#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
L1TD1	54596	broad.mit.edu	37	1	62675768	62675768	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr1:62675768A>G	ENST00000498273.1	+	4	1617	c.1322A>G	c.(1321-1323)gAa>gGa	p.E441G	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	441	Glu-rich.							p.E441G(1)|p.E441V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						CAGACTTCAGAACAGGACTCA	0.493																																																2	Substitution - Missense(2)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)	1											72.0	68.0	69.0					1																	62675768		2203	4300	6503	62448356	SO:0001583	missense	54596			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.1322A>G	1.37:g.62675768A>G	ENSP00000419901:p.Glu441Gly	Somatic		Capture	Illumina GAIIx	Phase_I	62448356	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	ENST00000498273.1	37	CCDS619.1	.	.	.	.	.	.	.	.	.	.	A	11.20	1.569768	0.28003	.	.	ENSG00000240563	ENST00000498273	T	0.15952	2.38	1.53	-3.07	0.05363	.	.	.	.	.	T	0.08313	0.0207	N	0.24115	0.695	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.29971	-0.9994	9	0.48119	T	0.1	.	0.229	0.00177	0.2447:0.1972:0.1663:0.3918	.	441	Q5T7N2	LITD1_HUMAN	G	441	ENSP00000419901:E441G	ENSP00000419901:E441G	E	+	2	0	L1TD1	62448356	0.005000	0.15991	0.000000	0.03702	0.673000	0.39480	0.035000	0.13797	-1.938000	0.01046	0.172000	0.16884	GAA		0.493	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024688.1	NM_019079	
CLCA4	22802	broad.mit.edu	37	1	87031502	87031502	+	Silent	SNP	C	C	T	rs199899112		TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr1:87031502C>T	ENST00000370563.3	+	6	795	c.753C>T	c.(751-753)aaC>aaT	p.N251N	CLCA4_ENST00000263723.5_5'UTR	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	251					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)	p.N251N(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		AATTTTGTAACGAAAAAACCC	0.269													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16264	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1						C		1,3603		0,1,1801	62.0	55.0	57.0		753	-1.6	0.1	1		57	0,8132		0,0,4066	no	coding-synonymous	CLCA4	NM_012128.3		0,1,5867	TT,TC,CC		0.0,0.0277,0.0085		251/920	87031502	1,11735	1802	4066	5868	86804090	SO:0001819	synonymous_variant	22802			AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.753C>T	1.37:g.87031502C>T		Somatic		Capture	Illumina GAIIx	Phase_I	86804090	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Silent	SNP	ENST00000370563.3	37	CCDS41355.1																																																																																				0.269	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128	
TRMT13	54482	broad.mit.edu	37	1	100613448	100613448	+	Splice_Site	SNP	A	A	C			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr1:100613448A>C	ENST00000370141.2	+	10	823		c.e10-1			NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)						tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.?(1)									TTGTGTTTGCAGATCTTGCAT	0.328																																																1	Unknown(1)	ovary(1)	1											54.0	55.0	55.0					1																	100613448		2201	4300	6501	100386036	SO:0001630	splice_region_variant	54482			BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.818-1A>C	1.37:g.100613448A>C		Somatic		Capture	Illumina GAIIx	Phase_I	100386036	Q5VVL0|Q9NW65	Splice_Site	SNP	ENST00000370141.2	37	CCDS765.1	.	.	.	.	.	.	.	.	.	.	.	17.61	3.433052	0.62844	.	.	ENSG00000122435	ENST00000370141	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9199	0.79556	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC76	100386036	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	7.680000	0.84062	2.161000	0.67846	0.533000	0.62120	.		0.328	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029919.1	NM_019083	Intron
SCAMP3	10067	broad.mit.edu	37	1	155227416	155227416	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr1:155227416C>T	ENST00000302631.3	-	6	657	c.550G>A	c.(550-552)Gcc>Acc	p.A184T	FAM189B_ENST00000368368.3_5'Flank|FAM189B_ENST00000472550.1_5'Flank|FAM189B_ENST00000361361.2_5'Flank|SCAMP3_ENST00000355379.3_Missense_Mutation_p.A158T|SCAMP3_ENST00000472397.1_5'UTR|FAM189B_ENST00000350210.2_5'Flank	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	184					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)	p.A184T(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCCAGGCAGGCGAGGAAGTTC	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											41.0	41.0	41.0					1																	155227416		2197	4298	6495	153494040	SO:0001583	missense	10067			AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.550G>A	1.37:g.155227416C>T	ENSP00000307275:p.Ala184Thr	Somatic		Capture	Illumina GAIIx	Phase_I	153494040	A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Missense_Mutation	SNP	ENST00000302631.3	37	CCDS1105.1	.	.	.	.	.	.	.	.	.	.	.	21.4	4.140292	0.77775	.	.	ENSG00000116521	ENST00000302631;ENST00000355379	T;T	0.20881	2.04;2.04	4.92	4.92	0.64577	.	0.059356	0.64402	D	0.000002	T	0.24198	0.0586	L	0.55990	1.75	0.46981	D	0.99927	P;P;D	0.64830	0.817;0.879;0.994	B;B;P	0.55965	0.41;0.329;0.788	T	0.00715	-1.1597	10	0.56958	D	0.05	-14.4334	12.7333	0.57210	0.1649:0.8351:0.0:0.0	.	184;158;184	Q6FHJ5;O14828-2;O14828	.;.;SCAM3_HUMAN	T	184;158	ENSP00000307275:A184T;ENSP00000347540:A158T	ENSP00000307275:A184T	A	-	1	0	SCAMP3	153494040	0.977000	0.34250	0.999000	0.59377	0.994000	0.84299	2.555000	0.45854	2.554000	0.86153	0.561000	0.74099	GCC		0.567	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087399.1	NM_005698	
OR5D16	390144	broad.mit.edu	37	11	55606580	55606580	+	Missense_Mutation	SNP	C	C	T	rs562661348		TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr11:55606580C>T	ENST00000378396.1	+	1	353	c.353C>T	c.(352-354)gCg>gTg	p.A118V		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A118V(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				ATTCTATTTGCGGTGATGGCC	0.423													-|||	1	0.000199681	0.0	0.0014	5008	,	,		18662	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	11											122.0	118.0	119.0					11																	55606580		2201	4296	6497	55363156	SO:0001583	missense	390144			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.353C>T	11.37:g.55606580C>T	ENSP00000367649:p.Ala118Val	Somatic		Capture	Illumina GAIIx	Phase_I	55363156	Q6IF65|Q96RB4	Missense_Mutation	SNP	ENST00000378396.1	37	CCDS31512.1	.	.	.	.	.	.	.	.	.	.	.	14.25	2.478779	0.44044	.	.	ENSG00000205029	ENST00000378396	T	0.02015	4.5	4.47	3.56	0.40772	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.07954	0.0199	M	0.76433	2.335	0.09310	N	1	D	0.55605	0.972	P	0.53593	0.73	T	0.08994	-1.0695	9	0.72032	D	0.01	-5.0358	11.1707	0.48569	0.0:0.9083:0.0:0.0917	.	118	Q8NGK9	OR5DG_HUMAN	V	118	ENSP00000367649:A118V	ENSP00000367649:A118V	A	+	2	0	OR5D16	55363156	0.001000	0.12720	0.009000	0.14445	0.743000	0.42351	1.590000	0.36654	1.048000	0.40298	0.530000	0.56133	GCG		0.423	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496	
SLC37A2	219855	broad.mit.edu	37	11	124954721	124954721	+	Splice_Site	SNP	A	A	G			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr11:124954721A>G	ENST00000403796.2	+	13	1427	c.1126A>G	c.(1126-1128)Atg>Gtg	p.M376V	SLC37A2_ENST00000298280.5_Splice_Site_p.D347G|SLC37A2_ENST00000308074.4_Splice_Site_p.M376V|SLC37A2_ENST00000525837.1_3'UTR|SLC37A2_ENST00000407458.1_Splice_Site_p.M376V	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	376					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.M376V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		CCTCTCTCAGATGTTCCTGTA	0.592																																					Melanoma(11;373 620 21213 26083 47768)											1	Substitution - Missense(1)	ovary(1)	11											75.0	62.0	66.0					11																	124954721		2201	4299	6500	124459931	SO:0001630	splice_region_variant	219855			AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.1126-1A>G	11.37:g.124954721A>G		Somatic		Capture	Illumina GAIIx	Phase_I	124459931	A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Missense_Mutation	SNP	ENST00000403796.2	37	CCDS44757.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.37|12.37	1.916494|1.916494	0.33815|0.33815	.|.	.|.	ENSG00000134955|ENSG00000134955	ENST00000298280|ENST00000403796;ENST00000407458;ENST00000308074	T|T;T;T	0.49720|0.56776	0.77|0.44;0.44;0.44	4.89|4.89	1.17|1.17	0.20885|0.20885	.|Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.|0.230675	.|0.45126	.|N	.|0.000396	T|T	0.32315|0.32315	0.0825|0.0825	N|N	0.19112|0.19112	0.55|0.55	0.28261|0.28261	N|N	0.924848|0.924848	.|B;B;B	.|0.21688	.|0.059;0.001;0.0	.|B;B;B	.|0.28991	.|0.097;0.006;0.006	T|T	0.17961|0.17961	-1.0352|-1.0352	6|9	.|.	.|.	.|.	-28.0857|-28.0857	6.5329|6.5329	0.22336|0.22336	0.4042:0.4631:0.0:0.1327|0.4042:0.4631:0.0:0.1327	.|.	.|1;376;376	.|B7Z480;Q8TED4-2;Q8TED4	.|.;.;SPX2_HUMAN	G|V	347|376	ENSP00000298280:D347G|ENSP00000384407:M376V;ENSP00000385126:M376V;ENSP00000311833:M376V	.|.	D|M	+|+	2|1	0|0	SLC37A2|SLC37A2	124459931|124459931	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.832000|0.832000	0.47134|0.47134	2.079000|2.079000	0.41577|0.41577	0.360000|0.360000	0.24265|0.24265	0.460000|0.460000	0.39030|0.39030	GAT|ATG		0.592	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386837.1	XM_166184	Missense_Mutation
NTM	50863	broad.mit.edu	37	11	132016219	132016219	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr11:132016219C>T	ENST00000374786.1	+	2	690	c.211C>T	c.(211-213)Cgc>Tgc	p.R71C	NTM_ENST00000539799.1_Missense_Mutation_p.R71C|NTM_ENST00000425719.2_Missense_Mutation_p.R71C|NTM_ENST00000374784.1_Missense_Mutation_p.R71C|NTM_ENST00000427481.2_Missense_Mutation_p.R62C|NTM_ENST00000374791.3_Missense_Mutation_p.R71C	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	71	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R71C(1)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						CTGGCTAAACCGCAGCACCAT	0.567																																																1	Substitution - Missense(1)	ovary(1)	11											151.0	116.0	128.0					11																	132016219		2201	4297	6498	131521429	SO:0001583	missense	50863			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.211C>T	11.37:g.132016219C>T	ENSP00000363918:p.Arg71Cys	Somatic		Capture	Illumina GAIIx	Phase_I	131521429	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	37	CCDS8491.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810210	0.90707	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000550167;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63;1.63;1.63	5.69	4.79	0.61399	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.65688	0.2715	M	0.93854	3.465	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0;1.0	T	0.76334	-0.2997	10	0.72032	D	0.01	-21.636	14.9742	0.71257	0.0:0.9316:0.0:0.0684	.	71;62;71;71;71;71	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;NTRI_HUMAN;.;.	C	71;71;62;62;71;71;71	ENSP00000363923:R71C;ENSP00000437668:R71C;ENSP00000448104:R62C;ENSP00000416320:R62C;ENSP00000363918:R71C;ENSP00000396722:R71C;ENSP00000363916:R71C	ENSP00000363916:R71C	R	+	1	0	NTM	131521429	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.085000	0.71343	1.428000	0.47296	-0.123000	0.14984	CGC		0.567	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522	
PCED1B	91523	broad.mit.edu	37	12	47629840	47629840	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr12:47629840C>T	ENST00000546455.1	+	4	1725	c.994C>T	c.(994-996)Cgg>Tgg	p.R332W	PCED1B_ENST00000432328.1_Missense_Mutation_p.R332W|RP11-493L12.3_ENST00000547748.1_RNA			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	332	Pro-rich.						hydrolase activity (GO:0016787)	p.R332W(1)									GGGAATGCCCCGGTTCCCACA	0.597																																																1	Substitution - Missense(1)	ovary(1)	12											121.0	127.0	125.0					12																	47629840		2203	4300	6503	45916107	SO:0001583	missense	91523			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.994C>T	12.37:g.47629840C>T	ENSP00000446688:p.Arg332Trp	Somatic		Capture	Illumina GAIIx	Phase_I	45916107	Q96B20	Missense_Mutation	SNP	ENST00000546455.1	37	CCDS8752.1	.	.	.	.	.	.	.	.	.	.	C	10.50	1.368718	0.24771	.	.	ENSG00000179715	ENST00000546455;ENST00000432328	T;T	0.31247	1.5;1.5	3.95	3.06	0.35304	.	1.882490	0.03437	N	0.208652	T	0.21387	0.0515	N	0.14661	0.345	0.09310	N	1	D	0.60575	0.988	B	0.41299	0.353	T	0.25082	-1.0142	10	0.37606	T	0.19	-0.74	9.1444	0.36923	0.2168:0.7832:0.0:0.0	.	332	Q96HM7	F113B_HUMAN	W	332	ENSP00000446688:R332W;ENSP00000396040:R332W	ENSP00000396040:R332W	R	+	1	2	FAM113B	45916107	0.016000	0.18221	0.024000	0.17045	0.069000	0.16628	0.685000	0.25378	1.230000	0.43646	0.655000	0.94253	CGG		0.597	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405079.1	NM_138371	
BRCA2	675	broad.mit.edu	37	13	32912553	32912553	+	Missense_Mutation	SNP	C	C	T	rs80358656|rs397507322		TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr13:32912553C>T	ENST00000380152.3	+	11	4294	c.4061C>T	c.(4060-4062)aCg>aTg	p.T1354M	BRCA2_ENST00000544455.1_Missense_Mutation_p.T1354M			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1354	Interaction with POLH.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.T1354M(1)|p.E1353fs*5(1)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AAAGATGAAACGGACTTGCTA	0.323			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(2)	13	GRCh37	CM035691	BRCA2	M	rs80358656	C	MET/THR	0,4406		0,0,2203	60.0	61.0	61.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	4061	-3.0	0.0	13	dbSNP_132	61	3,8593	3.0+/-9.4	0,3,4295	no	missense	BRCA2	NM_000059.3	81	0,3,6498	TT,TC,CC		0.0349,0.0,0.0231	possibly-damaging	1354/3419	32912553	3,12999	2203	4298	6501	31810553	SO:0001583	missense	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.4061C>T	13.37:g.32912553C>T	ENSP00000369497:p.Thr1354Met	Somatic		Capture	Illumina GAIIx	Phase_I	31810553	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	C	5.731	0.319279	0.10845	0.0	3.49E-4	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00717	5.79;5.79	5.75	-3.01	0.05463	.	0.534882	0.19957	N	0.102297	T	0.00468	0.0015	N	0.22421	0.69	0.09310	N	1	P	0.46327	0.876	B	0.30646	0.118	T	0.55451	-0.8139	10	0.72032	D	0.01	.	7.0232	0.24926	0.4571:0.1323:0.4106:0.0	.	1354	P51587	BRCA2_HUMAN	M	1354	ENSP00000369497:T1354M;ENSP00000439902:T1354M	ENSP00000369497:T1354M	T	+	2	0	BRCA2	31810553	0.001000	0.12720	0.002000	0.10522	0.274000	0.26718	0.055000	0.14229	-0.494000	0.06669	-0.363000	0.07495	ACG		0.323	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
SEC23A	10484	broad.mit.edu	37	14	39565308	39565308	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr14:39565308C>A	ENST00000307712.6	-	2	532	c.15G>T	c.(13-15)ttG>ttT	p.L5F	SEC23A_ENST00000557280.1_Missense_Mutation_p.L5F|SEC23A_ENST00000553970.1_Missense_Mutation_p.L5F|SEC23A_ENST00000548032.2_Missense_Mutation_p.L5F|SEC23A_ENST00000536508.1_Intron|SEC23A_ENST00000545328.2_Missense_Mutation_p.L5F	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	5					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.L5F(1)		kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		GAATGAATTCCAAATAGGTTG	0.343																																																1	Substitution - Missense(1)	ovary(1)	14											107.0	101.0	103.0					14																	39565308		2203	4300	6503	38635059	SO:0001583	missense	10484			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.15G>T	14.37:g.39565308C>A	ENSP00000306881:p.Leu5Phe	Somatic		Capture	Illumina GAIIx	Phase_I	38635059	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	37	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	C	14.88	2.668309	0.47677	.	.	ENSG00000100934	ENST00000307712;ENST00000545328;ENST00000555017;ENST00000556092;ENST00000548032;ENST00000555425;ENST00000557280;ENST00000553970;ENST00000557437	D;D;D;D;D;D;D;D;D	0.88741	-2.24;-2.23;-1.66;-1.66;-2.42;-2.39;-2.41;-2.41;-2.1	5.72	3.9	0.45041	.	0.208543	0.43110	D	0.000617	T	0.81978	0.4937	N	0.24115	0.695	0.80722	D	1	B;B	0.33073	0.244;0.396	B;B	0.35899	0.213;0.163	T	0.81346	-0.0974	10	0.51188	T	0.08	-10.9126	11.7522	0.51855	0.0:0.8582:0.0:0.1418	.	5;5	F5H365;Q15436	.;SC23A_HUMAN	F	5	ENSP00000306881:L5F;ENSP00000445393:L5F;ENSP00000450819:L5F;ENSP00000451230:L5F;ENSP00000447489:L5F;ENSP00000451999:L5F;ENSP00000452575:L5F;ENSP00000451924:L5F;ENSP00000452390:L5F	ENSP00000306881:L5F	L	-	3	2	SEC23A	38635059	0.993000	0.37304	1.000000	0.80357	0.995000	0.86356	0.449000	0.21744	1.413000	0.46997	0.563000	0.77884	TTG		0.343	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2		
DLST	1743	broad.mit.edu	37	14	75367869	75367869	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr14:75367869A>G	ENST00000334220.4	+	14	1221	c.1160A>G	c.(1159-1161)aAc>aGc	p.N387S	DLST_ENST00000334212.6_Missense_Mutation_p.N301S	NM_001933.4	NP_001924.2	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)	387					cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|generation of precursor metabolites and energy (GO:0006091)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|oxoglutarate dehydrogenase complex (GO:0045252)	dihydrolipoyllysine-residue succinyltransferase activity (GO:0004149)	p.N387S(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00698)		CCCATTATCAACCCCCCTCAG	0.517																																																1	Substitution - Missense(1)	ovary(1)	14											122.0	111.0	115.0					14																	75367869		2203	4300	6503	74437622	SO:0001583	missense	1743				CCDS9833.1	14q23.1	2008-08-11			ENSG00000119689	ENSG00000119689	2.3.1.61		2911	protein-coding gene	gene with protein product		126063		DLTS		8009371	Standard	NM_001933		Approved		uc001xqv.2	P36957		ENST00000334220.4:c.1160A>G	14.37:g.75367869A>G	ENSP00000335304:p.Asn387Ser	Somatic		Capture	Illumina GAIIx	Phase_I	74437622	B7Z5W8|E7ESY5|Q7LDY7|Q9BQ32	Missense_Mutation	SNP	ENST00000334220.4	37	CCDS9833.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.356883	0.61293	.	.	ENSG00000119689	ENST00000334220;ENST00000334212	T;T	0.52295	0.67;0.67	5.94	5.94	0.96194	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.68961	0.3058	H	0.97315	3.98	0.80722	D	1	B;B;B	0.33288	0.17;0.013;0.406	B;B;B	0.37387	0.139;0.034;0.248	T	0.77183	-0.2681	10	0.87932	D	0	-15.9156	16.3979	0.83621	1.0:0.0:0.0:0.0	.	301;387;299	B7Z5W8;P36957;Q86TQ8	.;ODO2_HUMAN;.	S	387;301	ENSP00000335304:N387S;ENSP00000335465:N301S	ENSP00000335465:N301S	N	+	2	0	DLST	74437622	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	9.339000	0.96797	2.279000	0.76181	0.459000	0.35465	AAC		0.517	DLST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413637.1		
IGDCC3	9543	broad.mit.edu	37	15	65624385	65624385	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr15:65624385T>A	ENST00000327987.4	-	7	1293	c.1042A>T	c.(1042-1044)Atg>Ttg	p.M348L	IGDCC3_ENST00000559231.1_5'UTR	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	348	Ig-like C2-type 4.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)		p.M348L(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CAGGTGAACATGGCTGTGGTC	0.612																																																1	Substitution - Missense(1)	ovary(1)	15											85.0	69.0	74.0					15																	65624385		2201	4299	6500	63411438	SO:0001583	missense	9543			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1042A>T	15.37:g.65624385T>A	ENSP00000332773:p.Met348Leu	Somatic		Capture	Illumina GAIIx	Phase_I	63411438	O95215	Missense_Mutation	SNP	ENST00000327987.4	37	CCDS10205.1	.	.	.	.	.	.	.	.	.	.	T	11.27	1.587991	0.28268	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	T	0.37752	1.18	4.56	2.24	0.28232	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.254237	0.43919	D	0.000515	T	0.15392	0.0371	N	0.05259	-0.085	0.36382	D	0.861962	B	0.26318	0.146	B	0.24006	0.05	T	0.13953	-1.0490	10	0.20519	T	0.43	-23.7951	8.4244	0.32720	0.0:0.1621:0.0:0.8379	.	348	Q8IVU1	IGDC3_HUMAN	L	348;211	ENSP00000332773:M348L	ENSP00000332773:M348L	M	-	1	0	IGDCC3	63411438	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.839000	0.48207	0.712000	0.32039	-0.250000	0.11733	ATG		0.612	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884	
BLM	641	broad.mit.edu	37	15	91312750	91312750	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr15:91312750C>T	ENST00000355112.3	+	12	2607	c.2489C>T	c.(2488-2490)aCg>aTg	p.T830M	BLM_ENST00000560509.1_Missense_Mutation_p.T830M|BLM_ENST00000560136.1_3'UTR	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	830	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)	p.T830M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			ATGGCTCTTACGGCCACAGCT	0.443			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																													yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	1	Substitution - Missense(1)	ovary(1)	15											82.0	71.0	75.0					15																	91312750		2198	4298	6496	89113754	SO:0001583	missense	641	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.2489C>T	15.37:g.91312750C>T	ENSP00000347232:p.Thr830Met	Somatic		Capture	Illumina GAIIx	Phase_I	89113754	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.525064	0.85600	.	.	ENSG00000197299	ENST00000355112;ENST00000536925;ENST00000543977	T	0.18338	2.22	4.86	4.86	0.63082	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65595	0.2706	H	0.99924	4.96	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.83462	0.0054	10	0.87932	D	0	-2.0889	15.8442	0.78874	0.0:1.0:0.0:0.0	.	830;455;830	B2RAN0;B7ZKN7;P54132	.;.;BLM_HUMAN	M	830;483;17	ENSP00000347232:T830M	ENSP00000347232:T830M	T	+	2	0	BLM	89113754	1.000000	0.71417	0.999000	0.59377	0.887000	0.51463	7.544000	0.82117	2.398000	0.81561	0.591000	0.81541	ACG		0.443	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
ZSCAN32	54925	broad.mit.edu	37	16	3434788	3434788	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr16:3434788G>A	ENST00000396852.4	-	6	1212	c.905C>T	c.(904-906)aCc>aTc	p.T302I	ZSCAN32_ENST00000422427.2_Missense_Mutation_p.T90I|ZSCAN32_ENST00000396846.3_Missense_Mutation_p.T302I|ZSCAN32_ENST00000573830.1_Missense_Mutation_p.T13I|ZSCAN32_ENST00000574940.1_Missense_Mutation_p.T302I|ZSCAN32_ENST00000304926.3_Missense_Mutation_p.T90I|ZSCAN32_ENST00000439568.2_Missense_Mutation_p.T13I	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32	302					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.T90I(1)									CTGTTCTGGGGTCCGCAGAAA	0.502																																																1	Substitution - Missense(1)	ovary(1)	16											155.0	162.0	160.0					16																	3434788		2197	4300	6497	3374789	SO:0001583	missense	54925			AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.905C>T	16.37:g.3434788G>A	ENSP00000380061:p.Thr302Ile	Somatic		Capture	Illumina GAIIx	Phase_I	3374789	B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	Missense_Mutation	SNP	ENST00000396852.4	37		.	.	.	.	.	.	.	.	.	.	G	18.21	3.572825	0.65765	.	.	ENSG00000140987	ENST00000304926;ENST00000396852;ENST00000396846;ENST00000439568;ENST00000422427	T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68	3.17	1.14	0.20703	.	0.278577	0.18971	U	0.126125	T	0.71108	0.3301	H	0.94462	3.54	0.09310	N	1	D;B;B	0.89917	1.0;0.057;0.229	D;B;B	0.85130	0.997;0.039;0.072	T	0.60475	-0.7256	10	0.87932	D	0	.	5.4715	0.16672	0.2825:0.0:0.7175:0.0	.	90;90;302	B4DR24;Q9NX65;Q6WMU8	.;ZN434_HUMAN;.	I	90;302;302;13;90	ENSP00000302502:T90I;ENSP00000380061:T302I;ENSP00000380057:T302I;ENSP00000391787:T13I;ENSP00000407312:T90I	ENSP00000302502:T90I	T	-	2	0	ZNF434	3374789	0.002000	0.14202	0.163000	0.22734	0.734000	0.41952	0.411000	0.21115	0.052000	0.16007	0.655000	0.94253	ACC		0.502	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000251509.2	NM_017810	
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic		Capture	Illumina GAIIx	Phase_I	7519131	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
Unknown	0	broad.mit.edu	37	2	73927939	73927939	+	IGR	SNP	G	G	A			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr2:73927939G>A								ALMS1P (15236 upstream) : TPRKB (29017 downstream)																							CTAGTCCCGGGCAAACTGGAG	0.567																																																0			2											63.0	69.0	67.0					2																	73927939		2203	4300	6503	73781447	SO:0001628	intergenic_variant	51471																															2.37:g.73927939G>A		Somatic		Capture	Illumina GAIIx	Phase_I	73781447		Missense_Mutation	SNP		37																																																																																				0	0.567								
SOGA1	140710	broad.mit.edu	37	20	35425305	35425305	+	Silent	SNP	A	A	G			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr20:35425305A>G	ENST00000357779.3	-	13	3074	c.2748T>C	c.(2746-2748)ctT>ctC	p.L916L	SOGA1_ENST00000456801.2_Silent_p.L757L|SOGA1_ENST00000279034.6_Silent_p.L916L|SOGA1_ENST00000237536.4_Silent_p.L1154L			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	916					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.L1154L(1)		endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						CATTTCCTCCAAGCTCAACTT	0.582																																																1	Substitution - coding silent(1)	ovary(1)	20											113.0	123.0	120.0					20																	35425305		2121	4228	6349	34858719	SO:0001819	synonymous_variant	140710			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.2748T>C	20.37:g.35425305A>G		Somatic		Capture	Illumina GAIIx	Phase_I	34858719	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Silent	SNP	ENST00000357779.3	37																																																																																					0.582	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
VGLL4	9686	broad.mit.edu	37	3	11643368	11643368	+	Nonsense_Mutation	SNP	C	C	A	rs77883256	byFrequency	TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr3:11643368C>A	ENST00000413604.1	-	2	386	c.16G>T	c.(16-18)Gag>Tag	p.E6*	VGLL4_ENST00000480288.1_5'Flank|VGLL4_ENST00000430365.2_Nonsense_Mutation_p.E71*|VGLL4_ENST00000404339.1_Nonsense_Mutation_p.E70*|VGLL4_ENST00000273038.3_Nonsense_Mutation_p.E65*			Q14135	VGLL4_HUMAN	vestigial-like family member 4	65					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.E65*(1)		NS(1)|endometrium(1)|large_intestine(1)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		TCTAGGTCCTCGTCACCTGGC	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	3											136.0	128.0	131.0					3																	11643368		2203	4300	6503	11618368	SO:0001587	stop_gained	9686			D50911	CCDS2606.1, CCDS46754.1, CCDS46755.1, CCDS46756.1, CCDS68342.1, CCDS68343.1	3p25.2	2014-03-03	2014-03-03		ENSG00000144560	ENSG00000144560			28966	protein-coding gene	gene with protein product			"""vestigial like 4 (Drosophila)"""			8590280, 15140898	Standard	NM_001284390		Approved	KIAA0121	uc010hdx.1	Q14135	OTTHUMG00000129739	ENST00000413604.1:c.16G>T	3.37:g.11643368C>A	ENSP00000404624:p.Glu6*	Somatic		Capture	Illumina GAIIx	Phase_I	11618368	B4DTS7|J3KN68|Q7L5V0|Q9BQ78	Nonsense_Mutation	SNP	ENST00000413604.1	37		.	.	.	.	.	.	.	.	.	.	C	36	5.943076	0.97128	.	.	ENSG00000144560	ENST00000273038;ENST00000413604;ENST00000430365;ENST00000404339;ENST00000445411;ENST00000418000;ENST00000458499;ENST00000417206;ENST00000424709;ENST00000419541;ENST00000437722	.	.	.	5.33	4.44	0.53790	.	0.405259	0.29280	N	0.012618	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-16.3103	13.0763	0.59089	0.0:0.9212:0.0:0.0787	.	.	.	.	X	65;6;71;70;65;65;61;65;6;65;6	.	ENSP00000273038:E65X	E	-	1	0	VGLL4	11618368	1.000000	0.71417	0.329000	0.25429	0.954000	0.61252	4.219000	0.58561	1.207000	0.43291	0.655000	0.94253	GAG		0.567	VGLL4-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000339139.2	NM_014667	
POMGNT2	84892	broad.mit.edu	37	3	43121736	43121736	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr3:43121736C>T	ENST00000344697.2	-	2	1533	c.1188G>A	c.(1186-1188)atG>atA	p.M396I	POMGNT2_ENST00000441964.1_Missense_Mutation_p.M396I	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	396					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)	p.M396I(1)									TCTCTGGCATCATGTTCCGCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	3											78.0	69.0	72.0					3																	43121736		2203	4300	6503	43096740	SO:0001583	missense	84892			AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.1188G>A	3.37:g.43121736C>T	ENSP00000344125:p.Met396Ile	Somatic		Capture	Illumina GAIIx	Phase_I	43096740	B3KWC3|Q96SY3	Missense_Mutation	SNP	ENST00000344697.2	37	CCDS2709.1	.	.	.	.	.	.	.	.	.	.	C	9.167	1.020275	0.19433	.	.	ENSG00000144647	ENST00000441964;ENST00000344697	T;T	0.76060	-0.99;-0.99	5.32	2.43	0.29744	.	0.210813	0.49305	D	0.000160	T	0.51312	0.1667	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37911	-0.9685	10	0.46703	T	0.11	-22.0436	4.2354	0.10623	0.2187:0.5175:0.1805:0.0833	.	396	Q8NAT1	AGO61_HUMAN	I	396	ENSP00000408992:M396I;ENSP00000344125:M396I	ENSP00000344125:M396I	M	-	3	0	C3orf39	43096740	0.000000	0.05858	0.267000	0.24556	0.932000	0.56968	-0.637000	0.05459	1.259000	0.44117	0.650000	0.86243	ATG		0.592	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256643.1	NM_032806	
FLNB	2317	broad.mit.edu	37	3	58097923	58097923	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr3:58097923G>C	ENST00000295956.4	+	18	2788	c.2623G>C	c.(2623-2625)Gct>Cct	p.A875P	FLNB_ENST00000358537.3_Missense_Mutation_p.A875P|FLNB_ENST00000419752.2_Missense_Mutation_p.A706P|FLNB_ENST00000357272.4_Missense_Mutation_p.A875P|FLNB_ENST00000490882.1_Missense_Mutation_p.A875P|FLNB_ENST00000493452.1_Missense_Mutation_p.A706P|FLNB_ENST00000348383.5_Missense_Mutation_p.A875P|FLNB_ENST00000429972.2_Missense_Mutation_p.A875P	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	875					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.A875P(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CACCAAGGGGGCTGGGAAAGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	3											109.0	112.0	111.0					3																	58097923		2203	4300	6503	58072963	SO:0001583	missense	2317			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.2623G>C	3.37:g.58097923G>C	ENSP00000295956:p.Ala875Pro	Somatic		Capture	Illumina GAIIx	Phase_I	58072963	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	G	33	5.279472	0.95489	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24;-2.24;-2.24;-2.24;-2.24	5.29	5.29	0.74685	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.96228	0.8770	H	0.97516	4.02	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;1.0;1.0;1.0	D	0.97698	1.0183	10	0.87932	D	0	.	18.9418	0.92608	0.0:0.0:1.0:0.0	.	875;875;706;706;875;875	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	P	875;875;875;875;875;875;706;706	ENSP00000295956:A875P;ENSP00000420213:A875P;ENSP00000351339:A875P;ENSP00000415599:A875P;ENSP00000232447:A875P;ENSP00000349819:A875P;ENSP00000418510:A706P;ENSP00000414532:A706P	ENSP00000295956:A875P	A	+	1	0	FLNB	58072963	1.000000	0.71417	0.609000	0.28983	0.982000	0.71751	9.866000	0.99616	2.488000	0.83962	0.655000	0.94253	GCT		0.498	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
TMPRSS7	344805	broad.mit.edu	37	3	111795730	111795730	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr3:111795730G>C	ENST00000452346.2	+	16	1966	c.1963G>C	c.(1963-1965)Gat>Cat	p.D655H	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.D529H			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	655	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.D384H(1)		breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						CAGGCTGTCAGATCCCACACC	0.448																																																1	Substitution - Missense(1)	ovary(1)	3											172.0	166.0	168.0					3																	111795730		1982	4180	6162	113278420	SO:0001583	missense	344805			BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.1963G>C	3.37:g.111795730G>C	ENSP00000398236:p.Asp655His	Somatic		Capture	Illumina GAIIx	Phase_I	113278420	C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	ENST00000452346.2	37		.	.	.	.	.	.	.	.	.	.	G	23.0	4.364284	0.82463	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	D;D	0.89617	-2.54;-2.54	6.11	6.11	0.99139	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.92479	0.7612	L	0.42529	1.33	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.92226	0.5788	10	0.59425	D	0.04	.	17.651	0.88164	0.0:0.0:1.0:0.0	.	655;529	Q7RTY8;Q7RTY8-2	TMPS7_HUMAN;.	H	655;643;629;529	ENSP00000398236:D655H;ENSP00000411645:D529H	ENSP00000411645:D529H	D	+	1	0	TMPRSS7	113278420	1.000000	0.71417	0.987000	0.45799	0.837000	0.47467	6.964000	0.76061	2.906000	0.99361	0.655000	0.94253	GAT		0.448	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
UROC1	131669	broad.mit.edu	37	3	126219626	126219626	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr3:126219626C>T	ENST00000290868.2	-	11	1110	c.1057G>A	c.(1057-1059)Ggc>Agc	p.G353S	UROC1_ENST00000383579.3_Missense_Mutation_p.G413S	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	353					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)	p.G353S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		GGGTAGTAGCCGCCATTGAAC	0.607																																																1	Substitution - Missense(1)	ovary(1)	3											106.0	100.0	102.0					3																	126219626		2203	4300	6503	127702316	SO:0001583	missense	131669			AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.1057G>A	3.37:g.126219626C>T	ENSP00000290868:p.Gly353Ser	Somatic		Capture	Illumina GAIIx	Phase_I	127702316	E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	ENST00000290868.2	37	CCDS3038.1	.	.	.	.	.	.	.	.	.	.	c	22.7	4.321938	0.81580	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.71103	-0.54;-0.54	4.94	4.07	0.47477	Urocanase domain (2);	0.109289	0.64402	D	0.000006	D	0.83464	0.5260	M	0.83774	2.66	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.76575	0.97;0.988	D	0.85161	0.0992	10	0.87932	D	0	-0.3433	11.4876	0.50363	0.0:0.8183:0.1817:0.0	.	413;353	E9PE13;Q96N76	.;HUTU_HUMAN	S	353;413	ENSP00000290868:G353S;ENSP00000373073:G413S	ENSP00000290868:G353S	G	-	1	0	UROC1	127702316	1.000000	0.71417	0.854000	0.33618	0.940000	0.58332	5.594000	0.67557	1.096000	0.41439	-0.344000	0.07964	GGC		0.607	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370325.2	NM_144639	
AMBN	258	broad.mit.edu	37	4	71472089	71472089	+	Missense_Mutation	SNP	C	C	T	rs140331879	byFrequency	TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr4:71472089C>T	ENST00000322937.6	+	13	1089	c.986C>T	c.(985-987)cCg>cTg	p.P329L	AMBN_ENST00000449493.2_Missense_Mutation_p.P314L	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	329					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)	p.P329L(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			TCCCCTATGCCGGAGGCCAAC	0.567													C|||	20	0.00399361	0.0	0.0029	5008	,	,		19515	0.0169		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	4											62.0	61.0	61.0					4																	71472089		2203	4300	6503	71506678	SO:0001583	missense	258			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.986C>T	4.37:g.71472089C>T	ENSP00000313809:p.Pro329Leu	Somatic		Capture	Illumina GAIIx	Phase_I	71506678	Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	ENST00000322937.6	37	CCDS3543.1	14	0.00641025641025641	0	0.0	1	0.0027624309392265192	13	0.022727272727272728	0	0.0	C	9.225	1.034382	0.19590	.	.	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.30714	1.52;1.52	5.79	-0.696	0.11287	.	0.812013	0.11105	N	0.599212	T	0.13072	0.0317	L	0.59436	1.845	0.09310	N	0.999999	B	0.29612	0.251	B	0.27608	0.081	T	0.20638	-1.0269	10	0.59425	D	0.04	0.5528	4.3771	0.11275	0.4659:0.2914:0.0:0.2428	.	329	Q9NP70	AMBN_HUMAN	L	329;328;314	ENSP00000313809:P329L;ENSP00000391234:P314L	ENSP00000313809:P329L	P	+	2	0	AMBN	71506678	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.193000	0.17116	-0.155000	0.11098	-0.793000	0.03317	CCG		0.567	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252165.1	NM_016519	
MAST4	375449	broad.mit.edu	37	5	66448676	66448676	+	Silent	SNP	A	A	T			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr5:66448676A>T	ENST00000403625.2	+	25	3802	c.3507A>T	c.(3505-3507)acA>acT	p.T1169T	MAST4_ENST00000403666.1_Silent_p.T980T|MAST4_ENST00000404260.3_Silent_p.T1172T|MAST4_ENST00000261569.7_Silent_p.T975T|MAST4_ENST00000405643.1_Silent_p.T990T	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	1172	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.T1069T(1)		breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		ACATCTATACAGTGCACCATA	0.498																																																1	Substitution - coding silent(1)	ovary(1)	5											48.0	47.0	48.0					5																	66448676		1974	4142	6116	66484432	SO:0001819	synonymous_variant	375449			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.3507A>T	5.37:g.66448676A>T		Somatic		Capture	Illumina GAIIx	Phase_I	66484432	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Silent	SNP	ENST00000403625.2	37	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	A	5.393	0.257652	0.10239	.	.	ENSG00000069020	ENST00000443808	.	.	.	6.17	-12.3	0.00002	.	.	.	.	.	T	0.32971	0.0847	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44574	-0.9319	4	.	.	.	-22.095	3.3878	0.07278	0.2077:0.4017:0.2495:0.1411	.	.	.	.	C	226	.	.	S	+	1	0	MAST4	66484432	0.000000	0.05858	0.077000	0.20336	0.653000	0.38743	-2.778000	0.00775	-3.053000	0.00259	-1.117000	0.02048	AGT		0.498	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
HIST1H1T	3010	broad.mit.edu	37	6	26107987	26107987	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr6:26107987C>G	ENST00000338379.4	-	1	377	c.335G>C	c.(334-336)aGt>aCt	p.S112T		NM_005323.3	NP_005314.2	P22492	H1T_HUMAN	histone cluster 1, H1t	112	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				binding of sperm to zona pellucida (GO:0007339)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|nucleosome assembly (GO:0006334)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S112T(1)		breast(2)|endometrium(1)|lung(3)|ovary(2)|prostate(1)	9						CACCTTCTTACTAAGCTTAAA	0.458																																																1	Substitution - Missense(1)	ovary(1)	6											93.0	90.0	91.0					6																	26107987		2203	4300	6503	26215966	SO:0001583	missense	3010			M60094	CCDS34349.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000187475	ENSG00000187475		"""Histones / Replication-dependent"""	4720	protein-coding gene	gene with protein product		142712	"""H1 histone family, member T (testis-specific)"", ""histone 1, H1t"""	H1FT		8175896, 12408966	Standard	NM_005323		Approved	H1t	uc003ngj.3	P22492	OTTHUMG00000014430	ENST00000338379.4:c.335G>C	6.37:g.26107987C>G	ENSP00000341214:p.Ser112Thr	Somatic		Capture	Illumina GAIIx	Phase_I	26215966	Q6ISI1|Q8IUE8	Missense_Mutation	SNP	ENST00000338379.4	37	CCDS34349.1	.	.	.	.	.	.	.	.	.	.	.	12.85	2.061774	0.36373	.	.	ENSG00000187475	ENST00000338379	T	0.10477	2.87	5.38	1.3	0.21679	Histone H1/H5 (2);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.360243	0.30714	N	0.009030	T	0.06371	0.0164	L	0.60957	1.885	0.25959	N	0.982652	P	0.41569	0.755	P	0.45660	0.489	T	0.11817	-1.0572	10	0.66056	D	0.02	-19.109	8.6391	0.33966	0.0:0.5711:0.0:0.4289	.	112	P22492	H1T_HUMAN	T	112	ENSP00000341214:S112T	ENSP00000341214:S112T	S	-	2	0	HIST1H1T	26215966	0.000000	0.05858	0.614000	0.29051	0.091000	0.18340	-2.693000	0.00829	0.380000	0.24823	0.655000	0.94253	AGT		0.458	HIST1H1T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040093.2	NM_005323	
HSPA1L	3305	broad.mit.edu	37	6	31779014	31779014	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr6:31779014C>G	ENST00000375654.4	-	2	925	c.736G>C	c.(736-738)Gag>Cag	p.E246Q	HSPA1L_ENST00000417199.3_Missense_Mutation_p.E246Q	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	246					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.E246Q(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						CTCTTGAACTCCTCCACGAAG	0.572																																																1	Substitution - Missense(1)	ovary(1)	6											69.0	71.0	70.0					6																	31779014		2203	4298	6501	31886993	SO:0001583	missense	3305			D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.736G>C	6.37:g.31779014C>G	ENSP00000364805:p.Glu246Gln	Somatic		Capture	Illumina GAIIx	Phase_I	31886993	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605510	0.46527	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653;ENST00000424494	T;T	0.01178	5.22;5.22	5.29	5.29	0.74685	.	0.000000	0.35067	N	0.003470	T	0.04137	0.0115	M	0.76574	2.34	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.30446	-0.9978	10	0.87932	D	0	-3.5899	16.462	0.84059	0.0:1.0:0.0:0.0	.	246	P34931	HS71L_HUMAN	Q	246;246;191;136	ENSP00000364805:E246Q;ENSP00000387691:E246Q	ENSP00000364804:E191Q	E	-	1	0	HSPA1L	31886993	1.000000	0.71417	1.000000	0.80357	0.061000	0.15899	5.907000	0.69908	2.739000	0.93911	0.585000	0.79938	GAG		0.572	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
FHL5	9457	broad.mit.edu	37	6	97051519	97051519	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr6:97051519C>A	ENST00000326771.2	+	3	410	c.30C>A	c.(28-30)taC>taA	p.Y10*	FHL5_ENST00000541107.1_Nonsense_Mutation_p.Y10*	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	10					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.Y10*(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		ACTGTCAATACTGCACAGCAT	0.328																																																1	Substitution - Nonsense(1)	ovary(1)	6											158.0	137.0	145.0					6																	97051519		2203	4300	6503	97158240	SO:0001587	stop_gained	9457			AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.30C>A	6.37:g.97051519C>A	ENSP00000326022:p.Tyr10*	Somatic		Capture	Illumina GAIIx	Phase_I	97158240	B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Nonsense_Mutation	SNP	ENST00000326771.2	37	CCDS5035.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400487	0.62177	.	.	ENSG00000112214	ENST00000541107;ENST00000326771;ENST00000450218	.	.	.	5.65	3.86	0.44501	.	0.000000	0.39834	N	0.001251	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7571	0.57341	0.0:0.8642:0.0:0.1358	.	.	.	.	X	10	.	ENSP00000326022:Y10X	Y	+	3	2	FHL5	97158240	1.000000	0.71417	1.000000	0.80357	0.260000	0.26232	2.034000	0.41145	0.716000	0.32124	0.591000	0.81541	TAC		0.328	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482	
ALDH8A1	64577	broad.mit.edu	37	6	135239875	135239875	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr6:135239875A>C	ENST00000265605.2	-	7	1210	c.1142T>G	c.(1141-1143)aTt>aGt	p.I381S	ALDH8A1_ENST00000367845.2_Missense_Mutation_p.I327S|ALDH8A1_ENST00000367847.2_Missense_Mutation_p.I331S	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	381					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)	p.I381S(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		TTCATCCTTAATGTCTGTTAT	0.502																																																1	Substitution - Missense(1)	ovary(1)	6											134.0	117.0	123.0					6																	135239875		2203	4300	6503	135281568	SO:0001583	missense	64577			AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.1142T>G	6.37:g.135239875A>C	ENSP00000265605:p.Ile381Ser	Somatic		Capture	Illumina GAIIx	Phase_I	135281568	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	37	CCDS5171.1	.	.	.	.	.	.	.	.	.	.	A	17.63	3.437710	0.62955	.	.	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847;ENST00000460753	T;T;T;T	0.76316	-1.01;1.55;-1.01;-1.01	5.72	5.72	0.89469	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.265778	0.44097	D	0.000489	T	0.59046	0.2165	L	0.31578	0.945	0.54753	D	0.999988	B;B;B	0.13594	0.008;0.006;0.008	B;B;B	0.16722	0.016;0.009;0.016	T	0.62393	-0.6864	10	0.87932	D	0	.	15.9941	0.80228	1.0:0.0:0.0:0.0	.	331;327;381	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	S	381;327;331;66	ENSP00000265605:I381S;ENSP00000356819:I327S;ENSP00000356821:I331S;ENSP00000437161:I66S	ENSP00000265605:I381S	I	-	2	0	ALDH8A1	135281568	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.163000	0.94750	2.179000	0.69175	0.533000	0.62120	ATT		0.502	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2		
ZNF107	51427	broad.mit.edu	37	7	64166798	64166798	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr7:64166798A>T	ENST00000395391.1	+	4	1491	c.116A>T	c.(115-117)tAt>tTt	p.Y39F	ZNF107_ENST00000344930.3_Missense_Mutation_p.Y39F|ZNF107_ENST00000423627.1_Missense_Mutation_p.Y39F			Q9UII5	ZN107_HUMAN	zinc finger protein 107	39					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y39F(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				AAATGTGAATATGAGAATTTA	0.393																																																1	Substitution - Missense(1)	ovary(1)	7											76.0	71.0	73.0					7																	64166798		2203	4300	6503	63804233	SO:0001583	missense	51427			AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.116A>T	7.37:g.64166798A>T	ENSP00000378789:p.Tyr39Phe	Somatic		Capture	Illumina GAIIx	Phase_I	63804233		Missense_Mutation	SNP	ENST00000395391.1	37	CCDS5527.1	.	.	.	.	.	.	.	.	.	.	.	8.892	0.954298	0.18431	.	.	ENSG00000196247	ENST00000541526;ENST00000360117;ENST00000344930;ENST00000423627;ENST00000395391	T;T;T;T	0.06768	4.95;3.26;3.26;3.26	1.13	-2.26	0.06867	.	.	.	.	.	T	0.04137	0.0115	N	0.22421	0.69	0.09310	N	1	P	0.34615	0.459	B	0.30943	0.122	T	0.35151	-0.9800	9	0.45353	T	0.12	.	1.5596	0.02592	0.358:0.3205:0.0:0.3215	.	39	Q9UII5	ZN107_HUMAN	F	39	ENSP00000353234:Y39F;ENSP00000343443:Y39F;ENSP00000400037:Y39F;ENSP00000378789:Y39F	ENSP00000343443:Y39F	Y	+	2	0	ZNF107	63804233	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	-0.908000	0.04063	-0.545000	0.06224	0.254000	0.18369	TAT		0.393	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251593.1	NM_016220	
NRG1	3084	broad.mit.edu	37	8	32620819	32620819	+	Intron	SNP	G	G	T			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr8:32620819G>T	ENST00000405005.3	+	12	1268				NRG1_ENST00000287845.5_Intron|NRG1_ENST00000539990.1_Intron|NRG1_ENST00000341377.5_Intron|NRG1_ENST00000338921.4_Intron|NRG1_ENST00000519301.1_Intron|NRG1_ENST00000521670.1_Missense_Mutation_p.R451I|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000356819.4_Intron|NRG1_ENST00000287842.3_Intron			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		ACTCATCTTAGATCTTCTTCC	0.403																																																0			8											212.0	195.0	201.0					8																	32620819		2203	4300	6503	32740361	SO:0001627	intron_variant	3084			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1269-447G>T	8.37:g.32620819G>T		Somatic		Capture	Illumina GAIIx	Phase_I	32740361	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	CCDS6085.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.459568	0.43736	.	.	ENSG00000157168	ENST00000521670	T	0.72051	-0.62	5.72	3.85	0.44370	.	.	.	.	.	T	0.49440	0.1557	N	0.08118	0	0.80722	D	1	B;B;B	0.21606	0.022;0.012;0.058	B;B;B	0.16722	0.007;0.007;0.016	T	0.52968	-0.8504	9	0.87932	D	0	.	9.9398	0.41574	0.0:0.1481:0.6997:0.1522	.	297;447;451	B7Z1D7;B0FYA9;Q02297-3	.;.;.	I	451	ENSP00000428828:R451I	ENSP00000428828:R451I	R	+	2	0	NRG1	32740361	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.860000	0.39428	2.702000	0.92279	0.650000	0.86243	AGA		0.403	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
TG	7038	broad.mit.edu	37	8	134042140	134042140	+	Nonsense_Mutation	SNP	C	C	T			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr8:134042140C>T	ENST00000220616.4	+	41	7151	c.7111C>T	c.(7111-7113)Cga>Tga	p.R2371*	TG_ENST00000542445.1_Nonsense_Mutation_p.R741*|TG_ENST00000377869.1_Nonsense_Mutation_p.R2314*|TG_ENST00000519543.1_Nonsense_Mutation_p.R504*	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2371					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.R2371*(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GACCCACATCCGAGGATTTGG	0.642																																																1	Substitution - Nonsense(1)	ovary(1)	8											47.0	48.0	48.0					8																	134042140		2203	4300	6503	134111322	SO:0001587	stop_gained	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.7111C>T	8.37:g.134042140C>T	ENSP00000220616:p.Arg2371*	Somatic		Capture	Illumina GAIIx	Phase_I	134111322	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Nonsense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	10.335392|10.335392	0.99385|0.99385	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000519178;ENST00000518108|ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543	.|.	.|.	.|.	5.47|5.47	-1.68|-1.68	0.08212|0.08212	.|.	.|1.253950	.|0.05376	.|N	.|0.536251	T|.	0.12433|.	0.0302|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.18808|.	-1.0325|.	3|.	.|0.12103	.|T	.|0.63	.|.	2.5159|2.5159	0.04667|0.04667	0.218:0.2297:0.4416:0.1108|0.218:0.2297:0.4416:0.1108	.|.	.|.	.|.	.|.	L|X	826;166|2314;1177;2371;741;504	.|.	.|ENSP00000220616:R2371X	P|R	+|+	2|1	0|2	TG|TG	134111322|134111322	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.036000|0.036000	0.12997|0.12997	0.461000|0.461000	0.21940|0.21940	-0.292000|-0.292000	0.08999|0.08999	-1.086000|-1.086000	0.02197|0.02197	CCG|CGA		0.642	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
AKNA	80709	broad.mit.edu	37	9	117113181	117113181	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr9:117113181G>C	ENST00000307564.4	-	15	3340	c.3179C>G	c.(3178-3180)aCa>aGa	p.T1060R	AKNA_ENST00000374075.5_Missense_Mutation_p.T979R|AKNA_ENST00000374088.3_Missense_Mutation_p.T1060R|AKNA_ENST00000223791.3_Missense_Mutation_p.T520R|AKNA_ENST00000374079.4_5'Flank	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1060					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.T1060R(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GATGGTCTCTGTTGGTCCACA	0.597																																																1	Substitution - Missense(1)	ovary(1)	9											80.0	80.0	80.0					9																	117113181		2203	4300	6503	116153002	SO:0001583	missense	80709			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.3179C>G	9.37:g.117113181G>C	ENSP00000303769:p.Thr1060Arg	Somatic		Capture	Illumina GAIIx	Phase_I	116153002	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	G	8.944	0.966559	0.18659	.	.	ENSG00000106948	ENST00000307564;ENST00000320310;ENST00000374088;ENST00000223791;ENST00000374075	T;T;T;T	0.14640	2.71;2.71;2.49;2.71	3.85	2.95	0.34219	.	0.962947	0.08585	N	0.923868	T	0.12732	0.0309	L	0.34521	1.04	0.09310	N	0.99999	P;B	0.35575	0.51;0.386	B;B	0.36766	0.116;0.232	T	0.27262	-1.0079	10	0.62326	D	0.03	-2.7421	8.9839	0.35980	0.0:0.0:0.7797:0.2203	.	1060;979	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	R	1060;72;1060;520;979	ENSP00000303769:T1060R;ENSP00000363201:T1060R;ENSP00000223791:T520R;ENSP00000363188:T979R	ENSP00000223791:T520R	T	-	2	0	AKNA	116153002	0.187000	0.23238	0.015000	0.15790	0.025000	0.11179	2.400000	0.44504	1.208000	0.43306	-0.261000	0.10672	ACA		0.597	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
TSPAN7	7102	broad.mit.edu	37	X	38530639	38530639	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chrX:38530639T>A	ENST00000378482.2	+	3	457	c.280T>A	c.(280-282)Ttt>Att	p.F94I	TSPAN7_ENST00000286824.6_Missense_Mutation_p.F111I|TSPAN7_ENST00000545599.1_Missense_Mutation_p.F68I|TSPAN7_ENST00000422612.2_Missense_Mutation_p.F120I|TSPAN7_ENST00000488893.1_3'UTR|TM4SF2_ENST00000465127.1_Missense_Mutation_p.F124I	NM_004615.3	NP_004606.2	P41732	TSN7_HUMAN	tetraspanin 7	94					viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)		p.F89I(1)|p.F94I(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						GTATGCCATGTTTCTGTCCCT	0.438																																																2	Substitution - Missense(2)	ovary(2)	X											371.0	313.0	333.0					X																	38530639		2202	4300	6502	38415583	SO:0001583	missense	7102			D29808	CCDS14248.1	Xp11.4	2013-02-14	2005-03-21	2005-03-21	ENSG00000156298	ENSG00000156298		"""CD molecules"", ""Tetraspanins"""	11854	protein-coding gene	gene with protein product		300096	"""transmembrane 4 superfamily member 2"", ""mental retardation, X-linked 58"""	MXS1, TM4SF2, MRX58		12070254	Standard	NM_004615		Approved	DXS1692E, TALLA-1, A15, CD231	uc004deg.4	P41732	OTTHUMG00000024090	ENST00000378482.2:c.280T>A	X.37:g.38530639T>A	ENSP00000367743:p.Phe94Ile	Somatic		Capture	Illumina GAIIx	Phase_I	38415583	B2R5W7|D3DWB1|Q8WVG5|Q9UEY9	Missense_Mutation	SNP	ENST00000378482.2	37	CCDS14248.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.486812	0.84854	.	.	ENSG00000250349;ENSG00000156298;ENSG00000156298;ENSG00000156298;ENSG00000156298	ENST00000465127;ENST00000378482;ENST00000422612;ENST00000286824;ENST00000545599	T;T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25;-1.25	5.87	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.81767	0.4892	L	0.54863	1.705	0.80722	D	1	P;P;P	0.49696	0.927;0.927;0.863	P;P;P	0.58620	0.842;0.781;0.629	T	0.79374	-0.1830	9	.	.	.	.	11.0941	0.48134	0.0:0.073:0.0:0.927	.	111;120;94	B4DDG0;B4DEA5;P41732	.;.;TSN7_HUMAN	I	124;94;120;111;68	ENSP00000417050:F124I;ENSP00000367743:F94I;ENSP00000388954:F120I;ENSP00000286824:F111I;ENSP00000441540:F68I	.	F	+	1	0	RP5-972B16.2;TSPAN7	38415583	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.698000	0.84413	0.833000	0.34828	0.486000	0.48141	TTT		0.438	TSPAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356412.1		
RB1CC1	9821	broad.mit.edu	37	8	53568620	53568622	+	In_Frame_Del	DEL	CAA	CAA	-			TCGA-23-1030-01A-02W-0486-08	TCGA-23-1030-10C-01W-0486-08	CAA	CAA	-	-	CAA	CAA	Unknown	Valid	Somatic	Phase_I	WXS	Illumina_Capture			Illumina GAIIx	b85a6d4c-613c-4f66-893d-c3846a4cf6bc	747b636b-ea6a-4a5a-94de-6606a1a9827d	g.chr8:53568620_53568622delCAA	ENST00000025008.5	-	15	4290_4292	c.3767_3769delTTG	c.(3766-3771)gttgag>gag	p.V1256del	RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_In_Frame_Del_p.V1256del|RB1CC1_ENST00000435644.2_In_Frame_Del_p.V1256del	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1256					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.V1256del(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				AACTCTTTCTCAACAACTTCTCT	0.291																																					GBM(180;1701 2102 13475 42023 52570)											1	Deletion - In frame(1)	ovary(1)	8																																								53731175	SO:0001651	inframe_deletion	9821			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.3767_3769delTTG	8.37:g.53568623_53568625delCAA	ENSP00000025008:p.Val1256del	Somatic		Capture	Illumina GAIIx	Phase_I	53731173	Q86YR4|Q8WVU9|Q92601	In_Frame_Del	DEL	ENST00000025008.5	37	CCDS34892.1																																																																																				0.291	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
