#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ECE1	1889	broad.mit.edu	37	1	21546500	21546500	+	Missense_Mutation	SNP	C	C	T	rs374518508		TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr1:21546500C>T	ENST00000374893.6	-	19	2335	c.2261G>A	c.(2260-2262)cGc>cAc	p.R754H	ECE1_ENST00000415912.2_Missense_Mutation_p.R738H|ECE1_ENST00000436918.2_Missense_Mutation_p.R722H|ECE1_ENST00000357071.4_Missense_Mutation_p.R742H|ECE1_ENST00000264205.6_Missense_Mutation_p.R751H	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	754			R -> C (in HSCRCDAD; dbSNP:rs3026906). {ECO:0000269|PubMed:9915973}.		bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)	p.R754H(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		AGGTGGGCAGCGGAAGTGTTC	0.617																																																1	Substitution - Missense(1)	ovary(1)	1						T	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	98.0	90.0	93.0		2261,2252,2213,2225	-0.5	1.0	1		93	0,8600		0,0,4300	no	missense,missense,missense,missense	ECE1	NM_001397.2,NM_001113349.1,NM_001113348.1,NM_001113347.1	29,29,29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign,benign	754/771,751/768,738/755,742/759	21546500	1,13005	2203	4300	6503	21419087	SO:0001583	missense	1889			D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.2261G>A	1.37:g.21546500C>T	ENSP00000364028:p.Arg754His	Somatic		Capture	Illumina GAIIx	Phase_I	21419087	A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Missense_Mutation	SNP	ENST00000374893.6	37	CCDS215.1	.	.	.	.	.	.	.	.	.	.	c	2.806	-0.248166	0.05867	2.27E-4	0.0	ENSG00000117298	ENST00000415912;ENST00000357071;ENST00000374893;ENST00000436918;ENST00000264205	D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55	4.98	-0.503	0.12000	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.472937	0.25711	N	0.028808	T	0.59252	0.2180	N	0.03029	-0.43	0.21697	N	0.999581	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.0;0.0;0.001	T	0.45571	-0.9252	10	0.25751	T	0.34	-16.7079	11.2084	0.48784	0.0:0.4632:0.0:0.5368	.	722;738;754;742;751	B4DKB2;Q2Z2K8;P42892;P42892-2;P42892-4	.;.;ECE1_HUMAN;.;.	H	738;742;754;722;751	ENSP00000405088:R738H;ENSP00000349581:R742H;ENSP00000364028:R754H;ENSP00000388439:R722H;ENSP00000264205:R751H	ENSP00000264205:R751H	R	-	2	0	ECE1	21419087	0.267000	0.24122	0.959000	0.39883	0.052000	0.14988	0.021000	0.13489	-0.584000	0.05913	-2.889000	0.00095	CGC		0.617	ECE1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007470.2	NM_001397	
HIVEP3	59269	broad.mit.edu	37	1	42049046	42049046	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr1:42049046C>T	ENST00000372583.1	-	4	2308	c.1423G>A	c.(1423-1425)Gtg>Atg	p.V475M	HIVEP3_ENST00000372584.1_Missense_Mutation_p.V475M|HIVEP3_ENST00000429157.2_Missense_Mutation_p.V475M|HIVEP3_ENST00000247584.5_Missense_Mutation_p.V475M	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	475	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V475M(1)		NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GTGTCCACCACGGCCTCGTTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											78.0	72.0	74.0					1																	42049046		2203	4300	6503	41821633	SO:0001583	missense	59269			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.1423G>A	1.37:g.42049046C>T	ENSP00000361664:p.Val475Met	Somatic		Capture	Illumina GAIIx	Phase_I	41821633	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	37	CCDS463.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.800850	0.70567	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	4.82	4.82	0.62117	.	0.000000	0.47093	D	0.000245	T	0.45915	0.1366	L	0.51914	1.62	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.982	T	0.26677	-1.0096	10	0.41790	T	0.15	-1.5088	17.6825	0.88248	0.0:1.0:0.0:0.0	.	475;475	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	M	475	ENSP00000361665:V475M;ENSP00000361664:V475M;ENSP00000247584:V475M;ENSP00000410828:V475M	ENSP00000247584:V475M	V	-	1	0	HIVEP3	41821633	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.918000	0.69996	2.514000	0.84764	0.561000	0.74099	GTG		0.622	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
BCAN	63827	broad.mit.edu	37	1	156616813	156616813	+	Nonsense_Mutation	SNP	C	C	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr1:156616813C>G	ENST00000329117.5	+	3	648	c.312C>G	c.(310-312)taC>taG	p.Y104*	RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Nonsense_Mutation_p.Y104*|RP11-284F21.10_ENST00000605886.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	104	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.Y104*(1)		cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ACGAGGCCTACCGGTTCCGCG	0.682																																																1	Substitution - Nonsense(1)	ovary(1)	1											47.0	35.0	39.0					1																	156616813		2203	4299	6502	154883437	SO:0001587	stop_gained	63827			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.312C>G	1.37:g.156616813C>G	ENSP00000331210:p.Tyr104*	Somatic		Capture	Illumina GAIIx	Phase_I	154883437	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Nonsense_Mutation	SNP	ENST00000329117.5	37	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971182	0.74246	.	.	ENSG00000132692	ENST00000441358;ENST00000255029;ENST00000329117;ENST00000457777;ENST00000361588	.	.	.	4.61	2.71	0.32032	.	0.000000	0.53938	D	0.000042	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.0678	9.6616	0.39958	0.0:0.8255:0.0:0.1745	.	.	.	.	X	104	.	ENSP00000255029:Y104X	Y	+	3	2	BCAN	154883437	0.024000	0.19004	1.000000	0.80357	0.496000	0.33645	0.365000	0.20348	0.534000	0.28695	0.455000	0.32223	TAC		0.682	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
INSRR	3645	broad.mit.edu	37	1	156821464	156821464	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr1:156821464C>T	ENST00000368195.3	-	4	1454	c.1058G>A	c.(1057-1059)aGc>aAc	p.S353N	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	353					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S353N(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GAGGATGAGGCTTCCCTCCAC	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											99.0	80.0	86.0					1																	156821464		2203	4300	6503	155088088	SO:0001583	missense	3645			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.1058G>A	1.37:g.156821464C>T	ENSP00000357178:p.Ser353Asn	Somatic		Capture	Illumina GAIIx	Phase_I	155088088	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	C	8.188	0.795369	0.16327	.	.	ENSG00000027644	ENST00000368195	T	0.78003	-1.14	4.72	3.79	0.43588	EGF receptor, L domain (1);	0.342126	0.25253	N	0.032005	T	0.32675	0.0837	.	.	.	0.27123	N	0.962096	B	0.02656	0.0	B	0.08055	0.003	T	0.17684	-1.0361	9	0.09338	T	0.73	.	6.7177	0.23312	0.0:0.7255:0.0:0.2745	.	353	P14616	INSRR_HUMAN	N	353	ENSP00000357178:S353N	ENSP00000357178:S353N	S	-	2	0	INSRR	155088088	0.998000	0.40836	1.000000	0.80357	0.890000	0.51754	0.516000	0.22817	1.165000	0.42670	0.462000	0.41574	AGC		0.587	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
USH2A	7399	broad.mit.edu	37	1	216595264	216595264	+	Missense_Mutation	SNP	G	G	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr1:216595264G>T	ENST00000307340.3	-	2	801	c.415C>A	c.(415-417)Cct>Act	p.P139T	USH2A_ENST00000366943.2_Missense_Mutation_p.P139T|USH2A_ENST00000366942.3_Missense_Mutation_p.P139T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	139					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.P139T(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGAGAAGGAGGAGAAGAAAAG	0.413										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1											110.0	106.0	107.0					1																	216595264		2203	4300	6503	214661887	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.415C>A	1.37:g.216595264G>T	ENSP00000305941:p.Pro139Thr	Somatic		Capture	Illumina GAIIx	Phase_I	214661887	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.702884	0.68501	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.77098	-1.07;-1.07;-1.07	5.42	4.51	0.55191	Concanavalin A-like lectin/glucanase (1);	0.168341	0.28016	U	0.016924	D	0.83184	0.5199	L	0.59436	1.845	0.43043	D	0.994639	D;D	0.60160	0.983;0.987	P;P	0.58620	0.755;0.842	D	0.85137	0.0978	10	0.72032	D	0.01	.	14.133	0.65268	0.0725:0.0:0.9275:0.0	.	139;139	O75445-2;O75445	.;USH2A_HUMAN	T	139	ENSP00000305941:P139T;ENSP00000355910:P139T;ENSP00000355909:P139T	ENSP00000305941:P139T	P	-	1	0	USH2A	214661887	1.000000	0.71417	0.999000	0.59377	0.959000	0.62525	3.225000	0.51246	1.288000	0.44600	0.591000	0.81541	CCT		0.413	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
ITIH2	3698	broad.mit.edu	37	10	7751080	7751080	+	Missense_Mutation	SNP	C	C	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr10:7751080C>A	ENST00000358415.4	+	4	454	c.288C>A	c.(286-288)aaC>aaA	p.N96K	ITIH2_ENST00000379587.4_Missense_Mutation_p.N85K|ITIH2_ENST00000480387.1_Intron	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	96	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.N96K(1)		NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						AAGTGGTGAACAATTCCCCGC	0.443																																																1	Substitution - Missense(1)	ovary(1)	10											149.0	141.0	144.0					10																	7751080		2203	4300	6503	7791086	SO:0001583	missense	3698			X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.288C>A	10.37:g.7751080C>A	ENSP00000351190:p.Asn96Lys	Somatic		Capture	Illumina GAIIx	Phase_I	7791086	Q14659|Q15484|Q5T986	Missense_Mutation	SNP	ENST00000358415.4	37	CCDS31141.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.549660	0.65311	.	.	ENSG00000151655	ENST00000358415;ENST00000429820;ENST00000379587	T;T;T	0.56941	0.43;0.43;0.43	5.79	4.79	0.61399	Vault protein inter-alpha-trypsin (2);Vault protein inter-alpha-trypsin, metazoa (1);	0.000000	0.85682	D	0.000000	T	0.78052	0.4223	M	0.93150	3.385	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	T	0.82890	-0.0233	10	0.87932	D	0	-36.8223	12.6707	0.56866	0.0:0.8582:0.0:0.1418	.	96	P19823	ITIH2_HUMAN	K	96;71;85	ENSP00000351190:N96K;ENSP00000388826:N71K;ENSP00000368906:N85K	ENSP00000351190:N96K	N	+	3	2	ITIH2	7791086	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	1.450000	0.35134	2.738000	0.93877	0.585000	0.79938	AAC		0.443	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	NM_002216	
CTNNA3	29119	broad.mit.edu	37	10	68940233	68940233	+	Nonsense_Mutation	SNP	G	G	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr10:68940233G>A	ENST00000433211.2	-	7	1063	c.889C>T	c.(889-891)Cga>Tga	p.R297*	CTNNA3_ENST00000545309.1_Nonsense_Mutation_p.R297*|CTNNA3_ENST00000373744.4_Nonsense_Mutation_p.R297*	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.R297*(3)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						AGTGATGGTCGTATTTCCTCC	0.448																																																3	Substitution - Nonsense(3)	large_intestine(2)|ovary(1)	10											143.0	130.0	134.0					10																	68940233		2203	4300	6503	68610239	SO:0001587	stop_gained	29119			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.889C>T	10.37:g.68940233G>A	ENSP00000389714:p.Arg297*	Somatic		Capture	Illumina GAIIx	Phase_I	68610239		Nonsense_Mutation	SNP	ENST00000433211.2	37	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	G	39	7.874806	0.98537	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000545309	.	.	.	5.83	1.89	0.25635	.	0.107942	0.39985	N	0.001208	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.0289	14.0978	0.65034	0.0:0.0:0.3637:0.6363	.	.	.	.	X	297	.	ENSP00000362849:R297X	R	-	1	2	CTNNA3	68610239	0.984000	0.35163	0.997000	0.53966	0.990000	0.78478	1.218000	0.32467	0.456000	0.26937	-0.347000	0.07816	CGA		0.448	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
KIF20B	9585	broad.mit.edu	37	10	91479226	91479226	+	Silent	SNP	T	T	C			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr10:91479226T>C	ENST00000371728.3	+	13	1550	c.1485T>C	c.(1483-1485)ccT>ccC	p.P495P	KIF20B_ENST00000394289.2_Silent_p.P495P|KIF20B_ENST00000260753.4_Silent_p.P495P|KIF20B_ENST00000416354.1_Silent_p.P495P	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	495					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)	p.P495P(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TATTTGGACCTGTCAAATCTT	0.313																																																1	Substitution - coding silent(1)	ovary(1)	10											38.0	42.0	41.0					10																	91479226		2193	4297	6490	91469206	SO:0001819	synonymous_variant	9585			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.1485T>C	10.37:g.91479226T>C		Somatic		Capture	Illumina GAIIx	Phase_I	91469206	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Silent	SNP	ENST00000371728.3	37																																																																																					0.313	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
ARHGAP19	84986	broad.mit.edu	37	10	99052333	99052333	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr10:99052333G>A	ENST00000358531.4	-	1	80	c.52C>T	c.(52-54)Cgg>Tgg	p.R18W	ARHGAP19-SLIT1_ENST00000453547.2_Missense_Mutation_p.R18W|ARHGAP19-SLIT1_ENST00000358308.3_Missense_Mutation_p.R18W|ARHGAP19-SLIT1_ENST00000316676.8_Missense_Mutation_p.R18W	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19	18					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.R18W(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		GCTCACCTCCGGCCGGATTCG	0.642																																																1	Substitution - Missense(1)	ovary(1)	10											135.0	105.0	115.0					10																	99052333		2203	4300	6503	99042323	SO:0001583	missense	84986			AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.52C>T	10.37:g.99052333G>A	ENSP00000351333:p.Arg18Trp	Somatic		Capture	Illumina GAIIx	Phase_I	99042323	A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Missense_Mutation	SNP	ENST00000358531.4	37	CCDS7454.2	.	.	.	.	.	.	.	.	.	.	G	8.942	0.966106	0.18659	.	.	ENSG00000213390	ENST00000453547;ENST00000316676;ENST00000358531;ENST00000358308	T;T;T;T	0.11604	2.92;2.96;2.95;2.76	4.22	2.31	0.28768	.	1.110750	0.07259	U	0.867083	T	0.11367	0.0277	N	0.14661	0.345	0.27819	N	0.941878	D;B	0.71674	0.998;0.001	P;B	0.50754	0.649;0.001	T	0.36939	-0.9727	10	0.54805	T	0.06	.	9.3654	0.38221	0.0:0.0:0.611:0.389	.	18;18	Q14CB8-6;Q14CB8	.;RHG19_HUMAN	W	18	ENSP00000414774:R18W;ENSP00000324468:R18W;ENSP00000351333:R18W;ENSP00000351058:R18W	ENSP00000324468:R18W	R	-	1	2	ARHGAP19	99042323	0.994000	0.37717	0.731000	0.30826	0.024000	0.10985	3.721000	0.54941	0.704000	0.31869	-0.320000	0.08662	CGG		0.642	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049647.2	NM_032900	
CARS	833	broad.mit.edu	37	11	3028132	3028132	+	Missense_Mutation	SNP	C	C	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr11:3028132C>A	ENST00000397111.5	-	18	2122	c.1877G>T	c.(1876-1878)gGg>gTg	p.G626V	CARS_ENST00000401769.3_Missense_Mutation_p.G639V|CARS_ENST00000470221.2_5'UTR|CARS_ENST00000397114.3_Missense_Mutation_p.G616V|CARS_ENST00000278224.9_Missense_Mutation_p.G626V|CARS_ENST00000380525.4_Missense_Mutation_p.G709V			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	626					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)	p.G626V(1)	CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	AAACCGCACCCCAAGCTCGGG	0.587			T	ALK	ALCL																																Ovarian(61;932 1157 5961 20446 52152)		Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	1	Substitution - Missense(1)	ovary(1)	11											182.0	174.0	176.0					11																	3028132		2202	4298	6500	2984708	SO:0001583	missense	833			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.1877G>T	11.37:g.3028132C>A	ENSP00000380300:p.Gly626Val	Somatic		Capture	Illumina GAIIx	Phase_I	2984708	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Missense_Mutation	SNP	ENST00000397111.5	37	CCDS7742.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.138178	0.77775	.	.	ENSG00000110619	ENST00000380525;ENST00000397111;ENST00000278224;ENST00000397114;ENST00000401769	T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3	4.42	4.42	0.53409	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.000000	0.85682	D	0.000000	D	0.92198	0.7526	H	0.94542	3.55	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.996;0.964;0.992;1.0;0.964	D;D;P;D;D;P	0.91635	0.991;0.924;0.808;0.944;0.999;0.808	D	0.94346	0.7575	10	0.87932	D	0	-44.8475	15.3614	0.74478	0.0:1.0:0.0:0.0	.	639;709;626;626;709;616	B4DKY1;B4DPV7;P49589;P49589-2;Q5HYE4;A8MVQ3	.;.;SYCC_HUMAN;.;.;.	V	709;626;626;616;639	ENSP00000369897:G709V;ENSP00000380300:G626V;ENSP00000278224:G626V;ENSP00000380303:G616V;ENSP00000384069:G639V	ENSP00000278224:G626V	G	-	2	0	CARS	2984708	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.621000	0.74228	2.280000	0.76307	0.462000	0.41574	GGG		0.587	CARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030117.4	NM_001751	
KIAA1549L	25758	broad.mit.edu	37	11	33564032	33564032	+	Missense_Mutation	SNP	A	A	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr11:33564032A>T	ENST00000321505.4	+	1	212	c.32A>T	c.(31-33)gAt>gTt	p.D11V	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.D11V|KIAA1549L_ENST00000265654.5_Missense_Mutation_p.D11V			Q6ZVL6	K154L_HUMAN	KIAA1549-like	11						integral component of membrane (GO:0016021)		p.D11V(1)									AATGCCCAGGATCTCATAGGC	0.493																																																1	Substitution - Missense(1)	ovary(1)	11											78.0	78.0	78.0					11																	33564032		1988	4145	6133	33520608	SO:0001583	missense	25758			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.32A>T	11.37:g.33564032A>T	ENSP00000315295:p.Asp11Val	Somatic		Capture	Illumina GAIIx	Phase_I	33520608	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	37	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	A	6.025	0.372931	0.11409	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654	.	.	.	4.84	0.949	0.19566	.	.	.	.	.	T	0.24236	0.0587	N	0.24115	0.695	0.09310	N	1	B;P	0.39782	0.267;0.688	B;B	0.40534	0.079;0.332	T	0.13282	-1.0515	8	0.72032	D	0.01	.	5.8387	0.18621	0.3602:0.4653:0.1745:0.0	.	11;11	E9PAT2;Q6ZVL6-2	.;.	V	11	.	ENSP00000265654:D11V	D	+	2	0	C11orf41	33520608	0.000000	0.05858	0.003000	0.11579	0.016000	0.09150	0.302000	0.19192	-0.091000	0.12440	0.459000	0.35465	GAT		0.493	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
OR4X1	390113	broad.mit.edu	37	11	48285590	48285590	+	Missense_Mutation	SNP	T	T	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr11:48285590T>G	ENST00000320048.1	+	1	178	c.178T>G	c.(178-180)Ttt>Gtt	p.F60V		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F60V(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						CATGTATTTCTTTCTCAGCTA	0.468																																																1	Substitution - Missense(1)	ovary(1)	11											149.0	136.0	140.0					11																	48285590		2201	4298	6499	48242166	SO:0001583	missense	390113			AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.178T>G	11.37:g.48285590T>G	ENSP00000321506:p.Phe60Val	Somatic		Capture	Illumina GAIIx	Phase_I	48242166	Q6IF74	Missense_Mutation	SNP	ENST00000320048.1	37	CCDS31487.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.968866	0.53614	.	.	ENSG00000176567	ENST00000320048	T	0.14391	2.51	4.29	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.45418	0.1341	H	0.98027	4.13	0.25879	N	0.983613	D	0.56968	0.978	P	0.54499	0.754	T	0.56007	-0.8050	9	0.72032	D	0.01	.	11.6949	0.51538	0.0:0.0:0.0:1.0	.	60	Q8NH49	OR4X1_HUMAN	V	60	ENSP00000321506:F60V	ENSP00000321506:F60V	F	+	1	0	OR4X1	48242166	0.857000	0.29778	1.000000	0.80357	0.670000	0.39368	1.186000	0.32078	1.914000	0.55421	0.460000	0.39030	TTT		0.468	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383373.1	NM_001004726	
MMP13	4322	broad.mit.edu	37	11	102826347	102826347	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr11:102826347C>T	ENST00000260302.3	-	1	116	c.88G>A	c.(88-90)Gat>Aat	p.D30N	MMP13_ENST00000340273.4_Missense_Mutation_p.D30N	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	30					bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D30N(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	TCAGACAAATCATCTTCATCA	0.502																																																1	Substitution - Missense(1)	ovary(1)	11											111.0	100.0	104.0					11																	102826347		2202	4299	6501	102331557	SO:0001583	missense	4322			X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.88G>A	11.37:g.102826347C>T	ENSP00000260302:p.Asp30Asn	Somatic		Capture	Illumina GAIIx	Phase_I	102331557	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	37	CCDS8324.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.442901	0.25987	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	T;T	0.38240	1.15;1.15	5.62	4.69	0.59074	Metallopeptidase, catalytic domain (1);	0.422167	0.28742	N	0.014293	T	0.19046	0.0457	N	0.08118	0	0.23882	N	0.996572	P	0.35656	0.514	B	0.28916	0.096	T	0.09952	-1.0651	10	0.42905	T	0.14	.	14.0175	0.64533	0.0:0.9243:0.0:0.0757	.	30	P45452	MMP13_HUMAN	N	30	ENSP00000260302:D30N;ENSP00000339672:D30N	ENSP00000260302:D30N	D	-	1	0	MMP13	102331557	0.667000	0.27484	0.034000	0.17996	0.108000	0.19459	2.001000	0.40825	1.440000	0.47531	0.655000	0.94253	GAT		0.502	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	NM_002427	
TECTA	7007	broad.mit.edu	37	11	121028627	121028627	+	Silent	SNP	G	G	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr11:121028627G>A	ENST00000392793.1	+	14	4654	c.4383G>A	c.(4381-4383)ccG>ccA	p.P1461P	TECTA_ENST00000264037.2_Silent_p.P1461P			O75443	TECTA_HUMAN	tectorin alpha	1461					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.P1461P(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		AGTGCGACCCGCGCCAATGCA	0.652																																																1	Substitution - coding silent(1)	ovary(1)	11											42.0	42.0	42.0					11																	121028627		2203	4299	6502	120533837	SO:0001819	synonymous_variant	7007			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4383G>A	11.37:g.121028627G>A		Somatic		Capture	Illumina GAIIx	Phase_I	120533837		Silent	SNP	ENST00000392793.1	37	CCDS8434.1																																																																																				0.652	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
ARHGAP32	9743	broad.mit.edu	37	11	128993408	128993408	+	Missense_Mutation	SNP	C	C	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr11:128993408C>G	ENST00000310343.9	-	4	334	c.335G>C	c.(334-336)gGt>gCt	p.G112A	ARHGAP32_ENST00000524655.1_Missense_Mutation_p.G38A	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	112					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)	p.G112A(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CGGAAAGTGACCTTTAGTGAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	11											96.0	86.0	89.0					11																	128993408		1566	3579	5145	128498618	SO:0001583	missense	9743			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.335G>C	11.37:g.128993408C>G	ENSP00000310561:p.Gly112Ala	Somatic		Capture	Illumina GAIIx	Phase_I	128498618	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244313	0.79912	.	.	ENSG00000134909	ENST00000310343;ENST00000524655;ENST00000457677;ENST00000525234	T;T;T	0.75821	-0.97;-0.97;-0.97	5.55	5.55	0.83447	.	.	.	.	.	D	0.82820	0.5120	L	0.49126	1.545	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.69307	0.933;0.963	T	0.82612	-0.0371	9	0.49607	T	0.09	.	18.0611	0.89378	0.0:1.0:0.0:0.0	.	46;112	Q86T64;A7KAX9	.;RHG32_HUMAN	A	112;38;46;86	ENSP00000310561:G112A;ENSP00000432468:G38A;ENSP00000432303:G86A	ENSP00000310561:G112A	G	-	2	0	ARHGAP32	128498618	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.770000	0.74990	2.597000	0.87782	0.655000	0.94253	GGT		0.333	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
SLCO1B3	28234	broad.mit.edu	37	12	21054396	21054396	+	Silent	SNP	T	T	C			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr12:21054396T>C	ENST00000381545.3	+	15	2079	c.1860T>C	c.(1858-1860)ttT>ttC	p.F620F	SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000540229.1_Silent_p.F620F|SLCO1B3_ENST00000553473.1_Silent_p.F620F|SLCO1B3_ENST00000261196.2_Silent_p.F620F|LST3_ENST00000381541.3_Intron	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	620					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.F620F(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	ATTCCGTATTTTTTGGGTAAG	0.333																																																1	Substitution - coding silent(1)	ovary(1)	12											145.0	141.0	142.0					12																	21054396		2203	4300	6503	20945663	SO:0001819	synonymous_variant	28234				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1860T>C	12.37:g.21054396T>C		Somatic		Capture	Illumina GAIIx	Phase_I	20945663	E7EMT8|Q5JAR4	Silent	SNP	ENST00000381545.3	37	CCDS8684.1																																																																																				0.333	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844	
CCDC65	85478	broad.mit.edu	37	12	49315215	49315215	+	Missense_Mutation	SNP	C	C	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr12:49315215C>G	ENST00000320516.4	+	8	1632	c.1444C>G	c.(1444-1446)Cca>Gca	p.P482A	RP11-302B13.5_ENST00000398092.4_Intron|CCDC65_ENST00000266984.5_Intron	NM_033124.4	NP_149115.2	Q8IXS2	CCD65_HUMAN	coiled-coil domain containing 65	482								p.P482A(1)		breast(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	15						TAAACAACATCCAACCACTTA	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											79.0	75.0	76.0					12																	49315215		2203	4300	6503	47601482	SO:0001583	missense	85478				CCDS8772.1	12q13.12	2014-07-18			ENSG00000139537	ENSG00000139537			29937	protein-coding gene	gene with protein product		611088				17089017, 21700706	Standard	NM_033124		Approved	NYD-SP28, FLJ35732, FAP250, CILD27	uc001rso.3	Q8IXS2		ENST00000320516.4:c.1444C>G	12.37:g.49315215C>G	ENSP00000312706:p.Pro482Ala	Somatic		Capture	Illumina GAIIx	Phase_I	47601482	A6NJG5|B2RBE2|Q8N7G4|Q8NA91|Q96JA0	Missense_Mutation	SNP	ENST00000320516.4	37	CCDS8772.1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.781909	0.31502	.	.	ENSG00000139537	ENST00000320516	T	0.30714	1.52	5.27	1.11	0.20524	.	0.336398	0.25958	N	0.027201	T	0.19327	0.0464	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.13710	-1.0499	9	.	.	.	.	3.458	0.07523	0.1228:0.4883:0.2403:0.1487	.	482	Q8IXS2	CCD65_HUMAN	A	482	ENSP00000312706:P482A	.	P	+	1	0	CCDC65	47601482	0.001000	0.12720	0.021000	0.16686	0.307000	0.27823	0.968000	0.29357	0.301000	0.22738	0.591000	0.81541	CCA		0.383	CCDC65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408922.1	NM_033124	
SRGAP1	57522	broad.mit.edu	37	12	64521913	64521913	+	Missense_Mutation	SNP	C	C	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr12:64521913C>G	ENST00000355086.3	+	21	3337	c.2813C>G	c.(2812-2814)tCc>tGc	p.S938C	SRGAP1_ENST00000543397.1_Missense_Mutation_p.S875C|SRGAP1_ENST00000357825.3_Missense_Mutation_p.S915C	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	938					axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.S938C(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		ATTAGAAGGTCCACGTCATCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											53.0	49.0	50.0					12																	64521913		2203	4300	6503	62808180	SO:0001583	missense	57522			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.2813C>G	12.37:g.64521913C>G	ENSP00000347198:p.Ser938Cys	Somatic		Capture	Illumina GAIIx	Phase_I	62808180	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	37	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.687618	0.88639	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.21361	3.01;2.6;2.01	5.65	5.65	0.86999	.	0.000000	0.34986	U	0.003527	T	0.43255	0.1239	L	0.58101	1.795	0.80722	D	1	D;D	0.67145	0.996;0.995	P;D	0.63703	0.885;0.917	T	0.03296	-1.1051	9	.	.	.	.	20.1057	0.97893	0.0:1.0:0.0:0.0	.	938;875	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	C	938;915;875	ENSP00000347198:S938C;ENSP00000350480:S915C;ENSP00000437948:S875C	.	S	+	2	0	SRGAP1	62808180	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	7.695000	0.84257	2.827000	0.97445	0.650000	0.86243	TCC		0.532	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
BTBD11	121551	broad.mit.edu	37	12	108012027	108012027	+	Missense_Mutation	SNP	C	C	T	rs371455377		TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr12:108012027C>T	ENST00000280758.5	+	10	2852	c.2324C>T	c.(2323-2325)gCg>gTg	p.A775V	BTBD11_ENST00000420571.2_Intron|BTBD11_ENST00000490090.2_Missense_Mutation_p.A775V|BTBD11_ENST00000357167.4_Missense_Mutation_p.A312V|RP11-128P10.1_ENST00000548473.1_RNA	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	775						integral component of membrane (GO:0016021)		p.A775V(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						ACTGACCTGGCGGAGACAGCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	12						C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	53.0	53.0	53.0		935,2324	4.9	1.0	12		53	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	BTBD11	NM_001017523.1,NM_001018072.1	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	312/642,775/1105	108012027	1,13005	2203	4300	6503	106536157	SO:0001583	missense	121551			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.2324C>T	12.37:g.108012027C>T	ENSP00000280758:p.Ala775Val	Somatic		Capture	Illumina GAIIx	Phase_I	106536157	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.614431	0.46631	0.0	1.16E-4	ENSG00000151136	ENST00000280758;ENST00000490090;ENST00000357167	T;T;T	0.41400	1.22;1.26;1.0	4.88	4.88	0.63580	.	0.286415	0.39146	N	0.001441	T	0.23210	0.0561	N	0.08118	0	0.80722	D	1	B;B;P	0.34662	0.178;0.152;0.462	B;B;B	0.24006	0.05;0.016;0.031	T	0.07635	-1.0762	10	0.28530	T	0.3	.	18.4067	0.90539	0.0:1.0:0.0:0.0	.	312;775;775	E9PHS4;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	V	775;775;312	ENSP00000280758:A775V;ENSP00000447319:A775V;ENSP00000349690:A312V	ENSP00000280758:A775V	A	+	2	0	BTBD11	106536157	0.614000	0.27017	0.994000	0.49952	0.944000	0.59088	1.034000	0.30204	2.406000	0.81754	0.563000	0.77884	GCG		0.612	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
COQ5	84274	broad.mit.edu	37	12	120941829	120941829	+	Nonsense_Mutation	SNP	C	C	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr12:120941829C>A	ENST00000288532.6	-	6	866	c.826G>T	c.(826-828)Gga>Tga	p.G276*	Y_RNA_ENST00000410669.1_RNA|COQ5_ENST00000445328.2_Nonsense_Mutation_p.G202*	NM_032314.3	NP_115690.3	Q5HYK3	COQ5_HUMAN	coenzyme Q5 homolog, methyltransferase (S. cerevisiae)	276					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	methyltransferase activity (GO:0008168)	p.G276*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(1)|prostate(1)|urinary_tract(3)	20	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTCCAGTCTCCAGCGATGACC	0.433																																																1	Substitution - Nonsense(1)	ovary(1)	12											117.0	121.0	120.0					12																	120941829		2203	4300	6503	119426212	SO:0001587	stop_gained	84274			AK057777	CCDS31912.1	12q24.31	2011-09-16	2006-04-04		ENSG00000110871	ENSG00000110871	2.1.1.201		28722	protein-coding gene	gene with protein product	"""2-methoxy-6-polyprenyl-1,4-benzoquinol methylase"""		"""coenzyme Q5 homolog, methyltransferase (yeast)"""				Standard	NM_032314		Approved	MGC4767	uc001tyn.3	Q5HYK3	OTTHUMG00000169375	ENST00000288532.6:c.826G>T	12.37:g.120941829C>A	ENSP00000288532:p.Gly276*	Somatic		Capture	Illumina GAIIx	Phase_I	119426212	B4DEJ4|Q32Q28|Q53HH0|Q96LV1|Q9BSP8	Nonsense_Mutation	SNP	ENST00000288532.6	37	CCDS31912.1	.	.	.	.	.	.	.	.	.	.	C	33	5.211872	0.95069	.	.	ENSG00000110871	ENST00000288532;ENST00000445328;ENST00000552443	.	.	.	5.77	4.89	0.63831	.	0.141691	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	14.8776	0.70507	0.0:0.9314:0.0:0.0686	.	.	.	.	X	276;202;195	.	ENSP00000288532:G276X	G	-	1	0	COQ5	119426212	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.941000	0.63540	1.456000	0.47831	0.650000	0.86243	GGA		0.433	COQ5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403767.2	NM_032314	
TMEM132B	114795	broad.mit.edu	37	12	126135286	126135286	+	Silent	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr12:126135286C>T	ENST00000299308.3	+	7	1694	c.1686C>T	c.(1684-1686)tcC>tcT	p.S562S	TMEM132B_ENST00000535886.1_Silent_p.S74S	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	562						integral component of membrane (GO:0016021)		p.S562S(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GAGGCTGCTCCCTGCAGTACC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	12											82.0	92.0	89.0					12																	126135286		2187	4291	6478	124701239	SO:0001819	synonymous_variant	114795			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1686C>T	12.37:g.126135286C>T		Somatic		Capture	Illumina GAIIx	Phase_I	124701239	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Silent	SNP	ENST00000299308.3	37	CCDS41859.1																																																																																				0.572	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
N4BP2L1	90634	broad.mit.edu	37	13	32978397	32978397	+	Intron	SNP	G	G	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr13:32978397G>A	ENST00000380133.2	-	4	524				N4BP2L1_ENST00000530622.2_Intron|N4BP2L1_ENST00000380130.2_Intron|N4BP2L1_ENST00000459716.1_Intron|N4BP2L1_ENST00000380139.4_Silent_p.T136T			Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1									p.T136T(1)		large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		TCTTTTGTTCGGTCTGAAATA	0.363																																																1	Substitution - coding silent(1)	ovary(1)	13											90.0	86.0	88.0					13																	32978397		2203	4300	6503	31876397	SO:0001627	intron_variant	90634			U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697	ENST00000380133.2:c.473+60C>T	13.37:g.32978397G>A		Somatic		Capture	Illumina GAIIx	Phase_I	31876397	A4QN21|Q5TBK0	Silent	SNP	ENST00000380133.2	37	CCDS9345.2																																																																																				0.363	N4BP2L1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044412.2	NM_052818	
FREM2	341640	broad.mit.edu	37	13	39453024	39453024	+	Silent	SNP	C	C	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr13:39453024C>A	ENST00000280481.7	+	23	9132	c.8916C>A	c.(8914-8916)gcC>gcA	p.A2972A		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2972					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A2972A(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TATTTAATGCCAAACTAGCAG	0.443																																																1	Substitution - coding silent(1)	ovary(1)	13											190.0	170.0	177.0					13																	39453024		2203	4300	6503	38351024	SO:0001819	synonymous_variant	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8916C>A	13.37:g.39453024C>A		Somatic		Capture	Illumina GAIIx	Phase_I	38351024	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																				0.443	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
RNASE9	390443	broad.mit.edu	37	14	21024769	21024769	+	Missense_Mutation	SNP	T	T	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr14:21024769T>G	ENST00000557068.1	-	4	2185	c.460A>C	c.(460-462)Aaa>Caa	p.K154Q	RNASE9_ENST00000404716.3_Missense_Mutation_p.K159Q|RNASE9_ENST00000556208.1_Missense_Mutation_p.K159Q|RNASE9_ENST00000555230.1_Missense_Mutation_p.K154Q|RNASE9_ENST00000553541.1_Missense_Mutation_p.K154Q|RNASE9_ENST00000553706.1_Missense_Mutation_p.K159Q|RNASE9_ENST00000429244.2_Missense_Mutation_p.K154Q|RNASE9_ENST00000338904.3_Missense_Mutation_p.K154Q|RNASE9_ENST00000557209.1_Missense_Mutation_p.K159Q|RNASE9_ENST00000554964.1_Missense_Mutation_p.K154Q			P60153	RNAS9_HUMAN	ribonuclease, RNase A family, 9 (non-active)	154						extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)	p.K154Q(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|ovary(2)|urinary_tract(1)	8	all_cancers(95;0.00238)		Epithelial(56;3.32e-06)|all cancers(55;2.46e-05)	GBM - Glioblastoma multiforme(265;0.0141)		GATTCGTATTTACACGCTGGT	0.363																																																1	Substitution - Missense(1)	ovary(1)	14											102.0	87.0	92.0					14																	21024769		2203	4300	6503	20094609	SO:0001583	missense	390443			AY665804	CCDS32036.1, CCDS53883.1, CCDS55904.1	14q11.2	2006-10-31				ENSG00000188655		"""Ribonucleases, RNase A"""	20673	protein-coding gene	gene with protein product		614014				15676279, 12920233	Standard	NM_001001673		Approved	h461	uc010ahu.3	P60153		ENST00000557068.1:c.460A>C	14.37:g.21024769T>G	ENSP00000451565:p.Lys154Gln	Somatic		Capture	Illumina GAIIx	Phase_I	20094609	A2RQR8|A8QJS1|Q5GAN7|Q6KG53	Missense_Mutation	SNP	ENST00000557068.1	37	CCDS32036.1	.	.	.	.	.	.	.	.	.	.	T	2.922	-0.222878	0.06061	.	.	ENSG00000188655	ENST00000338904;ENST00000554964;ENST00000555230;ENST00000557068;ENST00000404716;ENST00000556208;ENST00000553541;ENST00000429244;ENST00000553706;ENST00000557209	T;T;T;T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	3.73	-7.47	0.01365	Ribonuclease A, domain (3);	.	.	.	.	T	0.41858	0.1177	N	0.16478	0.41	0.09310	N	1	B;B	0.18968	0.022;0.032	B;B	0.13407	0.009;0.008	T	0.24799	-1.0150	9	0.17832	T	0.49	-11.2161	2.5869	0.04832	0.1171:0.1503:0.2324:0.5001	.	154;159	P60153;P60153-2	RNAS9_HUMAN;.	Q	154;154;154;154;159;159;154;154;159;159	ENSP00000340162:K154Q;ENSP00000450599:K154Q;ENSP00000450800:K154Q;ENSP00000451565:K154Q;ENSP00000384683:K159Q;ENSP00000451160:K159Q;ENSP00000451285:K154Q;ENSP00000409504:K154Q;ENSP00000450570:K159Q;ENSP00000450987:K159Q	ENSP00000340162:K154Q	K	-	1	0	RNASE9	20094609	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.887000	0.00173	-1.920000	0.01069	-1.286000	0.01371	AAA		0.363	RNASE9-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411094.1	NM_001001673	
SPG11	80208	broad.mit.edu	37	15	44921512	44921512	+	Missense_Mutation	SNP	T	T	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr15:44921512T>G	ENST00000261866.7	-	9	1826	c.1810A>C	c.(1810-1812)Aaa>Caa	p.K604Q	SPG11_ENST00000558319.1_Missense_Mutation_p.K604Q|SPG11_ENST00000559193.1_Missense_Mutation_p.K604Q|SPG11_ENST00000427534.2_Missense_Mutation_p.K604Q|SPG11_ENST00000535302.2_Missense_Mutation_p.K604Q	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	604					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.K604Q(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		GAAAAGTGTTTGCTTTGGGGT	0.368																																																1	Substitution - Missense(1)	ovary(1)	15											143.0	129.0	134.0					15																	44921512		2198	4298	6496	42708804	SO:0001583	missense	80208				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.1810A>C	15.37:g.44921512T>G	ENSP00000261866:p.Lys604Gln	Somatic		Capture	Illumina GAIIx	Phase_I	42708804	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	ENST00000261866.7	37	CCDS10112.1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.112252	0.56398	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.81078	-1.45;-1.2;-1.19	5.7	5.7	0.88788	.	0.127798	0.52532	D	0.000075	D	0.83041	0.5168	L	0.54323	1.7	0.50467	D	0.999873	B;B;D;B	0.63046	0.441;0.441;0.992;0.441	B;B;P;B	0.53593	0.213;0.213;0.73;0.198	T	0.82727	-0.0314	10	0.39692	T	0.17	.	14.1877	0.65617	0.0:0.0:0.0:1.0	.	604;604;604;604	C4B7M2;F5H3N6;B9EK60;Q96JI7	.;.;.;SPTCS_HUMAN	Q	604	ENSP00000261866:K604Q;ENSP00000445278:K604Q;ENSP00000396110:K604Q	ENSP00000261866:K604Q	K	-	1	0	SPG11	42708804	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.548000	0.60718	2.178000	0.69098	0.533000	0.62120	AAA		0.368	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
RORA	6095	broad.mit.edu	37	15	60919532	60919532	+	Intron	SNP	C	C	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr15:60919532C>A	ENST00000335670.6	-	2	297				RP11-219B17.1_ENST00000559824.1_RNA|RP11-219B17.1_ENST00000558235.1_RNA|RORA_ENST00000560004.1_Intron|RORA_ENST00000309157.4_Missense_Mutation_p.E14D|RORA_ENST00000261523.5_Missense_Mutation_p.E14D	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A						angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E14D(1)		endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						GCACTCTTGCCTCAGTCTCTA	0.552																																																1	Substitution - Missense(1)	ovary(1)	15											206.0	174.0	185.0					15																	60919532		2203	4300	6503	58706824	SO:0001627	intron_variant	6095			U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.196+51323G>T	15.37:g.60919532C>A		Somatic		Capture	Illumina GAIIx	Phase_I	58706824	P35397|P35399|P45445|Q495X4|Q96H83	Missense_Mutation	SNP	ENST00000335670.6	37	CCDS10177.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836090	0.32421	.	.	ENSG00000069667	ENST00000309157;ENST00000261523	D;D	0.94931	-3.56;-3.46	3.22	2.28	0.28536	.	.	.	.	.	D	0.85474	0.5705	N	0.08118	0	0.51767	D	0.999933	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.78602	-0.2140	9	0.39692	T	0.17	.	8.6176	0.33842	0.0:0.7658:0.2342:0.0	.	14;14	P35398-3;P35398	.;RORA_HUMAN	D	14	ENSP00000309753:E14D;ENSP00000261523:E14D	ENSP00000261523:E14D	E	-	3	2	RORA	58706824	0.879000	0.30193	0.719000	0.30619	0.037000	0.13140	1.162000	0.31786	0.902000	0.36520	0.655000	0.94253	GAG		0.552	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256142.2		
CDK10	8558	broad.mit.edu	37	16	89758909	89758909	+	Missense_Mutation	SNP	A	A	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr16:89758909A>G	ENST00000353379.7	+	6	513	c.470A>G	c.(469-471)aAc>aGc	p.N157S	CDK10_ENST00000505473.1_Missense_Mutation_p.N86S|CDK10_ENST00000331006.8_Missense_Mutation_p.N110S	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	157	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.N157S(1)		ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		CTGCACAGGAACTTCATTATC	0.567																																																1	Substitution - Missense(1)	ovary(1)	16											85.0	76.0	79.0					16																	89758909		2198	4300	6498	88286410	SO:0001583	missense	8558			L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.470A>G	16.37:g.89758909A>G	ENSP00000338673:p.Asn157Ser	Somatic		Capture	Illumina GAIIx	Phase_I	88286410	A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Missense_Mutation	SNP	ENST00000353379.7	37	CCDS10984.2	.	.	.	.	.	.	.	.	.	.	A	13.66	2.303790	0.40795	.	.	ENSG00000185324	ENST00000331006;ENST00000393082;ENST00000505473;ENST00000353379	T;T;T	0.66280	-0.2;-0.2;-0.2	4.51	3.38	0.38709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.237466	0.49916	N	0.000132	T	0.55561	0.1928	L	0.57536	1.79	0.43761	D	0.996272	B;B;B;B;B;B	0.25105	0.002;0.001;0.057;0.0;0.009;0.118	B;B;B;B;B;B	0.25987	0.035;0.014;0.057;0.014;0.015;0.065	T	0.54351	-0.8307	10	0.59425	D	0.04	-38.58	8.0779	0.30726	0.8278:0.0:0.1722:0.0	.	151;86;157;86;86;115	B7Z319;A8K370;Q15131;Q15131-3;Q15131-4;Q59EI2	.;.;CDK10_HUMAN;.;.;.	S	110;128;86;157	ENSP00000329957:N110S;ENSP00000424415:N86S;ENSP00000338673:N157S	ENSP00000329957:N110S	N	+	2	0	CDK10	88286410	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.799000	0.47892	0.717000	0.32145	0.402000	0.26972	AAC		0.567	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269925.2		
TP53	7157	broad.mit.edu	37	17	7578500	7578500	+	Nonsense_Mutation	SNP	G	G	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr17:7578500G>A	ENST00000269305.4	-	5	619	c.430C>T	c.(430-432)Cag>Tag	p.Q144*	TP53_ENST00000420246.2_Nonsense_Mutation_p.Q144*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q144*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q144*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q144*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q144*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	144	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).|Q -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q144*(36)|p.0?(8)|p.Q144fs*25(3)|p.Q144K(2)|p.Q12*(2)|p.Q144fs*26(2)|p.Q51*(2)|p.Q144_G154del11(1)|p.L137_W146del10(1)|p.Q51fs*25(1)|p.Q144del(1)|p.Q144fs*32(1)|p.Q144fs*16(1)|p.P142_Q144delPVQ(1)|p.Q144fs*4(1)|p.Q12fs*25(1)|p.V143_S149del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACCCACAGCTGCACAGGGCAG	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	65	Substitution - Nonsense(40)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(5)|Substitution - Missense(2)	lung(11)|upper_aerodigestive_tract(10)|oesophagus(8)|breast(8)|endometrium(6)|ovary(5)|bone(4)|large_intestine(3)|stomach(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|soft_tissue(1)|liver(1)|skin(1)|prostate(1)	17											57.0	56.0	57.0					17																	7578500		2203	4300	6503	7519225	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.430C>T	17.37:g.7578500G>A	ENSP00000269305:p.Gln144*	Somatic		Capture	Illumina GAIIx	Phase_I	7519225	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.071217	0.55646	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	.	.	.	5.48	5.48	0.80851	.	0.121732	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-30.9139	17.2272	0.86973	0.0:0.0:1.0:0.0	.	.	.	.	X	144;144;144;144;144;144;133;51;12;51;12;144	.	ENSP00000269305:Q144X	Q	-	1	0	TP53	7519225	1.000000	0.71417	0.908000	0.35775	0.017000	0.09413	7.953000	0.87836	2.733000	0.93635	0.655000	0.94253	CAG		0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KIAA1468	57614	broad.mit.edu	37	18	59894635	59894635	+	Silent	SNP	G	G	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr18:59894635G>T	ENST00000398130.2	+	6	1204	c.972G>T	c.(970-972)gtG>gtT	p.V324V	KIAA1468_ENST00000256858.6_Silent_p.V324V	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	324								p.V324V(1)		autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				TTGTAGATGTGGCCAGTGGAG	0.428																																																1	Substitution - coding silent(1)	ovary(1)	18											116.0	114.0	115.0					18																	59894635		1932	4144	6076	58045615	SO:0001819	synonymous_variant	57614			BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.972G>T	18.37:g.59894635G>T		Somatic		Capture	Illumina GAIIx	Phase_I	58045615		Silent	SNP	ENST00000398130.2	37	CCDS11979.2																																																																																				0.428	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854	
ZNF236	7776	broad.mit.edu	37	18	74563797	74563797	+	Missense_Mutation	SNP	A	A	C			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr18:74563797A>C	ENST00000253159.8	+	3	457	c.259A>C	c.(259-261)Acc>Ccc	p.T87P	ZNF236_ENST00000583095.1_3'UTR|ZNF236_ENST00000320610.9_Missense_Mutation_p.T89P	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	87					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T87P(1)		NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		TCATAAATGCACCCACAGCGG	0.443																																																1	Substitution - Missense(1)	ovary(1)	18											108.0	107.0	108.0					18																	74563797		1895	4115	6010	72692785	SO:0001583	missense	7776			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.259A>C	18.37:g.74563797A>C	ENSP00000253159:p.Thr87Pro	Somatic		Capture	Illumina GAIIx	Phase_I	72692785	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.245008	0.59103	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.32023	1.47;1.47	5.7	4.53	0.55603	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.65165	0.2665	H	0.95043	3.615	0.53005	D	0.999963	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.963	T	0.73642	-0.3918	10	0.59425	D	0.04	.	12.0816	0.53673	0.8709:0.0:0.0:0.1291	.	87;87	Q9NWI2;Q9UL36	.;ZN236_HUMAN	P	87	ENSP00000253159:T87P;ENSP00000444524:T87P	ENSP00000253159:T87P	T	+	1	0	ZNF236	72692785	1.000000	0.71417	0.988000	0.46212	0.382000	0.30200	8.989000	0.93506	0.963000	0.38082	-0.480000	0.04831	ACC		0.443	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
BST2	684	broad.mit.edu	37	19	17516280	17516280	+	Silent	SNP	C	C	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr19:17516280C>G	ENST00000252593.6	-	1	177	c.105G>C	c.(103-105)gtG>gtC	p.V35V	BST2_ENST00000527220.1_5'UTR|CTD-2521M24.9_ENST00000500836.2_lincRNA	NM_004335.2	NP_004326.1	Q10589	BST2_HUMAN	bone marrow stromal cell antigen 2	35					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of plasmacytoid dendritic cell cytokine production (GO:0002737)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of actin cytoskeleton organization (GO:0032956)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metalloendopeptidase inhibitor activity (GO:0008191)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.V35V(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(2)	9						CCCCCAGAATCACGATGATCA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	19											137.0	112.0	121.0					19																	17516280		2203	4300	6503	17377280	SO:0001819	synonymous_variant	684				CCDS12358.1	19p13.2	2009-10-30				ENSG00000130303		"""CD molecules"""	1119	protein-coding gene	gene with protein product		600534				7607676	Standard	NM_004335		Approved	CD317, tetherin	uc002ngl.3	Q10589		ENST00000252593.6:c.105G>C	19.37:g.17516280C>G		Somatic		Capture	Illumina GAIIx	Phase_I	17377280	A8K4Y4|Q53G07	Silent	SNP	ENST00000252593.6	37	CCDS12358.1																																																																																				0.547	BST2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387346.1	NM_004335	
NCCRP1	342897	broad.mit.edu	37	19	39689812	39689812	+	Missense_Mutation	SNP	G	G	C			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr19:39689812G>C	ENST00000339852.4	+	4	477	c.455G>C	c.(454-456)tGg>tCg	p.W152S		NM_001001414.1	NP_001001414.1	Q6ZVX7	FBX50_HUMAN	non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)	152	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.				positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.W152S(1)		kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	10						TTTCACAGCTGGACAGTGAAG	0.597																																					Melanoma(107;1207 1556 14956 29427 52130)											1	Substitution - Missense(1)	ovary(1)	19											73.0	66.0	68.0					19																	39689812		2203	4300	6503	44381652	SO:0001583	missense	342897			AK123941, BC067874	CCDS12529.1	19q13.2	2013-07-31	2008-11-19		ENSG00000188505	ENSG00000188505			33739	protein-coding gene	gene with protein product		615901					Standard	NM_001001414		Approved	LOC342897, NCCRP-1, FBXO50	uc002okq.1	Q6ZVX7		ENST00000339852.4:c.455G>C	19.37:g.39689812G>C	ENSP00000342137:p.Trp152Ser	Somatic		Capture	Illumina GAIIx	Phase_I	44381652	Q6NVV5	Missense_Mutation	SNP	ENST00000339852.4	37	CCDS12529.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916812	0.73098	.	.	ENSG00000188505	ENST00000339852	T	0.34472	1.36	5.25	5.25	0.73442	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.000000	0.85682	D	0.000000	T	0.59059	0.2166	M	0.68593	2.085	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.59878	-0.7371	10	0.52906	T	0.07	-20.501	16.3339	0.83052	0.0:0.0:1.0:0.0	.	152	Q6ZVX7	NCRP1_HUMAN	S	152	ENSP00000342137:W152S	ENSP00000342137:W152S	W	+	2	0	NCCRP1	44381652	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	5.325000	0.65869	2.458000	0.83093	0.491000	0.48974	TGG		0.597	NCCRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463829.1	NM_001001414	
CYP2A13	1553	broad.mit.edu	37	19	41594876	41594876	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr19:41594876C>T	ENST00000330436.3	+	2	223	c.223C>T	c.(223-225)Ccc>Tcc	p.P75S		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	75					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.P75S(1)		breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	TCACTTGGGGCCCCGGCGGGT	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											88.0	83.0	85.0					19																	41594876		2203	4300	6503	46286716	SO:0001583	missense	1553			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.223C>T	19.37:g.41594876C>T	ENSP00000332679:p.Pro75Ser	Somatic		Capture	Illumina GAIIx	Phase_I	46286716	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	37	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	2.903	-0.227046	0.06022	.	.	ENSG00000197838	ENST00000330436	T	0.67698	-0.28	3.49	-0.267	0.12938	.	0.880911	0.09886	U	0.743079	T	0.38558	0.1045	N	0.16790	0.44	0.09310	N	1	B	0.26258	0.145	B	0.27715	0.082	T	0.30060	-0.9991	10	0.02654	T	1	.	1.659	0.02787	0.1679:0.4741:0.1635:0.1945	.	75	Q16696	CP2AD_HUMAN	S	75	ENSP00000332679:P75S	ENSP00000332679:P75S	P	+	1	0	CYP2A13	46286716	0.000000	0.05858	0.050000	0.19076	0.202000	0.24057	-3.240000	0.00544	-0.040000	0.13580	-0.497000	0.04613	CCC		0.642	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
DPYSL5	56896	broad.mit.edu	37	2	27165477	27165477	+	Missense_Mutation	SNP	C	C	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr2:27165477C>G	ENST00000288699.6	+	11	1457	c.1299C>G	c.(1297-1299)caC>caG	p.H433Q	DPYSL5_ENST00000401478.1_Missense_Mutation_p.H433Q	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	433					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.H433Q(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCGCTGCCACGGCGTGCCAC	0.632											OREG0014510	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	2											55.0	49.0	51.0					2																	27165477		2203	4300	6503	27018981	SO:0001583	missense	56896			AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.1299C>G	2.37:g.27165477C>G	ENSP00000288699:p.His433Gln	Somatic	792	Capture	Illumina GAIIx	Phase_I	27018981	Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	ENST00000288699.6	37	CCDS1730.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.105744	0.77096	.	.	ENSG00000157851	ENST00000288699;ENST00000401478	D;D	0.84873	-1.91;-1.91	6.08	-4.04	0.04010	Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.85044	0.5607	M	0.68952	2.095	0.40768	D	0.983067	P	0.47034	0.889	P	0.46796	0.527	D	0.84516	0.0625	10	0.48119	T	0.1	-22.7308	19.3405	0.94339	0.0:0.892:0.0:0.108	.	433	Q9BPU6	DPYL5_HUMAN	Q	433	ENSP00000288699:H433Q;ENSP00000385549:H433Q	ENSP00000288699:H433Q	H	+	3	2	DPYSL5	27018981	0.001000	0.12720	0.953000	0.39169	0.965000	0.64279	-1.427000	0.02441	-0.671000	0.05274	-1.105000	0.02106	CAC		0.632	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134	
SPDYA	245711	broad.mit.edu	37	2	29039006	29039006	+	Missense_Mutation	SNP	T	T	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr2:29039006T>G	ENST00000334056.5	+	3	315	c.126T>G	c.(124-126)aaT>aaG	p.N42K	SPDYA_ENST00000379579.4_Missense_Mutation_p.N42K|SPDYA_ENST00000462832.1_3'UTR	NM_182756.3	NP_877433.2			speedy/RINGO cell cycle regulator family member A									p.N42K(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(172;0.155)					GTAAAGATAATTGGCAAGCAT	0.373																																																1	Substitution - Missense(1)	ovary(1)	2											112.0	111.0	111.0					2																	29039006		2203	4300	6503	28892510	SO:0001583	missense	245711			AA424209	CCDS1767.2	2p23	2013-05-08	2013-05-08	2006-03-31	ENSG00000163806	ENSG00000163806		"""Speedy homologs"""	30613	protein-coding gene	gene with protein product		614029	"""speedy homolog 1 (Drosophila)"", ""speedy homolog A (Xenopus laevis)"""	SPDY1		11980914, 12839962, 15611625	Standard	NM_182756		Approved	SPY1, Ringo3	uc002rmk.3	Q5MJ70	OTTHUMG00000074041	ENST00000334056.5:c.126T>G	2.37:g.29039006T>G	ENSP00000335628:p.Asn42Lys	Somatic		Capture	Illumina GAIIx	Phase_I	28892510		Missense_Mutation	SNP	ENST00000334056.5	37	CCDS1767.2	.	.	.	.	.	.	.	.	.	.	T	11.77	1.736850	0.30774	.	.	ENSG00000163806	ENST00000379579;ENST00000334056;ENST00000449210	.	.	.	4.89	2.51	0.30379	.	0.392314	0.21639	U	0.071364	T	0.23846	0.0577	N	0.19112	0.55	0.23893	N	0.996542	B;B	0.14012	0.002;0.009	B;B	0.15870	0.006;0.014	T	0.16394	-1.0404	9	0.19590	T	0.45	-34.7368	8.2118	0.31488	0.0:0.2299:0.0:0.77	.	42;42	Q5MJ70;Q5MJ70-1	SPDYA_HUMAN;.	K	42	.	ENSP00000335628:N42K	N	+	3	2	SPDYA	28892510	0.945000	0.32115	1.000000	0.80357	0.923000	0.55619	0.500000	0.22562	0.828000	0.34709	0.533000	0.62120	AAT		0.373	SPDYA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157171.1	NM_182756	
FAHD2A	51011	broad.mit.edu	37	2	96076301	96076301	+	Silent	SNP	C	C	T	rs373080650		TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr2:96076301C>T	ENST00000233379.4	+	4	642	c.489C>T	c.(487-489)gcC>gcT	p.A163A	FAHD2A_ENST00000447036.1_Silent_p.A163A	NM_016044.2	NP_057128.2	Q96GK7	FAH2A_HUMAN	fumarylacetoacetate hydrolase domain containing 2A	163							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.A163A(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	8						TGGAGCTGGCCGTGGTCATTG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	2						C		0,4406		0,0,2203	88.0	65.0	73.0		489	-2.6	0.8	2		73	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	FAHD2A	NM_016044.2		0,1,6500	TT,TC,CC		0.0116,0.0,0.0077		163/315	96076301	1,13001	2203	4298	6501	95440028	SO:0001819	synonymous_variant	51011			AF151863	CCDS2014.1	2q11.2	2008-02-05			ENSG00000115042	ENSG00000115042			24252	protein-coding gene	gene with protein product							Standard	NM_016044		Approved	CGI-105	uc002sur.3	Q96GK7	OTTHUMG00000130397	ENST00000233379.4:c.489C>T	2.37:g.96076301C>T		Somatic		Capture	Illumina GAIIx	Phase_I	95440028	Q9Y3B0	Silent	SNP	ENST00000233379.4	37	CCDS2014.1																																																																																				0.592	FAHD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252778.1	NM_016044	
LCT	3938	broad.mit.edu	37	2	136567188	136567188	+	Missense_Mutation	SNP	C	C	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr2:136567188C>A	ENST00000264162.2	-	8	2739	c.2729G>T	c.(2728-2730)gGc>gTc	p.G910V	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	910	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.G910V(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	AGAGGACACGCCCCACAGAAA	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											80.0	84.0	83.0					2																	136567188		2203	4300	6503	136283658	SO:0001583	missense	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2729G>T	2.37:g.136567188C>A	ENSP00000264162:p.Gly910Val	Somatic		Capture	Illumina GAIIx	Phase_I	136283658	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372726	0.82573	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	D	0.86562	-2.14	5.78	5.78	0.91487	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.042683	0.85682	D	0.000000	D	0.95928	0.8674	H	0.95745	3.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96589	0.9436	10	0.87932	D	0	-27.2599	20.0139	0.97470	0.0:1.0:0.0:0.0	.	910	P09848	LPH_HUMAN	V	910;342	ENSP00000264162:G910V	ENSP00000264162:G910V	G	-	2	0	LCT	136283658	1.000000	0.71417	0.994000	0.49952	0.875000	0.50365	6.068000	0.71201	2.724000	0.93272	0.563000	0.77884	GGC		0.532	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
ITGAV	3685	broad.mit.edu	37	2	187506195	187506195	+	Missense_Mutation	SNP	G	G	C			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr2:187506195G>C	ENST00000261023.3	+	12	1313	c.1039G>C	c.(1039-1041)Gtg>Ctg	p.V347L	AC017101.10_ENST00000453665.1_RNA|ITGAV_ENST00000433736.2_Missense_Mutation_p.V301L|ITGAV_ENST00000374907.3_Missense_Mutation_p.V311L	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	347					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)	p.V347L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	GCAGGTCTCAGTGTCTCTACA	0.483																																					Melanoma(58;108 1995 6081)											1	Substitution - Missense(1)	ovary(1)	2											171.0	168.0	169.0					2																	187506195		2203	4300	6503	187214440	SO:0001583	missense	3685				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1039G>C	2.37:g.187506195G>C	ENSP00000261023:p.Val347Leu	Somatic		Capture	Illumina GAIIx	Phase_I	187214440	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	ENST00000261023.3	37	CCDS2292.1	.	.	.	.	.	.	.	.	.	.	G	13.92	2.382078	0.42207	.	.	ENSG00000138448	ENST00000544640;ENST00000261023;ENST00000374907;ENST00000433736	T;T;T	0.23147	1.92;1.92;1.92	5.71	2.38	0.29361	.	0.465832	0.24537	N	0.037674	T	0.21347	0.0514	M	0.67397	2.05	0.32934	D	0.517461	B;B;B	0.14438	0.002;0.01;0.005	B;B;B	0.17722	0.003;0.019;0.003	T	0.20907	-1.0261	10	0.12103	T	0.63	.	5.6725	0.17731	0.1419:0.3931:0.465:0.0	.	301;311;347	E7EWZ6;P06756-2;P06756	.;.;ITAV_HUMAN	L	347;347;311;301	ENSP00000261023:V347L;ENSP00000364042:V311L;ENSP00000404291:V301L	ENSP00000261023:V347L	V	+	1	0	ITGAV	187214440	0.915000	0.31059	0.724000	0.30704	0.976000	0.68499	1.526000	0.35964	0.705000	0.31890	0.655000	0.94253	GTG		0.483	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
CDK5RAP1	51654	broad.mit.edu	37	20	31979987	31979987	+	Missense_Mutation	SNP	G	G	A	rs140768425		TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr20:31979987G>A	ENST00000357886.4	-	5	658	c.505C>T	c.(505-507)Cgg>Tgg	p.R169W	CDK5RAP1_ENST00000477105.1_5'UTR|CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.R169W|CDK5RAP1_ENST00000544843.1_Missense_Mutation_p.R169W|CDK5RAP1_ENST00000473997.1_Missense_Mutation_p.R79W|CDK5RAP1_ENST00000339269.5_Missense_Mutation_p.R169W			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	169	MTTase N-terminal.				brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)	p.R169W(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						GAGCGGGGCCGCCTTGTCTTC	0.453																																																1	Substitution - Missense(1)	ovary(1)	20						G	TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	83.0	86.0	85.0		235,505	4.2	0.9	20	dbSNP_134	85	0,8600		0,0,4300	no	missense,missense	CDK5RAP1	NM_016082.3,NM_016408.2	101,101	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging,probably-damaging	79/498,169/588	31979987	2,13004	2203	4300	6503	31443648	SO:0001583	missense	51654			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.505C>T	20.37:g.31979987G>A	ENSP00000350558:p.Arg169Trp	Somatic		Capture	Illumina GAIIx	Phase_I	31443648	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	ENST00000357886.4	37		.	.	.	.	.	.	.	.	.	.	G	24.8	4.568307	0.86439	4.54E-4	0.0	ENSG00000101391	ENST00000346416;ENST00000357886;ENST00000339269;ENST00000452723;ENST00000375351;ENST00000544843	.	.	.	5.19	4.22	0.49857	Methylthiotransferase, N-terminal (2);	0.110167	0.64402	D	0.000013	D	0.85613	0.5737	H	0.94306	3.52	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;P	0.91635	0.959;0.999;0.973;0.973;0.973;0.954;0.888	D	0.89051	0.3455	9	0.87932	D	0	-18.9715	12.6714	0.56870	0.0:0.0:0.8337:0.1663	.	169;169;169;169;169;169;79	Q675N4;Q96SZ6-4;Q96SZ6;Q675N5;Q53H36;Q96SZ6-3;Q96SZ6-2	.;.;CK5P1_HUMAN;.;.;.;.	W	169;169;169;79;59;169	.	ENSP00000341840:R169W	R	-	1	2	CDK5RAP1	31443648	1.000000	0.71417	0.918000	0.36340	0.978000	0.69477	4.913000	0.63341	1.379000	0.46325	0.591000	0.81541	CGG		0.453	CDK5RAP1-011	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078697.1	NM_016408	
LPIN3	64900	broad.mit.edu	37	20	39987135	39987135	+	Silent	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr20:39987135C>T	ENST00000373257.3	+	19	2455	c.2364C>T	c.(2362-2364)aaC>aaT	p.N788N	LPIN3_ENST00000491528.1_3'UTR	NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	788	C-LIP.				fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)	p.N788N(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				TCACAGTCAACCCCCGGGGAG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	20											78.0	84.0	82.0					20																	39987135		2203	4300	6503	39420549	SO:0001819	synonymous_variant	64900			AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.2364C>T	20.37:g.39987135C>T		Somatic		Capture	Illumina GAIIx	Phase_I	39420549	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Silent	SNP	ENST00000373257.3	37	CCDS33469.1																																																																																				0.607	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080393.1	NM_022896	
SLC2A10	81031	broad.mit.edu	37	20	45354908	45354908	+	Silent	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr20:45354908C>T	ENST00000359271.2	+	2	1483	c.1233C>T	c.(1231-1233)acC>acT	p.T411T		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	411					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)	p.T411T(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				TGCGCTGGACCGCACTGCTGT	0.632																																																1	Substitution - coding silent(1)	ovary(1)	20											40.0	38.0	39.0					20																	45354908		2203	4300	6503	44788315	SO:0001819	synonymous_variant	81031			AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.1233C>T	20.37:g.45354908C>T		Somatic		Capture	Illumina GAIIx	Phase_I	44788315	A8K4J6|Q3MIX5|Q9H4I6	Silent	SNP	ENST00000359271.2	37	CCDS13402.1																																																																																				0.632	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2		
KRTAP26-1	388818	broad.mit.edu	37	21	31691839	31691839	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr21:31691839C>T	ENST00000360542.3	-	1	768	c.515G>A	c.(514-516)cGt>cAt	p.R172H		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	172						intermediate filament (GO:0005882)		p.R172H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						ACTTTGAGGACGATAGGCCAA	0.562																																																1	Substitution - Missense(1)	ovary(1)	21											192.0	193.0	193.0					21																	31691839		2203	4300	6503	30613710	SO:0001583	missense	388818			AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.515G>A	21.37:g.31691839C>T	ENSP00000353742:p.Arg172His	Somatic		Capture	Illumina GAIIx	Phase_I	30613710	B0RZD3	Missense_Mutation	SNP	ENST00000360542.3	37	CCDS13588.1	.	.	.	.	.	.	.	.	.	.	C	13.91	2.379383	0.42207	.	.	ENSG00000197683	ENST00000360542	T	0.16897	2.31	5.06	2.27	0.28462	.	1.468220	0.04336	N	0.353191	T	0.12092	0.0294	L	0.27053	0.805	0.09310	N	1	P	0.47350	0.894	B	0.39068	0.289	T	0.22487	-1.0215	10	0.24483	T	0.36	1.0E-4	6.4572	0.21936	0.0:0.7061:0.0:0.2939	.	172	Q6PEX3	KR261_HUMAN	H	172	ENSP00000353742:R172H	ENSP00000353742:R172H	R	-	2	0	KRTAP26-1	30613710	0.000000	0.05858	0.020000	0.16555	0.006000	0.05464	0.114000	0.15520	0.782000	0.33613	0.650000	0.86243	CGT		0.562	KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128218.1	NM_203405	
CAMK1	8536	broad.mit.edu	37	3	9807658	9807658	+	Intron	SNP	G	G	C			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr3:9807658G>C	ENST00000256460.3	-	3	261				OGG1_ENST00000302036.7_Missense_Mutation_p.D372H|OGG1_ENST00000383826.5_3'UTR|OGG1_ENST00000449570.2_3'UTR|OGG1_ENST00000302008.8_3'UTR|OGG1_ENST00000349503.5_Missense_Mutation_p.D305H	NM_003656.4	NP_003647.1	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I						cell cycle (GO:0007049)|nucleocytoplasmic transport (GO:0006913)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of synapse structural plasticity (GO:0051835)|protein phosphorylation (GO:0006468)|regulation of muscle cell differentiation (GO:0051147)|regulation of protein binding (GO:0043393)|regulation of protein localization (GO:0032880)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	12	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		TGGGTTCTGTGACCACTGCTG	0.592																																																0			3											69.0	58.0	61.0					3																	9807658		2203	4300	6503	9782658	SO:0001627	intron_variant	4968			L41816	CCDS2582.1	3p25.3	2004-02-27			ENSG00000134072	ENSG00000134072			1459	protein-coding gene	gene with protein product		604998				7641687	Standard	NM_003656		Approved	CaMKI	uc003bst.3	Q14012	OTTHUMG00000128419	ENST00000256460.3:c.84-84C>G	3.37:g.9807658G>C		Somatic		Capture	Illumina GAIIx	Phase_I	9782658	Q3KPF6	Missense_Mutation	SNP	ENST00000256460.3	37	CCDS2582.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.968|7.968	0.748550|0.748550	0.15710|0.15710	.|.	.|.	ENSG00000114026|ENSG00000114026	ENST00000302036;ENST00000349503|ENST00000352937	T;T|.	0.64803|.	-0.12;0.86|.	2.71|2.71	0.81|0.81	0.18732|0.18732	.|.	2.075800|.	0.02615|.	N|.	0.102547|.	T|.	0.15089|.	0.0364|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999999|0.999999	B;B|.	0.26258|.	0.145;0.073|.	B;B|.	0.32928|.	0.155;0.027|.	T|.	0.25606|.	-1.0127|.	10|.	0.66056|.	D|.	0.02|.	.|.	3.9446|3.9446	0.09343|0.09343	0.1453:0.2486:0.6062:0.0|0.1453:0.2486:0.6062:0.0	.|.	305;372|.	E5KPM6;E5KPM5|.	.;.|.	H|S	372;305|210	ENSP00000306561:D372H;ENSP00000303132:D305H|.	ENSP00000306561:D372H|.	D|X	+|+	1|2	0|2	OGG1|OGG1	9782658|9782658	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.007000|0.007000	0.05969|0.05969	0.074000|0.074000	0.14662|0.14662	0.201000|0.201000	0.20466|0.20466	-0.252000|-0.252000	0.11476|0.11476	GAC|TGA		0.592	CAMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250206.1	NM_003656	
DOCK3	1795	broad.mit.edu	37	3	51127673	51127673	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr3:51127673C>T	ENST00000266037.9	+	9	627	c.604C>T	c.(604-606)Cgc>Tgc	p.R202C		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	202					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R202C(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		AGATACAATGCGCCCACGTCA	0.368																																																1	Substitution - Missense(1)	ovary(1)	3											59.0	54.0	55.0					3																	51127673		1881	4108	5989	51102713	SO:0001583	missense	1795			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.604C>T	3.37:g.51127673C>T	ENSP00000266037:p.Arg202Cys	Somatic		Capture	Illumina GAIIx	Phase_I	51102713	O15017	Missense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963198	0.74016	.	.	ENSG00000088538	ENST00000266037	T	0.05855	3.38	5.5	5.5	0.81552	.	0.049292	0.85682	D	0.000000	T	0.29882	0.0747	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01146	-1.1437	10	0.66056	D	0.02	.	19.7537	0.96281	0.0:1.0:0.0:0.0	.	202	Q8IZD9	DOCK3_HUMAN	C	202	ENSP00000266037:R202C	ENSP00000266037:R202C	R	+	1	0	DOCK3	51102713	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.816000	0.48026	2.736000	0.93811	0.591000	0.81541	CGC		0.368	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
PTPRG	5793	broad.mit.edu	37	3	62189104	62189104	+	Missense_Mutation	SNP	C	C	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr3:62189104C>G	ENST00000474889.1	+	12	2012	c.1635C>G	c.(1633-1635)agC>agG	p.S545R	PTPRG_ENST00000295874.10_Missense_Mutation_p.S545R	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	545					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.S545R(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CCTCAGCCAGCAAGCAGGCGG	0.692																																																1	Substitution - Missense(1)	ovary(1)	3											16.0	14.0	15.0					3																	62189104		2203	4294	6497	62164144	SO:0001583	missense	5793			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.1635C>G	3.37:g.62189104C>G	ENSP00000418112:p.Ser545Arg	Somatic		Capture	Illumina GAIIx	Phase_I	62164144	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.356945	0.24598	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.52295	0.71;0.67	4.39	3.5	0.40072	.	0.343749	0.32719	N	0.005731	T	0.41351	0.1155	L	0.54323	1.7	0.32360	N	0.557336	B;B	0.30973	0.302;0.201	B;B	0.32465	0.146;0.034	T	0.56498	-0.7969	10	0.62326	D	0.03	.	8.3822	0.32479	0.0:0.8195:0.0:0.1805	.	545;545	P23470-2;P23470	.;PTPRG_HUMAN	R	545	ENSP00000418112:S545R;ENSP00000295874:S545R	ENSP00000295874:S545R	S	+	3	2	PTPRG	62164144	1.000000	0.71417	0.997000	0.53966	0.356000	0.29392	2.760000	0.47581	2.162000	0.67917	0.591000	0.81541	AGC		0.692	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
UBA3	9039	broad.mit.edu	37	3	69111278	69111278	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr3:69111278C>T	ENST00000361055.4	-	10	800	c.746G>A	c.(745-747)tGt>tAt	p.C249Y	UBA3_ENST00000349511.4_Missense_Mutation_p.C235Y|UBA3_ENST00000540295.1_Missense_Mutation_p.C72Y|UBA3_ENST00000415609.2_Missense_Mutation_p.C208Y	NM_003968.3	NP_003959.3	Q8TBC4	UBA3_HUMAN	ubiquitin-like modifier activating enzyme 3	249					cellular protein modification process (GO:0006464)|endomitotic cell cycle (GO:0007113)|protein neddylation (GO:0045116)|proteolysis (GO:0006508)|regulation of cell cycle (GO:0051726)	cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|NEDD8 activating enzyme activity (GO:0019781)|protein heterodimerization activity (GO:0046982)	p.C249Y(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.98e-05)|Epithelial(33;0.000363)|LUSC - Lung squamous cell carcinoma(21;0.012)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.206)|Kidney(39;0.241)		ATACTCAATACAGTGTTCTGG	0.338																																																1	Substitution - Missense(1)	ovary(1)	3											120.0	121.0	120.0					3																	69111278		2203	4300	6503	69193968	SO:0001583	missense	9039			AB012190	CCDS2909.1, CCDS2910.1	3p14.1	2013-09-26	2007-11-30	2007-11-30	ENSG00000144744	ENSG00000144744		"""Ubiquitin-like modifier activating enzymes"""	12470	protein-coding gene	gene with protein product	"""NEDD8-activating enzyme E1 catalytic subunit"", ""NEDD8-activating enzyme E1 subunit 2"""	603172	"""ubiquitin-activating enzyme E1C (homologous to yeast UBA3)"", ""ubiquitin-activating enzyme E1C (UBA3 homolog, yeast)"""	UBE1C		9694792	Standard	NM_003968		Approved	hUba3, NAE2	uc003dno.3	Q8TBC4	OTTHUMG00000154325	ENST00000361055.4:c.746G>A	3.37:g.69111278C>T	ENSP00000354340:p.Cys249Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	69193968	A6NLB5|A8K027|O76088|Q9NTU3	Missense_Mutation	SNP	ENST00000361055.4	37	CCDS2909.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.853572	0.91355	.	.	ENSG00000144744	ENST00000415609;ENST00000361055;ENST00000349511;ENST00000540295	T;T;T;T	0.33865	1.39;1.39;1.39;1.39	5.74	5.74	0.90152	Ubiquitin activating enzyme, alpha domain (1);Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-activating enzyme (1);	0.000000	0.85682	D	0.000000	T	0.76579	0.4007	H	0.98111	4.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85312	0.1079	10	0.87932	D	0	-7.925	19.9254	0.97100	0.0:1.0:0.0:0.0	.	235;249	Q8TBC4-2;Q8TBC4	.;UBA3_HUMAN	Y	208;249;235;72	ENSP00000400294:C208Y;ENSP00000354340:C249Y;ENSP00000340041:C235Y;ENSP00000440085:C72Y	ENSP00000340041:C235Y	C	-	2	0	UBA3	69193968	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.769000	0.85360	2.701000	0.92244	0.655000	0.94253	TGT		0.338	UBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334839.1	NM_198195	
ZBTB38	253461	broad.mit.edu	37	3	141163991	141163991	+	Missense_Mutation	SNP	A	A	G			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr3:141163991A>G	ENST00000514251.1	+	4	3040	c.2761A>G	c.(2761-2763)Aac>Gac	p.N921D	ZBTB38_ENST00000321464.5_Missense_Mutation_p.N922D|ZBTB38_ENST00000441582.2_Missense_Mutation_p.N921D					zinc finger and BTB domain containing 38									p.N921D(1)		breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						CCCTTACTACAACTACAAACC	0.478																																																1	Substitution - Missense(1)	ovary(1)	3											45.0	47.0	46.0					3																	141163991		1930	4130	6060	142646681	SO:0001583	missense	253461			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.2761A>G	3.37:g.141163991A>G	ENSP00000426387:p.Asn921Asp	Somatic		Capture	Illumina GAIIx	Phase_I	142646681		Missense_Mutation	SNP	ENST00000514251.1	37	CCDS43157.1	.	.	.	.	.	.	.	.	.	.	A	18.93	3.727692	0.69074	.	.	ENSG00000177311	ENST00000514251;ENST00000441582;ENST00000321464	T;T;T	0.09255	3.0;3.0;3.0	5.28	5.28	0.74379	.	0.135862	0.49305	D	0.000147	T	0.29620	0.0739	M	0.65975	2.015	0.38727	D	0.953578	D;D	0.76494	0.999;0.999	D;D	0.65987	0.94;0.94	T	0.05146	-1.0903	9	.	.	.	-38.5744	15.2009	0.73136	1.0:0.0:0.0:0.0	.	922;921	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	D	921;921;922	ENSP00000426387:N921D;ENSP00000406955:N921D;ENSP00000372635:N922D	.	N	+	1	0	ZBTB38	142646681	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.256000	0.65468	1.997000	0.58415	0.528000	0.53228	AAC		0.478	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2		
EIF2A	83939	broad.mit.edu	37	3	150289799	150289799	+	Missense_Mutation	SNP	G	G	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr3:150289799G>T	ENST00000460851.1	+	10	975	c.866G>T	c.(865-867)tGt>tTt	p.C289F	EIF2A_ENST00000273435.5_Missense_Mutation_p.C284F|EIF2A_ENST00000383043.3_Missense_Mutation_p.C75F|SERP1_ENST00000479209.1_Intron|EIF2A_ENST00000406576.3_Missense_Mutation_p.C228F|SERP1_ENST00000490945.1_Intron|EIF2A_ENST00000487799.1_Missense_Mutation_p.C264F			Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A, 65kDa	289					positive regulation of signal transduction (GO:0009967)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|ribosome assembly (GO:0042255)|SREBP signaling pathway (GO:0032933)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 2 complex (GO:0005850)|extracellular space (GO:0005615)	ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)|tRNA binding (GO:0000049)	p.C264F(1)		cervix(1)|endometrium(2)|kidney(1)|lung(3)	7		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ACTGAGTTTTGTGCTGTATAT	0.348																																																1	Substitution - Missense(1)	ovary(1)	3											82.0	77.0	79.0					3																	150289799		1838	4091	5929	151772489	SO:0001583	missense	83939			AF212241	CCDS46935.1	3q25.1	2011-01-19	2006-01-24		ENSG00000144895	ENSG00000144895			3254	protein-coding gene	gene with protein product		609234				12133843, 1620067	Standard	NM_032025		Approved	EIF-2A	uc003eya.3	Q9BY44	OTTHUMG00000159775	ENST00000460851.1:c.866G>T	3.37:g.150289799G>T	ENSP00000417229:p.Cys289Phe	Somatic		Capture	Illumina GAIIx	Phase_I	151772489	A8MPS6|B4DF96|B4DQ14|D3DNI9|Q5QTR2|Q7Z4E9|Q8NFM1|Q96EW9|Q96K81	Missense_Mutation	SNP	ENST00000460851.1	37	CCDS46935.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.6|23.6	4.436774|4.436774	0.83885|0.83885	.|.	.|.	ENSG00000144895|ENSG00000144895	ENST00000487799;ENST00000460851;ENST00000406576;ENST00000273435;ENST00000383043|ENST00000465535	T;T;T;T;T|.	0.42900|.	1.52;1.67;1.49;3.52;0.96|.	5.98|5.98	5.98|5.98	0.97165|0.97165	WD40/YVTN repeat-like-containing domain (1);Translation initiation factor 2A, beta propellor-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83008|0.83008	0.5161|0.5161	M|M	0.82630|0.82630	2.6|2.6	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.984;0.965|.	D;D;D|.	0.87578|.	0.998;0.958;0.943|.	T|T	0.82627|0.82627	-0.0364|-0.0364	10|5	0.72032|.	D|.	0.01|.	-21.1703|-21.1703	20.4434|20.4434	0.99119|0.99119	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	228;264;289|.	B4DF96;B4DQ14;Q9BY44|.	.;.;EIF2A_HUMAN|.	F|L	264;289;228;284;75|63	ENSP00000420537:C264F;ENSP00000417229:C289F;ENSP00000385292:C228F;ENSP00000273435:C284F;ENSP00000372513:C75F|.	ENSP00000273435:C284F|.	C|V	+|+	2|1	0|0	EIF2A|EIF2A	151772489|151772489	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	9.415000|9.415000	0.97375|0.97375	2.838000|2.838000	0.97847|0.97847	0.655000|0.655000	0.94253|0.94253	TGT|GTG		0.348	EIF2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357259.2	NM_032025	
DNAH5	1767	broad.mit.edu	37	5	13770874	13770874	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr5:13770874G>A	ENST00000265104.4	-	56	9693	c.9589C>T	c.(9589-9591)Cgg>Tgg	p.R3197W	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3197	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3197W(2)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCCAGGGTCCGCACCTCCACA	0.458									Kartagener syndrome																																							2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	5											87.0	81.0	83.0					5																	13770874		2203	4300	6503	13823874	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9589C>T	5.37:g.13770874G>A	ENSP00000265104:p.Arg3197Trp	Somatic		Capture	Illumina GAIIx	Phase_I	13823874	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.139623	0.56936	.	.	ENSG00000039139	ENST00000265104	T	0.24151	1.87	5.81	5.81	0.92471	.	0.292466	0.38605	N	0.001629	T	0.29256	0.0728	L	0.41492	1.28	0.25247	N	0.989708	P	0.40619	0.724	B	0.40741	0.339	T	0.14868	-1.0457	10	0.66056	D	0.02	.	20.0804	0.97772	0.0:0.0:1.0:0.0	.	3197	Q8TE73	DYH5_HUMAN	W	3197	ENSP00000265104:R3197W	ENSP00000265104:R3197W	R	-	1	2	DNAH5	13823874	1.000000	0.71417	0.998000	0.56505	0.682000	0.39822	5.598000	0.67585	2.738000	0.93877	0.655000	0.94253	CGG		0.458	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
MSH3	4437	broad.mit.edu	37	5	79968144	79968144	+	Missense_Mutation	SNP	G	G	C			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr5:79968144G>C	ENST00000265081.6	+	5	954	c.874G>C	c.(874-876)Gtt>Ctt	p.V292L		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	292	Interaction with EXO1.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)	p.V283L(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CAGACTGTTTGTTCATGTACG	0.413								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)											1	Substitution - Missense(1)	ovary(1)	5											106.0	102.0	103.0					5																	79968144		2203	4300	6503	80003900	SO:0001583	missense	4437			U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.874G>C	5.37:g.79968144G>C	ENSP00000265081:p.Val292Leu	Somatic		Capture	Illumina GAIIx	Phase_I	80003900	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.251903	0.80135	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	D	0.89050	-2.46	5.69	5.69	0.88448	DNA mismatch repair protein MutS, N-terminal (2);DNA mismatch repair protein MutS-like, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93933	0.8058	M	0.66378	2.025	0.47819	D	0.999525	D	0.89917	1.0	D	0.87578	0.998	D	0.92881	0.6323	9	.	.	.	-21.6311	19.4293	0.94758	0.0:0.0:1.0:0.0	.	292	P20585	MSH3_HUMAN	L	292;283	ENSP00000265081:V292L	.	V	+	1	0	MSH3	80003900	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	7.526000	0.81920	2.697000	0.92050	0.650000	0.86243	GTT		0.413	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
FBN2	2201	broad.mit.edu	37	5	127624902	127624902	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr5:127624902C>T	ENST00000508053.1	-	58	7528	c.6554G>A	c.(6553-6555)gGt>gAt	p.G2185D	FBN2_ENST00000262464.4_Missense_Mutation_p.G2185D			P35556	FBN2_HUMAN	fibrillin 2	2185	EGF-like 36; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.G2185D(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GATACATTGACCATTTGAACA	0.458																																																1	Substitution - Missense(1)	ovary(1)	5											164.0	154.0	157.0					5																	127624902		2203	4300	6503	127652801	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.6554G>A	5.37:g.127624902C>T	ENSP00000424571:p.Gly2185Asp	Somatic		Capture	Illumina GAIIx	Phase_I	127652801	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.863924	0.91511	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.92299	-3.01;-3.01	5.76	4.84	0.62591	Matrix fibril-associated (1);EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.093273	0.46758	D	0.000265	D	0.96534	0.8869	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.96817	0.9601	10	0.87932	D	0	.	16.7681	0.85528	0.1292:0.8708:0.0:0.0	.	2185	P35556	FBN2_HUMAN	D	2185	ENSP00000262464:G2185D;ENSP00000424571:G2185D	ENSP00000262464:G2185D	G	-	2	0	FBN2	127652801	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	5.735000	0.68587	2.882000	0.98803	0.655000	0.94253	GGT		0.458	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
GPX6	257202	broad.mit.edu	37	6	28483444	28483444	+	Missense_Mutation	SNP	T	T	G	rs199611213		TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr6:28483444T>G	ENST00000474923.1	-	1	120	c.77A>C	c.(76-78)cAa>cCa	p.Q26P	GPX6_ENST00000483058.1_Intron|GPX6_ENST00000361902.1_Missense_Mutation_p.Q26P			P59796	GPX6_HUMAN	glutathione peroxidase 6 (olfactory)	26					response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)	p.Q26P(1)		NS(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Glutathione(DB00143)	CTTCCTATTTTGAGGCTTTAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	6						T	PRO/GLN	0,3948		0,0,1974	80.0	88.0	85.0		77	2.1	0.0	6		85	2,8300		0,2,4149	yes	missense	GPX6	NM_182701.1	76	0,2,6123	GG,GT,TT		0.0241,0.0,0.0163	benign	26/222	28483444	2,12248	1974	4151	6125	28591423	SO:0001583	missense	257202				CCDS43432.1	6p22.1	2012-03-01			ENSG00000198704	ENSG00000198704	1.11.1.9		4558	protein-coding gene	gene with protein product		607913	"""glutathione peroxidase pseudogene 3"""	GPXP3			Standard	NM_182701		Approved		uc021yrx.1	P59796	OTTHUMG00000044828	ENST00000474923.1:c.77A>C	6.37:g.28483444T>G	ENSP00000417364:p.Gln26Pro	Somatic		Capture	Illumina GAIIx	Phase_I	28591423	Q4PJ17	Missense_Mutation	SNP	ENST00000474923.1	37		.	.	.	.	.	.	.	.	.	.	T	9.218	1.032585	0.19590	0.0	2.41E-4	ENSG00000198704	ENST00000361902;ENST00000474923	T;T	0.10860	4.16;2.83	3.31	2.12	0.27331	.	1.218500	0.06108	N	0.666733	T	0.04048	0.0113	L	0.43152	1.355	0.09310	N	1	B	0.28208	0.203	B	0.33339	0.162	T	0.46512	-0.9186	10	0.38643	T	0.18	.	6.6537	0.22977	0.0:0.0:0.2446:0.7554	.	26	P59796	GPX6_HUMAN	P	26	ENSP00000354581:Q26P;ENSP00000417364:Q26P	ENSP00000354581:Q26P	Q	-	2	0	GPX6	28591423	0.003000	0.15002	0.001000	0.08648	0.003000	0.03518	1.416000	0.34759	0.617000	0.30160	0.533000	0.62120	CAA		0.532	GPX6-002	PUTATIVE	basic|exp_conf|seleno	protein_coding	protein_coding	OTTHUMT00000356246.5		
MSH5	4439	broad.mit.edu	37	6	31727879	31727879	+	Missense_Mutation	SNP	G	G	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr6:31727879G>T	ENST00000375755.3	+	19	1984	c.1698G>T	c.(1696-1698)atG>atT	p.M566I	MSH5_ENST00000375703.3_Missense_Mutation_p.M566I|MSH5_ENST00000431848.2_Missense_Mutation_p.M265I|MSH5_ENST00000534153.4_Missense_Mutation_p.M583I|MSH5_ENST00000375750.3_Missense_Mutation_p.M566I|MSH5_ENST00000375742.3_Missense_Mutation_p.M583I|MSH5-SAPCD1_ENST00000493662.2_Missense_Mutation_p.M583I|MSH5_ENST00000375740.3_Missense_Mutation_p.M583I|MSH5_ENST00000395853.1_Missense_Mutation_p.M240I|SAPCD1_ENST00000415669.2_5'Flank|SAPCD1_ENST00000425424.1_5'Flank	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	566					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.M583I(1)		breast(1)|ovary(2)|skin(2)	5						ATCCTCTGATGGAACTCTGTG	0.547								Direct reversal of damage;Mismatch excision repair (MMR)																																								1	Substitution - Missense(1)	ovary(1)	6											110.0	113.0	112.0					6																	31727879		2203	4300	6503	31835858	SO:0001583	missense	4439			AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.1698G>T	6.37:g.31727879G>T	ENSP00000364908:p.Met566Ile	Somatic		Capture	Illumina GAIIx	Phase_I	31835858	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Missense_Mutation	SNP	ENST00000375755.3	37	CCDS4720.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.720070	0.48728	.	.	ENSG00000204410	ENST00000375755;ENST00000375742;ENST00000383401;ENST00000375750;ENST00000534153;ENST00000375703;ENST00000375740;ENST00000431848;ENST00000395853	D;D;D;D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74	6.06	6.06	0.98353	DNA mismatch repair protein MutS, core (1);DNA mismatch repair protein MutS, C-terminal (1);	0.042347	0.85682	D	0.000000	T	0.49287	0.1548	N	0.02985	-0.445	0.34244	D	0.678015	B;B;B;B;B	0.21688	0.059;0.027;0.034;0.0;0.046	B;B;B;B;B	0.23716	0.048;0.029;0.048;0.001;0.029	T	0.55366	-0.8152	9	0.07990	T	0.79	-19.4076	18.1147	0.89549	0.0:0.0:1.0:0.0	.	251;583;566;566;583	Q59EC5;O43196-4;O43196;O43196-2;O43196-3	.;.;MSH5_HUMAN;.;.	I	566;583;98;566;583;566;583;265;240	ENSP00000364908:M566I;ENSP00000364894:M583I;ENSP00000364903:M566I;ENSP00000431693:M583I;ENSP00000364855:M566I;ENSP00000364892:M583I;ENSP00000416784:M265I;ENSP00000379194:M240I	ENSP00000364855:M566I	M	+	3	0	MSH5	31835858	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.584000	0.74057	2.882000	0.98803	0.655000	0.94253	ATG		0.547	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076243.4		
PRPH2	5961	broad.mit.edu	37	6	42689522	42689522	+	Missense_Mutation	SNP	T	T	C	rs62645926		TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr6:42689522T>C	ENST00000230381.5	-	1	790	c.551A>G	c.(550-552)tAc>tGc	p.Y184C		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	184			Y -> S (in cone-rod dystrophy).		cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.Y184C(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			AAAGTCCAGGTAGCGATTGCT	0.498																																																1	Substitution - Missense(1)	ovary(1)	6	GRCh37	CM961239	PRPH2	M							151.0	145.0	147.0					6																	42689522		2203	4300	6503	42797500	SO:0001583	missense	5961				CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.551A>G	6.37:g.42689522T>C	ENSP00000230381:p.Tyr184Cys	Somatic		Capture	Illumina GAIIx	Phase_I	42797500	Q5TFH5|Q6DK65	Missense_Mutation	SNP	ENST00000230381.5	37	CCDS4871.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.306547	0.81247	.	.	ENSG00000112619	ENST00000230381	T	0.79940	-1.32	5.63	5.63	0.86233	Tetraspanin, EC2 domain (1);	0.000000	0.85682	D	0.000000	D	0.89976	0.6871	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91923	0.5549	10	0.87932	D	0	.	16.1339	0.81465	0.0:0.0:0.0:1.0	.	184	P23942	PRPH2_HUMAN	C	184	ENSP00000230381:Y184C	ENSP00000230381:Y184C	Y	-	2	0	PRPH2	42797500	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.927000	0.87577	2.271000	0.75665	0.533000	0.62120	TAC		0.498	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040556.1	NM_000322	
TIAM2	26230	broad.mit.edu	37	6	155566795	155566795	+	Silent	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr6:155566795C>T	ENST00000461783.3	+	21	4855	c.3582C>T	c.(3580-3582)taC>taT	p.Y1194Y	TIAM2_ENST00000318981.5_Silent_p.Y1194Y|TIAM2_ENST00000529824.2_Silent_p.Y1194Y|TIAM2_ENST00000360366.4_Silent_p.Y1218Y|TIAM2_ENST00000528391.2_Silent_p.Y530Y|TIAM2_ENST00000367174.2_Silent_p.Y570Y|TIAM2_ENST00000275246.7_Silent_p.Y119Y|TIAM2_ENST00000456144.1_Silent_p.Y1194Y|TIAM2_ENST00000456877.2_Silent_p.Y506Y			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1194	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Y1194Y(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TCCTTTATTACGCGGACCACT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	6											241.0	254.0	250.0					6																	155566795		2203	4300	6503	155608487	SO:0001819	synonymous_variant	26230				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.3582C>T	6.37:g.155566795C>T		Somatic		Capture	Illumina GAIIx	Phase_I	155608487	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Silent	SNP	ENST00000461783.3	37	CCDS34558.1																																																																																				0.413	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
POLD2	5425	broad.mit.edu	37	7	44161501	44161501	+	Missense_Mutation	SNP	G	G	C			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr7:44161501G>C	ENST00000406581.2	-	3	801	c.152C>G	c.(151-153)gCc>gGc	p.A51G	POLD2_ENST00000452185.1_Missense_Mutation_p.A51G|POLD2_ENST00000481763.1_5'Flank|POLD2_ENST00000223361.3_Missense_Mutation_p.A51G	NM_001256879.1	NP_001243808.1	P49005	DPOD2_HUMAN	polymerase (DNA directed), delta 2, accessory subunit	51					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)	p.A51G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	12						ATAAATGTGGGCATACTGCCG	0.587																																																1	Substitution - Missense(1)	ovary(1)	7											85.0	73.0	77.0					7																	44161501		2203	4300	6503	44128026	SO:0001583	missense	5425				CCDS5477.1, CCDS75586.1	7p13	2012-05-18	2012-05-18		ENSG00000106628	ENSG00000106628		"""DNA polymerases"""	9176	protein-coding gene	gene with protein product	"""Pol delta B subunit (p50)"", ""DNA polymerase delta subunit p50"""	600815	"""polymerase (DNA directed), delta 2, regulatory subunit (50kD)"", ""polymerase (DNA directed), delta 2, regulatory subunit 50kDa"""			8530069	Standard	NM_001127218		Approved		uc003tkf.5	P49005	OTTHUMG00000022909	ENST00000406581.2:c.152C>G	7.37:g.44161501G>C	ENSP00000386105:p.Ala51Gly	Somatic		Capture	Illumina GAIIx	Phase_I	44128026	A4D2J4|B2R5S4	Missense_Mutation	SNP	ENST00000406581.2	37	CCDS5477.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.011139	0.93346	.	.	ENSG00000106628	ENST00000406581;ENST00000223361;ENST00000452185;ENST00000436844;ENST00000433715;ENST00000456038;ENST00000418438	T;T;T;T	0.53857	0.81;0.79;0.81;0.6	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.62672	0.2447	L	0.51914	1.62	0.80722	D	1	D;D	0.63046	0.963;0.992	P;P	0.57425	0.491;0.82	T	0.57682	-0.7769	10	0.26408	T	0.33	-18.229	18.4041	0.90528	0.0:0.0:1.0:0.0	.	51;51	P49005;F8W8R3	DPOD2_HUMAN;.	G	51	ENSP00000386105:A51G;ENSP00000223361:A51G;ENSP00000395231:A51G;ENSP00000416203:A51G	ENSP00000223361:A51G	A	-	2	0	POLD2	44128026	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.081000	0.94049	2.434000	0.82447	0.563000	0.77884	GCC		0.587	POLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250994.2	NM_001127218	
ZNF479	90827	broad.mit.edu	37	7	57194380	57194380	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr7:57194380C>T	ENST00000331162.4	-	3	355	c.85G>A	c.(85-87)Gaa>Aaa	p.E29K		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	29	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E29*(1)|p.E29K(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			CATTGCCATTCCTCCAGAGAG	0.438																																																2	Substitution - Missense(1)|Substitution - Nonsense(1)	ovary(1)|lung(1)	7											49.0	50.0	50.0					7																	57194380		2172	4276	6448	57198322	SO:0001583	missense	90827			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.85G>A	7.37:g.57194380C>T	ENSP00000333776:p.Glu29Lys	Somatic		Capture	Illumina GAIIx	Phase_I	57198322		Missense_Mutation	SNP	ENST00000331162.4	37	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	c	14.37	2.515141	0.44763	.	.	ENSG00000185177	ENST00000331162	T	0.12255	2.7	1.25	1.25	0.21368	Krueppel-associated box (4);	.	.	.	.	T	0.50667	0.1629	H	0.99011	4.4	0.09310	N	0.999998	D	0.76494	0.999	D	0.81914	0.995	T	0.40515	-0.9559	9	0.87932	D	0	.	8.0193	0.30400	0.0:1.0:0.0:0.0	.	29	Q96JC4	ZN479_HUMAN	K	29	ENSP00000333776:E29K	ENSP00000333776:E29K	E	-	1	0	ZNF479	57198322	0.001000	0.12720	0.051000	0.19133	0.007000	0.05969	0.049000	0.14099	0.669000	0.31146	0.393000	0.25936	GAA		0.438	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202	
MGAM	8972	broad.mit.edu	37	7	141764312	141764312	+	Missense_Mutation	SNP	C	C	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr7:141764312C>A	ENST00000549489.2	+	37	4569	c.4474C>A	c.(4474-4476)Ccc>Acc	p.P1492T	MGAM_ENST00000475668.2_Missense_Mutation_p.P1492T	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1492	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.P1492T(1)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCAGACCAGACCCACATACGA	0.527																																																1	Substitution - Missense(1)	ovary(1)	7											21.0	23.0	22.0					7																	141764312		1987	4158	6145	141410781	SO:0001583	missense	8972			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4474C>A	7.37:g.141764312C>A	ENSP00000447378:p.Pro1492Thr	Somatic		Capture	Illumina GAIIx	Phase_I	141410781	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.443801	0.63067	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.90900	-2.75	4.22	4.22	0.49857	Glycoside hydrolase, superfamily (1);	.	.	.	.	D	0.92130	0.7505	M	0.69185	2.1	0.51012	D	0.999909	P	0.49783	0.928	P	0.51193	0.662	D	0.93153	0.6551	9	0.66056	D	0.02	.	15.4323	0.75112	0.0:1.0:0.0:0.0	.	1492	O43451	MGA_HUMAN	T	1492;1492;1369	ENSP00000447378:P1492T	ENSP00000316431:P1369T	P	+	1	0	MGAM	141410781	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	5.911000	0.69939	1.888000	0.54679	0.306000	0.20318	CCC		0.527	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
RALYL	138046	broad.mit.edu	37	8	85686876	85686876	+	Missense_Mutation	SNP	T	T	C			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr8:85686876T>C	ENST00000521268.1	+	3	1424	c.319T>C	c.(319-321)Tct>Cct	p.S107P	RALYL_ENST00000517638.1_Missense_Mutation_p.S120P|RALYL_ENST00000518566.1_Missense_Mutation_p.S107P|RALYL_ENST00000521376.1_Missense_Mutation_p.S34P|RALYL_ENST00000522455.1_Missense_Mutation_p.S107P|RALYL_ENST00000523850.1_Missense_Mutation_p.S34P|RALYL_ENST00000521695.1_Missense_Mutation_p.S107P	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	107							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S107P(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						GAGGCCCCTTTCTGCACTTTA	0.358																																																1	Substitution - Missense(1)	ovary(1)	8											64.0	62.0	63.0					8																	85686876		1817	4090	5907	85849431	SO:0001583	missense	138046				CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.319T>C	8.37:g.85686876T>C	ENSP00000430367:p.Ser107Pro	Somatic		Capture	Illumina GAIIx	Phase_I	85849431	B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	ENST00000521268.1	37	CCDS55253.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.277846	0.80692	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850;ENST00000521376	T;T;T;T;T;T;T	0.22539	2.75;2.75;2.75;2.8;2.74;2.32;1.95	5.78	5.78	0.91487	.	0.076274	0.64402	D	0.000006	T	0.37892	0.1020	M	0.66939	2.045	0.30254	N	0.793841	B;B;D;B;B	0.57571	0.006;0.026;0.98;0.049;0.026	B;B;P;B;B	0.55303	0.015;0.022;0.773;0.072;0.022	T	0.44726	-0.9309	10	0.66056	D	0.02	-5.9657	13.623	0.62149	0.0:0.0:0.0:1.0	.	107;107;34;120;107	B3KT61;B3KSX3;Q86SE5-2;G3V129;Q86SE5	.;.;.;.;RALYL_HUMAN	P	107;107;107;107;120;34;34	ENSP00000430394:S107P;ENSP00000428667:S107P;ENSP00000430367:S107P;ENSP00000430065:S107P;ENSP00000430128:S120P;ENSP00000428807:S34P;ENSP00000428310:S34P	ENSP00000430128:S120P	S	+	1	0	RALYL	85849431	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	4.460000	0.60108	2.199000	0.70637	0.533000	0.62120	TCT		0.358	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379448.1		
CPNE3	8895	broad.mit.edu	37	8	87560532	87560532	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr8:87560532G>A	ENST00000521271.1	+	12	1045	c.883G>A	c.(883-885)Gga>Aga	p.G295R	CPNE3_ENST00000198765.4_Missense_Mutation_p.G295R	NM_003909.3	NP_003900.1	O75131	CPNE3_HUMAN	copine III	295	VWFA.				lipid metabolic process (GO:0006629)|protein phosphorylation (GO:0006468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|transporter activity (GO:0005215)	p.G295R(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	23						TTGGCAGGTGGGAGTGGACTT	0.488																																																1	Substitution - Missense(1)	ovary(1)	8											112.0	94.0	100.0					8																	87560532		2203	4300	6503	87629648	SO:0001583	missense	8895			AB014536	CCDS6243.1	8q21	2008-07-03				ENSG00000085719			2316	protein-coding gene	gene with protein product		604207				9430674	Standard	NM_003909		Approved		uc003ydv.2	O75131		ENST00000521271.1:c.883G>A	8.37:g.87560532G>A	ENSP00000430934:p.Gly295Arg	Somatic		Capture	Illumina GAIIx	Phase_I	87629648	A8KA47|Q8IYA1	Missense_Mutation	SNP	ENST00000521271.1	37	CCDS6243.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.0|29.0	4.968486|4.968486	0.92855|0.92855	.|.	.|.	ENSG00000085719|ENSG00000085719	ENST00000198765;ENST00000521271|ENST00000517391	T;T|.	0.22134|.	1.97;1.97|.	5.71|5.71	4.83|4.83	0.62350|0.62350	von Willebrand factor, type A (1);|.	0.107041|.	0.64402|.	N|.	0.000007|.	D|.	0.87541|.	0.6203|.	H|H	0.96175|0.96175	3.78|3.78	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.68765|.	0.96|.	D|.	0.91753|.	0.5414|.	10|.	0.87932|.	D|.	0|.	-10.6619|-10.6619	16.0874|16.0874	0.81068|0.81068	0.0:0.0:0.865:0.135|0.0:0.0:0.865:0.135	.|.	295|.	O75131|.	CPNE3_HUMAN|.	R|X	295|183	ENSP00000198765:G295R;ENSP00000430934:G295R|.	ENSP00000198765:G295R|.	G|W	+|+	1|3	0|0	CPNE3|CPNE3	87629648|87629648	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	9.826000|9.826000	0.99387|0.99387	1.407000|1.407000	0.46875|0.46875	-0.182000|-0.182000	0.12963|0.12963	GGA|TGG		0.488	CPNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374994.1		
DOCK8	81704	broad.mit.edu	37	9	463545	463545	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr9:463545C>T	ENST00000453981.1	+	47	6209	c.6097C>T	c.(6097-6099)Cgt>Tgt	p.R2033C	RP11-165F24.3_ENST00000588474.1_RNA|RP11-165F24.3_ENST00000608617.1_RNA|DOCK8_ENST00000469391.1_Missense_Mutation_p.R1933C|DOCK8_ENST00000432829.2_Missense_Mutation_p.R1965C|RP11-165F24.3_ENST00000589387.1_RNA|RP11-165F24.3_ENST00000593137.1_RNA|RP11-165F24.3_ENST00000585819.1_RNA|RP11-165F24.3_ENST00000589287.1_RNA|RP11-165F24.3_ENST00000592805.1_RNA|RP11-165F24.3_ENST00000591577.1_RNA|RP11-165F24.3_ENST00000415004.2_RNA|RP11-165F24.3_ENST00000590518.1_RNA|RP11-165F24.3_ENST00000586805.1_RNA|DOCK8_ENST00000382329.1_Missense_Mutation_p.R1500C|RP11-165F24.3_ENST00000588989.1_RNA			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	2033	DHR-2.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R1965C(1)		breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GAAAAACAAGCGTCTCATCAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	9											68.0	68.0	68.0					9																	463545		2203	4300	6503	453545	SO:0001583	missense	81704			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.6097C>T	9.37:g.463545C>T	ENSP00000408464:p.Arg2033Cys	Somatic		Capture	Illumina GAIIx	Phase_I	453545	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	37	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	C	19.36	3.813346	0.70912	.	.	ENSG00000107099	ENST00000453981;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.04	4.13	0.48395	.	0.284900	0.38720	N	0.001596	T	0.26521	0.0648	L	0.41492	1.28	0.47037	D	0.999298	D;D;D	0.61697	0.981;0.981;0.99	P;P;P	0.56788	0.806;0.806;0.806	T	0.01604	-1.1314	10	0.66056	D	0.02	.	12.7763	0.57451	0.2964:0.7036:0.0:0.0	.	1933;1500;2033	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	C	2033;1965;1933;1500	ENSP00000408464:R2033C;ENSP00000394888:R1965C;ENSP00000419438:R1933C;ENSP00000371766:R1500C	ENSP00000371766:R1500C	R	+	1	0	DOCK8	453545	0.997000	0.39634	1.000000	0.80357	0.960000	0.62799	1.230000	0.32612	1.231000	0.43661	0.563000	0.77884	CGT		0.398	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
LINGO2	158038	broad.mit.edu	37	9	27950233	27950233	+	Missense_Mutation	SNP	T	T	C			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr9:27950233T>C	ENST00000379992.2	-	6	886	c.437A>G	c.(436-438)gAc>gGc	p.D146G	LINGO2_ENST00000308675.3_Missense_Mutation_p.D146G	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	146						integral component of membrane (GO:0016021)		p.D146G(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		GAACATGTAGTCTAGTAAAAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	9											78.0	72.0	74.0					9																	27950233		2203	4300	6503	27940233	SO:0001583	missense	158038			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.437A>G	9.37:g.27950233T>C	ENSP00000369328:p.Asp146Gly	Somatic		Capture	Illumina GAIIx	Phase_I	27940233	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	ENST00000379992.2	37	CCDS6524.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.306667	0.60305	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.79749	-1.3;-1.3	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.83261	0.5216	N	0.20986	0.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82313	-0.0519	9	.	.	.	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	146	Q7L985	LIGO2_HUMAN	G	146	ENSP00000369328:D146G;ENSP00000310126:D146G	.	D	-	2	0	LINGO2	27940233	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.003000	0.88520	2.371000	0.80710	0.533000	0.62120	GAC		0.418	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570	
FANCG	2189	broad.mit.edu	37	9	35075483	35075483	+	Missense_Mutation	SNP	A	A	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr9:35075483A>T	ENST00000378643.3	-	10	1903	c.1412T>A	c.(1411-1413)gTg>gAg	p.V471E	VCP_ENST00000358901.6_5'Flank|FANCG_ENST00000476212.1_Intron	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	471					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)	p.V471E(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			ACTAATTGCCACTTTTTGGGC	0.557			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																														yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	1	Substitution - Missense(1)	ovary(1)	9											111.0	130.0	123.0					9																	35075483		2203	4300	6503	35065483	SO:0001583	missense	2189			AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.1412T>A	9.37:g.35075483A>T	ENSP00000367910:p.Val471Glu	Somatic		Capture	Illumina GAIIx	Phase_I	35065483		Missense_Mutation	SNP	ENST00000378643.3	37	CCDS6574.1	.	.	.	.	.	.	.	.	.	.	A	0.075	-1.195470	0.01594	.	.	ENSG00000221829	ENST00000378643	T	0.11604	2.76	5.5	4.35	0.52113	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.01870	0.0059	N	0.00082	-2.215	0.27561	N	0.950189	B	0.02656	0.0	B	0.01281	0.0	T	0.34179	-0.9839	9	0.02654	T	1	-3.9777	9.373	0.38266	0.1665:0.0:0.0:0.8335	.	471	O15287	FANCG_HUMAN	E	471	ENSP00000367910:V471E	ENSP00000367910:V471E	V	-	2	0	FANCG	35065483	0.966000	0.33281	0.972000	0.41901	0.425000	0.31504	3.878000	0.56130	0.907000	0.36646	-0.339000	0.08088	GTG		0.557	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052269.1	NM_004629	
CTSL	1514	broad.mit.edu	37	9	90342624	90342624	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chr9:90342624C>T	ENST00000343150.5	+	2	996	c.106C>T	c.(106-108)Cac>Tac	p.H36Y	CTSL_ENST00000495822.1_Intron|CTSL_ENST00000342020.5_Missense_Mutation_p.H36Y|CTSL_ENST00000340342.6_Missense_Mutation_p.H36Y			P07711	CATL1_HUMAN	cathepsin L	36					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)	p.H36Y(1)									GAAGGCGATGCACAACAGATT	0.463																																																1	Substitution - Missense(1)	ovary(1)	9											97.0	87.0	90.0					9																	90342624		2203	4300	6503	89532444	SO:0001583	missense	1514			X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.106C>T	9.37:g.90342624C>T	ENSP00000345344:p.His36Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	89532444	Q6IAV1|Q96QJ0	Missense_Mutation	SNP	ENST00000343150.5	37	CCDS6675.1	.	.	.	.	.	.	.	.	.	.	C	7.552	0.662933	0.14710	.	.	ENSG00000135047	ENST00000343150;ENST00000340342;ENST00000342020;ENST00000539280	T;T;T	0.80033	-1.33;-1.33;-1.33	4.08	1.11	0.20524	Proteinase inhibitor I29, cathepsin propeptide (2);	0.000000	0.85682	D	0.000000	T	0.73860	0.3641	L	0.61036	1.89	0.30020	N	0.814398	B	0.12630	0.006	B	0.17433	0.018	T	0.64816	-0.6318	10	0.36615	T	0.2	.	8.4148	0.32666	0.0:0.7255:0.0:0.2745	.	36	P07711	CATL1_HUMAN	Y	36	ENSP00000345344:H36Y;ENSP00000365061:H36Y;ENSP00000340470:H36Y	ENSP00000365061:H36Y	H	+	1	0	CTSL1	89532444	0.932000	0.31603	0.000000	0.03702	0.012000	0.07955	2.800000	0.47900	0.035000	0.15519	0.484000	0.47621	CAC		0.463	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052936.1	NM_001912	
MAGEB6	158809	broad.mit.edu	37	X	26212100	26212100	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chrX:26212100G>A	ENST00000379034.1	+	2	286	c.137G>A	c.(136-138)cGc>cAc	p.R46H		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	46	Ser-rich.							p.R46H(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						TCCTCTTCTCGCGCTTGTCTG	0.552																																																1	Substitution - Missense(1)	ovary(1)	X											114.0	97.0	103.0					X																	26212100		2202	4300	6502	26122021	SO:0001583	missense	158809			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.137G>A	X.37:g.26212100G>A	ENSP00000368320:p.Arg46His	Somatic		Capture	Illumina GAIIx	Phase_I	26122021	Q6GS19|Q9H219	Missense_Mutation	SNP	ENST00000379034.1	37	CCDS14217.1	.	.	.	.	.	.	.	.	.	.	g	0.384	-0.927188	0.02377	.	.	ENSG00000176746	ENST00000379034	T	0.04234	3.67	1.67	-1.67	0.08238	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.01800	0.0057	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.44726	-0.9309	9	0.41790	T	0.15	.	0.5815	0.00712	0.2414:0.3391:0.239:0.1805	.	46	Q8N7X4	MAGB6_HUMAN	H	46	ENSP00000368320:R46H	ENSP00000368320:R46H	R	+	2	0	MAGEB6	26122021	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.000000	0.12993	-0.649000	0.05430	-2.046000	0.00415	CGC		0.552	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523	
GDPD2	54857	broad.mit.edu	37	X	69647002	69647002	+	Missense_Mutation	SNP	A	A	C			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chrX:69647002A>C	ENST00000374382.3	+	9	969	c.718A>C	c.(718-720)Acc>Ccc	p.T240P	GDPD2_ENST00000538649.1_Missense_Mutation_p.T161P|GDPD2_ENST00000536730.1_Missense_Mutation_p.T161P|GDPD2_ENST00000453994.2_Missense_Mutation_p.T240P|GDPD2_ENST00000472623.1_3'UTR	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	240	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)	p.T240P(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					TCCCGAGAACACCCTGATGTC	0.582																																																1	Substitution - Missense(1)	ovary(1)	X											94.0	79.0	84.0					X																	69647002		2203	4300	6503	69563727	SO:0001583	missense	54857			AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.718A>C	X.37:g.69647002A>C	ENSP00000363503:p.Thr240Pro	Somatic		Capture	Illumina GAIIx	Phase_I	69563727	B4DRH4|B4DVC9|Q9NXJ6	Missense_Mutation	SNP	ENST00000374382.3	37	CCDS14402.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.932826	0.73442	.	.	ENSG00000130055	ENST00000453994;ENST00000536730;ENST00000538649;ENST00000374382	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	5.35	5.35	0.76521	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.000000	0.85682	D	0.000000	T	0.74152	0.3679	H	0.98594	4.275	0.47009	D	0.999283	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.84171	0.0434	9	.	.	.	-18.2418	13.073	0.59072	1.0:0.0:0.0:0.0	.	240;26;161;240	B4DVC9;B3KUI6;B4DRH4;Q9HCC8	.;.;.;GDPD2_HUMAN	P	240;161;161;240	ENSP00000414019:T240P;ENSP00000445982:T161P;ENSP00000444601:T161P;ENSP00000363503:T240P	.	T	+	1	0	GDPD2	69563727	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	8.267000	0.89874	1.967000	0.57214	0.486000	0.48141	ACC		0.582	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057070.1	NM_017711	
CLDN2	9075	broad.mit.edu	37	X	106171625	106171625	+	Missense_Mutation	SNP	C	C	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chrX:106171625C>A	ENST00000541806.1	+	2	686	c.167C>A	c.(166-168)aCa>aAa	p.T56K	CLDN2_ENST00000540876.1_Missense_Mutation_p.T56K|CLDN2_ENST00000336803.1_Missense_Mutation_p.T56K	NM_001171092.1	NP_001164563.1	P57739	CLD2_HUMAN	claudin 2	56					calcium-independent cell-cell adhesion (GO:0016338)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.T56K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						GAATGTGCCACACACAGCACA	0.567																																																1	Substitution - Missense(1)	ovary(1)	X											115.0	94.0	101.0					X																	106171625		2203	4300	6503	106058281	SO:0001583	missense	9075			AK075405	CCDS14524.1	Xq22.3-q23	2008-05-14			ENSG00000165376	ENSG00000165376		"""Claudins"""	2041	protein-coding gene	gene with protein product		300520				9892664	Standard	NM_020384		Approved		uc022ccc.1	P57739	OTTHUMG00000022154	ENST00000541806.1:c.167C>A	X.37:g.106171625C>A	ENSP00000441283:p.Thr56Lys	Somatic		Capture	Illumina GAIIx	Phase_I	106058281	B2R6B9	Missense_Mutation	SNP	ENST00000541806.1	37	CCDS14524.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.890862	0.52014	.	.	ENSG00000165376	ENST00000541806;ENST00000540876;ENST00000336803	D;D;D	0.89123	-2.47;-2.47;-2.47	5.6	5.6	0.85130	Claudin, conserved site (1);	0.108239	0.64402	D	0.000006	D	0.90448	0.7009	M	0.63428	1.95	0.40844	D	0.983695	P	0.50369	0.934	P	0.51101	0.659	D	0.89377	0.3679	10	0.29301	T	0.29	.	15.8564	0.78979	0.0:1.0:0.0:0.0	.	56	P57739	CLD2_HUMAN	K	56	ENSP00000441283:T56K;ENSP00000443230:T56K;ENSP00000336571:T56K	ENSP00000336571:T56K	T	+	2	0	CLDN2	106058281	0.691000	0.27709	1.000000	0.80357	0.995000	0.86356	1.612000	0.36889	2.343000	0.79666	0.594000	0.82650	ACA		0.567	CLDN2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057815.1		
STAG2	10735	broad.mit.edu	37	X	123179101	123179101	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chrX:123179101C>T	ENST00000371160.1	+	8	840	c.550C>T	c.(550-552)Cgg>Tgg	p.R184W	STAG2_ENST00000354548.5_Missense_Mutation_p.R115W|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.R184W|STAG2_ENST00000371157.3_Missense_Mutation_p.R184W|STAG2_ENST00000371144.3_Missense_Mutation_p.R184W|STAG2_ENST00000371145.3_Missense_Mutation_p.R184W	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	184					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.R184W(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						CGTGTTAGTACGGCAATGTCA	0.373																																																1	Substitution - Missense(1)	ovary(1)	X											195.0	181.0	186.0					X																	123179101		2203	4300	6503	123006782	SO:0001583	missense	10735			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.550C>T	X.37:g.123179101C>T	ENSP00000360202:p.Arg184Trp	Somatic		Capture	Illumina GAIIx	Phase_I	123006782	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142053	0.77775	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144;ENST00000435215	T;T;T;T;T;T;T;T	0.44881	0.91;1.36;1.36;1.36;1.36;0.91;1.36;0.91	4.64	3.71	0.42584	STAG (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62060	0.2397	M	0.79475	2.455	0.80722	D	1	D;D	0.76494	0.999;0.999	P;D	0.65140	0.888;0.932	T	0.68819	-0.5308	10	0.72032	D	0.01	-1.6646	13.8263	0.63352	0.1528:0.8472:0.0:0.0	.	184;184	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	W	184;184;115;184;184;184;184;184	ENSP00000218089:R184W;ENSP00000397265:R184W;ENSP00000346555:R115W;ENSP00000360202:R184W;ENSP00000360199:R184W;ENSP00000360187:R184W;ENSP00000360186:R184W;ENSP00000392118:R184W	ENSP00000218089:R184W	R	+	1	2	STAG2	123006782	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.980000	0.56895	2.025000	0.59659	0.422000	0.28245	CGG		0.373	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
UTP14A	10813	broad.mit.edu	37	X	129054485	129054485	+	Nonsense_Mutation	SNP	G	G	T			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chrX:129054485G>T	ENST00000394422.3	+	9	833	c.805G>T	c.(805-807)Gag>Tag	p.E269*	UTP14A_ENST00000371042.3_Nonsense_Mutation_p.E101*|UTP14A_ENST00000425117.2_Nonsense_Mutation_p.E217*|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371051.5_Nonsense_Mutation_p.E215*	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	269					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.E269*(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						AAAAGAGTTTGAGCAGCTGCG	0.478																																																1	Substitution - Nonsense(1)	ovary(1)	X											124.0	122.0	123.0					X																	129054485		2203	4300	6503	128882166	SO:0001587	stop_gained	10813			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.805G>T	X.37:g.129054485G>T	ENSP00000377944:p.Glu269*	Somatic		Capture	Illumina GAIIx	Phase_I	128882166	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Nonsense_Mutation	SNP	ENST00000394422.3	37	CCDS14615.1	.	.	.	.	.	.	.	.	.	.	G	33	5.246215	0.95272	.	.	ENSG00000156697	ENST00000425117;ENST00000394422;ENST00000371051;ENST00000427972;ENST00000371042	.	.	.	6.17	6.17	0.99709	.	0.090541	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-31.1652	19.7362	0.96205	0.0:0.0:1.0:0.0	.	.	.	.	X	217;269;215;101;101	.	ENSP00000360081:E101X	E	+	1	0	UTP14A	128882166	1.000000	0.71417	0.792000	0.32020	0.123000	0.20343	9.438000	0.97539	2.618000	0.88619	0.600000	0.82982	GAG		0.478	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649	
L1CAM	3897	broad.mit.edu	37	X	153129914	153129914	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0990-01A-01W-0486-08	TCGA-20-0990-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	4c50d48a-7b5d-41bd-a502-a70b53ab4767	b3ee80a8-f98d-4c24-8a5b-20c3e9a35c93	g.chrX:153129914G>A	ENST00000370060.1	-	25	3374	c.3185C>T	c.(3184-3186)tCc>tTc	p.S1062F	L1CAM_ENST00000361981.3_Missense_Mutation_p.S1057F|L1CAM_ENST00000370057.3_Missense_Mutation_p.S1062F|L1CAM_ENST00000370055.1_Missense_Mutation_p.S1057F|L1CAM_ENST00000538883.1_Missense_Mutation_p.S1064F|L1CAM_ENST00000543994.1_Missense_Mutation_p.S1064F|L1CAM_ENST00000361699.4_Missense_Mutation_p.S1062F	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1062	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.S1062F(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGCGAAAGGGAAGCCCCACC	0.607																																																1	Substitution - Missense(1)	ovary(1)	X											113.0	100.0	104.0					X																	153129914		2203	4300	6503	152783108	SO:0001583	missense	3897			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3185C>T	X.37:g.153129914G>A	ENSP00000359077:p.Ser1062Phe	Somatic		Capture	Illumina GAIIx	Phase_I	152783108	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	G	0.712	-0.786784	0.02907	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000370058;ENST00000361699	D;D;D;D;D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-1.69;-2.02	4.49	-2.81	0.05805	Fibronectin, type III (1);Immunoglobulin-like fold (1);	2.939600	0.01107	N	0.005480	T	0.69124	0.3076	N	0.08118	0	0.09310	N	1	B;B;B	0.22746	0.074;0.015;0.0	B;B;B	0.23574	0.047;0.004;0.002	T	0.57505	-0.7800	10	0.25106	T	0.35	.	4.55	0.12107	0.0:0.3025:0.324:0.3735	.	1057;1062;1062	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	F	1062;1064;1062;1064;1057;1057;7;1062	ENSP00000359077:S1062F;ENSP00000438430:S1064F;ENSP00000359074:S1062F;ENSP00000439645:S1064F;ENSP00000354712:S1057F;ENSP00000359072:S1057F;ENSP00000359075:S7F;ENSP00000355380:S1062F	ENSP00000355380:S1062F	S	-	2	0	L1CAM	152783108	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.343000	0.02642	-1.140000	0.02877	-0.740000	0.03531	TCC		0.607	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
