#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SNRPB	6628	genome.wustl.edu	37	20	2448390	2448390	+	Silent	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr20:2448390G>A	ENST00000438552.2	-	2	180	c.18C>T	c.(16-18)agC>agT	p.S6S	SNRPB_ENST00000339610.6_5'UTR|RP4-734P14.4_ENST00000461548.1_Nonsense_Mutation_p.Q107*|SNRPB_ENST00000381342.2_Silent_p.S6S	NM_198216.1	NP_937859.1	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptides B and B1	6					gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	10						GCATCTTGCTGCTCTTGCCCA	0.522																																																0			20											120.0	103.0	109.0					20																	2448390		2203	4300	6503	2396390	SO:0001819	synonymous_variant	6628				CCDS13026.1, CCDS13027.1	20p13	2011-10-11			ENSG00000125835	ENSG00000125835			11153	protein-coding gene	gene with protein product		182282		SNRPB1		1376292	Standard	NM_003091		Approved	COD, SmB/SmB', Sm-B/B', snRNP-B	uc002wfz.1	P14678	OTTHUMG00000031694	ENST00000438552.2:c.18C>T	20.37:g.2448390G>A		Somatic		Capture	Illumina GAIIx	4	2396390	Q15490|Q6IB35|Q9UIS5	Silent	SNP	superfamily_Sm-like ribonucleoproteins,HMMPfam_LSM,HMMSmart_SM00651	p.S6	ENST00000438552.2	37	c.18	CCDS13026.1	20																																																																																			-	superfamily_Sm-like ribonucleoproteins		0.522	SNRPB-002	KNOWN	basic|CCDS	protein_coding	SNRPB	protein_coding	OTTHUMT00000077585.2	G			2396390	-1	no_errors	NM_198216	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
TRAP1	10131	genome.wustl.edu	37	16	3713464	3713464	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr16:3713464C>T	ENST00000246957.5	-	14	1757	c.1669G>A	c.(1669-1671)Gat>Aat	p.D557N	TRAP1_ENST00000538171.1_Missense_Mutation_p.D504N|DNASE1_ENST00000414110.2_Intron|TRAP1_ENST00000573872.1_5'Flank|DNASE1_ENST00000575152.1_3'UTR|TRAP1_ENST00000575671.1_Missense_Mutation_p.D348N	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	557					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				TTGTAGTGATCCACGACTATG	0.562																																																0			16											142.0	128.0	133.0					16																	3713464		2197	4300	6497	3653465	SO:0001583	missense	10131			AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.1669G>A	16.37:g.3713464C>T	ENSP00000246957:p.Asp557Asn	Somatic		Capture	Illumina GAIIx	4	3653465	B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Missense_Mutation	SNP	PatternScan_HSP90,superfamily_ATP_bd_ATPase,HMMPfam_HATPase_c,HMMSmart_HATPase_c,HMMPfam_HSP90,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_SSF110942	p.D557N	ENST00000246957.5	37	c.1669	CCDS10508.1	16	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146000	0.57044	.	.	ENSG00000126602	ENST00000246957;ENST00000538171	T;T	0.10477	2.87;2.87	5.83	5.83	0.93111	.	0.208986	0.49305	D	0.000156	T	0.13543	0.0328	L	0.41710	1.295	0.80722	D	1	B;B	0.24043	0.078;0.096	B;B	0.26094	0.039;0.066	T	0.03630	-1.1018	10	0.46703	T	0.11	-32.1787	19.112	0.93319	0.0:1.0:0.0:0.0	.	504;557	F5H897;Q12931	.;TRAP1_HUMAN	N	557;504	ENSP00000246957:D557N;ENSP00000442070:D504N	ENSP00000246957:D557N	D	-	1	0	TRAP1	3653465	1.000000	0.71417	0.868000	0.34077	0.295000	0.27426	7.424000	0.80242	2.764000	0.94973	0.557000	0.71058	GAT	-	HMMPfam_HSP90		0.562	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAP1	protein_coding	OTTHUMT00000251586.2	C	NM_016292		3653465	-1	no_errors	NM_016292	genbank	human	validated	54_36p	missense	SNP	1.000	T
ADCY9	115	genome.wustl.edu	37	16	4015998	4015998	+	Silent	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr16:4015998G>A	ENST00000294016.3	-	11	4378	c.3840C>T	c.(3838-3840)aaC>aaT	p.N1280N		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	1280					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						AAGGCACCAGGTTGGCAATCT	0.597																																																0			16											109.0	93.0	99.0					16																	4015998		2197	4300	6497	3955999	SO:0001819	synonymous_variant	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.3840C>T	16.37:g.4015998G>A		Somatic		Capture	Illumina GAIIx	4	3955999	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Silent	SNP	HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1	p.N1280	ENST00000294016.3	37	c.3840	CCDS32382.1	16																																																																																			-	NULL		0.597	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	protein_coding	OTTHUMT00000438076.1	G			3955999	-1	no_errors	NM_001116	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
PPAPDC2	403313	genome.wustl.edu	37	9	4662652	4662652	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr9:4662652G>T	ENST00000381883.2	+	1	355	c.277G>T	c.(277-279)Gac>Tac	p.D93Y	SPATA6L_ENST00000454239.2_Intron|SPATA6L_ENST00000223517.5_Intron|SPATA6L_ENST00000381895.5_Intron|SPATA6L_ENST00000381890.5_Intron|SPATA6L_ENST00000475086.1_Intron	NM_203453.3	NP_982278.3	Q8IY26	PPAC2_HUMAN	phosphatidic acid phosphatase type 2 domain containing 2	93						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(2)|lung(1)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.026)		GGACCGCATGGACTTGAACCC	0.716											OREG0019084	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(187;1057 3809 8526)											0			9											22.0	24.0	23.0					9																	4662652		2200	4298	6498	4652652	SO:0001583	missense	403313			AK128369	CCDS34981.1	9p24	2010-04-23			ENSG00000205808	ENSG00000205808			23682	protein-coding gene	gene with protein product	"""polyisoprenoid diphosphate phosphatase type 1"""	611666				16464866	Standard	NM_203453		Approved	FLJ90191, FLJ46512, PDP1	uc003zin.4	Q8IY26	OTTHUMG00000019466	ENST00000381883.2:c.277G>T	9.37:g.4662652G>T	ENSP00000371307:p.Asp93Tyr	Somatic	620	Capture	Illumina GAIIx	4	4652652	B3KY05|Q5JVJ6|Q8NCK9	Missense_Mutation	SNP	superfamily_AcPase_VanPerase,HMMSmart_acidPPc,HMMPfam_PAP2	p.D93Y	ENST00000381883.2	37	c.277	CCDS34981.1	9	.	.	.	.	.	.	.	.	.	.	G	15.37	2.812900	0.50527	.	.	ENSG00000205808	ENST00000381883;ENST00000537542	T	0.14766	2.48	4.76	1.56	0.23342	.	0.523497	0.19930	U	0.102882	T	0.07863	0.0197	L	0.40543	1.245	0.22629	N	0.998913	P	0.44877	0.845	B	0.34536	0.185	T	0.30208	-0.9986	10	0.66056	D	0.02	-26.6401	3.0786	0.06254	0.3303:0.221:0.4487:0.0	.	93	Q8IY26	PPAC2_HUMAN	Y	93;2	ENSP00000371307:D93Y	ENSP00000371307:D93Y	D	+	1	0	PPAPDC2	4652652	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.825000	0.27393	0.556000	0.29098	0.655000	0.94253	GAC	-	superfamily_AcPase_VanPerase		0.716	PPAPDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAPDC2	protein_coding	OTTHUMT00000051567.1	G	NM_203453		4652652	+1	no_errors	NM_203453	genbank	human	validated	54_36p	missense	SNP	0.999	T
OR52R1	119695	genome.wustl.edu	37	11	4824880	4824880	+	Missense_Mutation	SNP	C	C	T	rs150778227		TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr11:4824880C>T	ENST00000356069.2	-	1	730	c.731G>A	c.(730-732)cGt>cAt	p.R244H	MMP26_ENST00000380390.1_Intron|OR52R1_ENST00000380382.1_Missense_Mutation_p.R323H|MMP26_ENST00000477339.1_Intron	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATGGGAGGAACGTGTGCTAAA	0.473																																																0			11						C	HIS/ARG	0,4402		0,0,2201	86.0	85.0	85.0		731	5.6	1.0	11	dbSNP_134	85	1,8595	1.2+/-3.3	0,1,4297	no	missense	OR52R1	NM_001005177.3	29	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	244/316	4824880	1,12997	2201	4298	6499	4781456	SO:0001583	missense	119695			BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.731G>A	11.37:g.4824880C>T	ENSP00000348368:p.Arg244His	Somatic		Capture	Illumina GAIIx	4	4781456	Q6IFI0	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.R323H	ENST00000356069.2	37	c.968	CCDS31360.2	11	.	.	.	.	.	.	.	.	.	.	C	18.40	3.616511	0.66672	0.0	1.16E-4	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.00091	8.74;8.74	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.116326	0.39083	N	0.001462	T	0.00109	0.0003	N	0.14661	0.345	0.35573	D	0.805663	P	0.37370	0.592	B	0.18871	0.023	D	0.88826	0.3302	10	0.87932	D	0	.	18.291	0.90130	0.0:1.0:0.0:0.0	.	244	Q8NGF1	O52R1_HUMAN	H	244;323	ENSP00000348368:R244H;ENSP00000369742:R323H	ENSP00000348368:R244H	R	-	2	0	OR52R1	4781456	1.000000	0.71417	0.994000	0.49952	0.888000	0.51559	5.822000	0.69265	2.902000	0.99343	0.650000	0.86243	CGT	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.473	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52R1	protein_coding	OTTHUMT00000142183.1	C	NM_001005177		4781456	-1	no_errors	NM_001005177	genbank	human	validated	54_36p	missense	SNP	0.999	T
PEX5	5830	genome.wustl.edu	37	12	7361146	7361146	+	Silent	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr12:7361146C>T	ENST00000455147.2	+	14	1855	c.1275C>T	c.(1273-1275)acC>acT	p.T425T	PEX5_ENST00000420616.2_Silent_p.T425T|PEX5_ENST00000266563.5_Silent_p.T388T|PEX5_ENST00000266564.3_Silent_p.T417T|PEX5_ENST00000434354.2_Silent_p.T440T|PEX5_ENST00000412720.2_Silent_p.T446T	NM_001131026.1	NP_001124498.1	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5	425				T -> I (in Ref. 1; AAC50103). {ECO:0000305}.	cell development (GO:0048468)|cerebral cortex cell migration (GO:0021795)|cerebral cortex neuron differentiation (GO:0021895)|endoplasmic reticulum organization (GO:0007029)|fatty acid beta-oxidation (GO:0006635)|mitochondrial membrane organization (GO:0007006)|negative regulation of protein homotetramerization (GO:1901094)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|positive regulation of multicellular organism growth (GO:0040018)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|protein import into peroxisome matrix, translocation (GO:0016561)|protein import into peroxisome membrane (GO:0045046)|protein targeting to peroxisome (GO:0006625)|protein tetramerization (GO:0051262)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|small GTPase binding (GO:0031267)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)	21						CCTGTGAAACCCTACGAGACT	0.597																																																0			12											66.0	60.0	62.0					12																	7361146		2203	4300	6503	7252413	SO:0001819	synonymous_variant	5830			U19721	CCDS8576.1, CCDS44822.1, CCDS44823.1, CCDS44824.1, CCDS73433.1	12p	2013-01-10	2004-03-17	2004-03-19		ENSG00000139197		"""Tetratricopeptide (TTC) repeat domain containing"""	9719	protein-coding gene	gene with protein product		600414	"""peroxisome receptor 1"""	PXR1			Standard	NM_000319		Approved	PTS1R	uc010sgc.2	P50542		ENST00000455147.2:c.1275C>T	12.37:g.7361146C>T		Somatic		Capture	Illumina GAIIx	4	7252413	A8K891|B4DZ45|B7ZAD5|D3DUT8|Q15115|Q15266|Q96FN7	Silent	SNP	superfamily_SSF48452,HMMSmart_TPR,HMMPfam_TPR_1	p.T417	ENST00000455147.2	37	c.1251	CCDS44823.1	12																																																																																			-	superfamily_SSF48452		0.597	PEX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX5	protein_coding	OTTHUMT00000398611.1	C	NM_000319		7252413	+1	no_errors	NM_000319	genbank	human	reviewed	54_36p	silent	SNP	0.996	T
TP53	7157	genome.wustl.edu	37	17	7577017	7577017	+	Splice_Site	SNP	A	A	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr17:7577017A>C	ENST00000269305.4	-	8	1109		c.e8+1		TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(6)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCTTGCTTACCTCGCTTAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	16	Whole gene deletion(8)|Unknown(6)|Deletion - Frameshift(2)	bone(4)|haematopoietic_and_lymphoid_tissue(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|lung(2)|stomach(1)|urinary_tract(1)|ovary(1)	17											128.0	112.0	117.0					17																	7577017		2203	4300	6503	7517742	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.919+1T>G	17.37:g.7577017A>C		Somatic		Capture	Illumina GAIIx	4	7517742	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e7+2	ENST00000269305.4	37	c.919+2	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	8.950	0.968007	0.18659	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.81	3.72	0.42706	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7248	0.28753	0.8139:0.0:0.0:0.1861	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517742	1.000000	0.71417	0.780000	0.31762	0.217000	0.24651	7.280000	0.78610	0.855000	0.35359	0.459000	0.35465	.	-	-		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546	Intron	7517742	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	C
ADCY2	108	genome.wustl.edu	37	5	7695938	7695938	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr5:7695938C>G	ENST00000338316.4	+	6	1032	c.943C>G	c.(943-945)Ctg>Gtg	p.L315V	ADCY2_ENST00000537121.1_Missense_Mutation_p.L135V	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	315					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						AGTCCACATGCTGAATGAGCT	0.443																																																0			5											113.0	104.0	108.0					5																	7695938		2203	4300	6503	7748938	SO:0001583	missense	108			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.943C>G	5.37:g.7695938C>G	ENSP00000342952:p.Leu315Val	Somatic		Capture	Illumina GAIIx	4	7748938	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	HMMSmart_CYCc,superfamily_A/G_cyclase,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1,HMMPfam_DUF1053	p.L315V	ENST00000338316.4	37	c.943	CCDS3872.2	5	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325988	0.60743	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	D;D	0.86230	-2.09;-2.09	5.51	4.64	0.57946	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000001	D	0.95683	0.8596	H	0.99026	4.405	0.39623	D	0.970059	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.994	D	0.95897	0.8912	10	0.87932	D	0	.	8.9645	0.35867	0.0:0.7263:0.0:0.2737	.	135;315	B7Z2C1;Q08462	.;ADCY2_HUMAN	V	315;166;135	ENSP00000342952:L315V;ENSP00000444803:L135V	ENSP00000342952:L315V	L	+	1	2	ADCY2	7748938	1.000000	0.71417	1.000000	0.80357	0.686000	0.39977	1.165000	0.31822	1.446000	0.47643	0.655000	0.94253	CTG	-	HMMSmart_CYCc,superfamily_A/G_cyclase,HMMPfam_Guanylate_cyc		0.443	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	protein_coding	OTTHUMT00000206930.2	C	NM_020546		7748938	+1	no_errors	NM_020546	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
DPPA3	359787	genome.wustl.edu	37	12	7869651	7869651	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr12:7869651A>G	ENST00000345088.2	+	4	575	c.458A>G	c.(457-459)gAc>gGc	p.D153G		NM_199286.2	NP_954980.1	Q6W0C5	DPPA3_HUMAN	developmental pluripotency associated 3	153					chromatin modification (GO:0016568)|embryonic cleavage (GO:0040016)|negative regulation of DNA demethylation (GO:1901536)|protection of DNA demethylation of female pronucleus (GO:0044726)|regulation of genetic imprinting (GO:2000653)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)	8				Kidney(36;0.0887)		GGGAATCAAGACACCAAGCCA	0.378																																																0			12											80.0	82.0	81.0					12																	7869651		2203	4300	6503	7760918	SO:0001583	missense	359787			AY317075	CCDS8582.1	12p13.31	2012-10-02			ENSG00000187569	ENSG00000187569			19199	protein-coding gene	gene with protein product		608408					Standard	NM_199286		Approved	Stella	uc001qtf.3	Q6W0C5	OTTHUMG00000168434	ENST00000345088.2:c.458A>G	12.37:g.7869651A>G	ENSP00000339250:p.Asp153Gly	Somatic		Capture	Illumina GAIIx	4	7760918	Q0P5U3|Q6JZS6	Missense_Mutation	SNP	NULL	p.D153G	ENST00000345088.2	37	c.458	CCDS8582.1	12	.	.	.	.	.	.	.	.	.	.	A	6.746	0.506496	0.12883	.	.	ENSG00000187569	ENST00000345088	T	0.46063	0.88	2.45	-1.4	0.08968	.	.	.	.	.	T	0.24509	0.0594	N	0.24115	0.695	0.09310	N	1	B	0.27910	0.193	B	0.30646	0.118	T	0.24440	-1.0160	9	0.46703	T	0.11	.	2.9208	0.05768	0.4583:0.2443:0.2974:0.0	.	153	Q6W0C5	DPPA3_HUMAN	G	153	ENSP00000339250:D153G	ENSP00000339250:D153G	D	+	2	0	DPPA3	7760918	0.003000	0.15002	0.002000	0.10522	0.003000	0.03518	0.401000	0.20948	-0.321000	0.08627	-0.464000	0.05259	GAC	-	NULL		0.378	DPPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA3	protein_coding	OTTHUMT00000399718.1	A	NM_199286		7760918	+1	no_errors	NM_199286	genbank	human	reviewed	54_36p	missense	SNP	0.002	G
GATA3	2625	genome.wustl.edu	37	10	8115829	8115829	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr10:8115829A>T	ENST00000346208.3	+	6	1630	c.1175A>T	c.(1174-1176)aAc>aTc	p.N392I	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Missense_Mutation_p.N393I			P23771	GATA3_HUMAN	GATA binding protein 3	392					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.A395fs*54(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						AGCTCGTTTAACCCGGCCGCC	0.557			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																																Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Insertion - Frameshift(1)	breast(1)	10											100.0	102.0	101.0					10																	8115829		2203	4300	6503	8155835	SO:0001583	missense	2625			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1175A>T	10.37:g.8115829A>T	ENSP00000341619:p.Asn392Ile	Somatic		Capture	Illumina GAIIx	4	8155835	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00401,PatternScan_GATA_ZN_FINGER_1,HMMPfam_GATA	p.N393I	ENST00000346208.3	37	c.1178	CCDS7083.1	10	.	.	.	.	.	.	.	.	.	.	A	14.36	2.513607	0.44763	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.96334	-3.98;-3.95	5.26	5.26	0.73747	.	0.148164	0.56097	D	0.000021	D	0.89832	0.6829	N	0.08118	0	0.44880	D	0.997898	P;P	0.46395	0.877;0.713	B;B	0.40506	0.216;0.331	D	0.90621	0.4559	10	0.66056	D	0.02	-9.1164	9.6669	0.39990	0.9222:0.0:0.0778:0.0	.	392;393	P23771;P23771-2	GATA3_HUMAN;.	I	393;392	ENSP00000368632:N393I;ENSP00000341619:N392I	ENSP00000341619:N392I	N	+	2	0	GATA3	8155835	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.063000	0.71162	1.981000	0.57761	0.379000	0.24179	AAC	-	NULL		0.557	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	protein_coding	OTTHUMT00000046719.1	A	NM_001002295		8155835	+1	no_errors	NM_001002295	genbank	human	validated	54_36p	missense	SNP	1.000	T
CTNNBIP1	56998	genome.wustl.edu	37	1	9910818	9910818	+	Silent	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:9910818C>T	ENST00000377263.1	-	6	515	c.204G>A	c.(202-204)gtG>gtA	p.V68V	CTNNBIP1_ENST00000377258.1_Silent_p.V68V|CTNNBIP1_ENST00000377256.1_Silent_p.V68V|CTNNBIP1_ENST00000400904.3_Silent_p.V68V|CTNNBIP1_ENST00000537447.1_Silent_p.V68V|RP11-84A14.5_ENST00000454104.1_RNA	NM_001012329.1|NM_020248.2	NP_001012329.1|NP_064633.1	Q9NSA3	CNBP1_HUMAN	catenin, beta interacting protein 1	68					anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of DNA binding (GO:0043392)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)			cervix(1)|large_intestine(1)|lung(1)	3		all_lung(284;1.82e-05)|Lung NSC(185;3.08e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|Colorectal(212;7.32e-08)|COAD - Colon adenocarcinoma(227;1.73e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000912)|KIRC - Kidney renal clear cell carcinoma(229;0.00112)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		AAAACGCCATCACCACGTCCT	0.587																																																0			1											131.0	118.0	122.0					1																	9910818		2203	4300	6503	9833405	SO:0001819	synonymous_variant	56998			AB021262	CCDS106.1	1p36.22	2013-09-19	2001-11-29		ENSG00000178585	ENSG00000178585			16913	protein-coding gene	gene with protein product	"""beta-catenin-interacting protein ICAT"", ""inhibitor of beta-catenin and Tcf-4"""	607758	"""catenin, beta-interacting protein 1"""			10898789	Standard	XM_006710779		Approved	ICAT, MGC15093	uc001aql.1	Q9NSA3	OTTHUMG00000001796	ENST00000377263.1:c.204G>A	1.37:g.9910818C>T		Somatic		Capture	Illumina GAIIx	4	9833405	Q5T4V2	Silent	SNP	HMMPfam_ICAT,superfamily_beta-catenin-interacting protein ICAT	p.V68	ENST00000377263.1	37	c.204	CCDS106.1	1																																																																																			-	HMMPfam_ICAT,superfamily_beta-catenin-interacting protein ICAT		0.587	CTNNBIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNBIP1	protein_coding	OTTHUMT00000005012.1	C	NM_020248		9833405	-1	no_errors	NM_001012329	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
MARCH6	10299	genome.wustl.edu	37	5	10415676	10415676	+	Silent	SNP	T	T	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr5:10415676T>G	ENST00000274140.5	+	21	2175	c.2043T>G	c.(2041-2043)ggT>ggG	p.G681G	MARCH6_ENST00000449913.2_Silent_p.G633G|MARCH6_ENST00000510792.1_Silent_p.G379G|MARCH6_ENST00000503788.1_Silent_p.G576G	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	681					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						CTGCTTGTGGTCTCTATGTTT	0.478																																																0			5											255.0	228.0	237.0					5																	10415676		2203	4300	6503	10468676	SO:0001819	synonymous_variant	10299			AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.2043T>G	5.37:g.10415676T>G		Somatic		Capture	Illumina GAIIx	4	10468676	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Silent	SNP	superfamily_RING/U-box,HMMSmart_SM00744,HMMPfam_zf-C3HC4	p.G681	ENST00000274140.5	37	c.2043	CCDS34135.1	5																																																																																			-	NULL		0.478	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH6	protein_coding	OTTHUMT00000366919.2	T	NM_005885		10468676	+1	no_errors	NM_005885	genbank	human	provisional	54_36p	silent	SNP	0.978	G
DRAXIN	374946	genome.wustl.edu	37	1	11772023	11772023	+	Splice_Site	SNP	G	G	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:11772023G>T	ENST00000294485.5	+	4	892		c.e4+1			NM_198545.3	NP_940947.3			dorsal inhibitory axon guidance protein																		AAGAAGAAAGGTATGCCCACC	0.567																																																0			1											85.0	56.0	66.0					1																	11772023		2203	4300	6503	11694610	SO:0001630	splice_region_variant	374946			AY358750	CCDS135.1	1p36.22	2012-08-20	2012-08-14	2012-08-14	ENSG00000162490	ENSG00000162490			25054	protein-coding gene	gene with protein product	"""dorsal repulsive axon guidance protein"", ""neural tissue-specific cysteine-rich protein"""	612682	"""chromosome 1 open reading frame 187"""	C1orf187		19150847	Standard	NM_198545		Approved	FLJ34999, Draxin, Neucrin	uc001asr.1	Q8NBI3	OTTHUMG00000002227	ENST00000294485.5:c.757+1G>T	1.37:g.11772023G>T		Somatic		Capture	Illumina GAIIx	4	11694610		Splice_Site	SNP	-	e3+1	ENST00000294485.5	37	c.757+1	CCDS135.1	1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.926793	0.52759	.	.	ENSG00000162490	ENST00000294485	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8233	0.92106	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf187	11694610	1.000000	0.71417	1.000000	0.80357	0.287000	0.27160	8.780000	0.91799	2.687000	0.91594	0.655000	0.94253	.	-	-		0.567	DRAXIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf187	protein_coding	OTTHUMT00000006325.1	G	NM_198545	Intron	11694610	+1	no_errors	NM_198545	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
MFN2	9927	genome.wustl.edu	37	1	12067114	12067114	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:12067114G>T	ENST00000235329.5	+	17	2199	c.1877G>T	c.(1876-1878)tGg>tTg	p.W626L	MFN2_ENST00000444836.1_Missense_Mutation_p.W626L	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	626					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		CTGCAGGTGTGGAAGGCAGTG	0.632																																																0			1											125.0	119.0	121.0					1																	12067114		2203	4300	6503	11989701	SO:0001583	missense	9927			AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.1877G>T	1.37:g.12067114G>T	ENSP00000235329:p.Trp626Leu	Somatic		Capture	Illumina GAIIx	4	11989701	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Dynamin_N,HMMPfam_Fzo_mitofusin	p.W626L	ENST00000235329.5	37	c.1877	CCDS30587.1	1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.389985	0.42410	.	.	ENSG00000116688	ENST00000444836;ENST00000235329;ENST00000376337	D;D	0.95980	-3.87;-3.87	4.6	4.6	0.57074	Fzo/mitofusin HR2 domain (1);	0.135470	0.53938	D	0.000052	D	0.95481	0.8532	L	0.49778	1.585	0.80722	D	1	P	0.52316	0.952	P	0.60117	0.869	D	0.93148	0.6547	10	0.06494	T	0.89	-12.5313	16.6266	0.84972	0.0:0.0:1.0:0.0	.	626	O95140	MFN2_HUMAN	L	626;626;324	ENSP00000416338:W626L;ENSP00000235329:W626L	ENSP00000235329:W626L	W	+	2	0	MFN2	11989701	1.000000	0.71417	1.000000	0.80357	0.028000	0.11728	7.434000	0.80377	2.381000	0.81170	0.655000	0.94253	TGG	-	HMMPfam_Fzo_mitofusin		0.632	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN2	protein_coding	OTTHUMT00000006859.2	G	NM_014874		11989701	+1	no_errors	NM_014874	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
HIVEP1	3096	genome.wustl.edu	37	6	12120832	12120832	+	Silent	SNP	T	T	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr6:12120832T>C	ENST00000379388.2	+	4	1136	c.804T>C	c.(802-804)gcT>gcC	p.A268A		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	268					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ATATGTCTGCTGCTCAGAAGA	0.408																																																0			6											127.0	115.0	118.0					6																	12120832		1924	4151	6075	12228818	SO:0001819	synonymous_variant	3096			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.804T>C	6.37:g.12120832T>C		Somatic		Capture	Illumina GAIIx	4	12228818	B2RTU3|Q14122|Q5MPB1|Q5VW60	Silent	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.A268	ENST00000379388.2	37	c.804	CCDS43426.1	6																																																																																			-	NULL		0.408	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	protein_coding	OTTHUMT00000039870.2	T	NM_002114		12228818	+1	no_errors	NM_002114	genbank	human	validated	54_36p	silent	SNP	0.000	C
EPS8	2059	genome.wustl.edu	37	12	15811014	15811014	+	Splice_Site	SNP	A	A	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr12:15811014A>T	ENST00000281172.5	-	12	1536	c.1100T>A	c.(1099-1101)aTg>aAg	p.M367K	EPS8_ENST00000540613.1_Splice_Site_p.M107K|EPS8_ENST00000542903.1_Splice_Site_p.M107K|EPS8_ENST00000543612.1_Splice_Site_p.M367K|EPS8_ENST00000543523.1_Splice_Site_p.M367K	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	367					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		AAATCTCACCATATTTAATGG	0.343																																																0			12											59.0	60.0	60.0					12																	15811014		2203	4300	6503	15702281	SO:0001630	splice_region_variant	2059			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.1101+1T>A	12.37:g.15811014A>T		Somatic		Capture	Illumina GAIIx	4	15702281	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	HMMSmart_PTB,superfamily_SSF50729,HMMPfam_PTB,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.M367K	ENST00000281172.5	37	c.1100	CCDS31753.1	12	.	.	.	.	.	.	.	.	.	.	A	18.89	3.720504	0.68959	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000540613;ENST00000542903;ENST00000543223	T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0	5.0	5.0	0.66597	.	0.040549	0.85682	D	0.000000	T	0.23727	0.0574	L	0.49640	1.575	0.58432	D	0.999999	B	0.33120	0.398	B	0.34489	0.184	T	0.05194	-1.0900	10	0.87932	D	0	-24.5893	14.8694	0.70444	1.0:0.0:0.0:0.0	.	367	Q12929	EPS8_HUMAN	K	367;367;367;107;107;367	ENSP00000441867:M367K;ENSP00000281172:M367K;ENSP00000442388:M367K;ENSP00000441888:M107K;ENSP00000437806:M107K	ENSP00000281172:M367K	M	-	2	0	EPS8	15702281	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.271000	0.89883	2.108000	0.64289	0.477000	0.44152	ATG	-	NULL		0.343	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8	protein_coding	OTTHUMT00000401093.1	A		Missense_Mutation	15702281	-1	no_errors	NM_004447	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
OR10H1	26539	genome.wustl.edu	37	19	15918749	15918749	+	Silent	SNP	C	C	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr19:15918749C>A	ENST00000334920.2	-	1	187	c.99G>T	c.(97-99)ctG>ctT	p.L33L		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						ACAGGTACATCAGCAGGAACA	0.592																																																0			19											150.0	134.0	140.0					19																	15918749		2203	4298	6501	15779749	SO:0001819	synonymous_variant	26539			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.99G>T	19.37:g.15918749C>A		Somatic		Capture	Illumina GAIIx	4	15779749	Q6IFQ2|Q96R59	Silent	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.L33	ENST00000334920.2	37	c.99	CCDS12335.1	19																																																																																			-	superfamily_SSF81321		0.592	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H1	protein_coding	OTTHUMT00000460364.1	C			15779749	-1	no_errors	NM_013940	genbank	human	validated	54_36p	silent	SNP	0.635	A
NPC1	4864	genome.wustl.edu	37	18	21121119	21121119	+	Silent	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr18:21121119G>A	ENST00000269228.5	-	16	2981	c.2427C>T	c.(2425-2427)agC>agT	p.S809S	NPC1_ENST00000540608.1_5'UTR|NPC1_ENST00000412552.2_Silent_p.S491S	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	809					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AGGCCTGGACGCTTGTTCCAT	0.473																																																0			18											109.0	106.0	107.0					18																	21121119		2203	4300	6503	19375117	SO:0001819	synonymous_variant	4864			AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.2427C>T	18.37:g.21121119G>A		Somatic		Capture	Illumina GAIIx	4	19375117	B4DET3|Q9P130	Silent	SNP	HMMPfam_Patched,superfamily_SSF82866	p.S809	ENST00000269228.5	37	c.2427	CCDS11878.1	18																																																																																			-	HMMPfam_Patched		0.473	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPC1	protein_coding	OTTHUMT00000254823.2	G	NM_000271		19375117	-1	no_errors	NM_000271	genbank	human	validated	54_36p	silent	SNP	0.000	A
OR4K14	122740	genome.wustl.edu	37	14	20483062	20483062	+	Silent	SNP	T	T	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr14:20483062T>C	ENST00000305045.2	-	1	290	c.291A>G	c.(289-291)ggA>ggG	p.G97G		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GAGCCATACATCCTCCAAAGG	0.483																																																0			14											107.0	100.0	102.0					14																	20483062		2203	4300	6503	19552902	SO:0001819	synonymous_variant	122740				CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.291A>G	14.37:g.20483062T>C		Somatic		Capture	Illumina GAIIx	4	19552902	Q6IEU1|Q96R71	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G97	ENST00000305045.2	37	c.291	CCDS32027.1	14																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.483	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K14	protein_coding	OTTHUMT00000410343.1	T			19552902	-1	no_errors	NM_001004712	genbank	human	provisional	54_36p	silent	SNP	0.912	C
OR4M2	390538	genome.wustl.edu	37	15	22369419	22369419	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr15:22369419C>T	ENST00000332663.2	+	1	942	c.844C>T	c.(844-846)Cct>Tct	p.P282S	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TTTAATATTCCCTTTACGTAA	0.378																																																0			15											184.0	142.0	157.0					15																	22369419		2203	4300	6503	19870783	SO:0001583	missense	390538			AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.844C>T	15.37:g.22369419C>T	ENSP00000329467:p.Pro282Ser	Somatic		Capture	Illumina GAIIx	4	19870783	B9EH16|Q6IEY2	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.P282S	ENST00000332663.2	37	c.844	CCDS32172.1	15	.	.	.	.	.	.	.	.	.	.	.	14.69	2.611515	0.46631	.	.	ENSG00000182974	ENST00000332663	T	0.00330	8.08	2.28	2.28	0.28536	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000149	T	0.00967	0.0032	M	0.92738	3.34	0.36867	D	0.88872	D	0.89917	1.0	D	0.97110	1.0	T	0.55075	-0.8197	10	0.87932	D	0	-12.8675	10.3191	0.43756	0.0:1.0:0.0:0.0	.	282	Q8NGB6	OR4M2_HUMAN	S	282	ENSP00000329467:P282S	ENSP00000329467:P282S	P	+	1	0	OR4M2	19870783	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	5.243000	0.65395	1.297000	0.44761	0.448000	0.29417	CCT	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.378	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	OR4M2	protein_coding	OTTHUMT00000414921.1	C			19870783	+1	no_errors	NM_001004719	genbank	human	provisional	54_36p	missense	SNP	0.167	T
PLXDC2	84898	genome.wustl.edu	37	10	20534380	20534380	+	Silent	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr10:20534380G>C	ENST00000377252.4	+	13	2260	c.1419G>C	c.(1417-1419)gtG>gtC	p.V473V	PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_Silent_p.V424V	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	473					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						CCATTCTTGTGACAGTCTATA	0.473																																																0			10											284.0	243.0	257.0					10																	20534380		2203	4300	6503	20574386	SO:0001819	synonymous_variant	84898			AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.1419G>C	10.37:g.20534380G>C		Somatic		Capture	Illumina GAIIx	4	20574386	Q96E59|Q96PD9|Q96SU9	Silent	SNP	HMMPfam_PSI,HMMSmart_SM00423	p.V473	ENST00000377252.4	37	c.1419	CCDS7132.1	10																																																																																			-	NULL		0.473	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC2	protein_coding	OTTHUMT00000047101.2	G	NM_032812		20574386	+1	no_errors	NM_032812	genbank	human	provisional	54_36p	silent	SNP	1.000	C
ADAM7	8756	genome.wustl.edu	37	8	24344811	24344811	+	Missense_Mutation	SNP	G	G	A	rs146451180	byFrequency	TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr8:24344811G>A	ENST00000175238.6	+	11	1155	c.1072G>A	c.(1072-1074)Gtg>Atg	p.V358M	ADAM7_ENST00000380789.1_Missense_Mutation_p.V358M|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM7_ENST00000520720.1_Missense_Mutation_p.V130M	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	358	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		AGGAAAATGCGTGATGGACAG	0.463													G|||	17	0.00339457	0.0	0.0014	5008	,	,		20616	0.0		0.004	False		,,,				2504	0.0123															0			8						G	MET/VAL	2,4404	4.2+/-10.8	0,2,2201	107.0	80.0	89.0		1072	5.0	1.0	8	dbSNP_134	89	25,8575	17.9+/-57.8	0,25,4275	yes	missense	ADAM7	NM_003817.2	21	0,27,6476	AA,AG,GG		0.2907,0.0454,0.2076	probably-damaging	358/755	24344811	27,12979	2203	4300	6503	24400701	SO:0001583	missense	8756			AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.1072G>A	8.37:g.24344811G>A	ENSP00000175238:p.Val358Met	Somatic		Capture	Illumina GAIIx	4	24400701	A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMPfam_Disintegrin,HMMSmart_SM00050,superfamily_Blood coagulation inhibitor (disintegrin),PatternScan_DISINTEGRIN_1,HMMSmart_SM00608,HMMPfam_ADAM_CR"	p.V358M	ENST00000175238.6	37	c.1072	CCDS6045.1	8	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	13.57	2.276436	0.40294	4.54E-4	0.002907	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	T;T;T	0.37411	1.2;1.2;1.2	5.03	5.03	0.67393	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.50627	D	0.000116	T	0.58047	0.2095	M	0.78801	2.425	0.34320	D	0.686517	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71731	-0.4504	10	0.87932	D	0	.	9.4766	0.38875	0.0973:0.0:0.9027:0.0	.	130;358	E5RK87;Q9H2U9	.;ADAM7_HUMAN	M	358;358;130;173	ENSP00000175238:V358M;ENSP00000370166:V358M;ENSP00000430400:V130M	ENSP00000175238:V358M	V	+	1	0	ADAM7	24400701	0.998000	0.40836	0.995000	0.50966	0.222000	0.24845	2.890000	0.48609	2.331000	0.79229	0.561000	0.74099	GTG	-	"superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin"		0.463	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM7	protein_coding	OTTHUMT00000215150.1	G	NM_003817		24400701	+1	no_errors	NM_003817	genbank	human	validated	54_36p	missense	SNP	1.000	A
KCNA4	3739	genome.wustl.edu	37	11	30033813	30033813	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr11:30033813C>T	ENST00000328224.6	-	2	1646	c.413G>A	c.(412-414)gGa>gAa	p.G138E	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	138					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	GTAAAACCTTCcctcctcttc	0.552																																																0			11											50.0	49.0	50.0					11																	30033813		2193	4294	6487	29990389	SO:0001583	missense	3739			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.413G>A	11.37:g.30033813C>T	ENSP00000328511:p.Gly138Glu	Somatic		Capture	Illumina GAIIx	4	29990389		Missense_Mutation	SNP	HMMPfam_K_channel_TID,superfamily_POZ domain,HMMSmart_SM00225,HMMPfam_K_tetra,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.G138E	ENST00000328224.6	37	c.413	CCDS41629.1	11	.	.	.	.	.	.	.	.	.	.	C	4.149	0.026061	0.08054	.	.	ENSG00000182255	ENST00000328224	D	0.96554	-4.05	4.66	3.74	0.42951	.	1.055600	0.07635	U	0.929381	D	0.92189	0.7523	N	0.24115	0.695	0.40633	D	0.981874	B	0.02656	0.0	B	0.04013	0.001	D	0.84270	0.0488	10	0.44086	T	0.13	.	8.5109	0.33217	0.0:0.7631:0.1553:0.0816	.	138	P22459	KCNA4_HUMAN	E	138	ENSP00000328511:G138E	ENSP00000328511:G138E	G	-	2	0	KCNA4	29990389	0.765000	0.28485	0.294000	0.24946	0.513000	0.34164	1.288000	0.33296	0.942000	0.37525	0.561000	0.74099	GGA	-	NULL		0.552	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA4	protein_coding	OTTHUMT00000388074.2	C	NM_002233		29990389	-1	no_errors	NM_002233	genbank	human	reviewed	54_36p	missense	SNP	0.688	T
CCDC129	223075	genome.wustl.edu	37	7	31594114	31594114	+	Silent	SNP	G	G	A	rs200034335		TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr7:31594114G>A	ENST00000407970.3	+	3	227	c.189G>A	c.(187-189)caG>caA	p.Q63Q	CCDC129_ENST00000409210.1_5'UTR|CCDC129_ENST00000482748.1_3'UTR|CCDC129_ENST00000451887.2_Silent_p.Q89Q|CCDC129_ENST00000319386.3_Silent_p.Q63Q	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	63										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AAAGTATTCAGCAGTGGCTGG	0.413																																																0			7											100.0	99.0	100.0					7																	31594114		2203	4300	6503	31560639	SO:0001819	synonymous_variant	223075			AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.189G>A	7.37:g.31594114G>A		Somatic		Capture	Illumina GAIIx	4	31560639	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Silent	SNP	PatternScan_PA2_HIS	p.Q63	ENST00000407970.3	37	c.189	CCDS5435.2	7																																																																																			-	NULL		0.413	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC129	protein_coding	OTTHUMT00000318975.1	G	NM_194300		31560639	+1	no_errors	NM_194300	genbank	human	validated	54_36p	silent	SNP	1.000	A
YARS2	51067	genome.wustl.edu	37	12	32908075	32908075	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr12:32908075G>C	ENST00000324868.8	-	1	761	c.734C>G	c.(733-735)tCt>tGt	p.S245C		NM_001040436.2	NP_001035526.1	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	245					gene expression (GO:0010467)|mitochondrial tyrosyl-tRNA aminoacylation (GO:0070184)|translation (GO:0006412)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)|tyrosine binding (GO:0072545)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	16	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	TAGTTGATCAGATCCGCCCAG	0.478											OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			12											146.0	156.0	153.0					12																	32908075		2203	4300	6503	32799342	SO:0001583	missense	51067			AF132939	CCDS31770.1	12p11.21	2014-03-19	2007-02-23		ENSG00000139131	ENSG00000139131	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	24249	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 2, mitochondrial"""	610957				15779907, 15840810	Standard	NM_001040436		Approved	FLJ13995, CGI-04, mt-TyrRS	uc001rli.3	Q9Y2Z4	OTTHUMG00000169454	ENST00000324868.8:c.734C>G	12.37:g.32908075G>C	ENSP00000320658:p.Ser245Cys	Somatic	836	Capture	Illumina GAIIx	4	32799342	D3DUW8|Q9H817	Missense_Mutation	SNP	superfamily_SSF52374,HMMPfam_tRNA-synt_1b,PatternScan_AA_TRNA_LIGASE_I,superfamily_SSF55174	p.S245C	ENST00000324868.8	37	c.734	CCDS31770.1	12	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210812	0.79240	.	.	ENSG00000139131	ENST00000324868	T	0.55413	0.52	5.86	4.92	0.64577	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.133751	0.51477	D	0.000083	T	0.76709	0.4025	H	0.94771	3.58	0.44570	D	0.997535	D	0.69078	0.997	P	0.60789	0.879	T	0.83003	-0.0176	10	0.87932	D	0	-11.8828	13.6561	0.62339	0.0:0.0:0.7398:0.2602	.	245	Q9Y2Z4	SYYM_HUMAN	C	245	ENSP00000320658:S245C	ENSP00000320658:S245C	S	-	2	0	YARS2	32799342	1.000000	0.71417	0.193000	0.23327	0.932000	0.56968	4.303000	0.59098	2.784000	0.95788	0.644000	0.83932	TCT	-	superfamily_SSF52374,HMMPfam_tRNA-synt_1b		0.478	YARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YARS2	protein_coding	OTTHUMT00000404153.1	G	NM_015936		32799342	-1	no_errors	NM_001040436	genbank	human	validated	54_36p	missense	SNP	0.987	C
RPS10	6204	genome.wustl.edu	37	6	34392999	34392999	+	Splice_Site	SNP	C	C	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr6:34392999C>A	ENST00000326199.8	-	2	94		c.e2-1		RPS10-NUDT3_ENST00000605528.1_Splice_Site|RPS10_ENST00000494077.1_Splice_Site|RPS10_ENST00000344700.3_5'Flank	NM_001014.4|NM_001203245.2|NM_001204091.1	NP_001005.1|NP_001190174.1|NP_001191020.1	P46783	RS10_HUMAN	ribosomal protein S10						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	9						GCATCAACATCTGCAAGAAGG	0.493																																					Colon(121;749 1624 4895 8687 22360)											0			6											12.0	13.0	13.0					6																	34392999		2198	4282	6480	34500977	SO:0001630	splice_region_variant	6204			U14972	CCDS4792.1	6p21.31	2011-04-05			ENSG00000124614	ENSG00000124614		"""S ribosomal proteins"""	10383	protein-coding gene	gene with protein product		603632				7772601, 9582194	Standard	NM_001014		Approved	MGC88819, S10		P46783	OTTHUMG00000014546	ENST00000326199.8:c.1-1G>T	6.37:g.34392999C>A		Somatic		Capture	Illumina GAIIx	4	34500977	B2R4E3|Q5TZC0	Splice_Site	SNP	-	e1-1	ENST00000326199.8	37	c.1-1	CCDS4792.1	6																																																																																			-	-		0.493	RPS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS10	protein_coding	OTTHUMT00000040230.1	C		Intron	34500977	-1	no_errors	NM_001014	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
NUP155	9631	genome.wustl.edu	37	5	37302961	37302961	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr5:37302961G>C	ENST00000231498.3	-	29	3570	c.3367C>G	c.(3367-3369)Ctt>Gtt	p.L1123V	NUP155_ENST00000513532.1_Missense_Mutation_p.L1059V|NUP155_ENST00000381843.2_Missense_Mutation_p.L1064V|NUP155_ENST00000502533.1_5'UTR	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	1123					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTGGCACTAAGAATGGCTCGA	0.373																																																0			5											133.0	134.0	133.0					5																	37302961		2203	4300	6503	37338718	SO:0001583	missense	9631			AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.3367C>G	5.37:g.37302961G>C	ENSP00000231498:p.Leu1123Val	Somatic		Capture	Illumina GAIIx	4	37338718	Q9UBE9|Q9UFL5	Missense_Mutation	SNP	HMMPfam_Nucleoporin	p.L1123V	ENST00000231498.3	37	c.3367	CCDS3921.1	5	.	.	.	.	.	.	.	.	.	.	G	11.53	1.665226	0.29604	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	T;T;T	0.77877	-1.13;-1.12;-1.12	5.44	5.44	0.79542	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.66015	0.2747	L	0.39245	1.2	0.58432	D	0.999998	B;B	0.32526	0.374;0.127	B;B	0.31101	0.097;0.124	T	0.61417	-0.7067	10	0.16420	T	0.52	.	10.4091	0.44282	0.1198:0.0:0.8802:0.0	.	1059;1123	E9PF10;O75694	.;NU155_HUMAN	V	1123;1064;1085;1059	ENSP00000231498:L1123V;ENSP00000371265:L1064V;ENSP00000422019:L1059V	ENSP00000231498:L1123V	L	-	1	0	NUP155	37338718	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.106000	0.71511	2.550000	0.86006	0.591000	0.81541	CTT	-	HMMPfam_Nucleoporin		0.373	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP155	protein_coding	OTTHUMT00000207593.2	G	NM_153485, NM_004298		37338718	-1	no_errors	NM_153485	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
NAGLU	4669	genome.wustl.edu	37	17	40693191	40693191	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr17:40693191G>A	ENST00000225927.2	+	5	1089	c.988G>A	c.(988-990)Gcc>Acc	p.A330T	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	330					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	CCTTGCCGCAGCCACCACTGC	0.577																																																0			17											70.0	62.0	64.0					17																	40693191		2203	4300	6503	37946717	SO:0001583	missense	4669				CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.988G>A	17.37:g.40693191G>A	ENSP00000225927:p.Ala330Thr	Somatic		Capture	Illumina GAIIx	4	37946717		Missense_Mutation	SNP	HMMPfam_NAGLU	p.A330T	ENST00000225927.2	37	c.988	CCDS11427.1	17	.	.	.	.	.	.	.	.	.	.	G	7.692	0.691259	0.15039	.	.	ENSG00000108784	ENST00000225927	D	0.98207	-4.79	5.07	1.95	0.26073	Alpha-N-acetylglucosaminidase, tim-barrel domain (1);	0.516889	0.21799	N	0.068943	D	0.93861	0.8036	N	0.17764	0.52	0.21762	N	0.999556	B	0.19073	0.033	B	0.21708	0.036	D	0.86473	0.1786	10	0.23302	T	0.38	-14.0686	9.5673	0.39407	0.2341:0.0:0.7659:0.0	.	330	P54802	ANAG_HUMAN	T	330	ENSP00000225927:A330T	ENSP00000225927:A330T	A	+	1	0	NAGLU	37946717	0.992000	0.36948	0.342000	0.25602	0.080000	0.17528	2.141000	0.42168	0.732000	0.32470	0.561000	0.74099	GCC	-	HMMPfam_NAGLU		0.577	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAGLU	protein_coding	OTTHUMT00000450385.1	G	NM_000263		37946717	+1	no_errors	NM_000263	genbank	human	reviewed	54_36p	missense	SNP	0.816	A
CHST14	113189	genome.wustl.edu	37	15	40764103	40764103	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr15:40764103C>G	ENST00000306243.5	+	1	944	c.691C>G	c.(691-693)Cga>Gga	p.R231G	CHST14_ENST00000559991.1_Missense_Mutation_p.R206G	NM_130468.3	NP_569735.1	Q8NCH0	CHSTE_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14	231					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|dermatan sulfate proteoglycan metabolic process (GO:0050655)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|phosphate ion binding (GO:0042301)			cervix(1)|large_intestine(1)|prostate(2)	4		all_cancers(109;2.34e-14)|all_epithelial(112;1.08e-11)|Lung NSC(122;2.95e-09)|all_lung(180;6.03e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0781)		TGGCGAGATCCGAGAGTACCA	0.597																																																0			15											84.0	93.0	90.0					15																	40764103		2203	4300	6503	38551395	SO:0001583	missense	113189			AF401222	CCDS10059.1	15q15.1	2014-09-17	2007-03-27	2007-03-27	ENSG00000169105	ENSG00000169105		"""Sulfotransferases, membrane-bound"""	24464	protein-coding gene	gene with protein product		608429	"""dermatan 4 sulfotransferase 1"""	D4ST1		11470797	Standard	NM_130468		Approved	HD4ST, D4ST-1	uc001zlw.3	Q8NCH0	OTTHUMG00000129985	ENST00000306243.5:c.691C>G	15.37:g.40764103C>G	ENSP00000307297:p.Arg231Gly	Somatic		Capture	Illumina GAIIx	4	38551395	Q6PJ31|Q6UXA0|Q96P94	Missense_Mutation	SNP	HMMPfam_Sulfotransfer_2	p.R231G	ENST00000306243.5	37	c.691	CCDS10059.1	15	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317256	0.40996	.	.	ENSG00000169105	ENST00000306243	T	0.73681	-0.77	5.01	2.95	0.34219	.	0.401882	0.23718	N	0.045256	T	0.55625	0.1932	N	0.16656	0.425	0.38037	D	0.93533	B	0.13145	0.007	B	0.14578	0.011	T	0.52823	-0.8524	10	0.26408	T	0.33	-17.6039	10.3066	0.43685	0.4841:0.5159:0.0:0.0	.	231	Q8NCH0	CHSTE_HUMAN	G	231	ENSP00000307297:R231G	ENSP00000307297:R231G	R	+	1	2	CHST14	38551395	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.317000	0.33631	1.320000	0.45209	0.655000	0.94253	CGA	-	HMMPfam_Sulfotransfer_2		0.597	CHST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST14	protein_coding	OTTHUMT00000252251.1	C	NM_130468		38551395	+1	no_errors	NM_130468	genbank	human	provisional	54_36p	missense	SNP	1.000	G
MAG	4099	genome.wustl.edu	37	19	35800951	35800951	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr19:35800951T>C	ENST00000392213.3	+	8	1565	c.1406T>C	c.(1405-1407)gTg>gCg	p.V469A	MAG_ENST00000537831.2_Missense_Mutation_p.V444A|MAG_ENST00000593348.1_3'UTR|MAG_ENST00000361922.4_Missense_Mutation_p.V469A	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	469	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			AGCGGCCTCGTGCTCACCAGC	0.687																																																0			19											57.0	51.0	53.0					19																	35800951		2203	4300	6503	40492791	SO:0001583	missense	27307			M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1406T>C	19.37:g.35800951T>C	ENSP00000376048:p.Val469Ala	Somatic		Capture	Illumina GAIIx	4	40492791	B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG,HMMPfam_C2-set_2,HMMPfam_I-set,HMMSmart_IGc2,HMMPfam_ig	p.V469A	ENST00000392213.3	37	c.1406	CCDS12455.1	19	.	.	.	.	.	.	.	.	.	.	T	13.01	2.108330	0.37242	.	.	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.13657	2.57;2.57;2.57	4.8	4.8	0.61643	.	0.513575	0.19972	N	0.101963	T	0.08268	0.0206	N	0.14661	0.345	0.23459	N	0.997636	B;B;B	0.13145	0.007;0.003;0.002	B;B;B	0.13407	0.004;0.009;0.006	T	0.31138	-0.9954	10	0.15499	T	0.54	.	12.3376	0.55075	0.0:0.0:0.0:1.0	.	506;469;469	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	A	506;469;469;444	ENSP00000355234:V469A;ENSP00000376048:V469A;ENSP00000440695:V444A	ENSP00000262624:V506A	V	+	2	0	MAG	40492791	0.961000	0.32948	1.000000	0.80357	0.904000	0.53231	1.827000	0.39102	2.020000	0.59435	0.379000	0.24179	GTG	-	superfamily_SSF48726		0.687	MAG-001	KNOWN	basic|CCDS	protein_coding	MAG	protein_coding	OTTHUMT00000466071.1	T	NM_080600		40492791	+1	no_errors	NM_002361	genbank	human	reviewed	54_36p	missense	SNP	0.888	C
EPB42	2038	genome.wustl.edu	37	15	43507498	43507498	+	Silent	SNP	G	G	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr15:43507498G>T	ENST00000441366.2	-	3	450	c.225C>A	c.(223-225)acC>acA	p.T75T	EPB42_ENST00000300215.3_Silent_p.T105T|EPB42_ENST00000540029.1_Intron	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2	75					cell morphogenesis (GO:0000902)|erythrocyte maturation (GO:0043249)|hemoglobin metabolic process (GO:0020027)|iron ion homeostasis (GO:0055072)|peptide cross-linking (GO:0018149)|regulation of cell shape (GO:0008360)|spleen development (GO:0048536)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		ATGTGGCTTGGGTCCTGTTGA	0.527																																																0			15											138.0	111.0	120.0					15																	43507498		2203	4299	6502	41294790	SO:0001819	synonymous_variant	2038			M60298	CCDS10093.1, CCDS45249.1	15q15-q21	2013-05-02			ENSG00000166947	ENSG00000166947		"""Transglutaminases"""	3381	protein-coding gene	gene with protein product	"""Erythrocyte surface protein band 4.2"""	177070				1284644	Standard	NM_000119		Approved	PA, MGC116735, MGC116737	uc001zrb.4	P16452	OTTHUMG00000130701	ENST00000441366.2:c.225C>A	15.37:g.43507498G>T		Somatic		Capture	Illumina GAIIx	4	41294790	Q4KKX0|Q4VB97	Silent	SNP	superfamily_Ig_E-set,HMMPfam_Transglut_N,superfamily_SSF54001,HMMSmart_TGc,PatternScan_TRANSGLUTAMINASES,HMMPfam_Transglut_core,superfamily_Transglut_C,HMMPfam_Transglut_C	p.T105	ENST00000441366.2	37	c.315	CCDS45249.1	15																																																																																			-	superfamily_Ig_E-set,HMMPfam_Transglut_N		0.527	EPB42-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB42	protein_coding	OTTHUMT00000432219.1	G	NM_000119		41294790	-1	no_errors	NM_000119	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
JPH2	57158	genome.wustl.edu	37	20	42744587	42744587	+	Silent	SNP	G	G	C	rs74352869	byFrequency	TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr20:42744587G>C	ENST00000372980.3	-	4	2600	c.1728C>G	c.(1726-1728)ccC>ccG	p.P576P		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	576	Pro-rich.				calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GTGGGGGCTCGGGCGGCGTGG	0.746													G|||	766	0.152955	0.2345	0.1254	5008	,	,		10507	0.0804		0.2247	False		,,,				2504	0.0634															0			20						G		672,2910		75,522,1194	4.0	5.0	5.0		1728	1.3	0.9	20	dbSNP_131	5	1430,6150		154,1122,2514	no	coding-synonymous	JPH2	NM_020433.4		229,1644,3708	CC,CG,GG		18.8654,18.7605,18.8318		576/697	42744587	2102,9060	1791	3790	5581	42178001	SO:0001819	synonymous_variant	57158			AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.1728C>G	20.37:g.42744587G>C		Somatic		Capture	Illumina GAIIx	4	42178001	E1P5X1|O95913|Q5JY74|Q9UJN4	Silent	SNP	superfamily_Histone H3 K4-specific methyltransferase SET7/9 N-terminal domain,HMMSmart_SM00698,HMMPfam_MORN,PatternScan_SUGAR_TRANSPORT_1,PatternScan_XYLOSE_ISOMERASE_1	p.P576	ENST00000372980.3	37	c.1728	CCDS13325.1	20																																																																																			-	NULL		0.746	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH2	protein_coding	OTTHUMT00000080307.1	G			42178001	-1	no_errors	NM_020433	genbank	human	reviewed	54_36p	silent	SNP	0.028	C
SLC3A1	6519	genome.wustl.edu	37	2	44513096	44513096	+	Intron	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:44513096C>T	ENST00000260649.6	+	4	841				SLC3A1_ENST00000409229.3_Intron|SLC3A1_ENST00000410056.3_Intron|SLC3A1_ENST00000409380.1_5'UTR|SLC3A1_ENST00000409387.1_Intron|SLC3A1_ENST00000409741.1_Intron	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1						amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	TGCAAAGGATCAGGGAGGGCA	0.448																																																0			2																																								44366600	SO:0001627	intron_variant	729634				CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.766-75C>T	2.37:g.44513096C>T		Somatic		Capture	Illumina GAIIx	4	44366600	A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	RNA	SNP	-	NULL	ENST00000260649.6	37	NULL	CCDS1819.1	2																																																																																			-	-		0.448	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT18P26	protein_coding	OTTHUMT00000250676.1	C	NM_000341		44366600	-1	pseudogene	XR_039730	genbank	human	model	54_36p	rna	SNP	0.000	T
NPC1L1	29881	genome.wustl.edu	37	7	44578506	44578506	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr7:44578506T>C	ENST00000289547.4	-	2	1545	c.1490A>G	c.(1489-1491)aAc>aGc	p.N497S	NPC1L1_ENST00000381160.3_Missense_Mutation_p.N497S|NPC1L1_ENST00000546276.1_Missense_Mutation_p.N497S|NPC1L1_ENST00000423141.1_Missense_Mutation_p.N497S	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	497					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GAGCGTGCGGTTGTTCTGGAA	0.547																																																0			7											142.0	124.0	130.0					7																	44578506		2203	4300	6503	44545031	SO:0001583	missense	29881				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.1490A>G	7.37:g.44578506T>C	ENSP00000289547:p.Asn497Ser	Somatic		Capture	Illumina GAIIx	4	44545031	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	HMMPfam_Patched,superfamily_SSF82866	p.N497S	ENST00000289547.4	37	c.1490	CCDS5491.1	7	.	.	.	.	.	.	.	.	.	.	t	0.424	-0.906819	0.02434	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276;ENST00000423141	D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36	5.07	5.07	0.68467	.	0.265269	0.42420	D	0.000709	T	0.79040	0.4379	N	0.16307	0.4	0.32613	N	0.524311	B;B;B;B	0.19200	0.034;0.028;0.002;0.009	B;B;B;B	0.19391	0.025;0.013;0.007;0.009	T	0.74659	-0.3591	10	0.11485	T	0.65	-19.9189	12.7542	0.57325	0.0:0.0:0.0:1.0	.	497;497;497;497	B7ZLE6;Q9UHC9-3;Q17RV5;D3DVK9	.;.;.;.	S	497	ENSP00000289547:N497S;ENSP00000370552:N497S;ENSP00000438033:N497S;ENSP00000404670:N497S	ENSP00000289547:N497S	N	-	2	0	NPC1L1	44545031	1.000000	0.71417	0.942000	0.38095	0.743000	0.42351	2.573000	0.46007	1.904000	0.55121	0.334000	0.21626	AAC	-	HMMPfam_Patched		0.547	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	NPC1L1	protein_coding	OTTHUMT00000251256.1	T	NM_013389		44545031	-1	no_errors	NM_013389	genbank	human	validated	54_36p	missense	SNP	1.000	C
WDR13	64743	genome.wustl.edu	37	X	48457119	48457119	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chrX:48457119G>A	ENST00000218056.5	+	2	561	c.56G>A	c.(55-57)cGc>cAc	p.R19H	WDR13_ENST00000376729.5_Missense_Mutation_p.R19H|WDR13_ENST00000492715.1_3'UTR	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	19						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						AACGCGTACCGCACACCAACG	0.652																																																0			X											41.0	28.0	33.0					X																	48457119		2203	4299	6502	48342063	SO:0001583	missense	64743			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.56G>A	X.37:g.48457119G>A	ENSP00000218056:p.Arg19His	Somatic		Capture	Illumina GAIIx	4	48342063	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_WD40	p.R19H	ENST00000218056.5	37	c.56	CCDS14302.1	X	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495996	0.64186	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	D;D	0.81739	-1.53;-1.53	4.53	4.53	0.55603	.	0.054916	0.85682	D	0.000000	T	0.77143	0.4087	L	0.60455	1.87	0.58432	D	0.999998	B	0.22683	0.073	B	0.17722	0.019	T	0.76526	-0.2927	10	0.59425	D	0.04	-14.9143	13.6403	0.62246	0.0:0.0:1.0:0.0	.	19	Q9H1Z4	WDR13_HUMAN	H	19	ENSP00000365919:R19H;ENSP00000218056:R19H	ENSP00000218056:R19H	R	+	2	0	WDR13	48342063	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.792000	0.91856	2.081000	0.62600	0.523000	0.50628	CGC	-	NULL		0.652	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	protein_coding	OTTHUMT00000060743.2	G			48342063	+1	no_errors	NM_017883	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
STON1	11037	genome.wustl.edu	37	2	48757105	48757105	+	5'Flank	SNP	A	A	G	rs201429893	byFrequency	TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:48757105A>G	ENST00000406226.1	+	0	0				STON1_ENST00000404752.1_5'Flank|STON1-GTF2A1L_ENST00000402114.2_5'UTR|STON1-GTF2A1L_ENST00000405008.1_5'UTR	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1						endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GTCGGACACCAGAAAAACTTT	0.652													a|||	12	0.00239617	0.0008	0.0014	5008	,	,		5661	0.0		0.0099	False		,,,				2504	0.0															0			2								6,3646		0,6,1820	8.0	9.0	9.0			-0.8	0.0	2		9	72,8064		1,70,3997	no	utr-5	STON1-GTF2A1L	NM_001198593.1		1,76,5817	GG,GA,AA		0.885,0.1643,0.6617			48757105	78,11710	1826	4068	5894	48610609	SO:0001631	upstream_gene_variant	0			AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169		2.37:g.48757105A>G	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	48610609	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Silent	SNP	NULL	p.P36	ENST00000406226.1	37	c.108	CCDS1841.1	2																																																																																			-	NULL		0.652	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	uc002rwn.1	protein_coding	OTTHUMT00000323848.2	A	NM_006873		48610609	+1	no_errors	ENST00000378305	ensembl	human	known	54_36p	silent	SNP	0.084	G
WDR6	11180	genome.wustl.edu	37	3	49052721	49052721	+	Nonstop_Mutation	SNP	A	A	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr3:49052721A>C	ENST00000608424.1	+	6	3405	c.3366A>C	c.(3364-3366)tgA>tgC	p.*1122C	WDR6_ENST00000448293.1_Nonstop_Mutation_p.*1071C|WDR6_ENST00000415265.2_Nonstop_Mutation_p.*570C|DALRD3_ENST00000496568.1_5'Flank|WDR6_ENST00000395474.3_Nonstop_Mutation_p.*1152C			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	0					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		GGTATGACTGAGGTATCCTGC	0.612																																																0			3											60.0	55.0	57.0					3																	49052721		2203	4300	6503	49027725	SO:0001578	stop_lost	11180			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.3366A>C	3.37:g.49052721A>C	ENSP00000477389:p.*1122Cysext*86	Somatic		Capture	Illumina GAIIx	4	49027725	B4DHK2|Q3MIT1|Q9UF63	Nonstop_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.*1122C	ENST00000608424.1	37	c.3366		3	.	.	.	.	.	.	.	.	.	.	A	12.87	2.066549	0.36470	.	.	ENSG00000178252	ENST00000395474;ENST00000415265;ENST00000448293	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9527	0.58409	1.0:0.0:0.0:0.0	.	.	.	.	C	1152;570;1071	.	.	X	+	3	0	WDR6	49027725	0.992000	0.36948	0.824000	0.32777	0.334000	0.28698	1.802000	0.38853	2.110000	0.64415	0.459000	0.35465	TGA	-	NULL		0.612	WDR6-024	NOVEL	basic|appris_principal	protein_coding	WDR6	protein_coding	OTTHUMT00000471652.1	A			49027725	+1	no_errors	NM_018031	genbank	human	reviewed	54_36p	nonstop	SNP	0.300	C
ZNF224	7767	genome.wustl.edu	37	19	44611121	44611121	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr19:44611121A>C	ENST00000336976.6	+	6	1062	c.808A>C	c.(808-810)Att>Ctt	p.I270L	AC084219.4_ENST00000592946.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	270					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				GAAGGCCTTCATTCACGATTC	0.423																																																0			19											134.0	138.0	137.0					19																	44611121		2203	4300	6503	49302961	SO:0001583	missense	7767			AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.808A>C	19.37:g.44611121A>C	ENSP00000337368:p.Ile270Leu	Somatic		Capture	Illumina GAIIx	4	49302961	A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.I270L	ENST00000336976.6	37	c.808	CCDS33046.1	19	.	.	.	.	.	.	.	.	.	.	a	9.484	1.098927	0.20552	.	.	ENSG00000186019	ENST00000336976	T	0.07114	3.22	3.44	-1.93	0.07594	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05318	0.0141	N	0.17379	0.485	0.09310	N	1	P	0.42456	0.78	P	0.45232	0.474	T	0.25467	-1.0131	9	0.39692	T	0.17	.	2.046	0.03561	0.2451:0.1355:0.094:0.5253	.	270	Q9NZL3	ZN224_HUMAN	L	270	ENSP00000337368:I270L	ENSP00000337368:I270L	I	+	1	0	ZNF224	49302961	0.000000	0.05858	0.001000	0.08648	0.314000	0.28054	0.447000	0.21710	-0.675000	0.05246	0.482000	0.46254	ATT	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.423	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF224	protein_coding	OTTHUMT00000460477.1	A	NM_013398		49302961	+1	no_errors	NM_013398	genbank	human	provisional	54_36p	missense	SNP	0.063	C
FBXO46	23403	genome.wustl.edu	37	19	46216180	46216180	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr19:46216180G>C	ENST00000317683.3	-	2	707	c.574C>G	c.(574-576)Cga>Gga	p.R192G		NM_001080469.1	NP_001073938.1	Q6PJ61	FBX46_HUMAN	F-box protein 46	192										breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	15		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)		GTGGTCGGTCGTGGGTAGCTC	0.697																																																0			19											12.0	15.0	14.0					19																	46216180		2002	4147	6149	50908020	SO:0001583	missense	23403			BC021978	CCDS46116.1	19q13.3	2008-02-05	2004-06-15	2004-06-16		ENSG00000177051		"""F-boxes /  ""other"""""	25069	protein-coding gene	gene with protein product		609117	"""F-box only protein 34-like"""	FBXO34L		9585442	Standard	NM_001080469		Approved	20D7-FC4, Fbx46	uc002pcz.3	Q6PJ61		ENST00000317683.3:c.574C>G	19.37:g.46216180G>C	ENSP00000410007:p.Arg192Gly	Somatic		Capture	Illumina GAIIx	4	50908020		Missense_Mutation	SNP	superfamily_F-box domain,HMMPfam_F-box,HMMSmart_SM00256	p.R192G	ENST00000317683.3	37	c.574	CCDS46116.1	19	.	.	.	.	.	.	.	.	.	.	G	5.053	0.195459	0.09599	.	.	ENSG00000177051	ENST00000317683	.	.	.	4.12	4.12	0.48240	.	.	.	.	.	T	0.18676	0.0448	N	0.08118	0	0.09310	N	1	P	0.38300	0.626	B	0.30572	0.117	T	0.09378	-1.0677	8	0.72032	D	0.01	-19.276	11.743	0.51804	0.0:0.0:1.0:0.0	.	192	Q6PJ61	FBX46_HUMAN	G	192	.	ENSP00000410007:R192G	R	-	1	2	FBXO46	50908020	0.001000	0.12720	0.334000	0.25495	0.092000	0.18411	0.654000	0.24918	2.136000	0.66102	0.462000	0.41574	CGA	-	NULL		0.697	FBXO46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO46	protein_coding	OTTHUMT00000459661.1	G	XM_371179		50908020	-1	no_errors	NM_001080469	genbank	human	provisional	54_36p	missense	SNP	0.000	C
TRPM4	54795	genome.wustl.edu	37	19	49674985	49674985	+	Missense_Mutation	SNP	C	C	T	rs368950027		TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr19:49674985C>T	ENST00000252826.5	+	8	1135	c.1009C>T	c.(1009-1011)Cgt>Tgt	p.R337C	TRPM4_ENST00000427978.2_Missense_Mutation_p.R337C|TRPM4_ENST00000355712.5_Missense_Mutation_p.R54C|TRPM4_ENST00000601347.1_3'UTR	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	337					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		TCGAATCAGGCGTTTCTTTCC	0.642																																																0			19						C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	33.0	35.0	34.0		1009,1009	5.1	1.0	19		34	3,8597	3.0+/-9.4	0,3,4297	no	missense,missense	TRPM4	NM_001195227.1,NM_017636.3	180,180	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging,probably-damaging	337/1070,337/1215	49674985	3,13003	2203	4300	6503	54366797	SO:0001583	missense	54795			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.1009C>T	19.37:g.49674985C>T	ENSP00000252826:p.Arg337Cys	Somatic		Capture	Illumina GAIIx	4	54366797	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	HMMPfam_Ion_trans	p.R337C	ENST00000252826.5	37	c.1009	CCDS33073.1	19	.	.	.	.	.	.	.	.	.	.	C	19.58	3.855153	0.71719	0.0	3.49E-4	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	T;T;T	0.61980	1.27;1.27;0.06	5.05	5.05	0.67936	.	0.501510	0.20472	N	0.091670	T	0.74854	0.3771	L	0.52573	1.65	0.37783	D	0.927092	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;P	0.76071	0.972;0.987;0.987;0.644	T	0.78996	-0.1983	10	0.87932	D	0	-9.783	16.2632	0.82562	0.0:1.0:0.0:0.0	.	54;163;337;337	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	C	337;337;54	ENSP00000252826:R337C;ENSP00000407492:R337C;ENSP00000347944:R54C	ENSP00000252826:R337C	R	+	1	0	TRPM4	54366797	0.990000	0.36364	0.963000	0.40424	0.715000	0.41141	3.913000	0.56394	2.529000	0.85273	0.591000	0.81541	CGT	-	NULL		0.642	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM4	protein_coding	OTTHUMT00000465543.2	C	NM_017636		54366797	+1	no_errors	NM_017636	genbank	human	provisional	54_36p	missense	SNP	0.284	T
SLC17A7	57030	genome.wustl.edu	37	19	49934399	49934399	+	Splice_Site	SNP	C	C	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr19:49934399C>A	ENST00000221485.3	-	11	1433	c.1262G>T	c.(1261-1263)gGg>gTg	p.G421V	SLC17A7_ENST00000600601.1_Splice_Site_p.G354V|SLC17A7_ENST00000543531.1_Splice_Site_p.G409V	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	421					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		CACGTTGAACCCTGGCGGAGA	0.617																																																0			19											78.0	65.0	69.0					19																	49934399		2203	4300	6503	54626211	SO:0001630	splice_region_variant	57030			AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.1262-1G>T	19.37:g.49934399C>A		Somatic		Capture	Illumina GAIIx	4	54626211	B4DFR9|B4DG46|Q6PCD0	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1	p.G421V	ENST00000221485.3	37	c.1262	CCDS12764.1	19	.	.	.	.	.	.	.	.	.	.	C	24.4	4.528208	0.85706	.	.	ENSG00000104888	ENST00000221485;ENST00000543531	T;T	0.68331	-0.32;-0.32	4.38	4.38	0.52667	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.56097	D	0.000022	D	0.87321	0.6148	H	0.96662	3.86	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.91635	0.999;0.988	D	0.91349	0.5103	10	0.87932	D	0	.	14.8148	0.70024	0.0:1.0:0.0:0.0	.	421;263	Q9P2U7;A8K0Q7	VGLU1_HUMAN;.	V	421;409	ENSP00000221485:G421V;ENSP00000441767:G409V	ENSP00000221485:G421V	G	-	2	0	SLC17A7	54626211	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	7.368000	0.79567	2.462000	0.83206	0.484000	0.47621	GGG	-	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1		0.617	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A7	protein_coding	OTTHUMT00000465367.2	C		Missense_Mutation	54626211	-1	no_errors	NM_020309	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
BCAS3	54828	genome.wustl.edu	37	17	59093135	59093135	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr17:59093135T>C	ENST00000390652.5	+	16	1541	c.1510T>C	c.(1510-1512)Tat>Cat	p.Y504H	BCAS3_ENST00000407086.3_Missense_Mutation_p.Y504H|BCAS3_ENST00000589222.1_Missense_Mutation_p.Y504H|BCAS3_ENST00000585744.1_Missense_Mutation_p.Y275H|BCAS3_ENST00000408905.3_Missense_Mutation_p.Y504H|BCAS3_ENST00000588462.1_Missense_Mutation_p.Y504H|BCAS3_ENST00000588874.1_Missense_Mutation_p.Y275H	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			CCAAGACTCCTATAACAATTT	0.448																																																0			17											201.0	183.0	189.0					17																	59093135		1878	4108	5986	56447917	SO:0001583	missense	54828			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.1510T>C	17.37:g.59093135T>C	ENSP00000375067:p.Tyr504His	Somatic		Capture	Illumina GAIIx	4	56447917		Missense_Mutation	SNP	superfamily_WD40 repeat-like	p.Y504H	ENST00000390652.5	37	c.1510	CCDS45749.1	17	.	.	.	.	.	.	.	.	.	.	T	22.3	4.269196	0.80469	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000405070;ENST00000408905;ENST00000360207	T;T;T	0.32988	1.43;1.48;1.48	5.59	5.59	0.84812	.	0.065742	0.64402	D	0.000006	T	0.37758	0.1015	L	0.29908	0.895	0.50039	D	0.999841	D;P;B;D;D;D	0.58620	0.971;0.936;0.029;0.983;0.971;0.983	P;P;B;P;P;P	0.56700	0.641;0.568;0.009;0.804;0.641;0.804	T	0.06991	-1.0796	10	0.33940	T	0.23	.	15.774	0.78193	0.0:0.0:0.0:1.0	.	295;504;504;504;504;504	B4E3M9;Q9H6U6-3;Q9H6U6-8;Q9H6U6-7;Q9H6U6;Q9H6U6-2	.;.;.;.;BCAS3_HUMAN;.	H	504;504;504;504;296	ENSP00000375067:Y504H;ENSP00000385323:Y504H;ENSP00000386173:Y504H	ENSP00000353336:Y296H	Y	+	1	0	BCAS3	56447917	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.499000	0.81566	2.124000	0.65301	0.533000	0.62120	TAT	-	NULL		0.448	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS3	protein_coding	OTTHUMT00000449578.1	T	NM_017679		56447917	+1	no_errors	NM_001099432	genbank	human	validated	54_36p	missense	SNP	1.000	C
PSMC5	5705	genome.wustl.edu	37	17	61904239	61904239	+	5'Flank	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr17:61904239G>C	ENST00000310144.6	+	0	0				FTSJ3_ENST00000427159.2_Silent_p.G8G|PSMC5_ENST00000375812.4_5'Flank|PSMC5_ENST00000581882.1_5'Flank|PSMC5_ENST00000580864.1_5'Flank|FTSJ3_ENST00000580295.1_5'Flank	NM_002805.5	NP_002796.4	P62195	PRS8_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 5						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|nuclear proteasome complex (GO:0031595)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|thyrotropin-releasing hormone receptor binding (GO:0031531)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(2)|large_intestine(8)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	20						GTCGGCTCTTGCCAACTTTGC	0.562																																																0			17											95.0	90.0	92.0					17																	61904239		2203	4300	6503	59257971	SO:0001631	upstream_gene_variant	117246			L38810	CCDS11645.1, CCDS56043.1	17q23.3	2010-04-21			ENSG00000087191	ENSG00000087191		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9552	protein-coding gene	gene with protein product		601681				9473509, 9048938	Standard	NM_002805		Approved	SUG1, p45/SUG, TBP10, p45, S8, TRIP1, SUG-1	uc002jcb.3	P62195			17.37:g.61904239G>C	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	59257971	A8K3Z3|A8K763|O35051|O43208|P47210|P52915|P52916	Silent	SNP	superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_FtsJ,HMMPfam_Spb1_C	p.G8	ENST00000310144.6	37	c.24	CCDS11645.1	17																																																																																			-	NULL		0.562	PSMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJ3	protein_coding	OTTHUMT00000444404.1	G	NM_002805		59257971	-1	no_errors	NM_017647	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
CDH4	1002	genome.wustl.edu	37	20	60499506	60499506	+	Silent	SNP	C	C	T	rs559348748		TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr20:60499506C>T	ENST00000360469.5	+	11	1831	c.1743C>T	c.(1741-1743)taC>taT	p.Y581Y	CDH4_ENST00000543233.1_Silent_p.Y507Y	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	581	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			ACAACGTCTACGAGGCCACCT	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		16084	0.0		0.0	False		,,,				2504	0.001															0			20											124.0	94.0	104.0					20																	60499506		2203	4300	6503	59932901	SO:0001819	synonymous_variant	1002			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1743C>T	20.37:g.60499506C>T		Somatic		Capture	Illumina GAIIx	4	59932901	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	superfamily_Cadherin,HMMPfam_Cadherin_pro,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.Y581	ENST00000360469.5	37	c.1743	CCDS13488.1	20																																																																																			-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.647	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	protein_coding	OTTHUMT00000079965.2	C	NM_001794		59932901	+1	no_errors	NM_001794	genbank	human	reviewed	54_36p	silent	SNP	0.998	T
POLA2	23649	genome.wustl.edu	37	11	65036162	65036162	+	Nonsense_Mutation	SNP	G	G	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr11:65036162G>T	ENST00000265465.3	+	4	847	c.316G>T	c.(316-318)Gag>Tag	p.E106*	POLA2_ENST00000541089.1_5'UTR	NM_002689.2	NP_002680.2	Q14181	DPOA2_HUMAN	polymerase (DNA directed), alpha 2, accessory subunit	106	Poly-Glu.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein import into nucleus, translocation (GO:0000060)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|protein heterodimerization activity (GO:0046982)			endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	11					Dacarbazine(DB00851)	GGAAGAAGAAGAGGAAATCCT	0.398																																																0			11											105.0	100.0	101.0					11																	65036162		2201	4297	6498	64792738	SO:0001587	stop_gained	23649			BC002990	CCDS8098.1	11q13	2012-05-18	2012-05-18		ENSG00000014138	ENSG00000014138		"""DNA polymerases"""	30073	protein-coding gene	gene with protein product	"""DNA polymerase alpha subunit B"", ""DNA polymerase alpha 70 kDa subunit"""		"""polymerase (DNA directed), alpha 2 (70kD subunit)"""			8223465, 11433027	Standard	NM_002689		Approved	FLJ21662	uc001odj.3	Q14181	OTTHUMG00000165951	ENST00000265465.3:c.316G>T	11.37:g.65036162G>T	ENSP00000265465:p.Glu106*	Somatic		Capture	Illumina GAIIx	4	64792738	B4DNB4|Q9BPV3	Nonsense_Mutation	SNP	HMMPfam_Pol_alpha_B_N,HMMPfam_DNA_pol_E_B	p.E106*	ENST00000265465.3	37	c.316	CCDS8098.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.845290	0.97016	.	.	ENSG00000014138	ENST00000265465;ENST00000532391	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-27.3772	17.8657	0.88794	0.0:0.0:1.0:0.0	.	.	.	.	X	106;66	.	ENSP00000265465:E106X	E	+	1	0	POLA2	64792738	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	6.043000	0.71004	2.826000	0.97356	0.491000	0.48974	GAG	-	HMMPfam_Pol_alpha_B_N		0.398	POLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLA2	protein_coding	OTTHUMT00000387223.1	G	NM_002689		64792738	+1	no_errors	NM_002689	genbank	human	provisional	54_36p	nonsense	SNP	1.000	T
CTSF	8722	genome.wustl.edu	37	11	66330659	66330659	+	IGR	SNP	C	C	A	rs368116977		TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr11:66330659C>A	ENST00000310325.5	-	0	2035				CTD-3074O7.2_ENST00000504911.1_lincRNA|ACTN3_ENST00000502692.1_RNA|ACTN3_ENST00000513398.1_RNA	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)			endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GGAGAGCGACCTTTGACCCCA	0.607																																																0			11											41.0	44.0	43.0					11																	66330659		1993	4160	6153	66087235	SO:0001628	intergenic_variant	89			AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090		11.37:g.66330659C>A		Somatic		Capture	Illumina GAIIx	4	66087235	B2R964|O95240|Q9NSU4|Q9UKQ5	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand_Ca_insen,PatternScan_DEHYDRATASE_SER_THR	p.L901I	ENST00000310325.5	37	c.2701	CCDS8144.1	11																																																																																			-	NULL		0.607	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN3	protein_coding	OTTHUMT00000393047.1	C	NM_003793		66087235	+1	pseudogene	NM_001104	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
STARD8	9754	genome.wustl.edu	37	X	67941447	67941447	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chrX:67941447A>T	ENST00000252336.6	+	9	2450	c.2078A>T	c.(2077-2079)gAg>gTg	p.E693V	STARD8_ENST00000374599.3_Missense_Mutation_p.E773V|STARD8_ENST00000374597.3_Missense_Mutation_p.E693V	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	693	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						GAGAACCGAGAGGTGCTACAG	0.577																																																0			X											99.0	83.0	89.0					X																	67941447		2203	4300	6503	67858172	SO:0001583	missense	9754			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.2078A>T	X.37:g.67941447A>T	ENSP00000252336:p.Glu693Val	Somatic		Capture	Illumina GAIIx	4	67858172	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP,superfamily_Bet v1-like,HMMPfam_START,HMMSmart_SM00234	p.E693V	ENST00000252336.6	37	c.2078	CCDS14390.1	X	.	.	.	.	.	.	.	.	.	.	A	22.3	4.277444	0.80580	.	.	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.20069	2.1;2.1;2.1	4.15	4.15	0.48705	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.43033	0.1229	M	0.75150	2.29	0.80722	D	1	P;D	0.69078	0.935;0.997	P;D	0.70935	0.649;0.971	T	0.41556	-0.9502	10	0.87932	D	0	.	10.4115	0.44296	1.0:0.0:0.0:0.0	.	773;693	Q92502-2;Q92502	.;STAR8_HUMAN	V	693;773;693	ENSP00000252336:E693V;ENSP00000363727:E773V;ENSP00000363725:E693V	ENSP00000252336:E693V	E	+	2	0	STARD8	67858172	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.581000	0.90788	1.652000	0.50683	0.486000	0.48141	GAG	-	superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP		0.577	STARD8-201	KNOWN	basic|CCDS	protein_coding	STARD8	protein_coding	OTTHUMT00000057026.2	A	NM_014725		67858172	+1	no_errors	NM_014725	genbank	human	validated	54_36p	missense	SNP	1.000	T
EFNB1	1947	genome.wustl.edu	37	X	68059567	68059567	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chrX:68059567G>A	ENST00000204961.4	+	3	1247	c.467G>A	c.(466-468)cGc>cAc	p.R156H		NM_004429.4	NP_004420.1	P98172	EFNB1_HUMAN	ephrin-B1	156	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|embryonic pattern specification (GO:0009880)|ephrin receptor signaling pathway (GO:0048013)|neural crest cell migration (GO:0001755)|positive regulation of T cell proliferation (GO:0042102)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ephrin receptor binding (GO:0046875)			breast(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	22						TGCCGCACACGCACCATGAAG	0.572																																																0			X											82.0	59.0	67.0					X																	68059567		2203	4300	6503	67976292	SO:0001583	missense	1947			U09303	CCDS14391.1	Xq12	2011-03-09			ENSG00000090776	ENSG00000090776		"""Ephrins"""	3226	protein-coding gene	gene with protein product		300035	"""craniofrontonasal syndrome (craniofrontonasal dysplasia)"""	EPLG2, CFNS		7774950, 16526919	Standard	NM_004429		Approved	LERK2, Elk-L	uc004dxd.4	P98172	OTTHUMG00000021751	ENST00000204961.4:c.467G>A	X.37:g.68059567G>A	ENSP00000204961:p.Arg156His	Somatic		Capture	Illumina GAIIx	4	67976292	D3DVU0	Missense_Mutation	SNP	HMMPfam_Ephrin,superfamily_Cupredoxin,PatternScan_EPHRIN	p.R156H	ENST00000204961.4	37	c.467	CCDS14391.1	X	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231202	0.79688	.	.	ENSG00000090776	ENST00000204961	D	0.93547	-3.24	5.24	5.24	0.73138	Cupredoxin (2);	0.177297	0.48767	D	0.000169	D	0.90058	0.6895	L	0.28014	0.82	0.42859	D	0.994103	D	0.59767	0.986	P	0.47864	0.559	D	0.88979	0.3406	10	0.27785	T	0.31	-7.2292	15.0463	0.71830	0.0:0.0:1.0:0.0	.	156	P98172	EFNB1_HUMAN	H	156	ENSP00000204961:R156H	ENSP00000204961:R156H	R	+	2	0	EFNB1	67976292	0.182000	0.23173	0.964000	0.40570	0.970000	0.65996	2.769000	0.47654	2.435000	0.82474	0.544000	0.68410	CGC	-	HMMPfam_Ephrin,superfamily_Cupredoxin		0.572	EFNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNB1	protein_coding	OTTHUMT00000057029.1	G	NM_004429		67976292	+1	no_errors	NM_004429	genbank	human	reviewed	54_36p	missense	SNP	0.991	A
PHKA1	5255	genome.wustl.edu	37	X	71846834	71846834	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chrX:71846834A>T	ENST00000373542.4	-	17	1939	c.1780T>A	c.(1780-1782)Ttt>Att	p.F594I	PHKA1_ENST00000373539.3_Missense_Mutation_p.F594I|PHKA1_ENST00000541944.1_Missense_Mutation_p.F594I|PHKA1_ENST00000339490.3_Missense_Mutation_p.F594I|PHKA1_ENST00000373545.3_Missense_Mutation_p.F594I	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	594					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GCCCCACCAAAATACCCATCT	0.388																																																0			X											166.0	139.0	148.0					X																	71846834		2203	4300	6503	71763559	SO:0001583	missense	5255				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1780T>A	X.37:g.71846834A>T	ENSP00000362643:p.Phe594Ile	Somatic		Capture	Illumina GAIIx	4	71763559	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	HMMPfam_PHK_AB,superfamily_Six-hairpin glycosidases	p.F594I	ENST00000373542.4	37	c.1780	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	A	12.12	1.842112	0.32513	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.89939	-2.54;-2.59;-2.54;-2.57;-2.57	4.85	4.85	0.62838	Glycoside hydrolase 15-related (1);	0.109695	0.64402	D	0.000007	D	0.86020	0.5833	L	0.35593	1.075	0.58432	D	0.999998	P;B;B	0.48834	0.916;0.036;0.201	P;B;B	0.54706	0.759;0.027;0.141	T	0.82798	-0.0279	10	0.02654	T	1	-17.3519	11.3458	0.49559	1.0:0.0:0.0:0.0	.	594;594;594	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	I	594	ENSP00000362646:F594I;ENSP00000362643:F594I;ENSP00000441251:F594I;ENSP00000342469:F594I;ENSP00000362640:F594I	ENSP00000342469:F594I	F	-	1	0	PHKA1	71763559	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	8.754000	0.91642	1.577000	0.49804	0.345000	0.21793	TTT	-	HMMPfam_PHK_AB		0.388	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	protein_coding	OTTHUMT00000058896.1	A			71763559	-1	no_errors	NM_002637	genbank	human	validated	54_36p	missense	SNP	1.000	T
ALMS1	7840	genome.wustl.edu	37	2	73676187	73676187	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:73676187G>A	ENST00000264448.6	+	8	2641	c.2530G>A	c.(2530-2532)Gac>Aac	p.D844N	ALMS1_ENST00000377715.1_Missense_Mutation_p.D844N|ALMS1_ENST00000409009.1_Missense_Mutation_p.D802N	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	844	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TGGACCAGCTGACGGAAAGAC	0.507																																																0			2											76.0	78.0	78.0					2																	73676187		1894	4112	6006	73529695	SO:0001583	missense	7840			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.2530G>A	2.37:g.73676187G>A	ENSP00000264448:p.Asp844Asn	Somatic		Capture	Illumina GAIIx	4	73529695	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.D844N	ENST00000264448.6	37	c.2530	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448901	0.43531	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.19250	3.04;3.04;2.16	4.07	4.07	0.47477	.	1.368040	0.05334	N	0.528830	T	0.23370	0.0565	L	0.43152	1.355	0.09310	N	0.999995	B;B;B	0.28880	0.226;0.136;0.136	B;B;B	0.29524	0.103;0.038;0.042	T	0.13072	-1.0523	10	0.41790	T	0.15	.	12.0643	0.53580	0.0:0.0:1.0:0.0	.	844;802;844	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	N	802;844;844	ENSP00000386627:D802N;ENSP00000264448:D844N;ENSP00000366944:D844N	ENSP00000264448:D844N	D	+	1	0	ALMS1	73529695	0.009000	0.17119	0.251000	0.24312	0.032000	0.12392	1.001000	0.29783	2.559000	0.86315	0.655000	0.94253	GAC	-	NULL		0.507	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	protein_coding	OTTHUMT00000327776.1	G	NM_015120		73529695	+1	no_errors	NM_015120	genbank	human	reviewed	54_36p	missense	SNP	0.060	A
MYOZ1	58529	genome.wustl.edu	37	10	75394308	75394308	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr10:75394308C>A	ENST00000359322.4	-	4	800	c.436G>T	c.(436-438)Ggt>Tgt	p.G146C		NM_021245.3	NP_067068.1			myozenin 1											central_nervous_system(1)|large_intestine(5)|lung(2)|ovary(2)|skin(2)	12	Prostate(51;0.0112)					CCCGCGGGACCACCTGTACCC	0.632																																																0			10											57.0	60.0	59.0					10																	75394308		2203	4300	6503	75064314	SO:0001583	missense	58529			AF240633	CCDS7330.1	10q22.1	2008-07-03	2002-01-10	2002-01-11	ENSG00000177791	ENSG00000177791			13752	protein-coding gene	gene with protein product	"""calsarcin-2"""	605603	"""myozenin"""	MYOZ		11171996, 10984498	Standard	NM_021245		Approved	FATZ, CS-2	uc001jur.4	Q9NP98	OTTHUMG00000018466	ENST00000359322.4:c.436G>T	10.37:g.75394308C>A	ENSP00000352272:p.Gly146Cys	Somatic		Capture	Illumina GAIIx	4	75064314		Missense_Mutation	SNP	HMMPfam_Calsarcin	p.G146C	ENST00000359322.4	37	c.436	CCDS7330.1	10	.	.	.	.	.	.	.	.	.	.	C	15.71	2.912944	0.52439	.	.	ENSG00000177791	ENST00000359322	T	0.63417	-0.04	6.05	4.17	0.49024	.	0.346432	0.36444	N	0.002596	T	0.71350	0.3329	L	0.56769	1.78	0.51767	D	0.999939	D	0.56521	0.976	P	0.59948	0.866	T	0.71513	-0.4570	10	0.51188	T	0.08	1.0681	12.585	0.56412	0.1326:0.7402:0.1272:0.0	.	146	Q9NP98	MYOZ1_HUMAN	C	146	ENSP00000352272:G146C	ENSP00000352272:G146C	G	-	1	0	MYOZ1	75064314	0.349000	0.24870	0.999000	0.59377	0.076000	0.17211	1.203000	0.32284	0.853000	0.35312	-0.176000	0.13171	GGT	-	HMMPfam_Calsarcin		0.632	MYOZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOZ1	protein_coding	OTTHUMT00000048654.1	C			75064314	-1	no_errors	NM_021245	genbank	human	provisional	54_36p	missense	SNP	0.997	A
VCL	7414	genome.wustl.edu	37	10	75863620	75863620	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr10:75863620C>G	ENST00000211998.4	+	15	2159	c.2065C>G	c.(2065-2067)Caa>Gaa	p.Q689E	VCL_ENST00000372755.3_Missense_Mutation_p.Q689E|VCL_ENST00000478896.2_3'UTR|VCL_ENST00000417648.2_Intron	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	689	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					CCCTGGAAATCAAGCTGCTTA	0.408																																																0			10											198.0	167.0	178.0					10																	75863620		2203	4300	6503	75533626	SO:0001583	missense	7414			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.2065C>G	10.37:g.75863620C>G	ENSP00000211998:p.Gln689Glu	Somatic		Capture	Illumina GAIIx	4	75533626	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	superfamily_alpha-catenin/vinculin,HMMPfam_Vinculin,PatternScan_VINCULIN_1,PatternScan_VINCULIN_2	p.Q689E	ENST00000211998.4	37	c.2065	CCDS7341.1	10	.	.	.	.	.	.	.	.	.	.	C	13.49	2.251289	0.39797	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T	0.37058	1.22;1.22;1.22	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.56659	0.2000	L	0.50333	1.59	0.80722	D	1	B;B;P	0.44776	0.038;0.012;0.843	B;B;P	0.61800	0.01;0.01;0.894	T	0.52193	-0.8608	10	0.66056	D	0.02	.	20.2527	0.98410	0.0:1.0:0.0:0.0	.	616;689;689	F5H7T3;P18206-2;P18206	.;.;VINC_HUMAN	E	689;689;596;616;361	ENSP00000361841:Q689E;ENSP00000211998:Q689E;ENSP00000415489:Q361E	ENSP00000211998:Q689E	Q	+	1	0	VCL	75533626	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.566000	0.67372	2.788000	0.95919	0.557000	0.71058	CAA	-	HMMPfam_Vinculin,superfamily_alpha-catenin/vinculin		0.408	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	protein_coding		C	NM_003373, NM_014000		75533626	+1	no_errors	NM_014000	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
BAHCC1	57597	genome.wustl.edu	37	17	79425877	79425877	+	Silent	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr17:79425877C>T	ENST00000307745.7	+	24	5487	c.5487C>T	c.(5485-5487)ttC>ttT	p.F1829F	RP11-1055B8.8_ENST00000572590.1_RNA																							TGGAAAGCTTCGCCGTGGAGG	0.662																																																0			17											18.0	23.0	21.0					17																	79425877		2107	4218	6325	77040472	SO:0001819	synonymous_variant	57597																														ENST00000307745.7:c.5487C>T	17.37:g.79425877C>T		Somatic		Capture	Illumina GAIIx	4	77040472		Silent	SNP	HMMPfam_BAH,HMMSmart_SM00439	p.F1951	ENST00000307745.7	37	c.5853		17																																																																																			-	NULL		0.662	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	BAHCC1	protein_coding		C			77040472	+1	no_errors	NM_001080519	genbank	human	inferred	54_36p	silent	SNP	0.994	T
RSBN1L	222194	genome.wustl.edu	37	7	77408439	77408439	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr7:77408439C>T	ENST00000334955.8	+	8	2522	c.2495C>T	c.(2494-2496)tCa>tTa	p.S832L	RSBN1L_ENST00000445288.1_Missense_Mutation_p.S562L	NM_198467.2	NP_940869.2	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	832						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(12)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CAACACAGTTCAGCACATTCA	0.284																																																0			7											32.0	31.0	32.0					7																	77408439		1831	4071	5902	77246375	SO:0001583	missense	222194			AK124517	CCDS43607.1	7q21.11	2004-08-11			ENSG00000187257	ENSG00000187257			24765	protein-coding gene	gene with protein product						12477932	Standard	NM_198467		Approved	FLJ42526, FLJ45813, MGC71764	uc010ldt.1	Q6PCB5	OTTHUMG00000155517	ENST00000334955.8:c.2495C>T	7.37:g.77408439C>T	ENSP00000334040:p.Ser832Leu	Somatic		Capture	Illumina GAIIx	4	77246375	C9K0P1|Q6ZS58|Q6ZVI9|Q86X48	Missense_Mutation	SNP	NULL	p.S832L	ENST00000334955.8	37	c.2495	CCDS43607.1	7	.	.	.	.	.	.	.	.	.	.	C	13.76	2.334648	0.41297	.	.	ENSG00000187257	ENST00000334955;ENST00000445288	.	.	.	5.83	4.02	0.46733	.	0.224192	0.32287	N	0.006311	T	0.28599	0.0708	L	0.29908	0.895	0.32927	D	0.516647	B	0.12013	0.005	B	0.11329	0.006	T	0.32561	-0.9902	9	0.05525	T	0.97	-2.6742	8.1178	0.30953	0.0:0.7306:0.1305:0.1389	.	832	Q6PCB5	RSBNL_HUMAN	L	832;562	.	ENSP00000334040:S832L	S	+	2	0	RSBN1L	77246375	0.951000	0.32395	0.780000	0.31762	0.978000	0.69477	1.207000	0.32333	0.800000	0.34041	0.655000	0.94253	TCA	-	NULL		0.284	RSBN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSBN1L	protein_coding	OTTHUMT00000340455.3	C	NM_198467		77246375	+1	no_errors	NM_198467	genbank	human	validated	54_36p	missense	SNP	0.998	T
COPS4	51138	genome.wustl.edu	37	4	83971131	83971131	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr4:83971131G>A	ENST00000264389.2	+	4	539	c.404G>A	c.(403-405)gGa>gAa	p.G135E	COPS4_ENST00000503682.1_Missense_Mutation_p.G135E|COPS4_ENST00000511653.1_Missense_Mutation_p.G135E|COPS4_ENST00000509093.1_Missense_Mutation_p.G135E	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	135					cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				TTGGAAACAGGACAAAAGTAT	0.343																																																0			4											111.0	126.0	121.0					4																	83971131		2203	4299	6502	84190155	SO:0001583	missense	51138			AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.404G>A	4.37:g.83971131G>A	ENSP00000264389:p.Gly135Glu	Somatic		Capture	Illumina GAIIx	4	84190155	B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	"HMMPfam_PCI,superfamily_""Winged helix"" DNA-binding domain,HMMSmart_SM00088"	p.G135E	ENST00000264389.2	37	c.404	CCDS3600.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.456580	0.96223	.	.	ENSG00000138663	ENST00000509093;ENST00000264389;ENST00000503682;ENST00000511653	T;T;T;T	0.48201	0.84;0.85;0.82;0.82	5.64	5.64	0.86602	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.74336	0.3703	M	0.90814	3.15	0.80722	D	1	D;D;D;P	0.71674	0.993;0.994;0.998;0.778	D;D;P;P	0.68353	0.91;0.957;0.817;0.516	T	0.74609	-0.3608	10	0.31617	T	0.26	-19.3077	19.7164	0.96122	0.0:0.0:1.0:0.0	.	135;135;135;135	B3KST5;D6RFN0;D6RAX7;Q9BT78	.;.;.;CSN4_HUMAN	E	135	ENSP00000425976:G135E;ENSP00000264389:G135E;ENSP00000424791:G135E;ENSP00000424655:G135E	ENSP00000264389:G135E	G	+	2	0	COPS4	84190155	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.645000	0.98471	2.662000	0.90505	0.650000	0.86243	GGA	-	NULL		0.343	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS4	protein_coding	OTTHUMT00000252643.1	G			84190155	+1	no_errors	NM_016129	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PTPN13	5783	genome.wustl.edu	37	4	87695539	87695539	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr4:87695539T>A	ENST00000411767.2	+	33	5426	c.5363T>A	c.(5362-5364)cTc>cAc	p.L1788H	PTPN13_ENST00000511467.1_Missense_Mutation_p.L1793H|PTPN13_ENST00000436978.1_Missense_Mutation_p.L1793H|PTPN13_ENST00000316707.6_Missense_Mutation_p.L1597H|PTPN13_ENST00000427191.2_Missense_Mutation_p.L1769H			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1788	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		GTAGAACTCCTCATTACCCTA	0.363																																																0			4											32.0	31.0	31.0					4																	87695539		1824	4081	5905	87914563	SO:0001583	missense	5783				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5363T>A	4.37:g.87695539T>A	ENSP00000407249:p.Leu1788His	Somatic		Capture	Illumina GAIIx	4	87914563	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	HMMSmart_KIND,superfamily_SSF101690,HMMSmart_B41,superfamily_SSF54236,HMMPfam_FERM_N,superfamily_FERM_3-hlx,HMMPfam_FERM_M,superfamily_SSF50729,HMMPfam_FERM_C,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,superfamily_SSF52799,HMMSmart_PTPc,HMMPfam_Y_phosphatase	p.L1793H	ENST00000411767.2	37	c.5378	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	T	7.116	0.577006	0.13686	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.33	-0.915	0.10494	PDZ/DHR/GLGF (2);	0.545711	0.15091	N	0.281077	T	0.16214	0.0390	N	0.05554	-0.025	0.21984	N	0.999435	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.002;0.0;0.001;0.0	T	0.22138	-1.0225	10	0.14656	T	0.56	.	4.515	0.11930	0.5024:0.1756:0.0:0.322	.	1597;1769;1788;1793	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	H	1769;1793;1597;1788;1793;1737	ENSP00000408368:L1769H;ENSP00000394794:L1793H;ENSP00000322675:L1597H;ENSP00000407249:L1788H;ENSP00000426626:L1793H	ENSP00000322675:L1597H	L	+	2	0	PTPN13	87914563	0.004000	0.15560	0.107000	0.21349	0.927000	0.56198	0.402000	0.20965	0.102000	0.17638	0.460000	0.39030	CTC	-	superfamily_PDZ,HMMPfam_PDZ		0.363	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	protein_coding	OTTHUMT00000363191.1	T			87914563	+1	no_errors	NM_080685	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
C7orf62	219557	genome.wustl.edu	37	7	88424242	88424242	+	Silent	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr7:88424242G>A	ENST00000297203.2	-	2	200	c.15C>T	c.(13-15)gtC>gtT	p.V5V	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	5										NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						TCTGGTTATGGACCGAAAAGG	0.413																																																0			7											97.0	105.0	102.0					7																	88424242		2200	4299	6499	88262178	SO:0001819	synonymous_variant	219557			BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.15C>T	7.37:g.88424242G>A		Somatic		Capture	Illumina GAIIx	4	88262178		Silent	SNP	NULL	p.V5	ENST00000297203.2	37	c.15	CCDS34678.1	7																																																																																			-	NULL		0.413	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGC26647	protein_coding	OTTHUMT00000332714.1	G	NM_152706		88262178	-1	no_errors	NM_152706	genbank	human	predicted	54_36p	silent	SNP	0.003	A
IGKV2D-24	28885	genome.wustl.edu	37	2	90044225	90044225	+	RNA	SNP	T	T	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:90044225T>C	ENST00000462693.1	+	0	176									immunoglobulin kappa variable 2D-24 (non-functional)																		AGTCAAAGCCTCGTACACAGT	0.532																																																0			2											103.0	106.0	105.0					2																	90044225		1888	4108	5996	89681530			0			X63401		2p11.2	2012-02-08	2008-09-10		ENSG00000241566	ENSG00000241566		"""Immunoglobulins / IGK locus"""	5797	other	immunoglobulin gene			"""immunoglobulin kappa variable 2D-24"""				Standard	NG_000833		Approved				OTTHUMG00000151618		2.37:g.90044225T>C		Somatic		Capture	Illumina GAIIx	4	89681530		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv	p.L49P	ENST00000462693.1	37	c.146		2																																																																																			-	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv		0.532	IGKV2D-24-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211624	IG_V_gene	OTTHUMT00000323290.1	T	NG_000833		89681530	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390269	ensembl	human	known	54_36p	missense	SNP	0.145	C
IGKV2D-24	28885	genome.wustl.edu	37	2	90044380	90044380	+	RNA	SNP	A	A	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:90044380A>T	ENST00000462693.1	+	0	331									immunoglobulin kappa variable 2D-24 (non-functional)																		ACTGAAAATCAGCAGGGTGGA	0.507																																																0			2											123.0	120.0	121.0					2																	90044380		1876	4099	5975	89681685			0			X63401		2p11.2	2012-02-08	2008-09-10		ENSG00000241566	ENSG00000241566		"""Immunoglobulins / IGK locus"""	5797	other	immunoglobulin gene			"""immunoglobulin kappa variable 2D-24"""				Standard	NG_000833		Approved				OTTHUMG00000151618		2.37:g.90044380A>T		Somatic		Capture	Illumina GAIIx	4	89681685		Missense_Mutation	SNP	HMMSmart_IGv,HMMPfam_V-set,superfamily_SSF48726	p.S101C	ENST00000462693.1	37	c.301		2																																																																																			-	HMMSmart_IGv,HMMPfam_V-set,superfamily_SSF48726		0.507	IGKV2D-24-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211624	IG_V_gene	OTTHUMT00000323290.1	A	NG_000833		89681685	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390269	ensembl	human	known	54_36p	missense	SNP	1.000	T
KCNK13	56659	genome.wustl.edu	37	14	90650588	90650588	+	Silent	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr14:90650588C>T	ENST00000282146.4	+	2	909	c.468C>T	c.(466-468)atC>atT	p.I156I		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	156					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				TCGCCTACATCATGAAGTCGT	0.582																																																0			14											90.0	93.0	92.0					14																	90650588		2203	4300	6503	89720341	SO:0001819	synonymous_variant	56659			AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.468C>T	14.37:g.90650588C>T		Somatic		Capture	Illumina GAIIx	4	89720341	B5TJL8|Q96E79	Silent	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans_2	p.I156	ENST00000282146.4	37	c.468	CCDS9889.1	14																																																																																			-	superfamily_Voltage-gated potassium channels		0.582	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK13	protein_coding	OTTHUMT00000411251.1	C	NM_022054		89720341	+1	no_errors	NM_022054	genbank	human	reviewed	54_36p	silent	SNP	0.971	T
FAT3	120114	genome.wustl.edu	37	11	92533847	92533847	+	Silent	SNP	A	A	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr11:92533847A>G	ENST00000298047.6	+	9	7685	c.7668A>G	c.(7666-7668)gaA>gaG	p.E2556E	FAT3_ENST00000409404.2_Silent_p.E2556E|FAT3_ENST00000525166.1_Silent_p.E2406E			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2556	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCACCACAGAAAGGCTAGACC	0.488										TCGA Ovarian(4;0.039)																																						0			11											50.0	49.0	50.0					11																	92533847		1986	4160	6146	92173495	SO:0001819	synonymous_variant	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7668A>G	11.37:g.92533847A>G		Somatic		Capture	Illumina GAIIx	4	92173495	B5MDB0|Q96AU6	Silent	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Concanavalin A-like lectins/glucanases,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00179,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2	p.E2556	ENST00000298047.6	37	c.7668		11																																																																																			-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.488	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		A	NM_001008781		92173495	+1	no_errors	NM_001008781	genbank	human	validated	54_36p	silent	SNP	1.000	G
CNN3	1266	genome.wustl.edu	37	1	95363310	95363310	+	Silent	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:95363310G>A	ENST00000370206.4	-	7	1361	c.978C>T	c.(976-978)ggC>ggT	p.G326G	CNN3_ENST00000538964.1_Silent_p.G326G|CNN3_ENST00000545882.1_Silent_p.G285G|CNN3_ENST00000394202.4_Silent_p.G280G|CNN3_ENST00000487539.1_5'Flank	NM_001839.3	NP_001830.1	Q15417	CNN3_HUMAN	calponin 3, acidic	326	Asp/Glu-rich (acidic).				actomyosin structure organization (GO:0031032)|epithelial cell differentiation (GO:0030855)	focal adhesion (GO:0005925)				breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|stomach(1)|urinary_tract(2)	18		all_lung(203;0.00206)|Lung NSC(277;0.00948)		all cancers(265;0.0325)|Epithelial(280;0.0861)		AATAATCAATGCCTTGGTCGC	0.408																																																0			1											174.0	158.0	163.0					1																	95363310		2203	4300	6503	95135898	SO:0001819	synonymous_variant	1266			BC025372	CCDS30775.1, CCDS65592.1, CCDS65593.1	1p22-p21	2010-07-08			ENSG00000117519	ENSG00000117519			2157	protein-coding gene	gene with protein product		602374				8526917	Standard	NM_001839		Approved		uc001dqz.4	Q15417	OTTHUMG00000010783	ENST00000370206.4:c.978C>T	1.37:g.95363310G>A		Somatic		Capture	Illumina GAIIx	4	95135898	B4DFK6|B4DP09|F8WA86|Q6FHA7	Silent	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033,PatternScan_CALPONIN_1,HMMPfam_Calponin	p.G326	ENST00000370206.4	37	c.978	CCDS30775.1	1																																																																																			-	NULL		0.408	CNN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNN3	protein_coding	OTTHUMT00000029702.2	G	NM_001839		95135898	-1	no_errors	NM_001839	genbank	human	validated	54_36p	silent	SNP	1.000	A
ERICH5	203111	genome.wustl.edu	37	8	99101307	99101307	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr8:99101307C>A	ENST00000318528.3	+	2	421	c.62C>A	c.(61-63)aCt>aAt	p.T21N	C8orf47_ENST00000545282.1_Intron	NM_173549.2	NP_775820.2	Q6P6B1	ERIC5_HUMAN		21										kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(2)	13	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			ACCAAAGTAACTTCAAATGAG	0.333																																																0			8											39.0	38.0	38.0					8																	99101307		2203	4300	6503	99170483	SO:0001583	missense	203111																														ENST00000318528.3:c.62C>A	8.37:g.99101307C>A	ENSP00000315614:p.Thr21Asn	Somatic		Capture	Illumina GAIIx	4	99170483	G3V1K4|Q8N1L8	Missense_Mutation	SNP	NULL	p.T21N	ENST00000318528.3	37	c.62	CCDS34929.1	8	.	.	.	.	.	.	.	.	.	.	C	13.38	2.220988	0.39201	.	.	ENSG00000177459	ENST00000318528	T	0.30448	1.53	4.76	4.76	0.60689	.	0.532611	0.15901	N	0.239073	T	0.39226	0.1070	L	0.40543	1.245	0.80722	D	1	D	0.57257	0.979	P	0.54664	0.758	T	0.08146	-1.0736	10	0.52906	T	0.07	-0.5167	13.4541	0.61189	0.0:1.0:0.0:0.0	.	21	Q6P6B1	CH047_HUMAN	N	21	ENSP00000315614:T21N	ENSP00000315614:T21N	T	+	2	0	C8orf47	99170483	0.987000	0.35691	0.908000	0.35775	0.144000	0.21451	0.790000	0.26900	2.634000	0.89283	0.655000	0.94253	ACT	-	NULL		0.333	C8orf47-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C8orf47	protein_coding	OTTHUMT00000380465.1	C			99170483	+1	no_errors	NM_173549	genbank	human	predicted	54_36p	missense	SNP	0.965	A
CCDC180	100499483	genome.wustl.edu	37	9	100133988	100133988	+	Splice_Site	SNP	A	A	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr9:100133988A>G	ENST00000357054.1	+	46	5502	c.4567A>G	c.(4567-4569)Agg>Ggg	p.R1523G	CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000375202.2_Splice_Site_p.R1578G|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Splice_Site_p.R1578G			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1523						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CCAGGTTGCAAGTAAGAGGCA	0.532																																																0			9											111.0	90.0	97.0					9																	100133988		2203	4300	6503	99173809	SO:0001630	splice_region_variant	57653			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.4567+1A>G	9.37:g.100133988A>G		Somatic		Capture	Illumina GAIIx	4	99173809	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.R1523G	ENST00000357054.1	37	c.4567		9	.	.	.	.	.	.	.	.	.	.	A	16.63	3.176245	0.57692	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000529487	T;T;T	0.40756	1.02;1.02;1.02	5.29	2.86	0.33363	.	0.774398	0.12189	N	0.491383	T	0.37625	0.1010	L	0.51422	1.61	0.25562	N	0.986987	B;P	0.42078	0.137;0.77	B;B	0.39217	0.086;0.294	T	0.16070	-1.0415	10	0.72032	D	0.01	-2.6941	9.7271	0.40339	0.6471:0.3529:0.0:0.0	.	1717;1523	B7ZMG3;Q9P1Z9	.;CI174_HUMAN	G	1523;1578;1578	ENSP00000349562:R1523G;ENSP00000364348:R1578G;ENSP00000434727:R1578G	ENSP00000349562:R1523G	R	+	1	2	C9orf174	99173809	1.000000	0.71417	0.996000	0.52242	0.640000	0.38277	2.580000	0.46068	0.382000	0.24878	0.459000	0.35465	AGG	-	NULL		0.532	CCDC180-201	KNOWN	basic	protein_coding	KIAA1529	protein_coding		A	NM_020893	Missense_Mutation	99173809	+1	no_errors	NM_020893	genbank	human	predicted	54_36p	missense	SNP	0.978	G
POP1	10940	genome.wustl.edu	37	8	99161225	99161225	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr8:99161225G>T	ENST00000401707.2	+	13	1974	c.1893G>T	c.(1891-1893)tgG>tgT	p.W631C	POP1_ENST00000349693.3_Missense_Mutation_p.W631C	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	631					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			TGGCTTTCTGGATTCCATTTG	0.403																																																0			8											54.0	48.0	50.0					8																	99161225		2203	4300	6503	99230401	SO:0001583	missense	10940			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.1893G>T	8.37:g.99161225G>T	ENSP00000385787:p.Trp631Cys	Somatic		Capture	Illumina GAIIx	4	99230401	A8K5W9|Q15037	Missense_Mutation	SNP	HMMPfam_POP1,HMMPfam_POPLD	p.W631C	ENST00000401707.2	37	c.1893	CCDS6277.1	8	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986436	0.74589	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.66460	-0.21;-0.21	5.46	5.46	0.80206	POPLD (1);	0.000000	0.85682	D	0.000000	D	0.85839	0.5790	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88832	0.3306	10	0.87932	D	0	-7.4411	17.4961	0.87718	0.0:0.0:1.0:0.0	.	631	Q99575	POP1_HUMAN	C	631	ENSP00000385787:W631C;ENSP00000339529:W631C	ENSP00000339529:W631C	W	+	3	0	POP1	99230401	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.731000	0.98807	2.567000	0.86603	0.655000	0.94253	TGG	-	HMMPfam_POPLD		0.403	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP1	protein_coding	OTTHUMT00000379470.1	G	NM_015029		99230401	+1	no_errors	NM_015029	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TMEM246	84302	genome.wustl.edu	37	9	104239151	104239151	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr9:104239151G>A	ENST00000374851.1	-	4	1371	c.224C>T	c.(223-225)gCt>gTt	p.A75V	RP11-490D19.6_ENST00000424154.1_RNA|RP11-490D19.6_ENST00000425734.1_RNA|TMEM246_ENST00000374847.1_Missense_Mutation_p.A75V|RP11-490D19.6_ENST00000450109.1_RNA|RP11-490D19.6_ENST00000431507.1_RNA|TMEM246_ENST00000374848.3_Missense_Mutation_p.A75V			Q9BRR3	TM246_HUMAN	transmembrane protein 246	75						integral component of membrane (GO:0016021)											GTGGAGGGCAGCCTCACCCTC	0.552																																																0			9											65.0	64.0	65.0					9																	104239151		2203	4300	6503	103278972	SO:0001583	missense	84302			BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.224C>T	9.37:g.104239151G>A	ENSP00000363984:p.Ala75Val	Somatic		Capture	Illumina GAIIx	4	103278972	Q49AQ4	Missense_Mutation	SNP	NULL	p.A75V	ENST00000374851.1	37	c.224	CCDS6757.1	9	.	.	.	.	.	.	.	.	.	.	g	12.56	1.975441	0.34848	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.63	5.63	0.86233	.	0.184772	0.47093	D	0.000245	T	0.36138	0.0956	N	0.25647	0.755	0.34647	D	0.721215	D	0.52996	0.957	B	0.42692	0.395	T	0.47661	-0.9100	9	0.30854	T	0.27	-9.9823	13.1223	0.59334	0.0:0.0:0.7284:0.2716	.	75	Q9BRR3	CI125_HUMAN	V	75	.	ENSP00000363980:A75V	A	-	2	0	C9orf125	103278972	0.997000	0.39634	1.000000	0.80357	0.917000	0.54804	2.659000	0.46741	2.636000	0.89361	0.645000	0.84053	GCT	-	NULL		0.552	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C9orf125	protein_coding	OTTHUMT00000053444.1	G	NM_032342		103278972	-1	no_errors	NM_032342	genbank	human	predicted	54_36p	missense	SNP	0.896	A
IGHV4-59	28392	genome.wustl.edu	37	14	107083312	107083312	+	RNA	SNP	A	A	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr14:107083312A>G	ENST00000455737.1	-	0	331									immunoglobulin heavy variable 4-59																		AGCTTCAGGGAGAACTGGTTC	0.537																																																0			14											76.0	77.0	77.0					14																	107083312		1822	4045	5867	106154357			0			L10088		14q32.33	2012-02-08			ENSG00000224373	ENSG00000224373		"""Immunoglobulins / IGH locus"""	5654	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151973		14.37:g.107083312A>G		Somatic		Capture	Illumina GAIIx	4	106154357		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv	p.S98P	ENST00000455737.1	37	c.292		14																																																																																			-	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv		0.537	IGHV4-59-002	KNOWN	basic|appris_principal	IG_V_gene	ENSG00000211969	IG_V_gene	OTTHUMT00000324620.1	A	NG_001019		106154357	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390629	ensembl	human	known	54_36p	missense	SNP	0.000	G
GUCY1A2	2977	genome.wustl.edu	37	11	106810882	106810882	+	Silent	SNP	T	T	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr11:106810882T>C	ENST00000526355.2	-	4	978	c.510A>G	c.(508-510)caA>caG	p.Q170Q	GUCY1A2_ENST00000347596.2_Silent_p.Q170Q|GUCY1A2_ENST00000282249.2_Silent_p.Q170Q	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	170					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	CAAATCTTTTTTGAATTTCCT	0.333																																																0			11											36.0	41.0	39.0					11																	106810882		2147	4284	6431	106316092	SO:0001819	synonymous_variant	2977			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.510A>G	11.37:g.106810882T>C		Somatic		Capture	Illumina GAIIx	4	106316092	A1L4C4|B7ZLT5	Silent	SNP	HMMPfam_HNOB,superfamily_H-NOX domain,HMMPfam_HNOBA,HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1	p.Q170	ENST00000526355.2	37	c.510	CCDS8335.1	11																																																																																			-	HMMPfam_HNOB,superfamily_H-NOX domain		0.333	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	GUCY1A2	protein_coding	OTTHUMT00000389003.2	T			106316092	-1	no_errors	NM_000855	genbank	human	validated	54_36p	silent	SNP	1.000	C
ARHGAP20	57569	genome.wustl.edu	37	11	110450156	110450156	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr11:110450156G>T	ENST00000260283.4	-	16	3798	c.3514C>A	c.(3514-3516)Cca>Aca	p.P1172T	ARHGAP20_ENST00000533353.1_Missense_Mutation_p.P1146T|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.P1146T|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.P1136T|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.P1149T|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.P715T|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.P1136T	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	1172					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		CCTGAGTCTGGGCTGGTCGCA	0.493																																																0			11											123.0	127.0	126.0					11																	110450156		2201	4298	6499	109955366	SO:0001583	missense	57569			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.3514C>A	11.37:g.110450156G>T	ENSP00000260283:p.Pro1172Thr	Somatic		Capture	Illumina GAIIx	4	109955366	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	superfamily_PH domain-like,HMMSmart_SM00233,HMMPfam_RA,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.P1172T	ENST00000260283.4	37	c.3514	CCDS31673.1	11	.	.	.	.	.	.	.	.	.	.	G	8.394	0.840331	0.16891	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.08896	3.04;3.04;3.08;3.04;3.05;3.04;3.05	5.62	2.72	0.32119	.	0.254272	0.28307	N	0.015839	T	0.06188	0.0160	L	0.36672	1.1	0.28635	N	0.907441	P;B;B	0.36683	0.565;0.113;0.18	B;B;B	0.33254	0.16;0.071;0.15	T	0.21759	-1.0236	10	0.45353	T	0.12	.	6.4424	0.21856	0.1553:0.0:0.6988:0.1459	.	1146;1172;1149	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	T	1172;1146;715;1149;1136;1146;1136	ENSP00000260283:P1172T;ENSP00000349660:P1146T;ENSP00000437905:P715T;ENSP00000432076:P1149T;ENSP00000436319:P1136T;ENSP00000436522:P1146T;ENSP00000431399:P1136T	ENSP00000260283:P1172T	P	-	1	0	ARHGAP20	109955366	0.958000	0.32768	0.959000	0.39883	0.115000	0.19883	0.494000	0.22467	0.300000	0.22699	0.655000	0.94253	CCA	-	NULL		0.493	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP20	protein_coding	OTTHUMT00000390628.1	G	NM_020809		109955366	-1	no_errors	NM_020809	genbank	human	validated	54_36p	missense	SNP	0.911	T
SIDT1	54847	genome.wustl.edu	37	3	113320464	113320464	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr3:113320464A>G	ENST00000264852.4	+	11	1801	c.1075A>G	c.(1075-1077)Att>Gtt	p.I359V	SIDT1_ENST00000393830.3_Missense_Mutation_p.I359V	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	359					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						ATCTCATCCCATTGCTGCCAG	0.408																																																0			3											120.0	107.0	111.0					3																	113320464		2203	4300	6503	114803154	SO:0001583	missense	54847			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1075A>G	3.37:g.113320464A>G	ENSP00000264852:p.Ile359Val	Somatic		Capture	Illumina GAIIx	4	114803154	Q17RR4	Missense_Mutation	SNP	NULL	p.I359V	ENST00000264852.4	37	c.1075	CCDS2974.1	3	.	.	.	.	.	.	.	.	.	.	A	8.433	0.849052	0.17034	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.23754	1.89;1.89	6.17	5.01	0.66863	.	0.084780	0.50627	D	0.000105	T	0.22820	0.0551	L	0.50333	1.59	0.42425	D	0.992652	B;B	0.28178	0.099;0.202	B;B	0.33846	0.137;0.171	T	0.02917	-1.1094	10	0.02654	T	1	-16.3141	12.6751	0.56889	0.935:0.0:0.065:0.0	.	359;359	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	V	359	ENSP00000264852:I359V;ENSP00000377416:I359V	ENSP00000264852:I359V	I	+	1	0	SIDT1	114803154	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	4.451000	0.60047	2.371000	0.80710	0.533000	0.62120	ATT	-	NULL		0.408	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	protein_coding	OTTHUMT00000317564.1	A	NM_017699		114803154	+1	no_errors	NM_017699	genbank	human	validated	54_36p	missense	SNP	1.000	G
ARSJ	79642	genome.wustl.edu	37	4	114824798	114824798	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr4:114824798G>C	ENST00000315366.7	-	2	1298	c.432C>G	c.(430-432)atC>atG	p.I144M	ARSJ_ENST00000541197.1_Missense_Mutation_p.I144M	NM_024590.3	NP_078866.3	Q5FYB0	ARSJ_HUMAN	arylsulfatase family, member J	144					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	21		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		TAGGTCTTATGATAGAATGTT	0.393																																																0			4											197.0	176.0	182.0					4																	114824798		1838	4092	5930	115044247	SO:0001583	missense	79642				CCDS43264.1	4q26	2013-02-14	2006-03-07		ENSG00000180801	ENSG00000180801		"""Arylsulfatase family"""	26286	protein-coding gene	gene with protein product		610010	"""arylsulfatase J"""			12975309, 16174644	Standard	NM_024590		Approved	FLJ23548	uc003ibq.1	Q5FYB0	OTTHUMG00000161067	ENST00000315366.7:c.432C>G	4.37:g.114824798G>C	ENSP00000320219:p.Ile144Met	Somatic		Capture	Illumina GAIIx	4	115044247	A2RUG0|B7ZM45|Q1HA39|Q5FWE4|Q6UWT9	Missense_Mutation	SNP	HMMPfam_Sulfatase,superfamily_Alkaline phosphatase-like,PatternScan_SULFATASE_1,PatternScan_SULFATASE_2	p.I144M	ENST00000315366.7	37	c.432	CCDS43264.1	4	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176115	0.57692	.	.	ENSG00000180801	ENST00000315366;ENST00000541197	D;D	0.98617	-5.03;-5.03	5.68	5.68	0.88126	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.98570	0.9522	M	0.62209	1.925	0.45015	D	0.998036	D;D	0.61080	0.989;0.981	D;D	0.71656	0.974;0.962	D	0.97957	1.0335	10	0.49607	T	0.09	.	9.8691	0.41164	0.0716:0.0:0.7899:0.1385	.	144;144	Q1HA39;Q5FYB0	.;ARSJ_HUMAN	M	144	ENSP00000320219:I144M;ENSP00000438836:I144M	ENSP00000320219:I144M	I	-	3	3	ARSJ	115044247	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.660000	0.54496	2.675000	0.91044	0.655000	0.94253	ATC	-	HMMPfam_Sulfatase,superfamily_Alkaline phosphatase-like		0.393	ARSJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSJ	protein_coding	OTTHUMT00000363650.1	G	NM_024590		115044247	-1	no_errors	NM_024590	genbank	human	validated	54_36p	missense	SNP	1.000	C
TMPRSS4-AS1	100526771	genome.wustl.edu	37	11	117899605	117899605	+	RNA	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr11:117899605G>A	ENST00000606951.1	-	0	344				TMPRSS4-AS1_ENST00000527695.1_RNA|TMPRSS4-AS1_ENST00000527329.1_RNA	NR_038318.1				TMPRSS4 antisense RNA 1																		agaagaaggaggaggggaagg	0.448																																																0			11																																								117404815			0					11q23.3	2012-10-12	2012-08-15		ENSG00000255274	ENSG00000255274		"""Long non-coding RNAs"""	44179	non-coding RNA	RNA, long non-coding			"""TMPRSS4 antisense RNA 1 (non-protein coding)"""				Standard	NR_038318		Approved		uc001pry.1		OTTHUMG00000166993		11.37:g.117899605G>A		Somatic		Capture	Illumina GAIIx	4	117404815		Missense_Mutation	SNP	NULL	p.L101F	ENST00000606951.1	37	c.301		11	.	.	.	.	.	.	.	.	.	.	G	1.920	-0.448631	0.04572	.	.	ENSG00000198230	ENST00000356822	.	.	.	0.851	-0.164	0.13359	.	.	.	.	.	T	0.37019	0.0988	.	.	.	.	.	.	.	.	.	.	.	.	T	0.46610	-0.9179	4	0.87932	D	0	.	3.1601	0.06517	0.3361:0.0:0.6639:0.0	.	.	.	.	F	101	.	ENSP00000364391:L101F	L	-	1	0	AP002962.1	117404815	0.063000	0.20901	0.002000	0.10522	0.056000	0.15407	-0.205000	0.09411	-0.071000	0.12886	0.467000	0.42956	CTC	-	NULL		0.448	TMPRSS4-AS1-003	KNOWN	basic	antisense	ENSG00000198230	antisense	OTTHUMT00000470982.1	G	NR_038318		117404815	-1	no_errors	ENST00000356822	ensembl	human	known	54_36p	missense	SNP	0.488	A
KMT2A	4297	genome.wustl.edu	37	11	118342400	118342400	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr11:118342400C>A	ENST00000389506.5	+	3	526	c.526C>A	c.(526-528)Cgt>Agt	p.R176S	KMT2A_ENST00000534358.1_Missense_Mutation_p.R176S|KMT2A_ENST00000354520.4_Missense_Mutation_p.R176S			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	176					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TCGAAAACCTCGTGGGAGACC	0.368																																																0			11											51.0	53.0	52.0					11																	118342400		2200	4296	6496	117847610	SO:0001583	missense	4297			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.526C>A	11.37:g.118342400C>A	ENSP00000374157:p.Arg176Ser	Somatic		Capture	Illumina GAIIx	4	117847610	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	PatternScan_HMGI_Y,HMMPfam_AT_hook,HMMPfam_zf-CXXC,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,PatternScan_RECR,HMMSmart_SM00297,superfamily_Bromodomain,HMMPfam_FYRN,HMMSmart_SM00541,PatternScan_EF_HAND_1,HMMPfam_FYRC,HMMSmart_SM00542,superfamily_SET domain,HMMPfam_SET,HMMSmart_SM00317,HMMSmart_SM00508	p.R176S	ENST00000389506.5	37	c.526	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	C	16.51	3.144835	0.57044	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000328469	D;T;D;D	0.90444	-2.65;1.53;-2.65;-2.67	5.92	5.01	0.66863	AT hook, DNA-binding motif (1);	0.117709	0.56097	N	0.000028	D	0.86045	0.5839	L	0.32530	0.975	0.58432	D	0.999994	B;B;B	0.21753	0.06;0.06;0.013	B;B;B	0.15484	0.013;0.013;0.006	T	0.83062	-0.0147	10	0.87932	D	0	.	14.9691	0.71220	0.0:0.9316:0.0:0.0683	.	176;176;209	E9PQG7;Q03164;E9PR05	.;MLL1_HUMAN;.	S	176;209;176;176;209	ENSP00000436786:R176S;ENSP00000432391:R209S;ENSP00000374157:R176S;ENSP00000346516:R176S	ENSP00000333556:R209S	R	+	1	0	MLL	117847610	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.687000	0.68219	1.495000	0.48549	0.650000	0.86243	CGT	-	PatternScan_HMGI_Y		0.368	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	protein_coding	OTTHUMT00000399085.2	C	NM_005933		117847610	+1	no_errors	NM_005933	genbank	human	validated	54_36p	missense	SNP	1.000	A
GFRA1	2674	genome.wustl.edu	37	10	117884801	117884801	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr10:117884801G>C	ENST00000355422.6	-	6	1251	c.701C>G	c.(700-702)tCc>tGc	p.S234C	GFRA1_ENST00000439649.3_Missense_Mutation_p.S229C|GFRA1_ENST00000369236.1_Missense_Mutation_p.S229C|GFRA1_ENST00000544592.1_Missense_Mutation_p.S113C	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	234					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		CTCTTCATAGGAGCACACAGG	0.557																																					Ovarian(128;329 1725 45498 46808 50759)											0			10											75.0	65.0	68.0					10																	117884801		2203	4300	6503	117874791	SO:0001583	missense	2674			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.701C>G	10.37:g.117884801G>C	ENSP00000347591:p.Ser234Cys	Somatic		Capture	Illumina GAIIx	4	117874791	A8KA21|O15507|O43912	Missense_Mutation	SNP	superfamily_GDNF receptor-like (Pfam 02351),HMMPfam_GDNF	p.S234C	ENST00000355422.6	37	c.701	CCDS44481.1	10	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970041	0.92855	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.55413	1.03;0.52	5.75	5.75	0.90469	.	0.112810	0.64402	D	0.000007	T	0.76385	0.3980	M	0.83384	2.64	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73708	0.97;0.981	T	0.78640	-0.2125	10	0.72032	D	0.01	-19.3602	19.9522	0.97203	0.0:0.0:1.0:0.0	.	234;229	P56159;P56159-2	GFRA1_HUMAN;.	C	234;229;229;113;229	ENSP00000358239:S229C;ENSP00000442179:S113C	ENSP00000347591:S229C	S	-	2	0	GFRA1	117874791	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.725000	0.93324	0.655000	0.94253	TCC	-	NULL		0.557	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	GFRA1	protein_coding	OTTHUMT00000050512.2	G	NM_145793		117874791	-1	no_errors	NM_005264	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
GFRA1	2674	genome.wustl.edu	37	10	117885055	117885055	+	Silent	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr10:117885055G>C	ENST00000355422.6	-	6	997	c.447C>G	c.(445-447)ccC>ccG	p.P149P	GFRA1_ENST00000439649.3_Silent_p.P144P|GFRA1_ENST00000369236.1_Silent_p.P144P|GFRA1_ENST00000544592.1_Silent_p.P28P	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	149					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		TGTTCCCTTTGGGAATGTGCT	0.522																																					Ovarian(128;329 1725 45498 46808 50759)											0			10											41.0	36.0	38.0					10																	117885055		2203	4300	6503	117875045	SO:0001819	synonymous_variant	2674			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.447C>G	10.37:g.117885055G>C		Somatic		Capture	Illumina GAIIx	4	117875045	A8KA21|O15507|O43912	Silent	SNP	HMMPfam_GDNF,superfamily_GDNF receptor-like (Pfam 02351)	p.P149	ENST00000355422.6	37	c.447	CCDS44481.1	10																																																																																			-	NULL		0.522	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	GFRA1	protein_coding	OTTHUMT00000050512.2	G	NM_145793		117875045	-1	no_errors	NM_005264	genbank	human	reviewed	54_36p	silent	SNP	0.993	C
KNTC1	9735	genome.wustl.edu	37	12	123014649	123014649	+	Silent	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr12:123014649C>T	ENST00000333479.7	+	2	216	c.39C>T	c.(37-39)acC>acT	p.T13T	KNTC1_ENST00000450485.2_Silent_p.T13T	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	13					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ATGATGATACCGGAAGTGGGT	0.388																																																0			12											103.0	107.0	106.0					12																	123014649		1883	4112	5995	121580602	SO:0001819	synonymous_variant	9735				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.39C>T	12.37:g.123014649C>T		Somatic		Capture	Illumina GAIIx	4	121580602	A7E2C4|B3KSG2	Silent	SNP	HMMPfam_Rod_C,PatternScan_BZIP_BASIC	p.T13	ENST00000333479.7	37	c.39	CCDS45002.1	12																																																																																			-	NULL		0.388	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	protein_coding	OTTHUMT00000396110.2	C			121580602	+1	no_errors	NM_014708	genbank	human	reviewed	54_36p	silent	SNP	0.996	T
PRDM5	11107	genome.wustl.edu	37	4	121774644	121774644	+	Silent	SNP	G	G	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr4:121774644G>T	ENST00000264808.3	-	3	469	c.229C>A	c.(229-231)Cgg>Agg	p.R77R	PRDM5_ENST00000515109.1_Silent_p.R77R|PRDM5_ENST00000428209.2_Silent_p.R77R|PRDM5_ENST00000394435.2_Silent_p.R77R	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	77	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TTGGAGTGCCGTGGGTTGGTA	0.448																																																0			4											299.0	293.0	295.0					4																	121774644		2203	4300	6503	121994094	SO:0001819	synonymous_variant	11107			AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.229C>A	4.37:g.121774644G>T		Somatic		Capture	Illumina GAIIx	4	121994094	Q0VAI9|Q0VAJ0|Q6NXQ7	Silent	SNP	HMMPfam_SET,HMMSmart_SM00317,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.R77	ENST00000264808.3	37	c.229	CCDS3716.1	4																																																																																			-	HMMPfam_SET,HMMSmart_SM00317		0.448	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM5	protein_coding	OTTHUMT00000256528.2	G			121994094	-1	no_errors	NM_018699	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
OR1J1	347168	genome.wustl.edu	37	9	125239497	125239497	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr9:125239497C>G	ENST00000259357.2	-	1	738	c.709G>C	c.(709-711)Gcc>Ccc	p.A237P	RP11-542K23.9_ENST00000412262.2_RNA	NM_001004451.1	NP_001004451.1	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J, member 1	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	16						GTGGACAAGGCTTTGCATATG	0.463																																																0			9											144.0	129.0	134.0					9																	125239497		2203	4300	6503	124279318	SO:0001583	missense	347168			AL353767	CCDS35120.1	9q33.2	2013-09-20			ENSG00000136834	ENSG00000136834		"""GPCR / Class A : Olfactory receptors"""	8208	protein-coding gene	gene with protein product							Standard	NM_001004451		Approved	hg32	uc011lyu.2	Q8NGS3	OTTHUMG00000020603	ENST00000259357.2:c.709G>C	9.37:g.125239497C>G	ENSP00000259357:p.Ala237Pro	Somatic		Capture	Illumina GAIIx	4	124279318	A3KFL8|Q6IF10|Q96R88	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A237P	ENST00000259357.2	37	c.709	CCDS35120.1	9	.	.	.	.	.	.	.	.	.	.	C	19.02	3.746730	0.69418	.	.	ENSG00000136834	ENST00000259357	T	0.00363	7.83	4.93	4.03	0.46877	GPCR, rhodopsin-like superfamily (1);	0.103999	0.42821	D	0.000643	T	0.01558	0.0050	H	0.99299	4.505	0.37093	D	0.899557	D	0.89917	1.0	D	0.85130	0.997	T	0.01935	-1.1244	10	0.87932	D	0	.	9.5398	0.39244	0.0:0.8294:0.0:0.1706	.	237	Q8NGS3	OR1J1_HUMAN	P	237	ENSP00000259357:A237P	ENSP00000259357:A237P	A	-	1	0	OR1J1	124279318	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	2.472000	0.45136	1.455000	0.47813	0.597000	0.82753	GCC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.463	OR1J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1J1	protein_coding	OTTHUMT00000053931.1	C			124279318	-1	no_errors	NM_001004451	genbank	human	provisional	54_36p	missense	SNP	1.000	G
CUZD1	50624	genome.wustl.edu	37	10	124600783	124600783	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr10:124600783C>T	ENST00000368904.1	-	4	1093	c.144G>A	c.(142-144)atG>atA	p.M48I	CUZD1_ENST00000545804.1_Missense_Mutation_p.M48I|CUZD1_ENST00000392790.1_Missense_Mutation_p.M48I					CUB and zona pellucida-like domains 1											NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|stomach(1)	39		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		GTTGCAGGATCATGGCTTTGT	0.458																																																0			10											198.0	175.0	183.0					10																	124600783		2203	4300	6503	124590773	SO:0001583	missense	50624			AF305835	CCDS7631.1	10q26.13	2003-11-18			ENSG00000138161	ENSG00000138161			17937	protein-coding gene	gene with protein product						10542259	Standard	NM_022034		Approved	ERG-1, UO-44		Q86UP6	OTTHUMG00000019195	ENST00000368904.1:c.144G>A	10.37:g.124600783C>T	ENSP00000357900:p.Met48Ile	Somatic		Capture	Illumina GAIIx	4	124590773		Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMSmart_SM00042,HMMPfam_CUB,HMMPfam_Zona_pellucida,HMMSmart_SM00241	p.M48I	ENST00000368904.1	37	c.144	CCDS7631.1	10	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136565	0.37728	.	.	ENSG00000138161	ENST00000368904;ENST00000545804;ENST00000392790	T;T;T	0.37752	1.18;1.18;1.18	5.42	-1.47	0.08772	CUB (3);	0.915016	0.09027	N	0.859337	T	0.14056	0.0340	N	0.03608	-0.345	0.09310	N	1	B	0.14012	0.009	B	0.06405	0.002	T	0.18808	-1.0325	10	0.66056	D	0.02	0.061	2.7338	0.05234	0.111:0.3557:0.3259:0.2074	.	48	Q86UP6	CUZD1_HUMAN	I	48	ENSP00000357900:M48I;ENSP00000441590:M48I;ENSP00000376540:M48I	ENSP00000357900:M48I	M	-	3	0	CUZD1	124590773	0.000000	0.05858	0.002000	0.10522	0.988000	0.76386	-1.516000	0.02250	-0.636000	0.05524	0.563000	0.77884	ATG	-	superfamily_Spermadhesin CUB domain,HMMSmart_SM00042		0.458	CUZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUZD1	protein_coding	OTTHUMT00000050829.2	C	NM_022034		124590773	-1	no_errors	NM_022034	genbank	human	provisional	54_36p	missense	SNP	0.286	T
ROPN1	54763	genome.wustl.edu	37	3	123694318	123694318	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr3:123694318C>G	ENST00000184183.4	-	5	644	c.304G>C	c.(304-306)Gat>Cat	p.D102H	ROPN1_ENST00000405845.3_Missense_Mutation_p.D102H	NM_017578.2	NP_060048.2	Q9HAT0	ROP1A_HUMAN	rhophilin associated tail protein 1	102						cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)|ovary(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.148)		TTAAACAGATCTGTTGGGAGA	0.522																																																0			3											6.0	6.0	6.0					3																	123694318		1934	4044	5978	125177008	SO:0001583	missense	54763			AF231410	CCDS3026.1	3q21.1	2011-01-20	2011-01-20			ENSG00000065371			17692	protein-coding gene	gene with protein product	"""cancer/testis antigen 91"""	611757	"""ropporin, rhophilin associated protein 1"""			10591629	Standard	NM_017578		Approved	ODF6, ropporin, ROPN1A, CT91	uc003eha.3	Q9HAT0		ENST00000184183.4:c.304G>C	3.37:g.123694318C>G	ENSP00000184183:p.Asp102His	Somatic		Capture	Illumina GAIIx	4	125177008	D3DN99|Q9UF38	Missense_Mutation	SNP	superfamily_Dimerization-anchoring domain of cAMP-dependent type II PK regulatory subunit,HMMPfam_RIIa	p.D102H	ENST00000184183.4	37	c.304	CCDS3026.1	3	.	.	.	.	.	.	.	.	.	.	C	13.42	2.231756	0.39399	.	.	ENSG00000065371	ENST00000184183;ENST00000405845;ENST00000467907;ENST00000460743;ENST00000495336	T;T;T;T	0.32753	1.97;1.97;1.97;1.44	4.61	3.73	0.42828	.	0.060284	0.64402	D	0.000011	T	0.25754	0.0627	L	0.38175	1.15	0.80722	D	1	B	0.09022	0.002	B	0.12156	0.007	T	0.08973	-1.0696	10	0.72032	D	0.01	-24.1068	12.5989	0.56487	0.0:0.8328:0.1672:0.0	.	102	Q9HAT0	ROP1A_HUMAN	H	102	ENSP00000184183:D102H;ENSP00000385919:D102H;ENSP00000417067:D102H;ENSP00000420310:D102H	ENSP00000184183:D102H	D	-	1	0	ROPN1	125177008	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	4.462000	0.60121	1.342000	0.45619	-0.168000	0.13345	GAT	-	NULL		0.522	ROPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROPN1	protein_coding	OTTHUMT00000356188.2	C	NM_017578		125177008	-1	no_errors	NM_017578	genbank	human	provisional	54_36p	missense	SNP	1.000	G
RPUSD4	84881	genome.wustl.edu	37	11	126073350	126073350	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr11:126073350T>A	ENST00000298317.4	-	7	1150	c.1097A>T	c.(1096-1098)aAt>aTt	p.N366I	RPUSD4_ENST00000533628.1_Missense_Mutation_p.N335I|RPUSD4_ENST00000534393.1_5'Flank	NM_032795.2	NP_116184.2	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4	366					pseudouridine synthesis (GO:0001522)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		ATTGTTCTCATTTTGATCCTC	0.542																																																0			11											153.0	147.0	149.0					11																	126073350		2201	4299	6500	125578560	SO:0001583	missense	84881			BC014131	CCDS8469.1, CCDS53721.1	11q24.2	2013-02-11			ENSG00000165526	ENSG00000165526		"""RNA pseudouridylate synthase domain containing"""	25898	protein-coding gene	gene with protein product							Standard	NM_032795		Approved	FLJ14494	uc001qde.3	Q96CM3	OTTHUMG00000165815	ENST00000298317.4:c.1097A>T	11.37:g.126073350T>A	ENSP00000298317:p.Asn366Ile	Somatic		Capture	Illumina GAIIx	4	125578560	E9PML2|Q96K56	Missense_Mutation	SNP	superfamily_PsdUridine_synth_cat_dom,HMMPfam_PseudoU_synth_2,PatternScan_PSI_RLU	p.N366I	ENST00000298317.4	37	c.1097	CCDS8469.1	11	.	.	.	.	.	.	.	.	.	.	T	14.28	2.489305	0.44249	.	.	ENSG00000165526	ENST00000298317;ENST00000533628	T;T	0.13538	2.74;2.58	5.23	-9.03	0.00737	Pseudouridine synthase, catalytic domain (1);	1.575620	0.03532	N	0.222647	T	0.08223	0.0205	L	0.51422	1.61	0.09310	N	1	P;P	0.34780	0.468;0.468	B;B	0.27500	0.08;0.08	T	0.18555	-1.0333	10	0.16896	T	0.51	-16.2212	3.8662	0.09018	0.107:0.4222:0.2351:0.2357	.	335;366	E9PML2;Q96CM3	.;RUSD4_HUMAN	I	366;335	ENSP00000298317:N366I;ENSP00000433065:N335I	ENSP00000298317:N366I	N	-	2	0	RPUSD4	125578560	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	-1.335000	0.02662	-1.690000	0.01432	-0.400000	0.06385	AAT	-	superfamily_PsdUridine_synth_cat_dom		0.542	RPUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPUSD4	protein_coding	OTTHUMT00000386336.1	T	NM_032795		125578560	-1	no_errors	NM_032795	genbank	human	validated	54_36p	missense	SNP	0.000	A
SCAI	286205	genome.wustl.edu	37	9	127791975	127791975	+	Missense_Mutation	SNP	C	C	T	rs200106227		TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr9:127791975C>T	ENST00000336505.6	-	4	332	c.274G>A	c.(274-276)Gga>Aga	p.G92R	SCAI_ENST00000373549.4_Missense_Mutation_p.G115R	NM_001144877.2	NP_001138349.1	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion	92	Necessary to inhibit MKL1-induced SRF transcriptional activity. {ECO:0000250}.|Required for interaction with MKL1. {ECO:0000250}.				negative regulation of cell migration (GO:0030336)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(5)|stomach(1)|urinary_tract(1)	35						AAAGTTCTTCCAAAATAGGAC	0.333																																																0			9											82.0	79.0	80.0					9																	127791975		1841	4093	5934	126831796	SO:0001583	missense	286205			AK093983	CCDS43877.1, CCDS48017.1	9q34.11	2009-11-06	2009-07-09	2009-07-09	ENSG00000173611	ENSG00000173611			26709	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 126"""	C9orf126			Standard	NM_173690		Approved	FLJ36664, NET40	uc004bpd.3	Q8N9R8	OTTHUMG00000020667	ENST00000336505.6:c.274G>A	9.37:g.127791975C>T	ENSP00000336756:p.Gly92Arg	Somatic		Capture	Illumina GAIIx	4	126831796	Q3SXZ1|Q3SXZ2|Q5T163|Q8N1I4	Missense_Mutation	SNP	NULL	p.G115R	ENST00000336505.6	37	c.343	CCDS48017.1	9	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079024	0.76528	.	.	ENSG00000173611	ENST00000336505;ENST00000373549	T;T	0.42513	0.97;0.97	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.59702	0.2213	L	0.46614	1.455	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.994	T	0.54490	-0.8286	10	0.44086	T	0.13	-15.3376	18.7503	0.91812	0.0:1.0:0.0:0.0	.	92;115	Q8N9R8;Q8N9R8-2	SCAI_HUMAN;.	R	92;115	ENSP00000336756:G92R;ENSP00000362650:G115R	ENSP00000336756:G92R	G	-	1	0	SCAI	126831796	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.777000	0.68931	2.775000	0.95449	0.655000	0.94253	GGA	-	NULL		0.333	SCAI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf126	protein_coding	OTTHUMT00000054055.3	C	NM_173690		126831796	-1	no_errors	NM_173690	genbank	human	validated	54_36p	missense	SNP	1.000	T
SMARCA1	6594	genome.wustl.edu	37	X	128602868	128602868	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chrX:128602868C>G	ENST00000371122.4	-	21	2709	c.2580G>C	c.(2578-2580)tgG>tgC	p.W860C	SMARCA1_ENST00000371123.1_Missense_Mutation_p.W848C|SMARCA1_ENST00000371121.3_Missense_Mutation_p.W848C	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	860	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						CTCGTTTAGTCCAGTTTGTGA	0.333																																																0			X											96.0	86.0	90.0					X																	128602868		2203	4300	6503	128430549	SO:0001583	missense	6594			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.2580G>C	X.37:g.128602868C>G	ENSP00000360163:p.Trp860Cys	Somatic		Capture	Illumina GAIIx	4	128430549	Q5JV41|Q5JV42	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_SNF2_N,HMMSmart_SM00490,HMMPfam_Helicase_C,HMMPfam_HAND,superfamily_HAND domain of the nucleosome remodeling ATPase ISWI,HMMSmart_SM00717,superfamily_Homeodomain-like,HMMPfam_SLIDE	p.W860C	ENST00000371122.4	37	c.2580	CCDS14612.1	X	.	.	.	.	.	.	.	.	.	.	C	19.25	3.790805	0.70452	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.97665	-4.47;-4.47;-4.48;-4.3	5.3	5.3	0.74995	SANT domain, DNA binding (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.64402	D	0.000005	D	0.98985	0.9654	H	0.95679	3.705	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99560	1.0968	10	0.87932	D	0	-4.4856	18.2711	0.90069	0.0:1.0:0.0:0.0	.	839;860;848;860	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	C	848;848;860;839	ENSP00000360162:W848C;ENSP00000360164:W848C;ENSP00000360163:W860C;ENSP00000404275:W839C	ENSP00000360162:W848C	W	-	3	0	SMARCA1	128430549	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.617000	0.83032	2.340000	0.79590	0.544000	0.68410	TGG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00717,superfamily_Homeodomain-like		0.333	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCA1	protein_coding	OTTHUMT00000058206.1	C	NM_003069		128430549	-1	no_errors	NM_003069	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PLAC1	10761	genome.wustl.edu	37	X	133700432	133700432	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chrX:133700432T>A	ENST00000359237.4	-	3	566	c.281A>T	c.(280-282)tAc>tTc	p.Y94F	PLAC1_ENST00000476971.1_5'UTR	NM_021796.3	NP_068568.1			placenta-specific 1											large_intestine(4)|lung(1)|pancreas(1)	6	Acute lymphoblastic leukemia(192;0.000127)					CTCAGTGCTGTAGATAACCAT	0.532																																																0			X											210.0	177.0	188.0					X																	133700432		2203	4300	6503	133528098	SO:0001583	missense	10761			AF234654	CCDS14642.1	Xq26.3	2013-10-14			ENSG00000170965	ENSG00000170965			9044	protein-coding gene	gene with protein product	"""cancer/testis antigen 92"""	300296				10995572	Standard	NM_021796		Approved	CT92, OOSP2L	uc004exo.1	Q9HBJ0	OTTHUMG00000022457	ENST00000359237.4:c.281A>T	X.37:g.133700432T>A	ENSP00000352173:p.Tyr94Phe	Somatic		Capture	Illumina GAIIx	4	133528098		Missense_Mutation	SNP	NULL	p.Y94F	ENST00000359237.4	37	c.281	CCDS14642.1	X	.	.	.	.	.	.	.	.	.	.	T	15.82	2.945338	0.53079	.	.	ENSG00000170965	ENST00000359237	D	0.86497	-2.13	4.39	4.39	0.52855	.	0.000000	0.34362	N	0.004037	D	0.88599	0.6480	L	0.46157	1.445	0.22305	N	0.999212	D	0.76494	0.999	D	0.83275	0.996	T	0.78191	-0.2300	10	0.14656	T	0.56	-23.7138	9.0168	0.36175	0.0:0.0:0.0:1.0	.	94	Q9HBJ0	PLAC1_HUMAN	F	94	ENSP00000352173:Y94F	ENSP00000352173:Y94F	Y	-	2	0	PLAC1	133528098	1.000000	0.71417	0.483000	0.27378	0.274000	0.26718	3.042000	0.49815	1.951000	0.56629	0.486000	0.48141	TAC	-	NULL		0.532	PLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAC1	protein_coding	OTTHUMT00000058375.1	T	NM_021796		133528098	-1	no_errors	NM_021796	genbank	human	provisional	54_36p	missense	SNP	0.138	A
TUBBP5	643224	genome.wustl.edu	37	9	141071335	141071335	+	RNA	SNP	G	G	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr9:141071335G>T	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5																		CCATTTTCCAGGGTCGCATGC	0.542																																																0			9																																								140191156			0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071335G>T		Somatic		Capture	Illumina GAIIx	4	140191156		Missense_Mutation	SNP	superfamily_Tubulin nucleotide-binding domain-like,HMMPfam_Tubulin,PatternScan_TUBULIN,superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C	p.Q318H	ENST00000503395.1	37	c.954		9																																																																																			-	superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C		0.542	TUBBP5-003	KNOWN	basic	processed_transcript	ENSG00000159247	pseudogene	OTTHUMT00000373087.1	G	NR_027156		140191156	+1	no_start_codon	ENST00000290377	ensembl	human	known	54_36p	missense	SNP	0.995	T
PCDHB7	56129	genome.wustl.edu	37	5	140552444	140552444	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr5:140552444C>A	ENST00000231137.3	+	1	202	c.28C>A	c.(28-30)Cag>Aag	p.Q10K		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	10					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGTGCTGTGCAGAAAAGGCA	0.512																																																0			5											188.0	159.0	169.0					5																	140552444		2203	4300	6503	140532628	SO:0001583	missense	56129			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.28C>A	5.37:g.140552444C>A	ENSP00000231137:p.Gln10Lys	Somatic		Capture	Illumina GAIIx	4	140532628	A1L3Y8	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin-like,PatternScan_CADHERIN_1,HMMPfam_Cadherin,HMMSmart_SM00112	p.Q10K	ENST00000231137.3	37	c.28	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	C	0.037	-1.301377	0.01364	.	.	ENSG00000113212	ENST00000231137	T	0.47177	0.85	4.56	3.68	0.42216	.	.	.	.	.	T	0.26991	0.0661	N	0.16098	0.37	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.14309	-1.0477	9	0.24483	T	0.36	.	5.76	0.18195	0.348:0.5612:0.0:0.0908	.	10	Q9Y5E2	PCDB7_HUMAN	K	10	ENSP00000231137:Q10K	ENSP00000231137:Q10K	Q	+	1	0	PCDHB7	140532628	0.005000	0.15991	0.400000	0.26346	0.049000	0.14656	0.512000	0.22755	1.240000	0.43803	0.650000	0.86243	CAG	-	NULL		0.512	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	protein_coding	OTTHUMT00000251803.2	C	NM_018940		140532628	+1	no_errors	NM_018940	genbank	human	reviewed	54_36p	missense	SNP	0.009	A
PCDHB13	56123	genome.wustl.edu	37	5	140595283	140595283	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr5:140595283C>T	ENST00000341948.4	+	1	1775	c.1588C>T	c.(1588-1590)Cgc>Tgc	p.R530C		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	530	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTTCCAGTTCCGCGTGGGCGC	0.672																																																0			5											59.0	68.0	65.0					5																	140595283		2203	4300	6503	140575467	SO:0001583	missense	56123			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1588C>T	5.37:g.140595283C>T	ENSP00000345491:p.Arg530Cys	Somatic		Capture	Illumina GAIIx	4	140575467	A8K9V6	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.R530C	ENST00000341948.4	37	c.1588	CCDS4255.1	5	.	.	.	.	.	.	.	.	.	.	N	11.05	1.525206	0.27299	.	.	ENSG00000187372	ENST00000341948;ENST00000430318	T	0.01767	4.65	3.42	-5.59	0.02505	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.01523	0.0049	L	0.55743	1.74	0.09310	N	1	P	0.35174	0.488	B	0.24394	0.053	T	0.38134	-0.9675	9	0.54805	T	0.06	.	4.1035	0.10025	0.1858:0.307:0.4107:0.0964	.	530	Q9Y5F0	PCDBD_HUMAN	C	530	ENSP00000345491:R530C	ENSP00000345491:R530C	R	+	1	0	PCDHB13	140575467	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-5.426000	0.00123	-0.626000	0.05596	0.449000	0.29647	CGC	-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.672	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB13	protein_coding	OTTHUMT00000251810.1	C	NM_018933		140575467	+1	no_errors	NM_018933	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
MAGEC1	9947	genome.wustl.edu	37	X	140994026	140994026	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chrX:140994026C>A	ENST00000285879.4	+	4	1122	c.836C>A	c.(835-837)aCt>aAt	p.T279N	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	279										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TTCTCCTCCACTTTAGTGAGT	0.498										HNSCC(15;0.026)																																						0			X											91.0	84.0	86.0					X																	140994026		2164	4022	6186	140821692	SO:0001583	missense	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.836C>A	X.37:g.140994026C>A	ENSP00000285879:p.Thr279Asn	Somatic		Capture	Illumina GAIIx	4	140821692	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	HMMPfam_MAGE	p.T279N	ENST00000285879.4	37	c.836	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	c	0.506	-0.868617	0.02590	.	.	ENSG00000155495	ENST00000285879;ENST00000370511;ENST00000370510	T;T	0.20332	3.8;2.08	.	.	.	.	.	.	.	.	T	0.08268	0.0206	N	0.08118	0	0.46437	D	0.999045	P	0.51933	0.949	B	0.37304	0.246	T	0.21518	-1.0243	8	0.87932	D	0	.	5.9409	0.19192	0.0:0.9994:0.0:6.0E-4	.	279	O60732	MAGC1_HUMAN	N	279;81;80	ENSP00000285879:T279N;ENSP00000359542:T81N	ENSP00000285879:T279N	T	+	2	0	MAGEC1	140821692	0.000000	0.05858	0.028000	0.17463	0.028000	0.11728	-0.802000	0.04545	0.148000	0.19059	0.150000	0.16122	ACT	-	NULL		0.498	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	C	NM_005462		140821692	+1	no_errors	NM_005462	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
LRP1B	53353	genome.wustl.edu	37	2	141215125	141215125	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:141215125G>C	ENST00000389484.3	-	61	10692	c.9721C>G	c.(9721-9723)Cat>Gat	p.H3241D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3241					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GATGTTTTATGGGCACGGCTG	0.428										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											0			2											231.0	202.0	212.0					2																	141215125		2203	4300	6503	140931595	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.9721C>G	2.37:g.141215125G>C	ENSP00000374135:p.His3241Asp	Somatic		Capture	Illumina GAIIx	4	140931595	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	superfamily_LDL_rcpt_classA_cys-rich,HMMPfam_Ldl_recept_a,HMMSmart_LDLa,PatternScan_LDLRA_1,superfamily_SSF57196,HMMSmart_EGF,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,superfamily_SSF63825,HMMSmart_LY,HMMPfam_Ldl_recept_b,HMMPfam_EGF,HMMPfam_NHL,HMMPfam_EGF_2,PatternScan_EGF_1	p.H3241D	ENST00000389484.3	37	c.9721	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	G	17.13	3.309883	0.60414	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.87103	-2.21	5.46	5.46	0.80206	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	U	0.000000	D	0.89259	0.6664	N	0.25890	0.77	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.86880	0.2041	10	0.23891	T	0.37	.	19.3152	0.94208	0.0:0.0:1.0:0.0	.	3241	Q9NZR2	LRP1B_HUMAN	D	3241;3179	ENSP00000374135:H3241D	ENSP00000374135:H3241D	H	-	1	0	LRP1B	140931595	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.835000	0.99442	2.550000	0.86006	0.655000	0.94253	CAT	-	superfamily_SSF63825,HMMSmart_LY,HMMPfam_Ldl_recept_b		0.428	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	G	NM_018557		140931595	-1	no_errors	NM_018557	genbank	human	validated	54_36p	missense	SNP	1.000	C
FBXO38	81545	genome.wustl.edu	37	5	147806900	147806900	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr5:147806900C>G	ENST00000340253.5	+	15	2211	c.2043C>G	c.(2041-2043)atC>atG	p.I681M	FBXO38_ENST00000513826.1_Intron|FBXO38_ENST00000394370.3_Missense_Mutation_p.I681M|CTD-2283N19.1_ENST00000520980.2_RNA|FBXO38_ENST00000296701.6_Intron			Q6PIJ6	FBX38_HUMAN	F-box protein 38	681					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGAGCAGATCAAAGCCGATA	0.498																																																0			5											64.0	59.0	60.0					5																	147806900		2203	4300	6503	147787093	SO:0001583	missense	81545			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.2043C>G	5.37:g.147806900C>G	ENSP00000342023:p.Ile681Met	Somatic		Capture	Illumina GAIIx	4	147787093	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	superfamily_F-box domain,HMMPfam_F-box,superfamily_RNI-like	p.I681M	ENST00000340253.5	37	c.2043		5	.	.	.	.	.	.	.	.	.	.	C	14.92	2.680787	0.47886	.	.	ENSG00000145868	ENST00000340253;ENST00000394370	T;T	0.42513	0.98;0.97	5.89	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.48205	0.1487	L	0.32530	0.975	0.80722	D	1	D;D	0.69078	0.993;0.997	P;D	0.80764	0.858;0.994	T	0.47787	-0.9090	10	0.66056	D	0.02	-13.4282	6.6942	0.23189	0.2978:0.6209:0.0:0.0813	.	681;681	Q6PIJ6-2;Q6PIJ6	.;FBX38_HUMAN	M	681	ENSP00000342023:I681M;ENSP00000377895:I681M	ENSP00000342023:I681M	I	+	3	3	FBXO38	147787093	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.688000	0.25422	2.793000	0.96121	0.655000	0.94253	ATC	-	NULL		0.498	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	FBXO38	protein_coding	OTTHUMT00000252185.2	C	NM_030793		147787093	+1	no_errors	NM_205836	genbank	human	validated	54_36p	missense	SNP	1.000	G
ZNF282	8427	genome.wustl.edu	37	7	148895442	148895442	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr7:148895442G>A	ENST00000262085.3	+	2	288	c.183G>A	c.(181-183)atG>atA	p.M61I	ZNF282_ENST00000479907.1_Missense_Mutation_p.M61I	NM_003575.2	NP_003566.1	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	61					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		AATGGGACATGGACGCCCGGC	0.587																																																0			7											61.0	60.0	61.0					7																	148895442		2201	4300	6501	148526375	SO:0001583	missense	8427			D30612	CCDS5895.1	7q36.1	2013-01-08			ENSG00000170265	ENSG00000170265		"""Zinc fingers, C2H2-type"", ""-"""	13076	protein-coding gene	gene with protein product		603397				9396811	Standard	NM_003575		Approved	HUB1	uc003wfm.3	Q9UDV7	OTTHUMG00000158974	ENST00000262085.3:c.183G>A	7.37:g.148895442G>A	ENSP00000262085:p.Met61Ile	Somatic		Capture	Illumina GAIIx	4	148526375	B4DRI5|O43691|Q6DKK0	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.M61I	ENST00000262085.3	37	c.183	CCDS5895.1	7	.	.	.	.	.	.	.	.	.	.	G	14.06	2.422649	0.43020	.	.	ENSG00000170265	ENST00000262085;ENST00000479907	T;T	0.05717	3.4;5.2	4.56	3.64	0.41730	.	0.000000	0.51477	D	0.000085	T	0.09818	0.0241	N	0.24115	0.695	0.30959	N	0.72385	P;P;P;P	0.45126	0.851;0.851;0.851;0.851	P;P;P;P	0.58391	0.838;0.838;0.838;0.838	T	0.05616	-1.0874	10	0.24483	T	0.36	-32.5932	10.7085	0.45969	0.0:0.1921:0.8079:0.0	.	61;12;33;61	B4DRI5;Q86YG2;Q7Z2V4;Q9UDV7	.;.;.;ZN282_HUMAN	I	61	ENSP00000262085:M61I;ENSP00000418840:M61I	ENSP00000262085:M61I	M	+	3	0	ZNF282	148526375	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	2.264000	0.43302	2.096000	0.63516	0.313000	0.20887	ATG	-	NULL		0.587	ZNF282-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF282	protein_coding	OTTHUMT00000352746.1	G	NM_003575		148526375	+1	no_errors	NM_003575	genbank	human	validated	54_36p	missense	SNP	0.988	A
MBD5	55777	genome.wustl.edu	37	2	149247139	149247139	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:149247139C>T	ENST00000407073.1	+	12	4236	c.3239C>T	c.(3238-3240)cCa>cTa	p.P1080L	MBD5_ENST00000404807.1_Missense_Mutation_p.P1313L	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1080					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GTGGGTGGCCCAGGTGATGCT	0.498																																																0			2											151.0	136.0	141.0					2																	149247139		2203	4300	6503	148963609	SO:0001583	missense	55777			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3239C>T	2.37:g.149247139C>T	ENSP00000386049:p.Pro1080Leu	Somatic		Capture	Illumina GAIIx	4	148963609	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	HMMSmart_SM00391,HMMPfam_MBD,superfamily_Tudor/PWWP/MBT,HMMPfam_PWWP	p.P1080L	ENST00000407073.1	37	c.3239	CCDS33302.1	2	.	.	.	.	.	.	.	.	.	.	C	10.64	1.406956	0.25378	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	T;T	0.17854	2.25;2.25	5.94	0.457	0.16661	.	0.430369	0.22190	N	0.063381	T	0.09818	0.0241	N	0.08118	0	0.37286	D	0.908032	B;B	0.19817	0.039;0.039	B;B	0.22753	0.023;0.041	T	0.16660	-1.0395	10	0.62326	D	0.03	0.8125	14.6144	0.68539	0.5003:0.4997:0.0:0.0	.	1313;1080	E9PHH0;Q9P267	.;MBD5_HUMAN	L	1080;1313	ENSP00000386049:P1080L;ENSP00000384672:P1313L	ENSP00000384672:P1313L	P	+	2	0	MBD5	148963609	0.997000	0.39634	0.977000	0.42913	0.994000	0.84299	1.181000	0.32017	0.122000	0.18314	-0.474000	0.04947	CCA	-	NULL		0.498	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	protein_coding	OTTHUMT00000318111.2	C			148963609	+1	no_errors	NM_018328	genbank	human	validated	54_36p	missense	SNP	0.910	T
LCE2B	26239	genome.wustl.edu	37	1	152659606	152659606	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:152659606C>A	ENST00000368780.3	+	2	341	c.287C>A	c.(286-288)cCt>cAt	p.P96H	LCE2B_ENST00000417924.2_Missense_Mutation_p.P96H	NM_014357.4	NP_055172.1	O14633	LCE2B_HUMAN	late cornified envelope 2B	96	Cys-rich.				epidermis development (GO:0008544)|keratinization (GO:0031424)					endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	11	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAGAGTGAACCTTCTGGGGGC	0.622																																																0			1											34.0	43.0	40.0					1																	152659606		2190	4278	6468	150926230	SO:0001583	missense	26239			BI670514	CCDS1020.1	1q21	2008-02-05	2004-10-11	2004-10-15	ENSG00000159455	ENSG00000159455		"""Late cornified envelopes"""	16610	protein-coding gene	gene with protein product		612610	"""small proline rich-like (epidermal differentiation complex) 1B"""	SPRL1B		11698679, 9344646	Standard	NM_014357		Approved	LEP10, XP5	uc001fai.3	O14633	OTTHUMG00000012404	ENST00000368780.3:c.287C>A	1.37:g.152659606C>A	ENSP00000357769:p.Pro96His	Somatic		Capture	Illumina GAIIx	4	150926230	Q5TA80	Missense_Mutation	SNP	NULL	p.P96H	ENST00000368780.3	37	c.287	CCDS1020.1	1	.	.	.	.	.	.	.	.	.	.	C	3.877	-0.026644	0.07589	.	.	ENSG00000159455	ENST00000417924;ENST00000368780	T;T	0.03635	3.86;3.86	2.46	-0.0736	0.13734	.	.	.	.	.	T	0.01124	0.0037	L	0.38838	1.175	0.09310	N	1	B	0.13145	0.007	B	0.15870	0.014	T	0.46119	-0.9214	9	0.87932	D	0	.	6.1011	0.20047	0.5693:0.4307:0.0:0.0	.	96	O14633	LCE2B_HUMAN	H	96	ENSP00000414043:P96H;ENSP00000357769:P96H	ENSP00000357769:P96H	P	+	2	0	LCE2B	150926230	0.000000	0.05858	0.022000	0.16811	0.064000	0.16182	0.164000	0.16542	0.282000	0.22254	0.313000	0.20887	CCT	-	NULL		0.622	LCE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2B	protein_coding	OTTHUMT00000034524.1	C	NM_014357		150926230	+1	no_errors	NM_014357	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
AKAP12	9590	genome.wustl.edu	37	6	151669871	151669871	+	Silent	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr6:151669871G>C	ENST00000253332.1	+	3	534	c.345G>C	c.(343-345)gtG>gtC	p.V115V	AKAP12_ENST00000490177.1_3'UTR|AKAP12_ENST00000354675.6_Silent_p.V17V|snoU13_ENST00000458767.1_RNA|AKAP12_ENST00000402676.2_Silent_p.V115V|AKAP12_ENST00000359755.5_Silent_p.V10V			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	115					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CTGAAGATGTGAGCAAAAGAG	0.453																																					Melanoma(141;1616 1805 10049 24534 51979)											0			6											36.0	35.0	35.0					6																	151669871		2203	4300	6503	151711564	SO:0001819	synonymous_variant	9590			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.345G>C	6.37:g.151669871G>C		Somatic		Capture	Illumina GAIIx	4	151711564	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	HMMPfam_WSK,HMMPfam_RII_binding_1	p.V115	ENST00000253332.1	37	c.345	CCDS5229.1	6																																																																																			-	NULL		0.453	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP12	protein_coding	OTTHUMT00000042712.1	G			151711564	+1	no_errors	NM_005100	genbank	human	reviewed	54_36p	silent	SNP	0.976	C
FUNDC2	65991	genome.wustl.edu	37	X	154282920	154282920	+	Silent	SNP	A	A	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chrX:154282920A>G	ENST00000369498.3	+	5	797	c.543A>G	c.(541-543)ggA>ggG	p.G181G	FUNDC2_ENST00000484175.1_3'UTR	NM_023934.3	NP_076423.2	Q9BWH2	FUND2_HUMAN	FUN14 domain containing 2	181						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GATTTTTCGGAGGCTTTCTGC	0.428																																																0			X											155.0	143.0	147.0					X																	154282920		2203	4300	6503	153936114	SO:0001819	synonymous_variant	65991			AF267862	CCDS14763.1	Xq28	2010-03-12			ENSG00000165775	ENSG00000165775			24925	protein-coding gene	gene with protein product						12477932	Standard	NM_023934		Approved	HCBP6, DC44	uc004fmw.3	Q9BWH2	OTTHUMG00000013504	ENST00000369498.3:c.543A>G	X.37:g.154282920A>G		Somatic		Capture	Illumina GAIIx	4	153936114	B2R7W5|D3DWY5|Q8NHX8|Q9H2I6	Silent	SNP	HMMPfam_FUN14	p.G181	ENST00000369498.3	37	c.543	CCDS14763.1	X																																																																																			-	HMMPfam_FUN14		0.428	FUNDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUNDC2	protein_coding	OTTHUMT00000037641.3	A	NM_023934		153936114	+1	no_errors	NM_023934	genbank	human	validated	54_36p	silent	SNP	1.000	G
TENM2	57451	genome.wustl.edu	37	5	167631496	167631496	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr5:167631496G>C	ENST00000518659.1	+	19	3733	c.3694G>C	c.(3694-3696)Gct>Cct	p.A1232P	TENM2_ENST00000519204.1_Missense_Mutation_p.A1111P|TENM2_ENST00000403607.2_Missense_Mutation_p.A1056P|TENM2_ENST00000520394.1_Missense_Mutation_p.A1000P|TENM2_ENST00000545108.1_Missense_Mutation_p.A1232P	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1232					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CAACGGCCTTGCTGAAGGCAA	0.577																																																0			5											77.0	78.0	78.0					5																	167631496		2007	4175	6182	167564074	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.3694G>C	5.37:g.167631496G>C	ENSP00000429430:p.Ala1232Pro	Somatic		Capture	Illumina GAIIx	4	167564074	Q9ULU2	Missense_Mutation	SNP	HMMPfam_Ten_N,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Carboxypeptidase regulatory domain,superfamily_NHL repeat,HMMPfam_NHL,HMMPfam_RHS_repeat	p.A1232P	ENST00000518659.1	37	c.3694		5	.	.	.	.	.	.	.	.	.	.	g	28.2	4.903573	0.92035	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.91945	-2.47;-2.43;-2.59;-2.94;-2.94	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.96442	0.8839	M	0.85630	2.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.996	D	0.97038	0.9755	10	0.66056	D	0.02	.	18.1219	0.89574	0.0:0.0:1.0:0.0	.	1232;1232;1000	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	P	1232;1232;1111;1000;1056	ENSP00000429430:A1232P;ENSP00000438635:A1232P;ENSP00000428964:A1111P;ENSP00000427874:A1000P;ENSP00000384905:A1056P	ENSP00000384905:A1056P	A	+	1	0	ODZ2	167564074	1.000000	0.71417	0.851000	0.33527	0.879000	0.50718	9.866000	0.99616	2.255000	0.74692	0.550000	0.68814	GCT	-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_NHL repeat		0.577	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	protein_coding	OTTHUMT00000376096.1	G	NM_001122679		167564074	+1	no_errors	ENST00000388903	ensembl	human	known	54_36p	missense	SNP	1.000	C
MYOC	4653	genome.wustl.edu	37	1	171605173	171605173	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:171605173G>C	ENST00000037502.6	-	3	1478	c.1407C>G	c.(1405-1407)aaC>aaG	p.N469K		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	469	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					ACTTATAGCGGTTCTTGAATG	0.488																																																0			1											211.0	185.0	194.0					1																	171605173		2203	4300	6503	169871796	SO:0001583	missense	4653			BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.1407C>G	1.37:g.171605173G>C	ENSP00000037502:p.Asn469Lys	Somatic		Capture	Illumina GAIIx	4	169871796	B2RD84|O00620|Q7Z6Q9	Missense_Mutation	SNP	HMMPfam_OLF,HMMSmart_SM00284	p.N469K	ENST00000037502.6	37	c.1407	CCDS1297.1	1	.	.	.	.	.	.	.	.	.	.	G	19.63	3.864257	0.71949	.	.	ENSG00000034971	ENST00000037502;ENST00000357746;ENST00000536591	D	0.88509	-2.39	5.08	4.15	0.48705	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.89462	0.6722	L	0.54965	1.715	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.90227	0.4276	10	0.87932	D	0	.	8.3567	0.32335	0.1847:0.0:0.8153:0.0	.	411;469	B4DV44;Q99972	.;MYOC_HUMAN	K	469;422;402	ENSP00000037502:N469K	ENSP00000037502:N469K	N	-	3	2	MYOC	169871796	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	5.709000	0.68384	1.230000	0.43646	0.484000	0.47621	AAC	-	HMMPfam_OLF,HMMSmart_SM00284		0.488	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOC	protein_coding	OTTHUMT00000084178.2	G	NM_000261		169871796	-1	no_errors	NM_000261	genbank	human	reviewed	54_36p	missense	SNP	0.996	C
RBM45	129831	genome.wustl.edu	37	2	178977301	178977301	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:178977301G>C	ENST00000286070.5	+	1	120	c.28G>C	c.(28-30)Ggc>Cgc	p.G10R		NM_152945.2	NP_694453.2	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	10					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			CTCTGCGAGCGGCGGGGGCTT	0.637											OREG0015102	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			2											23.0	28.0	26.0					2																	178977301		2173	4258	6431	178685547	SO:0001583	missense	129831			AF526533	CCDS33335.1	2q31.2	2013-02-12			ENSG00000155636	ENSG00000155636		"""RNA binding motif (RRM) containing"""	24468	protein-coding gene	gene with protein product	"""developmentally regulated RNA binding protein 1"""	608888				12220514	Standard	XM_005246287		Approved	DRB1, FLJ44612	uc002ulv.3	Q8IUH3	OTTHUMG00000154202	ENST00000286070.5:c.28G>C	2.37:g.178977301G>C	ENSP00000286070:p.Gly10Arg	Somatic	1950	Capture	Illumina GAIIx	4	178685547	Q6NYL0|Q8NFC9	Missense_Mutation	SNP	HMMSmart_SM00360,HMMPfam_RRM_1,superfamily_RNA-binding domain RBD	p.G10R	ENST00000286070.5	37	c.28	CCDS33335.1	2	.	.	.	.	.	.	.	.	.	.	G	12.35	1.911641	0.33721	.	.	ENSG00000155636	ENST00000286070	T	0.05447	3.44	5.44	4.56	0.56223	.	0.534620	0.20024	N	0.100842	T	0.04227	0.0117	N	0.19112	0.55	0.33718	D	0.616613	P	0.36789	0.57	B	0.34138	0.176	T	0.37888	-0.9686	10	0.39692	T	0.17	-2.215	7.0484	0.25059	0.2691:0.0:0.7309:0.0	.	10	Q8IUH3-3	.	R	10	ENSP00000286070:G10R	ENSP00000286070:G10R	G	+	1	0	RBM45	178685547	1.000000	0.71417	0.990000	0.47175	0.366000	0.29705	2.473000	0.45145	1.265000	0.44215	0.563000	0.77884	GGC	-	NULL		0.637	RBM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM45	protein_coding	OTTHUMT00000334375.2	G	NM_152945		178685547	+1	no_errors	NM_152945	genbank	human	provisional	54_36p	missense	SNP	0.990	C
CALCRL	10203	genome.wustl.edu	37	2	188210990	188210990	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:188210990C>G	ENST00000409998.1	-	16	2088	c.1307G>C	c.(1306-1308)tGt>tCt	p.C436S	AC007319.1_ENST00000453517.1_RNA|AC007319.1_ENST00000412276.1_RNA|CALCRL_ENST00000410068.1_Missense_Mutation_p.C436S|CALCRL_ENST00000392370.3_Missense_Mutation_p.C436S			Q16602	CALRL_HUMAN	calcitonin receptor-like	436					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)			endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			TTCACTAGGACAGTCATGACT	0.353																																																0			2											123.0	114.0	117.0					2																	188210990		2203	4299	6502	187919235	SO:0001583	missense	10203			U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.1307G>C	2.37:g.188210990C>G	ENSP00000386972:p.Cys436Ser	Somatic		Capture	Illumina GAIIx	4	187919235	A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	superfamily_SSF111418,HMMSmart_HormR,HMMPfam_HRM,PatternScan_G_PROTEIN_RECEP_F2_1,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.C436S	ENST00000409998.1	37	c.1307	CCDS2293.1	2	.	.	.	.	.	.	.	.	.	.	C	6.419	0.445373	0.12164	.	.	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068	T;T;T	0.39787	1.06;1.06;1.06	5.7	-6.48	0.01896	.	0.628423	0.15424	N	0.263085	T	0.16300	0.0392	N	0.17312	0.475	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30736	-0.9968	10	0.10377	T	0.69	.	5.8489	0.18681	0.2747:0.3173:0.0:0.4079	.	436	Q16602	CALRL_HUMAN	S	436	ENSP00000376177:C436S;ENSP00000386972:C436S;ENSP00000387190:C436S	ENSP00000376177:C436S	C	-	2	0	CALCRL	187919235	0.001000	0.12720	0.001000	0.08648	0.911000	0.54048	-0.324000	0.07986	-1.122000	0.02945	-0.899000	0.02877	TGT	-	NULL		0.353	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CALCRL	protein_coding	OTTHUMT00000334648.1	C	NM_005795		187919235	-1	no_errors	NM_005795	genbank	human	validated	54_36p	missense	SNP	0.534	G
PMS1	5378	genome.wustl.edu	37	2	190728861	190728861	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:190728861A>G	ENST00000441310.2	+	10	2482	c.2249A>G	c.(2248-2250)tAt>tGt	p.Y750C	PMS1_ENST00000432292.3_Missense_Mutation_p.Y574C|PMS1_ENST00000447232.2_Intron|PMS1_ENST00000418224.3_Missense_Mutation_p.Y574C|PMS1_ENST00000409823.3_Missense_Mutation_p.Y711C	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	750					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TTAAATCCATATAGAGTAGAA	0.383			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																														yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0			2											106.0	118.0	114.0					2																	190728861		2203	4300	6503	190437106	SO:0001583	missense	5378				CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.2249A>G	2.37:g.190728861A>G	ENSP00000406490:p.Tyr750Cys	Somatic		Capture	Illumina GAIIx	4	190437106	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	superfamily_ATP_bd_ATPase,HMMPfam_HATPase_c,HMMSmart_HATPase_c,PatternScan_DNA_MISMATCH_REPAIR_1,superfamily_Ribosomal_S5_D2-typ_fold,HMMPfam_DNA_mis_repair,superfamily_HMG-box,HMMSmart_HMG,HMMPfam_HMG_box	p.Y750C	ENST00000441310.2	37	c.2249	CCDS2302.1	2	.	.	.	.	.	.	.	.	.	.	A	18.08	3.544692	0.65198	.	.	ENSG00000064933	ENST00000441310;ENST00000418224;ENST00000409823;ENST00000432292;ENST00000424307;ENST00000452382	T;T;T;T;D;T	0.87809	1.79;1.79;1.79;1.79;-2.3;1.79	5.45	5.45	0.79879	.	0.271361	0.43579	D	0.000552	D	0.92502	0.7619	M	0.71581	2.175	0.48452	D	0.999652	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.68353	0.957;0.953;0.957	D	0.93315	0.6688	10	0.87932	D	0	-7.57	15.7434	0.77920	1.0:0.0:0.0:0.0	.	750;711;750	Q4VAL4;Q5FBZ3;P54277	.;.;PMS1_HUMAN	C	750;574;711;574;689;138	ENSP00000406490:Y750C;ENSP00000404492:Y574C;ENSP00000387125:Y711C;ENSP00000398378:Y574C;ENSP00000389938:Y689C;ENSP00000396232:Y138C	ENSP00000387125:Y711C	Y	+	2	0	PMS1	190437106	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.018000	0.70811	2.301000	0.77427	0.524000	0.50904	TAT	-	NULL		0.383	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	protein_coding	OTTHUMT00000255918.2	A			190437106	+1	no_errors	NM_000534	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
F13B	2165	genome.wustl.edu	37	1	197009835	197009835	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:197009835T>C	ENST00000367412.1	-	11	1812	c.1769A>G	c.(1768-1770)gAa>gGa	p.E590G	F13B_ENST00000490002.1_5'UTR	NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	590	Sushi 10. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						ATTATTCTTTTCCATTTCAGT	0.303																																																0			1											45.0	42.0	43.0					1																	197009835		2201	4294	6495	195276458	SO:0001583	missense	2165			M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1769A>G	1.37:g.197009835T>C	ENSP00000356382:p.Glu590Gly	Somatic		Capture	Illumina GAIIx	4	195276458	A8K3E5|Q5VYL5	Missense_Mutation	SNP	superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP	p.E590G	ENST00000367412.1	37	c.1769	CCDS1388.1	1	.	.	.	.	.	.	.	.	.	.	T	15.87	2.960564	0.53400	.	.	ENSG00000143278	ENST00000367412	D	0.84070	-1.8	5.59	5.59	0.84812	Complement control module (1);	0.239048	0.21752	N	0.069645	T	0.81322	0.4798	M	0.81497	2.545	0.36654	D	0.877574	P	0.44627	0.839	B	0.36134	0.218	D	0.85670	0.1294	10	0.45353	T	0.12	.	11.5362	0.50639	0.0:0.0:0.1495:0.8505	.	590	P05160	F13B_HUMAN	G	590	ENSP00000356382:E590G	ENSP00000356382:E590G	E	-	2	0	F13B	195276458	0.962000	0.33011	0.942000	0.38095	0.911000	0.54048	1.678000	0.37586	2.246000	0.74042	0.533000	0.62120	GAA	-	superfamily_Complement_control_module		0.303	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13B	protein_coding	OTTHUMT00000088821.2	T	NM_001994		195276458	-1	no_errors	NM_001994	genbank	human	reviewed	54_36p	missense	SNP	0.753	C
REN	5972	genome.wustl.edu	37	1	204129729	204129729	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:204129729T>C	ENST00000272190.8	-	4	479	c.451A>G	c.(451-453)Aca>Gca	p.T151A	REN_ENST00000367195.2_Missense_Mutation_p.T151A	NM_000537.3	NP_000528.1	P00797	RENI_HUMAN	renin	151					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cell maturation (GO:0048469)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|drinking behavior (GO:0042756)|hormone-mediated signaling pathway (GO:0009755)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mesonephros development (GO:0001823)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of MAPK cascade (GO:0043408)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cAMP (GO:0051591)|response to cGMP (GO:0070305)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|peptidase activity (GO:0008233)|receptor binding (GO:0005102)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(4)|urinary_tract(1)	19	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	ACTGTCCCTGTTGAATAGCGG	0.572																																																0			1											179.0	150.0	160.0					1																	204129729		2203	4300	6503	202396352	SO:0001583	missense	5972			BC047752	CCDS30981.1	1q32	2008-02-05			ENSG00000143839	ENSG00000143839	3.4.23.15		9958	protein-coding gene	gene with protein product		179820					Standard	NM_000537		Approved		uc001haq.2	P00797	OTTHUMG00000036059	ENST00000272190.8:c.451A>G	1.37:g.204129729T>C	ENSP00000272190:p.Thr151Ala	Somatic		Capture	Illumina GAIIx	4	202396352	Q6FI38|Q6T5C2	Missense_Mutation	SNP	superfamily_Acid proteases,HMMPfam_A1_Propeptide,HMMPfam_Asp,PatternScan_ASP_PROTEASE	p.T151A	ENST00000272190.8	37	c.451	CCDS30981.1	1	.	.	.	.	.	.	.	.	.	.	T	7.022	0.558874	0.13436	.	.	ENSG00000143839	ENST00000367195;ENST00000545733;ENST00000272190	T;T	0.60299	0.2;0.2	4.86	2.45	0.29901	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.183072	0.49916	D	0.000131	T	0.49287	0.1548	M	0.62209	1.925	0.33074	D	0.535735	B	0.15141	0.012	B	0.18871	0.023	T	0.53187	-0.8474	10	0.72032	D	0.01	.	4.5514	0.12114	0.4419:0.0:0.0862:0.4719	.	151	P00797	RENI_HUMAN	A	151;70;151	ENSP00000356163:T151A;ENSP00000272190:T151A	ENSP00000272190:T151A	T	-	1	0	REN	202396352	0.866000	0.29940	0.889000	0.34880	0.001000	0.01503	1.760000	0.38430	0.194000	0.20326	-1.407000	0.01130	ACA	-	superfamily_Acid proteases,HMMPfam_Asp		0.572	REN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REN	protein_coding	OTTHUMT00000087891.1	T	NM_000537		202396352	-1	no_errors	NM_000537	genbank	human	reviewed	54_36p	missense	SNP	0.870	C
GPR1	2825	genome.wustl.edu	37	2	207041082	207041082	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:207041082C>T	ENST00000407325.2	-	3	1252	c.890G>A	c.(889-891)aGt>aAt	p.S297N	GPR1_ENST00000437420.1_Missense_Mutation_p.S297N	NM_001098199.1|NM_001261452.1|NM_001261453.1|NM_001261454.1|NM_001261455.1|NM_005279.3	NP_001091669.1|NP_001248381.1|NP_001248382.1|NP_001248383.1|NP_001248384.1|NP_005270.2	P46091	GPR1_HUMAN	G protein-coupled receptor 1	297					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	18		Lung NSC(271;7.93e-06)|Renal(323;0.000147)|Hepatocellular(293;0.000888)		UCEC - Uterine corpus endometrioid carcinoma (47;0.000241)|Epithelial(149;1.91e-37)|STAD - Stomach adenocarcinoma(1183;0.00178)|Lung(261;0.111)|LUSC - Lung squamous cell carcinoma(261;0.184)		GTTCAAGCAACTATTGAGGAA	0.478																																																0			2											115.0	109.0	111.0					2																	207041082		2203	4300	6503	206749327	SO:0001583	missense	2825				CCDS2368.1	2q33.3	2014-01-30			ENSG00000183671	ENSG00000183671		"""GPCR / Class A : Orphans"""	4463	protein-coding gene	gene with protein product		600239				7851889	Standard	NM_005279		Approved		uc031rqv.1	P46091	OTTHUMG00000132894	ENST00000407325.2:c.890G>A	2.37:g.207041082C>T	ENSP00000384345:p.Ser297Asn	Somatic		Capture	Illumina GAIIx	4	206749327	A5JUU6|A8K4L1|Q53TR9|Q6NVX4	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.S297N	ENST00000407325.2	37	c.890	CCDS2368.1	2	.	.	.	.	.	.	.	.	.	.	C	27.9	4.871722	0.91587	.	.	ENSG00000183671	ENST00000407325;ENST00000437420	T;T	0.79554	-1.28;-1.28	5.7	5.7	0.88788	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.92077	0.7489	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91430	0.5165	10	0.38643	T	0.18	.	19.8379	0.96666	0.0:1.0:0.0:0.0	.	297	P46091	GPR1_HUMAN	N	297	ENSP00000384345:S297N;ENSP00000397535:S297N	ENSP00000384345:S297N	S	-	2	0	GPR1	206749327	1.000000	0.71417	0.971000	0.41717	0.955000	0.61496	7.772000	0.85439	2.696000	0.92011	0.655000	0.94253	AGT	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.478	GPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR1	protein_coding	OTTHUMT00000256394.2	C	NM_001098199		206749327	-1	no_errors	NM_001098199	genbank	human	validated	54_36p	missense	SNP	1.000	T
UNC80	285175	genome.wustl.edu	37	2	210642243	210642243	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:210642243T>A	ENST00000439458.1	+	4	640	c.560T>A	c.(559-561)cTc>cAc	p.L187H	UNC80_ENST00000478701.1_3'UTR|UNC80_ENST00000272845.6_Missense_Mutation_p.L187H	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	187					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						ACTGTGGAGCTCTTCGTGTTT	0.507																																																0			2											109.0	113.0	112.0					2																	210642243		2203	4300	6503	210350488	SO:0001583	missense	285175			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.560T>A	2.37:g.210642243T>A	ENSP00000391088:p.Leu187His	Somatic		Capture	Illumina GAIIx	4	210350488	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.L187H	ENST00000439458.1	37	c.560	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	T	26.8	4.768937	0.90020	.	.	ENSG00000144406	ENST00000439458;ENST00000281753;ENST00000272845	T;T	0.42513	0.97;0.97	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.65176	0.2666	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.68368	-0.5427	10	0.87932	D	0	.	16.3662	0.83325	0.0:0.0:0.0:1.0	.	187;187	Q8N2C7;Q8N2C7-3	UNC80_HUMAN;.	H	187	ENSP00000391088:L187H;ENSP00000272845:L187H	ENSP00000272845:L187H	L	+	2	0	UNC80	210350488	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.830000	0.86741	2.274000	0.75844	0.533000	0.62120	CTC	-	NULL		0.507	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf21	protein_coding		T	NM_182587		210350488	+1	no_errors	NM_182587	genbank	human	validated	54_36p	missense	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237551468	237551468	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:237551468G>T	ENST00000366574.2	+	10	1075	c.758G>T	c.(757-759)gGt>gTt	p.G253V	RYR2_ENST00000360064.6_Missense_Mutation_p.G251V|RYR2_ENST00000542537.1_Missense_Mutation_p.G237V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	253	MIR 3. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGAGAACATGGTGAAGAGCAG	0.443																																																0			1											100.0	99.0	99.0					1																	237551468		2053	4207	6260	235618091	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.758G>T	1.37:g.237551468G>T	ENSP00000355533:p.Gly253Val	Somatic		Capture	Illumina GAIIx	4	235618091	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	HMMPfam_Ins145_P3_rec,HMMSmart_SM00472,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815),HMMPfam_RYDR_ITPR,HMMPfam_SPRY,HMMSmart_SM00449,HMMPfam_RyR,HMMPfam_RIH_assoc,superfamily_EF-hand,HMMPfam_RR_TM4-6,HMMPfam_Ion_trans	p.G253V	ENST00000366574.2	37	c.758	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889292	0.52014	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.86694	-2.16;-2.16;-2.16	5.34	5.34	0.76211	MIR motif (2);MIR (2);	0.000000	0.64402	D	0.000010	D	0.86573	0.5965	M	0.63428	1.95	0.80722	D	1	P	0.49253	0.921	B	0.43950	0.437	D	0.85843	0.1399	10	0.33141	T	0.24	.	15.9497	0.79823	0.0:0.0:1.0:0.0	.	253	Q92736	RYR2_HUMAN	V	253;251;237	ENSP00000355533:G253V;ENSP00000353174:G251V;ENSP00000443798:G237V	ENSP00000353174:G251V	G	+	2	0	RYR2	235618091	1.000000	0.71417	0.969000	0.41365	0.992000	0.81027	5.470000	0.66756	2.502000	0.84385	0.655000	0.94253	GGT	-	HMMSmart_SM00472,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815)		0.443	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	G	NM_001035		235618091	+1	no_errors	NM_001035	genbank	human	reviewed	54_36p	missense	SNP	0.989	T
OR2T11	127077	genome.wustl.edu	37	1	248789970	248789970	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:248789970A>T	ENST00000330803.2	-	1	521	c.460T>A	c.(460-462)Ttt>Att	p.F154I		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTGAGCAGAAAGCCATCGAGG	0.532																																																0			1											49.0	57.0	55.0					1																	248789970		2049	4233	6282	246856593	SO:0001583	missense	127077			BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.460T>A	1.37:g.248789970A>T	ENSP00000328934:p.Phe154Ile	Somatic		Capture	Illumina GAIIx	4	246856593	Q6IEY6	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.F154I	ENST00000330803.2	37	c.460	CCDS31122.1	1	.	.	.	.	.	.	.	.	.	.	.	8.491	0.862011	0.17178	.	.	ENSG00000183130	ENST00000330803	T	0.00042	8.84	4.38	1.87	0.25490	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	D	0.000411	T	0.00178	0.0005	N	0.21508	0.67	0.09310	N	1	D	0.69078	0.997	D	0.69479	0.964	T	0.55623	-0.8112	10	0.21014	T	0.42	.	5.7549	0.18168	0.766:0.0:0.0862:0.1478	.	154	Q8NH01	O2T11_HUMAN	I	154	ENSP00000328934:F154I	ENSP00000328934:F154I	F	-	1	0	OR2T11	246856593	0.000000	0.05858	0.610000	0.28997	0.127000	0.20565	-1.019000	0.03622	0.700000	0.31782	0.533000	0.62120	TTT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.532	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T11	protein_coding	OTTHUMT00000097134.1	A	NM_001001964		246856593	-1	no_errors	NM_001001964	genbank	human	provisional	54_36p	missense	SNP	0.003	T
PYGB	5834	genome.wustl.edu	37	20	25277071	25277071	+	Frame_Shift_Del	DEL	C	C	-			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr20:25277071delC	ENST00000216962.4	+	20	2555	c.2445delC	c.(2443-2445)gacfs	p.D815fs	PYGB_ENST00000471359.1_3'UTR|ABHD12_ENST00000376542.3_Intron	NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	815					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						TCTCCAGTGACCGGACCATCA	0.607																																																0			20											104.0	81.0	89.0					20																	25277071		2203	4300	6503	25225071	SO:0001589	frameshift_variant	5834				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.2445delC	20.37:g.25277071delC	ENSP00000216962:p.Asp815fs	Somatic		Capture	Illumina GAIIx	4	25225071	Q96AK1|Q9NPX8	Frame_Shift_Del	DEL	superfamily_SSF53756,HMMPfam_Phosphorylase,PatternScan_PHOSPHORYLASE	p.R816fs	ENST00000216962.4	37	c.2445	CCDS13171.1	20																																																																																			(deletion:cds_exon[25225006,25225158])	superfamily_SSF53756,HMMPfam_Phosphorylase		0.607	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	protein_coding	OTTHUMT00000078415.2	C	NM_002862		25225071	+1	no_errors	NM_002862	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
FAM186B	84070	genome.wustl.edu	37	12	49994080	49994080	+	Frame_Shift_Del	DEL	A	A	-			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr12:49994080delA	ENST00000257894.2	-	4	1504	c.1343delT	c.(1342-1344)ttcfs	p.F448fs	PRPF40B_ENST00000508736.1_3'UTR|FAM186B_ENST00000551047.1_Intron|FAM186B_ENST00000544141.1_Frame_Shift_Del_p.F358fs	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	448						protein complex (GO:0043234)				breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TCCCTTCTGGAAGTAGTCCTC	0.517																																																0			12											92.0	83.0	86.0					12																	49994080		2203	4300	6503	48280347	SO:0001589	frameshift_variant	84070			AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.1343delT	12.37:g.49994080delA	ENSP00000257894:p.Phe448fs	Somatic		Capture	Illumina GAIIx	4	48280347	B4DZ15|Q8TCP7|Q9H0L3	Frame_Shift_Del	DEL	NULL	p.F448fs	ENST00000257894.2	37	c.1343	CCDS8788.1	12																																																																																			(deletion:cds_exon[48279519,48281184])	NULL		0.517	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM186B	protein_coding	OTTHUMT00000394583.2	A	NM_032130		48280347	-1	no_errors	NM_032130	genbank	human	predicted	54_36p	frame_shift_del	DEL	0.001	-
ABCA13	154664	genome.wustl.edu	37	7	48356770	48356793	+	In_Frame_Del	DEL	GCTTTATCAGGAAATTCTACAATT	GCTTTATCAGGAAATTCTACAATT	-	rs370598060		TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	GCTTTATCAGGAAATTCTACAATT	GCTTTATCAGGAAATTCTACAATT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr7:48356770_48356793delGCTTTATCAGGAAATTCTACAATT	ENST00000435803.1	+	27	9900_9923	c.9876_9899delGCTTTATCAGGAAATTCTACAATT	c.(9874-9900)aagctttatcaggaaattctacaattg>aag	p.LYQEILQL3293del		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3293					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTTGCTTGAAGCTTTATCAGGAAATTCTACAATTGCCAAATGGT	0.362																																																0			7																																								48327339	SO:0001651	inframe_deletion	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.9876_9899delGCTTTATCAGGAAATTCTACAATT	7.37:g.48356770_48356793delGCTTTATCAGGAAATTCTACAATT	ENSP00000411096:p.Leu3293_Leu3300del	Somatic		Capture	Illumina GAIIx	4	48327316	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	In_Frame_Del	DEL	PatternScan_SERPIN	p.FIRKFYNC3239in_frame_del	ENST00000435803.1	37	c.9713_9736	CCDS47584.1	7																																																																																			(deletion:cds_exon[48327300,48327439])	NULL		0.362	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	protein_coding	OTTHUMT00000341964.2	GCTTTATCAGGAAATTCTACAATT	NM_152701		48327339	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_152701	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.998:0.999:1.000:0.997:1.000:1.000:1.000:1.000:0.994	-
TXNDC16	57544	genome.wustl.edu	37	14	52955151	52955152	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	AT	AT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr14:52955151_52955152delAT	ENST00000281741.4	-	12	1408_1409	c.1037_1038delAT	c.(1036-1038)catfs	p.H346fs	TXNDC16_ENST00000554399.1_Intron	NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	346					cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					TATTTTCCACATGAGATATTAT	0.312																																																0			14																																								52024902	SO:0001589	frameshift_variant	57544			AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.1037_1038delAT	14.37:g.52955151_52955152delAT	ENSP00000281741:p.His346fs	Somatic		Capture	Illumina GAIIx	4	52024901	A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Frame_Shift_Del	DEL	superfamily_Thioredoxin-like,HMMPfam_Thioredoxin	p.H346fs	ENST00000281741.4	37	c.1038_1037	CCDS32083.1	14																																																																																			(deletion:cds_exon[52024831,52024954])	NULL		0.312	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNDC16	protein_coding	OTTHUMT00000411681.1	AT	XM_051699		52024902	-1	no_errors	NM_020784	genbank	human	provisional	54_36p	frame_shift_del	DEL	0.994:0.994	-
B3GNT2	10678	genome.wustl.edu	37	2	62449713	62449713	+	Frame_Shift_Del	DEL	C	C	-			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr2:62449713delC	ENST00000301998.4	+	2	610	c.358delC	c.(358-360)ctgfs	p.L121fs	B3GNT2_ENST00000405767.1_Frame_Shift_Del_p.L121fs	NM_006577.5	NP_006568.2	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2	121					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)	18	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			TAAAGACTTTCTGCTGTATTT	0.458																																																0			2											153.0	173.0	166.0					2																	62449713		2203	4300	6503	62303217	SO:0001589	frameshift_variant	10678			AB049584	CCDS1870.1	2p15	2013-02-19	2006-04-12	2006-04-12	ENSG00000170340	ENSG00000170340		"""Beta 3-glycosyltransferases"""	15629	protein-coding gene	gene with protein product		605581	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1"""	B3GNT1		9892646, 11042166	Standard	NM_006577		Approved	B3GNT-2, BETA3GNT, B3GN-T2, B3GN-T1	uc002sbs.3	Q9NY97	OTTHUMG00000129444	ENST00000301998.4:c.358delC	2.37:g.62449713delC	ENSP00000305595:p.Leu121fs	Somatic		Capture	Illumina GAIIx	4	62303217	Q54AC1|Q9NQQ9|Q9NQR0|Q9NUT9	Frame_Shift_Del	DEL	HMMPfam_Galactosyl_T	p.L120fs	ENST00000301998.4	37	c.358	CCDS1870.1	2																																																																																			(deletion:cds_exon[62302860,62304053])	NULL		0.458	B3GNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT2	protein_coding	OTTHUMT00000251606.2	C	NM_006577		62303217	+1	no_errors	NM_006577	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
MUC13	56667	genome.wustl.edu	37	3	124630974	124630978	+	Frame_Shift_Del	DEL	TAGCC	TAGCC	-	rs368618875		TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	TAGCC	TAGCC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr3:124630974_124630978delTAGCC	ENST00000311075.3	-	9	1260_1264	c.1222_1226delGGCTA	c.(1222-1227)ggctacfs	p.GY408fs		NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	409					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						GAGTCCACTGTAGCCAAATGCACAC	0.429																																																0			3																																								126113668	SO:0001589	frameshift_variant	56667			AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.1222_1226delGGCTA	3.37:g.124630974_124630978delTAGCC	ENSP00000312235:p.Gly408fs	Somatic		Capture	Illumina GAIIx	4	126113664	Q6UWD9|Q9NXT5	Frame_Shift_Del	DEL	superfamily_EGF/Laminin,HMMSmart_SM00181,PatternScan_EGF_2,HMMPfam_SEA	p.G408fs	ENST00000311075.3	37	c.1226_1222		3																																																																																			(deletion:cds_exon[126113641,126113678])	NULL		0.429	MUC13-001	KNOWN	basic|appris_principal	protein_coding	MUC13	protein_coding	OTTHUMT00000355714.1	TAGCC	NM_033049		126113668	-1	no_errors	NM_033049	genbank	human	validated	54_36p	frame_shift_del	DEL	0.618:0.659:0.661:0.652:0.580	-
RPS14	6208	genome.wustl.edu	37	5	149826457	149826467	+	Frame_Shift_Del	DEL	AGCATATGGTG	AGCATATGGTG	-	rs200242397|rs11538774		TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	AGCATATGGTG	AGCATATGGTG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr5:149826457_149826467delAGCATATGGTG	ENST00000401695.3	-	3	255_265	c.209_219delCACCATATGCT	c.(208-219)tcaccatatgctfs	p.SPYA70fs	RPS14_ENST00000312037.5_Frame_Shift_Del_p.SPYA70fs|RPS14_ENST00000407193.1_Frame_Shift_Del_p.SPYA70fs			P62263	RS14_HUMAN	ribosomal protein S14	70					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|maturation of SSU-rRNA (GO:0030490)|mRNA metabolic process (GO:0016071)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|ribosomal small subunit assembly (GO:0000028)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)|translation regulator activity (GO:0045182)			central_nervous_system(1)|lung(1)|skin(1)	3		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCAACATAGCAGCATATGGTGAGGATTCATC	0.545																																																0			5																																								149806660	SO:0001589	frameshift_variant	6208				CCDS4307.1	5q31-q33	2012-10-02			ENSG00000164587	ENSG00000164587		"""S ribosomal proteins"""	10387	protein-coding gene	gene with protein product	"""emetine resistance"", ""40S ribosomal protein S14"""	130620				3785212, 1549121	Standard	XM_006714790		Approved	EMTB, S14	uc003lsj.3	P62263	OTTHUMG00000130080	ENST00000401695.3:c.209_219delCACCATATGCT	5.37:g.149826457_149826467delAGCATATGGTG	ENSP00000385958:p.Ser70fs	Somatic		Capture	Illumina GAIIx	4	149806650	B2R5G5|D3DQG5|P06366|Q5BJI0	Frame_Shift_Del	DEL	superfamily_Translational machinery components,HMMPfam_Ribosomal_S11,PatternScan_RIBOSOMAL_S11	p.S70fs	ENST00000401695.3	37	c.219_209	CCDS4307.1	5																																																																																			(deletion:cds_exon[149806558,149806719])	superfamily_Translational machinery components,HMMPfam_Ribosomal_S11		0.545	RPS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS14	protein_coding	OTTHUMT00000252373.1	AGCATATGGTG	NM_001025071		149806660	-1	no_errors	NM_001025070	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.999:1.000:1.000:0.995:1.000:1.000:0.909:1.000:1.000:1.000:1.000	-
NUF2	83540	genome.wustl.edu	37	1	163297340	163297349	+	Frame_Shift_Del	DEL	ACATTTTTAC	ACATTTTTAC	-			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	ACATTTTTAC	ACATTTTTAC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:163297340_163297349delACATTTTTAC	ENST00000271452.3	+	3	465_474	c.186_195delACATTTTTAC	c.(184-195)gaacatttttacfs	p.EHFY62fs	NUF2_ENST00000367900.3_Frame_Shift_Del_p.EHFY62fs|NUF2_ENST00000490881.1_3'UTR|NUF2_ENST00000524800.1_Frame_Shift_Del_p.EHFY62fs	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	62	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					TTCGACTGGAACATTTTTACATGGTGAGTT	0.357																																																0			1																																								161563973	SO:0001589	frameshift_variant	83540			BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.186_195delACATTTTTAC	1.37:g.163297340_163297349delACATTTTTAC	ENSP00000271452:p.Glu62fs	Somatic		Capture	Illumina GAIIx	4	161563964	Q8WU69|Q96HJ4|Q96Q78	Frame_Shift_Del	DEL	HMMPfam_Nuf2	p.H63fs	ENST00000271452.3	37	c.186_195	CCDS1245.1	1																																																																																			(deletion:cds_exon[161563902,161563976])	HMMPfam_Nuf2		0.357	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NUF2	protein_coding	OTTHUMT00000082812.1	ACATTTTTAC	NM_145697		161563973	+1	no_errors	NM_031423	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:0.995:1.000:1.000:1.000	-
CACNA1S	779	genome.wustl.edu	37	1	201035010	201035010	+	Frame_Shift_Del	DEL	G	G	-			TCGA-23-1114-01B-01W-0633-09	TCGA-23-1114-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	0114ee8f-86b5-4353-b16b-45899cf9bfc5	6a619513-c467-4c62-96bc-cefa5de3c3a2	g.chr1:201035010delG	ENST00000362061.3	-	22	3035	c.2809delC	c.(2809-2811)ctcfs	p.L938fs	CACNA1S_ENST00000367338.3_Frame_Shift_Del_p.L938fs	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	938					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AACTGTAGGAGGGTAGTGACC	0.647																																																0			1											102.0	82.0	89.0					1																	201035010		2203	4300	6503	199301633	SO:0001589	frameshift_variant	779			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.2809delC	1.37:g.201035010delG	ENSP00000355192:p.Leu938fs	Somatic		Capture	Illumina GAIIx	4	199301633	A4IF51|B1ALM2|Q12896|Q13934	Frame_Shift_Del	DEL	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ	p.L937fs	ENST00000362061.3	37	c.2809	CCDS1407.1	1																																																																																			(deletion:cds_exon[199301589,199301696])	superfamily_SSF81324,HMMPfam_Ion_trans		0.647	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	protein_coding	OTTHUMT00000087049.1	G	NM_000069		199301633	-1	no_errors	NM_000069	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
