#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PANK4	55229	broad.mit.edu	37	1	2452247	2452247	+	Missense_Mutation	SNP	T	T	G			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr1:2452247T>G	ENST00000378466.3	-	4	533	c.521A>C	c.(520-522)gAc>gCc	p.D174A	PANK4_ENST00000491212.1_5'Flank|PANK4_ENST00000435556.3_Missense_Mutation_p.D135A	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	174					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)	p.D174A(1)		breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		GAACTCAGGGTCGGAATCCTT	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											131.0	133.0	132.0					1																	2452247		2203	4300	6503	2442107	SO:0001583	missense	55229			AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.521A>C	1.37:g.2452247T>G	ENSP00000367727:p.Asp174Ala	Somatic		Capture	Illumina GAIIx	Phase_I	2442107	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Missense_Mutation	SNP	ENST00000378466.3	37	CCDS42.1	.	.	.	.	.	.	.	.	.	.	T	14.20	2.463955	0.43736	.	.	ENSG00000157881	ENST00000378466;ENST00000435556	D;D	0.99594	-6.25;-6.25	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.98664	0.9552	L	0.55017	1.72	0.80722	D	1	B;B	0.22080	0.064;0.019	B;B	0.27170	0.077;0.077	D	0.99859	1.1081	10	0.46703	T	0.11	-29.4076	13.719	0.62714	0.0:0.0:0.0:1.0	.	135;174	E9PHT6;Q9NVE7	.;PANK4_HUMAN	A	174;135	ENSP00000367727:D174A;ENSP00000421433:D135A	ENSP00000367727:D174A	D	-	2	0	PANK4	2442107	1.000000	0.71417	0.733000	0.30861	0.826000	0.46750	7.332000	0.79203	1.835000	0.53391	0.460000	0.39030	GAC		0.537	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002082.1		
HIVEP3	59269	broad.mit.edu	37	1	42045958	42045958	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr1:42045958G>A	ENST00000372583.1	-	4	5396	c.4511C>T	c.(4510-4512)tCa>tTa	p.S1504L	HIVEP3_ENST00000372584.1_Missense_Mutation_p.S1504L|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000247584.5_Missense_Mutation_p.S1504L|HIVEP3_ENST00000429157.2_Missense_Mutation_p.S1504L	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1504					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S1504L(1)		NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				AGATGGATCTGAGGACAGGCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											95.0	105.0	102.0					1																	42045958		2203	4300	6503	41818545	SO:0001583	missense	59269			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.4511C>T	1.37:g.42045958G>A	ENSP00000361664:p.Ser1504Leu	Somatic		Capture	Illumina GAIIx	Phase_I	41818545	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	37	CCDS463.1	.	.	.	.	.	.	.	.	.	.	G	4.176	0.031253	0.08101	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.07216	3.22;3.21;3.21;3.22	5.37	3.37	0.38596	.	0.709812	0.12291	N	0.482033	T	0.04815	0.0130	N	0.17474	0.49	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.08055	0.003;0.001	T	0.37361	-0.9709	10	0.28530	T	0.3	-0.3029	4.3533	0.11165	0.2304:0.3408:0.4287:0.0	.	1504;1504	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	L	1504	ENSP00000361665:S1504L;ENSP00000361664:S1504L;ENSP00000247584:S1504L;ENSP00000410828:S1504L	ENSP00000247584:S1504L	S	-	2	0	HIVEP3	41818545	0.029000	0.19370	0.256000	0.24389	0.440000	0.31957	1.329000	0.33770	1.504000	0.48704	0.655000	0.94253	TCA		0.562	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
PRKAA2	5563	broad.mit.edu	37	1	57173243	57173243	+	Missense_Mutation	SNP	A	A	G			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr1:57173243A>G	ENST00000371244.4	+	9	1582	c.1516A>G	c.(1516-1518)Act>Gct	p.T506A		NM_006252.3	NP_006243.2	P54646	AAPK2_HUMAN	protein kinase, AMP-activated, alpha 2 catalytic subunit	506					autophagy (GO:0006914)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|cellular response to glucose starvation (GO:0042149)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of glycolytic process (GO:0045821)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.T506A(2)		breast(6)|endometrium(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|stomach(1)	23					Acetylsalicylic acid(DB00945)	TGATTCCACAACTGCAGAGAG	0.493																																																2	Substitution - Missense(2)	ovary(2)	1											164.0	154.0	157.0					1																	57173243		2203	4300	6503	56945831	SO:0001583	missense	5563			BC069823	CCDS605.1	1p31	2011-08-25			ENSG00000162409	ENSG00000162409			9377	protein-coding gene	gene with protein product		600497		PRKAA		7959015	Standard	NM_006252		Approved	AMPK, AMPKa2	uc001cyk.4	P54646	OTTHUMG00000008282	ENST00000371244.4:c.1516A>G	1.37:g.57173243A>G	ENSP00000360290:p.Thr506Ala	Somatic		Capture	Illumina GAIIx	Phase_I	56945831	Q9H1E8|Q9UD43	Missense_Mutation	SNP	ENST00000371244.4	37	CCDS605.1	.	.	.	.	.	.	.	.	.	.	A	0.839	-0.742599	0.03088	.	.	ENSG00000162409	ENST00000371244	T	0.08807	3.05	5.99	0.865	0.19074	.	0.281293	0.40554	N	0.001066	T	0.02649	0.0080	N	0.08118	0	0.25119	N	0.990655	B	0.02656	0.0	B	0.01281	0.0	T	0.42172	-0.9467	10	0.08179	T	0.78	-11.4974	2.157	0.03814	0.4817:0.1211:0.2802:0.117	.	506	P54646	AAPK2_HUMAN	A	506	ENSP00000360290:T506A	ENSP00000360290:T506A	T	+	1	0	PRKAA2	56945831	0.004000	0.15560	0.005000	0.12908	0.506000	0.33950	0.640000	0.24705	0.159000	0.19401	-1.054000	0.02325	ACT		0.493	PRKAA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022753.2	NM_006252	
HIPK1	204851	broad.mit.edu	37	1	114483238	114483238	+	Missense_Mutation	SNP	C	C	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr1:114483238C>A	ENST00000369558.1	+	2	465	c.233C>A	c.(232-234)gCt>gAt	p.A78D	HIPK1_ENST00000369561.4_Missense_Mutation_p.A78D|HIPK1_ENST00000369555.2_Missense_Mutation_p.A78D|HIPK1_ENST00000369559.4_Missense_Mutation_p.A78D|HIPK1_ENST00000426820.2_Missense_Mutation_p.A78D|HIPK1_ENST00000369554.2_Missense_Mutation_p.A78D			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	78					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A78D(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCCTCCCAGCTCCTGCAGTG	0.552																																																1	Substitution - Missense(1)	ovary(1)	1											101.0	103.0	102.0					1																	114483238		2203	4300	6503	114284761	SO:0001583	missense	204851			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.233C>A	1.37:g.114483238C>A	ENSP00000358571:p.Ala78Asp	Somatic		Capture	Illumina GAIIx	Phase_I	114284761	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	CCDS867.1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.533602	0.64972	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000514621;ENST00000503968	T;T;T;T;T;T;T;T;T	0.55588	0.6;0.65;0.64;0.65;0.65;0.64;0.64;0.51;0.52	5.22	4.3	0.51218	.	0.000000	0.64402	D	0.000007	T	0.56426	0.1984	L	0.44542	1.39	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.80764	0.981;0.994	T	0.63143	-0.6703	10	0.66056	D	0.02	.	15.7542	0.78011	0.0:0.8632:0.1368:0.0	.	78;78	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	D	149;78;78;78;78;78;78;78;78	ENSP00000407442:A149D;ENSP00000358572:A78D;ENSP00000409673:A78D;ENSP00000358567:A78D;ENSP00000358568:A78D;ENSP00000358571:A78D;ENSP00000358574:A78D;ENSP00000422322:A78D;ENSP00000426695:A78D	ENSP00000358567:A78D	A	+	2	0	HIPK1	114284761	1.000000	0.71417	0.939000	0.37840	0.953000	0.61014	5.889000	0.69766	1.172000	0.42781	0.650000	0.86243	GCT		0.552	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
C1orf85	112770	broad.mit.edu	37	1	156264616	156264616	+	Silent	SNP	G	G	A	rs151318535	byFrequency	TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr1:156264616G>A	ENST00000362007.1	-	2	338	c.312C>T	c.(310-312)ccC>ccT	p.P104P	C1orf85_ENST00000482579.1_5'Flank	NM_001256604.1|NM_001256609.1|NM_144580.2	NP_001243533.1|NP_001243538.1|NP_653181.1	Q8WWB7	NCUG1_HUMAN	chromosome 1 open reading frame 85	104					intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P104P(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(2)|skin(3)	14	Hepatocellular(266;0.158)					GGCCCCCATCGGGCTCAGGGG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	1						G		0,4406		0,0,2203	104.0	114.0	111.0		312	-3.7	0.2	1	dbSNP_134	111	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	C1orf85	NM_144580.1		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		104/407	156264616	2,13004	2203	4300	6503	154531240	SO:0001819	synonymous_variant	112770			BC011575	CCDS1139.1, CCDS72947.1, CCDS72948.1, CCDS72949.1	1q22	2014-08-07			ENSG00000198715	ENSG00000198715			29436	protein-coding gene	gene with protein product	"""kidney lysosomal membrane protein"""					12975309, 18021396, 19489740	Standard	NM_144580		Approved	MGC31963, NCU-G1	uc001foh.4	Q8WWB7	OTTHUMG00000019789	ENST00000362007.1:c.312C>T	1.37:g.156264616G>A		Somatic		Capture	Illumina GAIIx	Phase_I	154531240	A6NH16|B4DJN4|Q5SZX4|Q6UX96|Q8IV07|Q96F65	Silent	SNP	ENST00000362007.1	37	CCDS1139.1																																																																																				0.587	C1orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052108.1	NM_144580	
COPA	1314	broad.mit.edu	37	1	160268941	160268941	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr1:160268941G>A	ENST00000241704.7	-	18	2010	c.1781C>T	c.(1780-1782)cCc>cTc	p.P594L	COPA_ENST00000368069.3_Missense_Mutation_p.P603L	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	594					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)	p.P594L(1)		central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GAACTCAGTGGGATCAATGGT	0.453																																																1	Substitution - Missense(1)	ovary(1)	1											135.0	130.0	132.0					1																	160268941		2203	4300	6503	158535565	SO:0001583	missense	1314			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.1781C>T	1.37:g.160268941G>A	ENSP00000241704:p.Pro594Leu	Somatic		Capture	Illumina GAIIx	Phase_I	158535565	Q5T201|Q8IXZ9	Missense_Mutation	SNP	ENST00000241704.7	37	CCDS1202.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.236290	0.58886	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.57436	0.44;0.4	4.98	4.07	0.47477	Coatomer, WD associated region (1);	0.049708	0.85682	D	0.000000	T	0.47655	0.1457	M	0.79805	2.47	0.80722	D	1	B;B	0.26081	0.002;0.141	B;B	0.36959	0.031;0.237	T	0.56595	-0.7953	10	0.56958	D	0.05	-9.065	12.2277	0.54470	0.0828:0.0:0.9172:0.0	.	594;603	P53621;P53621-2	COPA_HUMAN;.	L	603;594	ENSP00000357048:P603L;ENSP00000241704:P594L	ENSP00000241704:P594L	P	-	2	0	COPA	158535565	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.186000	0.94906	1.333000	0.45449	0.585000	0.79938	CCC		0.453	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	NM_004371	
ADAMTS4	9507	broad.mit.edu	37	1	161163815	161163815	+	Missense_Mutation	SNP	G	G	C			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr1:161163815G>C	ENST00000367996.5	-	5	1886	c.1458C>G	c.(1456-1458)caC>caG	p.H486Q	ADAMTS4_ENST00000478394.1_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	486	Disintegrin.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)	p.H486Q(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	CCCAGGGCGAGTGTTTGGTCT	0.657																																																1	Substitution - Missense(1)	ovary(1)	1											48.0	52.0	51.0					1																	161163815		2203	4299	6502	159430439	SO:0001583	missense	9507			AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.1458C>G	1.37:g.161163815G>C	ENSP00000356975:p.His486Gln	Somatic		Capture	Illumina GAIIx	Phase_I	159430439	Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Missense_Mutation	SNP	ENST00000367996.5	37	CCDS1223.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952659	0.73787	.	.	ENSG00000158859	ENST00000367996	T	0.03413	3.94	5.29	0.682	0.17992	.	0.000000	0.64402	D	0.000002	T	0.06050	0.0157	M	0.84156	2.68	0.80722	D	1	P	0.45474	0.859	P	0.49829	0.623	T	0.08452	-1.0721	10	0.87932	D	0	.	14.177	0.65549	0.1288:0.0:0.8712:0.0	.	486	O75173	ATS4_HUMAN	Q	486	ENSP00000356975:H486Q	ENSP00000356975:H486Q	H	-	3	2	ADAMTS4	159430439	1.000000	0.71417	0.981000	0.43875	0.979000	0.70002	1.159000	0.31749	-0.035000	0.13691	0.561000	0.74099	CAC		0.657	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083066.2	NM_005099	
USH2A	7399	broad.mit.edu	37	1	216062312	216062312	+	Missense_Mutation	SNP	T	T	C	rs370155266		TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr1:216062312T>C	ENST00000307340.3	-	41	8065	c.7679A>G	c.(7678-7680)aAt>aGt	p.N2560S	USH2A_ENST00000366943.2_Missense_Mutation_p.N2560S|RP5-1111A8.3_ENST00000414995.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2560	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.N2560S(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AATAACCCCATTGGATTTTCT	0.403										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1						T	SER/ASN	1,4405	2.1+/-5.4	0,1,2202	107.0	107.0	107.0		7679	4.5	0.6	1		107	1,8599	1.2+/-3.3	0,1,4299	no	missense	USH2A	NM_206933.2	46	0,2,6501	CC,CT,TT		0.0116,0.0227,0.0154	probably-damaging	2560/5203	216062312	2,13004	2203	4300	6503	214128935	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7679A>G	1.37:g.216062312T>C	ENSP00000305941:p.Asn2560Ser	Somatic		Capture	Illumina GAIIx	Phase_I	214128935	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	19.07	3.756038	0.69648	2.27E-4	1.16E-4	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.58940	0.3;0.3	5.61	4.48	0.54585	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.48286	D	0.000197	T	0.79441	0.4446	M	0.92026	3.265	0.44754	D	0.997759	D	0.89917	1.0	D	0.87578	0.998	T	0.82414	-0.0469	10	0.72032	D	0.01	.	11.5339	0.50626	0.0:0.07:0.0:0.93	.	2560	O75445	USH2A_HUMAN	S	2560	ENSP00000305941:N2560S;ENSP00000355910:N2560S	ENSP00000305941:N2560S	N	-	2	0	USH2A	214128935	1.000000	0.71417	0.639000	0.29394	0.983000	0.72400	3.932000	0.56537	0.955000	0.37878	0.533000	0.62120	AAT		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
IDE	3416	broad.mit.edu	37	10	94234621	94234621	+	Missense_Mutation	SNP	T	T	G			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr10:94234621T>G	ENST00000265986.6	-	17	2149	c.2093A>C	c.(2092-2094)gAt>gCt	p.D698A	IDE_ENST00000496903.1_5'UTR|IDE_ENST00000371581.5_Missense_Mutation_p.D143A	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	698					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)	p.D698A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TTTTAACTCATCTTTAGTCCA	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											93.0	92.0	93.0					10																	94234621		2203	4300	6503	94224601	SO:0001583	missense	3416			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2093A>C	10.37:g.94234621T>G	ENSP00000265986:p.Asp698Ala	Somatic		Capture	Illumina GAIIx	Phase_I	94224601	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	37	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.011078	0.54361	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.30182	1.54;1.54	5.65	5.65	0.86999	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.174186	0.49305	D	0.000153	T	0.27205	0.0667	L	0.50333	1.59	0.58432	D	0.999999	B;B	0.23540	0.087;0.049	B;B	0.20184	0.021;0.028	T	0.07404	-1.0774	10	0.10377	T	0.69	-11.9137	14.109	0.65111	0.0:0.0:0.0:1.0	.	698;143	P14735;B3KSB8	IDE_HUMAN;.	A	698;143	ENSP00000265986:D698A;ENSP00000360637:D143A	ENSP00000265986:D698A	D	-	2	0	IDE	94224601	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	7.936000	0.87665	2.154000	0.67381	0.477000	0.44152	GAT		0.393	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
MMP21	118856	broad.mit.edu	37	10	127460876	127460876	+	Missense_Mutation	SNP	G	G	A	rs150851206	byFrequency	TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr10:127460876G>A	ENST00000368808.3	-	4	889	c.890C>T	c.(889-891)aCg>aTg	p.T297M		NM_147191.1	NP_671724.1	Q8N119	MMP21_HUMAN	matrix metallopeptidase 21	297					hematopoietic progenitor cell differentiation (GO:0002244)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T297M(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	16		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)			Marimastat(DB00786)	TATGGATCCCGTCCTGTAGGT	0.532																																																1	Substitution - Missense(1)	ovary(1)	10						G	MET/THR	2,4404	4.2+/-10.8	0,2,2201	116.0	96.0	103.0		890	1.0	0.1	10	dbSNP_134	103	10,8590	7.7+/-29.5	0,10,4290	yes	missense	MMP21	NM_147191.1	81	0,12,6491	AA,AG,GG		0.1163,0.0454,0.0923	possibly-damaging	297/570	127460876	12,12994	2203	4300	6503	127450866	SO:0001583	missense	118856			AF331526	CCDS7647.1	10q26.3	2008-07-28	2005-08-08		ENSG00000154485	ENSG00000154485			14357	protein-coding gene	gene with protein product		608416	"""matrix metalloproteinase 21"""			11255011	Standard	NM_147191		Approved		uc001liu.3	Q8N119	OTTHUMG00000019235	ENST00000368808.3:c.890C>T	10.37:g.127460876G>A	ENSP00000357798:p.Thr297Met	Somatic		Capture	Illumina GAIIx	Phase_I	127450866	Q5VZP9|Q8NG02	Missense_Mutation	SNP	ENST00000368808.3	37	CCDS7647.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716168	0.30413	4.54E-4	0.001163	ENSG00000154485	ENST00000368808	T	0.17370	2.28	5.05	0.992	0.19819	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	1.150890	0.06200	N	0.683153	T	0.26048	0.0635	L	0.61036	1.89	0.09310	N	1	D	0.59357	0.985	P	0.49192	0.602	T	0.24657	-1.0154	10	0.56958	D	0.05	-17.5458	7.8275	0.29324	0.4621:0.0:0.5379:0.0	.	297	Q8N119	MMP21_HUMAN	M	297	ENSP00000357798:T297M	ENSP00000357798:T297M	T	-	2	0	MMP21	127450866	0.000000	0.05858	0.131000	0.22000	0.982000	0.71751	0.383000	0.20651	0.159000	0.19401	0.561000	0.74099	ACG		0.532	MMP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050928.1		
INTS4	92105	broad.mit.edu	37	11	77639496	77639496	+	Silent	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr11:77639496G>A	ENST00000534064.1	-	11	1297	c.1263C>T	c.(1261-1263)aaC>aaT	p.N421N	INTS4_ENST00000525931.1_5'UTR|INTS4_ENST00000529807.1_Silent_p.N421N	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	421					snRNA processing (GO:0016180)	integrator complex (GO:0032039)		p.N421N(1)	INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			CAATTTCATCGTTGAACATGT	0.468																																																1	Substitution - coding silent(1)	ovary(1)	11											56.0	51.0	52.0					11																	77639496		2199	4292	6491	77317144	SO:0001819	synonymous_variant	92105			BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.1263C>T	11.37:g.77639496G>A		Somatic		Capture	Illumina GAIIx	Phase_I	77317144	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Silent	SNP	ENST00000534064.1	37	CCDS31644.1																																																																																				0.468	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547	
FLI1	2313	broad.mit.edu	37	11	128680520	128680520	+	Silent	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr11:128680520C>T	ENST00000527786.2	+	9	1485	c.996C>T	c.(994-996)taC>taT	p.Y332Y	FLI1_ENST00000534087.2_Silent_p.Y299Y|FLI1_ENST00000525560.1_Silent_p.Y139Y|FLI1_ENST00000344954.6_Silent_p.Y299Y|FLI1_ENST00000281428.8_Silent_p.Y266Y	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	332					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y332Y(1)	EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		ACATGAATTACGACAAGCTGA	0.512			T	EWSR1	Ewing sarcoma																																		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	1	Substitution - coding silent(1)	ovary(1)	11											39.0	45.0	43.0					11																	128680520		2195	4296	6491	128185730	SO:0001819	synonymous_variant	2313			M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.996C>T	11.37:g.128680520C>T		Somatic		Capture	Illumina GAIIx	Phase_I	128185730	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Silent	SNP	ENST00000527786.2	37	CCDS44768.1																																																																																				0.512	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386226.2	NM_002017	
SLCO1C1	53919	broad.mit.edu	37	12	20890101	20890101	+	Missense_Mutation	SNP	A	A	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr12:20890101A>T	ENST00000266509.2	+	11	1811	c.1443A>T	c.(1441-1443)aaA>aaT	p.K481N	SLCO1C1_ENST00000540354.1_Missense_Mutation_p.K432N|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.K481N|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.K481N|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.K363N	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	481	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.K481N(1)		NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	CAAGATGCAAATGTTCAGAGA	0.378																																																1	Substitution - Missense(1)	ovary(1)	12											98.0	91.0	93.0					12																	20890101		2203	4300	6503	20781368	SO:0001583	missense	53919			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1443A>T	12.37:g.20890101A>T	ENSP00000266509:p.Lys481Asn	Somatic		Capture	Illumina GAIIx	Phase_I	20781368	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	ENST00000266509.2	37	CCDS8683.1	.	.	.	.	.	.	.	.	.	.	A	1.683	-0.505881	0.04261	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0	5.02	3.88	0.44766	Proteinase inhibitor I1, Kazal (1);Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.384337	0.31922	N	0.006860	T	0.21427	0.0516	N	0.00686	-1.255	0.36578	D	0.873392	P;B;B;B	0.36909	0.573;0.004;0.004;0.001	B;B;B;B	0.34536	0.185;0.017;0.007;0.007	T	0.28776	-1.0033	10	0.07325	T	0.83	.	5.307	0.15809	0.6899:0.1513:0.1588:0.0	.	363;432;481;481	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	N	481;432;481;481;363	ENSP00000444149:K481N;ENSP00000438665:K432N;ENSP00000266509:K481N;ENSP00000370964:K481N;ENSP00000444527:K363N	ENSP00000266509:K481N	K	+	3	2	SLCO1C1	20781368	0.577000	0.26708	1.000000	0.80357	0.994000	0.84299	0.066000	0.14489	1.047000	0.40274	0.528000	0.53228	AAA		0.378	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435	
SP1	6667	broad.mit.edu	37	12	53800433	53800433	+	Silent	SNP	A	A	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr12:53800433A>T	ENST00000327443.4	+	4	1838	c.1740A>T	c.(1738-1740)gcA>gcT	p.A580A	SP1_ENST00000426431.2_Silent_p.A573A	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	580	Transactivation domain C (highly charged).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A580A(1)		breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		ATGACACAGCAGGTGGAGAGG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	12											101.0	98.0	99.0					12																	53800433		2203	4300	6503	52086700	SO:0001819	synonymous_variant	6667			J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.1740A>T	12.37:g.53800433A>T		Somatic		Capture	Illumina GAIIx	Phase_I	52086700	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Silent	SNP	ENST00000327443.4	37	CCDS8857.1																																																																																				0.537	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1		
NEUROD4	58158	broad.mit.edu	37	12	55420538	55420538	+	Silent	SNP	C	C	T	rs145283816		TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr12:55420538C>T	ENST00000242994.3	+	2	693	c.315C>T	c.(313-315)gaC>gaT	p.D105D		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	105	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D105D(2)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						GCCTGAATGACGCCCTGGATA	0.488													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18790	0.0		0.0	False		,,,				2504	0.0															2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	12						C		5,4401	9.9+/-24.2	0,5,2198	86.0	88.0	87.0		315	-10.0	0.2	12	dbSNP_134	87	0,8600		0,0,4300	no	coding-synonymous	NEUROD4	NM_021191.2		0,5,6498	TT,TC,CC		0.0,0.1135,0.0384		105/332	55420538	5,13001	2203	4300	6503	53706805	SO:0001819	synonymous_variant	58158			AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.315C>T	12.37:g.55420538C>T		Somatic		Capture	Illumina GAIIx	Phase_I	53706805	B2RAC9	Silent	SNP	ENST00000242994.3	37	CCDS8886.1																																																																																				0.488	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406104.1		
STAT6	6778	broad.mit.edu	37	12	57502041	57502041	+	Silent	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr12:57502041G>A	ENST00000300134.3	-	2	346	c.21C>T	c.(19-21)gtC>gtT	p.V7V	STAT6_ENST00000543873.2_Silent_p.V7V|STAT6_ENST00000537215.2_Intron|STAT6_ENST00000556155.1_Silent_p.V7V|STAT6_ENST00000538913.2_Intron|STAT6_ENST00000454075.3_Silent_p.V7V	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	7					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.V7V(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						GCATCTTGGAGACCAGACCCC	0.567																																																1	Substitution - coding silent(1)	ovary(1)	12											41.0	37.0	38.0					12																	57502041		2203	4300	6503	55788308	SO:0001819	synonymous_variant	6778			BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.21C>T	12.37:g.57502041G>A		Somatic		Capture	Illumina GAIIx	Phase_I	55788308	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Silent	SNP	ENST00000300134.3	37	CCDS8931.1																																																																																				0.567	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153	
TRHDE	29953	broad.mit.edu	37	12	72893328	72893328	+	Silent	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr12:72893328C>T	ENST00000261180.4	+	6	1596	c.1500C>T	c.(1498-1500)gaC>gaT	p.D500D		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	500					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D500D(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TGCTGCTGGACGGTTTGGCCA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	12											176.0	137.0	150.0					12																	72893328		2203	4300	6503	71179595	SO:0001819	synonymous_variant	29953			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1500C>T	12.37:g.72893328C>T		Somatic		Capture	Illumina GAIIx	Phase_I	71179595	A5PL19|Q6UWJ4	Silent	SNP	ENST00000261180.4	37	CCDS9004.1																																																																																				0.458	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	
FAM222A	84915	broad.mit.edu	37	12	110205819	110205819	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr12:110205819G>A	ENST00000538780.1	+	3	801	c.85G>A	c.(85-87)Gag>Aag	p.E29K	FAM222A_ENST00000358906.3_Missense_Mutation_p.E29K|FAM222A-AS1_ENST00000541460.1_RNA|FAM222A-AS1_ENST00000541723.1_RNA	NM_032829.2	NP_116218.2	Q5U5X8	F222A_HUMAN	family with sequence similarity 222, member A	29								p.E29K(1)									TCCCACAGGCGAGGCGGTGGC	0.642																																																1	Substitution - Missense(1)	ovary(1)	12											45.0	44.0	44.0					12																	110205819		2203	4300	6503	108690202	SO:0001583	missense	84915			AK027627	CCDS9133.1	12q24.11	2012-04-27	2012-04-27	2012-04-27	ENSG00000139438	ENSG00000139438			25915	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 34"""	C12orf34		12477932	Standard	NM_032829		Approved	FLJ14721	uc001tpd.2	Q5U5X8	OTTHUMG00000169260	ENST00000538780.1:c.85G>A	12.37:g.110205819G>A	ENSP00000443292:p.Glu29Lys	Somatic		Capture	Illumina GAIIx	Phase_I	108690202	Q8NCD5|Q96SP6	Missense_Mutation	SNP	ENST00000538780.1	37	CCDS9133.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.884827	0.51908	.	.	ENSG00000139438	ENST00000538780;ENST00000358906	T;T	0.32272	1.46;1.46	3.16	3.16	0.36331	.	0.453258	0.17995	N	0.155080	T	0.26738	0.0654	N	0.22421	0.69	0.51767	D	0.999932	P	0.51537	0.946	P	0.46796	0.527	T	0.12400	-1.0549	10	0.66056	D	0.02	-22.9956	12.9952	0.58642	0.0:0.0:1.0:0.0	.	29	Q5U5X8	CL034_HUMAN	K	29	ENSP00000443292:E29K;ENSP00000351783:E29K	ENSP00000351783:E29K	E	+	1	0	C12orf34	108690202	1.000000	0.71417	0.935000	0.37517	0.725000	0.41563	8.033000	0.88852	1.591000	0.50007	0.305000	0.20034	GAG		0.642	FAM222A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403175.1	NM_032829	
CCDC62	84660	broad.mit.edu	37	12	123276578	123276578	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr12:123276578G>A	ENST00000253079.6	+	6	1026	c.682G>A	c.(682-684)Gaa>Aaa	p.E228K	CCDC62_ENST00000392440.2_Intron|CCDC62_ENST00000537566.1_Intron|CCDC62_ENST00000392441.4_Missense_Mutation_p.E228K	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	228					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)	p.E228K(1)		breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		GGACCTCAATGAAAAGACGAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	12											118.0	119.0	119.0					12																	123276578		2203	4300	6503	121842531	SO:0001583	missense	84660				CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.682G>A	12.37:g.123276578G>A	ENSP00000253079:p.Glu228Lys	Somatic		Capture	Illumina GAIIx	Phase_I	121842531	A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Missense_Mutation	SNP	ENST00000253079.6	37	CCDS9238.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974794	0.34848	.	.	ENSG00000130783	ENST00000253079;ENST00000392441	T;T	0.32988	1.44;1.43	5.11	4.2	0.49525	.	0.184368	0.34314	N	0.004068	T	0.37758	0.1015	L	0.41824	1.3	0.80722	D	1	B;D	0.60160	0.006;0.987	B;P	0.56612	0.011;0.802	T	0.07366	-1.0776	10	0.38643	T	0.18	-23.6379	11.8116	0.52185	0.0:0.177:0.823:0.0	.	228;228	Q6P9F0-2;Q6P9F0	.;CCD62_HUMAN	K	228	ENSP00000253079:E228K;ENSP00000376236:E228K	ENSP00000253079:E228K	E	+	1	0	CCDC62	121842531	1.000000	0.71417	0.931000	0.37212	0.633000	0.38033	3.873000	0.56093	1.236000	0.43740	0.585000	0.79938	GAA		0.398	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400930.1	NM_032573	
TMEM132B	114795	broad.mit.edu	37	12	126004167	126004167	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr12:126004167C>T	ENST00000299308.3	+	4	1282	c.1274C>T	c.(1273-1275)gCc>gTc	p.A425V		NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	425						integral component of membrane (GO:0016021)		p.A425V(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GTCCCTCTTGCCATGGTGAGG	0.483																																																1	Substitution - Missense(1)	ovary(1)	12											79.0	77.0	78.0					12																	126004167		1949	4140	6089	124570120	SO:0001583	missense	114795			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1274C>T	12.37:g.126004167C>T	ENSP00000299308:p.Ala425Val	Somatic		Capture	Illumina GAIIx	Phase_I	124570120	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	c	15.87	2.959275	0.53400	.	.	ENSG00000139364	ENST00000299308	T	0.17370	2.28	5.12	4.24	0.50183	.	0.000000	0.34700	U	0.003748	T	0.19604	0.0471	L	0.42581	1.335	0.80722	D	1	P	0.39282	0.666	B	0.42214	0.38	T	0.01715	-1.1289	10	0.52906	T	0.07	.	13.6578	0.62348	0.0:0.9253:0.0:0.0747	.	425	Q14DG7	T132B_HUMAN	V	425	ENSP00000299308:A425V	ENSP00000299308:A425V	A	+	2	0	TMEM132B	124570120	0.955000	0.32602	0.005000	0.12908	0.932000	0.56968	2.389000	0.44407	1.204000	0.43247	0.621000	0.83404	GCC		0.483	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
POSTN	10631	broad.mit.edu	37	13	38156560	38156560	+	Silent	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr13:38156560G>A	ENST00000379747.4	-	10	1452	c.1335C>T	c.(1333-1335)aaC>aaT	p.N445N	POSTN_ENST00000379742.4_Silent_p.N445N|POSTN_ENST00000379749.4_Silent_p.N445N|POSTN_ENST00000379743.4_Silent_p.N445N|POSTN_ENST00000541481.1_Silent_p.N445N|POSTN_ENST00000541179.1_Silent_p.N445N	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	445	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)	p.N445N(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		GTATTTGCCCGTTGTAAAGCT	0.378																																																1	Substitution - coding silent(1)	ovary(1)	13											153.0	148.0	149.0					13																	38156560		2203	4300	6503	37054560	SO:0001819	synonymous_variant	10631			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1335C>T	13.37:g.38156560G>A		Somatic		Capture	Illumina GAIIx	Phase_I	37054560	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Silent	SNP	ENST00000379747.4	37	CCDS9364.1																																																																																				0.378	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
DHRS2	10202	broad.mit.edu	37	14	24108162	24108162	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr14:24108162G>A	ENST00000250383.6	+	2	565	c.89G>A	c.(88-90)aGg>aAg	p.R30K	DHRS2_ENST00000553896.1_3'UTR|DHRS2_ENST00000344777.7_Missense_Mutation_p.R30K	NM_005794.3	NP_005785.1	Q13268	DHRS2_HUMAN	dehydrogenase/reductase (SDR family) member 2	30					C21-steroid hormone metabolic process (GO:0008207)|cellular response to oxidative stress (GO:0034599)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	carbonyl reductase (NADPH) activity (GO:0004090)	p.R30K(1)		endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00659)		GGGATAGACAGGAAGGGCGTC	0.617																																																1	Substitution - Missense(1)	ovary(1)	14											88.0	88.0	88.0					14																	24108162		2203	4300	6503	23178002	SO:0001583	missense	10202				CCDS9604.1, CCDS41927.1	14q11.2	2011-09-14			ENSG00000100867	ENSG00000100867		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18349	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 1"""	615194				7556196, 11944995, 16685466, 19027726	Standard	NM_182908		Approved	HEP27, SDR25C1	uc001wkt.4	Q13268	OTTHUMG00000028771	ENST00000250383.6:c.89G>A	14.37:g.24108162G>A	ENSP00000250383:p.Arg30Lys	Somatic		Capture	Illumina GAIIx	Phase_I	23178002	D3DS54|Q53GS4|Q7Z789|Q9H2R2	Missense_Mutation	SNP	ENST00000250383.6	37	CCDS9604.1	.	.	.	.	.	.	.	.	.	.	.	11.45	1.642971	0.29246	.	.	ENSG00000100867	ENST00000432832;ENST00000250383;ENST00000344777	D;T;D	0.82255	-1.53;-1.49;-1.59	4.65	-4.11	0.03928	.	2.339910	0.01707	N	0.027508	T	0.69052	0.3068	L	0.31476	0.935	0.09310	N	1	B;B;B;B	0.14438	0.001;0.001;0.006;0.01	B;B;B;B	0.14023	0.01;0.006;0.002;0.008	T	0.51132	-0.8744	10	0.19147	T	0.46	.	2.683	0.05100	0.2787:0.1567:0.4297:0.1349	.	8;30;30;8	Q13268;C9JZP6;D3DS54;Q13268-2	DHRS2_HUMAN;.;.;.	K	30	ENSP00000401213:R30K;ENSP00000250383:R30K;ENSP00000344674:R30K	ENSP00000250383:R30K	R	+	2	0	DHRS2	23178002	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.142000	0.00286	-0.645000	0.05458	-0.471000	0.05019	AGG		0.617	DHRS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000071842.2	NM_182908	
SIX4	51804	broad.mit.edu	37	14	61187159	61187159	+	Missense_Mutation	SNP	A	A	C			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr14:61187159A>C	ENST00000216513.4	-	2	927	c.868T>G	c.(868-870)Tca>Gca	p.S290A		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	290					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S290A(1)		breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		TTGCCATCTGACTCACTGTAT	0.468																																																1	Substitution - Missense(1)	ovary(1)	14											81.0	80.0	80.0					14																	61187159		2203	4300	6503	60256912	SO:0001583	missense	51804			AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.868T>G	14.37:g.61187159A>C	ENSP00000216513:p.Ser290Ala	Somatic		Capture	Illumina GAIIx	Phase_I	60256912	Q4QQH5|Q4V764	Missense_Mutation	SNP	ENST00000216513.4	37	CCDS9749.2	.	.	.	.	.	.	.	.	.	.	A	19.90	3.913123	0.72983	.	.	ENSG00000100625	ENST00000216513;ENST00000556952	D	0.91407	-2.84	5.62	5.62	0.85841	Homeodomain-related (1);Homeodomain-like (1);	0.672116	0.15151	N	0.277722	D	0.91616	0.7351	L	0.34521	1.04	0.54753	D	0.999987	B;D	0.61080	0.181;0.989	B;P	0.58520	0.06;0.84	D	0.91752	0.5413	10	0.66056	D	0.02	.	15.8389	0.78824	1.0:0.0:0.0:0.0	.	282;290	G3V2N2;Q9UIU6	.;SIX4_HUMAN	A	290;282	ENSP00000216513:S290A	ENSP00000216513:S290A	S	-	1	0	SIX4	60256912	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.959000	0.93110	2.150000	0.67090	0.533000	0.62120	TCA		0.468	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072397.2		
GALNT16	57452	broad.mit.edu	37	14	69808446	69808446	+	Silent	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr14:69808446C>T	ENST00000337827.4	+	12	1563	c.1236C>T	c.(1234-1236)ttC>ttT	p.F412F	GALNT16_ENST00000448469.3_Silent_p.F412F|GALNT16_ENST00000553669.1_Silent_p.F412F	NM_001168368.1|NM_020692.2	NP_001161840.1|NP_065743.2	Q8N428	GLT16_HUMAN	polypeptide N-acetylgalactosaminyltransferase 16	412					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.F412F(1)									GCAAGTCCTTCCGCTGGTACC	0.612																																																1	Substitution - coding silent(1)	ovary(1)	14											88.0	59.0	68.0					14																	69808446		2203	4300	6503	68878199	SO:0001819	synonymous_variant	57452			AB032956	CCDS32107.1	14q24.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000100626	ENSG00000100626	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23233	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 16"""	615132	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16"""	GALNTL1		10574461, 22186971	Standard	NM_020692		Approved	KIAA1130, GalNAc-T16	uc010aqu.2	Q8N428	OTTHUMG00000171231	ENST00000337827.4:c.1236C>T	14.37:g.69808446C>T		Somatic		Capture	Illumina GAIIx	Phase_I	68878199	Q4KMG3|Q58A55|Q9ULT9	Silent	SNP	ENST00000337827.4	37	CCDS32107.1																																																																																				0.612	GALNT16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412434.1	NM_001168368	
TMOD3	29766	broad.mit.edu	37	15	52181327	52181327	+	Missense_Mutation	SNP	C	C	G			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr15:52181327C>G	ENST00000308580.7	+	5	762	c.481C>G	c.(481-483)Caa>Gaa	p.Q161E	TMOD3_ENST00000544199.1_Missense_Mutation_p.Q161E|RP11-56B16.5_ENST00000558142.1_RNA	NM_014547.4	NP_055362.1	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)	161						striated muscle thin filament (GO:0005865)	tropomyosin binding (GO:0005523)	p.Q161E(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|stomach(1)	14				all cancers(107;0.00194)		TGGTGTTGACCAAGAACATTT	0.294																																					Colon(122;1837 2251 18387 22826)											1	Substitution - Missense(1)	ovary(1)	15											74.0	75.0	75.0					15																	52181327		2194	4278	6472	49968619	SO:0001583	missense	29766			AF177171	CCDS10145.1	15q21.1-q21.2	2008-05-14			ENSG00000138594	ENSG00000138594			11873	protein-coding gene	gene with protein product		605112				10662549	Standard	NM_014547		Approved	UTMOD	uc002abn.3	Q9NYL9	OTTHUMG00000131803	ENST00000308580.7:c.481C>G	15.37:g.52181327C>G	ENSP00000308753:p.Gln161Glu	Somatic		Capture	Illumina GAIIx	Phase_I	49968619	B2R6G7|Q9NT43|Q9NZR0	Missense_Mutation	SNP	ENST00000308580.7	37	CCDS10145.1	.	.	.	.	.	.	.	.	.	.	C	6.278	0.419327	0.11928	.	.	ENSG00000138594	ENST00000308580;ENST00000544199	T;T	0.12879	2.64;2.64	5.68	9.9E-4	0.14044	.	0.475067	0.22496	N	0.059297	T	0.07234	0.0183	N	0.25647	0.755	0.29655	N	0.843656	B	0.02656	0.0	B	0.01281	0.0	T	0.42481	-0.9449	10	0.07030	T	0.85	-4.8208	9.5548	0.39332	0.389:0.3109:0.3001:0.0	.	161	Q9NYL9	TMOD3_HUMAN	E	161	ENSP00000308753:Q161E;ENSP00000438909:Q161E	ENSP00000308753:Q161E	Q	+	1	0	TMOD3	49968619	0.959000	0.32827	0.577000	0.28562	0.881000	0.50899	1.107000	0.31110	0.022000	0.15160	-0.150000	0.13652	CAA		0.294	TMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254740.3		
RNF111	54778	broad.mit.edu	37	15	59383326	59383326	+	Missense_Mutation	SNP	A	A	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr15:59383326A>T	ENST00000557998.1	+	12	2999	c.2712A>T	c.(2710-2712)agA>agT	p.R904S	RNF111_ENST00000434298.1_Missense_Mutation_p.R913S|RNF111_ENST00000348370.4_Missense_Mutation_p.R904S|RNF111_ENST00000559209.1_Missense_Mutation_p.R913S|RNF111_ENST00000561186.1_Missense_Mutation_p.R913S	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	904					gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R904S(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		CAATTGAAAGATGTACATATC	0.323																																					NSCLC(72;983 1365 10746 34387 47081)											1	Substitution - Missense(1)	ovary(1)	15											119.0	123.0	121.0					15																	59383326		2192	4291	6483	57170618	SO:0001583	missense	54778			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.2712A>T	15.37:g.59383326A>T	ENSP00000452732:p.Arg904Ser	Somatic		Capture	Illumina GAIIx	Phase_I	57170618	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	ENST00000557998.1	37	CCDS58366.1	.	.	.	.	.	.	.	.	.	.	A	16.86	3.239419	0.58995	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.16196	2.36;2.36	5.25	2.95	0.34219	.	0.000000	0.85682	D	0.000000	T	0.27731	0.0682	L	0.49126	1.545	0.80722	D	1	D;D;B	0.62365	0.991;0.981;0.13	P;P;B	0.60541	0.876;0.69;0.162	T	0.00761	-1.1577	10	0.45353	T	0.12	-18.1652	8.5557	0.33480	0.7797:0.0:0.2203:0.0	.	913;904;904	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	S	904;913	ENSP00000288199:R904S;ENSP00000393641:R913S	ENSP00000288199:R904S	R	+	3	2	RNF111	57170618	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.794000	0.47853	0.454000	0.26884	0.528000	0.53228	AGA		0.323	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	NM_017610	
IGF1R	3480	broad.mit.edu	37	15	99472878	99472878	+	Missense_Mutation	SNP	C	C	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr15:99472878C>A	ENST00000268035.6	+	14	3485	c.2874C>A	c.(2872-2874)ttC>ttA	p.F958L	IGF1R_ENST00000558762.1_Missense_Mutation_p.F957L	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	958					axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)	p.F958L(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TGTACGTCTTCCATAGAAAGA	0.438																																																1	Substitution - Missense(1)	ovary(1)	15											185.0	161.0	169.0					15																	99472878		2197	4297	6494	97290401	SO:0001583	missense	3480			M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2874C>A	15.37:g.99472878C>A	ENSP00000268035:p.Phe958Leu	Somatic		Capture	Illumina GAIIx	Phase_I	97290401	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	37	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.963778	0.53507	.	.	ENSG00000140443	ENST00000268035	T	0.74947	-0.89	5.67	3.75	0.43078	.	0.211795	0.32578	N	0.005905	T	0.58538	0.2129	L	0.38531	1.155	0.38780	D	0.954752	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.56056	-0.8042	10	0.37606	T	0.19	.	3.5232	0.07750	0.0:0.5388:0.2296:0.2316	.	957;958	C9J5X1;P08069	.;IGF1R_HUMAN	L	958	ENSP00000268035:F958L	ENSP00000268035:F958L	F	+	3	2	IGF1R	97290401	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.218000	0.32467	1.345000	0.45676	0.655000	0.94253	TTC		0.438	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
XPO6	23214	broad.mit.edu	37	16	28115942	28115942	+	Silent	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr16:28115942G>A	ENST00000304658.5	-	21	3371	c.2871C>T	c.(2869-2871)acC>acT	p.T957T	XPO6_ENST00000565698.1_Silent_p.T943T	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	957					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						TGGCCAGCACGGTGGACTTGA	0.592																																																0			16											69.0	72.0	71.0					16																	28115942		2060	4209	6269	28023443	SO:0001819	synonymous_variant	23214			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.2871C>T	16.37:g.28115942G>A		Somatic		Capture	Illumina GAIIx	Phase_I	28023443	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Silent	SNP	ENST00000304658.5	37	CCDS42135.1																																																																																				0.592	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
SLC5A2	6524	broad.mit.edu	37	16	31499718	31499718	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr16:31499718G>A	ENST00000330498.3	+	9	1055	c.1036G>A	c.(1036-1038)Gtg>Atg	p.V346M	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	346					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)	p.V346M(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	GGTGGCGTGCGTGGTGCCTGA	0.672																																																1	Substitution - Missense(1)	ovary(1)	16											34.0	35.0	35.0					16																	31499718		2196	4299	6495	31407219	SO:0001583	missense	6524				CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.1036G>A	16.37:g.31499718G>A	ENSP00000327943:p.Val346Met	Somatic		Capture	Illumina GAIIx	Phase_I	31407219	A2RRD2	Missense_Mutation	SNP	ENST00000330498.3	37	CCDS10714.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.789172	0.70337	.	.	ENSG00000140675	ENST00000330498;ENST00000419665	D;D	0.89123	-2.47;-2.47	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.94820	0.8327	M	0.87827	2.91	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95220	0.8333	10	0.59425	D	0.04	.	15.2095	0.73209	0.0:0.0:1.0:0.0	.	346	P31639	SC5A2_HUMAN	M	346	ENSP00000327943:V346M;ENSP00000410601:V346M	ENSP00000327943:V346M	V	+	1	0	SLC5A2	31407219	1.000000	0.71417	0.993000	0.49108	0.122000	0.20287	9.650000	0.98490	2.453000	0.82957	0.561000	0.74099	GTG		0.672	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255627.2		
TP53	7157	broad.mit.edu	37	17	7577559	7577559	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs28934573		TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr17:7577559G>A	ENST00000269305.4	-	7	911	c.722C>T	c.(721-723)tCc>tTc	p.S241F	TP53_ENST00000445888.2_Missense_Mutation_p.S241F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.S241F|TP53_ENST00000413465.2_Missense_Mutation_p.S241F|TP53_ENST00000455263.2_Missense_Mutation_p.S241F|TP53_ENST00000359597.4_Missense_Mutation_p.S241F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S241F(85)|p.S241C(26)|p.0?(8)|p.S241Y(8)|p.C242fs*5(6)|p.?(5)|p.S241del(5)|p.S148F(4)|p.N239_C242delNSSC(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.S148C(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCATGCAGGAACTGTTACA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	160	Substitution - Missense(124)|Deletion - In frame(13)|Deletion - Frameshift(9)|Whole gene deletion(8)|Unknown(5)|Complex - deletion inframe(1)	urinary_tract(19)|large_intestine(18)|breast(17)|endometrium(15)|ovary(15)|lung(12)|skin(9)|biliary_tract(8)|central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(7)|upper_aerodigestive_tract(6)|stomach(6)|oesophagus(5)|bone(5)|liver(3)|pancreas(3)|eye(2)|thyroid(1)|kidney(1)	17	GRCh37	CM920673	TP53	M	rs28934573						139.0	108.0	118.0					17																	7577559		2203	4300	6503	7518284	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.722C>T	17.37:g.7577559G>A	ENSP00000269305:p.Ser241Phe	Somatic		Capture	Illumina GAIIx	Phase_I	7518284	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404027	0.62288	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	4.62	3.64	0.41730	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.120078	0.56097	D	0.000022	D	0.99871	0.9939	M	0.92784	3.345	0.53688	A	0.999973	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.96525	0.9388	9	0.87932	D	0	-35.4617	12.8645	0.57932	0.0:0.1651:0.8349:0.0	rs28934573	241;241;148;241;241;241	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	F	241;241;241;241;241;241;230;148;109;148	ENSP00000410739:S241F;ENSP00000352610:S241F;ENSP00000269305:S241F;ENSP00000398846:S241F;ENSP00000391127:S241F;ENSP00000391478:S241F;ENSP00000425104:S109F;ENSP00000423862:S148F	ENSP00000269305:S241F	S	-	2	0	TP53	7518284	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.346000	0.44027	1.295000	0.44724	0.462000	0.41574	TCC		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
RAPGEFL1	51195	broad.mit.edu	37	17	38349236	38349236	+	Silent	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr17:38349236G>A	ENST00000456989.2	+	13	1396	c.1350G>A	c.(1348-1350)gaG>gaA	p.E450E	RAPGEFL1_ENST00000436615.3_Silent_p.E395E|RAPGEFL1_ENST00000544503.1_Silent_p.E444E|RAPGEFL1_ENST00000264644.6_Silent_p.E395E			Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor (GEF)-like 1	601	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.E395E(1)		breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						TGAACATCGAGAAGCTGGTGA	0.517																																					Esophageal Squamous(28;274 750 6870 14218 42203)											1	Substitution - coding silent(1)	ovary(1)	17											138.0	133.0	135.0					17																	38349236		2203	4300	6503	35602762	SO:0001819	synonymous_variant	51195			AF117946	CCDS11363.1	17q21.2	2006-08-01	2004-03-26		ENSG00000108352	ENSG00000108352			17428	protein-coding gene	gene with protein product	"""Link guanine nucleotide exchange factor II"""		"""RAP guanine-nucleotide-exchange factor (GEF)-like 1"""				Standard	NM_016339		Approved	Link-GEFII	uc010cwu.1	Q9UHV5	OTTHUMG00000133325	ENST00000456989.2:c.1350G>A	17.37:g.38349236G>A		Somatic		Capture	Illumina GAIIx	Phase_I	35602762		Silent	SNP	ENST00000456989.2	37																																																																																					0.517	RAPGEFL1-005	PUTATIVE	non_canonical_conserved|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000397518.1	NM_016339	
LIPG	9388	broad.mit.edu	37	18	47091836	47091836	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr18:47091836G>A	ENST00000261292.4	+	2	525	c.247G>A	c.(247-249)Gct>Act	p.A83T	LIPG_ENST00000580036.1_Missense_Mutation_p.A83T|LIPG_ENST00000427224.2_Missense_Mutation_p.A83T|LIPG_ENST00000577628.1_Missense_Mutation_p.A119T	NM_006033.2	NP_006024.1	Q9Y5X9	LIPE_HUMAN	lipase, endothelial	83					cell proliferation (GO:0008283)|cholesterol homeostasis (GO:0042632)|high-density lipoprotein particle remodeling (GO:0034375)|lipid metabolic process (GO:0006629)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|regulation of lipoprotein metabolic process (GO:0050746)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)	extracellular space (GO:0005615)	heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phosphatidylcholine 1-acylhydrolase activity (GO:0008970)|phospholipase activity (GO:0004620)	p.A83T(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(2)	18						CAACATGACAGCTAAAACCTT	0.498																																					Pancreas(126;280 1778 12814 26243 34948)											1	Substitution - Missense(1)	ovary(1)	18											89.0	85.0	86.0					18																	47091836		2203	4300	6503	45345834	SO:0001583	missense	9388			AF118767	CCDS11938.1	18q21.1	2006-04-22				ENSG00000101670			6623	protein-coding gene	gene with protein product		603684				10318835, 10192396	Standard	XM_005258390		Approved	EDL	uc002ldv.3	Q9Y5X9		ENST00000261292.4:c.247G>A	18.37:g.47091836G>A	ENSP00000261292:p.Ala83Thr	Somatic		Capture	Illumina GAIIx	Phase_I	45345834	B0LPG6|Q6P9C8|Q6UW82	Missense_Mutation	SNP	ENST00000261292.4	37	CCDS11938.1	.	.	.	.	.	.	.	.	.	.	G	9.891	1.204219	0.22205	.	.	ENSG00000101670	ENST00000261292;ENST00000427224	D;D	0.90261	-2.64;-2.64	5.1	4.23	0.50019	Lipase, N-terminal (1);	0.158919	0.56097	D	0.000030	D	0.84862	0.5566	N	0.26130	0.795	0.44316	D	0.997198	B;B;B	0.31209	0.313;0.136;0.242	B;B;B	0.36719	0.231;0.231;0.223	T	0.79482	-0.1785	10	0.17369	T	0.5	-21.89	13.4402	0.61108	0.0766:0.0:0.9234:0.0	.	83;83;83	B4DTR8;Q9Y5X9;Q9Y5X9-2	.;LIPE_HUMAN;.	T	83	ENSP00000261292:A83T;ENSP00000387978:A83T	ENSP00000261292:A83T	A	+	1	0	LIPG	45345834	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	5.441000	0.66569	1.170000	0.42753	-0.215000	0.12644	GCT		0.498	LIPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447546.1	NM_006033	
ZNF570	148268	broad.mit.edu	37	19	37976014	37976014	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr19:37976014C>T	ENST00000330173.1	+	5	2019	c.1490C>T	c.(1489-1491)cCc>cTc	p.P497L	ZNF570_ENST00000586475.1_Missense_Mutation_p.P553L|ZNF570_ENST00000388801.3_Missense_Mutation_p.P294L|CTD-2086O20.3_ENST00000591976.1_lincRNA	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P497L(1)		endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGAGAGAGACCCTATGAATGT	0.448																																																1	Substitution - Missense(1)	ovary(1)	19											111.0	114.0	113.0					19																	37976014		2203	4300	6503	42667854	SO:0001583	missense	148268			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.1490C>T	19.37:g.37976014C>T	ENSP00000331540:p.Pro497Leu	Somatic		Capture	Illumina GAIIx	Phase_I	42667854	A1L472|B4DMP1	Missense_Mutation	SNP	ENST00000330173.1	37	CCDS12504.1	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097533	0.56075	.	.	ENSG00000171827	ENST00000330173;ENST00000388801	T;T	0.17054	2.3;2.3	4.25	4.25	0.50352	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41294	D	0.000910	T	0.42854	0.1221	M	0.78223	2.4	0.52501	D	0.999957	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.45086	-0.9285	10	0.87932	D	0	.	14.532	0.67934	0.0:1.0:0.0:0.0	.	294;497	B4DMP1;Q96NI8	.;ZN570_HUMAN	L	497;294	ENSP00000331540:P497L;ENSP00000373453:P294L	ENSP00000331540:P497L	P	+	2	0	ZNF570	42667854	0.985000	0.35326	1.000000	0.80357	0.996000	0.88848	2.814000	0.48010	2.351000	0.79841	0.563000	0.77884	CCC		0.448	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109600.1	NM_144694	
CYP2A7	1549	broad.mit.edu	37	19	41383249	41383249	+	Missense_Mutation	SNP	C	C	G			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr19:41383249C>G	ENST00000301146.4	-	7	1548	c.1007G>C	c.(1006-1008)gGc>gCc	p.G336A	CYP2A7_ENST00000291764.3_Missense_Mutation_p.G285A|CTC-490E21.12_ENST00000601627.1_Intron	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	336						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.G336A(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CCGGTTCTTGCCGATCACTCT	0.522																																																1	Substitution - Missense(1)	ovary(1)	19											94.0	79.0	84.0					19																	41383249		2203	4298	6501	46075089	SO:0001583	missense	1549			NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.1007G>C	19.37:g.41383249C>G	ENSP00000301146:p.Gly336Ala	Somatic		Capture	Illumina GAIIx	Phase_I	46075089	Q13121	Missense_Mutation	SNP	ENST00000301146.4	37	CCDS12569.1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792252	0.50102	.	.	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.16457	4.71;2.34	2.18	2.18	0.27775	.	0.131674	0.50627	U	0.000112	T	0.34629	0.0904	M	0.86343	2.81	0.42839	D	0.994047	P;P;B	0.45176	0.553;0.852;0.398	P;P;B	0.50791	0.575;0.65;0.359	T	0.46470	-0.9189	10	0.87932	D	0	.	11.4495	0.50145	0.0:1.0:0.0:0.0	.	336;285;336	B7ZKR0;F8W816;P20853	.;.;CP2A7_HUMAN	A	336;285	ENSP00000301146:G336A;ENSP00000291764:G285A	ENSP00000291764:G285A	G	-	2	0	CYP2A7	46075089	0.998000	0.40836	0.117000	0.21633	0.656000	0.38851	5.118000	0.64673	1.215000	0.43411	0.184000	0.17185	GGC		0.522	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463269.2	NM_030589	
ZC3H4	23211	broad.mit.edu	37	19	47570553	47570553	+	Missense_Mutation	SNP	T	T	C			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr19:47570553T>C	ENST00000253048.5	-	15	3009	c.2972A>G	c.(2971-2973)aAg>aGg	p.K991R	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	991							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.K991R(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		TGCGTCCTGCTTGGGGATGGG	0.701																																																1	Substitution - Missense(1)	ovary(1)	19											45.0	53.0	51.0					19																	47570553		2056	4179	6235	52262393	SO:0001583	missense	23211			AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.2972A>G	19.37:g.47570553T>C	ENSP00000253048:p.Lys991Arg	Somatic		Capture	Illumina GAIIx	Phase_I	52262393	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	T	18.83	3.707165	0.68615	.	.	ENSG00000130749	ENST00000253048	T	0.56941	0.43	5.02	5.02	0.67125	.	0.121948	0.53938	D	0.000049	T	0.69726	0.3143	M	0.67397	2.05	0.49483	D	0.999797	D	0.71674	0.998	D	0.77004	0.989	T	0.73379	-0.4001	10	0.72032	D	0.01	.	14.0115	0.64500	0.0:0.0:0.0:1.0	.	991	Q9UPT8	ZC3H4_HUMAN	R	991	ENSP00000253048:K991R	ENSP00000253048:K991R	K	-	2	0	ZC3H4	52262393	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	7.384000	0.79751	2.017000	0.59298	0.460000	0.39030	AAG		0.701	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
ZNF547	284306	broad.mit.edu	37	19	57889170	57889170	+	Missense_Mutation	SNP	T	T	G			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr19:57889170T>G	ENST00000282282.3	+	4	976	c.826T>G	c.(826-828)Ttc>Gtc	p.F276V	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F276V(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATGTGGGAAGTTCTTTAAGTG	0.408																																																1	Substitution - Missense(1)	ovary(1)	19											130.0	121.0	124.0					19																	57889170		2203	4300	6503	62580982	SO:0001583	missense	284306			AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.826T>G	19.37:g.57889170T>G	ENSP00000282282:p.Phe276Val	Somatic		Capture	Illumina GAIIx	Phase_I	62580982	A8K5Z9|Q96NC4	Missense_Mutation	SNP	ENST00000282282.3	37	CCDS33131.1	.	.	.	.	.	.	.	.	.	.	T	13.98	2.399399	0.42512	.	.	ENSG00000152433	ENST00000391704;ENST00000282282	T	0.16743	2.32	1.87	0.773	0.18516	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05960	0.0155	N	0.02111	-0.68	0.09310	N	1	B;B;B	0.25441	0.009;0.007;0.126	B;B;B	0.26094	0.006;0.003;0.066	T	0.42799	-0.9430	9	0.24483	T	0.36	.	7.3136	0.26488	0.0:0.0:0.2683:0.7317	.	276;276;276	Q8IVP9-2;C9JTQ3;Q8IVP9	.;.;ZN547_HUMAN	V	276	ENSP00000282282:F276V	ENSP00000282282:F276V	F	+	1	0	ZNF547	62580982	0.000000	0.05858	0.002000	0.10522	0.940000	0.58332	-0.607000	0.05648	0.204000	0.20548	0.402000	0.26972	TTC		0.408	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465787.1	NM_173631	
TSGA10	80705	broad.mit.edu	37	2	99688314	99688314	+	Missense_Mutation	SNP	A	A	G			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr2:99688314A>G	ENST00000393483.3	-	14	1806	c.962T>C	c.(961-963)gTg>gCg	p.V321A	TSGA10_ENST00000542655.1_3'UTR|TSGA10_ENST00000355053.4_Missense_Mutation_p.V321A|TSGA10_ENST00000539964.1_Missense_Mutation_p.V321A|TSGA10_ENST00000478090.1_5'UTR|TSGA10_ENST00000410001.1_Missense_Mutation_p.V321A	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	321					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.V321A(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						TTGTTCACACACAATTAGGGC	0.423																																																1	Substitution - Missense(1)	ovary(1)	2											146.0	134.0	138.0					2																	99688314		2203	4300	6503	99054746	SO:0001583	missense	80705			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.962T>C	2.37:g.99688314A>G	ENSP00000377123:p.Val321Ala	Somatic		Capture	Illumina GAIIx	Phase_I	99054746	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	ENST00000393483.3	37	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	A	11.90	1.776828	0.31411	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	D;D;D;D;T;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.08;-1.55	5.35	5.35	0.76521	.	0.156624	0.45606	D	0.000350	T	0.63034	0.2477	N	0.08118	0	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.58934	-0.7548	10	0.09084	T	0.74	-8.4088	9.4583	0.38769	0.8216:0.1784:0.0:0.0	.	321	Q9BZW7	TSG10_HUMAN	A	321	ENSP00000377123:V321A;ENSP00000386956:V321A;ENSP00000347161:V321A;ENSP00000444419:V321A;ENSP00000386508:V321A;ENSP00000377122:V321A	ENSP00000347161:V321A	V	-	2	0	TSGA10	99054746	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.749000	0.26320	2.258000	0.74832	0.529000	0.55759	GTG		0.423	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
GLI2	2736	broad.mit.edu	37	2	121747935	121747935	+	Missense_Mutation	SNP	G	G	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr2:121747935G>T	ENST00000452319.1	+	14	4505	c.4445G>T	c.(4444-4446)aGc>aTc	p.S1482I	GLI2_ENST00000361492.4_Missense_Mutation_p.S1482I|GLI2_ENST00000314490.11_Intron					GLI family zinc finger 2									p.S1482I(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				TGTCAGGACAGCATCCAGCCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	2											69.0	74.0	72.0					2																	121747935		2203	4300	6503	121464405	SO:0001583	missense	2736				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.4445G>T	2.37:g.121747935G>T	ENSP00000390436:p.Ser1482Ile	Somatic		Capture	Illumina GAIIx	Phase_I	121464405		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	G	7.064	0.566976	0.13560	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.15834	2.39;2.39	4.36	1.53	0.23141	.	0.565334	0.18369	N	0.143321	T	0.16557	0.0398	L	0.50333	1.59	0.19300	N	0.999979	P;P	0.49559	0.877;0.925	B;P	0.44990	0.216;0.466	T	0.16541	-1.0399	10	0.20519	T	0.43	.	9.6278	0.39761	0.3686:0.0:0.6314:0.0	.	1482;1137	P10070;P10070-2	GLI2_HUMAN;.	I	1482	ENSP00000390436:S1482I;ENSP00000354586:S1482I	ENSP00000354586:S1482I	S	+	2	0	GLI2	121464405	0.014000	0.17966	0.109000	0.21407	0.410000	0.31052	0.467000	0.22035	0.119000	0.18210	-0.263000	0.10527	AGC		0.637	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
NCKAP5	344148	broad.mit.edu	37	2	133542216	133542216	+	Missense_Mutation	SNP	C	C	G			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr2:133542216C>G	ENST00000409261.1	-	14	2541	c.2168G>C	c.(2167-2169)aGa>aCa	p.R723T	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.R723T|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	723										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGCAGCAGCTCTTGGCTGTAA	0.413																																																0			2											82.0	77.0	79.0					2																	133542216		1845	4111	5956	133258686	SO:0001583	missense	344148			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2168G>C	2.37:g.133542216C>G	ENSP00000387128:p.Arg723Thr	Somatic		Capture	Illumina GAIIx	Phase_I	133258686	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	c	11.24	1.580306	0.28180	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.42131	0.98;0.98	5.4	3.34	0.38264	.	0.424346	0.16877	U	0.195854	T	0.22166	0.0534	N	0.08118	0	0.49582	D	0.999802	B	0.02656	0.0	B	0.01281	0.0	T	0.04347	-1.0958	10	0.66056	D	0.02	.	7.2791	0.26302	0.0:0.5923:0.3046:0.1031	.	723	O14513	NCKP5_HUMAN	T	723	ENSP00000387128:R723T;ENSP00000380603:R723T	ENSP00000380603:R723T	R	-	2	0	NCKAP5	133258686	0.000000	0.05858	0.508000	0.27688	0.893000	0.52053	0.198000	0.17217	0.650000	0.30769	0.651000	0.88453	AGA		0.413	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
LCT	3938	broad.mit.edu	37	2	136564711	136564711	+	Missense_Mutation	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr2:136564711G>A	ENST00000264162.2	-	9	4170	c.4160C>T	c.(4159-4161)tCt>tTt	p.S1387F		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1387	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.S1387F(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	ATATGCAGCAGAAGCTGCACT	0.567																																																1	Substitution - Missense(1)	ovary(1)	2											126.0	101.0	110.0					2																	136564711		2203	4300	6503	136281181	SO:0001583	missense	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4160C>T	2.37:g.136564711G>A	ENSP00000264162:p.Ser1387Phe	Somatic		Capture	Illumina GAIIx	Phase_I	136281181	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807347	0.90623	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.35421	1.31	5.87	5.87	0.94306	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.345527	0.33346	N	0.005004	T	0.69205	0.3085	M	0.91612	3.225	0.38057	D	0.935965	D	0.56035	0.974	D	0.64687	0.928	T	0.76900	-0.2788	10	0.72032	D	0.01	-17.9564	20.2191	0.98319	0.0:0.0:1.0:0.0	.	1387	P09848	LPH_HUMAN	F	1387;819	ENSP00000264162:S1387F	ENSP00000264162:S1387F	S	-	2	0	LCT	136281181	0.997000	0.39634	0.728000	0.30774	0.967000	0.64934	7.610000	0.82949	2.780000	0.95670	0.655000	0.94253	TCT		0.567	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
RBM44	375316	broad.mit.edu	37	2	238722286	238722286	+	Missense_Mutation	SNP	G	G	C			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr2:238722286G>C	ENST00000409864.1	+	2	291	c.37G>C	c.(37-39)Ggt>Cgt	p.G13R	RBM44_ENST00000316997.4_Missense_Mutation_p.G13R|RBM44_ENST00000444524.2_3'UTR			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	12						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)	p.G13R(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		GACAGCATCTGGTAAAGGCTA	0.388																																																1	Substitution - Missense(1)	ovary(1)	2											68.0	67.0	67.0					2																	238722286		1902	4125	6027	238387025	SO:0001583	missense	375316			AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.37G>C	2.37:g.238722286G>C	ENSP00000386727:p.Gly13Arg	Somatic		Capture	Illumina GAIIx	Phase_I	238387025	A0AUW3	Missense_Mutation	SNP	ENST00000409864.1	37	CCDS46554.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.568301	0.45798	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.29397	1.57;1.57	4.25	0.503	0.16940	.	1.272590	0.05356	N	0.532843	T	0.27524	0.0676	L	0.34521	1.04	0.09310	N	1	P	0.44877	0.845	B	0.44278	0.445	T	0.25502	-1.0130	10	0.54805	T	0.06	-1.3307	6.2308	0.20734	0.4266:0.0:0.5734:0.0	.	12	Q6ZP01	RBM44_HUMAN	R	13	ENSP00000321179:G13R;ENSP00000386727:G13R	ENSP00000321179:G13R	G	+	1	0	RBM44	238387025	0.199000	0.23386	0.001000	0.08648	0.894000	0.52154	-0.074000	0.11450	0.076000	0.16826	0.655000	0.94253	GGT		0.388	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504	
PLCB4	5332	broad.mit.edu	37	20	9346157	9346157	+	Silent	SNP	A	A	C			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr20:9346157A>C	ENST00000378493.1	+	6	514	c.499A>C	c.(499-501)Agg>Cgg	p.R167R	PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000278655.4_Silent_p.R167R|PLCB4_ENST00000414679.2_Silent_p.R167R|PLCB4_ENST00000378501.2_Silent_p.R167R|PLCB4_ENST00000378473.3_Silent_p.R167R|PLCB4_ENST00000334005.3_Silent_p.R167R			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	167					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.R167R(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						AATTCCAGTTAGGAGGTAAGT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	20											126.0	113.0	118.0					20																	9346157		2203	4300	6503	9294157	SO:0001819	synonymous_variant	5332				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.499A>C	20.37:g.9346157A>C		Somatic		Capture	Illumina GAIIx	Phase_I	9294157	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	ENST00000378493.1	37	CCDS13105.1																																																																																				0.408	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
JAG1	182	broad.mit.edu	37	20	10622147	10622147	+	Silent	SNP	C	C	T	rs142085300		TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr20:10622147C>T	ENST00000254958.5	-	23	3392	c.2877G>A	c.(2875-2877)gcG>gcA	p.A959A	JAG1_ENST00000423891.2_Silent_p.A800A	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	959					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)	p.A959A(1)		biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						ATGTGATGTTCGCACAGTTAT	0.463									Alagille Syndrome																																							1	Substitution - coding silent(1)	ovary(1)	20						C		0,4406		0,0,2203	151.0	147.0	148.0		2877	-11.6	0.7	20	dbSNP_134	148	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	JAG1	NM_000214.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		959/1219	10622147	2,13004	2203	4300	6503	10570147	SO:0001819	synonymous_variant	182	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.2877G>A	20.37:g.10622147C>T		Somatic		Capture	Illumina GAIIx	Phase_I	10570147	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Silent	SNP	ENST00000254958.5	37	CCDS13112.1																																																																																				0.463	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
PCSK2	5126	broad.mit.edu	37	20	17434520	17434520	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr20:17434520C>T	ENST00000262545.2	+	9	1334	c.1019C>T	c.(1018-1020)aCt>aTt	p.T340I	PCSK2_ENST00000536609.1_Missense_Mutation_p.T305I|PCSK2_ENST00000377899.1_Missense_Mutation_p.T321I	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	340	Peptidase S8.				cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.T340I(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GACGGCAGGACTGCCCTGTAC	0.622																																																1	Substitution - Missense(1)	ovary(1)	20											152.0	113.0	126.0					20																	17434520		2203	4300	6503	17382520	SO:0001583	missense	5126			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1019C>T	20.37:g.17434520C>T	ENSP00000262545:p.Thr340Ile	Somatic		Capture	Illumina GAIIx	Phase_I	17382520	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	37	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	C	19.79	3.892908	0.72524	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	D;D;D	0.86694	-2.16;-2.16;-2.16	5.69	5.69	0.88448	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.90428	0.7003	L	0.32530	0.975	0.80722	D	1	D;B	0.76494	0.999;0.236	D;B	0.77557	0.99;0.115	D	0.91210	0.4998	10	0.72032	D	0.01	-25.2548	18.389	0.90475	0.0:1.0:0.0:0.0	.	305;340	B4DFQ3;P16519	.;NEC2_HUMAN	I	321;340;305	ENSP00000367131:T321I;ENSP00000262545:T340I;ENSP00000437458:T305I	ENSP00000262545:T340I	T	+	2	0	PCSK2	17382520	1.000000	0.71417	0.960000	0.40013	0.297000	0.27493	7.813000	0.86123	2.692000	0.91855	0.655000	0.94253	ACT		0.622	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
HHATL	57467	broad.mit.edu	37	3	42739827	42739827	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr3:42739827C>T	ENST00000441594.1	-	6	761	c.500G>A	c.(499-501)gGc>gAc	p.G167D	HHATL_ENST00000310417.5_Missense_Mutation_p.G167D	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	167					negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.G167D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		ATCAAAAGTGCCTGTTACAAA	0.572																																																1	Substitution - Missense(1)	ovary(1)	3											61.0	62.0	62.0					3																	42739827		2203	4300	6503	42714831	SO:0001583	missense	57467			AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.500G>A	3.37:g.42739827C>T	ENSP00000405423:p.Gly167Asp	Somatic		Capture	Illumina GAIIx	Phase_I	42714831	Q8TBG3|Q9ULP7	Missense_Mutation	SNP	ENST00000441594.1	37	CCDS2704.1	.	.	.	.	.	.	.	.	.	.	c	17.64	3.438633	0.62955	.	.	ENSG00000010282	ENST00000310417;ENST00000441594;ENST00000341477;ENST00000457462;ENST00000416756;ENST00000455195;ENST00000417472	D;D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26;-2.26	5.07	4.18	0.49190	.	0.094699	0.64402	D	0.000001	D	0.84247	0.5430	L	0.54323	1.7	0.80722	D	1	P	0.34864	0.473	B	0.38712	0.28	T	0.80386	-0.1404	10	0.19147	T	0.46	-26.4652	13.958	0.64162	0.0:0.9257:0.0:0.0743	.	167	Q9HCP6	HHATL_HUMAN	D	167;167;76;102;167;167;102	ENSP00000310621:G167D;ENSP00000405423:G167D;ENSP00000403787:G102D;ENSP00000395779:G167D;ENSP00000415351:G167D	ENSP00000310621:G167D	G	-	2	0	HHATL	42714831	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	5.864000	0.69575	2.643000	0.89663	0.556000	0.70494	GGC		0.572	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343627.1	NM_020707	
ZMYND10	51364	broad.mit.edu	37	3	50382649	50382649	+	Missense_Mutation	SNP	T	T	C			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr3:50382649T>C	ENST00000231749.3	-	2	1379	c.107A>G	c.(106-108)cAt>cGt	p.H36R	ZMYND10_ENST00000360165.3_Missense_Mutation_p.H36R|NPRL2_ENST00000493465.1_5'Flank|ZMYND10_ENST00000490675.1_5'Flank|ZMYND10-AS1_ENST00000440013.1_RNA	NM_015896.2	NP_056980.2	O75800	ZMY10_HUMAN	zinc finger, MYND-type containing 10	36					inner dynein arm assembly (GO:0036159)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)	centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)	metal ion binding (GO:0046872)	p.H36R(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|urinary_tract(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CAGGTTCTCATGCTGCTGGTT	0.582										TSP Lung(30;0.18)																																						1	Substitution - Missense(1)	ovary(1)	3											141.0	113.0	123.0					3																	50382649		2203	4300	6503	50357653	SO:0001583	missense	51364			U70824	CCDS2825.1	3p21.3	2014-02-03			ENSG00000004838	ENSG00000004838		"""Zinc fingers, MYND-type"""	19412	protein-coding gene	gene with protein product		607070				12629521, 23891469	Standard	NM_015896		Approved	BLU, CILD22	uc003dag.1	O75800	OTTHUMG00000156874	ENST00000231749.3:c.107A>G	3.37:g.50382649T>C	ENSP00000231749:p.His36Arg	Somatic		Capture	Illumina GAIIx	Phase_I	50357653	A6NK41|B3KU54|O14570|O75801|Q53FE6|Q8N4R6|Q8NDN6	Missense_Mutation	SNP	ENST00000231749.3	37	CCDS2825.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.020796	0.75275	.	.	ENSG00000004838	ENST00000231749;ENST00000360165	T;T	0.28069	1.63;1.63	4.98	4.98	0.66077	.	0.045659	0.85682	D	0.000000	T	0.40932	0.1137	M	0.70275	2.135	0.58432	D	0.999999	P;P	0.52170	0.951;0.64	P;B	0.46796	0.527;0.256	T	0.40961	-0.9535	10	0.48119	T	0.1	-16.4722	14.9628	0.71169	0.0:0.0:0.0:1.0	.	36;36	O75800-2;O75800	.;ZMY10_HUMAN	R	36	ENSP00000231749:H36R;ENSP00000353289:H36R	ENSP00000231749:H36R	H	-	2	0	ZMYND10	50357653	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	7.318000	0.79029	1.998000	0.58463	0.379000	0.24179	CAT		0.582	ZMYND10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346376.1	NM_015896	
APOD	347	broad.mit.edu	37	3	195295826	195295826	+	Missense_Mutation	SNP	A	A	G			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr3:195295826A>G	ENST00000343267.3	-	5	876	c.515T>C	c.(514-516)aTt>aCt	p.I172T		NM_001647.3	NP_001638.1	P05090	APOD_HUMAN	apolipoprotein D	172					aging (GO:0007568)|angiogenesis (GO:0001525)|brain development (GO:0007420)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of lipoprotein lipid oxidation (GO:0060588)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of T cell migration (GO:2000405)|peripheral nervous system axon regeneration (GO:0014012)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to reactive oxygen species (GO:0000302)|tissue regeneration (GO:0042246)	cytosolic ribosome (GO:0022626)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|lipid transporter activity (GO:0005319)	p.I172T(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CTTGACATCAATGTTATTAGA	0.453																																																1	Substitution - Missense(1)	ovary(1)	3											160.0	158.0	158.0					3																	195295826		2203	4300	6503	196777115	SO:0001583	missense	347				CCDS33925.1	3q29	2013-09-19			ENSG00000189058	ENSG00000189058		"""Lipocalins"", ""Apolipoproteins"""	612	protein-coding gene	gene with protein product		107740				2439269, 3453108	Standard	NM_001647		Approved		uc003fur.2	P05090	OTTHUMG00000155854	ENST00000343267.3:c.515T>C	3.37:g.195295826A>G	ENSP00000345179:p.Ile172Thr	Somatic		Capture	Illumina GAIIx	Phase_I	196777115	B2R579|D3DNW6|Q6IBG6	Missense_Mutation	SNP	ENST00000343267.3	37	CCDS33925.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.595630	0.46318	.	.	ENSG00000189058	ENST00000343267;ENST00000421243	T;T	0.31247	1.5;1.5	6.06	6.06	0.98353	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.000000	0.85682	D	0.000000	T	0.64349	0.2590	M	0.92691	3.335	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73154	-0.4072	10	0.87932	D	0	-24.4629	13.0011	0.58676	1.0:0.0:0.0:0.0	.	172	P05090	APOD_HUMAN	T	172;200	ENSP00000345179:I172T;ENSP00000415235:I200T	ENSP00000345179:I172T	I	-	2	0	APOD	196777115	1.000000	0.71417	0.171000	0.22900	0.030000	0.12068	6.515000	0.73751	2.324000	0.78689	0.533000	0.62120	ATT		0.453	APOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342004.1	NM_001647	
JAKMIP1	152789	broad.mit.edu	37	4	6086641	6086641	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr4:6086641C>T	ENST00000282924.5	-	5	1371	c.886G>A	c.(886-888)Gaa>Aaa	p.E296K	JAKMIP1_ENST00000410077.2_Missense_Mutation_p.E131K|JAKMIP1_ENST00000409021.3_Missense_Mutation_p.E296K|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.E131K|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.E296K|JAKMIP1_ENST00000457227.2_5'UTR	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	296	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)	p.E296*(2)|p.E296K(1)		NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GAATTCAGTTCAGCAATTTTT	0.393																																																3	Substitution - Nonsense(2)|Substitution - Missense(1)	lung(2)|ovary(1)	4											233.0	226.0	228.0					4																	6086641		2203	4300	6503	6137542	SO:0001583	missense	152789			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.886G>A	4.37:g.6086641C>T	ENSP00000282924:p.Glu296Lys	Somatic		Capture	Illumina GAIIx	Phase_I	6137542	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	37	CCDS3385.1	.	.	.	.	.	.	.	.	.	.	C	32	5.136085	0.94517	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000418227;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.45276	1.37;0.96;1.37;1.37;0.9	4.79	4.79	0.61399	.	0.216872	0.32640	N	0.005823	T	0.59555	0.2202	L	0.54323	1.7	0.51482	D	0.999929	D;B;D;D;B	0.67145	0.996;0.008;0.996;0.996;0.035	D;B;D;D;B	0.76071	0.981;0.009;0.987;0.987;0.015	T	0.63323	-0.6663	10	0.87932	D	0	.	15.0225	0.71640	0.0:1.0:0.0:0.0	.	131;296;131;296;296	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	K	296;131;296;296;188;296;296;131	ENSP00000386711:E296K;ENSP00000387042:E131K;ENSP00000282924:E296K;ENSP00000386925:E296K;ENSP00000386745:E131K	ENSP00000282924:E296K	E	-	1	0	JAKMIP1	6137542	1.000000	0.71417	0.988000	0.46212	0.973000	0.67179	7.396000	0.79891	2.203000	0.70933	0.591000	0.81541	GAA		0.393	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	
LARP7	51574	broad.mit.edu	37	4	113571627	113571627	+	Silent	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr4:113571627G>A	ENST00000344442.5	+	10	1583	c.1305G>A	c.(1303-1305)agG>agA	p.R435R	MIR367_ENST00000362299.1_RNA|MIR302B_ENST00000505215.1_RNA|MIR302B_ENST00000510655.1_RNA|MIR302A_ENST00000385192.1_RNA|MIR302B_ENST00000362188.1_RNA|MIR302D_ENST00000362275.1_RNA|MIR302C_ENST00000362232.1_RNA|MIR302B_ENST00000509938.1_RNA|LARP7_ENST00000324052.6_Silent_p.R435R|LARP7_ENST00000509061.1_Silent_p.R442R	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	435					RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R435R(1)		endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CAGCCAACAGGGAAGAGTGTC	0.428																																																1	Substitution - coding silent(1)	ovary(1)	4											107.0	99.0	102.0					4																	113571627		2203	4300	6503	113791076	SO:0001819	synonymous_variant	51574			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.1305G>A	4.37:g.113571627G>A		Somatic		Capture	Illumina GAIIx	Phase_I	113791076	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Silent	SNP	ENST00000344442.5	37	CCDS3701.2	.	.	.	.	.	.	.	.	.	.	G	0.252	-1.005741	0.02112	.	.	ENSG00000174720	ENST00000511529	.	.	.	5.4	4.22	0.49857	.	.	.	.	.	T	0.62332	0.2419	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59026	-0.7531	4	.	.	.	-1.209	11.0415	0.47833	0.0:0.0:0.1577:0.8422	.	.	.	.	E	229	.	.	G	+	2	0	LARP7	113791076	0.888000	0.30383	0.009000	0.14445	0.057000	0.15508	1.145000	0.31577	0.886000	0.36113	-0.335000	0.08231	GGG		0.428	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256417.2	NM_016648	
RNF150	57484	broad.mit.edu	37	4	141889014	141889014	+	Silent	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr4:141889014G>A	ENST00000515673.2	-	2	531	c.498C>T	c.(496-498)atC>atT	p.I166I	RNF150_ENST00000306799.3_Silent_p.I166I|RNF150_ENST00000379512.2_Silent_p.I25I|RNF150_ENST00000420921.2_Silent_p.I25I|RNF150_ENST00000515057.1_5'UTR|RNF150_ENST00000507500.1_Silent_p.I166I			Q9ULK6	RN150_HUMAN	ring finger protein 150	166	PA.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.I75I(1)		breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					TTATGGCCACGATGTCTTCTA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	4											186.0	159.0	168.0					4																	141889014		2203	4300	6503	142108464	SO:0001819	synonymous_variant	57484			AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.498C>T	4.37:g.141889014G>A		Somatic		Capture	Illumina GAIIx	Phase_I	142108464	Q3T1D0|Q6ZNW6	Silent	SNP	ENST00000515673.2	37	CCDS34065.1																																																																																				0.488	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364739.2	XM_291090	
FAT2	2196	broad.mit.edu	37	5	150922494	150922494	+	Missense_Mutation	SNP	G	G	C			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr5:150922494G>C	ENST00000261800.5	-	9	8206	c.8194C>G	c.(8194-8196)Cct>Gct	p.P2732A		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2732	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P2732A(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTGCTCTCAGGTGTAGTGCCC	0.512																																																1	Substitution - Missense(1)	ovary(1)	5											111.0	102.0	105.0					5																	150922494		2203	4300	6503	150902687	SO:0001583	missense	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.8194C>G	5.37:g.150922494G>C	ENSP00000261800:p.Pro2732Ala	Somatic		Capture	Illumina GAIIx	Phase_I	150902687	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	6.275	0.418867	0.11870	.	.	ENSG00000086570	ENST00000261800	T	0.49432	0.78	5.55	4.66	0.58398	Cadherin (4);Cadherin-like (1);	0.200628	0.35466	N	0.003194	T	0.37919	0.1021	L	0.60845	1.875	0.09310	N	1	B	0.27932	0.194	B	0.27887	0.084	T	0.35724	-0.9777	10	0.02654	T	1	.	10.31	0.43704	0.0:0.1222:0.5982:0.2795	.	2732	Q9NYQ8	FAT2_HUMAN	A	2732	ENSP00000261800:P2732A	ENSP00000261800:P2732A	P	-	1	0	FAT2	150902687	0.980000	0.34600	0.998000	0.56505	0.965000	0.64279	2.079000	0.41577	1.299000	0.44798	0.462000	0.41574	CCT		0.512	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
ABCC10	89845	broad.mit.edu	37	6	43412975	43412975	+	Missense_Mutation	SNP	C	C	T	rs144273435		TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr6:43412975C>T	ENST00000372530.4	+	14	3168	c.2953C>T	c.(2953-2955)Cgg>Tgg	p.R985W	ABCC10_ENST00000244533.3_Missense_Mutation_p.R957W	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	985	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.R957W(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	CACCCTTCTCCGGGCAGTGCT	0.607																																																1	Substitution - Missense(1)	ovary(1)	6						C	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	82.0	63.0	69.0		2953,2869	4.7	1.0	6	dbSNP_134	69	1,8599	2.2+/-6.3	0,1,4299	no	missense,missense	ABCC10	NM_001198934.1,NM_033450.2	101,101	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	985/1493,957/1465	43412975	2,13004	2203	4300	6503	43520953	SO:0001583	missense	89845			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.2953C>T	6.37:g.43412975C>T	ENSP00000361608:p.Arg985Trp	Somatic		Capture	Illumina GAIIx	Phase_I	43520953	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.974853	0.74360	2.27E-4	1.16E-4	ENSG00000124574	ENST00000372530;ENST00000244533	D;D	0.89552	-2.53;-2.53	4.69	4.69	0.59074	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.064498	0.64402	D	0.000008	D	0.95354	0.8492	H	0.94658	3.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.987	D	0.96137	0.9097	10	0.87932	D	0	-26.1574	13.6566	0.62341	0.1551:0.8449:0.0:0.0	.	957;985	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	W	985;957	ENSP00000361608:R985W;ENSP00000244533:R957W	ENSP00000244533:R957W	R	+	1	2	ABCC10	43520953	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.702000	0.47102	2.428000	0.82296	0.563000	0.77884	CGG		0.607	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
SOGA3	387104	broad.mit.edu	37	6	127797200	127797200	+	Silent	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr6:127797200C>T	ENST00000525778.1	-	6	2716	c.1971G>A	c.(1969-1971)gaG>gaA	p.E657E	SOGA3_ENST00000556132.1_Silent_p.E657E|SOGA3_ENST00000465909.2_Silent_p.E657E|SOGA3_ENST00000474293.2_5'Flank|SOGA3_ENST00000368268.2_Silent_p.E657E|SOGA3_ENST00000481848.2_Silent_p.E657E			Q5TF21	SOGA3_HUMAN	SOGA family member 3	657					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.E657E(1)									TCCGCAGCAGCTCCGTCTCGT	0.642																																																1	Substitution - coding silent(1)	ovary(1)	6											51.0	57.0	55.0					6																	127797200		2188	4287	6475	127838893	SO:0001819	synonymous_variant	387104			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.1971G>A	6.37:g.127797200C>T		Somatic		Capture	Illumina GAIIx	Phase_I	127838893		Silent	SNP	ENST00000525778.1	37	CCDS43505.1																																																																																				0.642	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
PHACTR2	9749	broad.mit.edu	37	6	144086568	144086568	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr6:144086568C>T	ENST00000427704.2	+	6	962	c.832C>T	c.(832-834)Cac>Tac	p.H278Y	PHACTR2_ENST00000440869.2_Missense_Mutation_p.H289Y|PHACTR2_ENST00000367582.3_Missense_Mutation_p.H209Y|PHACTR2_ENST00000367584.4_Missense_Mutation_p.H266Y|PHACTR2_ENST00000305766.6_Missense_Mutation_p.H198Y	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2	278							protein phosphatase inhibitor activity (GO:0004864)	p.H198Y(1)		NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		AATAACTTCTCACCTGTCCTC	0.507																																					Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)											1	Substitution - Missense(1)	ovary(1)	6											88.0	92.0	91.0					6																	144086568		1988	4182	6170	144128261	SO:0001583	missense	9749			AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.832C>T	6.37:g.144086568C>T	ENSP00000391763:p.His278Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	144128261	A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Missense_Mutation	SNP	ENST00000427704.2	37	CCDS47492.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.531508	0.45073	.	.	ENSG00000112419	ENST00000367584;ENST00000427704;ENST00000305766;ENST00000440869;ENST00000367582;ENST00000451827;ENST00000542769;ENST00000367583	T;T;T;T;T;T	0.44083	1.55;1.91;1.56;1.91;1.56;0.93	5.22	5.22	0.72569	.	1.216630	0.05419	N	0.543945	T	0.17916	0.0430	N	0.08118	0	0.80722	D	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.0	T	0.01476	-1.1345	10	0.59425	D	0.04	.	16.9731	0.86305	0.0:1.0:0.0:0.0	.	289;198;209;278	O75167-4;O75167-5;O75167-2;O75167	.;.;.;PHAR2_HUMAN	Y	266;278;198;289;209;156;153;156	ENSP00000356556:H266Y;ENSP00000391763:H278Y;ENSP00000305530:H198Y;ENSP00000417038:H289Y;ENSP00000356554:H209Y;ENSP00000442153:H153Y	ENSP00000305530:H198Y	H	+	1	0	PHACTR2	144128261	0.069000	0.21087	0.010000	0.14722	0.008000	0.06430	3.434000	0.52841	2.450000	0.82876	0.655000	0.94253	CAC		0.507	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042528.2	NM_014721	
MACC1	346389	broad.mit.edu	37	7	20197898	20197898	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr7:20197898C>T	ENST00000400331.5	-	5	2394	c.2086G>A	c.(2086-2088)Gtt>Att	p.V696I	MACC1_ENST00000332878.4_Missense_Mutation_p.V696I|MACC1_ENST00000589011.1_Missense_Mutation_p.V696I	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	696					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V696I(1)		endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						TTCTTTATAACATAAGAAACT	0.353																																																1	Substitution - Missense(1)	ovary(1)	7											73.0	78.0	77.0					7																	20197898		2203	4298	6501	20164423	SO:0001583	missense	346389				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.2086G>A	7.37:g.20197898C>T	ENSP00000383185:p.Val696Ile	Somatic		Capture	Illumina GAIIx	Phase_I	20164423	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.012862	0.35511	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.32515	1.45;1.45	5.75	2.97	0.34412	.	0.166739	0.52532	N	0.000065	T	0.28499	0.0705	L	0.56280	1.765	0.54753	D	0.999988	B	0.22541	0.071	B	0.19666	0.026	T	0.05099	-1.0906	10	0.45353	T	0.12	-11.3448	11.1124	0.48241	0.0:0.7983:0.0:0.2017	.	696	Q6ZN28	MACC1_HUMAN	I	696	ENSP00000383185:V696I;ENSP00000328410:V696I	ENSP00000328410:V696I	V	-	1	0	MACC1	20164423	1.000000	0.71417	0.874000	0.34290	0.968000	0.65278	2.188000	0.42612	0.350000	0.24002	0.655000	0.94253	GTT		0.353	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
HERPUD2	64224	broad.mit.edu	37	7	35709888	35709888	+	Silent	SNP	G	G	C			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr7:35709888G>C	ENST00000396081.1	-	3	1080	c.276C>G	c.(274-276)ccC>ccG	p.P92P	HERPUD2_ENST00000311350.3_Silent_p.P92P|HERPUD2_ENST00000426180.1_5'Flank	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	92					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.P92P(1)		kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						TTGGAGAACTGGGAGGAGTCC	0.378																																																1	Substitution - coding silent(1)	ovary(1)	7											153.0	143.0	147.0					7																	35709888		2203	4300	6503	35676413	SO:0001819	synonymous_variant	64224			BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.276C>G	7.37:g.35709888G>C		Somatic		Capture	Illumina GAIIx	Phase_I	35676413	A4D1Y8|Q9H6F9	Silent	SNP	ENST00000396081.1	37	CCDS5446.1																																																																																				0.378	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250584.1	NM_022373	
RIMS2	9699	broad.mit.edu	37	8	104943609	104943609	+	Missense_Mutation	SNP	T	T	C			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr8:104943609T>C	ENST00000436393.2	+	10	1938	c.1697T>C	c.(1696-1698)cTt>cCt	p.L566P	RIMS2_ENST00000262231.10_Missense_Mutation_p.L627P|RIMS2_ENST00000406091.3_Missense_Mutation_p.L788P|RIMS2_ENST00000507740.1_Missense_Mutation_p.L580P			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	850					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.L580P(1)|p.L566P(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ATTTACTTTCTTCCAGACAGA	0.333										HNSCC(12;0.0054)																																						2	Substitution - Missense(2)	ovary(2)	8											50.0	49.0	50.0					8																	104943609		1800	4058	5858	105012785	SO:0001583	missense	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1697T>C	8.37:g.104943609T>C	ENSP00000390665:p.Leu566Pro	Somatic		Capture	Illumina GAIIx	Phase_I	105012785	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37		.	.	.	.	.	.	.	.	.	.	T	23.2	4.391061	0.82902	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3	6.07	6.07	0.98685	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	D	0.93187	0.7830	H	0.96460	3.825	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.998;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;0.999;1.0	D	0.95085	0.8217	9	0.87932	D	0	.	16.6407	0.85098	0.0:0.0:0.0:1.0	.	850;850;566;627;580;788	Q9UQ26;Q9UQ26-2;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.;.	P	788;803;788;850;580;627;580;580;566	ENSP00000427018:L788P;ENSP00000384892:L788P;ENSP00000425205:L580P;ENSP00000262231:L627P;ENSP00000423559:L580P;ENSP00000386228:L580P;ENSP00000390665:L566P	ENSP00000262231:L627P	L	+	2	0	RIMS2	105012785	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.991000	0.88244	2.326000	0.78906	0.533000	0.62120	CTT		0.333	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
EXT1	2131	broad.mit.edu	37	8	119122833	119122833	+	Silent	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr8:119122833C>T	ENST00000378204.2	-	1	1259	c.453G>A	c.(451-453)gcG>gcA	p.A151A		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	151					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)	p.A151A(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			CAAAGAGGCACGCCTGGCTGG	0.502			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																													yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	1	Substitution - coding silent(1)	ovary(1)	8											94.0	108.0	103.0					8																	119122833		2203	4300	6503	119192014	SO:0001819	synonymous_variant	2131	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.453G>A	8.37:g.119122833C>T		Somatic		Capture	Illumina GAIIx	Phase_I	119192014	B2R7V2|Q9BVI9	Silent	SNP	ENST00000378204.2	37	CCDS6324.1																																																																																				0.502	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127	
ZNF572	137209	broad.mit.edu	37	8	125989760	125989760	+	Missense_Mutation	SNP	G	G	C			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr8:125989760G>C	ENST00000319286.5	+	3	1404	c.1250G>C	c.(1249-1251)tGc>tCc	p.C417S		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	417					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C417S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TGTTCTGAGTGCTGGAAAACT	0.418										HNSCC(60;0.17)																																						1	Substitution - Missense(1)	ovary(1)	8											75.0	74.0	74.0					8																	125989760		2203	4300	6503	126058941	SO:0001583	missense	137209			BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.1250G>C	8.37:g.125989760G>C	ENSP00000319305:p.Cys417Ser	Somatic		Capture	Illumina GAIIx	Phase_I	126058941	A1L4F1|Q8N1Q0	Missense_Mutation	SNP	ENST00000319286.5	37	CCDS6354.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.851223	0.71719	.	.	ENSG00000180938	ENST00000319286	D	0.85861	-2.04	5.17	5.17	0.71159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.53938	D	0.000053	D	0.92912	0.7745	M	0.84773	2.715	0.43924	D	0.996573	D	0.89917	1.0	D	0.87578	0.998	D	0.93708	0.7021	10	0.87932	D	0	-9.1514	16.2176	0.82239	0.0:0.0:1.0:0.0	.	417	Q7Z3I7	ZN572_HUMAN	S	417	ENSP00000319305:C417S	ENSP00000319305:C417S	C	+	2	0	ZNF572	126058941	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.538000	0.98072	2.692000	0.91855	0.655000	0.94253	TGC		0.418	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381359.1	NM_152412	
COL22A1	169044	broad.mit.edu	37	8	139890117	139890117	+	Silent	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr8:139890117G>A	ENST00000303045.6	-	3	980	c.534C>T	c.(532-534)ggC>ggT	p.G178G	COL22A1_ENST00000435777.1_Silent_p.G178G	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	178	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.G178G(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TGAGTGCCTCGCCCACGCCCA	0.677										HNSCC(7;0.00092)																																						1	Substitution - coding silent(1)	ovary(1)	8											24.0	25.0	24.0					8																	139890117		2203	4300	6503	139959299	SO:0001819	synonymous_variant	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.534C>T	8.37:g.139890117G>A		Somatic		Capture	Illumina GAIIx	Phase_I	139959299	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																				0.677	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
SLC45A4	57210	broad.mit.edu	37	8	142227244	142227244	+	Silent	SNP	G	G	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr8:142227244G>A	ENST00000024061.3	-	5	1828	c.1521C>T	c.(1519-1521)gtC>gtT	p.V507V	SLC45A4_ENST00000517878.1_Silent_p.V558V|SLC45A4_ENST00000433583.2_Silent_p.V500V|SLC45A4_ENST00000519067.1_Silent_p.V507V	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)		p.V507V(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			AGCCCATCTTGACCCCGGCGT	0.617																																																1	Substitution - coding silent(1)	ovary(1)	8											76.0	74.0	75.0					8																	142227244		2203	4300	6503	142296426	SO:0001819	synonymous_variant	57210			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.1521C>T	8.37:g.142227244G>A		Somatic		Capture	Illumina GAIIx	Phase_I	142296426	Q6ZRI2|Q9ULU3	Silent	SNP	ENST00000024061.3	37	CCDS34948.1																																																																																				0.617	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
BAI1	575	broad.mit.edu	37	8	143570761	143570761	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr8:143570761C>T	ENST00000517894.1	+	16	3487	c.2593C>T	c.(2593-2595)Cgc>Tgc	p.R865C	BAI1_ENST00000323289.5_Missense_Mutation_p.R865C			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	865					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R865C(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TCGCTCCCTGCGCACACCCTT	0.587																																																1	Substitution - Missense(1)	ovary(1)	8											99.0	109.0	106.0					8																	143570761		2057	4198	6255	143567763	SO:0001583	missense	575			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2593C>T	8.37:g.143570761C>T	ENSP00000430945:p.Arg865Cys	Somatic		Capture	Illumina GAIIx	Phase_I	143567763		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	C	19.68	3.873664	0.72180	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.09911	2.93;2.93	4.76	3.88	0.44766	.	0.672540	0.13670	U	0.370939	T	0.08980	0.0222	N	0.08118	0	0.32242	N	0.572627	D	0.55172	0.97	P	0.48901	0.594	T	0.14952	-1.0454	10	0.56958	D	0.05	.	10.7948	0.46453	0.0:0.9049:0.0:0.0951	.	865	E9PBK0	.	C	865	ENSP00000430945:R865C;ENSP00000313046:R865C	ENSP00000313046:R865C	R	+	1	0	BAI1	143567763	0.904000	0.30761	1.000000	0.80357	0.987000	0.75469	2.039000	0.41193	0.984000	0.38629	0.462000	0.41574	CGC		0.587	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
HAUS6	54801	broad.mit.edu	37	9	19058102	19058102	+	Missense_Mutation	SNP	T	T	A			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr9:19058102T>A	ENST00000380502.3	-	16	3130	c.2663A>T	c.(2662-2664)cAt>cTt	p.H888L	HAUS6_ENST00000380496.1_Missense_Mutation_p.H752L	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	888					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.H888L(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						ATGCTCAGTATGCAAATCACA	0.408																																																1	Substitution - Missense(1)	ovary(1)	9											213.0	201.0	205.0					9																	19058102		2203	4300	6503	19048102	SO:0001583	missense	54801			AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.2663A>T	9.37:g.19058102T>A	ENSP00000369871:p.His888Leu	Somatic		Capture	Illumina GAIIx	Phase_I	19048102	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Missense_Mutation	SNP	ENST00000380502.3	37	CCDS6489.1	.	.	.	.	.	.	.	.	.	.	T	0.377	-0.930827	0.02359	.	.	ENSG00000147874	ENST00000380502;ENST00000380496	T;T	0.21932	1.99;1.98	5.76	3.42	0.39159	.	0.672895	0.15656	N	0.251138	T	0.17662	0.0424	L	0.57536	1.79	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.003;0.002;0.002	T	0.38045	-0.9679	10	0.12103	T	0.63	-1.0864	6.4739	0.22024	0.1627:0.0779:0.0:0.7594	.	853;752;888	Q7Z4H7-3;Q5VY60;Q7Z4H7	.;.;HAUS6_HUMAN	L	888;752	ENSP00000369871:H888L;ENSP00000369865:H752L	ENSP00000369865:H752L	H	-	2	0	HAUS6	19048102	0.777000	0.28628	0.209000	0.23619	0.040000	0.13550	2.896000	0.48656	0.444000	0.26612	-0.605000	0.04089	CAT		0.408	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645	
TMC1	117531	broad.mit.edu	37	9	75435853	75435853	+	Missense_Mutation	SNP	A	A	G			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr9:75435853A>G	ENST00000297784.5	+	20	2399	c.1859A>G	c.(1858-1860)aAt>aGt	p.N620S	TMC1_ENST00000486417.1_3'UTR|TMC1_ENST00000396237.3_Missense_Mutation_p.N620S|TMC1_ENST00000340019.3_Missense_Mutation_p.N620S	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	620					auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)	p.N620S(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						ATGTGCTGCAATGTTCCTGAG	0.507																																					Pancreas(75;173 1345 14232 34245 43413)											1	Substitution - Missense(1)	ovary(1)	9											202.0	173.0	183.0					9																	75435853		2203	4300	6503	74625673	SO:0001583	missense	117531			AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.1859A>G	9.37:g.75435853A>G	ENSP00000297784:p.Asn620Ser	Somatic		Capture	Illumina GAIIx	Phase_I	74625673	A8MVZ2|B1AM91	Missense_Mutation	SNP	ENST00000297784.5	37	CCDS6643.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.644689	0.87859	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000542143;ENST00000396237	T;T;T	0.63255	-0.03;-0.03;-0.03	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.66645	0.2810	L	0.60455	1.87	0.54753	D	0.999987	P;P;P	0.43231	0.801;0.801;0.763	P;P;P	0.50617	0.531;0.531;0.646	T	0.61978	-0.6951	10	0.08381	T	0.77	-27.4342	16.2962	0.82776	1.0:0.0:0.0:0.0	.	587;587;620	A5D8Y1;A4FUA6;Q8TDI8	.;.;TMC1_HUMAN	S	620;620;587;587;614;620	ENSP00000297784:N620S;ENSP00000341433:N620S;ENSP00000379538:N620S	ENSP00000297784:N620S	N	+	2	0	TMC1	74625673	1.000000	0.71417	0.934000	0.37439	0.805000	0.45488	7.479000	0.81095	2.304000	0.77564	0.528000	0.53228	AAT		0.507	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052655.1		
OR13C8	138802	broad.mit.edu	37	9	107332186	107332186	+	Silent	SNP	A	A	C			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr9:107332186A>C	ENST00000335040.1	+	1	738	c.738A>C	c.(736-738)acA>acC	p.T246T		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T246T(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						CCCACCTGACAGTGGTGATTA	0.423																																																1	Substitution - coding silent(1)	ovary(1)	9											122.0	113.0	116.0					9																	107332186		2203	4300	6503	106372007	SO:0001819	synonymous_variant	138802				CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.738A>C	9.37:g.107332186A>C		Somatic		Capture	Illumina GAIIx	Phase_I	106372007	Q5VVG0|Q96R44	Silent	SNP	ENST00000335040.1	37	CCDS35090.1																																																																																				0.423	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053480.1		
CCNB3	85417	broad.mit.edu	37	X	50052251	50052251	+	Missense_Mutation	SNP	C	C	T			TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chrX:50052251C>T	ENST00000376042.1	+	6	1380	c.1082C>T	c.(1081-1083)tCc>tTc	p.S361F	CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.S361F			Q8WWL7	CCNB3_HUMAN	cyclin B3	361					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)		p.S361F(2)		breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					AAAGAGGATTCCCTTGTTAAG	0.443																																																2	Substitution - Missense(2)	ovary(2)	X											89.0	77.0	81.0					X																	50052251		2203	4300	6503	50068991	SO:0001583	missense	85417			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.1082C>T	X.37:g.50052251C>T	ENSP00000365210:p.Ser361Phe	Somatic		Capture	Illumina GAIIx	Phase_I	50068991	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	ENST00000376042.1	37	CCDS14331.1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019130	0.35606	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.39229	1.09;1.09	3.56	-5.02	0.02982	.	101.725000	0.00166	N	0.000000	T	0.27524	0.0676	L	0.32530	0.975	0.09310	N	1	P	0.38129	0.619	B	0.32211	0.142	T	0.19321	-1.0309	9	.	.	.	.	7.4403	0.27179	0.6259:0.2791:0.0:0.0949	.	361	Q8WWL7	CCNB3_HUMAN	F	361	ENSP00000365210:S361F;ENSP00000276014:S361F	.	S	+	2	0	CCNB3	50068991	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.363000	0.02592	-1.392000	0.02082	-0.390000	0.06520	TCC		0.443	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056558.1		
TWSG1	57045	broad.mit.edu	37	18	9396353	9396368	+	Frame_Shift_Del	DEL	TCCCTTCTCTCTTCCG	TCCCTTCTCTCTTCCG	-	rs140736771|rs35075982	byFrequency	TCGA-20-0991-01A-03D-0428-08	TCGA-20-0991-10A-01D-0428-08	TCCCTTCTCTCTTCCG	TCCCTTCTCTCTTCCG	-	-	TCCCTTCTCTCTTCCG	TCCCTTCTCTCTTCCG	Unknown	Valid	Somatic	Phase_I	WXS	Illumina_Capture			Illumina GAIIx	8ea6ecec-3854-452a-822e-d547aca9bb6f	8eaf3609-4474-4ef6-8304-45430f88c639	g.chr18:9396353_9396368delTCCCTTCTCTCTTCCG	ENST00000262120.5	+	4	490_505	c.299_314delTCCCTTCTCTCTTCCG	c.(298-315)atcccttctctcttccggfs	p.IPSLFR100fs	TWSG1_ENST00000581641.1_Frame_Shift_Del_p.IPSLFR100fs	NM_020648.5	NP_065699.1	Q9GZX9	TWSG1_HUMAN	twisted gastrulation BMP signaling modulator 1	100					BMP signaling pathway (GO:0030509)|camera-type eye development (GO:0043010)|cell differentiation (GO:0030154)|forebrain development (GO:0030900)|hemopoiesis (GO:0030097)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of osteoblast differentiation (GO:0045668)|ossification (GO:0001503)|positive regulation of BMP signaling pathway (GO:0030513)|salivary gland morphogenesis (GO:0007435)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.R105Q(2)|p.I100fs*10(1)|p.L103I(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|pancreas(2)	10						CATGAACCGATCCCTTCTCTCTTCCGGGCACTCACA	0.431																																																4	Substitution - Missense(3)|Deletion - Frameshift(1)	ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	18																																								9386368	SO:0001589	frameshift_variant	57045			AA486291	CCDS11844.1	18p11.3	2013-10-03	2013-10-03		ENSG00000128791	ENSG00000128791			12429	protein-coding gene	gene with protein product		605049	"""twisted gastrulation homolog 1 (Drosophila)"""			11260715	Standard	NM_020648		Approved	TSG	uc002knz.3	Q9GZX9	OTTHUMG00000131597	ENST00000262120.5:c.299_314delTCCCTTCTCTCTTCCG	18.37:g.9396353_9396368delTCCCTTCTCTCTTCCG	ENSP00000262120:p.Ile100fs	Somatic		Capture	Illumina GAIIx	Phase_I	9386353	B2RE08|D3DUH9|Q8NBI7|Q96K46	Frame_Shift_Del	DEL	ENST00000262120.5	37	CCDS11844.1																																																																																				0.431	TWSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254480.2		
