#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								12540	SO:0001628	intergenic_variant	4540																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	12540		Nonsense_Mutation	SNP	HMMPfam_Oxidored_q1_N,HMMPfam_Oxidored_q1,HMMPfam_NADH5_C	p.W68*		37	c.203		MT																																																																																			-	HMMPfam_Oxidored_q1_N	0	0					MT-ND5			G			12540	+1	no_errors	ENST00000361567	ensembl	human	known	54_36p	nonsense	SNP	NULL	A
KRTAP5-4	387267	genome.wustl.edu	37	11	1643006	1643006	+	Silent	SNP	G	G	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr11:1643006G>A	ENST00000399682.1	-	1	362	c.318C>T	c.(316-318)ggC>ggT	p.G106G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G106G(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCCCTTGGAGCCCCCACAGG	0.682																																																1	Substitution - coding silent(1)	kidney(1)	11											6.0	14.0	11.0					11																	1643006		642	1507	2149	1599582	SO:0001819	synonymous_variant	387267			AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.318C>T	11.37:g.1643006G>A		Somatic		Capture	Illumina GAIIx	4	1599582		Silent	SNP	PatternScan_MOLYBDOPTERIN_PROK_1,PatternScan_VWFC_1,PatternScan_TNFR_NGFR_1	p.G106	ENST00000399682.1	37	c.318		11																																																																																			-	NULL		0.682	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	KRTAP5-4	protein_coding	OTTHUMT00000127918.1	G	NM_001012709		1599582	-1	no_errors	ENST00000399682	ensembl	human	known	54_36p	silent	SNP	0.982	A
KRTAP5-5	439915	genome.wustl.edu	37	11	1651157	1651157	+	Silent	SNP	A	A	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr11:1651157A>G	ENST00000399676.2	+	1	125	c.87A>G	c.(85-87)ggA>ggG	p.G29G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	29						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtggaggctgtggct	0.711																																																0			11											25.0	36.0	33.0					11																	1651157		2116	4203	6319	1607733	SO:0001819	synonymous_variant	439915			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.87A>G	11.37:g.1651157A>G		Somatic		Capture	Illumina GAIIx	4	1607733	A8MWN2	Silent	SNP	PatternScan_MOLYBDOPTERIN_PROK_1,PatternScan_2FE2S_FER_1	p.G29	ENST00000399676.2	37	c.87	CCDS41592.1	11																																																																																			-	NULL		0.711	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	protein_coding	OTTHUMT00000127919.1	A			1607733	+1	no_errors	NM_001001480	genbank	human	validated	54_36p	silent	SNP	0.304	G
GNB1	2782	genome.wustl.edu	37	1	1735946	1735946	+	Silent	SNP	G	G	A	rs556077872		TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr1:1735946G>A	ENST00000378609.4	-	7	673	c.342C>T	c.(340-342)tgC>tgT	p.C114C		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	114					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		CCAGGCCACCGCAGGCCACAT	0.542																																																0			1											77.0	68.0	71.0					1																	1735946		2203	4300	6503	1725806	SO:0001819	synonymous_variant	2782			BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369		"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380					Standard	NM_002074		Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.342C>T	1.37:g.1735946G>A		Somatic		Capture	Illumina GAIIx	4	1725806	B1AJZ7|P04697|P04901|Q1RMY8	Silent	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.C114	ENST00000378609.4	37	c.342	CCDS34.1	1																																																																																			-	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40		0.542	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNB1	protein_coding	OTTHUMT00000002762.3	G	NM_002074		1725806	-1	no_errors	NM_002074	genbank	human	reviewed	54_36p	silent	SNP	0.887	A
ZZEF1	23140	genome.wustl.edu	37	17	3999985	3999985	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr17:3999985G>A	ENST00000381638.2	-	10	1806	c.1682C>T	c.(1681-1683)aCg>aTg	p.T561M	ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	561							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						TCCAGTTTCCGTAAGAAAACC	0.368																																																0			17											72.0	79.0	77.0					17																	3999985		2203	4300	6503	3946734	SO:0001583	missense	23140			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.1682C>T	17.37:g.3999985G>A	ENSP00000371051:p.Thr561Met	Somatic		Capture	Illumina GAIIx	4	3946734	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,superfamily_Galactose-binding domain-like,HMMPfam_APC10,superfamily_Spermadhesin CUB domain,HMMSmart_SM00291,HMMPfam_ZZ,PatternScan_ZF_ZZ_1	p.T561M	ENST00000381638.2	37	c.1682	CCDS11043.1	17	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711586	0.89112	.	.	ENSG00000074755	ENST00000381638	T	0.34667	1.35	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.52435	0.1734	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.51872	-0.8650	10	0.87932	D	0	-14.9521	19.2507	0.93923	0.0:0.0:1.0:0.0	.	561;561	O43149-3;O43149	.;ZZEF1_HUMAN	M	561	ENSP00000371051:T561M	ENSP00000371051:T561M	T	-	2	0	ZZEF1	3946734	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.898000	0.92538	2.868000	0.98415	0.555000	0.69702	ACG	-	NULL		0.368	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	protein_coding	OTTHUMT00000207480.1	G	NM_015113		3946734	-1	no_errors	NM_015113	genbank	human	validated	54_36p	missense	SNP	1.000	A
ADCY9	115	genome.wustl.edu	37	16	4164387	4164387	+	Missense_Mutation	SNP	C	C	G	rs369684993		TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr16:4164387C>G	ENST00000294016.3	-	2	1595	c.1057G>C	c.(1057-1059)Gag>Cag	p.E353Q		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	353					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TTCTCACTCTCCTCATCTCCC	0.478																																																0			16											174.0	163.0	167.0					16																	4164387		2197	4300	6497	4104388	SO:0001583	missense	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.1057G>C	16.37:g.4164387C>G	ENSP00000294016:p.Glu353Gln	Somatic		Capture	Illumina GAIIx	4	4104388	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1	p.E353Q	ENST00000294016.3	37	c.1057	CCDS32382.1	16	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356280	0.61293	.	.	ENSG00000162104	ENST00000294016	D	0.83506	-1.73	5.57	5.57	0.84162	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.054044	0.64402	D	0.000001	D	0.82637	0.5080	L	0.53249	1.67	0.58432	D	0.999994	P	0.46706	0.883	B	0.42827	0.399	T	0.83291	-0.0033	10	0.46703	T	0.11	.	19.6034	0.95572	0.0:1.0:0.0:0.0	.	353	O60503	ADCY9_HUMAN	Q	353	ENSP00000294016:E353Q	ENSP00000294016:E353Q	E	-	1	0	ADCY9	4104388	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.818000	0.86416	2.655000	0.90218	0.555000	0.69702	GAG	-	HMMSmart_SM00044		0.478	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	protein_coding	OTTHUMT00000438076.1	C			4104388	-1	no_errors	NM_001116	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CDC37L1	55664	genome.wustl.edu	37	9	4701670	4701670	+	Intron	SNP	C	C	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr9:4701670C>G	ENST00000381854.3	+	6	949				CDC37L1_ENST00000381858.1_Intron	NM_017913.2	NP_060383.2	Q7L3B6	CD37L_HUMAN	cell division cycle 37-like 1							cytoplasm (GO:0005737)				breast(1)|kidney(1)|lung(2)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		GGAAATGGAGCAAACCAATTA	0.348																																																0			9																																								4691670	SO:0001627	intron_variant	0			AK000497	CCDS6454.1	9p24.1	2013-01-17	2013-01-17		ENSG00000106993	ENSG00000106993			17179	protein-coding gene	gene with protein product		610346	"""CDC37 cell division cycle 37 homolog (S. cerevisiae)-like 1"", ""cell division cycle 37 homolog (S. cerevisiae)-like 1"""				Standard	NM_017913		Approved	HARC, FLJ20639, CDC37B	uc003zio.3	Q7L3B6	OTTHUMG00000019465	ENST00000381854.3:c.748-194C>G	9.37:g.4701670C>G		Somatic		Capture	Illumina GAIIx	4	4691670	B1AL70|Q9NWS3|Q9NX16	Missense_Mutation	SNP	NULL	p.A103P	ENST00000381854.3	37	c.307	CCDS6454.1	9																																																																																			-	NULL		0.348	CDC37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100133807	protein_coding	OTTHUMT00000051564.1	C	NM_017913		4691670	-1	no_start_codon:pseudogene:no_stop_codon	XM_001714543	genbank	human	model	54_36p	missense	SNP	0.000	G
C16orf71	146562	genome.wustl.edu	37	16	4787851	4787851	+	Silent	SNP	C	C	A	rs200644126		TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr16:4787851C>A	ENST00000299320.5	+	3	658	c.180C>A	c.(178-180)tcC>tcA	p.S60S	RP11-127I20.7_ENST00000588099.1_RNA|C16orf71_ENST00000590191.1_Silent_p.S60S	NM_139170.2	NP_631909.2	Q8IYS4	CP071_HUMAN	chromosome 16 open reading frame 71	60										breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)	11						ACCAAACCTCCCTGATTCCAG	0.587																																																0			16											81.0	78.0	79.0					16																	4787851		2197	4300	6497	4727852	SO:0001819	synonymous_variant	146562			AF447587	CCDS10521.1	16p13.3	2008-02-05			ENSG00000166246	ENSG00000166246			25081	protein-coding gene	gene with protein product						12477932	Standard	XM_005255144		Approved	FLJ43261, DKFZp686H2240	uc002cxn.3	Q8IYS4	OTTHUMG00000129480	ENST00000299320.5:c.180C>A	16.37:g.4787851C>A		Somatic		Capture	Illumina GAIIx	4	4727852	Q8NCV0	Silent	SNP	NULL	p.S60	ENST00000299320.5	37	c.180	CCDS10521.1	16																																																																																			-	NULL		0.587	C16orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf71	protein_coding	OTTHUMT00000251644.1	C	NM_139170		4727852	+1	no_errors	NM_139170	genbank	human	validated	54_36p	silent	SNP	0.631	A
USP6	9098	genome.wustl.edu	37	17	5072322	5072322	+	Silent	SNP	C	C	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr17:5072322C>A	ENST00000574788.1	+	35	5719	c.3489C>A	c.(3487-3489)ctC>ctA	p.L1163L	USP6_ENST00000332776.4_3'UTR|USP6_ENST00000304328.5_Silent_p.L846L|USP6_ENST00000250066.6_Silent_p.L1163L			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	1163	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CATCCTCACTCAGCGCTAACA	0.522			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0			17											41.0	40.0	41.0					17																	5072322		2203	4300	6503	5013046	SO:0001819	synonymous_variant	9098			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.3489C>A	17.37:g.5072322C>A		Somatic		Capture	Illumina GAIIx	4	5013046	Q15634|Q86WP6|Q8IWT4	Silent	SNP	superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_TBC,HMMSmart_SM00164,superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.L1163	ENST00000574788.1	37	c.3489	CCDS11069.2	17																																																																																			-	superfamily_Cysteine proteinases,HMMPfam_UCH		0.522	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	protein_coding	OTTHUMT00000438990.1	C	NM_004505		5013046	+1	no_errors	NM_004505	genbank	human	validated	54_36p	silent	SNP	0.542	A
TP53	7157	genome.wustl.edu	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	C	A	rs121912654		TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr17:7578461C>A	ENST00000269305.4	-	5	658	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	TP53_ENST00000420246.2_Missense_Mutation_p.V157F|TP53_ENST00000359597.4_Missense_Mutation_p.V157F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.V157F|TP53_ENST00000413465.2_Missense_Mutation_p.V157F|TP53_ENST00000445888.2_Missense_Mutation_p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCGCGGACGCGGGTGCCG	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	231	Substitution - Missense(189)|Deletion - Frameshift(15)|Deletion - In frame(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	lung(69)|liver(30)|upper_aerodigestive_tract(26)|breast(19)|oesophagus(14)|ovary(13)|stomach(9)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|bone(5)|vulva(4)|urinary_tract(4)|skin(3)|pancreas(3)|endometrium(2)|kidney(2)|biliary_tract(2)|soft_tissue(2)|prostate(1)|adrenal_gland(1)|salivary_gland(1)|thymus(1)	17											50.0	52.0	51.0					17																	7578461		2202	4300	6502	7519186	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.469G>T	17.37:g.7578461C>A	ENSP00000269305:p.Val157Phe	Somatic		Capture	Illumina GAIIx	4	7519186	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.V157F	ENST00000269305.4	37	c.469	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	12.19	1.865109	0.32977	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.47	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99718	0.9891	M	0.86420	2.815	0.33606	D	0.603	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.994;0.984;0.981;0.996;0.998;0.996	D	0.97998	1.0358	10	0.72032	D	0.01	-16.7152	5.3541	0.16051	0.0:0.6119:0.146:0.2421	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157F;ENSP00000352610:V157F;ENSP00000269305:V157F;ENSP00000398846:V157F;ENSP00000391127:V157F;ENSP00000391478:V157F;ENSP00000425104:V25F;ENSP00000423862:V64F;ENSP00000424104:V157F	ENSP00000269305:V157F	V	-	1	0	TP53	7519186	0.137000	0.22531	0.013000	0.15412	0.150000	0.21749	0.548000	0.23314	0.386000	0.24997	-0.253000	0.11424	GTC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7519186	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.095	A
CERS4	79603	genome.wustl.edu	37	19	8316031	8316031	+	Missense_Mutation	SNP	A	A	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr19:8316031A>T	ENST00000251363.5	+	3	371	c.71A>T	c.(70-72)gAg>gTg	p.E24V	CERS4_ENST00000558331.1_5'UTR|CERS4_ENST00000559336.1_Missense_Mutation_p.E24V|CERS4_ENST00000559450.1_Missense_Mutation_p.E24V|CERS4_ENST00000595722.1_Intron	NM_024552.2	NP_078828.2	Q9HA82	CERS4_HUMAN	ceramide synthase 4	24					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										ACGTGGACAGAGCTAGAAGAC	0.592																																																0			19											234.0	233.0	234.0					19																	8316031		2203	4300	6503	8222031	SO:0001583	missense	79603				CCDS12197.1	19p13.2	2014-09-11	2011-07-08	2011-07-08	ENSG00000090661	ENSG00000090661		"""Homeoboxes / CERS class"""	23747	protein-coding gene	gene with protein product		615334	"""LAG1 longevity assurance homolog 4 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 4"""	LASS4			Standard	NM_024552		Approved	FLJ12089, Trh1	uc002mjg.3	Q9HA82	OTTHUMG00000172570	ENST00000251363.5:c.71A>T	19.37:g.8316031A>T	ENSP00000251363:p.Glu24Val	Somatic		Capture	Illumina GAIIx	4	8222031	D6W665	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00724,HMMPfam_TRAM_LAG1_CLN8	p.E24V	ENST00000251363.5	37	c.71	CCDS12197.1	19	.	.	.	.	.	.	.	.	.	.	A	6.278	0.419349	0.11928	.	.	ENSG00000090661	ENST00000251363	T	0.69561	-0.41	4.22	-0.698	0.11280	.	0.662303	0.14659	N	0.306099	T	0.48978	0.1530	L	0.34521	1.04	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.34950	-0.9808	10	0.66056	D	0.02	0.7691	5.0142	0.14328	0.3756:0.1598:0.0:0.4647	.	24;24	Q53HF9;Q9HA82	.;CERS4_HUMAN	V	24	ENSP00000251363:E24V	ENSP00000251363:E24V	E	+	2	0	CERS4	8222031	0.140000	0.22579	0.001000	0.08648	0.022000	0.10575	2.143000	0.42187	-0.653000	0.05401	0.377000	0.23210	GAG	-	NULL		0.592	CERS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LASS4	protein_coding	OTTHUMT00000419200.1	A	NM_024552		8222031	+1	no_errors	NM_024552	genbank	human	validated	54_36p	missense	SNP	0.008	T
SEMA5A	9037	genome.wustl.edu	37	5	9237966	9237966	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr5:9237966C>T	ENST00000382496.5	-	6	972	c.307G>A	c.(307-309)Gcc>Acc	p.A103T		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	103	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CTGTAACAGGCCTTTTTGGTA	0.378																																																0			5											311.0	242.0	265.0					5																	9237966		2203	4300	6503	9290966	SO:0001583	missense	9037			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.307G>A	5.37:g.9237966C>T	ENSP00000371936:p.Ala103Thr	Somatic		Capture	Illumina GAIIx	4	9290966	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema,HMMPfam_PSI,HMMSmart_PSI,superfamily_Plexin-like_fold,superfamily_TSP1,HMMSmart_TSP1,HMMPfam_TSP_1	p.A103T	ENST00000382496.5	37	c.307	CCDS3875.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.26|12.26	1.883937|1.883937	0.33255|0.33255	.|.	.|.	ENSG00000112902|ENSG00000112902	ENST00000382496;ENST00000513968|ENST00000514923	T;T|.	0.11063|.	2.81;2.81|.	5.63|5.63	5.63|5.63	0.86233|0.86233	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.33556|0.33556	0.0867|0.0867	N|N	0.02916|0.02916	-0.46|-0.46	0.53005|0.53005	D|D	0.999961|0.999961	P|.	0.47910|.	0.902|.	P|.	0.52957|.	0.714|.	T|T	0.31447|0.31447	-0.9943|-0.9943	10|5	0.12430|.	T|.	0.62|.	.|.	15.1747|15.1747	0.72901|0.72901	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	103|.	Q13591|.	SEM5A_HUMAN|.	T|D	103|50	ENSP00000371936:A103T;ENSP00000421961:A103T|.	ENSP00000371936:A103T|.	A|G	-|-	1|2	0|0	SEMA5A|SEMA5A	9290966|9290966	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	4.525000|4.525000	0.60559|0.60559	2.654000|2.654000	0.90174|0.90174	0.655000|0.655000	0.94253|0.94253	GCC|GGC	-	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema		0.378	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	protein_coding	OTTHUMT00000206989.2	C			9290966	-1	no_errors	NM_003966	genbank	human	validated	54_36p	missense	SNP	1.000	T
TATDN2	9797	genome.wustl.edu	37	3	10320069	10320069	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr3:10320069G>T	ENST00000287652.4	+	6	3119	c.2068G>T	c.(2068-2070)Gcc>Tcc	p.A690S	RP11-438J1.1_ENST00000450534.1_3'UTR|TATDN2_ENST00000448281.2_Missense_Mutation_p.A690S|TATDN2_ENST00000496355.1_3'UTR	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	690					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						TGCCTGGGAGGCCCGGGAAGC	0.582																																																0			3											168.0	168.0	168.0					3																	10320069		2203	4300	6503	10295069	SO:0001583	missense	9797			D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.2068G>T	3.37:g.10320069G>T	ENSP00000287652:p.Ala690Ser	Somatic		Capture	Illumina GAIIx	4	10295069	Q3MIL9|Q5BKU0	Missense_Mutation	SNP	superfamily_SSF51556,PatternScan_TATD_1,HMMPfam_TatD_DNase,PatternScan_TATD_2,PatternScan_TATD_3	p.A690S	ENST00000287652.4	37	c.2068	CCDS33698.1	3	.	.	.	.	.	.	.	.	.	.	G	23.2	4.391906	0.83011	.	.	ENSG00000157014	ENST00000287652;ENST00000448281;ENST00000426850	T;T	0.24908	1.83;1.83	5.52	3.64	0.41730	.	0.376195	0.23303	U	0.049652	T	0.38983	0.1061	L	0.55834	1.745	0.38233	D	0.941095	P	0.48350	0.909	P	0.60609	0.877	T	0.27706	-1.0066	10	0.66056	D	0.02	-18.3013	8.8414	0.35144	0.0836:0.1532:0.7632:0.0	.	690	Q93075	TATD2_HUMAN	S	690;690;111	ENSP00000287652:A690S;ENSP00000408736:A690S	ENSP00000287652:A690S	A	+	1	0	TATDN2	10295069	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.771000	0.55318	2.595000	0.87683	0.655000	0.94253	GCC	-	superfamily_SSF51556,HMMPfam_TatD_DNase		0.582	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TATDN2	protein_coding	OTTHUMT00000339641.1	G	XM_376203		10295069	+1	no_errors	NM_014760	genbank	human	provisional	54_36p	missense	SNP	1.000	T
PRKACA	5566	genome.wustl.edu	37	19	14208295	14208295	+	Splice_Site	SNP	C	C	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr19:14208295C>G	ENST00000308677.4	-	8	839	c.643G>C	c.(643-645)Ggc>Cgc	p.G215R	PRKACA_ENST00000350356.3_5'UTR|PRKACA_ENST00000589994.1_Splice_Site_p.G207R|PRKACA_ENST00000590853.1_Intron	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	215	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						TTGTTGTAGCCCTGGAGCAAG	0.637																																																0			19											30.0	34.0	33.0					19																	14208295		2203	4300	6503	14069295	SO:0001630	splice_region_variant	5566				CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.643-1G>C	19.37:g.14208295C>G		Somatic		Capture	Illumina GAIIx	4	14069295	Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_SM00133	p.G215R	ENST00000308677.4	37	c.643	CCDS12304.1	19	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339785	0.81911	.	.	ENSG00000072062	ENST00000308677;ENST00000350356;ENST00000535695;ENST00000536649	T	0.66280	-0.2	4.54	4.54	0.55810	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.41938	U	0.000792	T	0.73187	0.3555	L	0.46741	1.465	0.50467	D	0.999873	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.76564	-0.2913	10	0.87932	D	0	.	14.7756	0.69729	0.0:1.0:0.0:0.0	.	157;215;207	B7Z708;P17612;P17612-2	.;KAPCA_HUMAN;.	R	215;207;215;157	ENSP00000309591:G215R	ENSP00000309591:G215R	G	-	1	0	PRKACA	14069295	1.000000	0.71417	0.999000	0.59377	0.831000	0.47069	7.596000	0.82721	2.054000	0.61138	0.591000	0.81541	GGC	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.637	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACA	protein_coding	OTTHUMT00000459004.1	C	NM_002730	Missense_Mutation	14069295	-1	no_errors	NM_002730	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
OR7C2	26658	genome.wustl.edu	37	19	15052654	15052654	+	Silent	SNP	G	G	A	rs139952516	byFrequency	TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr19:15052654G>A	ENST00000248072.3	+	1	354	c.354G>A	c.(352-354)acG>acA	p.T118T		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	118			T -> M (in dbSNP:rs8113325).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					TGACCATGACGGCCTATGACC	0.507													.|||	12	0.00239617	0.0	0.0159	5008	,	,		19805	0.0		0.001	False		,,,				2504	0.0															0			19						G		0,4406		0,0,2203	94.0	87.0	89.0		354	3.2	0.9	19	dbSNP_134	89	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	OR7C2	NM_012377.1		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		118/320	15052654	2,13004	2203	4300	6503	14913654	SO:0001819	synonymous_variant	26658			U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.354G>A	19.37:g.15052654G>A		Somatic		Capture	Illumina GAIIx	4	14913654	O43881|Q6IFP9	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T118	ENST00000248072.3	37	c.354	CCDS12320.1	19																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1		0.507	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C2	protein_coding	OTTHUMT00000466281.1	G			14913654	+1	no_errors	NM_012377	genbank	human	provisional	54_36p	silent	SNP	1.000	A
CCT8L2	150160	genome.wustl.edu	37	22	17072668	17072668	+	Missense_Mutation	SNP	G	G	A	rs147789853	byFrequency	TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr22:17072668G>A	ENST00000359963.3	-	1	1032	c.773C>T	c.(772-774)aCg>aTg	p.T258M		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	258					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				AAGACGGGCCGTTGCTGGTGC	0.502													a|||	2	0.000399361	0.0	0.0	5008	,	,		20024	0.0		0.002	False		,,,				2504	0.0															0			22						A	MET/THR	0,4406		0,0,2203	99.0	94.0	96.0		773	-0.8	0.0	22	dbSNP_134	96	1,8599	819.1+/-406.8	0,1,4299	no	missense	CCT8L2	NM_014406.4	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	258/558	17072668	1,13005	2203	4300	6503	15452668	SO:0001583	missense	150160			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.773C>T	22.37:g.17072668G>A	ENSP00000353048:p.Thr258Met	Somatic		Capture	Illumina GAIIx	4	15452668	A4QPH3|Q9UJS3	Missense_Mutation	SNP	superfamily_GroEL equatorial domain-like,HMMPfam_Cpn60_TCP1,superfamily_GroEL-intermediate domain like,superfamily_GroEL apical domain-like	p.T258M	ENST00000359963.3	37	c.773	CCDS13738.1	22	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	a	11.55	1.672953	0.29693	0.0	1.16E-4	ENSG00000198445	ENST00000359963	T	0.76968	-1.06	1.98	-0.751	0.11076	.	0.697381	0.11745	N	0.533639	D	0.83806	0.5334	M	0.82517	2.595	0.09310	N	1	D	0.65815	0.995	P	0.62885	0.908	T	0.71368	-0.4614	10	0.49607	T	0.09	-4.5008	4.844	0.13505	0.3565:0.0:0.6435:0.0	.	258	Q96SF2	TCPQM_HUMAN	M	258	ENSP00000353048:T258M	ENSP00000353048:T258M	T	-	2	0	CCT8L2	15452668	0.001000	0.12720	0.002000	0.10522	0.036000	0.12997	0.399000	0.20916	-0.216000	0.10048	-0.885000	0.02943	ACG	-	superfamily_GroEL equatorial domain-like,HMMPfam_Cpn60_TCP1,superfamily_GroEL-intermediate domain like,superfamily_GroEL apical domain-like		0.502	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8L2	protein_coding	OTTHUMT00000280580.1	G			15452668	-1	no_errors	NM_014406	genbank	human	validated	54_36p	missense	SNP	0.000	A
CDRT1	374286	genome.wustl.edu	37	17	15517314	15517314	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr17:15517314G>A	ENST00000395906.3	-	3	703	c.704C>T	c.(703-705)tCc>tTc	p.S235F	RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.S545F	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	235										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		ATTCATTTCGGATATACACCG	0.483																																																0			17											43.0	82.0	69.0					17																	15517314		2180	4293	6473	15458039	SO:0001583	missense	374286			U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.704C>T	17.37:g.15517314G>A	ENSP00000379242:p.Ser235Phe	Somatic		Capture	Illumina GAIIx	4	15458039	O43848|O95611	Missense_Mutation	SNP	superfamily_F-box domain,HMMPfam_F-box,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.S235F	ENST00000395906.3	37	c.704	CCDS45619.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.08|15.08	2.727262|2.727262	0.48833|0.48833	.|.	.|.	ENSG00000251537|ENSG00000251537	ENST00000455584|ENST00000261644;ENST00000395906	T|T	0.57273|0.31247	0.41|1.5	4.82|4.82	2.76|2.76	0.32466|0.32466	.|.	.|0.168569	.|0.28230	.|N	.|0.016116	T|T	0.36717|0.36717	0.0977|0.0977	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	N|N	0.999999|0.999999	.|D;P	.|0.60575	.|0.988;0.917	.|P;P	.|0.50440	.|0.641;0.548	T|T	0.19192|0.19192	-1.0313|-1.0313	6|10	.|0.72032	.|D	.|0.01	.|.	8.213|8.213	0.31494|0.31494	0.0:0.1717:0.6502:0.1781|0.0:0.1717:0.6502:0.1781	.|.	.|235;559	.|O95170;Q59EB2	.|CDRT1_HUMAN;.	S|F	560|235	ENSP00000402644:P560S|ENSP00000379242:S235F	.|ENSP00000261644:S235F	P|S	-|-	1|2	0|0	RP11-385D13.1|RP11-385D13.1	15458039|15458039	0.083000|0.083000	0.21467|0.21467	0.013000|0.013000	0.15412|0.15412	0.021000|0.021000	0.10359|0.10359	0.670000|0.670000	0.25157|0.25157	0.697000|0.697000	0.31718|0.31718	0.484000|0.484000	0.47621|0.47621	CCG|TCC	-	NULL		0.483	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT1	protein_coding	OTTHUMT00000448127.1	G	NM_006382		15458039	-1	no_errors	NM_006382	genbank	human	provisional	54_36p	missense	SNP	0.010	A
NBAS	51594	genome.wustl.edu	37	2	15694261	15694261	+	Splice_Site	SNP	G	G	C			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr2:15694261G>C	ENST00000281513.5	-	4	236	c.211C>G	c.(211-213)Ccg>Gcg	p.P71A	NBAS_ENST00000441750.1_Splice_Site_p.P71A	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	71					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						AAAGGTGCCGGGCTGAAATCA	0.368																																																0			2											76.0	76.0	76.0					2																	15694261		2203	4300	6503	15611712	SO:0001630	splice_region_variant	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.210-1C>G	2.37:g.15694261G>C		Somatic		Capture	Illumina GAIIx	4	15611712	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMPfam_Sec39,PatternScan_RIBOSOMAL_S14	p.P71A	ENST00000281513.5	37	c.211	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	G	8.396	0.840795	0.16891	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.10860	2.83;2.89	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.20373	0.0490	L	0.54323	1.7	0.27473	N	0.952828	D	0.62365	0.991	P	0.51016	0.656	T	0.02294	-1.1181	10	0.87932	D	0	.	15.9282	0.79635	0.0:0.0:1.0:0.0	.	71	A2RRP1	NBAS_HUMAN	A	71	ENSP00000413201:P71A;ENSP00000281513:P71A	ENSP00000281513:P71A	P	-	1	0	NBAS	15611712	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	7.035000	0.76517	2.493000	0.84123	0.305000	0.20034	CCG	-	NULL		0.368	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	protein_coding	OTTHUMT00000241638.1	G	NM_015909	Missense_Mutation	15611712	-1	no_errors	NM_015909	genbank	human	validated	54_36p	missense	SNP	1.000	C
CECR2	27443	genome.wustl.edu	37	22	18022253	18022253	+	Silent	SNP	C	C	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr22:18022253C>T	ENST00000400585.2	+	16	2370	c.1932C>T	c.(1930-1932)caC>caT	p.H644H	CECR2_ENST00000400573.5_Silent_p.H785H|CECR2_ENST00000262608.8_Silent_p.H786H			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	827					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		CTCTCGGTCACGTGATGGATT	0.592																																																0			22											66.0	72.0	70.0					22																	18022253		2050	4184	6234	16402253	SO:0001819	synonymous_variant	27443			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.1932C>T	22.37:g.18022253C>T		Somatic		Capture	Illumina GAIIx	4	16402253	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	superfamily_Bromodomain,HMMSmart_BROMO,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1	p.H785	ENST00000400585.2	37	c.2355		22																																																																																			-	NULL		0.592	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	protein_coding	OTTHUMT00000316226.2	C	NM_031413		16402253	+1	no_errors	ENST00000400585	ensembl	human	known	54_36p	silent	SNP	0.992	T
IL12RB1	3594	genome.wustl.edu	37	19	18183147	18183147	+	Nonsense_Mutation	SNP	C	C	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr19:18183147C>A	ENST00000600835.2	-	10	1094	c.796G>T	c.(796-798)Gag>Tag	p.E266*	IL12RB1_ENST00000322153.7_Nonsense_Mutation_p.E266*|IL12RB1_ENST00000593993.2_Nonsense_Mutation_p.E266*			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	266	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						TCTGGAAGCTCCAGCTGGGTT	0.577																																																0			19											41.0	38.0	39.0					19																	18183147		2203	4300	6503	18044147	SO:0001587	stop_gained	3594			U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.796G>T	19.37:g.18183147C>A	ENSP00000470788:p.Glu266*	Somatic		Capture	Illumina GAIIx	4	18044147	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Nonsense_Mutation	SNP	PatternScan_N6_MTASE,superfamily_Fibronectin type III,PatternScan_HEMATOPO_REC_L_F2,HMMSmart_SM00060,HMMPfam_fn3	p.E266*	ENST00000600835.2	37	c.796	CCDS54232.1	19	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551943	0.65311	.	.	ENSG00000096996	ENST00000430026;ENST00000322153	.	.	.	4.51	-0.642	0.11486	.	1.126930	0.06874	N	0.801323	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-3.9949	5.6291	0.17499	0.0:0.4615:0.3427:0.1958	.	.	.	.	X	266	.	ENSP00000314425:E266X	E	-	1	0	IL12RB1	18044147	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	0.229000	0.17833	0.060000	0.16281	-0.291000	0.09656	GAG	-	NULL		0.577	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB1	protein_coding	OTTHUMT00000466525.3	C			18044147	-1	no_errors	NM_005535	genbank	human	reviewed	54_36p	nonsense	SNP	0.041	A
ARHGEF40	55701	genome.wustl.edu	37	14	21542964	21542964	+	Nonsense_Mutation	SNP	G	G	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr14:21542964G>T	ENST00000298694.4	+	3	1202	c.1075G>T	c.(1075-1077)Gga>Tga	p.G359*	ARHGEF40_ENST00000298693.3_Nonsense_Mutation_p.G359*			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	359	Gly-rich.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						TAGAGGAGGAGGAGGAGGAGG	0.627																																																0			14											30.0	28.0	28.0					14																	21542964		2203	4299	6502	20612804	SO:0001587	stop_gained	55701				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.1075G>T	14.37:g.21542964G>T	ENSP00000298694:p.Gly359*	Somatic		Capture	Illumina GAIIx	4	20612804	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Nonsense_Mutation	SNP	superfamily_DBL homology domain (DH-domain),superfamily_PH domain-like,HMMSmart_SM00233	p.G359*	ENST00000298694.4	37	c.1075	CCDS32041.1	14	.	.	.	.	.	.	.	.	.	.	g	37	6.012658	0.97200	.	.	ENSG00000165801	ENST00000298694;ENST00000555038;ENST00000298693	.	.	.	4.92	4.0	0.46444	.	0.810801	0.10722	N	0.641575	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	.	11.3266	0.49452	0.0:0.1843:0.8157:0.0	.	.	.	.	X	359	.	ENSP00000298693:G359X	G	+	1	0	ARHGEF40	20612804	0.101000	0.21875	0.171000	0.22900	0.847000	0.48162	1.124000	0.31320	1.158000	0.42547	0.462000	0.41574	GGA	-	NULL		0.627	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLJ10357	protein_coding	OTTHUMT00000413122.1	G			20612804	+1	no_errors	NM_018071	genbank	human	validated	54_36p	nonsense	SNP	0.050	T
IGLV3-22	28795	genome.wustl.edu	37	22	23047213	23047213	+	RNA	SNP	C	C	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr22:23047213C>T	ENST00000390307.2	+	0	315									immunoglobulin lambda variable 3-22 (gene/pseudogene)																		TCTGGGTCCACCTCAGGGAAC	0.557																																																0			22											53.0	57.0	56.0					22																	23047213		1976	4155	6131	21377213			0			Z73666		22q11.2	2012-02-08	2008-09-12		ENSG00000211661	ENSG00000211661		"""Immunoglobulins / IGL locus"""	5906	other	immunoglobulin gene			"""immunoglobulin lambda variable 3-22"""				Standard	NG_000002		Approved				OTTHUMG00000151229		22.37:g.23047213C>T		Somatic		Capture	Illumina GAIIx	4	21377213		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406	p.T84I	ENST00000390307.2	37	c.251		22																																																																																			-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406		0.557	IGLV3-22-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV3-22	IG_V_gene	OTTHUMT00000321833.2	C	NG_000002		21377213	+1	no_stop_codon	ENST00000390307	ensembl	human	known	54_36p	missense	SNP	0.524	T
ANO5	203859	genome.wustl.edu	37	11	22272532	22272532	+	Missense_Mutation	SNP	C	C	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr11:22272532C>A	ENST00000324559.8	+	12	1472	c.1155C>A	c.(1153-1155)ttC>ttA	p.F385L		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	385					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CAACAGTGTTCTTTGCAATAT	0.303																																																0			11											87.0	85.0	85.0					11																	22272532		2203	4300	6503	22229108	SO:0001583	missense	203859			AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.1155C>A	11.37:g.22272532C>A	ENSP00000315371:p.Phe385Leu	Somatic		Capture	Illumina GAIIx	4	22229108		Missense_Mutation	SNP	HMMPfam_DUF590	p.F385L	ENST00000324559.8	37	c.1155	CCDS31444.1	11	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216591	0.79352	.	.	ENSG00000171714	ENST00000324559	T	0.62498	0.02	5.61	3.51	0.40186	.	0.000000	0.85682	D	0.000000	T	0.59197	0.2176	L	0.58810	1.83	0.58432	D	0.999999	P	0.45902	0.868	P	0.47346	0.544	T	0.58086	-0.7698	10	0.40728	T	0.16	.	6.2842	0.21023	0.0:0.6684:0.0:0.3316	.	385	Q75V66	ANO5_HUMAN	L	385	ENSP00000315371:F385L	ENSP00000315371:F385L	F	+	3	2	ANO5	22229108	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.457000	0.35212	1.360000	0.45960	0.557000	0.71058	TTC	-	NULL		0.303	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO5	protein_coding	OTTHUMT00000387615.1	C	NM_213599		22229108	+1	no_errors	NM_213599	genbank	human	validated	54_36p	missense	SNP	1.000	A
ITSN2	50618	genome.wustl.edu	37	2	24533517	24533517	+	Missense_Mutation	SNP	G	G	C	rs144746035		TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr2:24533517G>C	ENST00000355123.4	-	6	840	c.397C>G	c.(397-399)Cca>Gca	p.P133A	ITSN2_ENST00000406921.3_Missense_Mutation_p.P133A|ITSN2_ENST00000361999.3_Missense_Mutation_p.P133A|ITSN2_ENST00000407704.1_5'Flank	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	133					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTGCAGCTGGAGGCAATGGC	0.438																																																0			2											131.0	113.0	119.0					2																	24533517		2203	4300	6503	24387021	SO:0001583	missense	50618			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.397C>G	2.37:g.24533517G>C	ENSP00000347244:p.Pro133Ala	Somatic		Capture	Illumina GAIIx	4	24387021	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00027,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1,superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_1,HMMPfam_SH3_2,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.P132A	ENST00000355123.4	37	c.394	CCDS1710.2	2	.	.	.	.	.	.	.	.	.	.	G	0.915	-0.717804	0.03182	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000445614;ENST00000406921;ENST00000412011;ENST00000443927	T;T;T;T;T;T	0.61392	0.14;0.11;0.14;0.56;0.73;1.26	5.27	3.4	0.38934	.	0.467044	0.15423	N	0.263101	T	0.35885	0.0947	N	0.12887	0.27	0.41967	D	0.990732	B;B;B;B	0.26363	0.033;0.033;0.147;0.024	B;B;B;B	0.31442	0.04;0.04;0.13;0.035	T	0.09729	-1.0661	10	0.28530	T	0.3	.	4.7826	0.13210	0.0733:0.3582:0.3669:0.2016	.	133;133;133;133	Q9NZM3-4;Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;.;ITSN2_HUMAN	A	133;133;133;132;133;133;119	ENSP00000354561:P133A;ENSP00000347244:P133A;ENSP00000370250:P133A;ENSP00000384499:P133A;ENSP00000391224:P133A;ENSP00000391715:P119A	ENSP00000347244:P133A	P	-	1	0	ITSN2	24387021	0.904000	0.30761	0.998000	0.56505	0.960000	0.62799	-0.064000	0.11636	0.667000	0.31107	0.467000	0.42956	CCA	-	NULL		0.438	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	protein_coding	OTTHUMT00000207620.2	G	NM_006277		24387021	-1	no_errors	NM_006277	genbank	human	reviewed	54_36p	missense	SNP	0.987	C
SUPT7L	9913	genome.wustl.edu	37	2	27880482	27880482	+	Silent	SNP	G	G	C			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr2:27880482G>C	ENST00000337768.5	-	4	1043	c.474C>G	c.(472-474)ctC>ctG	p.L158L	SUPT7L_ENST00000406540.1_Silent_p.L156L|SUPT7L_ENST00000464789.2_Silent_p.L156L|SUPT7L_ENST00000404798.2_Silent_p.L23L|SUPT7L_ENST00000405491.1_Silent_p.L156L	NM_001282729.1|NM_014860.1	NP_001269658.1|NP_055675.1	O94864	ST65G_HUMAN	suppressor of Ty 7 (S. cerevisiae)-like	158					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|maintenance of protein location in nucleus (GO:0051457)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)					CTGCCTGGTAGAGGAGCTGCC	0.532																																																0			2											36.0	38.0	37.0					2																	27880482		1998	4158	6156	27733986	SO:0001819	synonymous_variant	9913			AF197954	CCDS42667.1, CCDS62885.1, CCDS62886.1	2p23.3	2008-02-05			ENSG00000119760	ENSG00000119760			30632	protein-coding gene	gene with protein product		612762				9872452, 11564863	Standard	NM_001282732		Approved	STAF65, gamma, KIAA0764, SPT7L	uc002rli.1	O94864	OTTHUMG00000151947	ENST00000337768.5:c.474C>G	2.37:g.27880482G>C		Somatic		Capture	Illumina GAIIx	4	27733986	B4E3W3|Q6IB21|Q9H2T6	Silent	SNP	HMMPfam_Bromo_TP,HMMSmart_SM00576	p.L158	ENST00000337768.5	37	c.474	CCDS42667.1	2																																																																																			-	HMMPfam_Bromo_TP,HMMSmart_SM00576		0.532	SUPT7L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT7L	protein_coding	OTTHUMT00000324568.1	G	NM_014860		27733986	-1	no_errors	NM_014860	genbank	human	provisional	54_36p	silent	SNP	1.000	C
PLB1	151056	genome.wustl.edu	37	2	28843195	28843195	+	Missense_Mutation	SNP	T	T	C			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr2:28843195T>C	ENST00000327757.5	+	47	3423	c.3379T>C	c.(3379-3381)Tgg>Cgg	p.W1127R	PLB1_ENST00000541605.1_Missense_Mutation_p.W92R|PLB1_ENST00000422425.2_Missense_Mutation_p.W1116R	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	1127	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					GGGACTCTCTTGGAGGTGAGG	0.502																																																0			2											85.0	78.0	81.0					2																	28843195		2203	4300	6503	28696699	SO:0001583	missense	151056				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.3379T>C	2.37:g.28843195T>C	ENSP00000330442:p.Trp1127Arg	Somatic		Capture	Illumina GAIIx	4	28696699	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	superfamily_SGNH hydrolase,PatternScan_LIPASE_GDSL_SER,HMMPfam_Lipase_GDSL	p.W1127R	ENST00000327757.5	37	c.3379	CCDS33168.1	2	.	.	.	.	.	.	.	.	.	.	T	12.51	1.960089	0.34565	.	.	ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000541605	T;T;T	0.13196	2.61;2.61;2.61	5.77	4.6	0.57074	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);Lipase, GDSL (1);	0.191751	0.48767	D	0.000176	T	0.43233	0.1238	M	0.91300	3.195	0.51482	D	0.999928	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.47711	-0.9096	10	0.66056	D	0.02	-11.6709	9.9697	0.41745	0.0:0.0:0.1705:0.8295	.	1116;1127	Q6P1J6-3;Q6P1J6	.;PLB1_HUMAN	R	1127;1116;92	ENSP00000330442:W1127R;ENSP00000416440:W1116R;ENSP00000437426:W92R	ENSP00000330442:W1127R	W	+	1	0	PLB1	28696699	1.000000	0.71417	0.928000	0.36995	0.128000	0.20619	4.174000	0.58256	1.003000	0.39130	-0.466000	0.05196	TGG	-	superfamily_SGNH hydrolase,HMMPfam_Lipase_GDSL		0.502	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PLB1	protein_coding	OTTHUMT00000353348.2	T			28696699	+1	no_errors	NM_153021	genbank	human	validated	54_36p	missense	SNP	0.950	C
TRIM10	10107	genome.wustl.edu	37	6	30128543	30128543	+	Silent	SNP	G	G	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr6:30128543G>A	ENST00000449742.2	-	1	168	c.93C>T	c.(91-93)tgC>tgT	p.C31C	TRIM15_ENST00000376688.1_5'Flank|TRIM15_ENST00000376694.4_5'Flank|TRIM10_ENST00000376704.3_Silent_p.C31C	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	31					erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			ovary(1)	1						AGTTGTGGCCGCAGTCGATAG	0.612																																																0			6											76.0	80.0	79.0					6																	30128543		2203	4300	6503	30236522	SO:0001819	synonymous_variant	10107			Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.93C>T	6.37:g.30128543G>A		Somatic		Capture	Illumina GAIIx	4	30236522	A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Silent	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_zf-B_box,HMMSmart_SM00336,HMMSmart_SM00589,HMMSmart_SM00449,HMMPfam_SPRY	p.C31	ENST00000449742.2	37	c.93	CCDS34375.1	6																																																																																			-	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1		0.612	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM10	protein_coding	OTTHUMT00000076634.1	G			30236522	-1	no_errors	NM_006778	genbank	human	validated	54_36p	silent	SNP	0.993	A
RFFL	117584	genome.wustl.edu	37	17	33353479	33353479	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr17:33353479G>T	ENST00000315249.7	-	2	316	c.94C>A	c.(94-96)Cct>Act	p.P32T	RAD51L3-RFFL_ENST00000593039.1_Intron|RFFL_ENST00000413582.2_Missense_Mutation_p.P32T|RFFL_ENST00000394597.2_Missense_Mutation_p.P32T|RFFL_ENST00000268850.7_Missense_Mutation_p.P32T|RFFL_ENST00000447669.2_Missense_Mutation_p.P32T|RFFL_ENST00000415395.2_Missense_Mutation_p.P32T|RFFL_ENST00000378516.2_Missense_Mutation_p.P32T|RFFL_ENST00000584655.1_Missense_Mutation_p.P32T					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase											kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CTGTACCCAGGGTTGGAATAG	0.577																																																0			17											79.0	61.0	67.0					17																	33353479		2203	4300	6503	30377592	SO:0001583	missense	117584			AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.94C>A	17.37:g.33353479G>T	ENSP00000326170:p.Pro32Thr	Somatic		Capture	Illumina GAIIx	4	30377592		Missense_Mutation	SNP	superfamily_FYVE/PHD zinc finger,superfamily_SAP domain,superfamily_RING/U-box,HMMSmart_SM00184	p.P32T	ENST00000315249.7	37	c.94	CCDS11286.1	17	.	.	.	.	.	.	.	.	.	.	G	15.43	2.831679	0.50845	.	.	ENSG00000092871	ENST00000315249;ENST00000394597;ENST00000378516;ENST00000268850;ENST00000413582;ENST00000415395;ENST00000414419;ENST00000447669	T;T;T;T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;-0.95;-0.95;-0.95;-0.95	5.21	4.2	0.49525	Zinc finger, FYVE/PHD-type (1);	0.061070	0.64402	D	0.000001	T	0.72542	0.3473	N	0.20685	0.6	0.42198	D	0.991751	D;P;D;D	0.89917	1.0;0.952;0.97;1.0	D;P;P;D	0.87578	0.998;0.644;0.471;0.998	T	0.68985	-0.5265	10	0.31617	T	0.26	-8.6524	8.0976	0.30837	0.0794:0.0:0.7624:0.1581	.	32;32;32;32	C9JN73;Q8WZ73-3;Q8WZ73;Q8WZ73-2	.;.;RFFL_HUMAN;.	T	32	ENSP00000326170:P32T;ENSP00000378096:P32T;ENSP00000367777:P32T;ENSP00000268850:P32T;ENSP00000408513:P32T;ENSP00000412322:P32T;ENSP00000395090:P32T;ENSP00000389832:P32T	ENSP00000268850:P32T	P	-	1	0	RFFL	30377592	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	4.636000	0.61339	2.711000	0.92665	0.650000	0.86243	CCT	-	superfamily_FYVE/PHD zinc finger		0.577	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFFL	protein_coding	OTTHUMT00000256460.2	G	NM_057178		30377592	-1	no_errors	NM_001017368	genbank	human	validated	54_36p	missense	SNP	1.000	T
KRT36	8689	genome.wustl.edu	37	17	39645949	39645949	+	Silent	SNP	G	G	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr17:39645949G>T	ENST00000328119.6	-	1	167	c.168C>A	c.(166-168)ctC>ctA	p.L56L	KRT36_ENST00000393986.2_Silent_p.L6L	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36	56	Head.				regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)			breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				CAAGGCCAGAGAGGCCCGACC	0.642																																																0			17											66.0	72.0	70.0					17																	39645949		2203	4300	6503	36899475	SO:0001819	synonymous_variant	8689			Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.168C>A	17.37:g.39645949G>T		Somatic		Capture	Illumina GAIIx	4	36899475	Q86XG4	Silent	SNP	HMMPfam_Filament,superfamily_Prefoldin,PatternScan_IF	p.L56	ENST00000328119.6	37	c.168	CCDS11395.1	17																																																																																			-	NULL		0.642	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT36	protein_coding	OTTHUMT00000259508.1	G	NM_003771		36899475	-1	no_errors	NM_003771	genbank	human	reviewed	54_36p	silent	SNP	0.612	T
DNAH8	1769	genome.wustl.edu	37	6	38810570	38810570	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr6:38810570G>T	ENST00000359357.3	+	33	4339	c.4085G>T	c.(4084-4086)tGg>tTg	p.W1362L	DNAH8_ENST00000441566.1_Missense_Mutation_p.W1362L|DNAH8_ENST00000449981.2_Missense_Mutation_p.W1579L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1362					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CAGAGACACTGGGATAGAATC	0.393																																																0			6											127.0	118.0	121.0					6																	38810570		2203	4300	6503	38918548	SO:0001583	missense	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.4085G>T	6.37:g.38810570G>T	ENSP00000352312:p.Trp1362Leu	Somatic		Capture	Illumina GAIIx	4	38918548	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,PatternScan_THIOL_PROTEASE_HIS,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.W1362L	ENST00000359357.3	37	c.4085		6	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230783	0.79688	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.73047	-0.71;-0.71;-0.71	5.12	5.12	0.69794	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	D	0.90366	0.6985	H	0.98901	4.365	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.94168	0.7420	10	0.87932	D	0	.	18.9269	0.92549	0.0:0.0:1.0:0.0	.	1362	Q96JB1	DYH8_HUMAN	L	1567;1567;1362;1362	ENSP00000333363:W1567L;ENSP00000352312:W1362L;ENSP00000402294:W1362L	ENSP00000333363:W1567L	W	+	2	0	DNAH8	38918548	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.813000	0.99286	2.532000	0.85374	0.557000	0.71058	TGG	-	HMMPfam_DHC_N2		0.393	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	G	NM_001206927		38918548	+1	no_errors	NM_001371	genbank	human	validated	54_36p	missense	SNP	1.000	T
MFSD2A	84879	genome.wustl.edu	37	1	40431658	40431658	+	Missense_Mutation	SNP	C	C	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr1:40431658C>A	ENST00000372809.5	+	6	868	c.725C>A	c.(724-726)aCa>aAa	p.T242K	MFSD2A_ENST00000480630.1_3'UTR|MFSD2A_ENST00000420632.2_Missense_Mutation_p.T73K|MFSD2A_ENST00000372811.5_Missense_Mutation_p.T229K	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A	242					establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						GCCAACCATACACATGGCACC	0.542																																																0			1											104.0	79.0	88.0					1																	40431658		2203	4300	6503	40204245	SO:0001583	missense	84879			AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.725C>A	1.37:g.40431658C>A	ENSP00000361895:p.Thr242Lys	Somatic		Capture	Illumina GAIIx	4	40204245	A8K675|Q6UWU5|Q96F59|Q9BRC8	Missense_Mutation	SNP	superfamily_MFS general substrate transporter,HMMPfam_MFS_1	p.T229K	ENST00000372809.5	37	c.686	CCDS44118.1	1	.	.	.	.	.	.	.	.	.	.	C	7.504	0.653347	0.14580	.	.	ENSG00000168389	ENST00000372811;ENST00000420632;ENST00000434861;ENST00000372809	T	0.60920	0.15	5.94	5.94	0.96194	Major facilitator superfamily domain, general substrate transporter (1);	0.089581	0.85682	D	0.000000	T	0.71082	0.3298	M	0.75264	2.295	0.52501	D	0.999955	P;P;P	0.45634	0.863;0.775;0.835	P;P;B	0.52514	0.701;0.606;0.311	T	0.67241	-0.5720	10	0.33940	T	0.23	-12.5608	19.3475	0.94370	0.0:1.0:0.0:0.0	.	192;242;229	B4DNN7;Q8NA29;Q8NA29-2	.;MFS2A_HUMAN;.	K	229;73;227;242	ENSP00000407606:T227K	ENSP00000361895:T242K	T	+	2	0	MFSD2A	40204245	0.990000	0.36364	0.529000	0.27951	0.007000	0.05969	3.666000	0.54540	2.816000	0.96949	0.563000	0.77884	ACA	-	superfamily_MFS general substrate transporter		0.542	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	MFSD2	protein_coding	OTTHUMT00000025756.1	C	NM_032793		40204245	+1	no_errors	NM_032793	genbank	human	validated	54_36p	missense	SNP	0.946	A
THADA	63892	genome.wustl.edu	37	2	43819135	43819135	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr2:43819135C>T	ENST00000405006.4	-	3	478	c.127G>A	c.(127-129)Gtg>Atg	p.V43M	THADA_ENST00000402360.2_Missense_Mutation_p.V43M|THADA_ENST00000404790.1_Missense_Mutation_p.V43M|THADA_ENST00000415080.2_De_novo_Start_InFrame|THADA_ENST00000405975.2_Missense_Mutation_p.V43M|THADA_ENST00000403856.1_Missense_Mutation_p.V43M	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	43										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GTGAGTTGCACACAATGTAAC	0.318																																																0			2											58.0	55.0	56.0					2																	43819135		1851	4080	5931	43672639	SO:0001583	missense	63892			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.127G>A	2.37:g.43819135C>T	ENSP00000385995:p.Val43Met	Somatic		Capture	Illumina GAIIx	4	43672639	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_DUF2428,PatternScan_FORMATE_NITRITE_TP_1	p.V43M	ENST00000405006.4	37	c.127	CCDS46268.1	2	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400071	0.62177	.	.	ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000405006;ENST00000402360;ENST00000404790;ENST00000403856	T;T;T;T;T	0.37235	2.69;2.69;1.28;1.27;1.21	4.86	3.93	0.45458	.	0.325278	0.27851	N	0.017600	T	0.44705	0.1306	L	0.54323	1.7	0.80722	D	1	P;P;P;P	0.50443	0.935;0.859;0.813;0.883	P;P;P;B	0.51945	0.685;0.515;0.492;0.391	T	0.44772	-0.9306	10	0.66056	D	0.02	.	12.9797	0.58555	0.1606:0.8394:0.0:0.0	.	43;43;43;43	B5MC89;Q8IY32;Q6YHU6-5;Q6YHU6	.;.;.;THADA_HUMAN	M	43	ENSP00000386088:V43M;ENSP00000385995:V43M;ENSP00000385441:V43M;ENSP00000384266:V43M;ENSP00000385469:V43M	ENSP00000349464:V43M	V	-	1	0	THADA	43672639	1.000000	0.71417	0.967000	0.41034	0.853000	0.48598	2.178000	0.42519	2.520000	0.84964	0.591000	0.81541	GTG	-	NULL		0.318	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THADA	protein_coding	OTTHUMT00000326070.3	C	NM_022065		43672639	-1	no_errors	NM_001083953	genbank	human	validated	54_36p	missense	SNP	0.971	T
SZT2	23334	genome.wustl.edu	37	1	43913778	43913778	+	Nonsense_Mutation	SNP	C	C	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr1:43913778C>T	ENST00000562955.1	+	68	9421	c.9421C>T	c.(9421-9423)Cag>Tag	p.Q3141*	SZT2_ENST00000372442.1_Nonsense_Mutation_p.Q2299*|SZT2-AS1_ENST00000396885.2_RNA	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	3198					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						GCTCACCAGCCAGCGAGAGCT	0.652																																																0			1											28.0	30.0	29.0					1																	43913778		2202	4300	6502	43686365	SO:0001587	stop_gained	23334			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.9421C>T	1.37:g.43913778C>T	ENSP00000457168:p.Gln3141*	Somatic		Capture	Illumina GAIIx	4	43686365	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Nonsense_Mutation	SNP	NULL	p.Q2299*	ENST00000562955.1	37	c.6895	CCDS30694.2	1	.	.	.	.	.	.	.	.	.	.	C	50	16.546835	0.99866	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.28	5.28	0.74379	.	0.056729	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	18.9013	0.92443	0.0:1.0:0.0:0.0	.	.	.	.	X	2299	.	ENSP00000361519:Q2299X	Q	+	1	0	SZT2	43686365	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.350000	0.79385	2.462000	0.83206	0.563000	0.77884	CAG	-	NULL		0.652	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0467	protein_coding	OTTHUMT00000019517.3	C	NM_015284		43686365	+1	no_errors	NM_015284	genbank	human	predicted	54_36p	nonsense	SNP	1.000	T
TDGF1	6997	genome.wustl.edu	37	3	46621296	46621296	+	Nonsense_Mutation	SNP	C	C	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr3:46621296C>A	ENST00000296145.5	+	4	1024	c.291C>A	c.(289-291)tgC>tgA	p.C97*	LRRC2_ENST00000296144.3_Intron|TDGF1_ENST00000542931.1_Nonsense_Mutation_p.C81*	NM_003212.3	NP_003203.1	P13385	TDGF1_HUMAN	teratocarcinoma-derived growth factor 1	97	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPK activity (GO:0000187)|anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle cell differentiation (GO:0055007)|cell differentiation (GO:0030154)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-6 (GO:0071354)|cellular response to tumor necrosis factor (GO:0071356)|embryo development (GO:0009790)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of signal transduction (GO:0009966)|vasculogenesis (GO:0001570)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	growth factor activity (GO:0008083)|receptor binding (GO:0005102)			cervix(2)|endometrium(1)|kidney(1)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		TTTGTGCCTGCCCTCCCTCCT	0.552																																																0			3											105.0	107.0	106.0					3																	46621296		2203	4300	6503	46596300	SO:0001587	stop_gained	6997			M96955	CCDS2742.1, CCDS54575.1	3p21.31	2012-10-03			ENSG00000241186	ENSG00000241186			11701	protein-coding gene	gene with protein product		187395				1882841, 10393436	Standard	NM_003212		Approved	CRIPTO, CR, Cripto-1	uc021wxd.1	P13385	OTTHUMG00000133482	ENST00000296145.5:c.291C>A	3.37:g.46621296C>A	ENSP00000296145:p.Cys97*	Somatic		Capture	Illumina GAIIx	4	46596300	Q8TCC1	Nonsense_Mutation	SNP	PatternScan_EGF_2,superfamily_SSF57196,HMMSmart_EGF,PatternScan_EGF_1,HMMPfam_CFC	p.C97*	ENST00000296145.5	37	c.291	CCDS2742.1	3	.	.	.	.	.	.	.	.	.	.	C	12.23	1.875473	0.33162	.	.	ENSG00000241186	ENST00000542931;ENST00000296145	.	.	.	4.44	1.61	0.23674	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.267	0.20932	0.0:0.6822:0.0:0.3178	.	.	.	.	X	81;97	.	ENSP00000296145:C97X	C	+	3	2	AC104304.1	46596300	0.514000	0.26202	0.996000	0.52242	0.377000	0.30045	-0.480000	0.06559	0.598000	0.29829	-0.140000	0.14226	TGC	-	superfamily_SSF57196,HMMSmart_EGF,PatternScan_EGF_1		0.552	TDGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDGF1	protein_coding	OTTHUMT00000257378.2	C	NM_003212		46596300	+1	no_errors	NM_003212	genbank	human	validated	54_36p	nonsense	SNP	0.996	A
MEP1A	4224	genome.wustl.edu	37	6	46777232	46777232	+	Missense_Mutation	SNP	A	A	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr6:46777232A>G	ENST00000230588.4	+	6	347	c.338A>G	c.(337-339)tAt>tGt	p.Y113C		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	113	Metalloprotease.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			TTCAAGCCCTATGAAGGAGAG	0.383																																																0			6											159.0	156.0	157.0					6																	46777232		2203	4300	6503	46885191	SO:0001583	missense	4224				CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.338A>G	6.37:g.46777232A>G	ENSP00000230588:p.Tyr113Cys	Somatic		Capture	Illumina GAIIx	4	46885191	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Missense_Mutation	SNP	PatternScan_EGF_1,PatternScan_EGF_2,superfamily_SSF55486,HMMSmart_ZnMc,HMMPfam_Astacin,PatternScan_ZINC_PROTEASE,HMMSmart_MAM,HMMPfam_MAM,PatternScan_MAM_1,superfamily_Traf_like,HMMSmart_MATH,HMMPfam_MATH,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF	p.Y113C	ENST00000230588.4	37	c.338	CCDS4918.1	6	.	.	.	.	.	.	.	.	.	.	A	20.3	3.963244	0.74016	.	.	ENSG00000112818	ENST00000230588	T	0.63580	-0.05	5.76	5.76	0.90799	Peptidase, metallopeptidase (1);Peptidase M12A, astacin (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79753	0.4500	M	0.89353	3.025	0.54753	D	0.999982	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83873	0.0275	10	0.72032	D	0.01	-25.4376	16.3786	0.83431	1.0:0.0:0.0:0.0	.	141;113	B7ZL91;Q16819	.;MEP1A_HUMAN	C	113	ENSP00000230588:Y113C	ENSP00000230588:Y113C	Y	+	2	0	MEP1A	46885191	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.701000	0.68325	2.323000	0.78572	0.528000	0.53228	TAT	-	superfamily_SSF55486,HMMSmart_ZnMc,HMMPfam_Astacin		0.383	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEP1A	protein_coding	OTTHUMT00000040803.1	A	NM_005588		46885191	+1	no_errors	NM_005588	genbank	human	validated	54_36p	missense	SNP	1.000	G
UNC13C	440279	genome.wustl.edu	37	15	54435870	54435870	+	Silent	SNP	G	G	A	rs373493676		TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr15:54435870G>A	ENST00000260323.11	+	3	3060	c.3060G>A	c.(3058-3060)caG>caA	p.Q1020Q	UNC13C_ENST00000537900.1_Silent_p.Q1020Q|UNC13C_ENST00000545554.1_Silent_p.Q1020Q	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1020					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTGCACTCCAGGTGTGTGGTG	0.383																																																0			15											164.0	154.0	157.0					15																	54435870		1891	4112	6003	52223162	SO:0001819	synonymous_variant	440279			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3060G>A	15.37:g.54435870G>A		Somatic		Capture	Illumina GAIIx	4	52223162	Q0P613|Q8ND48|Q96NP3	Silent	SNP	superfamily_SSF57889,HMMSmart_C1,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2,HMMPfam_DUF1041,HMMPfam_Membr_traf_MHD	p.Q1020	ENST00000260323.11	37	c.3060	CCDS45264.1	15																																																																																			-	NULL		0.383	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	protein_coding	OTTHUMT00000419028.3	G	NM_173166		52223162	+1	no_errors	NM_001080534	genbank	human	provisional	54_36p	silent	SNP	1.000	A
PODN	127435	genome.wustl.edu	37	1	53544321	53544321	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr1:53544321G>A	ENST00000312553.5	+	8	1290	c.1283G>A	c.(1282-1284)cGc>cAc	p.R428H	PODN_ENST00000395871.2_Missense_Mutation_p.R286H|PODN_ENST00000371500.3_Missense_Mutation_p.R409H|RP11-334A14.5_ENST00000447867.1_RNA	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	380					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GGCCTGCCTCGCCGCGTGCGC	0.632																																																0			1											109.0	95.0	100.0					1																	53544321		2203	4300	6503	53316909	SO:0001583	missense	127435			AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.1283G>A	1.37:g.53544321G>A	ENSP00000308315:p.Arg428His	Somatic		Capture	Illumina GAIIx	4	53316909	B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRRNT,HMMSmart_LRRNT,HMMSmart_LRR_TYP,HMMPfam_LRR_1,superfamily_SSF52047	p.R428H	ENST00000312553.5	37	c.1283	CCDS573.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082203	0.76528	.	.	ENSG00000174348	ENST00000371500;ENST00000395871;ENST00000312553	T;T;T	0.25250	3.57;1.81;2.2	4.81	4.81	0.61882	.	0.054653	0.64402	D	0.000001	T	0.46444	0.1393	L	0.49513	1.565	0.41184	D	0.986251	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.76575	0.962;0.988;0.975	T	0.37842	-0.9688	10	0.48119	T	0.1	.	18.0614	0.89378	0.0:0.0:1.0:0.0	.	286;409;428	Q7Z5L7-4;Q7Z5L7-2;Q7Z5L7-3	.;.;.	H	409;286;428	ENSP00000360555:R409H;ENSP00000379212:R286H;ENSP00000308315:R428H	ENSP00000308315:R428H	R	+	2	0	PODN	53316909	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.799000	0.85936	2.492000	0.84095	0.555000	0.69702	CGC	-	superfamily_SSF52047		0.632	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PODN	protein_coding	OTTHUMT00000024735.1	G	NM_153703		53316909	+1	no_errors	NM_153703	genbank	human	validated	54_36p	missense	SNP	0.999	A
MC3R	4159	genome.wustl.edu	37	20	54824013	54824013	+	Silent	SNP	C	C	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr20:54824013C>T	ENST00000243911.2	+	1	226	c.114C>T	c.(112-114)gtC>gtT	p.V38V		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	38					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.V75V(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			GTGAGCAGGTCTTCATCAAGC	0.582																																																1	Substitution - coding silent(1)	lung(1)	20											122.0	110.0	114.0					20																	54824013		2203	4300	6503	54257420	SO:0001819	synonymous_variant	4159				CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.114C>T	20.37:g.54824013C>T		Somatic		Capture	Illumina GAIIx	4	54257420	Q4KN27|Q9H517	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V75	ENST00000243911.2	37	c.225	CCDS13449.2	20																																																																																			-	superfamily_SSF81321		0.582	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC3R	protein_coding	OTTHUMT00000079786.2	C			54257420	+1	no_errors	NM_019888	genbank	human	reviewed	54_36p	silent	SNP	0.999	T
DST	667	genome.wustl.edu	37	6	56481168	56481168	+	Missense_Mutation	SNP	T	T	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr6:56481168T>G	ENST00000370765.6	-	24	7204	c.7097A>C	c.(7096-7098)tAt>tCt	p.Y2366S	DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000446842.2_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1696					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AAGTTCAAGATATATACTTTT	0.363																																																0			6											69.0	70.0	70.0					6																	56481168		2203	4300	6503	56589127	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7097A>C	6.37:g.56481168T>G	ENSP00000359801:p.Tyr2366Ser	Somatic		Capture	Illumina GAIIx	4	56589127	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	HMMSmart_SPEC,superfamily_Spectrin,HMMPfam_Spectrin,superfamily_SSF75399,HMMSmart_PLEC,HMMPfam_Plectin	p.Y2366S	ENST00000370765.6	37	c.7097	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	T	16.21	3.058230	0.55325	.	.	ENSG00000151914	ENST00000370765	T	0.69040	-0.37	5.92	5.92	0.95590	.	.	.	.	.	T	0.79879	0.4522	.	.	.	0.09310	N	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.82946	-0.0205	7	0.72032	D	0.01	.	16.3636	0.83296	0.0:0.0:0.0:1.0	.	2366	Q03001-3	.	S	2366	ENSP00000359801:Y2366S	ENSP00000359801:Y2366S	Y	-	2	0	DST	56589127	1.000000	0.71417	0.358000	0.25811	0.907000	0.53573	8.040000	0.89188	2.267000	0.75376	0.528000	0.53228	TAT	-	HMMSmart_PLEC,HMMPfam_Plectin		0.363	DST-010	KNOWN	basic|CCDS	protein_coding	DST	protein_coding	OTTHUMT00000041027.2	T	NM_001723		56589127	-1	no_errors	NM_001723	genbank	human	reviewed	54_36p	missense	SNP	0.997	G
LPXN	9404	genome.wustl.edu	37	11	58295525	58295525	+	Missense_Mutation	SNP	A	A	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr11:58295525A>T	ENST00000395074.2	-	8	970	c.882T>A	c.(880-882)ttT>ttA	p.F294L	LPXN_ENST00000528954.1_Missense_Mutation_p.F299L|LPXN_ENST00000528489.1_Missense_Mutation_p.F274L	NM_004811.2	NP_004802.1	O60711	LPXN_HUMAN	leupaxin	294	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell adhesion (GO:0007162)|protein complex assembly (GO:0006461)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|podosome (GO:0002102)	transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				CCCCACAAACAAAGCACTCTG	0.483																																																0			11											111.0	111.0	111.0					11																	58295525		2201	4295	6496	58052101	SO:0001583	missense	9404			AF062075	CCDS7969.1, CCDS53635.1	11q12.1	2013-09-20			ENSG00000110031	ENSG00000110031			14061	protein-coding gene	gene with protein product		605390				9565592	Standard	NM_004811		Approved	LDPL	uc001nmw.3	O60711	OTTHUMG00000167466	ENST00000395074.2:c.882T>A	11.37:g.58295525A>T	ENSP00000378512:p.Phe294Leu	Somatic		Capture	Illumina GAIIx	4	58052101	B2R8B4|B4DV71|Q53FW6|Q6FI07	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00132,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM	p.F294L	ENST00000395074.2	37	c.882	CCDS7969.1	11	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220607	0.79464	.	.	ENSG00000110031	ENST00000528954;ENST00000395074	D;D	0.92199	-2.99;-2.99	5.39	1.77	0.24775	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.94291	0.8166	M	0.70275	2.135	0.54753	D	0.999987	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.998;0.993	D	0.92681	0.6158	10	0.87932	D	0	.	8.2357	0.31625	0.6814:0.0:0.3186:0.0	.	274;299;294	B7Z5P7;B4DV71;O60711	.;.;LPXN_HUMAN	L	299;294	ENSP00000431284:F299L;ENSP00000378512:F294L	ENSP00000378512:F294L	F	-	3	2	LPXN	58052101	0.960000	0.32886	1.000000	0.80357	0.894000	0.52154	0.236000	0.17967	0.378000	0.24764	0.383000	0.25322	TTT	-	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00132,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM		0.483	LPXN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPXN	protein_coding	OTTHUMT00000394709.1	A	NM_004811		58052101	-1	no_errors	NM_004811	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
ZNF256	10172	genome.wustl.edu	37	19	58454000	58454000	+	Missense_Mutation	SNP	C	C	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr19:58454000C>A	ENST00000282308.3	-	3	372	c.176G>T	c.(175-177)gGg>gTg	p.G59V	ZNF256_ENST00000598928.1_Missense_Mutation_p.G17W	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	59	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		CTCCTCATCCCCTGCTCCAGA	0.522																																					NSCLC(55;1313 1552 8040 11996)											0			19											83.0	84.0	84.0					19																	58454000		2202	4295	6497	63145812	SO:0001583	missense	10172			AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.176G>T	19.37:g.58454000C>A	ENSP00000282308:p.Gly59Val	Somatic		Capture	Illumina GAIIx	4	63145812	B2RA92|Q53Y85|Q9BV71	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.G59V	ENST00000282308.3	37	c.176	CCDS12966.1	19	.	.	.	.	.	.	.	.	.	.	.	7.133	0.580281	0.13686	.	.	ENSG00000152454	ENST00000282308	T	0.06768	3.26	3.04	1.93	0.25924	Krueppel-associated box (3);	.	.	.	.	T	0.04588	0.0125	N	0.12182	0.205	0.09310	N	0.999999	B	0.19583	0.037	B	0.17722	0.019	T	0.39440	-0.9614	9	0.46703	T	0.11	.	4.9268	0.13898	0.0:0.1461:0.0:0.8539	.	59	Q9Y2P7	ZN256_HUMAN	V	59	ENSP00000282308:G59V	ENSP00000282308:G59V	G	-	2	0	ZNF256	63145812	0.000000	0.05858	0.003000	0.11579	0.283000	0.27025	-1.101000	0.03336	0.563000	0.29222	-0.670000	0.03821	GGG	-	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMSmart_SM00349		0.522	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF256	protein_coding	OTTHUMT00000466702.1	C			63145812	-1	no_errors	NM_005773	genbank	human	validated	54_36p	missense	SNP	0.041	A
SYNE2	23224	genome.wustl.edu	37	14	64416695	64416695	+	Silent	SNP	T	T	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr14:64416695T>A	ENST00000344113.4	+	7	773	c.561T>A	c.(559-561)ctT>ctA	p.L187L	SYNE2_ENST00000358025.3_Silent_p.L187L|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000356081.3_Silent_p.L187L|SYNE2_ENST00000341472.5_Silent_p.L187L|SYNE2_ENST00000554584.1_Silent_p.L187L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	187	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GAAAGGCCCTTCTTTTGTGGG	0.488																																																0			14											145.0	145.0	145.0					14																	64416695		2026	4192	6218	63486448	SO:0001819	synonymous_variant	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.561T>A	14.37:g.64416695T>A		Somatic		Capture	Illumina GAIIx	4	63486448	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	superfamily_Calponin-homology,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_CH,PatternScan_ACTININ_2,superfamily_Spectrin,HMMSmart_SPEC,HMMPfam_Spectrin,superfamily_4_helix_cytokine,HMMPfam_KASH	p.L187	ENST00000344113.4	37	c.561	CCDS41963.1	14																																																																																			-	superfamily_Calponin-homology,HMMPfam_CH,HMMSmart_CH		0.488	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	protein_coding	OTTHUMT00000276994.2	T	NM_182914		63486448	+1	no_errors	NM_182914	genbank	human	validated	54_36p	silent	SNP	0.996	A
DIS3L	115752	genome.wustl.edu	37	15	66610931	66610931	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr15:66610931G>C	ENST00000319212.4	+	8	1189	c.1139G>C	c.(1138-1140)aGc>aCc	p.S380T	RP11-352G18.2_ENST00000565993.1_RNA|DIS3L_ENST00000319194.5_Missense_Mutation_p.S297T|DIS3L_ENST00000441424.2_Intron	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	380					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						ATTCGAATTAGCACTCAGCAA	0.443																																																0			15											88.0	86.0	86.0					15																	66610931		2201	4299	6500	64397985	SO:0001583	missense	115752				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.1139G>C	15.37:g.66610931G>C	ENSP00000321711:p.Ser380Thr	Somatic		Capture	Illumina GAIIx	4	64397985	Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	HMMPfam_RNB,PatternScan_RIBONUCLEASE_II	p.S297T	ENST00000319212.4	37	c.890	CCDS45286.1	15	.	.	.	.	.	.	.	.	.	.	G	13.41	2.229392	0.39399	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	T;T	0.29397	1.57;1.57	3.95	3.01	0.34805	.	0.248376	0.44483	D	0.000448	T	0.25680	0.0625	L	0.45137	1.4	0.80722	D	1	B;B	0.33266	0.134;0.404	B;B	0.36335	0.07;0.222	T	0.03000	-1.1084	10	0.15952	T	0.53	-6.2877	12.1512	0.54051	0.0:0.0:0.8277:0.1723	.	380;380	Q8TF46;Q8TF46-3	DI3L1_HUMAN;.	T	297;380	ENSP00000321583:S297T;ENSP00000321711:S380T	ENSP00000321583:S297T	S	+	2	0	DIS3L	64397985	1.000000	0.71417	0.721000	0.30653	0.926000	0.56050	9.190000	0.94934	0.951000	0.37770	0.591000	0.81541	AGC	-	NULL		0.443	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIS3L	protein_coding	OTTHUMT00000382792.2	G	NM_133375		64397985	+1	no_errors	NM_133375	genbank	human	validated	54_36p	missense	SNP	1.000	C
HYDIN	54768	genome.wustl.edu	37	16	70913548	70913548	+	Missense_Mutation	SNP	A	A	C			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr16:70913548A>C	ENST00000393567.2	-	61	10477	c.10327T>G	c.(10327-10329)Tac>Gac	p.Y3443D		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3443					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ATGCACTGGTAGTTCTGCATG	0.552																																																0			16											28.0	35.0	33.0					16																	70913548		1926	4141	6067	69471049	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.10327T>G	16.37:g.70913548A>C	ENSP00000377197:p.Tyr3443Asp	Somatic		Capture	Illumina GAIIx	4	69471049	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.Y3442D	ENST00000393567.2	37	c.10324	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	A	23.2	4.390182	0.82902	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01359	4.98	5.19	5.19	0.71726	.	0.000000	0.30742	U	0.008968	T	0.08846	0.0219	M	0.81341	2.54	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.00904	-1.1520	10	0.66056	D	0.02	.	14.7274	0.69354	1.0:0.0:0.0:0.0	.	3442	F8WD23	.	D	3443;3442	ENSP00000377197:Y3443D	ENSP00000313052:Y3442D	Y	-	1	0	HYDIN	69471049	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	8.518000	0.90559	1.955000	0.56771	0.418000	0.28097	TAC	-	NULL		0.552	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	protein_coding	OTTHUMT00000398624.3	A			69471049	-1	no_errors	NM_032821	genbank	human	validated	54_36p	missense	SNP	1.000	C
PBLD	64081	genome.wustl.edu	37	10	70048420	70048420	+	Splice_Site	SNP	T	T	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr10:70048420T>G	ENST00000358769.2	-	8	715		c.e8-2		PBLD_ENST00000309049.4_Splice_Site|PBLD_ENST00000432941.1_Splice_Site|PBLD_ENST00000336578.1_Splice_Site|PBLD_ENST00000495025.2_Splice_Site	NM_022129.3	NP_071412.2	P30039	PBLD_HUMAN	phenazine biosynthesis-like protein domain containing						biosynthetic process (GO:0009058)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein import into nucleus (GO:0060392)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	isomerase activity (GO:0016853)			endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21						AGAAACGACCTTGTTCATAAA	0.473																																																0			10											80.0	73.0	76.0					10																	70048420		2203	4300	6503	69718426	SO:0001630	splice_region_variant	64081			AK027673	CCDS7277.2, CCDS44413.1	10q21.3	2006-11-27			ENSG00000108187	ENSG00000108187			23301	protein-coding gene	gene with protein product	MAWD binding protein	612189				11355021	Standard	XM_005270028		Approved	MAWBP, MAWDBP, FLJ14767	uc001jns.1	P30039	OTTHUMG00000073949	ENST00000358769.2:c.513-2A>C	10.37:g.70048420T>G		Somatic		Capture	Illumina GAIIx	4	69718426	A8MZJ3|C9JIM0|Q9HCC2	Splice_Site	SNP	-	e7-2	ENST00000358769.2	37	c.513-2	CCDS7277.2	10	.	.	.	.	.	.	.	.	.	.	T	13.52	2.262355	0.39995	.	.	ENSG00000108187	ENST00000336578;ENST00000358769;ENST00000309049;ENST00000432941	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0671	0.59041	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PBLD	69718426	1.000000	0.71417	0.916000	0.36221	0.444000	0.32077	5.553000	0.67287	1.978000	0.57642	0.460000	0.39030	.	-	-		0.473	PBLD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PBLD	protein_coding	OTTHUMT00000048314.1	T	NM_022129	Intron	69718426	-1	no_errors	NM_022129	genbank	human	validated	54_36p	splice_site	SNP	0.960	G
GTF2IRD2B	389524	genome.wustl.edu	37	7	74564880	74564880	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr7:74564880C>T	ENST00000312575.7	+	16	2802	c.2627C>T	c.(2626-2628)aCg>aTg	p.T876M	GTF2IRD2B_ENST00000418185.2_Missense_Mutation_p.T423M	NM_001003795.2	NP_001003795.1	Q6EKJ0	GTD2B_HUMAN	GTF2I repeat domain containing 2B	876					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|ovary(2)|prostate(1)	4						caatgcaacacggtcctgaag	0.498																																																0			7											1.0	1.0	1.0					7																	74564880		716	1531	2247	74202816	SO:0001583	missense	389524			AY312850	CCDS34659.1	7q11.23	2014-05-06			ENSG00000174428	ENSG00000174428			33125	protein-coding gene	gene with protein product		608900				15100712	Standard	XM_005277580		Approved		uc003ubt.3	Q6EKJ0	OTTHUMG00000181534	ENST00000312575.7:c.2627C>T	7.37:g.74564880C>T	ENSP00000308080:p.Thr876Met	Somatic		Capture	Illumina GAIIx	4	74202816	B2RNE9|Q69GU6|Q8N979|Q9H739	Missense_Mutation	SNP	HMMPfam_GTF2I	p.T876M	ENST00000312575.7	37	c.2627	CCDS34659.1	7	.	.	.	.	.	.	.	.	.	.	C	7.911	0.736409	0.15574	.	.	ENSG00000174428	ENST00000312575;ENST00000418185;ENST00000412484	T;T	0.21031	2.03;2.03	1.66	0.688	0.18027	Ribonuclease H-like (1);	.	.	.	.	T	0.18130	0.0435	L	0.58101	1.795	0.30318	N	0.787839	B;B	0.24258	0.005;0.1	B;B	0.11329	0.006;0.005	T	0.16424	-1.0403	9	0.59425	D	0.04	-20.6594	5.0198	0.14356	0.352:0.648:0.0:0.0	.	371;876	Q86Y00;Q6EKJ0	.;GTD2B_HUMAN	M	876;423;291	ENSP00000308080:T876M;ENSP00000411454:T423M	ENSP00000308080:T876M	T	+	2	0	GTF2IRD2B	74202816	0.499000	0.26083	0.969000	0.41365	0.864000	0.49448	0.194000	0.17135	0.234000	0.21139	0.537000	0.68136	ACG	-	NULL		0.498	GTF2IRD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2IRD2B	protein_coding	OTTHUMT00000342728.1	C	NM_001003795		74202816	+1	no_errors	NM_001003795	genbank	human	reviewed	54_36p	missense	SNP	0.929	T
KAT6B	23522	genome.wustl.edu	37	10	76748864	76748864	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr10:76748864G>A	ENST00000287239.4	+	13	3112	c.2623G>A	c.(2623-2625)Gat>Aat	p.D875N	KAT6B_ENST00000372724.1_Missense_Mutation_p.D583N|KAT6B_ENST00000372714.1_Missense_Mutation_p.D583N|KAT6B_ENST00000372711.1_Missense_Mutation_p.D692N|KAT6B_ENST00000372725.1_Missense_Mutation_p.D583N|KAT6B_ENST00000490365.1_3'UTR	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	875	Catalytic.|Interaction with BRPF1.|MYST-type HAT.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GTTTCTCATTGATTTCAGTAA	0.398																																																0			10											117.0	117.0	117.0					10																	76748864		2203	4300	6503	76418870	SO:0001583	missense	23522			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.2623G>A	10.37:g.76748864G>A	ENSP00000287239:p.Asp875Asn	Somatic		Capture	Illumina GAIIx	4	76418870	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	"HMMSmart_SM00526,superfamily_""Winged helix"" DNA-binding domain,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,superfamily_Acyl-CoA N-acyltransferases (Nat),HMMPfam_MOZ_SAS"	p.D875N	ENST00000287239.4	37	c.2623	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	G	21.0	4.077939	0.76528	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	T;T;T;T;T	0.79352	-1.24;-1.24;-1.26;-1.24;-1.25	5.85	5.85	0.93711	.	0.000000	0.51477	D	0.000085	D	0.89392	0.6702	M	0.81112	2.525	0.80722	D	1	D;D;D	0.89917	0.988;1.0;0.997	P;D;D	0.91635	0.847;0.999;0.938	D	0.89768	0.3952	10	0.87932	D	0	-14.6475	20.1354	0.98024	0.0:0.0:1.0:0.0	.	692;583;875	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	N	583;583;875;583;692	ENSP00000361810:D583N;ENSP00000361809:D583N;ENSP00000287239:D875N;ENSP00000361799:D583N;ENSP00000361796:D692N	ENSP00000287239:D875N	D	+	1	0	KAT6B	76418870	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.864000	0.99589	2.756000	0.94617	0.650000	0.86243	GAT	-	superfamily_Acyl-CoA N-acyltransferases (Nat),HMMPfam_MOZ_SAS		0.398	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYST4	protein_coding	OTTHUMT00000048771.1	G	NM_012330		76418870	+1	no_errors	NM_012330	genbank	human	validated	54_36p	missense	SNP	1.000	A
CHRNA3	1136	genome.wustl.edu	37	15	78893961	78893961	+	Missense_Mutation	SNP	C	C	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr15:78893961C>A	ENST00000326828.5	-	5	1407	c.1023G>T	c.(1021-1023)tgG>tgT	p.W341C	CHRNA3_ENST00000348639.3_Missense_Mutation_p.W341C	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	341					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	CAGTCTTCACCCATGAGGGCA	0.537																																																0			15											145.0	134.0	138.0					15																	78893961		2196	4293	6489	76681016	SO:0001583	missense	1136				CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.1023G>T	15.37:g.78893961C>A	ENSP00000315602:p.Trp341Cys	Somatic		Capture	Illumina GAIIx	4	76681016	Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Missense_Mutation	SNP	superfamily_Nicotinic receptor ligand binding domain-like,HMMPfam_Neur_chan_LBD,PatternScan_NEUROTR_ION_CHANNEL,superfamily_Neurotransmitter-gated ion-channel transmembrane pore,HMMPfam_Neur_chan_memb	p.W341C	ENST00000326828.5	37	c.1023	CCDS10305.1	15	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101152	0.56183	.	.	ENSG00000080644	ENST00000348639;ENST00000326828;ENST00000326858	T;T	0.74632	-0.86;-0.86	6.02	6.02	0.97574	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.90256	0.6953	M	0.92459	3.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91125	0.4933	10	0.66056	D	0.02	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	341;341	P32297;P32297-3	ACHA3_HUMAN;.	C	341;341;205	ENSP00000267951:W341C;ENSP00000315602:W341C	ENSP00000315602:W341C	W	-	3	0	CHRNA3	76681016	1.000000	0.71417	1.000000	0.80357	0.195000	0.23768	7.795000	0.85887	2.865000	0.98341	0.655000	0.94253	TGG	-	superfamily_Neurotransmitter-gated ion-channel transmembrane pore,HMMPfam_Neur_chan_memb		0.537	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA3	protein_coding	OTTHUMT00000290111.3	C			76681016	-1	no_errors	NM_000743	genbank	human	validated	54_36p	missense	SNP	1.000	A
RSBN1L	222194	genome.wustl.edu	37	7	77408240	77408240	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr7:77408240C>G	ENST00000334955.8	+	8	2323	c.2296C>G	c.(2296-2298)Cct>Gct	p.P766A	RSBN1L_ENST00000445288.1_Missense_Mutation_p.P496A	NM_198467.2	NP_940869.2	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	766						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(12)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CAAGGAAGAACCTGTGAATGT	0.318																																																0			7											69.0	65.0	66.0					7																	77408240		1835	4089	5924	77246176	SO:0001583	missense	222194			AK124517	CCDS43607.1	7q21.11	2004-08-11			ENSG00000187257	ENSG00000187257			24765	protein-coding gene	gene with protein product						12477932	Standard	NM_198467		Approved	FLJ42526, FLJ45813, MGC71764	uc010ldt.1	Q6PCB5	OTTHUMG00000155517	ENST00000334955.8:c.2296C>G	7.37:g.77408240C>G	ENSP00000334040:p.Pro766Ala	Somatic		Capture	Illumina GAIIx	4	77246176	C9K0P1|Q6ZS58|Q6ZVI9|Q86X48	Missense_Mutation	SNP	NULL	p.P766A	ENST00000334955.8	37	c.2296	CCDS43607.1	7	.	.	.	.	.	.	.	.	.	.	C	10.82	1.458288	0.26248	.	.	ENSG00000187257	ENST00000334955;ENST00000445288	.	.	.	5.84	0.463	0.16700	.	0.481828	0.22343	N	0.061319	T	0.29684	0.0741	L	0.51422	1.61	0.27721	N	0.94514	B	0.10296	0.003	B	0.08055	0.003	T	0.17107	-1.0380	9	0.49607	T	0.09	-0.0753	3.1574	0.06509	0.2225:0.4471:0.2048:0.1256	.	766	Q6PCB5	RSBNL_HUMAN	A	766;496	.	ENSP00000334040:P766A	P	+	1	0	RSBN1L	77246176	0.022000	0.18835	0.947000	0.38551	0.996000	0.88848	-0.206000	0.09398	0.348000	0.23949	0.591000	0.81541	CCT	-	NULL		0.318	RSBN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSBN1L	protein_coding	OTTHUMT00000340455.3	C	NM_198467		77246176	+1	no_errors	NM_198467	genbank	human	validated	54_36p	missense	SNP	0.969	G
ZFHX4	79776	genome.wustl.edu	37	8	77617160	77617160	+	Missense_Mutation	SNP	G	G	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr8:77617160G>T	ENST00000521891.2	+	2	1285	c.837G>T	c.(835-837)atG>atT	p.M279I	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.M279I|ZFHX4_ENST00000050961.6_Missense_Mutation_p.M279I|ZFHX4_ENST00000455469.2_Missense_Mutation_p.M279I	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	279					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTGTTTTAATGTGTTTCTTGT	0.438										HNSCC(33;0.089)																																						0			8											275.0	263.0	267.0					8																	77617160		2063	4240	6303	77779715	SO:0001583	missense	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.837G>T	8.37:g.77617160G>T	ENSP00000430497:p.Met279Ile	Somatic		Capture	Illumina GAIIx	4	77779715	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	HMMSmart_SM00355,PatternScan_SOMATOTROPIN_2,superfamily_C2H2 and C2HC zinc fingers,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2,HMMSmart_SM00451,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.M279I	ENST00000521891.2	37	c.837	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	10.71	1.426944	0.25726	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.73047	-0.71;-0.65;-0.68;-0.71	5.53	5.53	0.82687	Zinc finger, C2H2-like (1);	0.000000	0.53938	U	0.000049	D	0.85256	0.5655	M	0.80422	2.495	0.80722	D	1	P;D;D;D	0.58268	0.936;0.962;0.962;0.982	P;D;D;D	0.68943	0.885;0.946;0.946;0.961	D	0.86039	0.1518	10	0.72032	D	0.01	.	19.6556	0.95837	0.0:0.0:1.0:0.0	.	279;279;279;279	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	I	279	ENSP00000430497:M279I;ENSP00000399605:M279I;ENSP00000050961:M279I;ENSP00000430848:M279I	ENSP00000050961:M279I	M	+	3	0	ZFHX4	77779715	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.263000	0.95617	2.882000	0.98803	0.655000	0.94253	ATG	-	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355		0.438	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	protein_coding	OTTHUMT00000379197.2	G	NM_024721		77779715	+1	no_errors	NM_024721	genbank	human	validated	54_36p	missense	SNP	1.000	T
ARNT2	9915	genome.wustl.edu	37	15	80800525	80800525	+	Silent	SNP	G	G	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr15:80800525G>A	ENST00000303329.4	+	6	816	c.651G>A	c.(649-651)acG>acA	p.T217T	ARNT2_ENST00000533983.1_Silent_p.T206T|ARNT2_ENST00000527771.1_Silent_p.T206T	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	217					central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			AGACTGGGACGGTCAAGAAAG	0.572																																																0			15											123.0	100.0	108.0					15																	80800525		2203	4300	6503	78587580	SO:0001819	synonymous_variant	9915			AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.651G>A	15.37:g.80800525G>A		Somatic		Capture	Illumina GAIIx	4	78587580	B4DIS7|O15024|Q8IYC2	Silent	SNP	superfamily_HLH helix-loop-helix DNA-binding domain,HMMPfam_HLH,HMMSmart_SM00353,HMMSmart_SM00091,HMMPfam_PAS,superfamily_PYP-like sensor domain (PAS domain),HMMPfam_PAS_3,HMMSmart_SM00086	p.T217	ENST00000303329.4	37	c.651	CCDS32307.1	15																																																																																			-	HMMPfam_PAS		0.572	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARNT2	protein_coding	OTTHUMT00000384389.2	G			78587580	+1	no_errors	NM_014862	genbank	human	reviewed	54_36p	silent	SNP	0.996	A
FRAS1	80144	genome.wustl.edu	37	4	79399115	79399115	+	Silent	SNP	T	T	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr4:79399115T>A	ENST00000264895.6	+	55	8438	c.7998T>A	c.(7996-7998)atT>atA	p.I2666I		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2662	Calx-beta 2.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CGAAGGTCATTATCAACGATA	0.448																																																0			4											88.0	86.0	87.0					4																	79399115		1936	4152	6088	79618139	SO:0001819	synonymous_variant	80144			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.7998T>A	4.37:g.79399115T>A		Somatic		Capture	Illumina GAIIx	4	79618139	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Nonsense_Mutation	SNP	HMMSmart_SM00214,HMMSmart_SM00215,PatternScan_VWFC_1,HMMPfam_VWC,superfamily_Growth factor receptor domain,HMMSmart_SM00261,HMMSmart_SM00181	p.L2665*	ENST00000264895.6	37	c.7994	CCDS54771.1	4	.	.	.	.	.	.	.	.	.	.	T	0.400	-0.918749	0.02396	.	.	ENSG00000138759	ENST00000512123	.	.	.	5.69	-2.99	0.05497	.	.	.	.	.	T	0.40040	0.1101	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33059	-0.9883	4	.	.	.	.	2.8504	0.05555	0.1208:0.3863:0.1236:0.3692	.	.	.	.	N	895	.	.	Y	+	1	0	FRAS1	79618139	0.998000	0.40836	0.980000	0.43619	0.002000	0.02628	0.470000	0.22084	-0.370000	0.08016	-1.100000	0.02121	TAT	-	NULL		0.448	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAS1	protein_coding		T			79618139	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_025074	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	6	80773976	80773976	+	IGR	SNP	C	C	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr6:80773976C>A								TTK (21732 upstream) : BCKDHB (42387 downstream)																							AGTTTTTTTACTTGCTAGAGT	0.398																																																0			6																																								80830695	SO:0001628	intergenic_variant	643562																															6.37:g.80773976C>A		Somatic		Capture	Illumina GAIIx	4	80830695		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.398					LOC643562			C			80830695	-1	pseudogene	XR_016539	genbank	human	model	54_36p	rna	SNP	0.923	A
CRISPLD2	83716	genome.wustl.edu	37	16	84914162	84914162	+	Missense_Mutation	SNP	C	C	T	rs369151118		TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr16:84914162C>T	ENST00000262424.5	+	13	1501	c.1277C>T	c.(1276-1278)cCg>cTg	p.P426L	CRISPLD2_ENST00000567845.1_Missense_Mutation_p.P425L|CRISPLD2_ENST00000564567.1_Missense_Mutation_p.P426L	NM_031476.3	NP_113664.1	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain containing 2	426	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|lung development (GO:0030324)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|transport vesicle (GO:0030133)	heparin binding (GO:0008201)			endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)	18						TACTGGGCTCCGGTGTTTGGA	0.448													C|||	1	0.000199681	0.0	0.0	5008	,	,		16015	0.0		0.0	False		,,,				2504	0.001															0			16						C	LEU/PRO	1,4397	2.1+/-5.4	0,1,2198	160.0	150.0	154.0		1277	4.3	0.5	16		154	0,8600		0,0,4300	no	missense	CRISPLD2	NM_031476.3	98	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	426/498	84914162	1,12997	2199	4300	6499	83471663	SO:0001583	missense	83716			AL136861	CCDS10949.1	16q24.1	2008-02-05	2005-02-16	2005-02-16	ENSG00000103196	ENSG00000103196			25248	protein-coding gene	gene with protein product		612434	"""LCCL domain containing cysteine-rich secretory protein 2"""	LCRISP2		11230166	Standard	NM_031476		Approved	DKFZP434B044	uc010voh.1	Q9H0B8	OTTHUMG00000137644	ENST00000262424.5:c.1277C>T	16.37:g.84914162C>T	ENSP00000262424:p.Pro426Leu	Somatic		Capture	Illumina GAIIx	4	83471663	D3DUM0|Q6P590|Q6UWH0|Q6UXC6|Q96IB1|Q96K61	Missense_Mutation	SNP	superfamily_PR-1-like,HMMSmart_SM00198,HMMPfam_SCP,PatternScan_CRISP_2,superfamily_LCCL domain,HMMSmart_SM00603,HMMPfam_LCCL	p.P426L	ENST00000262424.5	37	c.1277	CCDS10949.1	16	.	.	.	.	.	.	.	.	.	.	C	17.75	3.465233	0.63513	2.27E-4	0.0	ENSG00000103196	ENST00000262424	D	0.89050	-2.46	5.25	4.28	0.50868	LCCL (5);	0.000000	0.85682	D	0.000000	D	0.87330	0.6150	N	0.21508	0.67	0.80722	D	1	D;D	0.63046	0.985;0.992	P;P	0.55345	0.774;0.747	D	0.87657	0.2532	10	0.51188	T	0.08	.	13.5714	0.61849	0.0:0.8427:0.1573:0.0	.	426;426	Q9H0B8;Q9H0B8-2	CRLD2_HUMAN;.	L	426	ENSP00000262424:P426L	ENSP00000262424:P426L	P	+	2	0	CRISPLD2	83471663	1.000000	0.71417	0.543000	0.28128	0.548000	0.35241	6.815000	0.75242	1.175000	0.42826	0.655000	0.94253	CCG	-	superfamily_LCCL domain,HMMSmart_SM00603,HMMPfam_LCCL		0.448	CRISPLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD2	protein_coding	OTTHUMT00000269086.2	C	NM_031476		83471663	+1	no_errors	NM_031476	genbank	human	validated	54_36p	missense	SNP	0.989	T
LOC101928978	101928978	genome.wustl.edu	37	4	85166558	85166558	+	IGR	SNP	T	T	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr4:85166558T>A								RNU6-774P (11642 upstream) : RP11-42A4.1 (125987 downstream)																							ACCACTGAACTTTGGGCCTCT	0.607																																																0			4																																								85385582	SO:0001628	intergenic_variant	152845																															4.37:g.85166558T>A		Somatic		Capture	Illumina GAIIx	4	85385582		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.607					LOC152845			T			85385582	+1	pseudogene	XR_038721	genbank	human	model	54_36p	rna	SNP	0.958	A
IGKV3-7	28915	genome.wustl.edu	37	2	89278269	89278269	+	RNA	SNP	A	A	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr2:89278269A>T	ENST00000390247.2	-	0	162									immunoglobulin kappa variable 3-7 (non-functional)																		GTGTCATTACAATTTCTCTGG	0.448																																																0			2											107.0	104.0	105.0					2																	89278269		1885	4122	6007	89059384			0			X02725		2p11.2	2012-02-08	2008-09-10		ENSG00000243063	ENSG00000243063		"""Immunoglobulins / IGK locus"""	5821	other	immunoglobulin gene			"""immunoglobulin kappa variable 3-7"""				Standard	NG_000834		Approved				OTTHUMG00000151636		2.37:g.89278269A>T		Somatic		Capture	Illumina GAIIx	4	89059384		Silent	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406	p.I22	ENST00000390247.2	37	c.66		2																																																																																			-	HMMPfam_V-set,superfamily_Immunoglobulin		0.448	IGKV3-7-001	KNOWN	non_canonical_polymorphism|mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211602	IG_V_gene	OTTHUMT00000323360.1	A	NG_000834		89059384	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390247	ensembl	human	known	54_36p	silent	SNP	0.001	T
IGKV2D-29	28882	genome.wustl.edu	37	2	89986850	89986850	+	RNA	SNP	A	A	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr2:89986850A>G	ENST00000491977.1	+	0	161									immunoglobulin kappa variable 2D-29																		ATCTCCTGCAAGTCTAGTCAG	0.512																																																0			2											27.0	31.0	30.0					2																	89986850		1801	4057	5858	89624155			0			M31952		2p11.2	2012-02-08			ENSG00000243264	ENSG00000243264		"""Immunoglobulins / IGK locus"""	5800	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151619		2.37:g.89986850A>G		Somatic		Capture	Illumina GAIIx	4	89624155		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406	p.K44R	ENST00000491977.1	37	c.131		2																																																																																			-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406		0.512	IGKV2D-29-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211622	IG_V_gene	OTTHUMT00000323291.1	A	NG_000833		89624155	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390267	ensembl	human	known	54_36p	missense	SNP	0.923	G
IGKV2D-26	28884	genome.wustl.edu	37	2	90025254	90025254	+	RNA	SNP	C	C	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr2:90025254C>A	ENST00000390268.2	+	0	132									immunoglobulin kappa variable 2D-26																		TGTCTATCACCCCTGGAGAGC	0.468																																																0			2																																								89662555			0			X12689		2p11.2	2012-02-08			ENSG00000211623	ENSG00000211623		"""Immunoglobulins / IGK locus"""	5798	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151606		2.37:g.90025254C>A		Somatic		Capture	Illumina GAIIx	4	89662555		Silent	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv	p.T34	ENST00000390268.2	37	c.102		2																																																																																			-	HMMPfam_V-set,superfamily_SSF48726		0.468	IGKV2D-26-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211623	IG_V_gene	OTTHUMT00000323278.2	C	NG_000833		89662555	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390268	ensembl	human	known	54_36p	silent	SNP	0.011	A
CATSPERB	79820	genome.wustl.edu	37	14	92191511	92191511	+	Splice_Site	SNP	A	A	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr14:92191511A>T	ENST00000256343.3	-	3	237	c.81T>A	c.(79-81)gaT>gaA	p.D27E		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	27					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TCTCTGTATCATCTAAATAAT	0.289																																																0			14											36.0	35.0	35.0					14																	92191511		2201	4296	6497	91261264	SO:0001630	splice_region_variant	79820			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.80-1T>A	14.37:g.92191511A>T		Somatic		Capture	Illumina GAIIx	4	91261264	A0AV51	Missense_Mutation	SNP	NULL	p.D27E	ENST00000256343.3	37	c.81	CCDS32142.1	14	.	.	.	.	.	.	.	.	.	.	A	9.766	1.171491	0.21704	.	.	ENSG00000133962	ENST00000256343;ENST00000553329;ENST00000554560;ENST00000556661;ENST00000553676	T	0.41758	0.99	4.38	4.38	0.52667	.	0.532997	0.15510	N	0.258570	T	0.21186	0.0510	N	0.08118	0	0.19300	N	0.999976	B	0.18310	0.027	B	0.17098	0.017	T	0.14671	-1.0464	10	0.12103	T	0.63	.	10.1535	0.42809	1.0:0.0:0.0:0.0	.	27	Q9H7T0	CTSRB_HUMAN	E	27	ENSP00000256343:D27E	ENSP00000256343:D27E	D	-	3	2	CATSPERB	91261264	0.038000	0.19896	0.522000	0.27862	0.076000	0.17211	2.248000	0.43160	1.965000	0.57142	0.477000	0.44152	GAT	-	NULL		0.289	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPERB	protein_coding	OTTHUMT00000411769.1	A	NM_024764	Missense_Mutation	91261264	-1	no_errors	NM_024764	genbank	human	validated	54_36p	missense	SNP	0.399	T
CHD2	1106	genome.wustl.edu	37	15	93510584	93510584	+	Missense_Mutation	SNP	A	A	C	rs111669316		TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr15:93510584A>C	ENST00000394196.4	+	17	3098	c.2030A>C	c.(2029-2031)gAc>gCc	p.D677A	CHD2_ENST00000557381.1_Missense_Mutation_p.D677A	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	677					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TTTGAAGAAGACCATGGGAAG	0.393																																																0			15											49.0	49.0	49.0					15																	93510584		2197	4298	6495	91311588	SO:0001583	missense	1106			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.2030A>C	15.37:g.93510584A>C	ENSP00000377747:p.Asp677Ala	Somatic		Capture	Illumina GAIIx	4	91311588	C6G482|Q96IP5	Missense_Mutation	SNP	HMMSmart_SM00298,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Chromo,PatternScan_CHROMO_1,superfamily_Chromo domain-like,HMMSmart_SM00487,HMMPfam_SNF2_N,HMMSmart_SM00490,HMMPfam_Helicase_C,superfamily_Homeodomain-like	p.D677A	ENST00000394196.4	37	c.2030	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	A	14.13	2.442961	0.43326	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.92446	-3.04;-3.04	5.83	5.83	0.93111	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.35466	U	0.003191	D	0.88444	0.6438	L	0.33137	0.985	0.80722	D	1	B;B	0.21071	0.051;0.022	B;B	0.23150	0.044;0.01	D	0.84723	0.0741	10	0.48119	T	0.1	-23.4	16.1946	0.82018	1.0:0.0:0.0:0.0	.	677;677	O14647;O14647-2	CHD2_HUMAN;.	A	677	ENSP00000377747:D677A;ENSP00000451366:D677A	ENSP00000377747:D677A	D	+	2	0	CHD2	91311588	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.065000	0.71176	2.228000	0.72767	0.528000	0.53228	GAC	-	HMMSmart_SM00487,HMMPfam_SNF2_N		0.393	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	protein_coding	OTTHUMT00000313528.3	A	NM_001271		91311588	+1	no_errors	NM_001271	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
NUTM2F	54754	genome.wustl.edu	37	9	97081161	97081161	+	Silent	SNP	A	A	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr9:97081161A>T	ENST00000253262.4	-	7	1877	c.1857T>A	c.(1855-1857)ccT>ccA	p.P619P	NUTM2F_ENST00000335456.7_Intron|NUTM2F_ENST00000341207.4_Silent_p.P604P	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	619																	ACTCCTTGACAGGAGACTCTC	0.642																																																0			9											7.0	6.0	6.0					9																	97081161		1725	3840	5565	96120982	SO:0001819	synonymous_variant	54754				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.1857T>A	9.37:g.97081161A>T		Somatic		Capture	Illumina GAIIx	4	96120982	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Silent	SNP	NULL	p.P619	ENST00000253262.4	37	c.1857	CCDS47994.1	9																																																																																			-	NULL		0.642	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM22F	protein_coding	OTTHUMT00000053173.2	A	NM_017561		96120982	-1	no_errors	NM_017561	genbank	human	validated	54_36p	silent	SNP	0.001	T
GRIN3A	116443	genome.wustl.edu	37	9	104433307	104433307	+	Missense_Mutation	SNP	A	A	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr9:104433307A>T	ENST00000361820.3	-	3	1987	c.1387T>A	c.(1387-1389)Ttt>Att	p.F463I		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	463					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	CAGATGAAAAAGTTGTTTTCT	0.483																																																0			9											149.0	152.0	151.0					9																	104433307		2203	4300	6503	103473128	SO:0001583	missense	116443				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1387T>A	9.37:g.104433307A>T	ENSP00000355155:p.Phe463Ile	Somatic		Capture	Illumina GAIIx	4	103473128	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	superfamily_SSF53822,superfamily_SSF53850,HMMPfam_Lig_chan-Glu_bd,HMMSmart_PBPe,HMMPfam_Lig_chan	p.F463I	ENST00000361820.3	37	c.1387	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	A	13.73	2.325567	0.41197	.	.	ENSG00000198785	ENST00000361820	D	0.86627	-2.15	5.76	5.76	0.90799	.	0.318671	0.30809	N	0.008822	D	0.89157	0.6635	M	0.71036	2.16	0.41882	D	0.990323	P	0.38420	0.63	B	0.43867	0.434	D	0.89788	0.3966	10	0.56958	D	0.05	.	16.3634	0.83296	1.0:0.0:0.0:0.0	.	463	Q8TCU5	NMD3A_HUMAN	I	463	ENSP00000355155:F463I	ENSP00000355155:F463I	F	-	1	0	GRIN3A	103473128	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.275000	0.72594	2.324000	0.78689	0.533000	0.62120	TTT	-	superfamily_SSF53822		0.483	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	protein_coding	OTTHUMT00000053453.1	A			103473128	-1	no_errors	NM_133445	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
COL4A1	1282	genome.wustl.edu	37	13	110827047	110827047	+	Missense_Mutation	SNP	T	T	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr13:110827047T>A	ENST00000375820.4	-	38	3369	c.3248A>T	c.(3247-3249)gAa>gTa	p.E1083V		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1083	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GCTTCCTTTTTCTCCCTTCTC	0.532																																																0			13											127.0	138.0	134.0					13																	110827047		2203	4300	6503	109625048	SO:0001583	missense	1282			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.3248A>T	13.37:g.110827047T>A	ENSP00000364979:p.Glu1083Val	Somatic		Capture	Illumina GAIIx	4	109625048	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	HMMPfam_Collagen,superfamily_C-type lectin-like,HMMPfam_C4,HMMSmart_SM00111	p.E1083V	ENST00000375820.4	37	c.3248	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	T	14.66	2.602868	0.46423	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	D	0.96745	-4.11	5.8	5.8	0.92144	.	0.318283	0.33023	N	0.005376	D	0.96423	0.8833	L	0.48877	1.53	0.80722	D	1	P	0.37370	0.592	P	0.51516	0.672	D	0.95641	0.8698	10	0.34782	T	0.22	.	16.1549	0.81657	0.0:0.0:0.0:1.0	.	1083	P02462	CO4A1_HUMAN	V	726;1083;732	ENSP00000364979:E1083V	ENSP00000364973:E726V	E	-	2	0	COL4A1	109625048	0.882000	0.30256	0.995000	0.50966	0.878000	0.50629	2.167000	0.42415	2.209000	0.71365	0.533000	0.62120	GAA	-	HMMPfam_Collagen		0.532	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	protein_coding	OTTHUMT00000045759.3	T			109625048	-1	no_errors	NM_001845	genbank	human	reviewed	54_36p	missense	SNP	0.943	A
WNT2B	7482	genome.wustl.edu	37	1	113059938	113059938	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr1:113059938C>T	ENST00000369684.4	+	4	1362	c.877C>T	c.(877-879)Cgt>Tgt	p.R293C	RP4-671G15.2_ENST00000608357.1_RNA|WNT2B_ENST00000369686.5_Missense_Mutation_p.R274C|WNT2B_ENST00000256640.5_Missense_Mutation_p.R201C	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	293					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGCTATCGCCGTGCCACCCG	0.582																																																0			1											55.0	52.0	53.0					1																	113059938		2203	4300	6503	112861461	SO:0001583	missense	7482			AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.877C>T	1.37:g.113059938C>T	ENSP00000358698:p.Arg293Cys	Somatic		Capture	Illumina GAIIx	4	112861461	O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Missense_Mutation	SNP	HMMPfam_wnt,HMMSmart_SM00097,PatternScan_WNT1	p.R293C	ENST00000369684.4	37	c.877	CCDS847.1	1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066969	0.76301	.	.	ENSG00000134245	ENST00000256640;ENST00000369686;ENST00000369684	T;T;T	0.76448	-1.02;-1.02;-1.02	5.53	4.56	0.56223	.	0.604077	0.18354	N	0.143788	T	0.82061	0.4955	M	0.88450	2.955	0.26713	N	0.970924	D;D	0.76494	0.994;0.999	P;P	0.58520	0.766;0.84	T	0.76146	-0.3066	10	0.72032	D	0.01	.	8.4006	0.32583	0.2931:0.5784:0.1285:0.0	.	293;274	Q93097;Q93097-2	WNT2B_HUMAN;.	C	201;274;293	ENSP00000256640:R201C;ENSP00000358700:R274C;ENSP00000358698:R293C	ENSP00000256640:R201C	R	+	1	0	WNT2B	112861461	0.902000	0.30710	1.000000	0.80357	0.994000	0.84299	1.967000	0.40491	2.599000	0.87857	0.555000	0.69702	CGT	-	HMMPfam_wnt,HMMSmart_SM00097		0.582	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT2B	protein_coding	OTTHUMT00000030692.1	C	NM_004185		112861461	+1	no_errors	NM_024494	genbank	human	reviewed	54_36p	missense	SNP	0.678	T
NHLRC2	374354	genome.wustl.edu	37	10	115657951	115657951	+	Silent	SNP	C	C	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr10:115657951C>G	ENST00000369301.3	+	6	1334	c.1122C>G	c.(1120-1122)ggC>ggG	p.G374G		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	374										breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		TGGACTCTGGCAAACTGCCAA	0.403																																																0			10											37.0	38.0	38.0					10																	115657951		2203	4300	6503	115647941	SO:0001819	synonymous_variant	374354			AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.1122C>G	10.37:g.115657951C>G		Somatic		Capture	Illumina GAIIx	4	115647941	Q8N1H1|Q8N5A6	Silent	SNP	superfamily_Thioredoxin-like,superfamily_NHL repeat,HMMPfam_NHL	p.G374	ENST00000369301.3	37	c.1122	CCDS7585.1	10																																																																																			-	superfamily_NHL repeat		0.403	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC2	protein_coding	OTTHUMT00000050446.1	C	NM_198514		115647941	+1	no_errors	NM_198514	genbank	human	provisional	54_36p	silent	SNP	0.998	G
RAD21	5885	genome.wustl.edu	37	8	117878869	117878869	+	Missense_Mutation	SNP	C	C	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr8:117878869C>G	ENST00000297338.2	-	2	387	c.100G>C	c.(100-102)Gag>Cag	p.E34Q	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	34					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					AAATTACACTCGAACACATGG	0.398																																																0			8											86.0	76.0	80.0					8																	117878869		2203	4300	6503	117948050	SO:0001583	missense	5885			BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.100G>C	8.37:g.117878869C>G	ENSP00000297338:p.Glu34Gln	Somatic		Capture	Illumina GAIIx	4	117948050	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	HMMPfam_Rad21_Rec8_N,HMMPfam_Rad21_Rec8	p.E34Q	ENST00000297338.2	37	c.100	CCDS6321.1	8	.	.	.	.	.	.	.	.	.	.	C	13.79	2.341452	0.41498	.	.	ENSG00000164754	ENST00000297338;ENST00000520992;ENST00000517485;ENST00000519837;ENST00000522699	T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48	5.83	4.94	0.65067	Rad21/Rec8-like protein, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.44808	0.1311	L	0.49778	1.585	0.80722	D	1	D	0.54397	0.966	D	0.63283	0.913	T	0.29027	-1.0025	10	0.09338	T	0.73	-4.5353	16.8122	0.85724	0.0:0.8711:0.1289:0.0	.	34	O60216	RAD21_HUMAN	Q	34	ENSP00000297338:E34Q;ENSP00000429342:E34Q;ENSP00000427923:E34Q;ENSP00000430524:E34Q;ENSP00000428158:E34Q	ENSP00000297338:E34Q	E	-	1	0	RAD21	117948050	1.000000	0.71417	0.996000	0.52242	0.965000	0.64279	7.818000	0.86416	1.429000	0.47314	0.563000	0.77884	GAG	-	HMMPfam_Rad21_Rec8_N		0.398	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21	protein_coding	OTTHUMT00000381184.1	C	NM_006265		117948050	-1	no_errors	NM_006265	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SLC30A8	169026	genome.wustl.edu	37	8	118183397	118183397	+	Missense_Mutation	SNP	T	T	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr8:118183397T>G	ENST00000456015.2	+	7	954	c.954T>G	c.(952-954)caT>caG	p.H318Q	SLC30A8_ENST00000519688.1_Missense_Mutation_p.H269Q|SLC30A8_ENST00000427715.2_Missense_Mutation_p.H269Q|SLC30A8_ENST00000521243.1_Missense_Mutation_p.H269Q	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	318					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TCTCAGCTCATGTTGCTACAG	0.433																																					Ovarian(162;1202 1922 6011 16223 52092)											0			8											182.0	169.0	174.0					8																	118183397		2203	4300	6503	118252578	SO:0001583	missense	169026				CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.954T>G	8.37:g.118183397T>G	ENSP00000415011:p.His318Gln	Somatic		Capture	Illumina GAIIx	4	118252578	A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	HMMPfam_Cation_efflux	p.H318Q	ENST00000456015.2	37	c.954	CCDS6322.1	8	.	.	.	.	.	.	.	.	.	.	T	18.67	3.673902	0.67928	.	.	ENSG00000164756	ENST00000521243;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T	0.61392	0.11;0.11;0.11;0.11	4.97	-2.63	0.06133	.	0.103470	0.64402	D	0.000003	T	0.75398	0.3844	H	0.94886	3.595	0.54753	D	0.999987	D	0.89917	1.0	D	0.97110	1.0	T	0.72912	-0.4148	10	0.87932	D	0	-10.7098	5.2574	0.15553	0.0:0.3434:0.296:0.3606	.	318	Q8IWU4	ZNT8_HUMAN	Q	269;269;269;318	ENSP00000428545:H269Q;ENSP00000407505:H269Q;ENSP00000431069:H269Q;ENSP00000415011:H318Q	ENSP00000407505:H269Q	H	+	3	2	SLC30A8	118252578	0.290000	0.24343	0.981000	0.43875	0.988000	0.76386	-0.275000	0.08525	-0.240000	0.09696	-0.250000	0.11733	CAT	-	HMMPfam_Cation_efflux		0.433	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A8	protein_coding	OTTHUMT00000381205.1	T	NM_173851		118252578	+1	no_errors	NM_173851	genbank	human	validated	54_36p	missense	SNP	0.986	G
TECTA	7007	genome.wustl.edu	37	11	121000814	121000814	+	Missense_Mutation	SNP	G	G	T	rs371290564		TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr11:121000814G>T	ENST00000392793.1	+	10	3106	c.2835G>T	c.(2833-2835)caG>caT	p.Q945H	TECTA_ENST00000264037.2_Missense_Mutation_p.Q945H			O75443	TECTA_HUMAN	tectorin alpha	945					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GCCTGTGCCAGAGTGGGGGCA	0.612																																																0			11											63.0	61.0	62.0					11																	121000814		2203	4299	6502	120506024	SO:0001583	missense	7007			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2835G>T	11.37:g.121000814G>T	ENSP00000376543:p.Gln945His	Somatic		Capture	Illumina GAIIx	4	120506024		Missense_Mutation	SNP	HMMSmart_SM00539,HMMPfam_NIDO,HMMSmart_SM00215,HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,HMMPfam_TIL,HMMSmart_SM00181,PatternScan_EGF_2,PatternScan_FA58C_2,HMMPfam_Zona_pellucida,HMMSmart_SM00241,PatternScan_ZP_1,superfamily_EGF/Laminin	p.Q945H	ENST00000392793.1	37	c.2835	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	16.38	3.107190	0.56291	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.76839	-1.05;-1.05	5.78	4.86	0.63082	Uncharacterised domain, cysteine-rich (2);	0.133759	0.53938	D	0.000054	T	0.78610	0.4310	L	0.31207	0.915	0.32305	N	0.564471	D	0.67145	0.996	D	0.66847	0.947	T	0.80540	-0.1337	10	0.40728	T	0.16	.	9.4956	0.38986	0.2126:0.0:0.7874:0.0	.	945	O75443	TECTA_HUMAN	H	945	ENSP00000376543:Q945H;ENSP00000264037:Q945H	ENSP00000264037:Q945H	Q	+	3	2	TECTA	120506024	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.331000	0.33793	1.441000	0.47550	0.650000	0.86243	CAG	-	HMMPfam_C8		0.612	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	protein_coding	OTTHUMT00000313850.1	G	NM_005422		120506024	+1	no_errors	NM_005422	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
DCAF12L2	340578	genome.wustl.edu	37	X	125298739	125298739	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chrX:125298739C>T	ENST00000360028.2	-	1	1195	c.1169G>A	c.(1168-1170)aGc>aAc	p.S390N	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.S390N			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	390										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GGAGTCCAGGCTGGAAGAGGC	0.607																																																0			X											70.0	75.0	73.0					X																	125298739		2200	4299	6499	125126420	SO:0001583	missense	340578			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1169G>A	X.37:g.125298739C>T	ENSP00000353128:p.Ser390Asn	Somatic		Capture	Illumina GAIIx	4	125126420	B2RN42	Missense_Mutation	SNP	PatternScan_WD_REPEATS_1,superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40	p.S390N	ENST00000360028.2	37	c.1169	CCDS43991.1	X	.	.	.	.	.	.	.	.	.	.	C	0.081	-1.183308	0.01620	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.17691	2.26;2.26	4.14	1.23	0.21249	.	0.967720	0.08450	N	0.944006	T	0.09158	0.0226	N	0.16368	0.405	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42172	-0.9467	10	0.19590	T	0.45	.	4.6119	0.12406	0.187:0.6027:0.0:0.2103	.	390	Q5VW00	DC122_HUMAN	N	390	ENSP00000441489:S390N;ENSP00000353128:S390N	ENSP00000353128:S390N	S	-	2	0	DCAF12L2	125126420	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.652000	0.05366	0.111000	0.17947	0.600000	0.82982	AGC	-	NULL		0.607	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR40C	protein_coding	OTTHUMT00000058181.1	C	NM_001013628		125126420	-1	no_errors	NM_001013628	genbank	human	provisional	54_36p	missense	SNP	0.000	T
ARHGAP36	158763	genome.wustl.edu	37	X	130222644	130222644	+	Missense_Mutation	SNP	C	C	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chrX:130222644C>A	ENST00000276211.5	+	12	1874	c.1529C>A	c.(1528-1530)tCc>tAc	p.S510Y	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.S498Y|ARHGAP36_ENST00000370921.1_Missense_Mutation_p.S374Y	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	510					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						ACTGCCCGTTCCCATGACGAT	0.547																																																0			X											60.0	51.0	54.0					X																	130222644		2203	4300	6503	130050325	SO:0001583	missense	158763				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1529C>A	X.37:g.130222644C>A	ENSP00000276211:p.Ser510Tyr	Somatic		Capture	Illumina GAIIx	4	130050325	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.S510Y	ENST00000276211.5	37	c.1529	CCDS14628.1	X	.	.	.	.	.	.	.	.	.	.	C	10.12	1.261824	0.23051	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.15603	2.43;2.46;2.44;2.41	4.31	3.45	0.39498	.	0.147716	0.32106	N	0.006570	T	0.09335	0.0230	N	0.08118	0	0.29067	N	0.883525	P;P;P	0.50943	0.688;0.688;0.94	B;B;P	0.50440	0.332;0.332;0.641	T	0.09122	-1.0689	10	0.02654	T	1	.	7.039	0.25008	0.0:0.8771:0.0:0.1229	.	479;498;510	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	Y	510;498;479;374	ENSP00000276211:S510Y;ENSP00000359960:S498Y;ENSP00000408515:S479Y;ENSP00000359959:S374Y	ENSP00000276211:S510Y	S	+	2	0	ARHGAP36	130050325	1.000000	0.71417	1.000000	0.80357	0.210000	0.24377	1.021000	0.30040	1.165000	0.42670	0.600000	0.82982	TCC	-	NULL		0.547	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FLJ30058	protein_coding	OTTHUMT00000355073.1	C	NM_144967		130050325	+1	no_errors	NM_144967	genbank	human	validated	54_36p	missense	SNP	1.000	A
SLC45A4	57210	genome.wustl.edu	37	8	142222392	142222392	+	Silent	SNP	G	G	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr8:142222392G>A	ENST00000024061.3	-	7	2359	c.2052C>T	c.(2050-2052)gcC>gcT	p.A684A	SLC45A4_ENST00000517878.1_Silent_p.A735A|SLC45A4_ENST00000519067.1_Silent_p.A684A|SLC45A4_ENST00000433583.2_Silent_p.A677A	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			TGCCTTCGCCGGCCAACGGGG	0.632																																																0			8											39.0	38.0	38.0					8																	142222392		2201	4300	6501	142291574	SO:0001819	synonymous_variant	57210			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.2052C>T	8.37:g.142222392G>A		Somatic		Capture	Illumina GAIIx	4	142291574	Q6ZRI2|Q9ULU3	Silent	SNP	HMMPfam_MFS_1,superfamily_MFS general substrate transporter	p.A684	ENST00000024061.3	37	c.2052	CCDS34948.1	8																																																																																			-	NULL		0.632	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A4	protein_coding	OTTHUMT00000378571.3	G	XM_050325		142291574	-1	no_errors	NM_001080431	genbank	human	provisional	54_36p	silent	SNP	0.000	A
PRRG3	79057	genome.wustl.edu	37	X	150869496	150869496	+	Silent	SNP	T	T	G			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chrX:150869496T>G	ENST00000370353.3	+	4	1077	c.687T>G	c.(685-687)gcT>gcG	p.A229A	PRRG3_ENST00000538575.1_Silent_p.A229A			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	229						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					ACCCTGGCGCTGACAAGTAGT	0.537																																																0			X											86.0	76.0	79.0					X																	150869496		2202	4299	6501	150620152	SO:0001819	synonymous_variant	79057			AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.687T>G	X.37:g.150869496T>G		Somatic		Capture	Illumina GAIIx	4	150620152	A1A523|A1A575|Q8N2N6	Silent	SNP	HMMSmart_GLA,superfamily_VitK_dep_GLA,HMMPfam_Gla,PatternScan_GLA_1	p.A229	ENST00000370353.3	37	c.687	CCDS14699.1	X																																																																																			-	NULL		0.537	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG3	protein_coding	OTTHUMT00000060880.1	T	NM_024082		150620152	+1	no_errors	NM_024082	genbank	human	provisional	54_36p	silent	SNP	0.060	G
NUP210L	91181	genome.wustl.edu	37	1	154101759	154101759	+	Missense_Mutation	SNP	A	A	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr1:154101759A>T	ENST00000368559.3	-	8	1143	c.1072T>A	c.(1072-1074)Ttt>Att	p.F358I	NUP210L_ENST00000271854.3_Missense_Mutation_p.F358I	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	358					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			ATACCTAAAAATCCAGGCTCT	0.343																																																0			1											122.0	115.0	117.0					1																	154101759		1856	4103	5959	152368383	SO:0001583	missense	91181			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.1072T>A	1.37:g.154101759A>T	ENSP00000357547:p.Phe358Ile	Somatic		Capture	Illumina GAIIx	4	152368383	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	superfamily_Invasin_intimin,HMMSmart_BID_2,HMMPfam_Big_2	p.F358I	ENST00000368559.3	37	c.1072	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	A	17.56	3.421024	0.62622	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.05855	3.38;3.38	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000009	T	0.03011	0.0089	L	0.51422	1.61	0.35493	D	0.799147	P;B	0.35077	0.483;0.335	B;B	0.30943	0.122;0.086	T	0.45116	-0.9283	10	0.30854	T	0.27	-5.3819	13.2973	0.60305	1.0:0.0:0.0:0.0	.	358;358	E7EP56;Q5VU65	.;P210L_HUMAN	I	358	ENSP00000357547:F358I;ENSP00000271854:F358I	ENSP00000271854:F358I	F	-	1	0	NUP210L	152368383	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.705000	0.68355	2.149000	0.67028	0.460000	0.39030	TTT	-	NULL		0.343	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	protein_coding	OTTHUMT00000087270.3	A	NM_207308		152368383	-1	no_errors	NM_207308	genbank	human	validated	54_36p	missense	SNP	1.000	T
KRT8P45	149501	genome.wustl.edu	37	1	157043977	157043977	+	IGR	SNP	C	C	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr1:157043977C>T								ARHGEF11 (28815 upstream) : ETV3L (17858 downstream)																							CCTAGATAAACCGGAACATCA	0.587																																																0			1																																								155310601	SO:0001628	intergenic_variant	149501																															1.37:g.157043977C>T		Somatic		Capture	Illumina GAIIx	4	155310601		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.587					LOC149501			C			155310601	+1	pseudogene	XR_017100	genbank	human	model	54_36p	rna	SNP	1.000	T
MME	4311	genome.wustl.edu	37	3	154855931	154855931	+	Missense_Mutation	SNP	G	G	C			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr3:154855931G>C	ENST00000460393.1	+	9	881	c.761G>C	c.(760-762)aGa>aCa	p.R254T	MME_ENST00000360490.2_Missense_Mutation_p.R254T|MME_ENST00000492661.1_Missense_Mutation_p.R254T|MME_ENST00000493237.1_Missense_Mutation_p.R254T|MME_ENST00000462745.1_Missense_Mutation_p.R254T	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	254					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	TCTGTGGCCAGATTGATTCGT	0.353																																																0			3											161.0	166.0	165.0					3																	154855931		2203	4300	6503	156338625	SO:0001583	missense	4311				CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.761G>C	3.37:g.154855931G>C	ENSP00000418525:p.Arg254Thr	Somatic		Capture	Illumina GAIIx	4	156338625	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	"superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Peptidase_M13_N,HMMPfam_Peptidase_M13"	p.R254T	ENST00000460393.1	37	c.761	CCDS3172.1	3	.	.	.	.	.	.	.	.	.	.	G	7.590	0.670656	0.14776	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68	5.58	-5.18	0.02840	Peptidase M13 (1);	0.438594	0.27778	N	0.017896	T	0.28532	0.0706	N	0.01438	-0.865	0.34572	D	0.713522	B	0.06786	0.001	B	0.08055	0.003	T	0.08638	-1.0712	10	0.16896	T	0.51	-10.38	2.4871	0.04601	0.2923:0.2392:0.3523:0.1162	.	254	P08473	NEP_HUMAN	T	254	ENSP00000420389:R254T;ENSP00000418525:R254T;ENSP00000419653:R254T;ENSP00000417079:R254T;ENSP00000353679:R254T	ENSP00000353679:R254T	R	+	2	0	MME	156338625	0.999000	0.42202	0.784000	0.31847	0.774000	0.43823	0.967000	0.29344	-0.688000	0.05155	-0.302000	0.09304	AGA	-	"superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Peptidase_M13_N"		0.353	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MME	protein_coding	OTTHUMT00000351076.1	G	NM_000902		156338625	+1	no_errors	NM_000902	genbank	human	reviewed	54_36p	missense	SNP	0.772	C
IGSF9	57549	genome.wustl.edu	37	1	159904513	159904513	+	Missense_Mutation	SNP	G	G	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr1:159904513G>A	ENST00000368094.1	-	7	970	c.773C>T	c.(772-774)aCc>aTc	p.T258I	IGSF9_ENST00000493195.1_5'Flank|IGSF9_ENST00000361509.3_Missense_Mutation_p.T258I	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	258	Ig-like 3.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CCAGCTGTAGGTGAGGTTAGC	0.537																																																0			1											121.0	98.0	106.0					1																	159904513		2203	4300	6503	158171137	SO:0001583	missense	57549			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.773C>T	1.37:g.159904513G>A	ENSP00000357073:p.Thr258Ile	Somatic		Capture	Illumina GAIIx	4	158171137		Missense_Mutation	SNP	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin,HMMSmart_SM00408,HMMPfam_I-set,HMMPfam_ig,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Fibronectin type III	p.T258I	ENST00000368094.1	37	c.773	CCDS44254.1	1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812816	0.70912	.	.	ENSG00000085552	ENST00000361509;ENST00000368094;ENST00000198587	T;T	0.12879	2.64;2.64	4.31	4.31	0.51392	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40144	N	0.001171	T	0.26376	0.0644	M	0.72624	2.21	0.52501	D	0.999957	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.01326	-1.1384	9	.	.	.	-21.7525	14.3201	0.66479	0.0:0.0:1.0:0.0	.	258;258	Q9P2J2;C9JI81	TUTLA_HUMAN;.	I	258	ENSP00000355049:T258I;ENSP00000357073:T258I	.	T	-	2	0	IGSF9	158171137	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	9.259000	0.95561	2.222000	0.72286	0.491000	0.48974	ACC	-	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409,HMMSmart_SM00408		0.537	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	protein_coding	OTTHUMT00000059115.1	G	NM_020789		158171137	-1	no_errors	NM_020789	genbank	human	validated	54_36p	missense	SNP	1.000	A
C1orf192	257177	genome.wustl.edu	37	1	161335454	161335454	+	Missense_Mutation	SNP	C	C	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr1:161335454C>T	ENST00000367974.1	-	4	215	c.210G>A	c.(208-210)atG>atA	p.M70I	RP11-122G18.5_ENST00000437833.2_lincRNA	NM_001013625.2	NP_001013647.2	Q5VTH2	CA192_HUMAN	chromosome 1 open reading frame 192	70										endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	10	all_cancers(52;4.64e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TCTTCAGAGGCATTTGCCAGG	0.502																																																0			1											115.0	125.0	121.0					1																	161335454		2203	4300	6503	159602078	SO:0001583	missense	257177				CCDS30921.1	1q23.3	2014-02-21			ENSG00000188931	ENSG00000188931			32325	protein-coding gene	gene with protein product							Standard	NM_001013625		Approved	Flattop, Fltp	uc001gal.4	Q5VTH2	OTTHUMG00000034462	ENST00000367974.1:c.210G>A	1.37:g.161335454C>T	ENSP00000356951:p.Met70Ile	Somatic		Capture	Illumina GAIIx	4	159602078		Missense_Mutation	SNP	NULL	p.M70I	ENST00000367974.1	37	c.210	CCDS30921.1	1	.	.	.	.	.	.	.	.	.	.	C	19.76	3.887200	0.72410	.	.	ENSG00000188931	ENST00000367974	.	.	.	5.49	5.49	0.81192	.	0.066241	0.64402	D	0.000006	T	0.46833	0.1413	M	0.63843	1.955	0.28088	N	0.931902	P	0.46859	0.885	B	0.39805	0.31	T	0.59606	-0.7423	8	0.62326	D	0.03	-10.6418	17.2234	0.86963	0.0:1.0:0.0:0.0	.	70	Q5VTH2	CA192_HUMAN	I	70	.	ENSP00000356951:M70I	M	-	3	0	C1orf192	159602078	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.196000	0.58407	2.735000	0.93741	0.655000	0.94253	ATG	-	NULL		0.502	C1orf192-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf192	protein_coding	OTTHUMT00000083309.1	C	NM_001013625		159602078	-1	no_errors	NM_001013625	genbank	human	predicted	54_36p	missense	SNP	1.000	T
KCNMB1	3779	genome.wustl.edu	37	5	169805842	169805842	+	Missense_Mutation	SNP	A	A	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr5:169805842A>T	ENST00000274629.4	-	4	884	c.442T>A	c.(442-444)Ttc>Atc	p.F148I	KCNIP1_ENST00000377360.4_Intron|KCNIP1_ENST00000518527.1_Intron	NM_004137.3	NP_004128.1	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 1	148					blood coagulation (GO:0007596)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to calcium ion (GO:0051592)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			endometrium(1)|large_intestine(1)|lung(7)|ovary(2)	11	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)	Miconazole(DB01110)|Procaine(DB00721)	AGGCGCTGGAATAGGACGCTG	0.617																																																0			5											88.0	84.0	85.0					5																	169805842		2203	4300	6503	169738420	SO:0001583	missense	3779			AF035046	CCDS4373.1	5q34	2012-02-23			ENSG00000145936	ENSG00000145936		"""Potassium channels"""	6285	protein-coding gene	gene with protein product	"""BK channel beta subunit"""	603951				8799178, 9888999	Standard	NM_004137		Approved	hslo-beta	uc003maq.2	Q16558	OTTHUMG00000130439	ENST00000274629.4:c.442T>A	5.37:g.169805842A>T	ENSP00000274629:p.Phe148Ile	Somatic		Capture	Illumina GAIIx	4	169738420	O00707|O00708|P78475|Q53YR0|Q8TAX3|Q93005	Missense_Mutation	SNP	HMMPfam_CaKB	p.F148I	ENST00000274629.4	37	c.442	CCDS4373.1	5	.	.	.	.	.	.	.	.	.	.	A	10.09	1.255016	0.22965	.	.	ENSG00000145936	ENST00000274629	T	0.09445	2.98	5.3	3.93	0.45458	.	0.749194	0.12758	N	0.441564	T	0.06600	0.0169	N	0.14661	0.345	0.21627	N	0.999613	B	0.16802	0.019	B	0.19148	0.024	T	0.34153	-0.9840	9	.	.	.	.	9.4065	0.38464	0.9006:0.0:0.0994:0.0	.	148	Q16558	KCMB1_HUMAN	I	148	ENSP00000274629:F148I	.	F	-	1	0	KCNMB1	169738420	1.000000	0.71417	0.038000	0.18304	0.033000	0.12548	3.427000	0.52785	1.988000	0.58038	0.477000	0.44152	TTC	-	HMMPfam_CaKB		0.617	KCNMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNMB1	protein_coding	OTTHUMT00000252830.3	A			169738420	-1	no_errors	NM_004137	genbank	human	reviewed	54_36p	missense	SNP	0.599	T
TTN	7273	genome.wustl.edu	37	2	179479650	179479650	+	Silent	SNP	G	G	A	rs529418633	byFrequency	TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr2:179479650G>A	ENST00000591111.1	-	210	43985	c.43761C>T	c.(43759-43761)cgC>cgT	p.R14587R	TTN_ENST00000342992.6_Silent_p.R13660R|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000359218.5_Silent_p.R7288R|TTN_ENST00000460472.2_Silent_p.R7163R|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.R7355R|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.R16228R			Q8WZ42	TITIN_HUMAN	titin	14587	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGCCTTCACGCGGTAGGCAT	0.438													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18840	0.0		0.0	False		,,,				2504	0.0															0			2											109.0	99.0	102.0					2																	179479650		1937	4154	6091	179187895	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.43761C>T	2.37:g.179479650G>A		Somatic		Capture	Illumina GAIIx	4	179187895	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,HMMPfam_Titin_Z,HMMSmart_SM00406,PatternScan_IG_MHC,HMMPfam_PPAK,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_TYR	p.R12210	ENST00000591111.1	37	c.36630		2																																																																																			-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Fibronectin type III		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179187895	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	silent	SNP	0.997	A
DNAH7	56171	genome.wustl.edu	37	2	196822075	196822075	+	Silent	SNP	A	A	T			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr2:196822075A>T	ENST00000312428.6	-	19	3088	c.2988T>A	c.(2986-2988)tcT>tcA	p.S996S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	996	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TAATGTCTGGAGAGCTGAAAA	0.473																																																0			2											87.0	81.0	83.0					2																	196822075		1885	4115	6000	196530320	SO:0001819	synonymous_variant	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2988T>A	2.37:g.196822075A>T		Somatic		Capture	Illumina GAIIx	4	196530320	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,PatternScan_EF_HAND_1,HMMPfam_Dynein_heavy,PatternScan_ADH_SHORT	p.S996	ENST00000312428.6	37	c.2988	CCDS42794.1	2																																																																																			-	HMMPfam_DHC_N2		0.473	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	protein_coding	OTTHUMT00000335202.3	A	NM_018897		196530320	-1	no_errors	NM_018897	genbank	human	validated	54_36p	silent	SNP	1.000	T
RAB3GAP2	25782	genome.wustl.edu	37	1	220439819	220439819	+	Intron	SNP	G	G	A			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr1:220439819G>A	ENST00000358951.2	-	1	232				RAB3GAP2_ENST00000462353.1_5'UTR	NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)						establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TTATGAACCAGTATAAGTAGC	0.502																																																0			1																																								218506442	SO:0001627	intron_variant	6791			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.115+5745C>T	1.37:g.220439819G>A		Somatic		Capture	Illumina GAIIx	4	218506442	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	RNA	SNP	-	NULL	ENST00000358951.2	37	NULL	CCDS31028.1	1																																																																																			-	-		0.502	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AURKAPS1	protein_coding	OTTHUMT00000090205.2	G	NM_012414		218506442	-1	pseudogene	NR_001587	genbank	human	provisional	54_36p	rna	SNP	0.236	A
MOSPD2	158747	genome.wustl.edu	37	X	14936834	14936837	+	Frame_Shift_Del	DEL	CAAA	CAAA	-			TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	CAAA	CAAA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chrX:14936834_14936837delCAAA	ENST00000380492.3	+	14	1437_1440	c.1349_1352delCAAA	c.(1348-1353)ccaaacfs	p.PN450fs	MOSPD2_ENST00000482354.1_Frame_Shift_Del_p.PN450fs|MOSPD2_ENST00000495110.1_3'UTR	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	450						integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					AGCAGTAAACCAAACACTCTTACG	0.27																																																0			X																																								14846758	SO:0001589	frameshift_variant	158747			AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.1349_1352delCAAA	X.37:g.14936834_14936837delCAAA	ENSP00000369860:p.Pro450fs	Somatic		Capture	Illumina GAIIx	4	14846755	Q8N3H2|Q8NA83	Frame_Shift_Del	DEL	superfamily_CRAL/TRIO N-terminal domain,superfamily_CRAL/TRIO domain,HMMSmart_SM00516,HMMPfam_CRAL_TRIO,HMMPfam_Motile_Sperm,superfamily_PapD-like	p.N451fs	ENST00000380492.3	37	c.1349_1352	CCDS14162.1	X																																																																																			(deletion:cds_exon[14846723,14846825])	NULL		0.270	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOSPD2	protein_coding	OTTHUMT00000055837.1	CAAA	NM_152581		14846758	+1	no_errors	NM_152581	genbank	human	provisional	54_36p	frame_shift_del	DEL	1.000:0.996:0.996:0.994	-
SKIDA1	387640	genome.wustl.edu	37	10	21805466	21805467	+	In_Frame_Ins	INS	-	-	CCTCCT	rs112207161	byFrequency	TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr10:21805466_21805467insCCTCCT	ENST00000449193.2	-	4	3537_3538	c.1285_1286insAGGAGG	c.(1285-1287)ggg>gAGGAGGgg	p.428_429insEE	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_In_Frame_Ins_p.349_350insEE	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	347						nucleus (GO:0005634)		p.E428_G429insEE(2)									CCCGCTGCccccctcctcctcc	0.619														2708	0.540735	0.916	0.4063	5008	,	,		10303	0.3244		0.5408	False		,,,				2504	0.3517															2	Insertion - In frame(2)	soft_tissue(2)	10								3173,56,18,597		1435,46,11,246,5,0,0,3,1,175						3.0	1.0		dbSNP_132	7	4189,51,27,3619		1322,36,14,1495,1,0,13,2,9,1051	no	codingComplex	C10orf140	NM_207371.3		2757,82,25,1741,6,0,13,5,10,1226	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		46.8805,17.4558,37.2379				7362,107,45,4216				21845473	SO:0001652	inframe_insertion	387640			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1280_1285dupAGGAGG	10.37:g.21805467_21805472dupCCTCCT	ENSP00000410041:p.Glu427_Glu428dup	Somatic		Capture	Illumina GAIIx	4	21845472	B1ANA5|Q6ZMX4|Q8N3C3	In_Frame_Ins	INS	superfamily_Putative DNA-binding domain,HMMPfam_Ski_Sno,PatternScan_G_PROTEIN_RECEP_F1_1	p.429in_frame_insEE	ENST00000449193.2	37	c.1286_1285	CCDS44363.1	10																																																																																			-	NULL		0.619	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf140	protein_coding	OTTHUMT00000286950.2	-	NM_207371		21845473	-1	no_errors	NM_207371	genbank	human	validated	54_36p	in_frame_ins	INS	0.990:1.000	CCTCCT
KRTAP9-9	81870	genome.wustl.edu	37	17	39411670	39411671	+	In_Frame_Ins	INS	-	-	ACCTGCTGCAGGACC	rs67700678|rs540633489	byFrequency	TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr17:39411670_39411671insACCTGCTGCAGGACC	ENST00000394008.1	+	1	35_36	c.33_34insACCTGCTGCAGGACC	c.(34-36)acc>ACCTGCTGCAGGACCacc	p.12_12T>TCCRTT		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	12	14 X 5 AA repeats of C-C-[RQVGE]- [SPSTNQ]-[TASL].					keratin filament (GO:0045095)				endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			GCTGTCAGCCTACCTGCTGCAG	0.604														2488	0.496805	0.298	0.647	5008	,	,		16406	0.4196		0.5805	False		,,,				2504	0.6524															0			17																																								36665197	SO:0001652	inframe_insertion	85279			AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.34_48dupACCTGCTGCAGGACC	17.37:g.39411670_39411671insACCTGCTGCAGGACC	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	36665196	B5MDD6|Q9BYQ1	In_Frame_Ins	INS	HMMPfam_Keratin_B2	p.15in_frame_insTTCCR	ENST00000394008.1	37	c.33_34	CCDS54127.1	17																																																																																			-	HMMPfam_Keratin_B2		0.604	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-5	protein_coding	OTTHUMT00000257710.1	-	NM_030975		36665197	+1	no_errors	ENST00000394008	ensembl	human	known	54_36p	in_frame_ins	INS	0.024:0.014	ACCTGCTGCAGGACC
CYB561	1534	genome.wustl.edu	37	17	61514758	61514770	+	Frame_Shift_Del	DEL	TGAACTGCAGGTC	TGAACTGCAGGTC	-	rs527806618		TCGA-20-1687-01A-01W-0633-09	TCGA-20-1687-10A-01W-0633-09	TGAACTGCAGGTC	TGAACTGCAGGTC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	463e0262-355d-409c-8b11-349e57838c0e	e02415f3-1e9b-4a00-ae4b-4cdd7a2db1fc	g.chr17:61514758_61514770delTGAACTGCAGGTC	ENST00000392976.1	-	2	438_450	c.139_151delGACCTGCAGTTCA	c.(139-153)gacctgcagttcaacfs	p.DLQFN47fs	CYB561_ENST00000392975.2_Frame_Shift_Del_p.DLQFN47fs|CYB561_ENST00000581573.1_Frame_Shift_Del_p.DLQFN47fs|CYB561_ENST00000584031.1_Frame_Shift_Del_p.DLQFN47fs|CYB561_ENST00000582297.1_Frame_Shift_Del_p.DLQFN47fs|CYB561_ENST00000581163.1_5'Flank|CYB561_ENST00000582034.1_Frame_Shift_Del_p.DLQFN18fs|CYB561_ENST00000582997.1_Frame_Shift_Del_p.DLQFN54fs|CYB561_ENST00000360793.3_Frame_Shift_Del_p.DLQFN47fs|CYB561_ENST00000448884.2_Frame_Shift_Del_p.DLQFN47fs|CYB561_ENST00000542042.1_Frame_Shift_Del_p.DLQFN114fs	NM_001017916.1	NP_001017916.1	P49447	CY561_HUMAN	cytochrome b561	47	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				electron transport chain (GO:0022900)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)|transmembrane electron transfer carrier (GO:0022865)			lung(2)|ovary(1)|prostate(1)	4				READ - Rectum adenocarcinoma(1115;0.0689)		GGGTGCGCGTTGAACTGCAGGTCGCTCTCCCAG	0.648																																																0			17																																								58868502	SO:0001589	frameshift_variant	1534				CCDS11636.1	17q23.3	2013-03-14	2013-03-14		ENSG00000008283	ENSG00000008283		"""Cytochrome b genes"""	2571	protein-coding gene	gene with protein product	"""ferric-chelate reductase 2"", ""cytochrome b561 family, member A1"""	600019				7959749, 23249217	Standard	XM_005257091		Approved	FRRS2, CYB561A1	uc002jas.3	P49447		ENST00000392976.1:c.139_151delGACCTGCAGTTCA	17.37:g.61514758_61514770delTGAACTGCAGGTC	ENSP00000376702:p.Asp47fs	Somatic		Capture	Illumina GAIIx	4	58868490	B2RE96|B7Z775|D3DU11|Q5BJG9|Q9BU05|Q9BWR9	Frame_Shift_Del	DEL	HMMPfam_Cytochrom_B561,HMMSmart_SM00665	p.D47fs	ENST00000392976.1	37	c.151_139	CCDS11636.1	17																																																																																			(deletion:cds_exon[58868439,58868640])	HMMPfam_Cytochrom_B561		0.648	CYB561-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB561	protein_coding	OTTHUMT00000444843.1	TGAACTGCAGGTC	NM_001915		58868502	-1	no_errors	NM_001017916	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000:0.985:1.000:1.000:1.000:1.000:0.988:0.985:0.989:1.000:0.998:0.998:0.995	-
