'UTR|F10_ENST00000409306.1_3'UTR	NM_000504.3	NP_000495.1	P00742	FA10_HUMAN	coagulation factor X	420	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		G -> R (in FA10D; Padua 3). {ECO:0000269|PubMed:11728527}.		blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(4)|lung(10)|pancreas(1)|stomach(1)	18	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Antihemophilic Factor(DB00025)|Apixaban(DB06605)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Menadione(DB00170)|Rivaroxaban(DB06228)	GGGGGACAGCGGGGGCCCGCA	0.617																																																0			13	GRCh37	CM014703	F10	M							65.0	71.0	69.0					13																	113803622		2203	4300	6503	112851623	SO:0001583	missense	2159				CCDS9530.1	13q34	2012-10-02			ENSG00000126218	ENSG00000126218	3.4.21.6		3528	protein-coding gene	gene with protein product		613872					Standard	XM_005268298		Approved		uc001vsx.3	P00742	OTTHUMG00000017374	ENST00000375559.3:c.1258G>A	13.37:g.113803622G>A	ENSP00000364709:p.Gly420Arg	Somatic		Capture	Illumina GAIIx	4	112851623	Q14340	Missense_Mutation	SNP	HMMSmart_SM00069,superfamily_GLA-domain,HMMPfam_Gla,PatternScan_GLA_1,PatternScan_EGF_CA,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_EGF/Laminin,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.G420R	ENST00000375559.3	37	c.1258	CCDS9530.1	13	.	.	.	.	.	.	.	.	.	.	G	20.1	3.940763	0.73557	.	.	ENSG00000126218	ENST00000375559	D	0.99871	-7.35	5.38	5.38	0.77491	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.99935	0.9971	H	0.99820	4.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95774	0.8811	10	0.87932	D	0	.	19.1515	0.93491	0.0:0.0:1.0:0.0	.	420	P00742	FA10_HUMAN	R	420	ENSP00000364709:G420R	ENSP00000364709:G420R	G	+	1	0	F10	112851623	1.000000	0.71417	0.911000	0.35937	0.194000	0.23727	9.658000	0.98594	2.514000	0.84764	0.655000	0.94253	GGG	-	superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_SER		0.617	F10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F10	protein_coding	OTTHUMT00000045841.3	G			112851623	+1	no_errors	NM_000504	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CUL4B	8450	genome.wustl.edu	37	X	119694128	119694128	+	Silent	SNP	G	G	A	rs141353300	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chrX:119694128G>A	ENST00000404115.3	-	3	821	c.420C>T	c.(418-420)tcC>tcT	p.S140S	CUL4B_ENST00000371322.5_Silent_p.S122S|CUL4B_ENST00000336592.6_Silent_p.S127S	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	140	Ser-rich.				cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						aggaggaggaggaggaggaTT	0.478																																																0			X						G	,	0,3835		0,0,0,1632,571	65.0	59.0	61.0		366,420	0.1	1.0	X	dbSNP_134	61	1,6727		0,0,1,2428,1871	no	coding-synonymous,coding-synonymous	CUL4B	NM_001079872.1,NM_003588.3	,	0,0,1,4060,2442	AA,AG,A,GG,G		0.0149,0.0,0.0095	,	122/896,140/914	119694128	1,10562	2203	4300	6503	119578156	SO:0001819	synonymous_variant	8450			U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.420C>T	X.37:g.119694128G>A		Somatic		Capture	Illumina GAIIx	4	119578156	B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Silent	SNP	"superfamily_Cullin repeat,HMMPfam_Cullin,superfamily_Cullin homology domain,HMMSmart_SM00182,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Cullin_Nedd8,PatternScan_CULLIN_1"	p.S140	ENST00000404115.3	37	c.420	CCDS35379.1	X																																																																																			-	NULL		0.478	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	CUL4B	protein_coding	OTTHUMT00000058103.1	G	NM_003588		119578156	-1	no_errors	NM_003588	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
SNX2	6643	genome.wustl.edu	37	5	122154677	122154677	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr5:122154677G>T	ENST00000379516.2	+	11	1279	c.1171G>T	c.(1171-1173)Gaa>Taa	p.E391*	SNX2_ENST00000514949.1_Nonsense_Mutation_p.E274*|SNX2_ENST00000510372.1_3'UTR	NM_003100.2	NP_003091.2	O60749	SNX2_HUMAN	sorting nexin 2	391					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)|skin(1)	19		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		TATGTTTTCAGAACTACTTAG	0.373																																																0			5											121.0	110.0	114.0					5																	122154677		2203	4300	6503	122182576	SO:0001587	stop_gained	6643			AF043453	CCDS34217.1, CCDS64234.1	5q23.2	2011-05-03			ENSG00000205302	ENSG00000205302		"""Sorting nexins"""	11173	protein-coding gene	gene with protein product		605929				9819414	Standard	NM_003100		Approved		uc003kte.4	O60749	OTTHUMG00000163020	ENST00000379516.2:c.1171G>T	5.37:g.122154677G>T	ENSP00000368831:p.Glu391*	Somatic		Capture	Illumina GAIIx	4	122182576	B3KN44|B4DEK4|B7Z408|O43650|P82862|Q53XK8|Q597H6|Q9BTS8	Nonsense_Mutation	SNP	HMMPfam_Sorting_nexin,superfamily_PX domain,HMMPfam_PX,HMMSmart_SM00312,HMMPfam_Vps5	p.E391*	ENST00000379516.2	37	c.1171	CCDS34217.1	5	.	.	.	.	.	.	.	.	.	.	G	39	7.439339	0.98286	.	.	ENSG00000205302	ENST00000379516;ENST00000514949	.	.	.	5.81	4.94	0.65067	.	0.049406	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-17.1721	14.9994	0.71459	0.0683:0.0:0.9317:0.0	.	.	.	.	X	391;274	.	ENSP00000368831:E391X	E	+	1	0	SNX2	122182576	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.796000	0.99103	1.471000	0.48121	0.655000	0.94253	GAA	-	HMMPfam_Vps5		0.373	SNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX2	protein_coding	OTTHUMT00000371392.1	G	NM_003100		122182576	+1	no_errors	NM_003100	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
ITGB5	3693	genome.wustl.edu	37	3	124485160	124485160	+	Missense_Mutation	SNP	A	A	G			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr3:124485160A>G	ENST00000296181.4	-	13	2346	c.2050T>C	c.(2050-2052)Tac>Cac	p.Y684H	ITGB5_ENST00000461306.1_5'UTR	NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	684					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		GCGGTTTTGTAGAAACATAGC	0.567																																																0			3											104.0	95.0	98.0					3																	124485160		2203	4300	6503	125967850	SO:0001583	missense	3693			J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.2050T>C	3.37:g.124485160A>G	ENSP00000296181:p.Tyr684His	Somatic		Capture	Illumina GAIIx	4	125967850	B0LPF8|B2RD70	Missense_Mutation	SNP	HMMSmart_PSI,HMMPfam_Integrin_beta,HMMSmart_INB,superfamily_SSF53300,HMMSmart_VWA,superfamily_SSF69179,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_INTEGRIN_BETA,superfamily_SSF57196,HMMSmart_EGF,superfamily_Integrin_bsu_tail,HMMPfam_Integrin_B_tail,HMMPfam_Integrin_b_cyt	p.Y684H	ENST00000296181.4	37	c.2050	CCDS3030.1	3	.	.	.	.	.	.	.	.	.	.	A	23.7	4.444536	0.83993	.	.	ENSG00000082781	ENST00000296181	D	0.82984	-1.67	5.1	5.1	0.69264	Integrin beta subunit, tail (2);	0.059747	0.64402	D	0.000001	D	0.91040	0.7181	M	0.81497	2.545	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.92252	0.5809	10	0.72032	D	0.01	.	15.0452	0.71822	1.0:0.0:0.0:0.0	.	684	P18084	ITB5_HUMAN	H	684	ENSP00000296181:Y684H	ENSP00000296181:Y684H	Y	-	1	0	ITGB5	125967850	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.081000	0.94049	2.140000	0.66376	0.459000	0.35465	TAC	-	superfamily_Integrin_bsu_tail,HMMPfam_Integrin_B_tail		0.567	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB5	protein_coding	OTTHUMT00000355286.3	A	NM_002213		125967850	-1	no_errors	NM_002213	genbank	human	provisional	54_36p	missense	SNP	1.000	G
TRIB1	10221	genome.wustl.edu	37	8	126445730	126445730	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr8:126445730C>T	ENST00000520847.1	+	2	288	c.34C>T	c.(34-36)Cgg>Tgg	p.R12W	TRIB1_ENST00000311922.3_Missense_Mutation_p.R178W|TRIB1_ENST00000521778.1_3'UTR|TRIB1_ENST00000519576.1_5'Flank					tribbles pseudokinase 1											NS(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			GAAGAGGCTGCGGGAAGAGGA	0.572																																																0			8											92.0	95.0	94.0					8																	126445730		2203	4300	6503	126514912	SO:0001583	missense	10221			AF205437	CCDS6357.1, CCDS64971.1	8q24.13	2013-10-03	2013-10-03			ENSG00000173334			16891	protein-coding gene	gene with protein product		609461	"""tribbles homolog 1 (Drosophila)"""			9342215, 16715410	Standard	NM_001282985		Approved	C8FW, GIG2, TRB1	uc003yrx.3	Q96RU8		ENST00000520847.1:c.34C>T	8.37:g.126445730C>T	ENSP00000429063:p.Arg12Trp	Somatic		Capture	Illumina GAIIx	4	126514912		Missense_Mutation	SNP	HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase	p.R178W	ENST00000520847.1	37	c.532		8	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707244	0.68615	.	.	ENSG00000173334	ENST00000311922;ENST00000520847	T;T	0.74002	-0.8;-0.8	4.82	2.86	0.33363	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.29362	U	0.012365	D	0.84960	0.5588	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.68353	0.957	D	0.87369	0.2349	10	0.87932	D	0	-12.3019	13.8316	0.63384	0.4026:0.5974:0.0:0.0	.	178	Q96RU8	TRIB1_HUMAN	W	178;12	ENSP00000312150:R178W;ENSP00000429063:R12W	ENSP00000312150:R178W	R	+	1	2	TRIB1	126514912	0.996000	0.38824	1.000000	0.80357	0.988000	0.76386	0.544000	0.23253	1.143000	0.42306	0.436000	0.28706	CGG	-	HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like)		0.572	TRIB1-002	PUTATIVE	basic|exp_conf	protein_coding	TRIB1	protein_coding	OTTHUMT00000381431.1	C	NM_025195		126514912	+1	no_errors	NM_025195	genbank	human	validated	54_36p	missense	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	11	127810926	127810926	+	IGR	SNP	C	C	A			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr11:127810926C>A								RN7SKP279 (532883 upstream) : RP11-702B10.2 (239395 downstream)																							CCGTTCTCGACAATTCTCTTT	0.398																																																0			11																																								127316136	SO:0001628	intergenic_variant	387820																															11.37:g.127810926C>A		Somatic		Capture	Illumina GAIIx	4	127316136		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.398					LOC387820			C			127316136	-1	pseudogene	XR_017453	genbank	human	model	54_36p	rna	SNP	1.000	A
LAMA2	3908	genome.wustl.edu	37	6	129794413	129794413	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr6:129794413C>T	ENST00000421865.2	+	52	7404	c.7355C>T	c.(7354-7356)tCg>tTg	p.S2452L		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2452	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ATAGCAACTTCGTCTTCTGGA	0.328																																																0			6											77.0	75.0	76.0					6																	129794413		2203	4300	6503	129836106	SO:0001583	missense	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.7355C>T	6.37:g.129794413C>T	ENSP00000400365:p.Ser2452Leu	Somatic		Capture	Illumina GAIIx	4	129836106	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	HMMSmart_LamNT,HMMPfam_Laminin_N,superfamily_Gal_bind_like,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,superfamily_ConA_like_lec_gl,PatternScan_EGF_1,PatternScan_EGF_LAM_1,superfamily_SSF57196,PatternScan_EGF_2,HMMSmart_LamB,HMMPfam_Laminin_B,HMMPfam_Laminin_I,superfamily_SSF56399,HMMPfam_Laminin_II,HMMSmart_LamG,HMMPfam_Laminin_G_1,HMMPfam_Laminin_G_2	p.S2452L	ENST00000421865.2	37	c.7355	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	C	6.144	0.394853	0.11638	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	T	0.79033	-1.23	6.06	2.19	0.27852	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.966112	0.08591	N	0.923053	T	0.45377	0.1339	L	0.47016	1.485	0.09310	N	1	B;B	0.33318	0.408;0.408	B;B	0.20767	0.031;0.031	T	0.24083	-1.0170	9	.	.	.	.	5.2687	0.15613	0.1243:0.5241:0.0:0.3516	.	2453;2452	A6NF00;P24043	.;LAMA2_HUMAN	L	2452;2451;2452;470	ENSP00000400365:S2452L	.	S	+	2	0	LAMA2	129836106	0.000000	0.05858	0.756000	0.31282	0.044000	0.14063	0.053000	0.14184	0.410000	0.25675	-0.136000	0.14681	TCG	-	superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_1		0.328	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	protein_coding	OTTHUMT00000042180.1	C			129836106	+1	no_errors	NM_000426	genbank	human	reviewed	54_36p	missense	SNP	0.039	T
EFR3A	23167	genome.wustl.edu	37	8	132988321	132988321	+	Missense_Mutation	SNP	A	A	T	rs201002950		TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr8:132988321A>T	ENST00000254624.5	+	11	1432	c.1207A>T	c.(1207-1209)Atg>Ttg	p.M403L	EFR3A_ENST00000519656.1_Missense_Mutation_p.M367L|EFR3A_ENST00000334503.4_Missense_Mutation_p.M403L	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	403						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			AGAAATCATGATGTTCATTAT	0.333																																																0			8											96.0	93.0	94.0					8																	132988321		2203	4299	6502	133057503	SO:0001583	missense	23167			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.1207A>T	8.37:g.132988321A>T	ENSP00000254624:p.Met403Leu	Somatic		Capture	Illumina GAIIx	4	133057503	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	superfamily_ARM repeat	p.M403L	ENST00000254624.5	37	c.1207	CCDS34942.2	8	.	.	.	.	.	.	.	.	.	.	A	7.554	0.663258	0.14710	.	.	ENSG00000132294	ENST00000254624;ENST00000377917;ENST00000334503;ENST00000519656	T;T;T	0.29655	3.64;3.64;1.56	6.01	6.01	0.97437	Armadillo-type fold (1);	0.101814	0.85682	D	0.000000	T	0.22551	0.0544	L	0.31476	0.935	0.50171	D	0.999856	B	0.02656	0.0	B	0.06405	0.002	T	0.08330	-1.0727	10	0.08381	T	0.77	-20.0253	15.7096	0.77615	1.0:0.0:0.0:0.0	.	403	Q14156	EFR3A_HUMAN	L	403;403;403;367	ENSP00000254624:M403L;ENSP00000334769:M403L;ENSP00000428086:M367L	ENSP00000254624:M403L	M	+	1	0	EFR3A	133057503	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.632000	0.67819	2.307000	0.77673	0.528000	0.53228	ATG	-	NULL		0.333	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	protein_coding	OTTHUMT00000318886.1	A	NM_015137		133057503	+1	no_errors	NM_015137	genbank	human	validated	54_36p	missense	SNP	1.000	T
KCNQ3	3786	genome.wustl.edu	37	8	133141816	133141816	+	Missense_Mutation	SNP	G	G	A	rs372002816		TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr8:133141816G>A	ENST00000388996.4	-	15	2732	c.2312C>T	c.(2311-2313)tCg>tTg	p.S771L	KCNQ3_ENST00000519445.1_Missense_Mutation_p.S759L|KCNQ3_ENST00000521134.1_Missense_Mutation_p.S651L	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	771					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GATTCGGTCCGAGTAGGGGCC	0.612																																																0			8						G	LEU/SER,LEU/SER	0,4406		0,0,2203	44.0	44.0	44.0		1952,2312	4.3	0.0	8		44	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	KCNQ3	NM_001204824.1,NM_004519.3	145,145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	651/753,771/873	133141816	1,13005	2203	4300	6503	133210998	SO:0001583	missense	3786			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.2312C>T	8.37:g.133141816G>A	ENSP00000373648:p.Ser771Leu	Somatic		Capture	Illumina GAIIx	4	133210998	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_KCNQ_channel	p.S771L	ENST00000388996.4	37	c.2312	CCDS34943.1	8	.	.	.	.	.	.	.	.	.	.	G	4.269	0.049005	0.08243	0.0	1.16E-4	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	T;T;T	0.45668	0.89;0.89;0.89	5.29	4.33	0.51752	.	0.561536	0.17997	N	0.155003	T	0.23370	0.0565	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.10450	0.005;0.005	T	0.11421	-1.0588	10	0.66056	D	0.02	-0.2105	9.3733	0.38268	0.0816:0.0:0.7632:0.1552	.	759;771	E7ET42;O43525	.;KCNQ3_HUMAN	L	771;651;759;748;650	ENSP00000373648:S771L;ENSP00000429799:S651L;ENSP00000428790:S759L	ENSP00000373648:S771L	S	-	2	0	KCNQ3	133210998	0.065000	0.20965	0.009000	0.14445	0.126000	0.20510	2.115000	0.41921	2.476000	0.83614	0.655000	0.94253	TCG	-	NULL		0.612	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	protein_coding	OTTHUMT00000268621.2	G	NM_004519		133210998	-1	no_errors	NM_004519	genbank	human	reviewed	54_36p	missense	SNP	0.366	A
CLIC3	9022	genome.wustl.edu	37	9	139889162	139889162	+	Missense_Mutation	SNP	C	C	A	rs149417490	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr9:139889162C>A	ENST00000494426.1	-	6	941	c.682G>T	c.(682-684)Gcc>Tcc	p.A228S	CLIC3_ENST00000480181.1_5'UTR	NM_004669.2	NP_004660.2	O95833	CLIC3_HUMAN	chloride intracellular channel 3	228	GST C-terminal.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|signal transduction (GO:0007165)	chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			lung(1)|skin(1)	2	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GGCCGGTAGGCCGCCAGGATC	0.657													C|||	40	0.00798722	0.0023	0.0173	5008	,	,		11204	0.0		0.0189	False		,,,				2504	0.0061															0			9						C	SER/ALA	26,4346		0,26,2160	21.0	24.0	23.0		682	4.2	1.0	9	dbSNP_134	23	171,8415		1,169,4123	yes	missense	CLIC3	NM_004669.2	99	1,195,6283	AA,AC,CC		1.9916,0.5947,1.5203	benign	228/237	139889162	197,12761	2186	4293	6479	139008983	SO:0001583	missense	9022			AF102166	CCDS7021.1	9q34.3	2012-09-26			ENSG00000169583	ENSG00000169583		"""Ion channels / Chloride channels : Intracellular"""	2064	protein-coding gene	gene with protein product		606533				9880541	Standard	NM_004669		Approved		uc004ckj.1	O95833	OTTHUMG00000020954	ENST00000494426.1:c.682G>T	9.37:g.139889162C>A	ENSP00000419378:p.Ala228Ser	Somatic		Capture	Illumina GAIIx	4	139008983	Q5SPZ7	Missense_Mutation	SNP	superfamily_Thiordxn-like_fd,superfamily_GST_C_like	p.A228S	ENST00000494426.1	37	c.682	CCDS7021.1	9	29	0.013278388278388278	3	0.006097560975609756	10	0.027624309392265192	0	0.0	16	0.021108179419525065	C	16.20	3.054834	0.55325	0.005947	0.019916	ENSG00000169583	ENST00000494426	D	0.94046	-3.34	4.15	4.15	0.48705	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.277354	0.35179	N	0.003386	D	0.87111	0.6096	M	0.78916	2.43	0.44523	D	0.99747	P	0.40197	0.706	P	0.48141	0.568	D	0.88502	0.3083	10	0.54805	T	0.06	.	11.4707	0.50266	0.1801:0.8199:0.0:0.0	.	228	O95833	CLIC3_HUMAN	S	228	ENSP00000419378:A228S	ENSP00000419378:A228S	A	-	1	0	CLIC3	139008983	0.955000	0.32602	0.993000	0.49108	0.170000	0.22686	3.410000	0.52664	2.142000	0.66516	0.491000	0.48974	GCC	-	superfamily_GST_C_like		0.657	CLIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIC3	protein_coding	OTTHUMT00000055173.2	C	NM_004669		139008983	-1	no_errors	NM_004669	genbank	human	reviewed	54_36p	missense	SNP	0.964	A
PCDHB17	54661	genome.wustl.edu	37	5	140537631	140537631	+	3'UTR	SNP	G	G	A			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr5:140537631G>A	ENST00000539533.1	+	0	2055									protocadherin beta 17 pseudogene																		GGCCCAGGCCGACTCGCTCAC	0.692																																																0			5																																								140517815	SO:0001624	3_prime_UTR_variant	54661			AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.*291G>A	5.37:g.140537631G>A		Somatic		Capture	Illumina GAIIx	4	140517815		RNA	SNP	-	NULL	ENST00000539533.1	37	NULL		5																																																																																			-	-		0.692	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	PCDHB17	protein_coding		G			140517815	+1	pseudogene	NR_001280	genbank	human	provisional	54_36p	rna	SNP	0.008	A
PCDHGA11	56105	genome.wustl.edu	37	5	140802531	140802531	+	Silent	SNP	G	G	A	rs375881737	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr5:140802531G>A	ENST00000398587.2	+	1	1770	c.1737G>A	c.(1735-1737)gcG>gcA	p.A579A	PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA11_ENST00000518882.1_Silent_p.A579A|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	579	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGAGCTGGCGCCCCGCTCTG	0.632																																																0			5											92.0	110.0	104.0					5																	140802531		2203	4300	6503	140782715	SO:0001819	synonymous_variant	56105			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.1737G>A	5.37:g.140802531G>A		Somatic		Capture	Illumina GAIIx	4	140782715	B7ZVY8|Q9Y5D8|Q9Y5D9	Silent	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.A579	ENST00000398587.2	37	c.1737	CCDS47294.1	5																																																																																			-	superfamily_Cadherin-like		0.632	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA11	protein_coding	OTTHUMT00000376974.1	G	NM_018914		140782715	+1	no_errors	NM_018914	genbank	human	reviewed	54_36p	silent	SNP	0.080	A
TRIM42	287015	genome.wustl.edu	37	3	140407325	140407325	+	Missense_Mutation	SNP	G	G	A			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr3:140407325G>A	ENST00000286349.3	+	3	1992	c.1801G>A	c.(1801-1803)Gtg>Atg	p.V601M		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	601						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CGATGGCTCTGTGAAGACCCC	0.547																																																0			3											103.0	102.0	102.0					3																	140407325		2203	4300	6503	141890015	SO:0001583	missense	287015			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1801G>A	3.37:g.140407325G>A	ENSP00000286349:p.Val601Met	Somatic		Capture	Illumina GAIIx	4	141890015	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	PatternScan_TNFR_NGFR_1,superfamily_RING/U-box,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMSmart_SM00336,HMMPfam_zf-B_box,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.V601M	ENST00000286349.3	37	c.1801	CCDS3113.1	3	.	.	.	.	.	.	.	.	.	.	G	12.79	2.044278	0.36085	.	.	ENSG00000155890	ENST00000286349	T	0.39229	1.09	5.52	2.58	0.30949	Fibronectin, type III (2);	0.544950	0.16687	N	0.203705	T	0.21881	0.0527	N	0.08118	0	0.21915	N	0.999471	B	0.11235	0.004	B	0.09377	0.004	T	0.17653	-1.0362	10	0.56958	D	0.05	-42.5528	8.225	0.31564	0.0849:0.2981:0.6169:0.0	.	601	Q8IWZ5	TRI42_HUMAN	M	601	ENSP00000286349:V601M	ENSP00000286349:V601M	V	+	1	0	TRIM42	141890015	0.003000	0.15002	0.946000	0.38457	0.559000	0.35586	-0.093000	0.11111	0.812000	0.34326	0.655000	0.94253	GTG	-	superfamily_Fibronectin type III		0.547	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	protein_coding	OTTHUMT00000359531.2	G	NM_152616		141890015	+1	no_errors	NM_152616	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
POLR3C	10623	genome.wustl.edu	37	1	145598565	145598565	+	Missense_Mutation	SNP	G	G	C			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr1:145598565G>C	ENST00000334163.3	-	8	1088	c.928C>G	c.(928-930)Cag>Gag	p.Q310E	POLR3C_ENST00000471254.1_5'UTR|POLR3C_ENST00000369294.1_Missense_Mutation_p.Q310E	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	310					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			GTGAGATACTGATCAAGAACT	0.383																																																0			1											148.0	145.0	146.0					1																	145598565		2203	4300	6503	144309922	SO:0001583	missense	10623			AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.928C>G	1.37:g.145598565G>C	ENSP00000334564:p.Gln310Glu	Somatic		Capture	Illumina GAIIx	4	144309922	O15317|Q9Y3R6	Missense_Mutation	SNP	HMMPfam_HTH_9,HMMPfam_RNA_pol_Rpc82	p.Q310E	ENST00000334163.3	37	c.928	CCDS921.1	1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622525	0.87460	.	.	ENSG00000186141	ENST00000334163;ENST00000369294	T;T	0.50277	0.75;0.75	6.17	6.17	0.99709	RNA polymerase III Rpc82, C -terminal (1);	0.000000	0.85682	D	0.000000	T	0.57784	0.2077	M	0.72118	2.19	0.80722	D	1	B;P;D	0.59767	0.289;0.716;0.986	B;B;P	0.59595	0.093;0.289;0.86	T	0.49707	-0.8911	10	0.33141	T	0.24	-19.3325	18.3732	0.90420	0.0:0.0:1.0:0.0	.	310;310;310	E9PHH9;Q9BUI4;Q53F76	.;RPC3_HUMAN;.	E	310	ENSP00000334564:Q310E;ENSP00000358300:Q310E	ENSP00000334564:Q310E	Q	-	1	0	POLR3C	144309922	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.675000	0.91195	2.941000	0.99782	0.655000	0.94253	CAG	-	HMMPfam_RNA_pol_Rpc82		0.383	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3C	protein_coding	OTTHUMT00000038542.1	G	NM_006468		144309922	-1	no_errors	NM_006468	genbank	human	provisional	54_36p	missense	SNP	1.000	C
CXorf40A	91966	genome.wustl.edu	37	X	148633762	148633762	+	IGR	SNP	G	G	A	rs140475691		TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chrX:148633762G>A	ENST00000514208.1	+	0	1840				RP5-937E21.8_ENST00000431993.1_RNA			Q8TE69	CX04A_HUMAN	chromosome X open reading frame 40A											breast(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CATCCTCCCCGTGGCCTCTCA	0.582													.|||	164	0.0434437	0.0023	0.013	3775	,	,		15556	0.0774		0.0398	False		,,,				2504	0.0348															0			X																																								148441667	SO:0001628	intergenic_variant	642889			AF011889	CCDS14687.1, CCDS55522.1	Xq28	2010-03-16	2005-09-13	2005-09-13	ENSG00000197620	ENSG00000197620			28089	protein-coding gene	gene with protein product	"""endothelial-overexpressed lipopolysaccharide-associated factor 1"""		"""chromosome X open reading frame 40"""	CXorf40		8717057, 9147653, 16383041	Standard	XM_005278212		Approved	EOLA1	uc004fdg.3	Q8TE69	OTTHUMG00000022622		X.37:g.148633762G>A		Somatic		Capture	Illumina GAIIx	4	148441667	A8K784|B7Z6H6|B7ZL96|D6RA72|E7ENU3|Q2M3E9	RNA	SNP	-	NULL	ENST00000514208.1	37	NULL	CCDS55522.1	X																																																																																			-	-		0.582	CXorf40A-011	PUTATIVE	alternative_5_UTR|basic|CCDS	protein_coding	FLJ16423	protein_coding	OTTHUMT00000359389.1	G	NM_178124		148441667	+1	no_errors	XR_041441	genbank	human	model	54_36p	rna	SNP	0.000	A
HMGB3	3149	genome.wustl.edu	37	X	150156339	150156339	+	Silent	SNP	A	A	G	rs139826031	byFrequency	TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chrX:150156339A>G	ENST00000325307.7	+	5	651	c.555A>G	c.(553-555)gaA>gaG	p.E185E	HMGB3_ENST00000448905.2_Silent_p.E185E	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	185	Asp/Glu-rich (acidic).				DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					aggaagatgaagaagaggagg	0.463													A|||	34	0.00900662	0.0174	0.0029	3775	,	,		13837	0.0		0.008	False		,,,				2504	0.001															0			X						A		82,3751		1,66,14,1564,557	53.0	51.0	52.0		555	-0.6	0.2	X	dbSNP_134	52	102,6625		0,76,26,2352,1845	no	coding-synonymous	HMGB3	NM_005342.2		1,142,40,3916,2402	GG,GA,G,AA,A		1.5163,2.1393,1.7424		185/201	150156339	184,10376	2202	4299	6501	149906997	SO:0001819	synonymous_variant	3149			AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.555A>G	X.37:g.150156339A>G		Somatic		Capture	Illumina GAIIx	4	149906997	O95556|Q6NS40	Silent	SNP	superfamily_HMG-box,HMMPfam_HMG_box,HMMSmart_HMG,PatternScan_HMG_BOX_1	p.E185	ENST00000325307.7	37	c.555	CCDS35428.1	X																																																																																			-	NULL		0.463	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HMGB3	protein_coding	OTTHUMT00000060867.1	A	NM_005342		149906997	+1	no_errors	NM_005342	genbank	human	validated	54_36p	silent	SNP	0.996	G
LCE3E	353145	genome.wustl.edu	37	1	152538649	152538649	+	Silent	SNP	G	G	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr1:152538649G>T	ENST00000368789.1	-	2	91	c.36C>A	c.(34-36)ccC>ccA	p.P12P		NM_178435.2	NP_848522.1	Q5T5B0	LCE3E_HUMAN	late cornified envelope 3E	12					keratinization (GO:0031424)					lung(6)|ovary(1)	7	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		Lung(1;0.000294)|LUAD - Lung adenocarcinoma(1;0.00527)|LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)		ACTTGGGTGGGGGTTGGCACT	0.567																																																0			1											61.0	66.0	64.0					1																	152538649		2203	4300	6503	150805273	SO:0001819	synonymous_variant	353145				CCDS1013.1	1q21.3	2008-02-05			ENSG00000185966	ENSG00000185966		"""Late cornified envelopes"""	29463	protein-coding gene	gene with protein product		612617				11698679	Standard	NM_178435		Approved	LEP17	uc001faa.4	Q5T5B0	OTTHUMG00000012393	ENST00000368789.1:c.36C>A	1.37:g.152538649G>T		Somatic		Capture	Illumina GAIIx	4	150805273	A2RRM6	Silent	SNP	NULL	p.P12	ENST00000368789.1	37	c.36	CCDS1013.1	1																																																																																			-	NULL		0.567	LCE3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE3E	protein_coding	OTTHUMT00000034513.1	G	NM_178435		150805273	-1	no_errors	NM_178435	genbank	human	validated	54_36p	silent	SNP	0.965	T
TLL1	7092	genome.wustl.edu	37	4	167012329	167012329	+	Missense_Mutation	SNP	A	A	G	rs147825878		TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr4:167012329A>G	ENST00000061240.2	+	19	3139	c.2492A>G	c.(2491-2493)cAc>cGc	p.H831R	TLL1_ENST00000507499.1_Missense_Mutation_p.H854R	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	831	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GCTTATGACCACTTAGAAGTA	0.343																																																0			4						A	ARG/HIS	0,4406		0,0,2203	98.0	95.0	96.0		2492	5.3	1.0	4	dbSNP_134	96	1,8597	1.2+/-3.3	0,1,4298	no	missense	TLL1	NM_012464.4	29	0,1,6501	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	831/1014	167012329	1,13003	2203	4299	6502	167231779	SO:0001583	missense	7092			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2492A>G	4.37:g.167012329A>G	ENSP00000061240:p.His831Arg	Somatic		Capture	Illumina GAIIx	4	167231779	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	"superfamily_Metalloproteases (""zincins"") catalytic domain,HMMSmart_SM00235,HMMPfam_Astacin,superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,PatternScan_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMPfam_EGF_CA,HMMSmart_SM00181,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,HMMPfam_EGF"	p.H831R	ENST00000061240.2	37	c.2492	CCDS3811.1	4	.	.	.	.	.	.	.	.	.	.	A	20.9	4.072069	0.76415	0.0	1.16E-4	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.33438	1.41;1.41	5.3	5.3	0.74995	CUB (5);	0.000000	0.85682	U	0.000000	T	0.40094	0.1103	L	0.49455	1.56	0.80722	D	1	D;B	0.53745	0.962;0.324	P;B	0.51170	0.661;0.305	T	0.18587	-1.0332	10	0.46703	T	0.11	.	15.2575	0.73596	1.0:0.0:0.0:0.0	.	854;831	E9PD25;O43897	.;TLL1_HUMAN	R	831;854	ENSP00000061240:H831R;ENSP00000426082:H854R	ENSP00000061240:H831R	H	+	2	0	TLL1	167231779	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.195000	0.94971	2.026000	0.59711	0.383000	0.25322	CAC	-	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042		0.343	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	protein_coding	OTTHUMT00000363821.1	A			167231779	+1	no_errors	NM_012464	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
HMCN1	83872	genome.wustl.edu	37	1	186056441	186056441	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr1:186056441A>T	ENST00000271588.4	+	59	9368	c.9139A>T	c.(9139-9141)Aag>Tag	p.K3047*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.K3047*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3047	Ig-like C2-type 28.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AAGCAAGAAAAAGTTTTCCCT	0.358																																																0			1											143.0	138.0	140.0					1																	186056441		2203	4300	6503	184323064	SO:0001587	stop_gained	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.9139A>T	1.37:g.186056441A>T	ENSP00000271588:p.Lys3047*	Somatic		Capture	Illumina GAIIx	4	184323064	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	superfamily_vWA-like,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,HMMSmart_SM00408,HMMPfam_I-set,HMMSmart_SM00406,PatternScan_CECROPIN,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMSmart_SM00682,HMMPfam_G2F,superfamily_GFP-like,PatternScan_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,HMMPfam_EGF_CA,PatternScan_EGF_2	p.K3047*	ENST00000271588.4	37	c.9139	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	A	50	16.087740	0.99854	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.84	4.7	0.59300	.	0.394426	0.33040	N	0.005358	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3104	0.60376	0.8683:0.1317:0.0:0.0	.	.	.	.	X	3047	.	ENSP00000271588:K3047X	K	+	1	0	HMCN1	184323064	1.000000	0.71417	0.016000	0.15963	0.167000	0.22549	2.766000	0.47629	0.998000	0.38996	0.533000	0.62120	AAG	-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409		0.358	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	A	NM_031935		184323064	+1	no_errors	NM_031935	genbank	human	reviewed	54_36p	nonsense	SNP	0.861	T
ATP2B4	493	genome.wustl.edu	37	1	203681241	203681241	+	Missense_Mutation	SNP	C	C	T			TCGA-13-2066-01A-01D-1526-09	TCGA-13-2066-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ae34e8ba-0ca3-4c68-9379-28135af0646f	0596464f-371f-46ef-a427-7b1f1a1856fa	g.chr1:203681241C>T	ENST00000357681.5	+	13	3308	c.2185C>T	c.(2185-2187)Cgg>Tgg	p.R729W	ATP2B4_ENST00000367219.3_Missense_Mutation_p.R717W|ATP2B4_ENST00000391954.2_Missense_Mutation_p.R729W|ATP2B4_ENST00000341360.2_Missense_Mutation_p.R729W|ATP2B4_ENST00000367218.3_Missense_Mutation_p.R729W	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	729					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AGAATTCAACCGGCTCATCCG	0.552																																																0			1											92.0	88.0	89.0					1																	203681241		2203	4300	6503	201947864	SO:0001583	missense	493			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.2185C>T	1.37:g.203681241C>T	ENSP00000350310:p.Arg729Trp	Somatic		Capture	Illumina GAIIx	4	201947864	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	HMMPfam_Cation_ATPase_N,superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,HMMPfam_Hydrolase,superfamily_HAD-like,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Cation_ATPase_C	p.R729W	ENST00000357681.5	37	c.2185	CCDS1440.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226966	0.79576	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	D;D;D;D;D	0.97161	-4.27;-4.27;-4.27;-4.27;-4.27	5.64	4.7	0.59300	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.301584	0.23955	N	0.042918	D	0.98337	0.9448	M	0.87827	2.91	0.41067	D	0.985427	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.68353	0.957;0.913;0.936	D	0.99097	1.0842	10	0.87932	D	0	-7.9431	12.6582	0.56799	0.3574:0.6426:0.0:0.0	.	729;729;729	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	W	729;729;717;729;729	ENSP00000350310:R729W;ENSP00000356187:R729W;ENSP00000356188:R717W;ENSP00000375816:R729W;ENSP00000340930:R729W	ENSP00000340930:R729W	R	+	1	2	ATP2B4	201947864	0.987000	0.35691	1.000000	0.80357	0.994000	0.84299	1.165000	0.31822	1.274000	0.44362	0.650000	0.86243	CGG	-	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_Hydrolase,superfamily_HAD-like		0.552	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	protein_coding	OTTHUMT00000087462.1	C	NM_001001396		201947864	+1	no_errors	NM_001684	genbank	human	reviewed	54_36p	missense	SNP	0.986	T
