#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								5926	SO:0001628	intergenic_variant	4512																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	5926		Missense_Mutation	SNP	superfamily_Cytochrome c oxidase subunit I-like,HMMPfam_COX1,PatternScan_COX1_CUB	p.F8L		37	c.22		MT																																																																																			-	superfamily_Cytochrome c oxidase subunit I-like,HMMPfam_COX1	0	0					MT-CO1			T			5926	+1	no_stop_codon	ENST00000361624	ensembl	human	known	54_36p	missense	SNP	NULL	C
SCARF1	8578	genome.wustl.edu	37	17	1538486	1538486	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr17:1538486G>A	ENST00000263071.4	-	11	2108	c.2059C>T	c.(2059-2061)Cct>Tct	p.P687S	SCARF1_ENST00000571272.1_3'UTR|SCARF1_ENST00000348987.3_Missense_Mutation_p.P601S	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1	687	Gly-rich.				cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GTGGTCACAGGGCCCGAGCTC	0.657																																																0			17											39.0	36.0	37.0					17																	1538486		2203	4299	6502	1485236	SO:0001583	missense	8578			D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555	ENST00000263071.4:c.2059C>T	17.37:g.1538486G>A	ENSP00000263071:p.Pro687Ser	Somatic		Capture	Illumina GAIIx	4	1485236	A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	SNP	superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_Laminin_EGF,superfamily_Growth factor receptor domain	p.P687S	ENST00000263071.4	37	c.2059	CCDS11007.1	17	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.488163	0.01018	.	.	ENSG00000074660	ENST00000263071;ENST00000348987	T;T	0.18810	2.19;2.85	5.21	-0.408	0.12381	.	0.806745	0.10463	N	0.671743	T	0.08223	0.0205	N	0.03281	-0.365	0.09310	N	1	B;B	0.16603	0.018;0.002	B;B	0.10450	0.005;0.003	T	0.40869	-0.9540	10	0.19590	T	0.45	-0.0797	8.4181	0.32683	0.7556:0.0:0.2444:0.0	.	601;687	Q14162-2;Q14162	.;SREC_HUMAN	S	687;601	ENSP00000263071:P687S;ENSP00000323964:P601S	ENSP00000263071:P687S	P	-	1	0	SCARF1	1485236	0.110000	0.22057	0.003000	0.11579	0.076000	0.17211	0.432000	0.21461	-0.085000	0.12573	-0.300000	0.09419	CCT	-	NULL		0.657	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCARF1	protein_coding	OTTHUMT00000207081.4	G	NM_003693		1485236	-1	no_errors	NM_003693	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
CSMD1	64478	genome.wustl.edu	37	8	2806870	2806870	+	Missense_Mutation	SNP	T	T	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr8:2806870T>A	ENST00000520002.1	-	69	10911	c.10356A>T	c.(10354-10356)caA>caT	p.Q3452H	CSMD1_ENST00000602723.1_Missense_Mutation_p.Q3275H|CSMD1_ENST00000400186.3_Missense_Mutation_p.Q3275H|CSMD1_ENST00000542608.1_Missense_Mutation_p.Q3274H|CSMD1_ENST00000602557.1_Missense_Mutation_p.Q3452H|CSMD1_ENST00000537824.1_Missense_Mutation_p.Q3451H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3452						integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GAATGTCACCTTGAAAAGTAA	0.338																																																0			8											99.0	90.0	93.0					8																	2806870		1807	4070	5877	2794277	SO:0001583	missense	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.10356A>T	8.37:g.2806870T>A	ENSP00000430733:p.Gln3452His	Somatic		Capture	Illumina GAIIx	4	2794277	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.R3453W	ENST00000520002.1	37	c.10357		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.77|14.77	2.633232|2.633232	0.47049|0.47049	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.36520|.	1.25;1.55;1.57;1.25|.	5.6|5.6	2.79|2.79	0.32731|0.32731	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.60932|0.60932	0.2307|0.2307	M|M	0.69358|0.69358	2.11|2.11	0.80722|0.80722	D|D	1|1	B;D;D|.	0.76494|.	0.006;0.997;0.999|.	B;D;D|.	0.85130|.	0.004;0.96;0.997|.	T|T	0.55016|0.55016	-0.8206|-0.8206	10|5	0.87932|.	D|.	0|.	.|.	6.816|6.816	0.23831|0.23831	0.0:0.0997:0.1412:0.7591|0.0:0.0997:0.1412:0.7591	.|.	3452;3452;3274|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	H|W	3275;3452;3313;3451;3274|2854	ENSP00000383047:Q3275H;ENSP00000430733:Q3452H;ENSP00000441462:Q3451H;ENSP00000446243:Q3274H|.	ENSP00000320445:Q3313H|.	Q|R	-|-	3|1	2|2	CSMD1|CSMD1	2794277|2794277	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.174000|0.174000	0.22865|0.22865	1.364000|1.364000	0.34171|0.34171	0.323000|0.323000	0.23307|0.23307	0.519000|0.519000	0.50382|0.50382	CAA|AGG	-	NULL		0.338	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	T	NM_033225		2794277	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_033225	genbank	human	validated	54_36p	missense	SNP	1.000	A
DAPK3	1613	genome.wustl.edu	37	19	3961449	3961449	+	Intron	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr19:3961449G>A	ENST00000545797.2	-	7	873				DAPK3_ENST00000301264.3_Intron|MIR637_ENST00000385000.1_RNA			O43293	DAPK3_HUMAN	death-associated protein kinase 3						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|chromatin modification (GO:0016568)|cytokinesis (GO:0000910)|intracellular signal transduction (GO:0035556)|negative regulation of translation (GO:0017148)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of cell motility (GO:2000145)|regulation of focal adhesion assembly (GO:0051893)|regulation of mitosis (GO:0007088)|regulation of mitotic cell cycle (GO:0007346)|regulation of smooth muscle contraction (GO:0006940)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|leucine zipper domain binding (GO:0043522)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(2)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		AAAGCCCCCAGTGCTCAGTAA	0.607																																																0			19											39.0	44.0	43.0					19																	3961449		1568	3582	5150	3912449	SO:0001627	intron_variant	0			AB007144	CCDS12116.1	19p13.3	2008-02-05				ENSG00000167657			2676	protein-coding gene	gene with protein product		603289				9488481	Standard	XM_005259508		Approved	ZIP, ZIPK	uc002lzc.1	O43293		ENST00000545797.2:c.630-290C>T	19.37:g.3961449G>A		Somatic		Capture	Illumina GAIIx	4	3912449	A0AVN4|B3KQE2|Q05JY4	RNA	SNP	-	NULL	ENST00000545797.2	37	NULL	CCDS12116.1	19																																																																																			-	-		0.607	DAPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIRN637	protein_coding	OTTHUMT00000457817.2	G	NM_001348		3912449	-1	no_errors	ENST00000385000	ensembl	human	known	54_36p	rna	SNP	0.002	A
KCNA6	3742	genome.wustl.edu	37	12	4919820	4919820	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr12:4919820G>C	ENST00000280684.3	+	1	1479	c.613G>C	c.(613-615)Ggt>Cgt	p.G205R	RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Missense_Mutation_p.G205R			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	205					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	AGATGGTCGAGGTGGAAACAA	0.537										HNSCC(72;0.22)																																						0			12											75.0	67.0	70.0					12																	4919820		2203	4300	6503	4790081	SO:0001583	missense	3742			X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.613G>C	12.37:g.4919820G>C	ENSP00000280684:p.Gly205Arg	Somatic		Capture	Illumina GAIIx	4	4790081		Missense_Mutation	SNP	superfamily_BTB/POZ_fold,HMMSmart_BTB,HMMPfam_K_tetra,superfamily_SSF81324,HMMPfam_Ion_trans	p.G205R	ENST00000280684.3	37	c.613	CCDS8534.1	12	.	.	.	.	.	.	.	.	.	.	G	0.196	-1.049374	0.01981	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.97016	-4.21;-4.21	5.12	3.15	0.36227	.	0.142507	0.25386	U	0.031046	D	0.91610	0.7349	L	0.42245	1.32	0.36133	D	0.84629	B	0.02656	0.0	B	0.04013	0.001	D	0.86773	0.1974	10	0.18276	T	0.48	.	6.2808	0.21007	0.223:0.0:0.777:0.0	.	205	P17658	KCNA6_HUMAN	R	205	ENSP00000408321:G205R;ENSP00000280684:G205R	ENSP00000280684:G205R	G	+	1	0	KCNA6	4790081	.	.	0.985000	0.45067	0.181000	0.23173	.	.	1.398000	0.46701	0.655000	0.94253	GGT	-	superfamily_SSF81324		0.537	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA6	protein_coding	OTTHUMT00000398909.1	G	NM_002235		4790081	+1	no_errors	NM_002235	genbank	human	reviewed	54_36p	missense	SNP	0.818	C
OR51A7	119687	genome.wustl.edu	37	11	4928874	4928874	+	Missense_Mutation	SNP	T	T	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr11:4928874T>G	ENST00000359350.4	+	1	275	c.275T>G	c.(274-276)aTt>aGt	p.I92S	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCCATGGGAATTTCACCTAAT	0.448																																																0			11											151.0	130.0	137.0					11																	4928874		2201	4298	6499	4885450	SO:0001583	missense	119687			AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.275T>G	11.37:g.4928874T>G	ENSP00000352305:p.Ile92Ser	Somatic		Capture	Illumina GAIIx	4	4885450	Q6IFH8	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.I92S	ENST00000359350.4	37	c.275	CCDS31364.1	11	.	.	.	.	.	.	.	.	.	.	T	17.35	3.368313	0.61513	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.00606	6.26	4.78	4.78	0.61160	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45361	D	0.000372	T	0.04724	0.0128	H	0.96208	3.785	0.32124	N	0.587618	D	0.63046	0.992	D	0.68483	0.958	T	0.01988	-1.1234	10	0.87932	D	0	.	13.2778	0.60198	0.0:0.0:0.0:1.0	.	92	Q8NH64	O51A7_HUMAN	S	92;92;81	ENSP00000352305:I92S	ENSP00000352305:I92S	I	+	2	0	OR51A7	4885450	1.000000	0.71417	0.961000	0.40146	0.899000	0.52679	4.384000	0.59607	2.007000	0.58848	0.533000	0.62120	ATT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.448	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A7	protein_coding	OTTHUMT00000142175.1	T	NM_001004749		4885450	+1	no_errors	NM_001004749	genbank	human	provisional	54_36p	missense	SNP	0.305	G
ZNF232	7775	genome.wustl.edu	37	17	5015226	5015226	+	5'UTR	SNP	C	C	T	rs141582736	byFrequency	TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr17:5015226C>T	ENST00000250076.3	-	0	546				ZNF232_ENST00000416429.2_5'Flank|ZNF232_ENST00000575538.1_5'Flank|AC012146.7_ENST00000413077.1_RNA|AC012146.7_ENST00000570712.1_RNA|ZNF232_ENST00000575898.1_5'Flank|AC012146.7_ENST00000571138.1_RNA	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						TCCTCGCCGCCGGCTTCCGTT	0.697													C|||	25	0.00499201	0.0	0.0058	5008	,	,		14339	0.0		0.0129	False		,,,				2504	0.0082															0			17																																								4955950	SO:0001623	5_prime_UTR_variant	0			AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.-109G>A	17.37:g.5015226C>T		Somatic		Capture	Illumina GAIIx	4	4955950		Missense_Mutation	SNP	NULL	p.R269W	ENST00000250076.3	37	c.805	CCDS11068.1	17																																																																																			-	NULL		0.697	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100129673	protein_coding	OTTHUMT00000216915.1	C	NM_014519		4955950	+1	no_errors	XM_001715544	genbank	human	model	54_36p	missense	SNP	0.000	T
CHGB	1114	genome.wustl.edu	37	20	5904368	5904368	+	Silent	SNP	C	C	T	rs138422072	byFrequency	TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr20:5904368C>T	ENST00000378961.4	+	4	1782	c.1578C>T	c.(1576-1578)taC>taT	p.Y526Y		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	526						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						ACCCATACTACGACCCTCTCC	0.438																																																0			20						C		0,4406		0,0,2203	68.0	70.0	69.0		1578	-5.1	0.0	20	dbSNP_134	69	7,8593	5.7+/-21.5	0,7,4293	no	coding-synonymous	CHGB	NM_001819.2		0,7,6496	TT,TC,CC		0.0814,0.0,0.0538		526/678	5904368	7,12999	2203	4300	6503	5852368	SO:0001819	synonymous_variant	1114				CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1578C>T	20.37:g.5904368C>T		Somatic		Capture	Illumina GAIIx	4	5852368	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Silent	SNP	HMMPfam_Granin,PatternScan_GRANINS_2,PatternScan_GRANINS_1	p.Y526	ENST00000378961.4	37	c.1578	CCDS13092.1	20																																																																																			-	HMMPfam_Granin		0.438	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGB	protein_coding	OTTHUMT00000077897.2	C	NM_001819		5852368	+1	no_errors	NM_001819	genbank	human	reviewed	54_36p	silent	SNP	0.002	T
SLC25A23	79085	genome.wustl.edu	37	19	6456498	6456498	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr19:6456498C>T	ENST00000301454.4	-	4	522	c.416G>A	c.(415-417)cGc>cAc	p.R139H	SLC25A23_ENST00000414491.2_5'Flank|SLC25A23_ENST00000334510.5_Missense_Mutation_p.R139H	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	139	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						GAAGTGGTCGCGCCATTCTTG	0.587																																																0			19											166.0	123.0	138.0					19																	6456498		2203	4300	6503	6407498	SO:0001583	missense	79085			AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.416G>A	19.37:g.6456498C>T	ENSP00000301454:p.Arg139His	Somatic		Capture	Illumina GAIIx	4	6407498	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1,superfamily_Mitochondrial carrier,HMMPfam_Mito_carr	p.R139H	ENST00000301454.4	37	c.416	CCDS32882.1	19	.	.	.	.	.	.	.	.	.	.	C	32	5.122882	0.94429	.	.	ENSG00000125648	ENST00000264088;ENST00000301454;ENST00000334510	T;T;T	0.71579	-0.58;-0.58;-0.58	4.86	4.86	0.63082	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.87245	0.6129	M	0.90922	3.16	0.54753	D	0.999985	D	0.89917	1.0	D	0.79784	0.993	D	0.90468	0.4451	10	0.87932	D	0	-12.0441	16.7336	0.85442	0.0:1.0:0.0:0.0	.	139	Q9BV35	SCMC3_HUMAN	H	139	ENSP00000264088:R139H;ENSP00000301454:R139H;ENSP00000334537:R139H	ENSP00000264088:R139H	R	-	2	0	SLC25A23	6407498	1.000000	0.71417	0.921000	0.36526	0.957000	0.61999	7.390000	0.79816	2.251000	0.74343	0.491000	0.48974	CGC	-	superfamily_EF-hand,HMMSmart_SM00054		0.587	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A23	protein_coding	OTTHUMT00000453325.1	C	NM_024103		6407498	-1	no_errors	NM_024103	genbank	human	validated	54_36p	missense	SNP	0.995	T
RREB1	6239	genome.wustl.edu	37	6	7230384	7230384	+	Silent	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr6:7230384C>T	ENST00000349384.6	+	10	2366	c.2052C>T	c.(2050-2052)gcC>gcT	p.A684A	RREB1_ENST00000334984.6_Silent_p.A684A|RREB1_ENST00000379933.3_Silent_p.A684A|RREB1_ENST00000379938.2_Silent_p.A684A	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	684					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CCGACAAGGCCGCGCTCATCC	0.632																																																0			6											55.0	51.0	52.0					6																	7230384		2203	4300	6503	7175383	SO:0001819	synonymous_variant	6239			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2052C>T	6.37:g.7230384C>T		Somatic		Capture	Illumina GAIIx	4	7175383	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Silent	SNP	HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667	p.A684	ENST00000349384.6	37	c.2052	CCDS34336.1	6																																																																																			-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2		0.632	RREB1-002	KNOWN	basic|CCDS	protein_coding	RREB1	protein_coding	OTTHUMT00000352985.1	C			7175383	+1	no_errors	NM_001003699	genbank	human	validated	54_36p	silent	SNP	0.988	T
TP53	7157	genome.wustl.edu	37	17	7577610	7577610	+	Splice_Site	SNP	T	T	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr17:7577610T>C	ENST00000269305.4	-	7	862		c.e7-2		TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(43)|p.0?(8)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGAGCCAACCTAGGAGATAAC	0.522		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	53	Unknown(43)|Whole gene deletion(8)|Insertion - In frame(1)|Insertion - Frameshift(1)	lung(16)|liver(7)|upper_aerodigestive_tract(5)|biliary_tract(5)|ovary(5)|breast(4)|bone(4)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|urinary_tract(1)|oesophagus(1)	17											88.0	74.0	79.0					17																	7577610		2203	4300	6503	7518335	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.673-2A>G	17.37:g.7577610T>C		Somatic		Capture	Illumina GAIIx	4	7518335	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e6-2	ENST00000269305.4	37	c.673-2	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	17.76	3.468043	0.63625	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	3.35	3.35	0.38373	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3302	0.43818	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518335	1.000000	0.71417	0.324000	0.25361	0.557000	0.35523	7.634000	0.83273	1.750000	0.51863	0.379000	0.24179	.	-	-		0.522	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546	Intron	7518335	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	0.989	C
ARHGEF15	22899	genome.wustl.edu	37	17	8215578	8215578	+	Missense_Mutation	SNP	C	C	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr17:8215578C>A	ENST00000361926.3	+	2	331	c.221C>A	c.(220-222)gCt>gAt	p.A74D	ARHGEF15_ENST00000421050.1_Missense_Mutation_p.A74D	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	74	Pro-rich.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						AAGCCCCCTGCTCTTTTGCCC	0.612																																																0			17											86.0	83.0	84.0					17																	8215578		2203	4300	6503	8156303	SO:0001583	missense	22899			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.221C>A	17.37:g.8215578C>A	ENSP00000355026:p.Ala74Asp	Somatic		Capture	Illumina GAIIx	4	8156303	A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	PatternScan_DH_1,superfamily_DH-domain,HMMPfam_RhoGEF,HMMSmart_RhoGEF,superfamily_SSF50729	p.A74D	ENST00000361926.3	37	c.221	CCDS11139.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.794|8.794	0.931377|0.931377	0.18131|0.18131	.|.	.|.	ENSG00000198844|ENSG00000198844	ENST00000361926;ENST00000421050|ENST00000455564	T;T|.	0.72615|.	-0.67;-0.67|.	5.01|5.01	3.97|3.97	0.46021|0.46021	.|.	0.293335|.	0.29119|.	N|.	0.013087|.	T|T	0.28599|0.28599	0.0708|0.0708	L|L	0.27053|0.27053	0.805|0.805	0.23487|0.23487	N|N	0.997574|0.997574	D;D|.	0.64830|.	0.994;0.994|.	P;P|.	0.59288|.	0.77;0.855|.	T|T	0.09707|0.09707	-1.0662|-1.0662	10|6	0.62326|0.36615	D|T	0.03|0.2	-22.9722|-22.9722	7.5458|7.5458	0.27766|0.27766	0.0:0.8825:0.0:0.1175|0.0:0.8825:0.0:0.1175	.|.	74;74|.	D3DTR7;O94989|.	.;ARHGF_HUMAN|.	D|I	74|36	ENSP00000355026:A74D;ENSP00000412505:A74D|.	ENSP00000355026:A74D|ENSP00000413324:L36I	A|L	+|+	2|1	0|0	ARHGEF15|ARHGEF15	8156303|8156303	0.819000|0.819000	0.29175|0.29175	0.963000|0.963000	0.40424|0.40424	0.524000|0.524000	0.34500|0.34500	1.328000|1.328000	0.33758|0.33758	2.625000|2.625000	0.88918|0.88918	0.555000|0.555000	0.69702|0.69702	GCT|CTC	-	NULL		0.612	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	protein_coding	OTTHUMT00000226993.2	C	NM_173728		8156303	+1	no_errors	NM_173728	genbank	human	reviewed	54_36p	missense	SNP	0.532	A
ZNF699	374879	genome.wustl.edu	37	19	9407394	9407394	+	Missense_Mutation	SNP	C	C	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr19:9407394C>A	ENST00000591998.1	-	6	914	c.686G>T	c.(685-687)gGg>gTg	p.G229V	CTC-325H20.4_ENST00000591336.1_RNA|ZNF699_ENST00000308650.3_Missense_Mutation_p.G229V			Q32M78	ZN699_HUMAN	zinc finger protein 699	229					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GAAGGCCTTCCCACATTCCTT	0.453																																																0			19											140.0	132.0	135.0					19																	9407394		2063	4228	6291	9268394	SO:0001583	missense	374879			BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.686G>T	19.37:g.9407394C>A	ENSP00000467723:p.Gly229Val	Somatic		Capture	Illumina GAIIx	4	9268394	Q8N9A1	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2	p.G229V	ENST00000591998.1	37	c.686	CCDS42495.1	19	.	.	.	.	.	.	.	.	.	.	C	13.47	2.247728	0.39697	.	.	ENSG00000196110	ENST00000308650	T	0.22134	1.97	3.69	2.64	0.31445	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36519	N	0.002558	T	0.53498	0.1800	H	0.94423	3.535	0.44000	D	0.996704	D	0.69078	0.997	D	0.71184	0.972	T	0.66015	-0.6028	10	0.87932	D	0	.	11.3778	0.49739	0.0:0.8143:0.1857:0.0	.	229	Q32M78	ZN699_HUMAN	V	229	ENSP00000311596:G229V	ENSP00000311596:G229V	G	-	2	0	ZNF699	9268394	0.922000	0.31269	0.600000	0.28864	0.397000	0.30659	2.283000	0.43470	1.120000	0.41904	0.555000	0.69702	GGG	-	superfamily_SSF57667,HMMSmart_ZnF_C2H2		0.453	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF699	protein_coding	OTTHUMT00000449010.1	C	NM_198535		9268394	-1	no_errors	NM_198535	genbank	human	provisional	54_36p	missense	SNP	0.993	A
ZNF18	7566	genome.wustl.edu	37	17	11881349	11881349	+	Missense_Mutation	SNP	A	A	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr17:11881349A>C	ENST00000322748.3	-	9	2179	c.1575T>G	c.(1573-1575)tgT>tgG	p.C525W	ZNF18_ENST00000454073.3_Missense_Mutation_p.C524W|ZNF18_ENST00000580306.2_Missense_Mutation_p.C525W|RP11-1096G20.5_ENST00000580270.1_RNA	NM_144680.2	NP_653281.2	P17022	ZNF18_HUMAN	zinc finger protein 18	525					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	14				Colorectal(4;3.33e-05)|COAD - Colon adenocarcinoma(4;0.000494)|READ - Rectum adenocarcinoma(10;0.233)		AACTTTTCCCACAGTGCGAAC	0.408																																																0			17											115.0	115.0	115.0					17																	11881349		2203	4300	6503	11822074	SO:0001583	missense	7566			X52342	CCDS32568.1	17p12	2013-01-09	2006-05-10		ENSG00000154957	ENSG00000154957		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12969	protein-coding gene	gene with protein product		194524	"""zinc finger protein 18 (KOX 11)"""			15702252	Standard	XM_005256786		Approved	ZKSCAN6, KOX11, HDSG1, Zfp535, ZNF535, ZSCAN38	uc002gng.1	P17022	OTTHUMG00000178307	ENST00000322748.3:c.1575T>G	17.37:g.11881349A>C	ENSP00000315664:p.Cys525Trp	Somatic		Capture	Illumina GAIIx	4	11822074	Q5QHQ3|Q8IYC4|Q8NAH6	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SM00431,HMMPfam_KRAB,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.C525W	ENST00000322748.3	37	c.1575	CCDS32568.1	17	.	.	.	.	.	.	.	.	.	.	A	9.680	1.148979	0.21288	.	.	ENSG00000154957	ENST00000454073;ENST00000322748	D	0.85955	-2.05	5.89	-1.97	0.07503	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000012	D	0.93693	0.7985	H	0.97635	4.045	0.50171	D	0.999858	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	D	0.92215	0.5779	10	0.87932	D	0	-9.6297	11.2826	0.49203	0.5351:0.0:0.4649:0.0	.	524;525	P17022-2;P17022	.;ZNF18_HUMAN	W	525	ENSP00000315664:C525W	ENSP00000315664:C525W	C	-	3	2	ZNF18	11822074	0.981000	0.34729	0.644000	0.29465	0.815000	0.46073	0.420000	0.21263	-0.669000	0.05289	0.451000	0.29950	TGT	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.408	ZNF18-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF18	protein_coding	OTTHUMT00000441450.2	A	XM_085596		11822074	-1	no_errors	NM_144680	genbank	human	provisional	54_36p	missense	SNP	0.998	C
CD97	976	genome.wustl.edu	37	19	14516748	14516748	+	Silent	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr19:14516748C>T	ENST00000242786.5	+	14	1898	c.1818C>T	c.(1816-1818)ggC>ggT	p.G606G	CD97_ENST00000358600.3_Silent_p.G513G|CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Silent_p.G557G	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	606					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						ACGAAGGCGGCCAGGTGAGGT	0.701																																																0			19											37.0	31.0	33.0					19																	14516748		2203	4300	6503	14377748	SO:0001819	synonymous_variant	976				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1818C>T	19.37:g.14516748C>T		Somatic		Capture	Illumina GAIIx	4	14377748	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Silent	SNP	HMMSmart_SM00181,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,PatternScan_ASX_HYDROXYL,HMMPfam_GPS,HMMSmart_SM00303,superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.G606	ENST00000242786.5	37	c.1818	CCDS32929.1	19																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_2		0.701	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	protein_coding	OTTHUMT00000459821.2	C	NM_078481		14377748	+1	no_errors	NM_078481	genbank	human	reviewed	54_36p	silent	SNP	0.001	T
DCLRE1C	64421	genome.wustl.edu	37	10	14950524	14950524	+	Silent	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr10:14950524G>A	ENST00000378278.2	-	14	1999	c.1962C>T	c.(1960-1962)ccC>ccT	p.P654P	DCLRE1C_ENST00000378255.1_Silent_p.P534P|DCLRE1C_ENST00000357717.2_Silent_p.P539P|DCLRE1C_ENST00000378242.1_Silent_p.P307P|DCLRE1C_ENST00000378249.1_Silent_p.P539P|DCLRE1C_ENST00000453695.2_Silent_p.P534P|DCLRE1C_ENST00000378254.1_Silent_p.P534P|DCLRE1C_ENST00000492201.1_5'Flank|DCLRE1C_ENST00000378258.1_Silent_p.P534P|DCLRE1C_ENST00000378246.2_Silent_p.P539P|DCLRE1C_ENST00000396817.2_Silent_p.P534P|DCLRE1C_ENST00000378289.4_Intron			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	654					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						CTGGAGTTGAGGGAACTTCAA	0.388								Non-homologous end-joining																																								0			10											155.0	160.0	158.0					10																	14950524		2203	4300	6503	14990530	SO:0001819	synonymous_variant	64421			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.1962C>T	10.37:g.14950524G>A		Somatic		Capture	Illumina GAIIx	4	14990530	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Silent	SNP	superfamily_Metallo-hydrolase/oxidoreductase,HMMPfam_DRMBL	p.P654	ENST00000378278.2	37	c.1962	CCDS31149.1	10																																																																																			-	NULL		0.388	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	protein_coding	OTTHUMT00000046934.1	G	NM_022487		14990530	-1	no_errors	NM_001033855	genbank	human	reviewed	54_36p	silent	SNP	0.999	A
NBAS	51594	genome.wustl.edu	37	2	15359013	15359013	+	Missense_Mutation	SNP	G	G	C	rs553094685		TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr2:15359013G>C	ENST00000281513.5	-	48	6341	c.6316C>G	c.(6316-6318)Cgc>Ggc	p.R2106G	NBAS_ENST00000441750.1_Missense_Mutation_p.R1986G	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	2106					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						ACGTGAATGCGGGGCCGCACC	0.567																																																0			2											56.0	60.0	59.0					2																	15359013		2203	4300	6503	15276464	SO:0001583	missense	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.6316C>G	2.37:g.15359013G>C	ENSP00000281513:p.Arg2106Gly	Somatic		Capture	Illumina GAIIx	4	15276464	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMPfam_Sec39,PatternScan_RIBOSOMAL_S14	p.R2106G	ENST00000281513.5	37	c.6316	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371804	0.82573	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.55413	0.52;0.52	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.69771	0.3148	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;0.974	D;P	0.76071	0.987;0.578	T	0.72178	-0.4369	10	0.87932	D	0	.	13.6217	0.62140	0.0:0.0:0.8453:0.1547	.	1986;2106	A2RRP1-2;A2RRP1	.;NBAS_HUMAN	G	1986;2106	ENSP00000413201:R1986G;ENSP00000281513:R2106G	ENSP00000281513:R2106G	R	-	1	0	NBAS	15276464	1.000000	0.71417	0.880000	0.34516	0.985000	0.73830	6.790000	0.75115	2.644000	0.89710	0.591000	0.81541	CGC	-	NULL		0.567	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	protein_coding	OTTHUMT00000241638.1	G	NM_015909		15276464	-1	no_errors	NM_015909	genbank	human	validated	54_36p	missense	SNP	1.000	C
NBAS	51594	genome.wustl.edu	37	2	15468385	15468385	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr2:15468385G>C	ENST00000281513.5	-	37	4424	c.4399C>G	c.(4399-4401)Cta>Gta	p.L1467V	NBAS_ENST00000441750.1_Missense_Mutation_p.L1347V	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1467					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TGTTTCTCTAGATCTTCATTG	0.383																																																0			2											212.0	189.0	197.0					2																	15468385		2203	4300	6503	15385836	SO:0001583	missense	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.4399C>G	2.37:g.15468385G>C	ENSP00000281513:p.Leu1467Val	Somatic		Capture	Illumina GAIIx	4	15385836	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMPfam_Sec39,PatternScan_RIBOSOMAL_S14	p.L1467V	ENST00000281513.5	37	c.4399	CCDS1685.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.011|0.011	-1.698389|-1.698389	0.00725|0.00725	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000442506|ENST00000441750;ENST00000281513	.|T;T	.|0.10288	.|2.89;3.09	5.45|5.45	2.62|2.62	0.31277|0.31277	.|.	.|0.147217	.|0.47093	.|N	.|0.000243	T|T	0.11410|0.11410	0.0278|0.0278	L|L	0.48362|0.48362	1.52|1.52	0.22918|0.22918	N|N	0.998564|0.998564	.|P;B	.|0.51653	.|0.947;0.284	.|P;B	.|0.48524	.|0.58;0.059	T|T	0.17319|0.17319	-1.0373|-1.0373	5|10	.|0.87932	.|D	.|0	.|.	2.149|2.149	0.03795|0.03795	0.1692:0.1562:0.513:0.1616|0.1692:0.1562:0.513:0.1616	.|.	.|1347;1467	.|A2RRP1-2;A2RRP1	.|.;NBAS_HUMAN	M|V	514|1347;1467	.|ENSP00000413201:L1347V;ENSP00000281513:L1467V	.|ENSP00000281513:L1467V	I|L	-|-	3|1	3|2	NBAS|NBAS	15385836|15385836	0.149000|0.149000	0.22717|0.22717	0.067000|0.067000	0.19924|0.19924	0.007000|0.007000	0.05969|0.05969	0.383000|0.383000	0.20651|0.20651	0.773000|0.773000	0.33404|0.33404	0.655000|0.655000	0.94253|0.94253	ATC|CTA	-	NULL		0.383	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	protein_coding	OTTHUMT00000241638.1	G	NM_015909		15385836	-1	no_errors	NM_015909	genbank	human	validated	54_36p	missense	SNP	0.166	C
CYP4F2	8529	genome.wustl.edu	37	19	16000338	16000338	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr19:16000338G>C	ENST00000221700.6	-	7	908	c.813C>G	c.(811-813)atC>atG	p.I271M	CYP4F2_ENST00000011989.7_Missense_Mutation_p.I122M	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GCCGCTCCTGGATGACGGCAT	0.557																																																0			19											97.0	93.0	95.0					19																	16000338		2203	4300	6503	15861338	SO:0001583	missense	8529			U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.813C>G	19.37:g.16000338G>C	ENSP00000221700:p.Ile271Met	Somatic		Capture	Illumina GAIIx	4	15861338		Missense_Mutation	SNP	superfamily_Cytochrome_P450,HMMPfam_p450,PatternScan_CYTOCHROME_P450	p.I271M	ENST00000221700.6	37	c.813	CCDS12336.1	19	.	.	.	.	.	.	.	.	.	.	g	13.29	2.192734	0.38707	.	.	ENSG00000186115	ENST00000221700;ENST00000392846;ENST00000011989	T;T	0.73363	-0.74;1.19	2.72	1.66	0.24008	.	0.235592	0.27206	U	0.020435	D	0.85261	0.5656	M	0.92219	3.285	0.29075	N	0.883078	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.988	T	0.77135	-0.2699	10	0.87932	D	0	.	3.3801	0.07251	0.1466:0.0:0.6021:0.2513	.	122;271	B4DV75;P78329	.;CP4F2_HUMAN	M	271;122;122	ENSP00000221700:I271M;ENSP00000011989:I122M	ENSP00000011989:I122M	I	-	3	3	CYP4F2	15861338	0.998000	0.40836	0.896000	0.35187	0.802000	0.45316	0.208000	0.17415	0.454000	0.26884	0.305000	0.20034	ATC	-	superfamily_Cytochrome_P450,HMMPfam_p450		0.557	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F2	protein_coding	OTTHUMT00000460372.3	G	NM_001082		15861338	-1	no_errors	NM_001082	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
ABCC1	4363	genome.wustl.edu	37	16	16205321	16205321	+	Silent	SNP	G	G	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr16:16205321G>T	ENST00000399410.3	+	22	3136	c.2961G>T	c.(2959-2961)gtG>gtT	p.V987V	ABCC1_ENST00000346370.5_Silent_p.V931V|ABCC1_ENST00000351154.5_Silent_p.V928V|ABCC1_ENST00000349029.5_Silent_p.V872V|ABCC1_ENST00000345148.5_Silent_p.V987V|ABCC1_ENST00000399408.2_Silent_p.V997V	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	987	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GTAACCATGTGTCCGCGCTGG	0.537																																																0			16											174.0	182.0	180.0					16																	16205321		2059	4199	6258	16112822	SO:0001819	synonymous_variant	4363			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2961G>T	16.37:g.16205321G>T		Somatic		Capture	Illumina GAIIx	4	16112822	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Silent	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_PROTEIN_KINASE_ATP,PatternScan_ABC_TRANSPORTER_1	p.V987	ENST00000399410.3	37	c.2961	CCDS42122.1	16																																																																																			-	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane		0.537	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC1	protein_coding	OTTHUMT00000109701.1	G	NM_004996		16112822	+1	no_errors	NM_004996	genbank	human	reviewed	54_36p	silent	SNP	0.000	T
IGHV3OR15-7	28318	genome.wustl.edu	37	15	20192899	20192899	+	RNA	SNP	C	C	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr15:20192899C>G	ENST00000558565.2	-	0	359									immunoglobulin heavy variable 3/OR15-7 (pseudogene)																		GCTGACCTCCCCTCACTGTGT	0.577																																																0			15																																								18452913			0			Z29597		15q11.2	2012-06-12	2011-04-15		ENSG00000259490	ENSG00000259490		"""Immunoglobulins / IGH orphons"""	5633	pseudogene	immunoglobulin pseudogene			"""immunoglobulin heavy variable 3/OR15-7"", ""immunoglobulin heavy variable 3/OR15-7 pseudogene"""				Standard			Approved	IGHV3/OR15-7			OTTHUMG00000171835		15.37:g.20192899C>G		Somatic		Capture	Illumina GAIIx	4	18452913		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406	p.R242S	ENST00000558565.2	37	c.726		15																																																																																			-	HMMSmart_SM00409		0.577	IGHV3OR15-7-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	LOC646057	IG_V_gene	OTTHUMT00000415305.2	C			18452913	-1	no_errors	XM_001716562	genbank	human	model	54_36p	missense	SNP	0.006	G
ALDH3A1	218	genome.wustl.edu	37	17	19641670	19641670	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr17:19641670C>T	ENST00000457500.2	-	9	1642	c.1313G>A	c.(1312-1314)gGc>gAc	p.G438D	ALDH3A1_ENST00000444455.1_Missense_Mutation_p.G438D|ALDH3A1_ENST00000494157.2_Missense_Mutation_p.G365D|ALDH3A1_ENST00000225740.6_Missense_Mutation_p.G438D|ALDH3A1_ENST00000395555.3_Missense_Mutation_p.G374D|RP11-311F12.2_ENST00000580884.1_RNA	NM_001135168.1	NP_001128640.1	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3 family, member A1	438					aging (GO:0007568)|cellular aldehyde metabolic process (GO:0006081)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|alcohol dehydrogenase (NADP+) activity (GO:0008106)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)		GACCTTCAGGCCTTCATCATT	0.637																																																0			17											67.0	72.0	70.0					17																	19641670		2203	4300	6503	19582262	SO:0001583	missense	218			M74542	CCDS11212.1	17p11.2	2010-05-07	2010-05-07		ENSG00000108602	ENSG00000108602	1.2.1.5	"""Aldehyde dehydrogenases"""	405	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase, dimeric NADP-preferring"""	100660		ALDH3		7774944, 1737758	Standard	NM_000691		Approved		uc010cqu.3	P30838	OTTHUMG00000059469	ENST00000457500.2:c.1313G>A	17.37:g.19641670C>T	ENSP00000411821:p.Gly438Asp	Somatic		Capture	Illumina GAIIx	4	19582262	A8K828|Q9BT37	Missense_Mutation	SNP	superfamily_ALDH-like,HMMPfam_Aldedh,PatternScan_ALDEHYDE_DEHYDR_GLU,PatternScan_ALDEHYDE_DEHYDR_CYS	p.G438D	ENST00000457500.2	37	c.1313	CCDS11212.1	17	.	.	.	.	.	.	.	.	.	.	C	10.33	1.321007	0.23994	.	.	ENSG00000108602	ENST00000225740;ENST00000395555;ENST00000379258;ENST00000444455;ENST00000457500;ENST00000457844	T;T;T;T	0.79554	-1.1;-1.28;-1.1;-1.1	4.56	-1.55	0.08558	Aldehyde/histidinol dehydrogenase (1);	0.692618	0.14574	N	0.311282	T	0.51941	0.1704	N	0.04787	-0.16	0.09310	N	1	B;B;B	0.30709	0.004;0.291;0.004	B;B;B	0.27796	0.007;0.083;0.007	T	0.46119	-0.9214	10	0.51188	T	0.08	-12.2265	0.5768	0.00705	0.3032:0.1247:0.3196:0.2525	.	438;555;438	A8K828;Q8N9T9;P30838	.;.;AL3A1_HUMAN	D	438;374;496;438;438;365	ENSP00000225740:G438D;ENSP00000378923:G374D;ENSP00000388469:G438D;ENSP00000411821:G438D	ENSP00000225740:G438D	G	-	2	0	ALDH3A1	19582262	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.192000	0.17096	-0.186000	0.10533	-1.265000	0.01443	GGC	-	NULL		0.637	ALDH3A1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ALDH3A1	protein_coding	OTTHUMT00000132265.4	C	NM_000691		19582262	-1	no_errors	NM_000691	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
RIN2	54453	genome.wustl.edu	37	20	19970881	19970881	+	Missense_Mutation	SNP	A	A	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr20:19970881A>G	ENST00000255006.6	+	9	2290	c.2141A>G	c.(2140-2142)tAt>tGt	p.Y714C	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Missense_Mutation_p.Y232C	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	665	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						CAGAAGATGTATTCGCCGGAA	0.547																																																0			20											47.0	48.0	48.0					20																	19970881		2030	4197	6227	19918881	SO:0001583	missense	54453			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.2141A>G	20.37:g.19970881A>G	ENSP00000255006:p.Tyr714Cys	Somatic		Capture	Illumina GAIIx	4	19918881	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	superfamily_SH2 domain,superfamily_VPS9 domain (Pfam 02204),HMMSmart_SM00167,HMMPfam_VPS9,HMMPfam_RA,HMMSmart_SM00314	p.Y665C	ENST00000255006.6	37	c.1994	CCDS56182.1	20	.	.	.	.	.	.	.	.	.	.	A	23.5	4.419761	0.83559	.	.	ENSG00000132669	ENST00000255006;ENST00000440354	T;T	0.30448	1.53;1.53	5.83	5.83	0.93111	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.000000	0.85682	D	0.000000	T	0.54398	0.1856	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.52808	-0.8526	9	.	.	.	-16.3183	15.8552	0.78972	1.0:0.0:0.0:0.0	.	232;665	E7EPJ1;Q8WYP3	.;RIN2_HUMAN	C	714;232	ENSP00000255006:Y714C;ENSP00000391239:Y232C	.	Y	+	2	0	RIN2	19918881	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.339000	0.96797	2.225000	0.72522	0.482000	0.46254	TAT	-	superfamily_VPS9 domain (Pfam 02204),HMMSmart_SM00167,HMMPfam_VPS9		0.547	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	protein_coding	OTTHUMT00000078212.1	A			19918881	+1	no_errors	NM_018993	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
HIST1H2BI	8346	genome.wustl.edu	37	6	26273208	26273208	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr6:26273208C>G	ENST00000377733.2	+	1	65	c.5C>G	c.(4-6)cCt>cGt	p.P2R	HIST1H3G_ENST00000305910.3_5'Flank	NM_003525.2	NP_003516.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bi	2					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(1)|lung(8)|urinary_tract(1)	16						GCGAACATGCCTGAACCAGCT	0.542																																																0			6											94.0	94.0	94.0					6																	26273208		2203	4300	6503	26381187	SO:0001583	missense	8346			Z80782	CCDS4603.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000168242	ENSG00000278588		"""Histones / Replication-dependent"""	4756	protein-coding gene	gene with protein product		602807	"""H2B histone family, member K"", ""histone 1, H2bi"""	H2BFK		9119399, 12408966	Standard	NM_003525		Approved	H2B/k	uc003nhk.3	P62807	OTTHUMG00000014448	ENST00000377733.2:c.5C>G	6.37:g.26273208C>G	ENSP00000366962:p.Pro2Arg	Somatic		Capture	Illumina GAIIx	4	26381187	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	superfamily_Histone-fold,HMMSmart_SM00427,HMMPfam_Histone,PatternScan_HISTONE_H2B	p.P2R	ENST00000377733.2	37	c.5	CCDS4603.1	6	.	.	.	.	.	.	.	.	.	.	.	11.16	1.557852	0.27827	.	.	ENSG00000168242	ENST00000377733	T	0.19669	2.13	4.89	4.02	0.46733	.	.	.	.	.	T	0.34542	0.0901	M	0.89287	3.02	0.34378	D	0.692752	.	.	.	.	.	.	T	0.48139	-0.9061	7	0.87932	D	0	.	11.9022	0.52690	0.0:0.9143:0.0:0.0857	.	.	.	.	R	2	ENSP00000366962:P2R	ENSP00000366962:P2R	P	+	2	0	HIST1H2BI	26381187	1.000000	0.71417	0.888000	0.34837	0.008000	0.06430	4.769000	0.62300	1.066000	0.40716	-0.253000	0.11424	CCT	-	NULL		0.542	HIST1H2BI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BI	protein_coding	OTTHUMT00000040111.1	C	NM_003525		26381187	+1	no_errors	NM_003525	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SKAP2	8935	genome.wustl.edu	37	7	26779515	26779515	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr7:26779515G>A	ENST00000345317.2	-	5	689	c.376C>T	c.(376-378)Cgc>Tgc	p.R126C	SKAP2_ENST00000539623.1_De_novo_Start_OutOfFrame|SKAP2_ENST00000489977.1_5'UTR	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	126	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.R126C(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						CCTTTTCTGCGTTTTTCAAGG	0.373																																																1	Substitution - Missense(1)	skin(1)	7											74.0	70.0	71.0					7																	26779515		2203	4300	6503	26746040	SO:0001583	missense	8935				CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.376C>T	7.37:g.26779515G>A	ENSP00000005587:p.Arg126Cys	Somatic		Capture	Illumina GAIIx	4	26746040	A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_1	p.R126C	ENST00000345317.2	37	c.376	CCDS5400.1	7	.	.	.	.	.	.	.	.	.	.	G	20.8	4.058233	0.76074	.	.	ENSG00000005020	ENST00000345317;ENST00000535331;ENST00000432747	T;T	0.14391	2.51;2.51	5.81	5.81	0.92471	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.38878	0.1057	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.06391	-1.0829	10	0.87932	D	0	-25.7679	17.008	0.86398	0.0:0.0:1.0:0.0	.	111;126	B7Z5N4;O75563	.;SKAP2_HUMAN	C	126;111;111	ENSP00000005587:R126C;ENSP00000408163:R111C	ENSP00000005587:R126C	R	-	1	0	SKAP2	26746040	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.504000	0.66968	2.746000	0.94184	0.591000	0.81541	CGC	-	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233		0.373	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKAP2	protein_coding	OTTHUMT00000214128.1	G			26746040	-1	no_errors	NM_003930	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ZKSCAN4	387032	genome.wustl.edu	37	6	28217489	28217489	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr6:28217489C>G	ENST00000377294.2	-	2	790	c.547G>C	c.(547-549)Gga>Cga	p.G183R	ZKSCAN4_ENST00000423974.2_Missense_Mutation_p.G28R	NM_019110.3	NP_061983.2	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	183					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						GGCTGGGATCCCAGAGATTCA	0.433																																																0			6											199.0	182.0	188.0					6																	28217489		2203	4300	6503	28325468	SO:0001583	missense	387032			AK056698	CCDS4647.1	6p21	2013-01-09	2007-02-20	2007-02-20	ENSG00000187626	ENSG00000187626		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13854	protein-coding gene	gene with protein product		611643	"""zinc finger protein 307"", ""zinc finger protein 427"""	ZNF307, ZNF427		12477932	Standard	NM_019110		Approved	p373c6.1, P1P373C6, FLJ32136, ZSCAN36	uc003nks.1	Q969J2	OTTHUMG00000014511	ENST00000377294.2:c.547G>C	6.37:g.28217489C>G	ENSP00000366509:p.Gly183Arg	Somatic		Capture	Illumina GAIIx	4	28325468	B2RE32|Q5U7L4	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SCAN,superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.G183R	ENST00000377294.2	37	c.547	CCDS4647.1	6	.	.	.	.	.	.	.	.	.	.	C	11.66	1.704978	0.30232	.	.	ENSG00000187626	ENST00000377294;ENST00000423974	T;T	0.05717	3.45;3.4	3.7	2.82	0.32997	.	.	.	.	.	T	0.01222	0.0040	N	0.14661	0.345	0.26282	N	0.978252	B	0.15930	0.015	B	0.17433	0.018	T	0.47674	-0.9099	9	0.20519	T	0.43	.	9.2694	0.37661	0.0:0.7796:0.2204:0.0	.	183	Q969J2	ZKSC4_HUMAN	R	183;28	ENSP00000366509:G183R;ENSP00000401978:G28R	ENSP00000366509:G183R	G	-	1	0	ZKSCAN4	28325468	0.001000	0.12720	0.846000	0.33378	0.995000	0.86356	0.662000	0.25038	1.106000	0.41623	0.655000	0.94253	GGA	-	NULL		0.433	ZKSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN4	protein_coding	OTTHUMT00000040179.1	C	NM_019110		28325468	-1	no_errors	NM_019110	genbank	human	provisional	54_36p	missense	SNP	0.831	G
DUSP18	150290	genome.wustl.edu	37	22	31050496	31050496	+	Intron	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr22:31050496C>T	ENST00000407308.1	-	3	1731				SLC35E4_ENST00000406566.1_Intron|DUSP18_ENST00000461301.1_Intron|DUSP18_ENST00000404885.1_Intron			Q8NEJ0	DUS18_HUMAN	dual specificity phosphatase 18						peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(1)|lung(1)|prostate(1)|skin(1)	4						CACCTTGAGGCGGTCTTGGGC	0.617																																																0			22																																								29380496	SO:0001627	intron_variant	729212			AF461689	CCDS13883.1	22q12.1	2011-06-09				ENSG00000167065		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18484	protein-coding gene	gene with protein product		611446				12408986	Standard	NM_152511		Approved	DUSP20	uc003aiw.1	Q8NEJ0		ENST00000407308.1:c.565-2212G>A	22.37:g.31050496C>T		Somatic		Capture	Illumina GAIIx	4	29380496	B3KPA4	RNA	SNP	-	NULL	ENST00000407308.1	37	NULL	CCDS13883.1	22																																																																																			-	-		0.617	DUSP18-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	LOC729212	protein_coding	OTTHUMT00000321403.1	C			29380496	-1	pseudogene	XR_015827	genbank	human	model	54_36p	rna	SNP	1.000	T
MECR	51102	genome.wustl.edu	37	1	29527943	29527943	+	Intron	SNP	C	C	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:29527943C>G	ENST00000263702.6	-	6	782				MECR_ENST00000489248.1_5'Flank|MECR_ENST00000373791.3_Intron			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase						fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		ttcggagagactgaggccagc	0.453																																																0			1											29.0	27.0	28.0					1																	29527943		876	1991	2867	29400530	SO:0001627	intron_variant	51102				CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.756+511G>C	1.37:g.29527943C>G		Somatic		Capture	Illumina GAIIx	4	29400530	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	HMMPfam_ADH_N,superfamily_GroES-like	p.V194L	ENST00000263702.6	37	c.580	CCDS30659.1	1	.	.	.	.	.	.	.	.	.	.	C	9.308	1.054895	0.19907	.	.	ENSG00000116353	ENST00000373792;ENST00000453185	.	.	.	3.62	2.7	0.31948	.	.	.	.	.	T	0.13114	0.0318	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	T	0.28713	-1.0035	5	0.02654	T	1	.	7.0102	0.24857	0.0:0.8751:0.0:0.1249	.	.	.	.	L	194;121	.	ENSP00000362897:V194L	V	-	1	0	MECR	29400530	0.000000	0.05858	0.001000	0.08648	0.073000	0.16967	-0.485000	0.06520	1.082000	0.41137	0.655000	0.94253	GTC	-	NULL		0.453	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MECR	protein_coding	OTTHUMT00000130740.1	C	NM_016011		29400530	-1	no_errors	ENST00000373792	ensembl	human	known	54_36p	missense	SNP	0.000	G
ALK	238	genome.wustl.edu	37	2	29754909	29754909	+	Silent	SNP	A	A	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr2:29754909A>G	ENST00000389048.3	-	4	1932	c.1026T>C	c.(1024-1026)agT>agC	p.S342S	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	342	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	TGCAGTGCTCACTGCTGCTCC	0.577			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0			2											133.0	116.0	122.0					2																	29754909		2203	4300	6503	29608413	SO:0001819	synonymous_variant	238	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.1026T>C	2.37:g.29754909A>G		Somatic		Capture	Illumina GAIIx	4	29608413	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	superfamily_LDL receptor-like module,HMMSmart_SM00192,HMMPfam_MAM,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,PatternScan_RECEPTOR_TYR_KIN_II	p.S342	ENST00000389048.3	37	c.1026	CCDS33172.1	2																																																																																			-	NULL		0.577	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	protein_coding	OTTHUMT00000324994.1	A	NM_004304		29608413	-1	no_errors	NM_004304	genbank	human	reviewed	54_36p	silent	SNP	0.995	G
IFNGR2	3460	genome.wustl.edu	37	21	34787247	34787247	+	Silent	SNP	C	C	T	rs376457511		TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr21:34787247C>T	ENST00000290219.6	+	2	774	c.126C>T	c.(124-126)aaC>aaT	p.N42N	IFNGR2_ENST00000405436.1_5'UTR|IFNGR2_ENST00000381995.1_Silent_p.N61N	NM_005534.3	NP_005525.2	P38484	INGR2_HUMAN	interferon gamma receptor 2 (interferon gamma transducer 1)	42	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	interferon-gamma receptor activity (GO:0004906)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(1)	13					Interferon gamma-1b(DB00033)	GCCTGTACAACGCAGAGCAGG	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		17540	0.001		0.0	False		,,,				2504	0.0															0			21						C		0,4406		0,0,2203	83.0	82.0	82.0		126	-2.3	0.0	21		82	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	IFNGR2	NM_005534.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		42/338	34787247	2,13004	2203	4300	6503	33709117	SO:0001819	synonymous_variant	3460				CCDS33544.1	21q22.1	2014-09-17			ENSG00000159128	ENSG00000159128		"""Interferons"", ""Fibronectin type III domain containing"""	5440	protein-coding gene	gene with protein product		147569		IFNGT1		3136170	Standard	NM_005534		Approved	AF-1	uc002yrp.4	P38484	OTTHUMG00000065188	ENST00000290219.6:c.126C>T	21.37:g.34787247C>T		Somatic		Capture	Illumina GAIIx	4	33709117	Q9BTL5	Silent	SNP	superfamily_Fibronectin type III,HMMPfam_fn3	p.N42	ENST00000290219.6	37	c.126	CCDS33544.1	21																																																																																			-	superfamily_Fibronectin type III		0.547	IFNGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNGR2	protein_coding	OTTHUMT00000139916.1	C			33709117	+1	no_errors	NM_005534	genbank	human	reviewed	54_36p	silent	SNP	0.445	T
DOPEY2	9980	genome.wustl.edu	37	21	37660369	37660369	+	Missense_Mutation	SNP	T	T	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr21:37660369T>G	ENST00000399151.3	+	33	6303	c.6218T>G	c.(6217-6219)tTt>tGt	p.F2073C		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	2073					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCTCAGATGTTTCTTTTTTTC	0.373																																																0			21											183.0	168.0	173.0					21																	37660369		2203	4300	6503	36582239	SO:0001583	missense	9980			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.6218T>G	21.37:g.37660369T>G	ENSP00000382104:p.Phe2073Cys	Somatic		Capture	Illumina GAIIx	4	36582239	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	HMMPfam_Dopey_N	p.F2073C	ENST00000399151.3	37	c.6218	CCDS13643.1	21	.	.	.	.	.	.	.	.	.	.	T	19.09	3.759960	0.69763	.	.	ENSG00000142197	ENST00000399151	T	0.49720	0.77	5.41	5.41	0.78517	.	0.049231	0.85682	D	0.000000	T	0.69070	0.3070	M	0.86178	2.8	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.71656	0.974;0.943	T	0.74352	-0.3693	10	0.87932	D	0	-18.8072	10.654	0.45665	0.1429:0.0:0.0:0.8571	.	2066;2073	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	C	2073	ENSP00000382104:F2073C	ENSP00000382104:F2073C	F	+	2	0	DOPEY2	36582239	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.685000	0.68204	2.052000	0.61016	0.533000	0.62120	TTT	-	NULL		0.373	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	protein_coding	OTTHUMT00000194636.1	T	NM_005128		36582239	+1	no_errors	NM_005128	genbank	human	validated	54_36p	missense	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	1	39175805	39175805	+	IGR	SNP	A	A	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:39175805A>G								RP11-329N22.1 (233649 upstream) : RRAGC (128064 downstream)																							GCTGCTGTCCAGGCTGGTGTG	0.473																																																0			1																																								38948392	SO:0001628	intergenic_variant	0																															1.37:g.39175805A>G		Somatic		Capture	Illumina GAIIx	4	38948392		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.473					LOC400750			A			38948392	+1	pseudogene	XR_039444	genbank	human	model	54_36p	rna	SNP	1.000	G
GOSR2	9570	genome.wustl.edu	37	17	45008540	45008540	+	Missense_Mutation	SNP	A	A	G	rs34093958		TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr17:45008540A>G	ENST00000393456.2	+	3	227	c.170A>G	c.(169-171)aAg>aGg	p.K57R	GOSR2_ENST00000575949.1_Missense_Mutation_p.K57R|GOSR2_ENST00000415811.2_Missense_Mutation_p.K57R|RP11-156P1.2_ENST00000571841.1_Missense_Mutation_p.K57R|GOSR2_ENST00000576910.2_Missense_Mutation_p.K57R|GOSR2_ENST00000439730.2_Missense_Mutation_p.K57R|GOSR2_ENST00000225567.4_Missense_Mutation_p.K57R	NM_004287.3	NP_004278.2	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2	57					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|skin(1)	7			BRCA - Breast invasive adenocarcinoma(9;0.102)			TTGTCCAGCAAGGAGCCCCCT	0.453																																																0			17											69.0	71.0	70.0					17																	45008540		2203	4300	6503	42363539	SO:0001583	missense	9570			AF007548	CCDS11507.1, CCDS42355.1, CCDS45719.1	17q21	2006-02-10				ENSG00000108433			4431	protein-coding gene	gene with protein product		604027				9349823, 10198168	Standard	XM_005257843		Approved	GS27, Bos1	uc002ikz.3	O14653		ENST00000393456.2:c.170A>G	17.37:g.45008540A>G	ENSP00000377101:p.Lys57Arg	Somatic		Capture	Illumina GAIIx	4	42363539	D3DXJ5|D3DXJ6|Q8N4B8|Q96DA5|Q9BZZ4	Missense_Mutation	SNP	HMMPfam_V-SNARE	p.K57R	ENST00000393456.2	37	c.170	CCDS42355.1	17	.	.	.	.	.	.	.	.	.	.	A	26.3	4.728363	0.89390	.	.	ENSG00000108433	ENST00000225567;ENST00000393456;ENST00000415811;ENST00000439730	T;T;T;T	0.69040	-0.11;-0.1;-0.37;1.97	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.79707	0.4492	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.992;0.992;0.997;0.999	T	0.79147	-0.1923	10	0.42905	T	0.14	-39.1044	16.2026	0.82095	1.0:0.0:0.0:0.0	.	57;57;57;57	E7EQ34;O14653;O14653-2;Q8N4B8	.;GOSR2_HUMAN;.;.	R	57	ENSP00000225567:K57R;ENSP00000377101:K57R;ENSP00000394559:K57R;ENSP00000390577:K57R	ENSP00000225567:K57R	K	+	2	0	GOSR2	42363539	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.257000	0.95545	2.285000	0.76669	0.533000	0.62120	AAG	-	HMMPfam_V-SNARE		0.453	GOSR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GOSR2	protein_coding	OTTHUMT00000440438.1	A			42363539	+1	no_errors	NM_054022	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
FOXJ3	22887	genome.wustl.edu	37	1	42657165	42657165	+	Missense_Mutation	SNP	G	G	A	rs377432876		TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:42657165G>A	ENST00000372572.1	-	11	1471	c.1160C>T	c.(1159-1161)cCg>cTg	p.P387L	FOXJ3_ENST00000545068.1_Missense_Mutation_p.P387L|FOXJ3_ENST00000372573.1_Missense_Mutation_p.P387L|FOXJ3_ENST00000361346.1_Missense_Mutation_p.P387L|FOXJ3_ENST00000372571.1_5'Flank|FOXJ3_ENST00000361776.1_Missense_Mutation_p.P353L	NM_001198851.1	NP_001185780.1	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	387					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TAAACCATGCGGTCGATGGGG	0.612																																																0			1						G	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	417.0	328.0	358.0		1160,1160,1058,1160	5.3	1.0	1		358	0,8600		0,0,4300	no	missense,missense,missense,missense	FOXJ3	NM_001198850.1,NM_001198851.1,NM_001198852.1,NM_014947.4	98,98,98,98	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	387/623,387/623,353/589,387/623	42657165	1,13005	2203	4300	6503	42429752	SO:0001583	missense	22887			AB028964	CCDS30689.1, CCDS55594.1	1p34.2	2008-04-10			ENSG00000198815	ENSG00000198815		"""Forkhead boxes"""	29178	protein-coding gene	gene with protein product							Standard	NM_014947		Approved	KIAA1041	uc001chf.3	Q9UPW0	OTTHUMG00000007026	ENST00000372572.1:c.1160C>T	1.37:g.42657165G>A	ENSP00000361653:p.Pro387Leu	Somatic		Capture	Illumina GAIIx	4	42429752	A7MBL7|A7MD18|D3DPW2|Q9NSS7	Missense_Mutation	SNP	"HMMSmart_SM00339,superfamily_""Winged helix"" DNA-binding domain,PatternScan_FORK_HEAD_1,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2"	p.P387L	ENST00000372572.1	37	c.1160	CCDS30689.1	1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.783635	0.49891	2.27E-4	0.0	ENSG00000198815	ENST00000372573;ENST00000372572;ENST00000361346;ENST00000361776;ENST00000545068;ENST00000445886	T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81	5.31	5.31	0.75309	.	0.533478	0.14149	N	0.338140	T	0.25680	0.0625	N	0.08118	0	0.58432	D	0.999991	P;P	0.46327	0.876;0.804	B;B	0.34242	0.178;0.086	T	0.16129	-1.0413	10	0.66056	D	0.02	.	11.8657	0.52493	0.0:0.0:0.8254:0.1746	.	353;387	Q9UPW0-2;Q9UPW0	.;FOXJ3_HUMAN	L	387;387;387;353;387;353	ENSP00000361654:P387L;ENSP00000361653:P387L;ENSP00000354620:P387L;ENSP00000354449:P353L;ENSP00000439044:P387L;ENSP00000393408:P353L	ENSP00000354620:P387L	P	-	2	0	FOXJ3	42429752	1.000000	0.71417	0.996000	0.52242	0.843000	0.47879	3.930000	0.56522	2.646000	0.89796	0.555000	0.69702	CCG	-	NULL		0.612	FOXJ3-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FOXJ3	protein_coding	OTTHUMT00000018310.1	G	NM_014947		42429752	-1	no_errors	NM_014947	genbank	human	validated	54_36p	missense	SNP	0.988	A
CFAP57	149465	genome.wustl.edu	37	1	43675633	43675633	+	Intron	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:43675633C>T	ENST00000372492.4	+	11	2253				WDR65_ENST00000528956.1_Silent_p.L659L	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN												NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CACCTGCCTGCTACGTGCCTT	0.502																																																0			1											242.0	218.0	226.0					1																	43675633		2203	4300	6503	43448220	SO:0001627	intron_variant	149465																														ENST00000372492.4:c.1929+46C>T	1.37:g.43675633C>T		Somatic		Capture	Illumina GAIIx	4	43448220	A6NKQ3|Q17RI9|Q5TAI0	Silent	SNP	PatternScan_WD_REPEATS_1,superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40	p.L659	ENST00000372492.4	37	c.1975		1																																																																																			-	NULL		0.502	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	WDR65	protein_coding	OTTHUMT00000384325.1	C			43448220	+1	no_errors	NM_152498	genbank	human	provisional	54_36p	silent	SNP	0.000	T
KIAA0930	23313	genome.wustl.edu	37	22	45601674	45601674	+	Splice_Site	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr22:45601674C>T	ENST00000336156.5	-	3	401	c.336G>A	c.(334-336)aaG>aaA	p.K112K	KIAA0930_ENST00000251993.7_Splice_Site_p.K117K|KIAA0930_ENST00000443310.3_Splice_Site_p.K94K|KIAA0930_ENST00000391627.2_Splice_Site_p.K78K	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930	112										endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						CACCCCATACCTTCTGCAGGA	0.632																																																0			22											28.0	27.0	27.0					22																	45601674		2203	4299	6502	43980338	SO:0001630	splice_region_variant	23313			AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.336+1G>A	22.37:g.45601674C>T		Somatic		Capture	Illumina GAIIx	4	43980338	B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	Silent	SNP	HMMPfam_DUF2045	p.K117	ENST00000336156.5	37	c.351	CCDS33665.1	22																																																																																			-	HMMPfam_DUF2045		0.632	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf9	protein_coding	OTTHUMT00000321975.2	C	NM_001009880	Silent	43980338	-1	no_errors	NM_015264	genbank	human	validated	54_36p	silent	SNP	1.000	T
EIF2B3	8891	genome.wustl.edu	37	1	45454253	45454253	+	5'Flank	SNP	C	C	A	rs141446653	byFrequency	TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:45454253C>A	ENST00000360403.2	-	0	0				EIF2B3_ENST00000480675.1_5'Flank|EIF2B3_ENST00000372183.3_5'Flank	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa						cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					AAGCAGGAACCTTTATAACCA	0.483													C|||	6	0.00119808	0.0045	0.0	5008	,	,		21113	0.0		0.0	False		,,,				2504	0.0				Colon(26;357 658 2581 11857 12657)											0			1																																								45226840	SO:0001631	upstream_gene_variant	128192			AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585		1.37:g.45454253C>A	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	45226840	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Missense_Mutation	SNP	superfamily_Cyclophilin-like,HMMPfam_Pro_isomerase,PatternScan_CSA_PPIASE_1	p.G49C	ENST00000360403.2	37	c.145	CCDS517.1	1																																																																																			-	superfamily_Cyclophilin-like,HMMPfam_Pro_isomerase,PatternScan_CSA_PPIASE_1		0.483	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC128192	protein_coding	OTTHUMT00000023724.1	C	NM_020365		45226840	-1	no_errors	XM_060887	genbank	human	model	54_36p	missense	SNP	0.998	A
SULF2	55959	genome.wustl.edu	37	20	46294691	46294691	+	Silent	SNP	G	G	A	rs79982126	byFrequency	TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr20:46294691G>A	ENST00000359930.4	-	13	2663	c.1812C>T	c.(1810-1812)taC>taT	p.Y604Y	SULF2_ENST00000361612.4_Silent_p.Y604Y|SULF2_ENST00000484875.1_Silent_p.Y604Y|SULF2_ENST00000467815.1_Silent_p.Y604Y	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	604					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						TCTCTAGGATGTAGCACCTGC	0.602													G|||	34	0.00678914	0.0008	0.0072	5008	,	,		23770	0.0		0.0189	False		,,,				2504	0.0092															0			20						G	,,	16,4390	24.3+/-50.5	0,16,2187	206.0	172.0	184.0		1812,1812,1812	4.2	1.0	20	dbSNP_132	184	84,8516	48.9+/-108.6	0,84,4216	no	coding-synonymous,coding-synonymous,coding-synonymous	SULF2	NM_001161841.1,NM_018837.3,NM_198596.2	,,	0,100,6403	AA,AG,GG		0.9767,0.3631,0.7689	,,	604/871,604/871,604/868	46294691	100,12906	2203	4300	6503	45728098	SO:0001819	synonymous_variant	55959			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.1812C>T	20.37:g.46294691G>A		Somatic		Capture	Illumina GAIIx	4	45728098	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Silent	SNP	HMMPfam_Sulfatase,superfamily_Alkaline phosphatase-like,PatternScan_SULFATASE_1	p.Y604	ENST00000359930.4	37	c.1812	CCDS13408.1	20																																																																																			-	superfamily_Alkaline phosphatase-like		0.602	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULF2	protein_coding	OTTHUMT00000079606.1	G	NM_018837		45728098	-1	no_errors	NM_018837	genbank	human	validated	54_36p	silent	SNP	1.000	A
PEX16	9409	genome.wustl.edu	37	11	45936193	45936193	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr11:45936193C>G	ENST00000378750.5	-	6	746	c.503G>C	c.(502-504)gGg>gCg	p.G168A	PEX16_ENST00000532554.1_5'UTR|PEX16_ENST00000532681.1_Missense_Mutation_p.G73A|PEX16_ENST00000241041.3_Missense_Mutation_p.G168A			Q9Y5Y5	PEX16_HUMAN	peroxisomal biogenesis factor 16	168					ER-dependent peroxisome organization (GO:0032581)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)|protein localization to endoplasmic reticulum (GO:0070972)|protein targeting to peroxisome (GO:0006625)|protein to membrane docking (GO:0022615)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)			large_intestine(2)|lung(2)|ovary(2)|skin(1)	7				GBM - Glioblastoma multiforme(35;0.223)		TGACCGCTTCCCCACGTAGGA	0.602																																																0			11											179.0	145.0	156.0					11																	45936193		2203	4299	6502	45892769	SO:0001583	missense	9409			AF118240	CCDS7917.1, CCDS31472.1	11p	2007-12-14			ENSG00000121680	ENSG00000121680			8857	protein-coding gene	gene with protein product		603360				9922452	Standard	NM_057174		Approved		uc001nbt.3	Q9Y5Y5	OTTHUMG00000167005	ENST00000378750.5:c.503G>C	11.37:g.45936193C>G	ENSP00000368024:p.Gly168Ala	Somatic		Capture	Illumina GAIIx	4	45892769	Q9BWB9	Missense_Mutation	SNP	HMMPfam_Pex16	p.G168A	ENST00000378750.5	37	c.503	CCDS31472.1	11	.	.	.	.	.	.	.	.	.	.	C	23.4	4.405827	0.83230	.	.	ENSG00000121680	ENST00000241041;ENST00000378750;ENST00000532681;ENST00000533151;ENST00000525192	T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.51873	0.1700	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.981	T	0.38436	-0.9661	10	0.36615	T	0.2	-43.2789	20.5385	0.99246	0.0:1.0:0.0:0.0	.	168;168	Q9Y5Y5;Q9Y5Y5-2	PEX16_HUMAN;.	A	168;168;73;64;73	ENSP00000241041:G168A;ENSP00000368024:G168A;ENSP00000434654:G73A;ENSP00000433045:G64A;ENSP00000431309:G73A	ENSP00000241041:G168A	G	-	2	0	PEX16	45892769	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.788000	0.69020	2.863000	0.98299	0.549000	0.68633	GGG	-	HMMPfam_Pex16		0.602	PEX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX16	protein_coding	OTTHUMT00000392398.1	C	NM_057174		45892769	-1	no_errors	NM_057174	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CYP2B7P	1556	genome.wustl.edu	37	19	41442407	41442407	+	RNA	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr19:41442407G>A	ENST00000599198.1	+	0	499					NR_001278.1															NS(1)|endometrium(6)|kidney(1)|lung(2)|ovary(1)|skin(1)	12						GATTCAGGACGAGGCTCAGTG	0.542																																																0			19																																								46134247			1556																															19.37:g.41442407G>A		Somatic		Capture	Illumina GAIIx	4	46134247		Missense_Mutation	SNP	HMMPfam_p450,superfamily_Cytochrome_P450	p.E149K	ENST00000599198.1	37	c.445		19	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412233	0.83340	.	.	ENSG00000256612	ENST00000541697	.	.	.	3.82	2.75	0.32379	.	0.000000	0.85682	D	0.000000	T	0.72236	0.3435	.	.	.	.	.	.	D;D	0.76494	0.999;0.999	D;D	0.68483	0.93;0.958	T	0.80777	-0.1231	7	0.87932	D	0	.	10.6249	0.45502	0.0:0.0:0.8058:0.1942	.	149;149	B6A7R5;Q14097	.;.	K	149	.	ENSP00000441190:E149K	E	+	1	0	AC008537.4	46134247	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.803000	0.62546	0.935000	0.37341	0.499000	0.49734	GAG	-	HMMPfam_p450,superfamily_Cytochrome_P450		0.542	CYP2B7P1-006	KNOWN	basic	processed_transcript	CYP2B7P1	pseudogene	OTTHUMT00000465180.1	G			46134247	+1	no_errors	ENST00000330446	ensembl	human	known	54_36p	missense	SNP	1.000	A
SMAD4	4089	genome.wustl.edu	37	18	48586259	48586259	+	Missense_Mutation	SNP	T	T	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr18:48586259T>C	ENST00000342988.3	+	8	1466	c.928T>C	c.(928-930)Ttc>Ctc	p.F310L	SMAD4_ENST00000588745.1_Intron|SMAD4_ENST00000398417.2_Missense_Mutation_p.F310L	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	310	SAD.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(3)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TGAGCTTGCATTCCAGCCTCC	0.338																																																39	Whole gene deletion(36)|Unknown(3)	pancreas(27)|stomach(3)|breast(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	18	GRCh37	CI064731	SMAD4	I							122.0	117.0	118.0					18																	48586259		2203	4300	6503	46840257	SO:0001583	missense	4089			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.928T>C	18.37:g.48586259T>C	ENSP00000341551:p.Phe310Leu	Somatic		Capture	Illumina GAIIx	4	46840257	A8K405	Missense_Mutation	SNP	superfamily_SMAD MH1 domain,HMMSmart_SM00523,HMMPfam_MH1,superfamily_SMAD/FHA domain,HMMPfam_MH2,HMMSmart_SM00524	p.F310L	ENST00000342988.3	37	c.928	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	T	12.51	1.961076	0.34565	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.96885	-4.16;-4.16	5.58	5.58	0.84498	SMAD/FHA domain (1);	0.000000	0.85682	D	0.000000	D	0.91703	0.7377	N	0.25890	0.77	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	D	0.88203	0.2885	10	0.09843	T	0.71	.	14.7241	0.69329	0.0:0.0:0.0:1.0	.	310	Q13485	SMAD4_HUMAN	L	310	ENSP00000341551:F310L;ENSP00000381452:F310L	ENSP00000341551:F310L	F	+	1	0	SMAD4	46840257	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.713000	0.84693	2.114000	0.64651	0.528000	0.53228	TTC	-	superfamily_SMAD/FHA domain		0.338	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	protein_coding	OTTHUMT00000255993.3	T	NM_005359		46840257	+1	no_errors	NM_005359	genbank	human	validated	54_36p	missense	SNP	1.000	C
ATL1	51062	genome.wustl.edu	37	14	51087331	51087331	+	Missense_Mutation	SNP	T	T	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr14:51087331T>C	ENST00000358385.6	+	9	1118	c.877T>C	c.(877-879)Ttc>Ctc	p.F293L	ATL1_ENST00000354525.4_Missense_Mutation_p.F293L|ATL1_ENST00000441560.2_Missense_Mutation_p.F293L|ATL1_ENST00000357032.3_Missense_Mutation_p.F293L	NM_015915.4	NP_056999.2	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1	293	GB1/RHD3-type G.				axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(3)	18						AGATGATGAATTCATCAAAAA	0.388																																																0			14											68.0	71.0	70.0					14																	51087331		2203	4300	6503	50157081	SO:0001583	missense	51062			AF131801	CCDS9700.1, CCDS32077.1	14q21.3	2014-09-17	2008-09-17	2008-09-17	ENSG00000198513	ENSG00000198513			11231	protein-coding gene	gene with protein product	"""atlastin"""	606439	"""spastic paraplegia 3A (autosomal dominant)"""	SPG3, SPG3A		8252041, 7825576	Standard	NM_015915		Approved	FSP1, AD-FSP	uc001wyd.4	Q8WXF7	OTTHUMG00000140297	ENST00000358385.6:c.877T>C	14.37:g.51087331T>C	ENSP00000351155:p.Phe293Leu	Somatic		Capture	Illumina GAIIx	4	50157081	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GBP,superfamily_Interferon-induced guanylate-binding protein 1 (GBP1) C-terminal domain	p.F293L	ENST00000358385.6	37	c.877	CCDS9700.1	14	.	.	.	.	.	.	.	.	.	.	T	32	5.118819	0.94385	.	.	ENSG00000198513	ENST00000441560;ENST00000358385;ENST00000357032;ENST00000354525	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	5.7	5.7	0.88788	Guanylate-binding protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92541	0.7631	M	0.89840	3.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93939	0.7221	10	0.87932	D	0	-12.6987	15.1519	0.72706	0.0:0.0:0.0:1.0	.	293;293	Q8WXF7;G5E9T1	ATLA1_HUMAN;.	L	293	ENSP00000413675:F293L;ENSP00000351155:F293L;ENSP00000349534:F293L;ENSP00000346522:F293L	ENSP00000346522:F293L	F	+	1	0	ATL1	50157081	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.177000	0.69029	0.459000	0.35465	TTC	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GBP		0.388	ATL1-001	KNOWN	basic|CCDS	protein_coding	ATL1	protein_coding	OTTHUMT00000276884.2	T			50157081	+1	no_errors	NM_015915	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ST18	9705	genome.wustl.edu	37	8	53030927	53030927	+	Nonsense_Mutation	SNP	C	C	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr8:53030927C>A	ENST00000276480.7	-	24	3513	c.2830G>T	c.(2830-2832)Gaa>Taa	p.E944*		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	944					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E944K(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				ATATCTGCTTCAATTTTAAGG	0.308																																																1	Substitution - Missense(1)	lung(1)	8											191.0	187.0	188.0					8																	53030927		2201	4297	6498	53193480	SO:0001587	stop_gained	9705			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2830G>T	8.37:g.53030927C>A	ENSP00000276480:p.Glu944*	Somatic		Capture	Illumina GAIIx	4	53193480	Q17RY1	Nonsense_Mutation	SNP	superfamily_SSF103637,HMMPfam_zf-C2HC,HMMPfam_MYT1	p.E944*	ENST00000276480.7	37	c.2830	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	C	47	13.336713	0.99735	.	.	ENSG00000147488	ENST00000276480	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-26.1059	18.9918	0.92796	0.0:1.0:0.0:0.0	.	.	.	.	X	944	.	ENSP00000276480:E944X	E	-	1	0	ST18	53193480	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.441000	0.80485	2.499000	0.84300	0.591000	0.81541	GAA	-	NULL		0.308	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	protein_coding	OTTHUMT00000377867.1	C			53193480	-1	no_errors	NM_014682	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
WNT5A	7474	genome.wustl.edu	37	3	55504324	55504324	+	Silent	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr3:55504324C>T	ENST00000474267.1	-	6	1460	c.939G>A	c.(937-939)gaG>gaA	p.E313E	WNT5A_ENST00000493406.1_5'Flank|WNT5A_ENST00000497027.1_Silent_p.E298E|WNT5A_ENST00000264634.4_Silent_p.E313E			P41221	WNT5A_HUMAN	wingless-type MMTV integration site family, member 5A	313					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|ameboidal cell migration (GO:0001667)|anterior/posterior axis specification, embryo (GO:0008595)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular protein localization (GO:0034613)|cellular response to calcium ion (GO:0071277)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cervix development (GO:0060067)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|dopaminergic neuron differentiation (GO:0071542)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system development (GO:0048706)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity (GO:0001736)|face development (GO:0060324)|genitalia development (GO:0048806)|heart looping (GO:0001947)|hematopoietic stem cell proliferation (GO:0071425)|hindgut morphogenesis (GO:0007442)|hypophysis morphogenesis (GO:0048850)|keratinocyte differentiation (GO:0030216)|lateral sprouting involved in mammary gland duct morphogenesis (GO:0060599)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|male gonad development (GO:0008584)|mammary gland branching involved in thelarche (GO:0060744)|mesenchymal-epithelial cell signaling (GO:0060638)|midgut development (GO:0007494)|negative chemotaxis (GO:0050919)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of synapse assembly (GO:0051964)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|olfactory bulb interneuron development (GO:0021891)|optic cup formation involved in camera-type eye development (GO:0003408)|palate development (GO:0060021)|planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:0061350)|planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:0061349)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar cell polarity pathway involved in outflow tract morphogenesis (GO:0061347)|planar cell polarity pathway involved in pericardium morphogenesis (GO:0061354)|planar cell polarity pathway involved in ventricular septum morphogenesis (GO:0061348)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of meiosis (GO:0045836)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ossification (GO:0045778)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|protein phosphorylation (GO:0006468)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|response to organic substance (GO:0010033)|somitogenesis (GO:0001756)|type B pancreatic cell development (GO:0003323)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|wound healing (GO:0042060)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor tyrosine kinase-like orphan receptor binding (GO:0005115)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(1)|large_intestine(4)|lung(3)|prostate(2)|urinary_tract(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		AGCCGGTGCTCTCATTGCGCA	0.642																																																0			3											55.0	63.0	60.0					3																	55504324		2203	4300	6503	55479364	SO:0001819	synonymous_variant	7474			L20861	CCDS46850.1, CCDS58835.1	3p21-p14	2013-02-28			ENSG00000114251	ENSG00000114251		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12784	protein-coding gene	gene with protein product	"""WNT-5A protein"""	164975				8288227	Standard	NM_001256105		Approved	hWNT5A	uc010hmw.4	P41221	OTTHUMG00000158361	ENST00000474267.1:c.939G>A	3.37:g.55504324C>T		Somatic		Capture	Illumina GAIIx	4	55479364	A8K4A4|Q6P278	Silent	SNP	HMMPfam_wnt,HMMSmart_SM00097,PatternScan_WNT1	p.E313	ENST00000474267.1	37	c.939	CCDS46850.1	3																																																																																			-	HMMPfam_wnt,HMMSmart_SM00097		0.642	WNT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT5A	protein_coding	OTTHUMT00000350793.3	C	NM_003392		55479364	-1	no_errors	NM_003392	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
CCDC85A	114800	genome.wustl.edu	37	2	56611481	56611481	+	Silent	SNP	A	A	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr2:56611481A>T	ENST00000407595.2	+	6	2155	c.1653A>T	c.(1651-1653)ggA>ggT	p.G551G	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	551										breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AGTACAAAGGACCAATGTGAG	0.423																																																0			2											94.0	93.0	93.0					2																	56611481		1968	4149	6117	56464985	SO:0001819	synonymous_variant	114800			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.1653A>T	2.37:g.56611481A>T		Somatic		Capture	Illumina GAIIx	4	56464985		Silent	SNP	HMMPfam_DUF2216	p.G551	ENST00000407595.2	37	c.1653	CCDS46290.1	2																																																																																			-	NULL		0.423	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85A	protein_coding	OTTHUMT00000324993.1	A			56464985	+1	no_errors	NM_001080433	genbank	human	provisional	54_36p	silent	SNP	1.000	T
SERPINB2	5055	genome.wustl.edu	37	18	61570359	61570359	+	Silent	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr18:61570359C>T	ENST00000299502.4	+	8	1148	c.1068C>T	c.(1066-1068)caC>caT	p.H356H	SERPINB2_ENST00000457692.1_Silent_p.H356H	NM_002575.2	NP_002566.1	P05120	PAI2_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 2	356					blood coagulation (GO:0007596)|fibrinolysis (GO:0042730)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|liver(1)|lung(12)|prostate(2)|skin(2)|stomach(1)	32		Esophageal squamous(42;0.131)			Tenecteplase(DB00031)|Urokinase(DB00013)	AAGTGTTCCACCAAGCCATGG	0.542																																																0			18											130.0	108.0	116.0					18																	61570359		2203	4300	6503	59721339	SO:0001819	synonymous_variant	5055			Y00630	CCDS11989.1	18q21.3	2014-02-18	2005-08-18		ENSG00000197632	ENSG00000197632		"""Serine (or cysteine) peptidase inhibitors"""	8584	protein-coding gene	gene with protein product		173390	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2"""	PLANH2, PAI2		24172014	Standard	NM_002575		Approved	HsT1201	uc002ljo.3	P05120	OTTHUMG00000060592	ENST00000299502.4:c.1068C>T	18.37:g.61570359C>T		Somatic		Capture	Illumina GAIIx	4	59721339	Q96E96	Silent	SNP	HMMPfam_Serpin,superfamily_Prot_inh_serpin,HMMSmart_SERPIN,PatternScan_SERPIN	p.H356	ENST00000299502.4	37	c.1068	CCDS11989.1	18																																																																																			-	HMMPfam_Serpin,superfamily_Prot_inh_serpin,HMMSmart_SERPIN		0.542	SERPINB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB2	protein_coding	OTTHUMT00000134009.1	C	NM_002575		59721339	+1	no_errors	NM_002575	genbank	human	validated	54_36p	silent	SNP	0.978	T
LILRP2	79166	genome.wustl.edu	37	19	55221451	55221451	+	RNA	SNP	C	C	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr19:55221451C>A	ENST00000413439.1	+	0	1231									leukocyte immunoglobulin-like receptor pseudogene 2																		TCACTCTGTACAAGGAGGGGG	0.652																																					Ovarian(107;788 1543 20399 31552 46707)											0			19																																								59913263			79166			AF072100		19q13.4	2010-02-17			ENSG00000240258	ENSG00000170858		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"""	15497	pseudogene	pseudogene						10941842	Standard	NR_003061		Approved	ILT10, CD85m	uc002qgs.1		OTTHUMG00000065886		19.37:g.55221451C>A		Somatic		Capture	Illumina GAIIx	4	59913263		RNA	SNP	-	NULL	ENST00000413439.1	37	NULL		19																																																																																			-	-		0.652	LILRP2-002	KNOWN	basic	processed_transcript	LILRP2	pseudogene	OTTHUMT00000141240.2	C	NM_024317		59913263	+1	pseudogene	NR_003061	genbank	human	provisional	54_36p	rna	SNP	0.000	A
MNAT1	4331	genome.wustl.edu	37	14	61346553	61346553	+	Splice_Site	SNP	G	G	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr14:61346553G>C	ENST00000261245.4	+	7	910	c.809G>C	c.(808-810)gGg>gCg	p.G270A	MNAT1_ENST00000539616.2_Splice_Site_p.G228A|RP11-193F5.1_ENST00000553946.1_RNA	NM_002431.3	NP_002422.1	P51948	MAT1_HUMAN	MNAT CDK-activating kinase assembly factor 1	270					7-methylguanosine mRNA capping (GO:0006370)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to calcium ion (GO:0051592)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|ventricular system development (GO:0021591)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.0174)		GGAAGACTTGGGTATGTGTCC	0.393								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																																								0			14											79.0	70.0	73.0					14																	61346553		2203	4300	6503	60416306	SO:0001630	splice_region_variant	4331			X87843	CCDS9750.1, CCDS53899.1	14q23	2013-07-31	2013-07-31		ENSG00000020426	ENSG00000020426		"""RING-type (C3HC4) zinc fingers"", ""General transcription factor IIH complex subunits"""	7181	protein-coding gene	gene with protein product	"""CDK-activating kinase assembly factor"""	602659	"""menage a trois 1 (CAK assembly factor)"", ""menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)"""			9465303	Standard	NM_002431		Approved	MAT1, RNF66	uc001xfd.3	P51948	OTTHUMG00000152340	ENST00000261245.4:c.809+1G>C	14.37:g.61346553G>C		Somatic		Capture	Illumina GAIIx	4	60416306	G3V1U8|Q15817|Q6ICQ7	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_MAT1	p.G270A	ENST00000261245.4	37	c.809	CCDS9750.1	14	.	.	.	.	.	.	.	.	.	.	G	27.6	4.846305	0.91277	.	.	ENSG00000020426	ENST00000261245;ENST00000539616;ENST00000554002;ENST00000557134	T;T;T	0.56103	0.85;0.6;0.48	5.79	5.79	0.91817	.	0.059267	0.64402	D	0.000002	T	0.70395	0.3219	M	0.80183	2.485	0.80722	D	1	D;D	0.62365	0.987;0.991	P;P	0.58454	0.671;0.839	T	0.67803	-0.5576	10	0.29301	T	0.29	-17.2194	18.2229	0.89907	0.0:0.0:1.0:0.0	.	228;270	G3V1U8;P51948	.;MAT1_HUMAN	A	270;228;165;130	ENSP00000261245:G270A;ENSP00000446437:G228A;ENSP00000451017:G130A	ENSP00000261245:G270A	G	+	2	0	MNAT1	60416306	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.318000	0.79029	2.725000	0.93324	0.557000	0.71058	GGG;GGG;GGA;GGG	-	NULL		0.393	MNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNAT1	protein_coding	OTTHUMT00000276956.1	G	NM_002431	Missense_Mutation	60416306	+1	no_errors	NM_002431	genbank	human	validated	54_36p	missense	SNP	1.000	C
RAB3IL1	5866	genome.wustl.edu	37	11	61669967	61669967	+	Missense_Mutation	SNP	G	G	A	rs148671281		TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr11:61669967G>A	ENST00000394836.2	-	8	1103	c.946C>T	c.(946-948)Cgg>Tgg	p.R316W	RAB3IL1_ENST00000301773.5_Missense_Mutation_p.R290W	NM_013401.2	NP_037533.2	Q8TBN0	R3GEF_HUMAN	RAB3A interacting protein (rabin3)-like 1	316					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(4)|skin(3)|urinary_tract(1)	14						TCCCCGAGCCGGATTCGGTGG	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16048	0.0		0.0	False		,,,				2504	0.0															0			11											43.0	41.0	42.0					11																	61669967		2200	4298	6498	61426543	SO:0001583	missense	5866			AF084557	CCDS8014.1, CCDS60809.1	11q12.2	2008-02-01			ENSG00000167994	ENSG00000167994			9780	protein-coding gene	gene with protein product							Standard	NM_013401		Approved		uc001nso.4	Q8TBN0	OTTHUMG00000167524	ENST00000394836.2:c.946C>T	11.37:g.61669967G>A	ENSP00000378313:p.Arg316Trp	Somatic		Capture	Illumina GAIIx	4	61426543	Q86V32|Q9P1Q8	Missense_Mutation	SNP	HMMPfam_Sec2p	p.R316W	ENST00000394836.2	37	c.946	CCDS8014.1	11	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	17.92	3.507135	0.64410	.	.	ENSG00000167994	ENST00000394836;ENST00000301773	T;T	0.43688	0.94;0.94	4.25	3.24	0.37175	.	0.137802	0.50627	D	0.000117	T	0.59473	0.2196	M	0.77486	2.375	0.43238	D	0.995148	D;D	0.89917	1.0;0.998	D;P	0.65874	0.939;0.623	T	0.63888	-0.6535	10	0.87932	D	0	-23.5174	9.6714	0.40015	0.0:0.0:0.5883:0.4117	.	290;316	Q8TBN0-2;Q8TBN0	.;R3GEF_HUMAN	W	316;290	ENSP00000378313:R316W;ENSP00000301773:R290W	ENSP00000301773:R290W	R	-	1	2	RAB3IL1	61426543	1.000000	0.71417	1.000000	0.80357	0.387000	0.30353	6.738000	0.74822	2.304000	0.77564	0.561000	0.74099	CGG	-	NULL		0.627	RAB3IL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3IL1	protein_coding	OTTHUMT00000394917.1	G	NM_013401		61426543	-1	no_errors	NM_013401	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ABHD16B	140701	genome.wustl.edu	37	20	62493574	62493574	+	Silent	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr20:62493574C>T	ENST00000369916.3	+	1	1009	c.681C>T	c.(679-681)gtC>gtT	p.V227V	C20ORF135_ENST00000601296.1_5'Flank	NM_080622.3	NP_542189.1	Q9H3Z7	ABHGB_HUMAN	abhydrolase domain containing 16B	227							hydrolase activity (GO:0016787)			endometrium(2)|kidney(1)|lung(3)	6						ACGTGGTGGTCGAGTACGCAC	0.687																																																0			20											41.0	35.0	37.0					20																	62493574		2201	4299	6500	61964018	SO:0001819	synonymous_variant	140701				CCDS13539.1	20q13.33	2013-01-17	2010-12-09	2010-12-09	ENSG00000183260	ENSG00000183260		"""Abhydrolase domain containing"""	16128	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 135"""	C20orf135			Standard	NM_080622		Approved	dJ591C20.1	uc002ygx.1	Q9H3Z7	OTTHUMG00000033010	ENST00000369916.3:c.681C>T	20.37:g.62493574C>T		Somatic		Capture	Illumina GAIIx	4	61964018		Silent	SNP	superfamily_SSF53474,HMMPfam_Abhydrolase_1	p.V227	ENST00000369916.3	37	c.681	CCDS13539.1	20																																																																																			-	superfamily_SSF53474,HMMPfam_Abhydrolase_1		0.687	ABHD16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf135	protein_coding	OTTHUMT00000080254.1	C			61964018	+1	no_errors	NM_080622	genbank	human	validated	54_36p	silent	SNP	0.999	T
MTA2	9219	genome.wustl.edu	37	11	62363327	62363327	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr11:62363327G>C	ENST00000278823.2	-	13	1540	c.1151C>G	c.(1150-1152)cCt>cGt	p.P384R	MTA2_ENST00000524902.1_Missense_Mutation_p.P211R|MTA2_ENST00000527204.1_Missense_Mutation_p.P211R	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	384					ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						CTGCATGTTAGGTGGGCCCCA	0.577																																																0			11											68.0	67.0	67.0					11																	62363327		2202	4299	6501	62119903	SO:0001583	missense	9219			AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.1151C>G	11.37:g.62363327G>C	ENSP00000278823:p.Pro384Arg	Somatic		Capture	Illumina GAIIx	4	62119903	Q68DB1|Q9UQB5	Missense_Mutation	SNP	PatternScan_GATA_ZN_FINGER_1,HMMPfam_BAH,HMMSmart_BAH,HMMPfam_ELM2,HMMSmart_SANT,HMMPfam_Myb_DNA-binding,superfamily_SSF57716,HMMSmart_ZnF_GATA,HMMPfam_GATA	p.P384R	ENST00000278823.2	37	c.1151	CCDS8022.1	11	.	.	.	.	.	.	.	.	.	.	G	21.2	4.114369	0.77210	.	.	ENSG00000149480	ENST00000278823;ENST00000524902;ENST00000527204	D;D;D	0.99656	-6.31;-6.31;-6.31	5.87	4.91	0.64330	Zinc finger, GATA-type (2);	0.049029	0.85682	D	0.000000	D	0.98720	0.9570	M	0.65975	2.015	0.58432	D	0.999999	P	0.42456	0.78	B	0.39068	0.289	D	0.98669	1.0687	10	0.62326	D	0.03	-14.8293	13.5229	0.61578	0.0:0.0:0.8434:0.1566	.	384	O94776	MTA2_HUMAN	R	384;211;211	ENSP00000278823:P384R;ENSP00000431346:P211R;ENSP00000431797:P211R	ENSP00000278823:P384R	P	-	2	0	MTA2	62119903	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.675000	0.84002	2.778000	0.95560	0.650000	0.86243	CCT	-	superfamily_SSF57716,HMMSmart_ZnF_GATA,HMMPfam_GATA		0.577	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTA2	protein_coding	OTTHUMT00000395578.1	G	NM_004739		62119903	-1	no_errors	NM_004739	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PACS1	55690	genome.wustl.edu	37	11	65983655	65983655	+	Silent	SNP	T	T	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr11:65983655T>C	ENST00000320580.4	+	5	759	c.726T>C	c.(724-726)tcT>tcC	p.S242S		NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	242					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)		RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						AGGATGTCTCTGTGCCTGTGG	0.517																																																0			11											121.0	100.0	107.0					11																	65983655		2201	4295	6496	65740231	SO:0001819	synonymous_variant	55690			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.726T>C	11.37:g.65983655T>C		Somatic		Capture	Illumina GAIIx	4	65740231	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Silent	SNP	HMMPfam_Pacs-1	p.S242	ENST00000320580.4	37	c.726	CCDS8129.1	11																																																																																			-	NULL		0.517	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PACS1	protein_coding	OTTHUMT00000391690.2	T	NM_018026		65740231	+1	no_errors	NM_018026	genbank	human	reviewed	54_36p	silent	SNP	0.925	C
LEPR	3953	genome.wustl.edu	37	1	66036369	66036369	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:66036369C>T	ENST00000349533.6	+	4	439	c.254C>T	c.(253-255)aCa>aTa	p.T85I	LEPR_ENST00000462765.1_3'UTR|LEPR_ENST00000371059.3_Missense_Mutation_p.T85I|LEPR_ENST00000344610.8_Missense_Mutation_p.T85I|LEPR_ENST00000371058.1_Missense_Mutation_p.T85I|LEPR_ENST00000406510.3_5'UTR|LEPR_ENST00000371060.3_Missense_Mutation_p.T85I|snoU13_ENST00000459362.1_RNA	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TTATCCAAAACAACTTTCCAC	0.358																																																0			1											95.0	94.0	94.0					1																	66036369		2203	4300	6503	65808957	SO:0001583	missense	3953			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.254C>T	1.37:g.66036369C>T	ENSP00000330393:p.Thr85Ile	Somatic		Capture	Illumina GAIIx	4	65808957	Q6FHL5	Missense_Mutation	SNP	superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_HEMATOPO_REC_S_F1,HMMPfam_Lep_receptor_Ig,PatternScan_HEMATOPO_REC_L_F2	p.T85I	ENST00000349533.6	37	c.254	CCDS631.1	1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.253396	0.39797	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.56444	0.48;0.48;0.49;0.46;0.48	5.69	4.71	0.59529	.	0.518149	0.23035	N	0.052695	T	0.48642	0.1511	M	0.69823	2.125	0.30152	N	0.80293	P;P;P;D	0.54964	0.919;0.911;0.887;0.969	B;B;P;P	0.51385	0.406;0.391;0.595;0.668	T	0.50915	-0.8771	10	0.59425	D	0.04	-6.462	10.1975	0.43062	0.2454:0.7546:0.0:0.0	.	85;85;85;85	P48357-4;P48357;P48357-2;P48357-3	.;LEPR_HUMAN;.;.	I	85	ENSP00000340884:T85I;ENSP00000330393:T85I;ENSP00000360099:T85I;ENSP00000360098:T85I;ENSP00000360097:T85I	ENSP00000340884:T85I	T	+	2	0	LEPR	65808957	0.014000	0.17966	0.167000	0.22817	0.784000	0.44337	1.808000	0.38912	2.683000	0.91414	0.557000	0.71058	ACA	-	NULL		0.358	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	protein_coding	OTTHUMT00000025275.1	C	NM_002303		65808957	+1	no_errors	NM_002303	genbank	human	validated	54_36p	missense	SNP	0.004	T
TYSND1	219743	genome.wustl.edu	37	10	71899805	71899805	+	Silent	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr10:71899805G>A	ENST00000287078.6	-	4	1575	c.1576C>T	c.(1576-1578)Ctg>Ttg	p.L526L	TYSND1_ENST00000494143.1_5'UTR|TYSND1_ENST00000335494.5_3'UTR	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	526	Serine protease.				protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						TACTGCTGCAGGGCCGGCTGG	0.637																																																0			10											106.0	97.0	100.0					10																	71899805		2203	4300	6503	71569811	SO:0001819	synonymous_variant	219743			BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.1576C>T	10.37:g.71899805G>A		Somatic		Capture	Illumina GAIIx	4	71569811	Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	Silent	SNP	superfamily_Trypsin-like serine proteases	p.L526	ENST00000287078.6	37	c.1576	CCDS31213.1	10																																																																																			-	superfamily_Trypsin-like serine proteases		0.637	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYSND1	protein_coding	OTTHUMT00000048483.1	G	NM_173555		71569811	-1	no_errors	NM_173555	genbank	human	validated	54_36p	silent	SNP	0.981	A
E2F7	144455	genome.wustl.edu	37	12	77440073	77440073	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr12:77440073C>T	ENST00000322886.7	-	5	809	c.574G>A	c.(574-576)Gtg>Atg	p.V192M	E2F7_ENST00000416496.2_Missense_Mutation_p.V192M	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	192					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						GACTCCAGCACATTTACAATG	0.488																																																0			12											78.0	74.0	75.0					12																	77440073		2203	4300	6503	75964204	SO:0001583	missense	144455			BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.574G>A	12.37:g.77440073C>T	ENSP00000323246:p.Val192Met	Somatic		Capture	Illumina GAIIx	4	75964204	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	"superfamily_""Winged helix"" DNA-binding domain,HMMPfam_E2F_TDP"	p.V192M	ENST00000322886.7	37	c.574	CCDS9016.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.3|29.3	4.995956|4.995956	0.93167|0.93167	.|.	.|.	ENSG00000165891|ENSG00000165891	ENST00000551058|ENST00000322886;ENST00000416496;ENST00000550669	.|T;T;T	.|0.56611	.|0.7;0.45;0.46	6.08|6.08	6.08|6.08	0.98989|0.98989	.|Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.82688|0.82688	0.5091|0.5091	H|H	0.95917|0.95917	3.74|3.74	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|0.999;1.0	D|D	0.87043|0.87043	0.2142|0.2142	5|10	.|0.87932	.|D	.|0	-17.9406|-17.9406	19.6603|19.6603	0.95864|0.95864	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|192;192	.|F8VSE7;Q96AV8	.|.;E2F7_HUMAN	I|M	69|192	.|ENSP00000323246:V192M;ENSP00000393639:V192M;ENSP00000448245:V192M	.|ENSP00000323246:V192M	M|V	-|-	3|1	0|0	E2F7|E2F7	75964204|75964204	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.837000|0.837000	0.47467|0.47467	6.094000|6.094000	0.71431|0.71431	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	ATG|GTG	-	"superfamily_""Winged helix"" DNA-binding domain,HMMPfam_E2F_TDP"		0.488	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F7	protein_coding	OTTHUMT00000406716.1	C	XM_084871		75964204	-1	no_errors	NM_203394	genbank	human	validated	54_36p	missense	SNP	1.000	T
TMEM30A	55754	genome.wustl.edu	37	6	75969140	75969140	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr6:75969140C>T	ENST00000230461.6	-	5	937	c.608G>A	c.(607-609)gGt>gAt	p.G203D	TMEM30A_ENST00000370050.5_Missense_Mutation_p.G84D|TMEM30A_ENST00000475111.2_Missense_Mutation_p.G167D	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	203					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCAAGCAATACCTTTCTTTTT	0.338																																																0			6											91.0	91.0	91.0					6																	75969140		2203	4298	6501	76025860	SO:0001583	missense	55754			AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.608G>A	6.37:g.75969140C>T	ENSP00000230461:p.Gly203Asp	Somatic		Capture	Illumina GAIIx	4	76025860	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Missense_Mutation	SNP	HMMPfam_CDC50	p.G203D	ENST00000230461.6	37	c.608	CCDS4983.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.244993	0.95272	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.73466	0.3590	M	0.64676	1.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.71609	-0.4541	9	0.44086	T	0.13	.	19.3389	0.94334	0.0:1.0:0.0:0.0	.	167;203	Q9NV96-2;Q9NV96	.;CC50A_HUMAN	D	203;187;84;167	.	ENSP00000230461:G203D	G	-	2	0	TMEM30A	76025860	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.624000	0.83124	2.650000	0.89964	0.655000	0.94253	GGT	-	HMMPfam_CDC50		0.338	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM30A	protein_coding	OTTHUMT00000041248.2	C	NM_018247		76025860	-1	no_errors	NM_018247	genbank	human	validated	54_36p	missense	SNP	1.000	T
SEMA3A	10371	genome.wustl.edu	37	7	83590916	83590916	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr7:83590916G>A	ENST00000265362.4	-	17	2401	c.2087C>T	c.(2086-2088)aCa>aTa	p.T696I	SEMA3A_ENST00000436949.1_Missense_Mutation_p.T696I	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	696					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CTGGCTAGGTGTCATGCTATT	0.438																																																0			7											203.0	178.0	186.0					7																	83590916		2203	4300	6503	83428852	SO:0001583	missense	10371			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.2087C>T	7.37:g.83590916G>A	ENSP00000265362:p.Thr696Ile	Somatic		Capture	Illumina GAIIx	4	83428852		Missense_Mutation	SNP	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema,HMMSmart_PSI,superfamily_Plexin-like_fold,superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig	p.T696I	ENST00000265362.4	37	c.2087	CCDS5599.1	7	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292796	0.40594	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.28069	1.63;1.63	6.08	6.08	0.98989	.	0.269394	0.43919	D	0.000509	T	0.22551	0.0544	N	0.14661	0.345	0.54753	D	0.999983	B	0.29862	0.259	B	0.27608	0.081	T	0.04242	-1.0966	10	0.26408	T	0.33	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	696	Q14563	SEM3A_HUMAN	I	696	ENSP00000265362:T696I;ENSP00000415260:T696I	ENSP00000265362:T696I	T	-	2	0	SEMA3A	83428852	1.000000	0.71417	0.906000	0.35671	0.821000	0.46438	7.837000	0.86796	2.894000	0.99253	0.655000	0.94253	ACA	-	NULL		0.438	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3A	protein_coding	OTTHUMT00000253355.2	G	NM_006080		83428852	-1	no_errors	NM_006080	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
SLCO3A1	28232	genome.wustl.edu	37	15	92663776	92663776	+	Missense_Mutation	SNP	T	T	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr15:92663776T>C	ENST00000318445.6	+	5	1305	c.1091T>C	c.(1090-1092)gTg>gCg	p.V364A	SLCO3A1_ENST00000555549.1_3'UTR|SLCO3A1_ENST00000424469.2_Missense_Mutation_p.V364A	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	364					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	GAGATTGCAGTGGTGGCTGGC	0.572																																																0			15											213.0	190.0	198.0					15																	92663776		2198	4298	6496	90464780	SO:0001583	missense	28232			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.1091T>C	15.37:g.92663776T>C	ENSP00000320634:p.Val364Ala	Somatic		Capture	Illumina GAIIx	4	90464780	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	superfamily_MFS general substrate transporter,HMMPfam_OATP,superfamily_Kazal-type serine protease inhibitors,HMMPfam_Kazal_2	p.V364A	ENST00000318445.6	37	c.1091	CCDS10371.1	15	.	.	.	.	.	.	.	.	.	.	T	23.9	4.472540	0.84640	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000555549	T;T	0.80033	-1.33;-1.33	5.11	5.11	0.69529	Major facilitator superfamily domain, general substrate transporter (1);	0.062416	0.64402	N	0.000005	T	0.82250	0.4996	L	0.33668	1.02	0.80722	D	1	B;D;D	0.71674	0.42;0.998;0.997	B;D;D	0.77557	0.187;0.99;0.981	T	0.77413	-0.2597	10	0.08837	T	0.75	.	14.8971	0.70651	0.0:0.0:0.0:1.0	.	306;364;364	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	A	364;364;83	ENSP00000320634:V364A;ENSP00000387846:V364A	ENSP00000320634:V364A	V	+	2	0	SLCO3A1	90464780	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	7.478000	0.81082	1.920000	0.55613	0.477000	0.44152	GTG	-	superfamily_MFS general substrate transporter,HMMPfam_OATP		0.572	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO3A1	protein_coding	OTTHUMT00000313529.1	T	NM_013272		90464780	+1	no_errors	NM_013272	genbank	human	validated	54_36p	missense	SNP	1.000	C
ABCA4	24	genome.wustl.edu	37	1	94497359	94497359	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:94497359C>T	ENST00000370225.3	-	27	4189	c.4103G>A	c.(4102-4104)cGc>cAc	p.R1368H		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1368					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CTTGTGGCTGCGGATGGTGTG	0.612																																																0			1											86.0	78.0	81.0					1																	94497359		2203	4300	6503	94269947	SO:0001583	missense	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.4103G>A	1.37:g.94497359C>T	ENSP00000359245:p.Arg1368His	Somatic		Capture	Illumina GAIIx	4	94269947	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.R1368H	ENST00000370225.3	37	c.4103	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.330469	0.95733	.	.	ENSG00000198691	ENST00000546054;ENST00000370225	D	0.93906	-3.31	5.78	5.78	0.91487	.	0.055384	0.64402	D	0.000003	D	0.97185	0.9080	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	D	0.97331	0.9950	10	0.87932	D	0	.	20.0044	0.97430	0.0:1.0:0.0:0.0	.	1368	P78363	ABCA4_HUMAN	H	160;1368	ENSP00000359245:R1368H	ENSP00000359245:R1368H	R	-	2	0	ABCA4	94269947	1.000000	0.71417	0.966000	0.40874	0.858000	0.48976	7.531000	0.81973	2.714000	0.92807	0.650000	0.86243	CGC	-	NULL		0.612	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	C	NM_000350		94269947	-1	no_errors	NM_000350	genbank	human	reviewed	54_36p	missense	SNP	0.862	T
CYP26A1	1592	genome.wustl.edu	37	10	94836889	94836889	+	Missense_Mutation	SNP	G	G	C	rs140117559		TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr10:94836889G>C	ENST00000224356.4	+	7	1367	c.1322G>C	c.(1321-1323)aGc>aCc	p.S441T	CYP26A1_ENST00000371531.1_Missense_Mutation_p.S372T|CYP26A1_ENST00000394139.1_Missense_Mutation_p.S372T	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	441					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	GGCCTTAGGAGCTGTGTAGGC	0.453																																																0			10											65.0	59.0	61.0					10																	94836889		2203	4300	6503	94826879	SO:0001583	missense	1592			AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.1322G>C	10.37:g.94836889G>C	ENSP00000224356:p.Ser441Thr	Somatic		Capture	Illumina GAIIx	4	94826879	B3KNI4|Q5VXH9|Q5VXI0	Missense_Mutation	SNP	HMMPfam_p450,superfamily_Cytochrome_P450,PatternScan_CYTOCHROME_P450	p.S441T	ENST00000224356.4	37	c.1322	CCDS7426.1	10	.	.	.	.	.	.	.	.	.	.	G	8.720	0.914111	0.17907	.	.	ENSG00000095596	ENST00000371531;ENST00000224356;ENST00000394139	T;T;T	0.69306	-0.39;-0.39;-0.39	5.49	4.55	0.56014	Cytochrome P450, conserved site (1);	0.127864	0.64402	D	0.000001	T	0.52533	0.1740	N	0.20304	0.555	0.37230	D	0.905629	B;B	0.24721	0.11;0.004	B;B	0.29077	0.098;0.017	T	0.50898	-0.8773	10	0.16896	T	0.51	-23.3852	16.5819	0.84717	0.0:0.1294:0.8706:0.0	.	372;441	B3KNI4;O43174	.;CP26A_HUMAN	T	372;441;372	ENSP00000360586:S372T;ENSP00000224356:S441T;ENSP00000377695:S372T	ENSP00000224356:S441T	S	+	2	0	CYP26A1	94826879	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.012000	0.64017	2.857000	0.98124	0.650000	0.86243	AGC	-	HMMPfam_p450,superfamily_Cytochrome_P450,PatternScan_CYTOCHROME_P450		0.453	CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP26A1	protein_coding	OTTHUMT00000049408.3	G			94826879	+1	no_errors	NM_000783	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PTBP2	58155	genome.wustl.edu	37	1	97235312	97235312	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:97235312C>T	ENST00000426398.2	+	4	212	c.169C>T	c.(169-171)Cct>Tct	p.P57S	PTBP2_ENST00000482253.1_3'UTR|PTBP2_ENST00000370197.1_Missense_Mutation_p.P57S|PTBP2_ENST00000541987.1_Missense_Mutation_p.P26S|PTBP2_ENST00000394184.3_Missense_Mutation_p.P68S|PTBP2_ENST00000609116.1_Missense_Mutation_p.P57S|PTBP2_ENST00000370198.1_Missense_Mutation_p.P57S	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	57					mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		GGATGGTGCTCCTTCTCGTGT	0.328																																																0			1											109.0	119.0	115.0					1																	97235312		2203	4300	6503	97007900	SO:0001583	missense	58155			AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.169C>T	1.37:g.97235312C>T	ENSP00000412788:p.Pro57Ser	Somatic		Capture	Illumina GAIIx	4	97007900	Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.P57S	ENST00000426398.2	37	c.169	CCDS754.1	1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624572	0.66901	.	.	ENSG00000117569	ENST00000236228;ENST00000370198;ENST00000370197;ENST00000426398;ENST00000394184;ENST00000541987;ENST00000394176	T;T;T;T;T;T	0.80393	0.67;0.66;0.66;0.65;0.65;-1.37	5.94	5.94	0.96194	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	D	0.88012	0.6323	M	0.82823	2.61	0.52501	D	0.999952	P;P;P;P;D;D;D	0.58970	0.837;0.455;0.59;0.934;0.961;0.961;0.984	P;B;B;P;D;D;P	0.64321	0.616;0.188;0.176;0.796;0.924;0.924;0.854	D	0.88566	0.3126	10	0.62326	D	0.03	-3.635	15.81	0.78552	0.0:0.8648:0.1352:0.0	.	65;68;57;57;57;57;79	B4DSU5;B4DSS8;Q9UKA9-4;Q9UKA9;Q9UKA9-2;Q9UKA9-3;Q59G43	.;.;.;PTBP2_HUMAN;.;.;.	S	57;57;57;57;68;26;47	ENSP00000236228:P57S;ENSP00000359217:P57S;ENSP00000359216:P57S;ENSP00000412788:P57S;ENSP00000377738:P68S;ENSP00000442475:P26S	ENSP00000236228:P57S	P	+	1	0	PTBP2	97007900	1.000000	0.71417	0.978000	0.43139	0.994000	0.84299	5.883000	0.69721	2.820000	0.97059	0.650000	0.86243	CCT	-	superfamily_RNA-binding domain RBD		0.328	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP2	protein_coding	OTTHUMT00000029453.1	C			97007900	+1	no_errors	NM_021190	genbank	human	reviewed	54_36p	missense	SNP	0.985	T
TRRAP	8295	genome.wustl.edu	37	7	98495486	98495486	+	Silent	SNP	A	A	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr7:98495486A>C	ENST00000359863.4	+	8	839	c.630A>C	c.(628-630)cgA>cgC	p.R210R	TRRAP_ENST00000355540.3_Silent_p.R210R|TRRAP_ENST00000446306.3_Silent_p.R210R	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	210					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GTGAGACTCGAACAGTAAGTG	0.458																																																0			7											165.0	151.0	155.0					7																	98495486		2203	4300	6503	98333422	SO:0001819	synonymous_variant	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.630A>C	7.37:g.98495486A>C		Somatic		Capture	Illumina GAIIx	4	98333422	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	superfamily_ARM repeat,PatternScan_COPPER_BLUE,superfamily_Protein prenylyltransferase,HMMPfam_FAT,superfamily_TPR-like,superfamily_Protein kinase-like (PK-like),HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146,HMMPfam_FATC	p.R210	ENST00000359863.4	37	c.630	CCDS59066.1	7																																																																																			-	superfamily_ARM repeat		0.458	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	protein_coding	OTTHUMT00000317978.1	A	NM_003496		98333422	+1	no_errors	NM_003496	genbank	human	validated	54_36p	silent	SNP	0.997	C
RRP12	23223	genome.wustl.edu	37	10	99141222	99141222	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr10:99141222C>T	ENST00000370992.4	-	12	1450	c.1339G>A	c.(1339-1341)Gtg>Atg	p.V447M	RRP12_ENST00000536831.1_Missense_Mutation_p.V165M|RRP12_ENST00000414986.1_Missense_Mutation_p.V386M|RRP12_ENST00000315563.6_Missense_Mutation_p.V347M	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	447						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		TGGGGAGCCACGCATTCCTTC	0.612																																																0			10											63.0	51.0	55.0					10																	99141222		2203	4300	6503	99131212	SO:0001583	missense	23223				CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.1339G>A	10.37:g.99141222C>T	ENSP00000360031:p.Val447Met	Somatic		Capture	Illumina GAIIx	4	99131212	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_NUC173	p.V447M	ENST00000370992.4	37	c.1339	CCDS7457.1	10	.	.	.	.	.	.	.	.	.	.	C	17.40	3.379154	0.61735	.	.	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986;ENST00000536831	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.68	2.4	0.29515	Armadillo-like helical (1);Armadillo-type fold (1);	0.219434	0.47455	D	0.000228	T	0.71702	0.3371	M	0.74647	2.275	0.47094	D	0.999317	D;D;D;P	0.62365	0.985;0.972;0.991;0.801	P;P;P;B	0.61592	0.595;0.891;0.734;0.417	T	0.71889	-0.4456	10	0.72032	D	0.01	-15.7876	7.5755	0.27933	0.0:0.5998:0.0:0.4002	.	386;347;165;447	E9PCK7;Q5JTH9-2;F5H456;Q5JTH9	.;.;.;RRP12_HUMAN	M	447;347;386;165	ENSP00000360031:V447M;ENSP00000324315:V347M;ENSP00000414863:V386M;ENSP00000446184:V165M	ENSP00000324315:V347M	V	-	1	0	RRP12	99131212	0.506000	0.26139	0.995000	0.50966	0.665000	0.39181	0.726000	0.25984	0.758000	0.33059	0.551000	0.68910	GTG	-	superfamily_ARM repeat		0.612	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RRP12	protein_coding	OTTHUMT00000049699.4	C	NM_015179		99131212	-1	no_errors	NM_015179	genbank	human	validated	54_36p	missense	SNP	1.000	T
DNMBP	23268	genome.wustl.edu	37	10	101643914	101643914	+	Missense_Mutation	SNP	T	T	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr10:101643914T>C	ENST00000324109.4	-	15	3942	c.3851A>G	c.(3850-3852)tAt>tGt	p.Y1284C	DNMBP_ENST00000543621.1_Missense_Mutation_p.Y530C|DNMBP_ENST00000342239.3_Missense_Mutation_p.Y1308C|DNMBP_ENST00000472036.1_5'Flank|DNMBP_ENST00000540316.1_Missense_Mutation_p.Y220C	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1284					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		TTCAGGGGGATACCTGGCCAG	0.493																																																0			10											80.0	84.0	83.0					10																	101643914		2203	4300	6503	101633904	SO:0001583	missense	23268			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.3851A>G	10.37:g.101643914T>C	ENSP00000315659:p.Tyr1284Cys	Somatic		Capture	Illumina GAIIx	4	101633904	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,HMMPfam_SH3_2,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,PatternScan_DH_1,HMMSmart_SM00721,HMMPfam_BAR	p.Y1284C	ENST00000324109.4	37	c.3851	CCDS7485.1	10	.	.	.	.	.	.	.	.	.	.	T	21.2	4.116921	0.77323	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621;ENST00000540316	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.95	5.95	0.96441	Src homology-3 domain (1);	0.000000	0.43919	D	0.000512	T	0.75744	0.3891	M	0.84683	2.71	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.994;0.994;0.996	T	0.78430	-0.2207	10	0.51188	T	0.08	-17.0921	16.0852	0.81042	0.0:0.0:0.0:1.0	.	1284;530;1308	Q6XZF7;Q6XZF7-2;Q5SVK8	DNMBP_HUMAN;.;.	C	1308;1284;530;530;220	ENSP00000344914:Y1308C;ENSP00000315659:Y1284C;ENSP00000443657:Y530C;ENSP00000443573:Y220C	ENSP00000315659:Y1284C	Y	-	2	0	DNMBP	101633904	1.000000	0.71417	0.998000	0.56505	0.956000	0.61745	4.908000	0.63307	2.279000	0.76181	0.533000	0.62120	TAT	-	superfamily_SH3-domain		0.493	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	protein_coding	OTTHUMT00000049832.2	T	NM_015221		101633904	-1	no_errors	NM_015221	genbank	human	validated	54_36p	missense	SNP	1.000	C
GPR128	84873	genome.wustl.edu	37	3	100352118	100352118	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr3:100352118C>G	ENST00000273352.3	+	4	612	c.344C>G	c.(343-345)cCa>cGa	p.P115R	GPR128_ENST00000475887.1_5'Flank	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	115					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						GCGGGCAATCCAATGGCAGTC	0.289																																					Pancreas(87;185 1975 7223 18722)											0			3											35.0	37.0	37.0					3																	100352118		2203	4300	6503	101834808	SO:0001583	missense	84873			AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.344C>G	3.37:g.100352118C>G	ENSP00000273352:p.Pro115Arg	Somatic		Capture	Illumina GAIIx	4	101834808	Q14D94|Q86SQ2	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F2_2,HMMPfam_GPS,HMMSmart_GPS,HMMPfam_7tm_2	p.P115R	ENST00000273352.3	37	c.344	CCDS2938.1	3	.	.	.	.	.	.	.	.	.	.	C	16.68	3.189327	0.57909	.	.	ENSG00000144820	ENST00000273352	T	0.54675	0.56	5.67	5.67	0.87782	.	0.105765	0.42964	D	0.000632	T	0.70876	0.3274	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.73228	-0.4049	10	0.72032	D	0.01	.	15.2573	0.73596	0.0:1.0:0.0:0.0	.	115	Q96K78	GP128_HUMAN	R	115	ENSP00000273352:P115R	ENSP00000273352:P115R	P	+	2	0	GPR128	101834808	0.299000	0.24426	0.225000	0.23894	0.737000	0.42083	3.358000	0.52284	2.658000	0.90341	0.650000	0.86243	CCA	-	NULL		0.289	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR128	protein_coding	OTTHUMT00000353236.1	C			101834808	+1	no_errors	NM_032787	genbank	human	provisional	54_36p	missense	SNP	0.258	G
RNF20	56254	genome.wustl.edu	37	9	104309780	104309780	+	Missense_Mutation	SNP	A	A	C			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr9:104309780A>C	ENST00000389120.3	+	9	1162	c.1072A>C	c.(1072-1074)Aca>Cca	p.T358P	AL591377.1_ENST00000584534.1_RNA	NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	358					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		GGAGGTCACTACACAAAATGA	0.453																																																0			9											61.0	62.0	62.0					9																	104309780		2203	4300	6503	103349601	SO:0001583	missense	56254			AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.1072A>C	9.37:g.104309780A>C	ENSP00000373772:p.Thr358Pro	Somatic		Capture	Illumina GAIIx	4	103349601	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1	p.T358P	ENST00000389120.3	37	c.1072	CCDS35084.1	9	.	.	.	.	.	.	.	.	.	.	A	14.89	2.669349	0.47677	.	.	ENSG00000155827	ENST00000389120	T	0.32272	1.46	5.41	0.177	0.15054	.	0.381517	0.32640	N	0.005822	T	0.14270	0.0345	N	0.14661	0.345	0.32968	D	0.521894	B	0.14438	0.01	B	0.14023	0.01	T	0.04693	-1.0933	10	0.54805	T	0.06	-2.8213	4.2971	0.10906	0.5075:0.0:0.1382:0.3543	.	358	Q5VTR2	BRE1A_HUMAN	P	358	ENSP00000373772:T358P	ENSP00000373772:T358P	T	+	1	0	RNF20	103349601	0.950000	0.32346	0.898000	0.35279	0.993000	0.82548	1.698000	0.37794	0.075000	0.16796	0.460000	0.39030	ACA	-	NULL		0.453	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF20	protein_coding	OTTHUMT00000356402.1	A	NM_019592		103349601	+1	no_errors	NM_019592	genbank	human	reviewed	54_36p	missense	SNP	0.957	C
LONRF3	79836	genome.wustl.edu	37	X	118145901	118145901	+	Silent	SNP	A	A	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chrX:118145901A>G	ENST00000371628.3	+	8	1807	c.1776A>G	c.(1774-1776)agA>agG	p.R592R	LONRF3_ENST00000472173.1_3'UTR|LONRF3_ENST00000422289.2_Silent_p.R336R|LONRF3_ENST00000304778.7_Silent_p.R551R	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	592	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						CAGGCACGAGACAGTTTGGCA	0.502																																																0			X											202.0	142.0	162.0					X																	118145901		2203	4300	6503	118029929	SO:0001819	synonymous_variant	79836			AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1776A>G	X.37:g.118145901A>G		Somatic		Capture	Illumina GAIIx	4	118029929	Q5JPN6|Q8NB00|Q9H647	Silent	SNP	superfamily_TPR-like,HMMSmart_SM00028,superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_TPR_1,HMMPfam_LON,HMMSmart_SM00464	p.R592	ENST00000371628.3	37	c.1776	CCDS35374.1	X	.	.	.	.	.	.	.	.	.	.	A	9.983	1.228631	0.22542	.	.	ENSG00000175556	ENST00000439603	.	.	.	5.92	-1.02	0.10135	.	.	.	.	.	T	0.50360	0.1611	.	.	.	0.34349	D	0.68959	.	.	.	.	.	.	T	0.57952	-0.7722	4	.	.	.	-35.4074	11.3944	0.49832	0.5307:0.0:0.4693:0.0	.	.	.	.	A	358	.	.	T	+	1	0	LONRF3	118029929	0.310000	0.24527	0.722000	0.30670	0.981000	0.71138	-0.121000	0.10643	-0.192000	0.10432	0.481000	0.45027	ACA	-	HMMPfam_LON,HMMSmart_SM00464		0.502	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF3	protein_coding	OTTHUMT00000355124.2	A	NM_024778		118029929	+1	no_errors	NM_001031855	genbank	human	reviewed	54_36p	silent	SNP	0.589	G
KIAA1210	57481	genome.wustl.edu	37	X	118221702	118221702	+	Missense_Mutation	SNP	C	C	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chrX:118221702C>A	ENST00000402510.2	-	11	3490	c.3491G>T	c.(3490-3492)aGg>aTg	p.R1164M		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1164										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						AACTTTAGACCTCTTTAAGAA	0.483																																																0			X											60.0	55.0	57.0					X																	118221702		1863	4095	5958	118105730	SO:0001583	missense	57481			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.3491G>T	X.37:g.118221702C>A	ENSP00000384670:p.Arg1164Met	Somatic		Capture	Illumina GAIIx	4	118105730	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.R1164M	ENST00000402510.2	37	c.3491	CCDS48156.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.08|14.08	2.428378|2.428378	0.43122|0.43122	.|.	.|.	ENSG00000248857|ENSG00000250423	ENST00000440399|ENST00000402510	.|T	.|0.16073	.|2.37	4.43|4.43	-3.38|-3.38	0.04883|0.04883	.|.	.|.	.|.	.|.	.|.	T|T	0.25306|0.25306	0.0615|0.0615	L|L	0.38175|0.38175	1.15|1.15	0.09310|0.09310	N|N	1|1	.|D	.|0.71674	.|0.998	.|D	.|0.64776	.|0.929	T|T	0.18461|0.18461	-1.0336|-1.0336	5|9	.|0.52906	.|T	.|0.07	.|.	11.1434|11.1434	0.48415|0.48415	0.0:0.2795:0.0:0.7205|0.0:0.2795:0.0:0.7205	.|.	.|1164	.|Q9ULL0	.|K1210_HUMAN	D|M	570|1164	.|ENSP00000384670:R1164M	.|ENSP00000384670:R1164M	E|R	-|-	3|2	2|0	KIAA1210|RP13-347D8.6	118105730|118105730	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.018000|0.018000	0.09664|0.09664	-0.760000|-0.760000	0.04756|0.04756	-1.039000|-1.039000	0.03275|0.03275	-0.340000|-0.340000	0.08031|0.08031	GAG|AGG	-	NULL		0.483	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	protein_coding	OTTHUMT00000371251.2	C	NM_020721		118105730	-1	no_errors	NM_020721	genbank	human	validated	54_36p	missense	SNP	0.000	A
MCTS1	28985	genome.wustl.edu	37	X	119746083	119746083	+	Missense_Mutation	SNP	A	A	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chrX:119746083A>T	ENST00000371317.5	+	6	767	c.510A>T	c.(508-510)ttA>ttT	p.L170F	MCTS1_ENST00000487133.1_3'UTR|MCTS1_ENST00000371315.3_Missense_Mutation_p.L171F	NM_014060.2	NP_054779.1	Q9ULC4	MCTS1_HUMAN	malignant T cell amplified sequence 1	170	PUA. {ECO:0000255|PROSITE- ProRule:PRU00161}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|formation of translation preinitiation complex (GO:0001731)|IRES-dependent translational initiation (GO:0002192)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|ribosome disassembly (GO:0032790)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|stomach(1)|urinary_tract(1)	10						TCCATTATTTAAATGATGGGC	0.338																																																0			X											112.0	113.0	113.0					X																	119746083		2203	4300	6503	119630111	SO:0001583	missense	28985			AB034206	CCDS14601.1, CCDS48160.1	Xq24	2008-05-14			ENSG00000232119	ENSG00000232119			23357	protein-coding gene	gene with protein product		300587				9766643	Standard	NM_014060		Approved	MCT-1	uc011mub.2	Q9ULC4	OTTHUMG00000022303	ENST00000371317.5:c.510A>T	X.37:g.119746083A>T	ENSP00000360367:p.Leu170Phe	Somatic		Capture	Illumina GAIIx	4	119630111	B4DGY2|Q502X6	Missense_Mutation	SNP	superfamily_PUA domain-like,HMMPfam_PUA,HMMSmart_SM00359	p.L170F	ENST00000371317.5	37	c.510	CCDS14601.1	X	.	.	.	.	.	.	.	.	.	.	A	19.24	3.790131	0.70337	.	.	ENSG00000232119	ENST00000371317;ENST00000371315	D;D	0.93953	-3.32;-3.32	5.76	5.76	0.90799	Uncharacterised domain CHP00451 (1);Pseudouridine synthase/archaeosine transglycosylase (3);PUA-like domain (1);	0.000000	0.85682	D	0.000000	D	0.97660	0.9233	H	0.95043	3.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.98686	1.0694	9	.	.	.	-3.6512	14.1021	0.65062	1.0:0.0:0.0:0.0	.	171;170	Q9ULC4-3;Q9ULC4	.;MCTS1_HUMAN	F	170;171	ENSP00000360367:L170F;ENSP00000360365:L171F	.	L	+	3	2	MCTS1	119630111	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.917000	0.39996	1.928000	0.55862	0.486000	0.48141	TTA	-	superfamily_PUA domain-like,HMMPfam_PUA,HMMSmart_SM00359		0.338	MCTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTS1	protein_coding	OTTHUMT00000058110.1	A	NM_014060		119630111	+1	no_errors	NM_014060	genbank	human	validated	54_36p	missense	SNP	1.000	T
TMEM120B	144404	genome.wustl.edu	37	12	122199615	122199615	+	Silent	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr12:122199615G>A	ENST00000449592.2	+	6	623	c.522G>A	c.(520-522)cgG>cgA	p.R174R	TMEM120B_ENST00000540377.1_5'UTR	NM_001080825.2	NP_001074294.2	A0PK00	T120B_HUMAN	transmembrane protein 120B	174						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		TGACCATTCGGGAGAGCATTC	0.572																																																0			12											109.0	103.0	105.0					12																	122199615		2035	4185	6220	120683998	SO:0001819	synonymous_variant	0			BC127768	CCDS41852.1	12q24.31	2007-08-01			ENSG00000188735	ENSG00000188735			32008	protein-coding gene	gene with protein product							Standard	NM_001080825		Approved		uc001ubc.4	A0PK00	OTTHUMG00000169076	ENST00000449592.2:c.522G>A	12.37:g.122199615G>A		Somatic		Capture	Illumina GAIIx	4	120683998	A0PK01|B3KX33	Silent	SNP	HMMPfam_TMPIT	p.R174	ENST00000449592.2	37	c.522	CCDS41852.1	12																																																																																			-	HMMPfam_TMPIT		0.572	TMEM120B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM120B	protein_coding	OTTHUMT00000402158.1	G	NM_001080825		120683998	+1	no_errors	NM_001080825	genbank	human	validated	54_36p	silent	SNP	1.000	A
KALRN	8997	genome.wustl.edu	37	3	124210234	124210234	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr3:124210234G>A	ENST00000240874.3	+	31	4803	c.4646G>A	c.(4645-4647)gGg>gAg	p.G1549E	KALRN_ENST00000360013.3_Missense_Mutation_p.G1549E|KALRN_ENST00000460856.1_Missense_Mutation_p.G1540E	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1549	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TTGTGGTCTGGGCGCACCCCA	0.547																																																0			3											82.0	74.0	77.0					3																	124210234		2203	4300	6503	125692924	SO:0001583	missense	8997			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.4646G>A	3.37:g.124210234G>A	ENSP00000240874:p.Gly1549Glu	Somatic		Capture	Illumina GAIIx	4	125692924	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	superfamily_CRAL/TRIO domain,HMMSmart_SM00516,HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_Spectrin repeat,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_PH domain-like,HMMSmart_SM00233,HMMPfam_PH,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,HMMPfam_SH3_2,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.G1549E	ENST00000240874.3	37	c.4646	CCDS3027.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.315969|4.315969	0.81469|0.81469	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013|ENST00000354186	T;T;T|T	0.11063|0.10960	2.81;2.81;2.81|2.82	5.38|5.38	4.51|4.51	0.55191|0.55191	Pleckstrin homology-type (1);Pleckstrin homology domain (2);|.	0.059559|0.059559	0.64402|0.64402	D|D	0.000002|0.000002	T|T	0.21267|0.21267	0.0512|0.0512	L|L	0.52364|0.52364	1.645|1.645	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.81914|.	0.962;0.995;0.983|.	T|T	0.00695|0.00695	-1.1606|-1.1606	10|8	0.62326|0.87932	D|D	0.03|0	.|.	13.9587|13.9587	0.64166|0.64166	0.0719:0.0:0.9281:0.0|0.0719:0.0:0.9281:0.0	.|.	1540;1549;1549|.	C9IZQ6;O60229;O60229-2|.	.;KALRN_HUMAN;.|.	E|S	1540;1549;1549|1518	ENSP00000418611:G1540E;ENSP00000240874:G1549E;ENSP00000353109:G1549E|ENSP00000346122:G1518S	ENSP00000240874:G1549E|ENSP00000346122:G1518S	G|G	+|+	2|1	0|0	KALRN|KALRN	125692924|125692924	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.651000|9.651000	0.98493|0.98493	1.503000|1.503000	0.48686|0.48686	0.655000|0.655000	0.94253|0.94253	GGG|GGC	-	superfamily_PH domain-like,HMMSmart_SM00233,HMMPfam_PH		0.547	KALRN-005	KNOWN	basic|CCDS	protein_coding	KALRN	protein_coding	OTTHUMT00000258843.4	G	NM_003947		125692924	+1	no_errors	NM_001024660	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
POTEKP	440915	genome.wustl.edu	37	2	132366981	132366981	+	IGR	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr2:132366981G>A								RNU6-617P (6512 upstream) : LINC01087 (27616 downstream)																							GACATCAGAGGAAGAGTCACA	0.308																																																0			2																																								132083451	SO:0001628	intergenic_variant	0																															2.37:g.132366981G>A		Somatic		Capture	Illumina GAIIx	4	132083451		Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248	p.E346K		37	c.1036		2																																																																																			-	NULL	0	0.308					ACTBL3			G			132083451	+1	no_stop_codon	ENST00000397487	ensembl	human	known	54_36p	missense	SNP	0.039	A
EYA4	2070	genome.wustl.edu	37	6	133767791	133767791	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr6:133767791C>G	ENST00000367895.5	+	4	571	c.107C>G	c.(106-108)gCa>gGa	p.A36G	EYA4_ENST00000355286.6_Missense_Mutation_p.A36G|EYA4_ENST00000430974.2_Missense_Mutation_p.A36G|EYA4_ENST00000452339.2_Missense_Mutation_p.A36G|EYA4_ENST00000531901.1_Missense_Mutation_p.A36G|EYA4_ENST00000431403.2_Missense_Mutation_p.A36G|EYA4_ENST00000355167.3_Missense_Mutation_p.A36G|EYA4_ENST00000525849.1_Missense_Mutation_p.A36G	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	36					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		CAGGACCTAGCAAGTCCTCAT	0.393																																					Melanoma(57;398 1237 3528 4702 7415)											0			6											117.0	111.0	113.0					6																	133767791		2203	4300	6503	133809484	SO:0001583	missense	2070			Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.107C>G	6.37:g.133767791C>G	ENSP00000356870:p.Ala36Gly	Somatic		Capture	Illumina GAIIx	4	133809484	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	HMMPfam_Hydrolase	p.A36G	ENST00000367895.5	37	c.107	CCDS5165.1	6	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653553	0.47362	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;T;D;T;D	0.92249	-3.0;-2.96;-2.9;-2.9;-0.09;-2.92;-0.09;-2.9	4.94	4.94	0.65067	.	0.186442	0.47852	D	0.000212	D	0.82632	0.5079	L	0.34521	1.04	0.50813	D	0.999897	B;B;B;B;B;B	0.16603	0.004;0.002;0.0;0.001;0.003;0.018	B;B;B;B;B;B	0.20184	0.002;0.009;0.002;0.004;0.011;0.028	T	0.79431	-0.1806	10	0.35671	T	0.21	-15.2044	14.9707	0.71232	0.0:0.8568:0.1432:0.0	.	36;36;36;36;36;36	F2Z2Y1;E7ESD5;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;.;EYA4_HUMAN	G	36	ENSP00000395916:A36G;ENSP00000388670:A36G;ENSP00000356870:A36G;ENSP00000347294:A36G;ENSP00000347434:A36G;ENSP00000432770:A36G;ENSP00000433219:A36G;ENSP00000404558:A36G	ENSP00000347294:A36G	A	+	2	0	EYA4	133809484	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.476000	0.66793	2.418000	0.82041	0.591000	0.81541	GCA	-	NULL		0.393	EYA4-001	KNOWN	basic|CCDS	protein_coding	EYA4	protein_coding	OTTHUMT00000042282.2	C	NM_004100		133809484	+1	no_errors	NM_004100	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	7	138089217	138089217	+	IGR	SNP	G	G	A	rs370142674	byFrequency	TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr7:138089217G>A								SNORA51 (216342 upstream) : Y_RNA (11007 downstream)																							TTCTTCTCCCGTAAGTCCTTG	0.532													G|||	3	0.000599042	0.0023	0.0	5008	,	,		14545	0.0		0.0	False		,,,				2504	0.0															0			7																																								137739757	SO:0001628	intergenic_variant	442727																															7.37:g.138089217G>A		Somatic		Capture	Illumina GAIIx	4	137739757		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.532					LOC442727			G			137739757	-1	pseudogene	XR_017503	genbank	human	model	54_36p	rna	SNP	0.940	A
MAGEC1	9947	genome.wustl.edu	37	X	140994936	140994936	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chrX:140994936G>T	ENST00000285879.4	+	4	2032	c.1746G>T	c.(1744-1746)caG>caT	p.Q582H	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	582										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					ACTTTCCTCAGAGCCCTCAGG	0.592										HNSCC(15;0.026)																																						0			X											234.0	252.0	246.0					X																	140994936		2203	4300	6503	140822602	SO:0001583	missense	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1746G>T	X.37:g.140994936G>T	ENSP00000285879:p.Gln582His	Somatic		Capture	Illumina GAIIx	4	140822602	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	HMMPfam_MAGE	p.Q582H	ENST00000285879.4	37	c.1746	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	g	7.056	0.565384	0.13498	.	.	ENSG00000155495	ENST00000285879	T	0.02177	4.41	0.92	-1.84	0.07809	.	.	.	.	.	T	0.03220	0.0094	N	0.08118	0	0.09310	N	1	P	0.51240	0.943	D	0.66979	0.948	T	0.44390	-0.9331	9	0.87932	D	0	.	6.681	0.23119	0.0:0.0:0.726:0.274	.	582	O60732	MAGC1_HUMAN	H	582	ENSP00000285879:Q582H	ENSP00000285879:Q582H	Q	+	3	2	MAGEC1	140822602	0.000000	0.05858	0.010000	0.14722	0.010000	0.07245	-1.102000	0.03332	-1.270000	0.02433	-1.274000	0.01402	CAG	-	NULL		0.592	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	G	NM_005462		140822602	+1	no_errors	NM_005462	genbank	human	reviewed	54_36p	missense	SNP	0.005	T
TAS2R38	5726	genome.wustl.edu	37	7	141673169	141673169	+	Silent	SNP	G	G	A	rs181117063		TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr7:141673169G>A	ENST00000547270.1	-	1	404	c.321C>T	c.(319-321)ctC>ctT	p.L107L		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	107					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					CAGCAAGCCAGAGGTTGGCTT	0.517																																																0			7											91.0	91.0	91.0					7																	141673169		2203	4300	6503	141319638	SO:0001819	synonymous_variant	5726			AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.321C>T	7.37:g.141673169G>A		Somatic		Capture	Illumina GAIIx	4	141319638	A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Silent	SNP	superfamily_SSF81321,HMMPfam_TAS2R	p.L107	ENST00000547270.1	37	c.321	CCDS34765.1	7																																																																																			-	superfamily_SSF81321,HMMPfam_TAS2R		0.517	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R38	protein_coding	OTTHUMT00000350810.2	G	NM_176817		141319638	-1	no_errors	NM_176817	genbank	human	validated	54_36p	silent	SNP	0.997	A
PPP2R2B	5521	genome.wustl.edu	37	5	145972610	145972610	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr5:145972610G>A	ENST00000394413.3	-	8	1546	c.976C>T	c.(976-978)Cgc>Tgc	p.R326C	PPP2R2B_ENST00000394414.1_Missense_Mutation_p.R392C|PPP2R2B_ENST00000508545.2_Missense_Mutation_p.R315C|PPP2R2B_ENST00000394411.4_Missense_Mutation_p.R326C|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000453001.1_Missense_Mutation_p.R326C|CTB-99A3.1_ENST00000512730.1_RNA|PPP2R2B_ENST00000394410.2_Missense_Mutation_p.R315C|PPP2R2B_ENST00000504198.1_Missense_Mutation_p.R332C|PPP2R2B_ENST00000394409.3_Missense_Mutation_p.R384C|PPP2R2B_ENST00000356826.3_Missense_Mutation_p.R326C|PPP2R2B_ENST00000336640.6_Missense_Mutation_p.R329C			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	326					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGCTTGCTGCGGAGGTAGTCA	0.418																																																0			5											144.0	154.0	151.0					5																	145972610		2203	4300	6503	145952803	SO:0001583	missense	5521			M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.976C>T	5.37:g.145972610G>A	ENSP00000377935:p.Arg326Cys	Somatic		Capture	Illumina GAIIx	4	145952803	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Missense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_PP2A_B_N,PatternScan_PR55_1,HMMPfam_PP2A_B_subs_rcg,PatternScan_PR55_2,PatternScan_WD_REPEATS_1	p.R329C	ENST00000394413.3	37	c.985	CCDS4284.1	5	.	.	.	.	.	.	.	.	.	.	G	18.86	3.714039	0.68730	.	.	ENSG00000156475	ENST00000394413;ENST00000508545;ENST00000394414;ENST00000394411;ENST00000356826;ENST00000453001;ENST00000394410;ENST00000336640;ENST00000504198;ENST00000394409	T;T;T;T;T;T;T;T;T;T	0.77358	-1.08;-1.08;1.18;-1.08;-1.08;-1.08;-1.08;-1.08;-1.09;1.18	5.39	5.39	0.77823	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.90584	0.7048	M	0.93550	3.43	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.74023	0.967;0.967;0.951;0.967;0.982;0.973	D	0.92388	0.5919	10	0.87932	D	0	-13.6789	15.0059	0.71513	0.0:0.0:0.8572:0.1428	.	384;332;315;392;329;326	Q00005-4;Q00005-3;G3V149;Q00005-5;Q00005-2;Q00005	.;.;.;.;.;2ABB_HUMAN	C	326;315;392;326;326;326;315;329;332;384	ENSP00000377935:R326C;ENSP00000431320:R315C;ENSP00000377936:R392C;ENSP00000377933:R326C;ENSP00000349283:R326C;ENSP00000398779:R326C;ENSP00000377932:R315C;ENSP00000336591:R329C;ENSP00000421396:R332C;ENSP00000377931:R384C	ENSP00000336591:R329C	R	-	1	0	AC011357.1	145952803	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	1.492000	0.35594	2.808000	0.96608	0.655000	0.94253	CGC	-	superfamily_WD40 repeat-like		0.418	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2B	protein_coding	OTTHUMT00000251893.2	G	NM_181678		145952803	-1	no_errors	NM_181676	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SELENBP1	8991	genome.wustl.edu	37	1	151339380	151339380	+	Splice_Site	SNP	C	C	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:151339380C>G	ENST00000368868.5	-	6	573	c.482G>C	c.(481-483)gGg>gCg	p.G161A	SELENBP1_ENST00000473693.1_5'UTR|SELENBP1_ENST00000435071.1_Splice_Site_p.G97A|SELENBP1_ENST00000426705.2_Splice_Site_p.G203A|SELENBP1_ENST00000447402.3_Splice_Site_p.G99A	NM_003944.3	NP_003935.2	Q13228	SBP1_HUMAN	selenium binding protein 1	161					protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	selenium binding (GO:0008430)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|urinary_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CACAAAACCCCCTGAACAGGG	0.597																																																0			1											121.0	112.0	115.0					1																	151339380		2203	4300	6503	149606004	SO:0001630	splice_region_variant	8991			U29091	CCDS995.1, CCDS58027.1, CCDS60266.1	1q21.3	2014-05-19			ENSG00000143416	ENSG00000143416			10719	protein-coding gene	gene with protein product		604188				9027582	Standard	NM_003944		Approved	hSP56, hSBP, LPSB	uc010pcy.3	Q13228	OTTHUMG00000012498	ENST00000368868.5:c.482-1G>C	1.37:g.151339380C>G		Somatic		Capture	Illumina GAIIx	4	149606004	A6NML9|A6PVW9|B2RDR3|B4DKP6|B4E1F3|Q49AQ8|Q96GX7	Missense_Mutation	SNP	HMMPfam_SBP56,superfamily_Cyt_cd1_haem_C	p.G161A	ENST00000368868.5	37	c.482	CCDS995.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.1|26.1	4.701157|4.701157	0.88924|0.88924	.|.	.|.	ENSG00000143416|ENSG00000143416	ENST00000368868;ENST00000447402;ENST00000435071;ENST00000458566;ENST00000426705|ENST00000424475	T;T;T;T;T|T	0.41758|0.39592	0.99;0.99;0.99;2.0;2.0|1.07	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.64605|0.64605	0.2613|0.2613	M|M	0.88640|0.88640	2.97|2.97	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.76494|.	0.999;0.998;0.998;0.998;0.999;0.994;0.998|.	D;D;D;D;D;P;D|.	0.79784|.	0.992;0.992;0.992;0.985;0.993;0.886;0.977|.	T|T	0.70905|0.70905	-0.4745|-0.4745	10|8	0.62326|0.62326	D|D	0.03|0.03	.|.	17.9421|17.9421	0.89028|0.89028	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	99;203;121;145;14;97;161|.	B4E1F3;A6PVW9;A6PVW8;A6PVX1;B4DPI7;Q13228-2;Q13228|.	.;.;.;.;.;.;SBP1_HUMAN|.	A|R	161;99;97;145;203|122	ENSP00000357861:G161A;ENSP00000413960:G99A;ENSP00000408263:G97A;ENSP00000406222:G145A;ENSP00000397261:G203A|ENSP00000396209:G122R	ENSP00000357861:G161A|ENSP00000396209:G122R	G|G	-|-	2|1	0|0	SELENBP1|SELENBP1	149606004|149606004	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.736000|0.736000	0.42039|0.42039	5.779000|5.779000	0.68948|0.68948	2.644000|2.644000	0.89710|0.89710	0.561000|0.561000	0.74099|0.74099	GGG|GGG	-	HMMPfam_SBP56,superfamily_Cyt_cd1_haem_C		0.597	SELENBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELENBP1	protein_coding	OTTHUMT00000034904.4	C		Missense_Mutation	149606004	-1	no_errors	NM_003944	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
S100A7A	338324	genome.wustl.edu	37	1	153391775	153391775	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:153391775G>T	ENST00000368729.4	+	3	353	c.296G>T	c.(295-297)gGa>gTa	p.G99V	S100A7A_ENST00000368728.2_Missense_Mutation_p.G99V|S100A7A_ENST00000329256.2_Missense_Mutation_p.G99V	NM_176823.3	NP_789793.1	Q86SG5	S1A7A_HUMAN	S100 calcium binding protein A7A	99						cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein self-association (GO:0043621)			cervix(1)|endometrium(3)|kidney(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	12	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGTTCTGGGGGAAGCCAGTGA	0.532																																																0			1											44.0	45.0	44.0					1																	153391775		2203	4300	6503	151658399	SO:0001583	missense	338324			AY189118	CCDS30872.1	1q22	2013-01-10	2006-09-11	2006-09-11	ENSG00000184330	ENSG00000184330		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	21657	protein-coding gene	gene with protein product			"""S100 calcium binding protein A15"", ""S100 calcium binding protein A7-like 1"""	S100A15, S100A7L1		11230159	Standard	NM_176823		Approved	S100A7f	uc001fbt.1	Q86SG5	OTTHUMG00000013122	ENST00000368729.4:c.296G>T	1.37:g.153391775G>T	ENSP00000357718:p.Gly99Val	Somatic		Capture	Illumina GAIIx	4	151658399	D3DV38|Q5SY69	Missense_Mutation	SNP	superfamily_SSF47473,HMMPfam_S_100,PatternScan_S100_CABP,PatternScan_EF_HAND_1	p.G99V	ENST00000368729.4	37	c.296	CCDS30872.1	1	.	.	.	.	.	.	.	.	.	.	.	10.71	1.425898	0.25726	.	.	ENSG00000184330	ENST00000368729;ENST00000368728;ENST00000329256	T;T;T	0.10288	2.89;2.89;2.89	1.72	-3.38	0.04883	EF-hand-like domain (1);	.	.	.	.	T	0.03011	0.0089	M	0.72118	2.19	0.09310	N	0.999999	B	0.34200	0.441	B	0.24848	0.056	T	0.24225	-1.0166	9	0.72032	D	0.01	.	3.4584	0.07524	0.4971:0.2178:0.2851:0.0	.	99	Q86SG5	S1A7A_HUMAN	V	99	ENSP00000357718:G99V;ENSP00000357717:G99V;ENSP00000329008:G99V	ENSP00000329008:G99V	G	+	2	0	S100A7A	151658399	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.449000	0.06812	-1.100000	0.03030	-1.054000	0.02325	GGA	-	superfamily_SSF47473		0.532	S100A7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A7A	protein_coding	OTTHUMT00000036786.2	G	NM_176823		151658399	+1	no_errors	NM_176823	genbank	human	validated	54_36p	missense	SNP	0.000	T
PAXIP1	22976	genome.wustl.edu	37	7	154760666	154760666	+	Silent	SNP	C	C	T	rs61752011	byFrequency	TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr7:154760666C>T	ENST00000404141.1	-	7	1399	c.1245G>A	c.(1243-1245)ccG>ccA	p.P415P	PAXIP1_ENST00000397192.1_Silent_p.P415P|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	415	Gln-rich.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GGTGTAAAACCGGGtgctgct	0.562													C|||	1110	0.221645	0.0484	0.3588	5008	,	,		16758	0.2133		0.2922	False		,,,				2504	0.2945															0			7						C		272,3634		8,256,1689	22.0	22.0	22.0		1245	-9.9	0.0	7	dbSNP_129	22	1762,5876		184,1394,2241	no	coding-synonymous	PAXIP1	NM_007349.3		192,1650,3930	TT,TC,CC		23.0689,6.9636,17.6195		415/1070	154760666	2034,9510	1953	3819	5772	154391599	SO:0001819	synonymous_variant	22976			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1245G>A	7.37:g.154760666C>T		Somatic		Capture	Illumina GAIIx	4	154391599	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Silent	SNP	superfamily_BRCT domain,HMMPfam_BRCT,HMMSmart_SM00292	p.P415	ENST00000404141.1	37	c.1245	CCDS47753.1	7																																																																																			-	NULL		0.562	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	protein_coding	OTTHUMT00000322223.1	C	NM_007349		154391599	-1	no_errors	NM_007349	genbank	human	reviewed	54_36p	silent	SNP	0.000	T
SPTA1	6708	genome.wustl.edu	37	1	158648266	158648266	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:158648266C>G	ENST00000368147.4	-	6	917	c.737G>C	c.(736-738)tGg>tCg	p.W246S		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	246					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AAGGCGCTCCCAGGCAGCATT	0.448																																																0			1											89.0	84.0	86.0					1																	158648266		1874	4108	5982	156914890	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.737G>C	1.37:g.158648266C>G	ENSP00000357129:p.Trp246Ser	Somatic		Capture	Illumina GAIIx	4	156914890	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_EF-hand,HMMPfam_efhand_Ca_insen	p.W246S	ENST00000368147.4	37	c.737	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	19.65	3.867902	0.72065	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.68903	-0.36;-0.36	4.66	4.66	0.58398	.	0.000000	0.30410	N	0.009696	D	0.84469	0.5479	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88332	0.2969	10	0.87932	D	0	.	16.6455	0.85176	0.0:1.0:0.0:0.0	.	246	P02549	SPTA1_HUMAN	S	246	ENSP00000357130:W246S;ENSP00000357129:W246S	ENSP00000357129:W246S	W	-	2	0	SPTA1	156914890	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	6.719000	0.74718	2.572000	0.86782	0.650000	0.86243	TGG	-	HMMPfam_Spectrin,superfamily_Spectrin repeat,HMMSmart_SM00150		0.448	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	protein_coding	OTTHUMT00000051851.3	C	NM_003126		156914890	-1	no_errors	NM_003126	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TAGAP	117289	genome.wustl.edu	37	6	159462397	159462397	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr6:159462397C>G	ENST00000367066.3	-	6	797	c.466G>C	c.(466-468)Gtg>Ctg	p.V156L	RP1-111C20.4_ENST00000607796.1_RNA|RP1-111C20.4_ENST00000606466.1_RNA|TAGAP_ENST00000338313.5_Missense_Mutation_p.V156L|RP1-111C20.4_ENST00000606470.1_RNA|TAGAP_ENST00000326965.6_5'UTR|RP1-111C20.4_ENST00000607391.1_RNA	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	156	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TTAAAGACCACAGCGAGGAGG	0.562																																																0			6											95.0	86.0	89.0					6																	159462397		2203	4300	6503	159382385	SO:0001583	missense	117289			AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.466G>C	6.37:g.159462397C>G	ENSP00000356033:p.Val156Leu	Somatic		Capture	Illumina GAIIx	4	159382385	Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.V156L	ENST00000367066.3	37	c.466	CCDS5261.1	6	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024334	0.35701	.	.	ENSG00000164691	ENST00000367066;ENST00000338313	T;T	0.21734	1.99;1.99	5.66	5.66	0.87406	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.625511	0.15142	N	0.278239	T	0.32133	0.0819	M	0.86651	2.83	0.38806	D	0.955315	B;P	0.48834	0.328;0.916	B;P	0.46389	0.178;0.515	T	0.36311	-0.9753	10	0.52906	T	0.07	-9.6776	19.3418	0.94344	0.0:1.0:0.0:0.0	.	156;156	Q8N103-4;Q8N103	.;TAGAP_HUMAN	L	156	ENSP00000356033:V156L;ENSP00000340217:V156L	ENSP00000340217:V156L	V	-	1	0	TAGAP	159382385	0.274000	0.24191	0.020000	0.16555	0.156000	0.22039	4.975000	0.63777	2.678000	0.91216	0.563000	0.77884	GTG	-	superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP		0.562	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAGAP	protein_coding	OTTHUMT00000042890.1	C	NM_054114		159382385	-1	no_errors	NM_054114	genbank	human	reviewed	54_36p	missense	SNP	0.861	G
GABRG2	2566	genome.wustl.edu	37	5	161530962	161530962	+	Missense_Mutation	SNP	A	A	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr5:161530962A>T	ENST00000361925.4	+	6	919	c.699A>T	c.(697-699)agA>agT	p.R233S	GABRG2_ENST00000393933.4_Missense_Mutation_p.R138S|GABRG2_ENST00000356592.3_Missense_Mutation_p.R233S|GABRG2_ENST00000414552.2_Missense_Mutation_p.R273S			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	233					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GCGACACAAGATCCTGGAGGC	0.413																																																0			5											114.0	109.0	110.0					5																	161530962		2203	4300	6503	161463540	SO:0001583	missense	2566				CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.699A>T	5.37:g.161530962A>T	ENSP00000354651:p.Arg233Ser	Somatic		Capture	Illumina GAIIx	4	161463540	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	superfamily_Nicotinic receptor ligand binding domain-like,HMMPfam_Neur_chan_LBD,PatternScan_NEUROTR_ION_CHANNEL,superfamily_Neurotransmitter-gated ion-channel transmembrane pore,HMMPfam_Neur_chan_memb	p.R233S	ENST00000361925.4	37	c.699	CCDS4358.1	5	.	.	.	.	.	.	.	.	.	.	A	11.74	1.727974	0.30593	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933;ENST00000522053	T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0	5.56	-5.19	0.02832	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.61413	0.2345	N	0.12569	0.235	0.53005	D	0.999968	P;B;B	0.46327	0.876;0.361;0.312	P;B;B	0.52217	0.693;0.309;0.205	T	0.62338	-0.6875	10	0.22109	T	0.4	.	15.6509	0.77091	0.3727:0.0:0.6273:0.0	.	273;233;233	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	S	233;273;233;138;138	ENSP00000349000:R233S;ENSP00000410732:R273S;ENSP00000354651:R233S;ENSP00000377510:R138S;ENSP00000430182:R138S	ENSP00000349000:R233S	R	+	3	2	GABRG2	161463540	0.006000	0.16342	0.967000	0.41034	0.999000	0.98932	-0.817000	0.04472	-0.743000	0.04784	0.533000	0.62120	AGA	-	superfamily_Nicotinic receptor ligand binding domain-like,HMMPfam_Neur_chan_LBD		0.413	GABRG2-002	KNOWN	basic|CCDS	protein_coding	GABRG2	protein_coding	OTTHUMT00000252706.1	A			161463540	+1	no_errors	NM_198904	genbank	human	reviewed	54_36p	missense	SNP	0.968	T
SCN3A	6328	genome.wustl.edu	37	2	165952035	165952035	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr2:165952035G>T	ENST00000360093.3	-	25	4908	c.4417C>A	c.(4417-4419)Cag>Aag	p.Q1473K	SCN3A_ENST00000540861.1_5'Flank|SCN3A_ENST00000283254.7_Missense_Mutation_p.Q1473K|SCN3A_ENST00000465043.1_5'Flank|SCN3A_ENST00000409101.3_Missense_Mutation_p.Q1424K	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1473					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTTTCTGCTGGTTGAAGTTA	0.338																																																0			2											98.0	97.0	97.0					2																	165952035		2203	4300	6503	165660281	SO:0001583	missense	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4417C>A	2.37:g.165952035G>T	ENSP00000353206:p.Gln1473Lys	Somatic		Capture	Illumina GAIIx	4	165660281	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,HMMSmart_IQ,HMMPfam_IQ	p.Q1473K	ENST00000360093.3	37	c.4417		2	.	.	.	.	.	.	.	.	.	.	G	19.34	3.808229	0.70797	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101	D;D;D	0.97016	-4.21;-4.21;-4.21	5.25	5.25	0.73442	.	0.070869	0.56097	D	0.000040	D	0.97926	0.9318	M	0.74467	2.265	0.80722	D	1	P;P;B	0.52577	0.954;0.954;0.025	D;D;B	0.67900	0.954;0.954;0.146	D	0.98312	1.0524	10	0.87932	D	0	.	19.4069	0.94651	0.0:0.0:1.0:0.0	.	1424;1424;1473	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	K	1473;1473;1424	ENSP00000353206:Q1473K;ENSP00000283254:Q1473K;ENSP00000386726:Q1424K	ENSP00000283254:Q1473K	Q	-	1	0	SCN3A	165660281	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.601000	0.98297	2.894000	0.99253	0.591000	0.81541	CAG	-	superfamily_SSF81324		0.338	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	protein_coding		G	NM_006922		165660281	-1	no_errors	NM_006922	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CPEB4	80315	genome.wustl.edu	37	5	173317322	173317322	+	Missense_Mutation	SNP	C	C	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr5:173317322C>A	ENST00000265085.5	+	1	2040	c.586C>A	c.(586-588)Cct>Act	p.P196T	CPEB4_ENST00000334035.5_Missense_Mutation_p.P196T|CPEB4_ENST00000520867.1_Missense_Mutation_p.P196T|CPEB4_ENST00000522336.1_5'Flank|CPEB4_ENST00000517880.1_5'Flank|CPEB4_ENST00000519835.1_Missense_Mutation_p.P196T	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	196					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GGGAGGGGTCCCTGCTGCTTC	0.502																																																0			5											78.0	83.0	82.0					5																	173317322		2203	4300	6503	173249928	SO:0001583	missense	80315			BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.586C>A	5.37:g.173317322C>A	ENSP00000265085:p.Pro196Thr	Somatic		Capture	Illumina GAIIx	4	173249928	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.P196T	ENST00000265085.5	37	c.586	CCDS4390.1	5	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452567	0.43531	.	.	ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.82	5.82	0.92795	.	0.096933	0.64402	D	0.000001	T	0.32882	0.0844	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.15141	0.007;0.012;0.004;0.007	B;B;B;B	0.16289	0.007;0.015;0.007;0.007	T	0.11060	-1.0603	10	0.87932	D	0	-11.8924	20.0991	0.97865	0.0:1.0:0.0:0.0	.	196;196;196;196	B7ZLQ8;Q17RY0-2;E5RJM0;Q17RY0	.;.;.;CPEB4_HUMAN	T	196	ENSP00000265085:P196T;ENSP00000429092:P196T;ENSP00000334533:P196T;ENSP00000429048:P196T	ENSP00000265085:P196T	P	+	1	0	CPEB4	173249928	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.759000	0.68785	2.752000	0.94435	0.655000	0.94253	CCT	-	NULL		0.502	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPEB4	protein_coding	OTTHUMT00000252964.2	C	NM_030627		173249928	+1	no_errors	NM_030627	genbank	human	validated	54_36p	missense	SNP	1.000	A
TDRD5	163589	genome.wustl.edu	37	1	179620086	179620086	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:179620086G>A	ENST00000367614.1	+	12	2244	c.1885G>A	c.(1885-1887)Gat>Aat	p.D629N	TDRD5_ENST00000444136.1_Missense_Mutation_p.D629N|TDRD5_ENST00000294848.8_Missense_Mutation_p.D629N	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	629					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TGAATATGTAGATGGAATCCT	0.413																																																0			1											203.0	190.0	194.0					1																	179620086		2203	4300	6503	177886709	SO:0001583	missense	163589			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1885G>A	1.37:g.179620086G>A	ENSP00000356586:p.Asp629Asn	Somatic		Capture	Illumina GAIIx	4	177886709	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	HMMPfam_TUDOR,superfamily_Tudor/PWWP/MBT,HMMSmart_SM00333	p.D629N	ENST00000367614.1	37	c.1885	CCDS1332.1	1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174520	0.57692	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136;ENST00000417329	T;T;T;T	0.34275	2.59;2.59;2.77;1.37	5.91	5.91	0.95273	.	0.169864	0.51477	D	0.000083	T	0.34308	0.0893	L	0.46157	1.445	0.38931	D	0.957955	P;P	0.46859	0.885;0.671	P;B	0.44447	0.45;0.145	T	0.08700	-1.0709	10	0.28530	T	0.3	-9.1251	11.2155	0.48823	0.0828:0.0:0.9172:0.0	.	629;629	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	N	629;629;629;85	ENSP00000356586:D629N;ENSP00000294848:D629N;ENSP00000406052:D629N;ENSP00000410744:D85N	ENSP00000294848:D629N	D	+	1	0	TDRD5	177886709	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	2.899000	0.48679	2.793000	0.96121	0.655000	0.94253	GAT	-	NULL		0.413	TDRD5-002	KNOWN	basic|CCDS	protein_coding	TDRD5	protein_coding	OTTHUMT00000085295.1	G	NM_173533		177886709	+1	no_errors	NM_173533	genbank	human	provisional	54_36p	missense	SNP	1.000	A
SENP2	59343	genome.wustl.edu	37	3	185324264	185324264	+	Missense_Mutation	SNP	G	G	A	rs145156187		TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr3:185324264G>A	ENST00000296257.5	+	6	836	c.596G>A	c.(595-597)cGt>cAt	p.R199H	SENP2_ENST00000427465.2_Missense_Mutation_p.R23H|SENP2_ENST00000465201.1_3'UTR|SENP2_ENST00000545472.1_Missense_Mutation_p.R189H	NM_021627.2	NP_067640.2	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 2	199					cellular protein metabolic process (GO:0044267)|dorsal/ventral axis specification (GO:0009950)|heart development (GO:0007507)|labyrinthine layer development (GO:0060711)|mRNA transport (GO:0051028)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein binding (GO:0032091)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|protein transport (GO:0015031)|regulation of DNA endoreduplication (GO:0032875)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of Wnt signaling pathway (GO:0030111)|spongiotrophoblast layer development (GO:0060712)|trophoblast giant cell differentiation (GO:0060707)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	SUMO-specific protease activity (GO:0016929)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(3)	12	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			GGTCTGAGGCGTCCCCATTGT	0.443																																																0			3						G	HIS/ARG	0,4406		0,0,2203	65.0	64.0	64.0		596	4.7	1.0	3	dbSNP_134	64	2,8598	2.2+/-6.3	0,2,4298	no	missense	SENP2	NM_021627.2	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	199/590	185324264	2,13004	2203	4300	6503	186806958	SO:0001583	missense	59343			AF151697	CCDS33902.1	3q28	2005-08-17	2005-08-17		ENSG00000163904	ENSG00000163904			23116	protein-coding gene	gene with protein product		608261	"""SUMO1/sentrin/SMT3 specific protease 2"""			11896061, 11489887	Standard	XM_005247690		Approved	SMT3IP2, KIAA1331, DKFZp762A2316, AXAM2	uc003fpn.3	Q9HC62	OTTHUMG00000156658	ENST00000296257.5:c.596G>A	3.37:g.185324264G>A	ENSP00000296257:p.Arg199His	Somatic		Capture	Illumina GAIIx	4	186806958	B4DQ42|Q8IW97|Q96SR2|Q9P2L5	Missense_Mutation	SNP	superfamily_SSF54001,HMMPfam_Peptidase_C48	p.R199H	ENST00000296257.5	37	c.596	CCDS33902.1	3	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341318	0.81911	0.0	2.33E-4	ENSG00000163904	ENST00000430355;ENST00000545472;ENST00000296257;ENST00000427465	T;T;T	0.30714	1.52;1.54;1.55	5.58	4.71	0.59529	.	0.222986	0.32785	N	0.005646	T	0.20210	0.0486	N	0.19112	0.55	0.34357	D	0.690492	B;B	0.18310	0.027;0.027	B;B	0.12156	0.007;0.005	T	0.16867	-1.0388	10	0.49607	T	0.09	-15.1078	10.616	0.45451	0.0887:0.0:0.9113:0.0	.	189;199	B4DQ42;Q9HC62	.;SENP2_HUMAN	H	253;189;199;23	ENSP00000439653:R189H;ENSP00000296257:R199H;ENSP00000394562:R23H	ENSP00000296257:R199H	R	+	2	0	SENP2	186806958	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.377000	0.52425	1.513000	0.48852	0.579000	0.79373	CGT	-	NULL		0.443	SENP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SENP2	protein_coding	OTTHUMT00000345159.1	G	NM_021627		186806958	+1	no_errors	NM_021627	genbank	human	validated	54_36p	missense	SNP	1.000	A
FAM171B	165215	genome.wustl.edu	37	2	187615885	187615885	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr2:187615885C>G	ENST00000304698.5	+	5	952	c.749C>G	c.(748-750)cCt>cGt	p.P250R		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	250						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GAATTGACTCCTCTTGCTGCA	0.308																																																0			2											104.0	117.0	112.0					2																	187615885		2203	4300	6503	187324130	SO:0001583	missense	165215			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.749C>G	2.37:g.187615885C>G	ENSP00000304108:p.Pro250Arg	Somatic		Capture	Illumina GAIIx	4	187324130	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	HMMPfam_UPF0560	p.P250R	ENST00000304698.5	37	c.749	CCDS33347.1	2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324416	0.81580	.	.	ENSG00000144369	ENST00000304698;ENST00000272804	T	0.64085	-0.08	5.53	5.53	0.82687	.	0.053942	0.85682	D	0.000000	T	0.79125	0.4393	M	0.72353	2.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.80908	-0.1172	10	0.87932	D	0	-17.6889	17.6355	0.88121	0.0:1.0:0.0:0.0	.	250;251	Q6P995;A8K122	F171B_HUMAN;.	R	250	ENSP00000304108:P250R	ENSP00000272804:P250R	P	+	2	0	FAM171B	187324130	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.148000	0.71788	2.611000	0.88343	0.609000	0.83330	CCT	-	HMMPfam_UPF0560		0.308	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	protein_coding	OTTHUMT00000334679.1	C	NM_177454		187324130	+1	no_errors	NM_177454	genbank	human	validated	54_36p	missense	SNP	1.000	G
OPA1	4976	genome.wustl.edu	37	3	193380707	193380707	+	Missense_Mutation	SNP	C	C	T	rs143252541		TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr3:193380707C>T	ENST00000392438.3	+	24	2686	c.2452C>T	c.(2452-2454)Cgg>Tgg	p.R818W	OPA1_ENST00000361908.3_Missense_Mutation_p.R855W|OPA1_ENST00000361715.2_Missense_Mutation_p.R837W|OPA1_ENST00000361510.2_Missense_Mutation_p.R873W|OPA1_ENST00000361828.2_Missense_Mutation_p.R836W|OPA1_ENST00000361150.2_Missense_Mutation_p.R819W	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	818					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		AACCACAGTCCGGAAGAACCT	0.398																																																0			3						C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	96.0	92.0	93.0		2452,2344,2398,2455,2506,2509,2563,2617	4.9	1.0	3	dbSNP_134	93	1,8599		0,1,4299	no	missense,missense,missense,missense,missense,missense,missense,missense	OPA1	NM_015560.2,NM_130831.2,NM_130832.2,NM_130833.2,NM_130834.2,NM_130835.2,NM_130836.2,NM_130837.2	101,101,101,101,101,101,101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	818/961,782/925,800/943,819/962,836/979,837/980,855/998,873/1016	193380707	1,13005	2203	4300	6503	194863401	SO:0001583	missense	4976			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.2452C>T	3.37:g.193380707C>T	ENSP00000376233:p.Arg818Trp	Somatic		Capture	Illumina GAIIx	4	194863401	D3DNW4	Missense_Mutation	SNP	HMMSmart_SM00053,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Dynamin_N	p.R873W	ENST00000392438.3	37	c.2617	CCDS43186.1	3	.	.	.	.	.	.	.	.	.	.	C	22.5	4.294822	0.81025	0.0	1.16E-4	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150;ENST00000445863	D;D;D;D;D;D;D	0.96491	-3.66;-3.62;-3.61;-3.62;-3.66;-4.03;-2.74	5.85	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.97760	0.9265	M	0.81497	2.545	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.85130	0.997;0.981;0.997;0.997;0.986;0.997;0.988;0.997	D	0.97685	1.0175	10	0.87932	D	0	-12.0188	11.9355	0.52870	0.3043:0.6957:0.0:0.0	.	782;818;800;819;836;855;837;873	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	W	855;818;873;837;836;819;10	ENSP00000354681:R855W;ENSP00000376233:R818W;ENSP00000355324:R873W;ENSP00000355311:R837W;ENSP00000354429:R836W;ENSP00000354781:R819W;ENSP00000398358:R10W	ENSP00000354781:R819W	R	+	1	2	OPA1	194863401	0.952000	0.32445	1.000000	0.80357	0.996000	0.88848	1.789000	0.38724	2.753000	0.94483	0.655000	0.94253	CGG	-	NULL		0.398	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	protein_coding	OTTHUMT00000313812.2	C	NM_130837		194863401	+1	no_errors	NM_130837	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TNK2	10188	genome.wustl.edu	37	3	195615448	195615448	+	Silent	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr3:195615448C>T	ENST00000333602.6	-	2	629	c.12G>A	c.(10-12)gaG>gaA	p.E4E	TNK2_ENST00000392400.1_Silent_p.E4E|TNK2_ENST00000468819.1_5'UTR|TNK2_ENST00000381916.2_Silent_p.E67E|TNK2_ENST00000316664.3_Silent_p.E4E|TNK2_ENST00000428187.1_Silent_p.E36E	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	4	SAM-like domain.				cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	CTGTGCCCTCCTCTGGCTGCA	0.662																																																0			3											27.0	26.0	26.0					3																	195615448		2190	4236	6426	197099845	SO:0001819	synonymous_variant	10188			L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.12G>A	3.37:g.195615448C>T		Somatic		Capture	Illumina GAIIx	4	197099845	Q6ZMQ0|Q8N6U7|Q96H59	Silent	SNP	superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,HMMPfam_GTPase_binding	p.E67	ENST00000333602.6	37	c.201	CCDS33928.1	3	.	.	.	.	.	.	.	.	.	.	C	6.411	0.444040	0.12164	.	.	ENSG00000061938	ENST00000438207	.	.	.	4.86	3.04	0.35103	.	.	.	.	.	T	0.59459	0.2195	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56129	-0.8030	4	.	.	.	.	10.0216	0.42046	0.0:0.7675:0.0:0.2325	.	.	.	.	K	3	.	.	R	-	2	0	TNK2	197099845	0.785000	0.28726	0.997000	0.53966	0.618000	0.37518	-0.099000	0.11007	1.051000	0.40369	0.313000	0.20887	AGG	-	NULL		0.662	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TNK2	protein_coding	OTTHUMT00000341437.3	C	NM_005781		197099845	-1	no_errors	NM_001010938	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
ICA1L	130026	genome.wustl.edu	37	2	203705269	203705269	+	Intron	SNP	T	T	A			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr2:203705269T>A	ENST00000392237.2	-	3	151				ICA1L_ENST00000358299.2_Intron|ICA1L_ENST00000418208.1_Intron	NM_138468.4	NP_612477.3	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like											breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GTGGTCTTCATATGGATATTC	0.572																																																0			2																																								203413514	SO:0001627	intron_variant	645834			AB053317	CCDS2354.1, CCDS74632.1	2q33	2008-02-05	2006-05-26	2006-05-26	ENSG00000163596	ENSG00000163596			14442	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14"""	ALS2CR15, ALS2CR14		11586298	Standard	NM_138468		Approved		uc002uzh.1	Q8NDH6	OTTHUMG00000132856	ENST00000392237.2:c.7-11530A>T	2.37:g.203705269T>A		Somatic		Capture	Illumina GAIIx	4	203413514	B3KRW6|Q53P45|Q53QZ4|Q53T97|Q96N47|Q96Q32|Q9BVQ2	RNA	SNP	-	NULL	ENST00000392237.2	37	NULL	CCDS2354.1	2																																																																																			-	-		0.572	ICA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT8P15	protein_coding	OTTHUMT00000256330.1	T	NM_138468		203413514	-1	pseudogene	XR_016994	genbank	human	model	54_36p	rna	SNP	0.006	A
SCG2	7857	genome.wustl.edu	37	2	224462338	224462338	+	Missense_Mutation	SNP	T	T	G			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr2:224462338T>G	ENST00000305409.2	-	2	1895	c.1663A>C	c.(1663-1665)Agc>Cgc	p.S555R		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TCCTGAGAGCTGCCTTGATTC	0.512																																																0			2											106.0	101.0	103.0					2																	224462338		2203	4300	6503	224170582	SO:0001583	missense	7857			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1663A>C	2.37:g.224462338T>G	ENSP00000304133:p.Ser555Arg	Somatic		Capture	Illumina GAIIx	4	224170582	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	HMMPfam_Granin,PatternScan_GRANINS_1	p.S555R	ENST00000305409.2	37	c.1663	CCDS2457.1	2	.	.	.	.	.	.	.	.	.	.	T	13.92	2.380329	0.42207	.	.	ENSG00000171951	ENST00000305409;ENST00000450330	T	0.01725	4.67	5.77	0.606	0.17559	.	0.237443	0.41294	D	0.000920	T	0.02418	0.0074	L	0.36672	1.1	0.26960	N	0.965826	P	0.42203	0.773	P	0.45377	0.478	T	0.38001	-0.9681	10	0.66056	D	0.02	.	9.5712	0.39429	0.0:0.6848:0.0:0.3152	.	555	P13521	SCG2_HUMAN	R	555;415	ENSP00000304133:S555R	ENSP00000304133:S555R	S	-	1	0	SCG2	224170582	0.963000	0.33076	0.906000	0.35671	0.887000	0.51463	1.433000	0.34947	0.090000	0.17273	0.477000	0.44152	AGC	-	HMMPfam_Granin		0.512	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG2	protein_coding	OTTHUMT00000256870.2	T	NM_003469		224170582	-1	no_errors	NM_003469	genbank	human	reviewed	54_36p	missense	SNP	0.743	G
TM4SF20	79853	genome.wustl.edu	37	2	228228471	228228471	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr2:228228471C>T	ENST00000304568.3	-	4	696	c.659G>A	c.(658-660)gGa>gAa	p.G220E		NM_024795.3	NP_079071.2	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(2)|large_intestine(1)|lung(4)|stomach(2)	10		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		CTTAGAGACTCCACACAGACA	0.378																																																0			2											112.0	116.0	114.0					2																	228228471		2203	4300	6503	227936715	SO:0001583	missense	79853			AK026453	CCDS2466.1	2q36.3	2008-02-05			ENSG00000168955	ENSG00000168955			26230	protein-coding gene	gene with protein product		615404				12975309	Standard	NM_024795		Approved	FLJ22800, TCCE518	uc002vpb.2	Q53R12	OTTHUMG00000133187	ENST00000304568.3:c.659G>A	2.37:g.228228471C>T	ENSP00000303028:p.Gly220Glu	Somatic		Capture	Illumina GAIIx	4	227936715	B2RP42|Q5U609|Q6UWS1|Q9H5X9	Missense_Mutation	SNP	HMMPfam_L6_membrane	p.G220E	ENST00000304568.3	37	c.659	CCDS2466.1	2	.	.	.	.	.	.	.	.	.	.	C	23.0	4.359966	0.82353	.	.	ENSG00000168955	ENST00000304568	T	0.40225	1.04	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000001	T	0.68403	0.2997	M	0.86178	2.8	0.47737	D	0.999504	D	0.89917	1.0	D	0.97110	1.0	T	0.73183	-0.4063	10	0.87932	D	0	-21.723	15.1611	0.72785	0.0:1.0:0.0:0.0	.	220	Q53R12	T4S20_HUMAN	E	220	ENSP00000303028:G220E	ENSP00000303028:G220E	G	-	2	0	TM4SF20	227936715	0.936000	0.31750	0.992000	0.48379	0.966000	0.64601	3.944000	0.56629	2.659000	0.90383	0.655000	0.94253	GGA	-	HMMPfam_L6_membrane		0.378	TM4SF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF20	protein_coding	OTTHUMT00000256896.2	C	NM_024795		227936715	-1	no_errors	NM_024795	genbank	human	validated	54_36p	missense	SNP	0.999	T
ZP4	57829	genome.wustl.edu	37	1	238053399	238053399	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1683-01A-01W-0633-09	TCGA-20-1683-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a2a29b1-e68e-45c0-b314-389dd1084b6c	131ac6ab-2fad-4fbd-aa6a-2df3e8c05364	g.chr1:238053399C>T	ENST00000366570.4	-	2	411	c.253G>A	c.(253-255)Gtg>Atg	p.V85M	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	85					acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TCCAACACCACGGAGCTGCCT	0.567																																					NSCLC(166;160 2029 11600 18754 19936)											0			1											111.0	97.0	102.0					1																	238053399		2203	4300	6503	236120022	SO:0001583	missense	57829			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.253G>A	1.37:g.238053399C>T	ENSP00000355529:p.Val85Met	Somatic		Capture	Illumina GAIIx	4	236120022	B2RAE1	Missense_Mutation	SNP	superfamily_Trefoil,HMMSmart_SM00018,HMMPfam_Trefoil,PatternScan_P_TREFOIL,HMMPfam_Zona_pellucida,HMMSmart_SM00241,PatternScan_ZP_1	p.V85M	ENST00000366570.4	37	c.253	CCDS1615.1	1	.	.	.	.	.	.	.	.	.	.	C	9.959	1.222308	0.22457	.	.	ENSG00000116996	ENST00000366570	T	0.75260	-0.92	5.07	-7.63	0.01290	.	1.456490	0.04517	N	0.383857	T	0.43567	0.1253	N	0.17379	0.485	0.09310	N	1	P	0.40638	0.725	B	0.23574	0.047	T	0.49123	-0.8972	10	0.33940	T	0.23	-0.0087	2.6183	0.04909	0.0954:0.2256:0.2974:0.3816	.	85	Q12836	ZP4_HUMAN	M	85	ENSP00000355529:V85M	ENSP00000355529:V85M	V	-	1	0	ZP4	236120022	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-3.346000	0.00503	-1.598000	0.01607	0.655000	0.94253	GTG	-	NULL		0.567	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP4	protein_coding	OTTHUMT00000095476.1	C			236120022	-1	no_errors	NM_021186	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
