#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TARDBP	23435	genome.wustl.edu	37	1	11078845	11078845	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:11078845C>T	ENST00000240185.3	+	4	572	c.458C>T	c.(457-459)aCg>aTg	p.T153M	TARDBP_ENST00000439080.2_Missense_Mutation_p.T37M|TARDBP_ENST00000315091.3_Missense_Mutation_p.T153M	NM_007375.3	NP_031401.1	Q13148	TADBP_HUMAN	TAR DNA binding protein	153	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell death (GO:0008219)|mRNA processing (GO:0006397)|negative regulation by host of viral transcription (GO:0043922)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T153M(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)	11	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		GTTCGTTTTACGGAATATGAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	1											200.0	190.0	194.0					1																	11078845		2203	4300	6503	11001432	SO:0001583	missense	23435			U23731	CCDS122.1	1p36.22	2014-09-17			ENSG00000120948	ENSG00000120948		"""RNA binding motif (RRM) containing"""	11571	protein-coding gene	gene with protein product		605078				7745706	Standard	NM_007375		Approved	TDP-43, ALS10	uc001art.3	Q13148	OTTHUMG00000002120	ENST00000240185.3:c.458C>T	1.37:g.11078845C>T	ENSP00000240185:p.Thr153Met	Somatic		Capture	Illumina GAIIx	4	11001432	A4GUK4|A4GUK5|A4GUK6|B2R629|B4DJ45|E2PU12|Q53H27|Q6FI92|Q96DJ0	Missense_Mutation	SNP	-	p.T153M	ENST00000240185.3	37	c.458	CCDS122.1	1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360400	0.61403	.	.	ENSG00000120948	ENST00000240185;ENST00000439080;ENST00000315091	D;D;D	0.86030	-2.06;-2.06;-2.06	5.81	5.81	0.92471	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.173376	0.64402	D	0.000016	T	0.79592	0.4472	L	0.32530	0.975	0.49299	D	0.999771	B;B	0.31548	0.328;0.269	B;B	0.22753	0.018;0.041	T	0.76639	-0.2885	10	0.44086	T	0.13	-19.1925	20.0826	0.97783	0.0:1.0:0.0:0.0	.	37;153	B4DJ45;Q13148	.;TADBP_HUMAN	M	153;37;153	ENSP00000240185:T153M;ENSP00000404666:T37M;ENSP00000313129:T153M	ENSP00000240185:T153M	T	+	2	0	TARDBP	11001432	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.802000	0.69122	2.746000	0.94184	0.655000	0.94253	ACG	-	NULL		0.393	TARDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARDBP	protein_coding	OTTHUMT00000006063.1	C	NM_007375		11001432	1	no_errors	NM_007375	genbank	human	reviewed	54_36p	missense	SNP	1	T
KCNA10	3744	genome.wustl.edu	37	1	111061295	111061295	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:111061295C>G	ENST00000369771.2	-	1	502	c.115G>C	c.(115-117)Ggc>Cgc	p.G39R		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	39					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)	p.G39R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	CCAGGCCGGCCTTTTGGGCTG	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											44.0	48.0	47.0					1																	111061295		2203	4300	6503	110862818	SO:0001583	missense	3744			U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.115G>C	1.37:g.111061295C>G	ENSP00000358786:p.Gly39Arg	Somatic		Capture	Illumina GAIIx	4	110862818		Missense_Mutation	SNP	-	p.G39R	ENST00000369771.2	37	c.115	CCDS826.1	1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.802543	0.31869	.	.	ENSG00000143105	ENST00000369771	D	0.96913	-4.17	5.63	4.71	0.59529	.	0.858044	0.10658	N	0.649041	D	0.93210	0.7837	L	0.60455	1.87	0.35048	D	0.760352	P	0.51240	0.943	P	0.45681	0.49	D	0.88403	0.3016	10	0.27785	T	0.31	.	12.9071	0.58158	0.2951:0.7049:0.0:0.0	.	39	Q16322	KCA10_HUMAN	R	39	ENSP00000358786:G39R	ENSP00000358786:G39R	G	-	1	0	KCNA10	110862818	0.977000	0.34250	0.998000	0.56505	0.866000	0.49608	2.575000	0.46025	1.356000	0.45884	0.655000	0.94253	GGC	-	NULL		0.527	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA10	protein_coding	OTTHUMT00000059081.1	C	NM_005549		110862818	-1	no_errors	NM_005549	genbank	human	reviewed	54_36p	missense	SNP	0.22	G
PRAMEF20	645425	genome.wustl.edu	37	1	13742951	13742951	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:13742951G>C	ENST00000602960.1	+	1	144	c.140G>C	c.(139-141)aGa>aCa	p.R47T	PRAMEF20_ENST00000316412.5_Missense_Mutation_p.R47T			Q5VT98	PRA20_HUMAN	PRAME family member 20	47					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.R47T(1)		endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)	4	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.5e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000156)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTCAGCAGGAGACACTGTGAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											10.0	10.0	10.0					1																	13742951		2133	4200	6333	13615538	SO:0001583	missense	645425				CCDS41265.1	1p36.21	2014-07-15			ENSG00000204478	ENSG00000204478		"""-"""	25224	protein-coding gene	gene with protein product			"""PRAME family member 21"""	PRAMEF21			Standard	NM_001099852		Approved	OTTHUMG00000007911, OTTHUMT00000008157	uc009vnv.1	Q5VT98	OTTHUMG00000007911	ENST00000602960.1:c.140G>C	1.37:g.13742951G>C	ENSP00000473584:p.Arg47Thr	Somatic		Capture	Illumina GAIIx	4	13615538		Missense_Mutation	SNP	-	p.R47T	ENST00000602960.1	37	c.140	CCDS41265.1	1	.	.	.	.	.	.	.	.	.	.	.	6.133	0.392822	0.11638	.	.	ENSG00000204478	ENST00000316412	T	0.10668	2.85	1.51	0.559	0.17272	.	0.925980	0.09256	N	0.827218	T	0.28101	0.0693	M	0.91561	3.22	0.09310	N	1	.	.	.	.	.	.	T	0.16041	-1.0416	8	0.66056	D	0.02	.	5.6483	0.17602	0.2176:0.0:0.7824:0.0	.	.	.	.	T	47	ENSP00000346275:R47T	ENSP00000346275:R47T	R	+	2	0	PRAMEF20	13615538	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.056000	0.14256	-0.122000	0.11766	-2.148000	0.00335	AGA	-	NULL		0.612	PRAMEF20-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	PRAMEF20	protein_coding	OTTHUMT00000021782.1	G	NM_001099852		13615538	1	no_errors	NM_001099852	genbank	human	provisional	54_36p	missense	SNP	0.003	C
KCNA3	3738	genome.wustl.edu	37	1	111216555	111216555	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:111216555C>T	ENST00000369769.2	-	1	1100	c.877G>A	c.(877-879)Gat>Aat	p.D293N		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	293					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)	p.D293N(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	AAGAAGGGATCGGAGAAGCTG	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											68.0	70.0	69.0					1																	111216555		2203	4300	6503	111018078	SO:0001583	missense	3738			L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.877G>A	1.37:g.111216555C>T	ENSP00000358784:p.Asp293Asn	Somatic		Capture	Illumina GAIIx	4	111018078	Q5VWN2	Missense_Mutation	SNP	-	p.D293N	ENST00000369769.2	37	c.877	CCDS828.2	1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.401152	0.62288	.	.	ENSG00000177272	ENST00000369769	D	0.97404	-4.37	5.04	5.04	0.67666	.	0.000000	0.85682	U	0.000000	D	0.97520	0.9188	M	0.69248	2.105	0.80722	D	1	D	0.76494	0.999	P	0.59487	0.858	D	0.97672	1.0167	10	0.56958	D	0.05	.	18.3557	0.90356	0.0:1.0:0.0:0.0	.	293	P22001	KCNA3_HUMAN	N	293	ENSP00000358784:D293N	ENSP00000358784:D293N	D	-	1	0	KCNA3	111018078	1.000000	0.71417	0.945000	0.38365	0.975000	0.68041	7.727000	0.84838	2.337000	0.79520	0.655000	0.94253	GAT	-	NULL		0.612	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA3	protein_coding	OTTHUMT00000083391.1	C	NM_002232		111018078	-1	no_errors	NM_002232	genbank	human	reviewed	54_36p	missense	SNP	1	T
SCNM1	79005	genome.wustl.edu	37	1	151143925	151143925	+	IGR	SNP	C	C	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:151143925C>A	ENST00000368905.4	+	0	2016				TMOD4_ENST00000416280.2_Missense_Mutation_p.G168V	NM_001204856.1|NM_024041.3	NP_001191785.1|NP_076946.1	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)	p.G237V(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AATGGGGTCACCACTCCTCGT	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											201.0	160.0	174.0					1																	151143925		2203	4300	6503	149410549	SO:0001628	intergenic_variant	29765			BC000264	CCDS987.1, CCDS55636.1	1q21.3	2012-03-13			ENSG00000163156	ENSG00000163156			23136	protein-coding gene	gene with protein product		608095				12920299	Standard	NM_024041		Approved	MGC3180	uc001ewz.3	Q9BWG6	OTTHUMG00000012258		1.37:g.151143925C>A		Somatic		Capture	Illumina GAIIx	4	149410549	B4DWR1|Q5JR74	Missense_Mutation	SNP	-	p.G237V	ENST00000368905.4	37	c.710	CCDS987.1	1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376119	0.82682	.	.	ENSG00000163157	ENST00000295314;ENST00000416280	T;T	0.23147	1.92;1.92	5.89	4.98	0.66077	.	0.101710	0.64402	D	0.000002	T	0.25975	0.0633	L	0.54965	1.715	0.80722	D	1	P;D	0.64830	0.945;0.994	P;P	0.57548	0.493;0.823	T	0.03933	-1.0991	10	0.72032	D	0.01	-16.5	6.8453	0.23984	0.0:0.7758:0.0:0.2242	.	168;237	B7Z6N9;Q9NZQ9	.;TMOD4_HUMAN	V	237;168	ENSP00000295314:G237V;ENSP00000414180:G168V	ENSP00000295314:G237V	G	-	2	0	TMOD4	149410549	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.367000	0.59498	2.793000	0.96121	0.561000	0.74099	GGT	-	NULL		0.517	SCNM1-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	TMOD4	protein_coding	OTTHUMT00000034064.2	C	NM_024041		149410549	-1	no_errors	NM_013353	genbank	human	validated	54_36p	missense	SNP	1	A
SLAMF9	89886	genome.wustl.edu	37	1	159922246	159922246	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:159922246G>T	ENST00000368093.3	-	3	586	c.470C>A	c.(469-471)tCt>tAt	p.S157Y	SLAMF9_ENST00000368092.3_Intron|SLAMF9_ENST00000466773.1_5'UTR	NM_033438.3	NP_254273.2	Q96A28	SLAF9_HUMAN	SLAM family member 9	157	Ig-like C2-type.					integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.S157Y(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTTCTCCACAGAGCACACCAG	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											145.0	139.0	141.0					1																	159922246		2203	4300	6503	158188870	SO:0001583	missense	89886			AY034613	CCDS1191.1, CCDS53392.1	1q23.1	2013-01-11			ENSG00000162723	ENSG00000162723		"""Immunoglobulin superfamily / V-set domain containing"""	18430	protein-coding gene	gene with protein product		608589				11685473	Standard	NM_033438		Approved	CD2F-10, CD84-H1, SF2001	uc001fus.3	Q96A28	OTTHUMG00000024074	ENST00000368093.3:c.470C>A	1.37:g.159922246G>T	ENSP00000357072:p.Ser157Tyr	Somatic		Capture	Illumina GAIIx	4	158188870	Q5JRQ9|Q5JRR0|Q6UWG1	Missense_Mutation	SNP	-	p.S157Y	ENST00000368093.3	37	c.470	CCDS1191.1	1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.524778	0.64747	.	.	ENSG00000162723	ENST00000368093	T	0.04119	3.7	4.89	2.73	0.32206	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.395756	0.28635	N	0.014643	T	0.10594	0.0259	M	0.88979	2.995	0.09310	N	1	D	0.69078	0.997	D	0.66196	0.942	T	0.04607	-1.0939	9	.	.	.	-1.0116	7.0579	0.25109	0.1017:0.0:0.717:0.1813	.	157	Q96A28	SLAF9_HUMAN	Y	157	ENSP00000357072:S157Y	.	S	-	2	0	SLAMF9	158188870	0.812000	0.29077	0.031000	0.17742	0.789000	0.44602	0.960000	0.29253	1.027000	0.39758	0.650000	0.86243	TCT	-	NULL		0.547	SLAMF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF9	protein_coding	OTTHUMT00000060630.1	G	NM_033438		158188870	-1	no_errors	NM_033438	genbank	human	provisional	54_36p	missense	SNP	0.02	T
RNASEL	6041	genome.wustl.edu	37	1	182555278	182555278	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:182555278T>A	ENST00000367559.3	-	2	917	c.664A>T	c.(664-666)Acg>Tcg	p.T222S	RNASEL_ENST00000539397.1_Missense_Mutation_p.T222S|RNASEL_ENST00000444138.1_Missense_Mutation_p.T222S	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	222					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)	p.T222S(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						AGCAGATGCGTAATAGCCTCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											87.0	81.0	83.0					1																	182555278		2203	4300	6503	180821901	SO:0001583	missense	6041			L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.664A>T	1.37:g.182555278T>A	ENSP00000356530:p.Thr222Ser	Somatic		Capture	Illumina GAIIx	4	180821901	Q5W0L2|Q6AI46	Missense_Mutation	SNP	-	p.T222S	ENST00000367559.3	37	c.664	CCDS1347.1	1	.	.	.	.	.	.	.	.	.	.	T	11.02	1.517413	0.27123	.	.	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000539397	T;T;T	0.65178	-0.14;-0.14;-0.14	4.81	-2.84	0.05751	Ankyrin repeat-containing domain (4);	1.119570	0.06668	N	0.765590	T	0.49541	0.1563	L	0.38953	1.18	0.09310	N	1	B;B;B	0.30851	0.297;0.297;0.164	B;B;B	0.28784	0.094;0.094;0.026	T	0.39961	-0.9588	10	0.33940	T	0.23	-0.0318	11.7759	0.51985	0.0:0.6564:0.0:0.3436	.	222;222;222	Q5W0L2;Q6AI46;Q05823	.;.;RN5A_HUMAN	S	222	ENSP00000356530:T222S;ENSP00000411147:T222S;ENSP00000440844:T222S	ENSP00000356530:T222S	T	-	1	0	RNASEL	180821901	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.936000	0.28938	-0.303000	0.08856	-0.376000	0.06991	ACG	-	NULL		0.522	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEL	protein_coding	OTTHUMT00000085189.1	T	NM_021133		180821901	-1	no_errors	NM_021133	genbank	human	reviewed	54_36p	missense	SNP		A
HMCN1	83872	genome.wustl.edu	37	1	186135993	186135993	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:186135993G>T	ENST00000271588.4	+	100	15722	c.15493G>T	c.(15493-15495)Gac>Tac	p.D5165Y	HMCN1_ENST00000367492.2_Missense_Mutation_p.D5165Y	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5165	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.D5165Y(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCAGGACTGTGACAATACGAT	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											225.0	186.0	199.0					1																	186135993		2203	4300	6503	184402616	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15493G>T	1.37:g.186135993G>T	ENSP00000271588:p.Asp5165Tyr	Somatic		Capture	Illumina GAIIx	4	184402616	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	-	p.D5165Y	ENST00000271588.4	37	c.15493	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281465	0.80692	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	D;D	0.87256	-2.23;-2.23	5.69	5.69	0.88448	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);	0.088997	0.85682	D	0.000000	D	0.85553	0.5723	N	0.11870	0.19	0.47994	D	0.999564	D	0.65815	0.995	D	0.63283	0.913	D	0.86248	0.1647	10	0.46703	T	0.11	.	13.0716	0.59064	0.0732:0.0:0.9268:0.0	.	5165	Q96RW7	HMCN1_HUMAN	Y	5165	ENSP00000271588:D5165Y;ENSP00000356462:D5165Y	ENSP00000271588:D5165Y	D	+	1	0	HMCN1	184402616	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.468000	0.80943	2.677000	0.91161	0.655000	0.94253	GAC	-	NULL		0.483	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	G	NM_031935		184402616	1	no_errors	NM_031935	genbank	human	reviewed	54_36p	missense	SNP	1	T
C4BPB	725	genome.wustl.edu	37	1	207269942	207269942	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:207269942G>T	ENST00000243611.5	+	4	779	c.485G>T	c.(484-486)aGt>aTt	p.S162I	C4BPB_ENST00000367078.3_Missense_Mutation_p.S162I|C4BPB_ENST00000367076.3_Missense_Mutation_p.S161I|C4BPB_ENST00000391923.1_Missense_Mutation_p.S162I	NM_000716.3	NP_000707.1	P20851	C4BPB_HUMAN	complement component 4 binding protein, beta	162	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)		p.S161I(1)		breast(2)|lung(1)|ovary(1)	4						TCCACCATTAGTTATTACTGT	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											83.0	83.0	83.0					1																	207269942		2203	4300	6503	205336565	SO:0001583	missense	725			L11245	CCDS1476.1, CCDS31005.1	1q32	2008-07-18	2001-11-28		ENSG00000123843	ENSG00000123843			1328	protein-coding gene	gene with protein product	"""complement component 4 binding protein, beta chain"", ""C4b binding protein, beta chain"""	120831	"""complement component 4-binding protein, beta"""	C4BP		2300577, 8325877	Standard	XM_005273255		Approved		uc001hfj.3	P20851	OTTHUMG00000036035	ENST00000243611.5:c.485G>T	1.37:g.207269942G>T	ENSP00000243611:p.Ser162Ile	Somatic		Capture	Illumina GAIIx	4	205336565	A5JYP8|D3DT81|Q5VVR0|Q9BS25	Missense_Mutation	SNP	-	p.S162I	ENST00000243611.5	37	c.485	CCDS1476.1	1	.	.	.	.	.	.	.	.	.	.	G	8.944	0.966550	0.18659	.	.	ENSG00000123843	ENST00000367078;ENST00000452902;ENST00000243611;ENST00000367076;ENST00000391923	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	4.34	2.37	0.29283	Complement control module (2);Sushi/SCR/CCP (3);	0.277722	0.25651	N	0.029202	T	0.52108	0.1714	L	0.43554	1.36	0.21220	N	0.999757	B;B	0.33413	0.411;0.358	B;B	0.35114	0.196;0.124	T	0.40794	-0.9544	10	0.33940	T	0.23	-13.7594	11.0622	0.47955	0.0:0.5614:0.4386:0.0	.	162;161	P20851;P20851-2	C4BPB_HUMAN;.	I	162;162;162;161;162	ENSP00000356045:S162I;ENSP00000392237:S162I;ENSP00000243611:S162I;ENSP00000356043:S161I;ENSP00000375790:S162I	ENSP00000243611:S162I	S	+	2	0	C4BPB	205336565	0.087000	0.21565	0.040000	0.18447	0.030000	0.12068	0.284000	0.18864	0.518000	0.28383	-0.282000	0.10007	AGT	-	NULL		0.458	C4BPB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C4BPB	protein_coding	OTTHUMT00000087847.2	G	NM_000716		205336565	1	no_errors	NM_000716	genbank	human	reviewed	54_36p	missense	SNP	0.06	T
USH2A	7399	genome.wustl.edu	37	1	216420527	216420527	+	Nonsense_Mutation	SNP	G	G	A	rs111033334		TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:216420527G>A	ENST00000307340.3	-	13	2595	c.2209C>T	c.(2209-2211)Cga>Tga	p.R737*	USH2A_ENST00000366943.2_Nonsense_Mutation_p.R737*|USH2A_ENST00000366942.3_Nonsense_Mutation_p.R737*	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	737	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.R737*(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTAAAGCTTCGGAGAAATTTA	0.388										HNSCC(13;0.011)																																						1	Substitution - Nonsense(1)	ovary(1)	1	GRCh37	CM071124	USH2A	M	rs111033334						66.0	71.0	69.0					1																	216420527		2180	4292	6472	214487150	SO:0001587	stop_gained	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2209C>T	1.37:g.216420527G>A	ENSP00000305941:p.Arg737*	Somatic		Capture	Illumina GAIIx	4	214487150	Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	-	p.R737*	ENST00000307340.3	37	c.2209	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	43	9.874808	0.99285	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	.	.	.	5.69	3.59	0.41128	.	0.619565	0.12799	N	0.438220	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	14.9335	0.70935	0.0:0.0:0.7011:0.2989	.	.	.	.	X	737	.	ENSP00000305941:R737X	R	-	1	2	USH2A	214487150	0.955000	0.32602	0.479000	0.27329	0.985000	0.73830	1.627000	0.37050	1.308000	0.44962	0.655000	0.94253	CGA	-	NULL		0.388	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	G	NM_007123		214487150	-1	no_errors	NM_206933	genbank	human	reviewed	54_36p	nonsense	SNP	0.83	A
YTHDF2	51441	genome.wustl.edu	37	1	29069845	29069845	+	Missense_Mutation	SNP	C	C	T	rs370101470		TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:29069845C>T	ENST00000373812.3	+	4	1425	c.1063C>T	c.(1063-1065)Cgg>Tgg	p.R355W	YTHDF2_ENST00000542507.1_Missense_Mutation_p.R355W|YTHDF2_ENST00000541996.1_Missense_Mutation_p.R305W|YTHDF2_ENST00000478283.1_3'UTR	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2	355	Localization to mRNA processing bodies (P-bodies).				humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)	p.R355W(2)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		GGTAGCACCTCGGAACCGTGG	0.582																																																2	Substitution - Missense(2)	ovary(1)|NS(1)	1						C	TRP/ARG,TRP/ARG,TRP/ARG	0,3994		0,0,1997	98.0	97.0	97.0		913,1063,1063	5.9	1.0	1		97	1,8369		0,1,4184	no	missense,missense,missense	YTHDF2	NM_001172828.1,NM_001173128.1,NM_016258.2	101,101,101	0,1,6181	TT,TC,CC		0.0119,0.0,0.0081	probably-damaging,probably-damaging,probably-damaging	305/530,355/580,355/580	29069845	1,12363	1997	4185	6182	28942432	SO:0001583	missense	51441			AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.1063C>T	1.37:g.29069845C>T	ENSP00000362918:p.Arg355Trp	Somatic		Capture	Illumina GAIIx	4	28942432	A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	Missense_Mutation	SNP	-	p.R355W	ENST00000373812.3	37	c.1063	CCDS41296.1	1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604094	0.66445	0.0	1.19E-4	ENSG00000198492	ENST00000542507;ENST00000373812;ENST00000541996;ENST00000396232	T;T;T	0.59364	0.27;0.27;0.27	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.73249	0.3563	M	0.67397	2.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72147	-0.4378	9	.	.	.	.	13.9701	0.64235	0.1518:0.8482:0.0:0.0	.	355;355	B5BU99;Q9Y5A9	.;YTHD2_HUMAN	W	355;355;305;355	ENSP00000444660:R355W;ENSP00000362918:R355W;ENSP00000439394:R305W	.	R	+	1	2	YTHDF2	28942432	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.861000	0.69553	2.802000	0.96397	0.655000	0.94253	CGG	-	NULL		0.582	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDF2	protein_coding	OTTHUMT00000010335.1	C	NM_016258		28942432	1	no_errors	NM_016258	genbank	human	validated	54_36p	missense	SNP	1	T
ZSCAN20	7579	genome.wustl.edu	37	1	33945215	33945215	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:33945215C>A	ENST00000361328.3	+	2	479	c.326C>A	c.(325-327)aCc>aAc	p.T109N	ZSCAN20_ENST00000373413.2_Missense_Mutation_p.T109N|ZSCAN20_ENST00000480917.1_3'UTR	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	109	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T109N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GAGGTCCAGACCTGGGTGCAG	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											38.0	42.0	40.0					1																	33945215		2203	4299	6502	33717802	SO:0001583	missense	7579			X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.326C>A	1.37:g.33945215C>A	ENSP00000355053:p.Thr109Asn	Somatic		Capture	Illumina GAIIx	4	33717802	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	-	p.T109N	ENST00000361328.3	37	c.326	CCDS41300.1	1	.	.	.	.	.	.	.	.	.	.	C	11.18	1.564208	0.27915	.	.	ENSG00000121903	ENST00000373411;ENST00000326544;ENST00000373413;ENST00000361328;ENST00000401072	T	0.06218	3.33	4.97	1.86	0.25419	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.277671	0.26052	N	0.026637	T	0.07593	0.0191	L	0.42686	1.345	0.26485	N	0.975041	B;P;B	0.44627	0.275;0.839;0.379	B;P;B	0.48677	0.075;0.586;0.129	T	0.20306	-1.0279	10	0.24483	T	0.36	-2.8947	5.1322	0.14917	0.0:0.4533:0.3559:0.1908	.	109;109;109	P17040-3;P17040-4;P17040	.;.;ZSC20_HUMAN	N	109;109;109;43;43	ENSP00000362512:T109N	ENSP00000324450:T109N	T	+	2	0	ZSCAN20	33717802	0.046000	0.20272	1.000000	0.80357	0.975000	0.68041	-0.193000	0.09573	0.669000	0.31146	0.637000	0.83480	ACC	-	NULL		0.607	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN20	protein_coding	OTTHUMT00000277003.2	C	NM_145238		33717802	1	no_errors	NM_145238	genbank	human	validated	54_36p	missense	SNP	0.99	A
ZNF691	51058	genome.wustl.edu	37	1	43316672	43316672	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:43316672G>A	ENST00000372506.1	+	4	383	c.43G>A	c.(43-45)Gag>Aag	p.E15K	ZNF691_ENST00000372508.3_Missense_Mutation_p.E15K|ZNF691_ENST00000372504.1_Missense_Mutation_p.E37K|ZNF691_ENST00000397044.3_Missense_Mutation_p.E46K|ZNF691_ENST00000372502.1_Missense_Mutation_p.E37K|ZNF691_ENST00000372507.1_Missense_Mutation_p.E15K	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	46						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E46K(1)|p.E15K(1)		large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ACACCTGCCTGAGGAAGGGGA	0.547																																																2	Substitution - Missense(2)	ovary(2)	1											73.0	73.0	73.0					1																	43316672		2203	4300	6503	43089259	SO:0001583	missense	51058				CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.43G>A	1.37:g.43316672G>A	ENSP00000361584:p.Glu15Lys	Somatic		Capture	Illumina GAIIx	4	43089259	A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	-	p.E15K	ENST00000372506.1	37	c.43	CCDS476.1	1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164676	0.78339	.	.	ENSG00000164011	ENST00000372508;ENST00000372507;ENST00000372506;ENST00000397044;ENST00000372504;ENST00000397034;ENST00000372503;ENST00000372502	T;T;T;T;T;T;T	0.09073	3.06;3.06;3.06;3.02;3.02;4.46;3.02	5.85	5.85	0.93711	.	0.220360	0.32593	N	0.005885	T	0.07593	0.0191	N	0.19112	0.55	0.47214	D	0.99935	P;P	0.45348	0.7;0.856	B;B	0.39935	0.314;0.314	T	0.31336	-0.9947	10	0.38643	T	0.18	-16.8708	18.0364	0.89305	0.0:0.0:1.0:0.0	.	46;46	B4DJR7;Q5VV52	.;ZN691_HUMAN	K	15;15;15;46;37;46;46;37	ENSP00000361586:E15K;ENSP00000361585:E15K;ENSP00000361584:E15K;ENSP00000380237:E46K;ENSP00000361582:E37K;ENSP00000380228:E46K;ENSP00000361580:E37K	ENSP00000361580:E37K	E	+	1	0	ZNF691	43089259	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.120000	0.71596	2.941000	0.99782	0.655000	0.94253	GAG	-	NULL		0.547	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF691	protein_coding	OTTHUMT00000020192.1	G	NM_015911		43089259	1	no_errors	NM_015911	genbank	human	provisional	54_36p	missense	SNP	1	A
ZNF496	84838	genome.wustl.edu	37	1	247464555	247464555	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:247464555C>G	ENST00000294753.4	-	9	1494	c.1030G>C	c.(1030-1032)Gag>Cag	p.E344Q	ZNF496_ENST00000462139.1_5'UTR|ZNF496_ENST00000366498.2_Missense_Mutation_p.E380Q	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	344					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.E344Q(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			AGGCTGTTCTCTAGAGATCGC	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											65.0	73.0	70.0					1																	247464555		2134	4193	6327	245531178	SO:0001583	missense	84838			BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.1030G>C	1.37:g.247464555C>G	ENSP00000294753:p.Glu344Gln	Somatic		Capture	Illumina GAIIx	4	245531178	Q8TBS2	Missense_Mutation	SNP	-	p.E344Q	ENST00000294753.4	37	c.1030	CCDS1631.1	1	.	.	.	.	.	.	.	.	.	.	C	4.136	0.023595	0.08006	.	.	ENSG00000162714	ENST00000294753;ENST00000366498	T;T	0.06528	3.29;3.3	4.28	-0.344	0.12628	.	0.793754	0.11089	N	0.601000	T	0.03390	0.0098	N	0.11560	0.145	0.09310	N	1	P;B	0.46142	0.873;0.001	B;B	0.41412	0.356;0.001	T	0.47611	-0.9104	10	0.21540	T	0.41	-11.767	8.1634	0.31211	0.0:0.4532:0.4491:0.0977	.	380;344	Q96IT1-2;Q96IT1	.;ZN496_HUMAN	Q	344;380	ENSP00000294753:E344Q;ENSP00000355454:E380Q	ENSP00000294753:E344Q	E	-	1	0	ZNF496	245531178	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.092000	0.11129	0.135000	0.18707	-0.165000	0.13383	GAG	-	NULL		0.612	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF496	protein_coding	OTTHUMT00000098655.2	C	NM_032752		245531178	-1	no_errors	NM_032752	genbank	human	provisional	54_36p	missense	SNP		G
CCDC7	79741	genome.wustl.edu	37	10	33000616	33000616	+	Nonsense_Mutation	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr10:33000616C>T	ENST00000375030.2	+	10	1090	c.472C>T	c.(472-474)Caa>Taa	p.Q158*	C10orf68_ENST00000375028.3_Nonsense_Mutation_p.Q126*|C10orf68_ENST00000375025.4_Nonsense_Mutation_p.Q150*			Q9H943	CJ068_HUMAN		150								p.Q150*(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						AATCCAAGTGCAATTAGAGAT	0.308																																																1	Substitution - Nonsense(1)	ovary(1)	10											66.0	70.0	69.0					10																	33000616		2203	4296	6499	33040622	SO:0001587	stop_gained	79741																														ENST00000375030.2:c.472C>T	10.37:g.33000616C>T	ENSP00000364170:p.Gln158*	Somatic		Capture	Illumina GAIIx	4	33040622	B0QZ71|Q08AN7|Q8N7T7	Nonsense_Mutation	SNP	-	p.Q150*	ENST00000375030.2	37	c.448		10	.	.	.	.	.	.	.	.	.	.	.	14.41	2.526755	0.44969	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	.	.	.	2.71	0.731	0.18277	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	5.141	0.14959	0.2353:0.5355:0.2293:0.0	.	.	.	.	X	150;158;126;150;98	.	ENSP00000303710:Q150X	Q	+	1	0	C10orf68	33040622	0.000000	0.05858	0.002000	0.10522	0.035000	0.12851	-0.162000	0.10012	0.181000	0.19994	0.460000	0.39030	CAA	-	NULL		0.308	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	protein_coding	OTTHUMT00000313999.2	C			33040622	1	no_errors	NM_024688	genbank	human	validated	54_36p	nonsense	SNP	0.007	T
C10orf54	64115	genome.wustl.edu	37	10	73520673	73520673	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr10:73520673C>G	ENST00000394957.3	-	3	578	c.520G>C	c.(520-522)Gca>Cca	p.A174P	C10orf54_ENST00000481568.2_5'UTR|CDH23_ENST00000224721.6_Intron	NM_022153.1	NP_071436.1	Q9H7M9	GI24_HUMAN	chromosome 10 open reading frame 54	174					BMP signaling pathway (GO:0030509)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of T cell cytokine production (GO:0002725)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of stem cell differentiation (GO:2000738)|stem cell differentiation (GO:0048863)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.A174P(1)		breast(1)|central_nervous_system(2)|endometrium(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	9						TTGGATGGTGCATCTTTGCCT	0.572																																																1	Substitution - Missense(1)	ovary(1)	10											199.0	160.0	173.0					10																	73520673		2203	4300	6503	73190679	SO:0001583	missense	64115			AF193048	CCDS31218.1	10q22.1	2013-11-28			ENSG00000107738	ENSG00000107738		"""Immunoglobulin superfamily / V-set domain containing"""	30085	protein-coding gene	gene with protein product	"""stress induced secreted protein 1"""	615608				12975309	Standard	NM_022153		Approved	SISP1, GI24, B7-H5, B7H5	uc001jsd.3	Q9H7M9	OTTHUMG00000018426	ENST00000394957.3:c.520G>C	10.37:g.73520673C>G	ENSP00000378409:p.Ala174Pro	Somatic		Capture	Illumina GAIIx	4	73190679	A1L0X9|A4ZYV1|A8MVH5|Q6UXF3|Q8WUG3|Q8WYZ8	Missense_Mutation	SNP	HMMPfam_V-set;superfamily_Immunoglobulin	p.A174P	ENST00000394957.3	37	c.520	CCDS31218.1	10	.	.	.	.	.	.	.	.	.	.	C	13.37	2.216622	0.39201	.	.	ENSG00000107738	ENST00000394957;ENST00000263569	T	0.47528	0.84	5.8	-1.02	0.10135	.	0.607155	0.18705	N	0.133476	T	0.30727	0.0774	L	0.44542	1.39	0.09310	N	1	B;B	0.20671	0.047;0.001	B;B	0.22386	0.039;0.002	T	0.18777	-1.0326	10	0.51188	T	0.08	-12.9874	1.0684	0.01616	0.1473:0.351:0.1506:0.3511	.	170;174	Q2TA85;Q9H7M9	.;GI24_HUMAN	P	174;170	ENSP00000378409:A174P	ENSP00000263569:A170P	A	-	1	0	C10orf54	73190679	0.000000	0.05858	0.014000	0.15608	0.808000	0.45660	-0.375000	0.07475	0.077000	0.16863	0.655000	0.94253	GCA	-	NULL		0.572	C10orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf54	protein_coding	OTTHUMT00000048548.1	C	NM_022153		73190679	-1	no_errors	NM_022153	genbank	human	validated	54_36p	missense	SNP	0.01	G
LCOR	84458	genome.wustl.edu	37	10	98715149	98715149	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr10:98715149G>C	ENST00000371097.4	+	8	1318	c.772G>C	c.(772-774)Gtt>Ctt	p.V258L	LCOR_ENST00000371103.3_Missense_Mutation_p.V258L|LCOR_ENST00000540664.1_Missense_Mutation_p.V258L|LCOR_ENST00000356016.3_Missense_Mutation_p.V258L|LCOR_ENST00000498444.1_Intron			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	258					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V258L(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		GATACCACAAGTTCGAGGAAT	0.423																																																1	Substitution - Missense(1)	ovary(1)	10											82.0	84.0	84.0					10																	98715149		2203	4300	6503	98705139	SO:0001583	missense	84458				CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.772G>C	10.37:g.98715149G>C	ENSP00000360138:p.Val258Leu	Somatic		Capture	Illumina GAIIx	4	98705139	D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Missense_Mutation	SNP	-	p.V258L	ENST00000371097.4	37	c.772	CCDS7451.1	10	.	.	.	.	.	.	.	.	.	.	G	9.426	1.084224	0.20309	.	.	ENSG00000196233	ENST00000540664;ENST00000371103;ENST00000371097;ENST00000356016	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.58836	0.2150	N	0.11560	0.145	0.51482	D	0.999924	P;D	0.55605	0.953;0.972	D;D	0.72625	0.952;0.978	T	0.56932	-0.7897	9	0.17832	T	0.49	-3.4284	19.1864	0.93645	0.0:0.0:1.0:0.0	.	258;258	Q96JN0;Q96JN0-2	LCOR_HUMAN;.	L	258	.	ENSP00000348298:V258L	V	+	1	0	LCOR	98705139	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.316000	0.96319	2.606000	0.88127	0.650000	0.86243	GTT	-	NULL		0.423	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	LCOR	protein_coding	OTTHUMT00000049628.2	G			98705139	1	no_errors	NM_032440	genbank	human	provisional	54_36p	missense	SNP	1	C
MRVI1	10335	genome.wustl.edu	37	11	10651173	10651173	+	Silent	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr11:10651173C>T	ENST00000436272.1	-	4	537	c.459G>A	c.(457-459)gcG>gcA	p.A153A	MRVI1_ENST00000534266.2_5'UTR|MRVI1_ENST00000545852.1_5'UTR|MRVI1_ENST00000424001.1_5'UTR|MRVI1_ENST00000541483.1_Silent_p.A162A|MRVI1_ENST00000552103.1_Silent_p.A71A|MRVI1_ENST00000423302.2_Silent_p.A162A|MRVI1_ENST00000421747.1_Silent_p.A153A|MRVI1_ENST00000531107.1_Silent_p.A153A|MRVI1_ENST00000527509.2_Silent_p.A71A|MRVI1_ENST00000532037.1_5'Flank|MRVI1_ENST00000558540.1_5'UTR|MRVI1_ENST00000547195.1_Silent_p.A71A			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	153	Interaction with PRKG1. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)		p.A153A(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CTTCCAGCAGCGCCAGGTTTT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	11											78.0	84.0	82.0					11																	10651173		2060	4192	6252	10607749	SO:0001819	synonymous_variant	10335			AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.459G>A	11.37:g.10651173C>T		Somatic		Capture	Illumina GAIIx	4	10607749	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Silent	SNP	-	p.A153	ENST00000436272.1	37	c.459		11																																																																																			-	NULL		0.592	MRVI1-203	KNOWN	basic	protein_coding	MRVI1	protein_coding		C	NM_001098579		10607749	-1	no_errors	NM_001098579	genbank	human	reviewed	54_36p	silent	SNP	1	T
BACE1	23621	genome.wustl.edu	37	11	117161212	117161212	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr11:117161212G>C	ENST00000313005.6	-	8	1716	c.1256C>G	c.(1255-1257)gCt>gGt	p.A419G	BACE1_ENST00000445823.2_Missense_Mutation_p.A375G|BACE1_ENST00000428381.2_Missense_Mutation_p.A350G|BACE1_ENST00000528053.1_Missense_Mutation_p.A385G|BACE1_ENST00000513780.1_Missense_Mutation_p.A394G|BACE1_ENST00000510630.1_Missense_Mutation_p.A294G|BACE1_ENST00000392937.6_Missense_Mutation_p.A319G	NM_012104.4|NM_138971.3|NM_138972.3|NM_138973.3	NP_036236|NP_620427.1|NP_620428.1|NP_620429.1	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1	419					beta-amyloid metabolic process (GO:0050435)|membrane protein ectodomain proteolysis (GO:0006509)|proteolysis (GO:0006508)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	aspartic-type endopeptidase activity (GO:0004190)|beta-amyloid binding (GO:0001540)|beta-aspartyl-peptidase activity (GO:0008798)|enzyme binding (GO:0019899)	p.A419G(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		ACCATGGCAAGCGCTGACAGC	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											85.0	71.0	76.0					11																	117161212		2201	4296	6497	116666422	SO:0001583	missense	23621			AF190725	CCDS8383.1, CCDS44739.1, CCDS44740.1, CCDS44741.1, CCDS55787.1, CCDS55786.1	11q23-q24	2011-07-27	2004-04-02	2004-04-02	ENSG00000186318	ENSG00000186318			933	protein-coding gene	gene with protein product		604252	"""beta-site APP-cleaving enzyme"""	BACE		10531052	Standard	NM_012104		Approved		uc001pqz.3	P56817	OTTHUMG00000160636	ENST00000313005.6:c.1256C>G	11.37:g.117161212G>C	ENSP00000318585:p.Ala419Gly	Somatic		Capture	Illumina GAIIx	4	116666422	A0M8W7|B0YIU9|E9PE65|H7BXJ9|Q9BYB9|Q9BYC0|Q9BYC1|Q9UJT5|Q9ULS1	Missense_Mutation	SNP	HMMPfam_Asp;superfamily_Acid proteases	p.A419G	ENST00000313005.6	37	c.1256	CCDS8383.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.48|16.48	3.133942|3.133942	0.56828|0.56828	.|.	.|.	ENSG00000186318|ENSG00000186318	ENST00000313005;ENST00000392937;ENST00000528053;ENST00000510630;ENST00000428381;ENST00000513780;ENST00000445823|ENST00000292095	D;D;D;D;D;D|.	0.82711|.	-1.64;-1.64;-1.64;-1.64;-1.64;-1.64|.	5.9|5.9	5.9|5.9	0.94986|0.94986	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);|.	0.234655|.	0.44902|.	D|.	0.000415|.	T|T	0.49287|0.49287	0.1548|0.1548	N|N	0.08118|0.08118	0|0	0.41433|0.41433	D|D	0.987873|0.987873	B;B;B;B;B;B|.	0.26147|.	0.001;0.008;0.0;0.143;0.004;0.082|.	B;B;B;B;B;B|.	0.31614|.	0.005;0.012;0.002;0.133;0.003;0.054|.	T|T	0.49952|0.49952	-0.8884|-0.8884	10|6	0.59425|0.31617	D|T	0.04|0.26	.|.	19.2604|19.2604	0.93966|0.93966	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	319;294;419;375;350;394|.	F8W807;E9PE65;P56817;P56817-3;P56817-4;P56817-2|.	.;.;BACE1_HUMAN;.;.;.|.	G|V	419;319;385;294;350;394;375|182	ENSP00000318585:A419G;ENSP00000431848:A385G;ENSP00000422461:A294G;ENSP00000402228:A350G;ENSP00000424536:A394G;ENSP00000403685:A375G|.	ENSP00000318585:A419G|ENSP00000292095:L182V	A|L	-|-	2|1	0|0	BACE1|BACE1	116666422|116666422	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.973000|0.973000	0.67179|0.67179	5.435000|5.435000	0.66532|0.66532	2.793000|2.793000	0.96121|0.96121	0.563000|0.563000	0.77884|0.77884	GCT|CTT	-	NULL		0.507	BACE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BACE1	protein_coding	OTTHUMT00000361505.1	G			116666422	-1	no_errors	NM_012104	genbank	human	reviewed	54_36p	missense	SNP	1	C
OR51T1	401665	genome.wustl.edu	37	11	4903876	4903876	+	Silent	SNP	A	A	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr11:4903876A>C	ENST00000322049.1	+	1	747	c.747A>C	c.(745-747)gcA>gcC	p.A249A	OR51T1_ENST00000380378.1_Silent_p.A276A|MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A276A(1)|p.A249A(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACATCTGTGCAGTCACTATTT	0.488																																																2	Substitution - coding silent(2)	ovary(2)	11											104.0	86.0	92.0					11																	4903876		2201	4298	6499	4860452	SO:0001819	synonymous_variant	401665			BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.747A>C	11.37:g.4903876A>C		Somatic		Capture	Illumina GAIIx	4	4860452	Q6IFH9	Silent	SNP	-	p.A276	ENST00000322049.1	37	c.828		11																																																																																			-	NULL		0.488	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	OR51T1	protein_coding	OTTHUMT00000142180.1	A	NM_001004759		4860452	1	no_errors	NM_001004759	genbank	human	provisional	54_36p	silent	SNP	0.24	C
SYT9	143425	genome.wustl.edu	37	11	7441836	7441836	+	Silent	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr11:7441836G>A	ENST00000318881.6	+	6	1674	c.1437G>A	c.(1435-1437)aaG>aaA	p.K479K		NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	479					positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.K479K(1)		NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		ATCCTCGGAAGCCCATTGCAC	0.502																																																1	Substitution - coding silent(1)	ovary(1)	11											168.0	136.0	147.0					11																	7441836		2201	4296	6497	7398412	SO:0001819	synonymous_variant	143425			AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.1437G>A	11.37:g.7441836G>A		Somatic		Capture	Illumina GAIIx	4	7398412		Silent	SNP	-	p.K479	ENST00000318881.6	37	c.1437	CCDS7778.1	11																																																																																			-	NULL		0.502	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT9	protein_coding	OTTHUMT00000384483.1	G	NM_175733		7398412	1	no_errors	NM_175733	genbank	human	provisional	54_36p	silent	SNP	1	A
OR5M1	390168	genome.wustl.edu	37	11	56380397	56380397	+	Silent	SNP	G	G	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr11:56380397G>C	ENST00000526538.1	-	1	581	c.582C>G	c.(580-582)gtC>gtG	p.V194V		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V194V(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						CCATCTTTTTGACACGGGTGT	0.433																																																1	Substitution - coding silent(1)	ovary(1)	11											57.0	54.0	55.0					11																	56380397		1887	4111	5998	56136973	SO:0001819	synonymous_variant	390168			AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.582C>G	11.37:g.56380397G>C		Somatic		Capture	Illumina GAIIx	4	56136973	Q6IF60|Q96RB6	Silent	SNP	-	p.V194	ENST00000526538.1	37	c.582	CCDS53631.1	11																																																																																			-	NULL		0.433	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M1	protein_coding	OTTHUMT00000391610.1	G	NM_001004740		56136973	-1	no_errors	NM_001004740	genbank	human	provisional	54_36p	silent	SNP	0.01	C
MS4A2	2206	genome.wustl.edu	37	11	59863107	59863107	+	Missense_Mutation	SNP	T	T	C	rs370005134		TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr11:59863107T>C	ENST00000278888.3	+	7	815	c.713T>C	c.(712-714)aTg>aCg	p.M238T		NM_000139.4	NP_000130.1	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member 2	238					activation of phospholipase C activity (GO:0007202)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of mast cell degranulation (GO:0043306)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)		p.M238T(1)		endometrium(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)	17		all_epithelial(135;0.245)			Omalizumab(DB00043)	CCAGGGGAAATGTCTCCTCCC	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											117.0	114.0	115.0					11																	59863107		2201	4295	6496	59619683	SO:0001583	missense	2206			M89796	CCDS7980.1, CCDS73292.1	11q12-q13	2012-02-28	2012-02-28		ENSG00000149534	ENSG00000149534			7316	protein-coding gene	gene with protein product	"""Fc fragment of IgE, high affinity I, receptor for; beta polypeptide"""	147138	"""IgE responsiveness (atopic)"", ""membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)"""	FCER1B, IGER, APY		1386024	Standard	NM_000139		Approved	MS4A1	uc001nop.3	Q01362	OTTHUMG00000167239	ENST00000278888.3:c.713T>C	11.37:g.59863107T>C	ENSP00000278888:p.Met238Thr	Somatic		Capture	Illumina GAIIx	4	59619683	Q54A81	Missense_Mutation	SNP	-	p.M238T	ENST00000278888.3	37	c.713	CCDS7980.1	11	.	.	.	.	.	.	.	.	.	.	T	0.108	-1.142002	0.01728	.	.	ENSG00000149534	ENST00000278888	T	0.18657	2.2	4.49	-8.99	0.00751	.	3.283390	0.00766	N	0.001160	T	0.07413	0.0187	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23404	-1.0189	10	0.07482	T	0.82	10.3495	4.3106	0.10969	0.3717:0.4306:0.0932:0.1046	.	238	Q01362	FCERB_HUMAN	T	238	ENSP00000278888:M238T	ENSP00000278888:M238T	M	+	2	0	MS4A2	59619683	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.933000	0.00687	-3.066000	0.00255	-0.327000	0.08410	ATG	-	NULL		0.413	MS4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A2	protein_coding	OTTHUMT00000393844.1	T			59619683	1	no_errors	NM_000139	genbank	human	reviewed	54_36p	missense	SNP		C
OR6X1	390260	genome.wustl.edu	37	11	123624990	123624990	+	Silent	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr11:123624990C>T	ENST00000327930.2	-	1	263	c.237G>A	c.(235-237)ctG>ctA	p.L79L		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L79L(1)		breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AGGTTCCTAGCAGTTTGGGGA	0.493																																																1	Substitution - coding silent(1)	ovary(1)	11											139.0	134.0	136.0					11																	123624990		2202	4299	6501	123130200	SO:0001819	synonymous_variant	390260			AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.237G>A	11.37:g.123624990C>T		Somatic		Capture	Illumina GAIIx	4	123130200	B9EGW9|Q6IFA0	Silent	SNP	-	p.L79	ENST00000327930.2	37	c.237	CCDS31695.1	11																																																																																			-	NULL		0.493	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6X1	protein_coding	OTTHUMT00000387436.1	C	NM_001005188		123130200	-1	no_errors	NM_001005188	genbank	human	provisional	54_36p	silent	SNP	0.22	T
TMEM119	338773	genome.wustl.edu	37	12	108985584	108985584	+	Silent	SNP	G	G	A	rs147107990	byFrequency	TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr12:108985584G>A	ENST00000392806.3	-	2	744	c.576C>T	c.(574-576)ggC>ggT	p.G192G		NM_181724.2	NP_859075.2	Q4V9L6	TM119_HUMAN	transmembrane protein 119	192					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.G192G(1)		large_intestine(2)|lung(3)|ovary(1)|skin(1)	7						CGTCCCCACCGCCCAGTGCAG	0.687													G|||	2	0.000399361	0.0	0.0	5008	,	,		14559	0.001		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	12						G		1,4401		0,1,2200	36.0	32.0	33.0		576	4.3	0.0	12	dbSNP_134	33	0,8600		0,0,4300	no	coding-synonymous	TMEM119	NM_181724.2		0,1,6500	AA,AG,GG		0.0,0.0227,0.0077		192/284	108985584	1,13001	2201	4300	6501	107509713	SO:0001819	synonymous_variant	338773			AK075501	CCDS9119.1	12q23.3	2014-02-12				ENSG00000183160			27884	protein-coding gene	gene with protein product						12975309	Standard	NM_181724		Approved		uc001tng.3	Q4V9L6		ENST00000392806.3:c.576C>T	12.37:g.108985584G>A		Somatic		Capture	Illumina GAIIx	4	107509713	Q6UXE5|Q8N2F5	Silent	SNP	-	p.G192	ENST00000392806.3	37	c.576	CCDS9119.1	12																																																																																			-	NULL		0.687	TMEM119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM119	protein_coding	OTTHUMT00000403900.1	G	NM_181724		107509713	-1	no_errors	NM_181724	genbank	human	validated	54_36p	silent	SNP	0.01	A
WNK1	65125	genome.wustl.edu	37	12	994022	994022	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr12:994022C>T	ENST00000315939.6	+	19	4695	c.4052C>T	c.(4051-4053)gCa>gTa	p.A1351V	WNK1_ENST00000535572.1_Missense_Mutation_p.A1104V|WNK1_ENST00000530271.2_Missense_Mutation_p.A1849V|WNK1_ENST00000537687.1_Missense_Mutation_p.A1611V|WNK1_ENST00000340908.4_Missense_Mutation_p.A944V	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1351					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.A1351V(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			ACCACAGCAGCAGCCACAGCA	0.498																																					Colon(19;451 567 6672 12618 28860)											1	Substitution - Missense(1)	ovary(1)	12											90.0	85.0	87.0					12																	994022		2203	4300	6503	864283	SO:0001583	missense	65125			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.4052C>T	12.37:g.994022C>T	ENSP00000313059:p.Ala1351Val	Somatic		Capture	Illumina GAIIx	4	864283	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.A1351V	ENST00000315939.6	37	c.4052	CCDS8506.1	12	.	.	.	.	.	.	.	.	.	.	C	6.915	0.538434	0.13250	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000252477;ENST00000530271;ENST00000340908	T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4	5.45	2.64	0.31445	.	0.438861	0.22158	N	0.063838	T	0.28599	0.0708	L	0.40543	1.245	0.09310	N	1	B;B;B	0.10296	0.003;0.003;0.001	B;B;B	0.12156	0.007;0.007;0.003	T	0.18871	-1.0323	10	0.42905	T	0.14	-4.4642	10.571	0.45200	0.0:0.7913:0.0:0.2087	.	1104;1104;1351	Q9H4A3-2;F5GWT4;Q9H4A3	.;.;WNK1_HUMAN	V	1104;1351;1611;524;1849;944	ENSP00000441972:A1104V;ENSP00000313059:A1351V;ENSP00000444465:A1611V;ENSP00000433548:A1849V;ENSP00000341292:A944V	ENSP00000252477:A524V	A	+	2	0	WNK1	864283	0.050000	0.20438	0.142000	0.22268	0.036000	0.12997	0.658000	0.24979	0.363000	0.24346	0.655000	0.94253	GCA	-	NULL		0.498	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	protein_coding	OTTHUMT00000206683.1	C	NM_018979		864283	1	no_errors	NM_018979	genbank	human	validated	54_36p	missense	SNP	0.07	T
VWF	7450	genome.wustl.edu	37	12	6167145	6167145	+	Silent	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr12:6167145G>A	ENST00000261405.5	-	14	1853	c.1599C>T	c.(1597-1599)gaC>gaT	p.D533D		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	533	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.D533D(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TAAGGAAGTCGTCGCCCTGGT	0.657																																																1	Substitution - coding silent(1)	ovary(1)	12											57.0	59.0	58.0					12																	6167145		2203	4300	6503	6037406	SO:0001819	synonymous_variant	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.1599C>T	12.37:g.6167145G>A		Somatic		Capture	Illumina GAIIx	4	6037406	Q8TCE8|Q99806	Silent	SNP	HMMPfam_VWC;HMMPfam_VWD;HMMPfam_VWA;HMMPfam_TIL;superfamily_Serine proterase inhibitors;HMMPfam_DUF1787;superfamily_vWA-like;superfamily_EGF/Laminin;superfamily_PMP inhibitors;superfamily_Cystine-knot cytokines	p.D533	ENST00000261405.5	37	c.1599	CCDS8539.1	12																																																																																			-	HMMPfam_VWD		0.657	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	protein_coding	OTTHUMT00000399020.1	G	NM_000552		6037406	-1	no_errors	NM_000552	genbank	human	reviewed	54_36p	silent	SNP	1	A
PLEKHA5	54477	genome.wustl.edu	37	12	19518902	19518902	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr12:19518902C>G	ENST00000299275.6	+	24	3121	c.3115C>G	c.(3115-3117)Caa>Gaa	p.Q1039E	PLEKHA5_ENST00000355397.3_Missense_Mutation_p.Q1097E|PLEKHA5_ENST00000317589.4_Missense_Mutation_p.Q1102E|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.Q1021E|PLEKHA5_ENST00000538714.1_Missense_Mutation_p.Q1097E|PLEKHA5_ENST00000539256.1_Missense_Mutation_p.Q797E|PLEKHA5_ENST00000424268.1_Missense_Mutation_p.Q1028E|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.Q1205E|PLEKHA5_ENST00000359180.3_Missense_Mutation_p.Q983E	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	1039					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.Q1200E(1)|p.Q1039E(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CATCAGCCCTCAAGATGAAAC	0.313																																					Pancreas(196;329 2193 11246 14234 19524)											2	Substitution - Missense(2)	ovary(2)	12											63.0	58.0	59.0					12																	19518902		2203	4300	6503	19410169	SO:0001583	missense	54477			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.3115C>G	12.37:g.19518902C>G	ENSP00000299275:p.Gln1039Glu	Somatic		Capture	Illumina GAIIx	4	19410169	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	-	p.Q1039E	ENST00000299275.6	37	c.3115	CCDS8682.1	12	.	.	.	.	.	.	.	.	.	.	C	3.899	-0.022336	0.07634	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000359180;ENST00000429027;ENST00000299275;ENST00000539256;ENST00000538714;ENST00000424268;ENST00000543806;ENST00000538972	T;T;T;T;T;T;T;T;T;T	0.09255	3.0;3.0;3.0;3.0;3.0;3.0;3.0;3.0;3.0;3.0	4.24	2.34	0.29019	.	0.924676	0.09165	N	0.839660	T	0.08313	0.0207	L	0.27053	0.805	0.09310	N	1	B;B;B;B;B	0.30236	0.274;0.179;0.0;0.058;0.073	B;B;B;B;B	0.34722	0.188;0.092;0.003;0.021;0.047	T	0.43376	-0.9395	10	0.31617	T	0.26	-1.8594	4.1735	0.10341	0.1625:0.5924:0.1574:0.0877	.	1021;1028;983;1039;1097	F5H0I0;E7EME8;Q9HAU0-5;Q9HAU0;Q9HAU0-2	.;.;.;PKHA5_HUMAN;.	E	1102;1097;983;1205;1039;797;1097;1028;1021;320	ENSP00000325155:Q1102E;ENSP00000347560:Q1097E;ENSP00000352104:Q983E;ENSP00000404296:Q1205E;ENSP00000299275:Q1039E;ENSP00000440611:Q797E;ENSP00000439673:Q1097E;ENSP00000400411:Q1028E;ENSP00000439837:Q1021E;ENSP00000443553:Q320E	ENSP00000299275:Q1039E	Q	+	1	0	PLEKHA5	19410169	0.997000	0.39634	0.219000	0.23793	0.105000	0.19272	2.162000	0.42367	0.512000	0.28257	-0.384000	0.06662	CAA	-	NULL		0.313	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA5	protein_coding	OTTHUMT00000397013.1	C	NM_019012		19410169	1	no_errors	NM_019012	genbank	human	validated	54_36p	missense	SNP	0.11	G
DGKA	1606	genome.wustl.edu	37	12	56334431	56334431	+	Silent	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr12:56334431G>A	ENST00000331886.5	+	12	1396	c.942G>A	c.(940-942)gcG>gcA	p.A314A	DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000394147.1_Silent_p.A314A|DGKA_ENST00000551156.1_Silent_p.A314A	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	314					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)	p.A314A(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	GCCTGCAAGCGGTGGGCCATG	0.592											OREG0021913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	12											135.0	126.0	129.0					12																	56334431		2203	4300	6503	54620698	SO:0001819	synonymous_variant	1606			AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.942G>A	12.37:g.56334431G>A		Somatic	1014	Capture	Illumina GAIIx	4	54620698	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Silent	SNP	HMMPfam_DAGK_acc;HMMPfam_DAGK_cat;HMMPfam_efhand;HMMPfam_C1_1;superfamily_EF-hand;superfamily_Cysteine-rich domain	p.A314	ENST00000331886.5	37	c.942	CCDS8896.1	12																																																																																			-	HMMPfam_C1_1		0.592	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKA	protein_coding	OTTHUMT00000407291.1	G			54620698	1	no_errors	NM_001345	genbank	human	reviewed	54_36p	silent	SNP	0.21	A
TMEM132D	121256	genome.wustl.edu	37	12	130184522	130184522	+	Silent	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr12:130184522G>A	ENST00000422113.2	-	2	1127	c.801C>T	c.(799-801)atC>atT	p.I267I	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	267					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.I267I(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGATGCTCCCGATCCTCTGCA	0.572																																																1	Substitution - coding silent(1)	ovary(1)	12											92.0	82.0	86.0					12																	130184522		2203	4300	6503	128750475	SO:0001819	synonymous_variant	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.801C>T	12.37:g.130184522G>A		Somatic		Capture	Illumina GAIIx	4	128750475	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	-	p.I267	ENST00000422113.2	37	c.801	CCDS9266.1	12																																																																																			-	NULL		0.572	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	protein_coding	OTTHUMT00000399592.1	G	NM_133448		128750475	-1	no_errors	NM_133448	genbank	human	validated	54_36p	silent	SNP	0.994	A
N4BP2L2	10443	genome.wustl.edu	37	13	33016881	33016893	+	Frame_Shift_Del	DEL	AAAGAAGGAATAT	AAAGAAGGAATAT	-			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	AAAGAAGGAATAT	AAAGAAGGAATAT	AAAGAAGGAATAT	-	AAAGAAGGAATAT	AAAGAAGGAATAT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr13:33016881_33016893delAAAGAAGGAATAT	ENST00000504114.1	-	6	1827_1839	c.1736_1748delATATTCCTTCTTT	c.(1735-1749)tatattccttcttttfs	p.YIPSF579fs	N4BP2L2_ENST00000446957.2_Intron|N4BP2L2_ENST00000357505.6_Frame_Shift_Del_p.YIPSF579fs|N4BP2L2_ENST00000380121.3_5'UTR|N4BP2L2_ENST00000399396.3_Frame_Shift_Del_p.YIPSF594fs			Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	0					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		ATGTAGCACAAAAGAAGGAATATAATTTTTGTA	0.315																																																0			13																																								31914893	SO:0001589	frameshift_variant	10443			U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000504114.1:c.1736_1748delATATTCCTTCTTT	13.37:g.33016881_33016893delAAAGAAGGAATAT	ENSP00000427477:p.Tyr579fs	Somatic		Capture	Illumina GAIIx	4	31914881	A3KME8	Frame_Shift_Del	DEL	-	p.Y594fs	ENST00000504114.1	37	c.1793_1781		13																																																																																			(deletion:cds_exon[31914525;31916263])	NULL		0.315	N4BP2L2-004	PUTATIVE	basic	protein_coding	N4BP2L2	protein_coding	OTTHUMT00000361380.1	AAAGAAGGAATAT	NM_014887		31914893	-1	no_errors	NM_033111	genbank	human	validated	54_36p	frame_shift_del	DEL	0.710:0.923:0.954:0.983:0.982:0.982:0.976:0.947:0.842:0.518:0.003:0.004:0.002	-
CTAGE11P	647288	genome.wustl.edu	37	13	75813644	75813644	+	IGR	SNP	A	A	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr13:75813644A>T								AL162571.1 (30471 upstream) : LINC01078 (10971 downstream)																							GTCTTCTTCAAGCACAGCAGC	0.403																																																0			13																																								74711645	SO:0001628	intergenic_variant	647288																															13.37:g.75813644A>T		Somatic		Capture	Illumina GAIIx	4	74711645		RNA	SNP	-	NULL		37	NULL		13																																																																																			-	-	0	0.403					LOC647288			A			74711645	-1	pseudogene	XR_017516	genbank	human	model	54_36p	rna	SNP	0.87	T
SCEL	8796	genome.wustl.edu	37	13	78167662	78167662	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr13:78167662G>C	ENST00000349847.3	+	12	790	c.706G>C	c.(706-708)Gat>Cat	p.D236H	SCEL_ENST00000535157.1_Missense_Mutation_p.D214H|SCEL_ENST00000377246.3_Intron	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	236					embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)	p.D236H(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TCAGGATCTTGATAACATCGT	0.363																																																1	Substitution - Missense(1)	ovary(1)	13											133.0	122.0	126.0					13																	78167662		2203	4300	6503	77065663	SO:0001583	missense	8796			AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.706G>C	13.37:g.78167662G>C	ENSP00000302579:p.Asp236His	Somatic		Capture	Illumina GAIIx	4	77065663	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.D236H	ENST00000349847.3	37	c.706	CCDS9459.1	13	.	.	.	.	.	.	.	.	.	.	G	14.01	2.406558	0.42715	.	.	ENSG00000136155	ENST00000535157;ENST00000349847	T;T	0.29917	1.55;1.55	5.36	3.64	0.41730	.	0.464380	0.20181	N	0.097508	T	0.38639	0.1048	L	0.38175	1.15	0.09310	N	1	D;D	0.69078	0.996;0.997	P;P	0.62649	0.873;0.905	T	0.10613	-1.0622	10	0.56958	D	0.05	-5.4825	8.2856	0.31926	0.1827:0.0:0.8173:0.0	.	214;236	F5H651;O95171	.;SCEL_HUMAN	H	214;236	ENSP00000437895:D214H;ENSP00000302579:D236H	ENSP00000302579:D236H	D	+	1	0	SCEL	77065663	0.160000	0.22878	0.001000	0.08648	0.748000	0.42578	2.035000	0.41155	0.753000	0.32945	0.655000	0.94253	GAT	-	NULL		0.363	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCEL	protein_coding	OTTHUMT00000045339.2	G	NM_144777		77065663	1	no_errors	NM_144777	genbank	human	reviewed	54_36p	missense	SNP	0.01	C
LOC101927924	101927924	genome.wustl.edu	37	2	130683274	130683274	+	lincRNA	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:130683274C>T	ENST00000450840.1	+	0	105				AC079776.2_ENST00000433290.1_RNA																							TCCTCTATGACATCTAGATGG	0.488																																																0			2																																								130399744			0																															2.37:g.130683274C>T		Somatic		Capture	Illumina GAIIx	4	130399744		Missense_Mutation	SNP	-	p.C5Y	ENST00000450840.1	37	c.14		2																																																																																			-	NULL		0.488	AC079776.3-001	KNOWN	basic	lincRNA	ENSG00000214100	lincRNA	OTTHUMT00000331345.1	C			130399744	-1	no_errors	ENST00000397540	ensembl	human	novel	54_36p	missense	SNP	0.27	T
EAPP	55837	genome.wustl.edu	37	14	34998570	34998570	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr14:34998570C>G	ENST00000250454.3	-	4	545	c.464G>C	c.(463-465)aGa>aCa	p.R155T		NM_018453.3	NP_060923.2	Q56P03	EAPP_HUMAN	E2F-associated phosphoprotein	155					negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.R155T(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	12	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)		TTACCCCCTTCTCTGTGCATC	0.299																																																1	Substitution - Missense(1)	ovary(1)	14											138.0	122.0	126.0					14																	34998570		1814	4075	5889	34068321	SO:0001583	missense	55837			AF217512	CCDS41941.1	14q13	2007-03-26	2007-03-26	2007-03-26		ENSG00000129518			19312	protein-coding gene	gene with protein product		609486	"""chromosome 14 open reading frame 11"""	C14orf11		15716352	Standard	NM_018453		Approved	BM036, FLJ20578	uc001wsd.1	Q56P03		ENST00000250454.3:c.464G>C	14.37:g.34998570C>G	ENSP00000250454:p.Arg155Thr	Somatic		Capture	Illumina GAIIx	4	34068321	Q9BVF4|Q9NWV5|Q9NZ86	Missense_Mutation	SNP	-	p.R155T	ENST00000250454.3	37	c.464	CCDS41941.1	14	.	.	.	.	.	.	.	.	.	.	C	25.9	4.688601	0.88639	.	.	ENSG00000129518	ENST00000250454;ENST00000554792	T;T	0.45668	0.89;0.89	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.68513	0.3009	M	0.91612	3.225	0.80722	D	1	D	0.62365	0.991	P	0.55824	0.785	T	0.76377	-0.2981	10	0.66056	D	0.02	-19.5171	19.5171	0.95169	0.0:1.0:0.0:0.0	.	155	Q56P03	EAPP_HUMAN	T	155;134	ENSP00000250454:R155T;ENSP00000450908:R134T	ENSP00000250454:R155T	R	-	2	0	EAPP	34068321	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.847000	0.75404	2.705000	0.92388	0.585000	0.79938	AGA	-	NULL		0.299	EAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EAPP	protein_coding	OTTHUMT00000409847.1	C	NM_018453		34068321	-1	no_errors	NM_018453	genbank	human	reviewed	54_36p	missense	SNP	1	G
SOS2	6655	genome.wustl.edu	37	14	50585461	50585461	+	Silent	SNP	C	C	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr14:50585461C>A	ENST00000216373.5	-	23	3874	c.3600G>T	c.(3598-3600)ctG>ctT	p.L1200L	VCPKMT_ENST00000395860.2_5'Flank|VCPKMT_ENST00000395859.2_5'Flank|SOS2_ENST00000543680.1_Silent_p.L1167L	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	1200					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L1200L(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					GTGGACTATGCAGAGGCCCAT	0.507																																																1	Substitution - coding silent(1)	ovary(1)	14											95.0	100.0	98.0					14																	50585461		2203	4300	6503	49655211	SO:0001819	synonymous_variant	6655			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.3600G>T	14.37:g.50585461C>A		Somatic		Capture	Illumina GAIIx	4	49655211	B7ZKT6|D3DSB4|Q15503|Q17RN1	Silent	SNP	HMMPfam_RhoGEF;HMMPfam_RasGEF_N;HMMPfam_PH;HMMPfam_RasGEF;HMMPfam_Histone;superfamily_Ras GEF;superfamily_Histone-fold;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like	p.L1200	ENST00000216373.5	37	c.3600	CCDS9697.1	14																																																																																			-	NULL		0.507	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOS2	protein_coding	OTTHUMT00000276878.2	C			49655211	-1	no_errors	NM_006939	genbank	human	validated	54_36p	silent	SNP	1	A
FBXO34	55030	genome.wustl.edu	37	14	55819068	55819068	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr14:55819068T>A	ENST00000313833.4	+	2	2205	c.1960T>A	c.(1960-1962)Tat>Aat	p.Y654N	FBXO34_ENST00000440021.1_Missense_Mutation_p.Y654N	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	654								p.Y654N(1)		breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						CCCCAAGCCCTATTGCCAGGC	0.537																																																1	Substitution - Missense(1)	ovary(1)	14											90.0	87.0	88.0					14																	55819068		2203	4300	6503	54888821	SO:0001583	missense	55030			AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.1960T>A	14.37:g.55819068T>A	ENSP00000313159:p.Tyr654Asn	Somatic		Capture	Illumina GAIIx	4	54888821	Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	HMMPfam_F-box;superfamily_F-box domain	p.Y654N	ENST00000313833.4	37	c.1960	CCDS32086.1	14	.	.	.	.	.	.	.	.	.	.	T	20.3	3.969732	0.74246	.	.	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.44881	0.91;0.91	5.91	5.91	0.95273	.	0.238756	0.35936	N	0.002883	T	0.65502	0.2697	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.69217	-0.5203	10	0.87932	D	0	.	16.3512	0.83208	0.0:0.0:0.0:1.0	.	654	Q9NWN3	FBX34_HUMAN	N	654	ENSP00000313159:Y654N;ENSP00000394117:Y654N	ENSP00000313159:Y654N	Y	+	1	0	FBXO34	54888821	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	8.040000	0.89188	2.266000	0.75297	0.533000	0.62120	TAT	-	NULL		0.537	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO34	protein_coding	OTTHUMT00000411322.1	T			54888821	1	no_errors	NM_017943	genbank	human	validated	54_36p	missense	SNP	1	A
SPG11	80208	genome.wustl.edu	37	15	44952735	44952735	+	Silent	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr15:44952735G>A	ENST00000261866.7	-	2	353	c.337C>T	c.(337-339)Ctg>Ttg	p.L113L	SPG11_ENST00000535302.2_Silent_p.L113L|SPG11_ENST00000559193.1_Silent_p.L113L|SPG11_ENST00000558319.1_Silent_p.L113L|SPG11_ENST00000427534.2_Silent_p.L113L	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	113					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.L113L(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TAGATAAGCAGTTCATAATTT	0.378																																																1	Substitution - coding silent(1)	ovary(1)	15											128.0	125.0	126.0					15																	44952735		2198	4298	6496	42740027	SO:0001819	synonymous_variant	80208				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.337C>T	15.37:g.44952735G>A		Somatic		Capture	Illumina GAIIx	4	42740027	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Silent	SNP	-	p.L113	ENST00000261866.7	37	c.337	CCDS10112.1	15																																																																																			-	NULL		0.378	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	protein_coding	OTTHUMT00000253927.1	G			42740027	-1	no_errors	NM_025137	genbank	human	reviewed	54_36p	silent	SNP	0.99	A
SPATA5L1	79029	genome.wustl.edu	37	15	45713330	45713330	+	Silent	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr15:45713330G>A	ENST00000305560.6	+	8	2283	c.2184G>A	c.(2182-2184)ccG>ccA	p.P728P	SPATA5L1_ENST00000533841.1_3'UTR	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	728						cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.P728P(1)		kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		CTGTAAAACCGTCGTTAAGTT	0.358																																																1	Substitution - coding silent(1)	ovary(1)	15											71.0	73.0	73.0					15																	45713330		2198	4298	6496	43500622	SO:0001819	synonymous_variant	79029			AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.2184G>A	15.37:g.45713330G>A		Somatic		Capture	Illumina GAIIx	4	43500622	C9JHR5|Q9H8W7|Q9HA41	Silent	SNP	-	p.P728	ENST00000305560.6	37	c.2184	CCDS10123.1	15	.	.	.	.	.	.	.	.	.	.	G	1.748	-0.489945	0.04322	.	.	ENSG00000171763	ENST00000531624	.	.	.	5.6	-4.29	0.03721	.	.	.	.	.	T	0.61652	0.2364	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59568	-0.7430	4	.	.	.	-29.4054	12.7091	0.57080	0.5312:0.0:0.4688:0.0	.	.	.	.	H	233	.	.	R	+	2	0	SPATA5L1	43500622	0.025000	0.19082	0.900000	0.35374	0.230000	0.25150	-0.888000	0.04148	-1.187000	0.02709	-1.267000	0.01435	CGT	-	NULL		0.358	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SPATA5L1	protein_coding	OTTHUMT00000254218.1	G	NM_024063		43500622	1	no_errors	NM_024063	genbank	human	provisional	54_36p	silent	SNP	0.99	A
EEF1A1P22	645693	genome.wustl.edu	37	15	53230492	53230492	+	IGR	SNP	G	G	T	rs562100315	byFrequency	TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr15:53230492G>T								RP11-209K10.2 (133353 upstream) : RP11-209E8.1 (178069 downstream)																							TCCACAAGGAGATATGAATGG	0.453																																																0			15																																								51017784	SO:0001628	intergenic_variant	645693																															15.37:g.53230492G>T		Somatic		Capture	Illumina GAIIx	4	51017784		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.453					LOC645693			G			51017784	-1	pseudogene	XR_017498	genbank	human	model	54_36p	rna	SNP	1	T
CCDC33	80125	genome.wustl.edu	37	15	74623038	74623038	+	Silent	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr15:74623038G>A	ENST00000398814.3	+	13	1922	c.1491G>A	c.(1489-1491)ctG>ctA	p.L497L	CCDC33_ENST00000321288.5_Silent_p.L700L|CCDC33_ENST00000558821.1_Silent_p.L90L|CCDC33_ENST00000268082.4_Silent_p.L90L	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	700								p.L497L(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TGAGTGAGCTGGATATGAAGA	0.567																																																1	Substitution - coding silent(1)	ovary(1)	15											79.0	81.0	80.0					15																	74623038		1991	4183	6174	72410091	SO:0001819	synonymous_variant	80125			BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.1491G>A	15.37:g.74623038G>A		Somatic		Capture	Illumina GAIIx	4	72410091	A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Silent	SNP	-	p.L497	ENST00000398814.3	37	c.1491	CCDS42058.1	15																																																																																			-	NULL		0.567	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC33	protein_coding	OTTHUMT00000419491.2	G	NM_182791		72410091	1	no_errors	NM_025055	genbank	human	validated	54_36p	silent	SNP	0.57	A
RASGRF1	5923	genome.wustl.edu	37	15	79339206	79339206	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr15:79339206C>G	ENST00000419573.3	-	5	1034	c.760G>C	c.(760-762)Gag>Cag	p.E254Q	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.E254Q	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	254	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E254Q(1)		breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TGCACGTACTCAGCCTCAGCC	0.587																																																1	Substitution - Missense(1)	ovary(1)	15											136.0	103.0	114.0					15																	79339206		2196	4293	6489	77126261	SO:0001583	missense	5923			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.760G>C	15.37:g.79339206C>G	ENSP00000405963:p.Glu254Gln	Somatic		Capture	Illumina GAIIx	4	77126261	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_RhoGEF;HMMPfam_RasGEF_N;HMMPfam_PH;HMMPfam_RasGEF;superfamily_Ras GEF;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like	p.E254Q	ENST00000419573.3	37	c.760	CCDS10309.1	15	.	.	.	.	.	.	.	.	.	.	C	25.5	4.646950	0.87958	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.63255	-0.03	4.03	4.03	0.46877	Dbl homology (DH) domain (5);	0.000000	0.52532	U	0.000069	T	0.70798	0.3265	L	0.53249	1.67	0.80722	D	1	D;D;D;P	0.64830	0.994;0.994;0.989;0.898	D;D;D;P	0.69142	0.962;0.944;0.944;0.737	T	0.66333	-0.5950	10	0.18276	T	0.48	.	13.7003	0.62604	0.0:1.0:0.0:0.0	.	254;254;254;254	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	Q	254	ENSP00000405963:E254Q	ENSP00000378224:E254Q	E	-	1	0	RASGRF1	77126261	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	7.434000	0.80377	2.072000	0.62099	0.655000	0.94253	GAG	-	HMMPfam_RhoGEF		0.587	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	protein_coding	OTTHUMT00000291371.3	C	NM_002891		77126261	-1	no_errors	NM_002891	genbank	human	reviewed	54_36p	missense	SNP	1	G
ACAN	176	genome.wustl.edu	37	15	89382075	89382075	+	Silent	SNP	A	A	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr15:89382075A>G	ENST00000561243.1	+	2	252	c.252A>G	c.(250-252)gtA>gtG	p.V84V	ACAN_ENST00000439576.2_Silent_p.V84V|ACAN_ENST00000558207.1_Silent_p.V84V|ACAN_ENST00000559004.1_Silent_p.V84V|ACAN_ENST00000352105.7_Silent_p.V84V			P16112	PGCA_HUMAN	aggrecan	84	G1-A.|Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)	p.V84V(1)		NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGAAGGAGGTAGTGCTGCTGG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	15											114.0	132.0	126.0					15																	89382075		2122	4240	6362	87183079	SO:0001819	synonymous_variant	176			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.252A>G	15.37:g.89382075A>G		Somatic		Capture	Illumina GAIIx	4	87183079	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	HMMPfam_Sushi;HMMPfam_Xlink;HMMPfam_Lectin_C;HMMPfam_EGF;HMMPfam_V-set;superfamily_Immunoglobulin;superfamily_C-type lectin-like;superfamily_EGF/Laminin;superfamily_Complement control module/SCR domain	p.V84	ENST00000561243.1	37	c.252	CCDS53970.1	15																																																																																			-	HMMPfam_V-set		0.617	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	protein_coding	OTTHUMT00000416267.2	A	NM_001135		87183079	1	no_errors	NM_013227	genbank	human	reviewed	54_36p	silent	SNP	1	G
ANPEP	290	genome.wustl.edu	37	15	90349386	90349386	+	Silent	SNP	T	T	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr15:90349386T>C	ENST00000300060.6	-	2	742	c.429A>G	c.(427-429)ggA>ggG	p.G143G		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	143	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.G143G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	GCTGGGAGCCTCCCACACCAC	0.607																																					NSCLC(30;827 977 2459 19669 26125)											1	Substitution - coding silent(1)	ovary(1)	15											83.0	72.0	76.0					15																	90349386		2200	4299	6499	88150390	SO:0001819	synonymous_variant	290			M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.429A>G	15.37:g.90349386T>C		Somatic		Capture	Illumina GAIIx	4	88150390	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Silent	SNP	"HMMPfam_Peptidase_M1,superfamily_Metalloproteases (""zincins"") catalytic domain,superfamily_Leukotriene A4 hydrolase N-terminal domain"	p.G143	ENST00000300060.6	37	c.429	CCDS10356.1	15																																																																																			-	HMMPfam_Peptidase_M1		0.607	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANPEP	protein_coding	OTTHUMT00000313425.1	T			88150390	-1	no_errors	NM_001150	genbank	human	reviewed	54_36p	silent	SNP	0	C
CDH8	1006	genome.wustl.edu	37	16	61851493	61851493	+	Silent	SNP	C	C	A	rs551243066		TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr16:61851493C>A	ENST00000577390.1	-	7	2121	c.1167G>T	c.(1165-1167)ccG>ccT	p.P389P	CDH8_ENST00000584337.1_Silent_p.P389P|CDH8_ENST00000577730.1_Silent_p.P389P|CDH8_ENST00000299345.6_Silent_p.P389P	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	389	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.P389P(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		AAGAGAAGACCGGAGGCTCAT	0.502																																																1	Substitution - coding silent(1)	ovary(1)	16											108.0	91.0	97.0					16																	61851493		2203	4300	6503	60408994	SO:0001819	synonymous_variant	1006			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1167G>T	16.37:g.61851493C>A		Somatic		Capture	Illumina GAIIx	4	60408994	B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	HMMPfam_Cadherin_C;HMMPfam_Cadherin;superfamily_Cadherin-like	p.P389	ENST00000577390.1	37	c.1167	CCDS10802.1	16																																																																																			-	NULL		0.502	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	protein_coding	OTTHUMT00000268754.3	C	NM_001796		60408994	-1	no_errors	NM_001796	genbank	human	reviewed	54_36p	silent	SNP	0.27	A
TUBB3	10381	genome.wustl.edu	37	16	89999920	89999920	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr16:89999920G>A	ENST00000315491.7	+	3	334	c.211G>A	c.(211-213)Gga>Aga	p.G71R	TUBB3_ENST00000553967.1_Missense_Mutation_p.G71R|TUBB3_ENST00000555576.1_Missense_Mutation_p.G71R|TUBB3_ENST00000554336.1_Missense_Mutation_p.G71R|TUBB3_ENST00000556922.1_Missense_Mutation_p.G418R|TUBB3_ENST00000554444.1_5'UTR|TUBB3_ENST00000304984.5_5'UTR	NM_006086.3	NP_006077.2	Q13509	TBB3_HUMAN	tubulin, beta 3 class III	71					'de novo' posttranslational protein folding (GO:0051084)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G71R(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)	Ixabepilone(DB04845)	CCTGGAACCCGGAACCATGGA	0.582																																																1	Substitution - Missense(1)	ovary(1)	16											211.0	213.0	212.0					16																	89999920		2198	4300	6498	88527421	SO:0001583	missense	10381			BC000748	CCDS10988.1, CCDS56012.1	16q24.3	2014-02-04	2011-10-10		ENSG00000198211	ENSG00000198211		"""Tubulins"""	20772	protein-coding gene	gene with protein product	"""class III beta-tubulin"""	602661	"""tubulin, beta 3"", ""fibrosis of extraocular muscles, congenital, 3"""	FEOM3		9473684, 8098743, 20074521	Standard	NM_006086		Approved	beta-4, CFEOM3, CFEOM3A	uc002fph.2	Q13509	OTTHUMG00000138985	ENST00000315491.7:c.211G>A	16.37:g.89999920G>A	ENSP00000320295:p.Gly71Arg	Somatic		Capture	Illumina GAIIx	4	88527421	A8K854|Q9BTZ0|Q9BW10	Missense_Mutation	SNP	-	p.G71R	ENST00000315491.7	37	c.211	CCDS10988.1	16	.	.	.	.	.	.	.	.	.	.	G	16.41	3.114937	0.56505	.	.	ENSG00000258947;ENSG00000258947;ENSG00000258947;ENSG00000258947;ENSG00000198211;ENSG00000198211	ENST00000556922;ENST00000555399;ENST00000554336;ENST00000553967;ENST00000315491;ENST00000555576	T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41	4.57	4.57	0.56435	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.56097	D	0.000030	T	0.78861	0.4350	M	0.64404	1.975	0.80722	D	1	D;D	0.89917	1.0;0.981	D;P	0.85130	0.997;0.689	T	0.79017	-0.1975	9	.	.	.	.	15.2253	0.73345	0.0:0.0:1.0:0.0	.	71;71	Q13509;B2RBD5	TBB3_HUMAN;.	R	418;71;71;71;71;71	ENSP00000451560:G418R;ENSP00000450822:G71R;ENSP00000450765:G71R;ENSP00000320295:G71R;ENSP00000452554:G71R	.	G	+	1	0	RP11-566K11.2;TUBB3	88527421	1.000000	0.71417	0.982000	0.44146	0.497000	0.33675	9.632000	0.98428	2.255000	0.74692	0.650000	0.86243	GGA	-	NULL		0.582	TUBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB3	protein_coding	OTTHUMT00000272874.1	G	NM_006086		88527421	1	no_errors	NM_006086	genbank	human	validated	54_36p	missense	SNP	1	A
FBXW10	10517	genome.wustl.edu	37	17	18654366	18654366	+	Splice_Site	SNP	G	G	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr17:18654366G>C	ENST00000395665.4	+	5	1343	c.1122G>C	c.(1120-1122)aaG>aaC	p.K374N	FBXW10_ENST00000395667.1_Splice_Site_p.K374N|FBXW10_ENST00000301938.4_Splice_Site_p.K374N|FBXW10_ENST00000308799.4_Splice_Site_p.K403N			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	374								p.K374N(1)		NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						TGAGAACGAAGGTGGGTTCCA	0.488																																																1	Substitution - Missense(1)	ovary(1)	17											209.0	200.0	203.0					17																	18654366		2203	4300	6503	18595091	SO:0001630	splice_region_variant	10517			BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.1122+1G>C	17.37:g.18654366G>C		Somatic		Capture	Illumina GAIIx	4	18595091	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	-	p.K374N	ENST00000395665.4	37	c.1122	CCDS11199.3	17	.	.	.	.	.	.	.	.	.	.	G	11.39	1.624529	0.28889	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	2.73	2.73	0.32206	F-box domain, Skp2-like (1);	0.000000	0.38720	U	0.001593	T	0.46639	0.1403	M	0.69823	2.125	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.996	D;D;D;D	0.85130	0.996;0.997;0.991;0.937	T	0.49103	-0.8974	10	0.59425	D	0.04	.	11.2579	0.49065	0.0:0.0:1.0:0.0	.	374;403;374;374	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	N	374;403;374;374	ENSP00000379026:K374N;ENSP00000310382:K403N;ENSP00000306937:K374N;ENSP00000379025:K374N	ENSP00000306937:K374N	K	+	3	2	FBXW10	18595091	1.000000	0.71417	0.995000	0.50966	0.182000	0.23217	3.349000	0.52217	1.518000	0.48934	0.405000	0.27470	AAG	-	NULL		0.488	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	FBXW10	protein_coding	OTTHUMT00000313531.2	G	NM_031456	Missense_Mutation	18595091	1	no_errors	NM_031456	genbank	human	validated	54_36p	missense	SNP	1	C
CDC6	990	genome.wustl.edu	37	17	38447467	38447467	+	Silent	SNP	A	A	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr17:38447467A>C	ENST00000209728.4	+	3	807	c.336A>C	c.(334-336)ctA>ctC	p.L112L		NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	112					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)	p.L112L(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						AAAGAGAACTAGCCAAAGTTC	0.388																																																1	Substitution - coding silent(1)	ovary(1)	17											101.0	94.0	96.0					17																	38447467		2203	4300	6503	35700993	SO:0001819	synonymous_variant	990			U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.336A>C	17.37:g.38447467A>C		Somatic		Capture	Illumina GAIIx	4	35700993	Q8TB30	Silent	SNP	"HMMPfam_AAA;HMMPfam_Cdc6_C;superfamily_""Winged helix"" DNA-binding domain;superfamily_P-loop containing nucleoside triphosphate hydrolases"	p.L112	ENST00000209728.4	37	c.336	CCDS11365.1	17																																																																																			-	NULL		0.388	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC6	protein_coding	OTTHUMT00000257129.1	A			35700993	1	no_errors	NM_001254	genbank	human	reviewed	54_36p	silent	SNP	0.01	C
CDC6	990	genome.wustl.edu	37	17	38457165	38457165	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr17:38457165G>T	ENST00000209728.4	+	10	1806	c.1335G>T	c.(1333-1335)agG>agT	p.R445S	CTD-2267D19.6_ENST00000602403.1_lincRNA	NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	445					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)	p.R445S(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						ATGGTAACAGGATGACCTTGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	17											223.0	193.0	203.0					17																	38457165		2203	4300	6503	35710691	SO:0001583	missense	990			U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.1335G>T	17.37:g.38457165G>T	ENSP00000209728:p.Arg445Ser	Somatic		Capture	Illumina GAIIx	4	35710691	Q8TB30	Missense_Mutation	SNP	"HMMPfam_AAA;HMMPfam_Cdc6_C;superfamily_""Winged helix"" DNA-binding domain;superfamily_P-loop containing nucleoside triphosphate hydrolases"	p.R445S	ENST00000209728.4	37	c.1335	CCDS11365.1	17	.	.	.	.	.	.	.	.	.	.	G	8.334	0.827158	0.16749	.	.	ENSG00000094804	ENST00000209728	T	0.21191	2.02	5.96	2.36	0.29203	.	0.143965	0.64402	D	0.000012	T	0.13927	0.0337	L	0.39566	1.225	0.37906	D	0.931192	P	0.46064	0.872	B	0.40982	0.345	T	0.12993	-1.0526	10	0.07644	T	0.81	-13.5765	9.5958	0.39573	0.3346:0.0:0.6654:0.0	.	445	Q99741	CDC6_HUMAN	S	445	ENSP00000209728:R445S	ENSP00000209728:R445S	R	+	3	2	CDC6	35710691	0.999000	0.42202	0.999000	0.59377	0.866000	0.49608	0.421000	0.21280	0.735000	0.32537	0.655000	0.94253	AGG	-	NULL		0.418	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC6	protein_coding	OTTHUMT00000257129.1	G			35710691	1	no_errors	NM_001254	genbank	human	reviewed	54_36p	missense	SNP	1	T
AOC3	8639	genome.wustl.edu	37	17	41004661	41004661	+	Missense_Mutation	SNP	A	A	T	rs200247368		TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr17:41004661A>T	ENST00000308423.2	+	1	1461	c.1301A>T	c.(1300-1302)cAg>cTg	p.Q434L	AOC3_ENST00000591562.1_5'Flank	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	434					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)	p.Q434L(1)		breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	GTGTTTGAACAGAACCAGGGC	0.577																																					NSCLC(3;192 220 10664 11501 16477)											1	Substitution - Missense(1)	ovary(1)	17											100.0	89.0	93.0					17																	41004661		2203	4300	6503	38258187	SO:0001583	missense	8639			AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.1301A>T	17.37:g.41004661A>T	ENSP00000312326:p.Gln434Leu	Somatic		Capture	Illumina GAIIx	4	38258187	B2RCI5|K7ESB3|L0L8N9|Q45F94	Missense_Mutation	SNP	HMMPfam_Cu_amine_oxid;superfamily_Amine oxidase catalytic domain;HMMPfam_Cu_amine_oxidN2;HMMPfam_Cu_amine_oxidN3;superfamily_Amine oxidase N-terminal region	p.Q434L	ENST00000308423.2	37	c.1301	CCDS11444.1	17	.	.	.	.	.	.	.	.	.	.	A	2.750	-0.260322	0.05791	.	.	ENSG00000131471	ENST00000308423	T	0.04015	3.73	4.64	4.64	0.57946	Copper amine oxidase, C-terminal (3);	0.252843	0.39210	N	0.001427	T	0.03959	0.0111	N	0.16790	0.44	0.80722	D	1	B	0.18741	0.03	B	0.31290	0.127	T	0.50767	-0.8789	10	0.20519	T	0.43	.	9.8683	0.41157	0.8475:0.0:0.0:0.1525	.	434	Q16853	AOC3_HUMAN	L	434	ENSP00000312326:Q434L	ENSP00000312326:Q434L	Q	+	2	0	AOC3	38258187	0.999000	0.42202	1.000000	0.80357	0.561000	0.35649	2.851000	0.48302	2.093000	0.63338	0.482000	0.46254	CAG	-	HMMPfam_Cu_amine_oxid		0.577	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC3	protein_coding	OTTHUMT00000452444.1	A	NM_003734		38258187	1	no_errors	NM_003734	genbank	human	reviewed	54_36p	missense	SNP	1	T
TP53	7157	genome.wustl.edu	37	17	7578470	7578500	+	Frame_Shift_Del	DEL	CGGGCGGGGGTGTGGAATCAACCCACAGCTG	CGGGCGGGGGTGTGGAATCAACCCACAGCTG	-	rs137852790|rs137852791|rs587782705|rs137852789|rs28934874|rs587782197|rs72661116		TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	CGGGCGGGGGTGTGGAATCAACCCACAGCTG	CGGGCGGGGGTGTGGAATCAACCCACAGCTG	CGGGCGGGGGTGTGGAATCAACCCACAGCTG	-	CGGGCGGGGGTGTGGAATCAACCCACAGCTG	CGGGCGGGGGTGTGGAATCAACCCACAGCTG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr17:7578470_7578500delCGGGCGGGGGTGTGGAATCAACCCACAGCTG	ENST00000269305.4	-	5	619_649	c.430_460delCAGCTGTGGGTTGATTCCACACCCCCGCCCG	c.(430-462)cagctgtgggttgattccacacccccgcccggcfs	p.QLWVDSTPPPG144fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.QLWVDSTPPPG144fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.QLWVDSTPPPG144fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.QLWVDSTPPPG144fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.QLWVDSTPPPG144fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.QLWVDSTPPPG144fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	144	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).|Q -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.W146*(72)|p.P151S(68)|p.P152L(66)|p.Q144*(36)|p.P151H(31)|p.P152S(22)|p.P152fs*18(18)|p.L145Q(17)|p.L145P(17)|p.P151T(16)|p.P151A(13)|p.P151P(12)|p.P153fs*28(11)|p.G154S(9)|p.P151R(9)|p.L145L(8)|p.P152R(8)|p.0?(8)|p.Q144L(8)|p.P153S(8)|p.L145R(7)|p.P151fs*30(7)|p.P151L(7)|p.P152T(7)|p.P153P(7)|p.T150fs*16(6)|p.V147G(6)|p.S149S(6)|p.S149F(6)|p.V147I(6)|p.P153L(6)|p.V147D(5)|p.P152fs*29(5)|p.P152fs*14(5)|p.V147fs*23(5)|p.W146R(5)|p.S149fs*32(5)|p.P152P(5)|p.?(5)|p.G154C(4)|p.P152Q(4)|p.T150I(4)|p.Q144H(4)|p.D148E(4)|p.Q144R(4)|p.Q144P(4)|p.D148N(4)|p.S149P(4)|p.W146S(4)|p.P152fs*28(3)|p.W14*(3)|p.W53*(3)|p.Q144fs*25(3)|p.G154I(3)|p.S149fs*21(3)|p.P153T(3)|p.G154fs*27(3)|p.V147V(3)|p.Q12*(2)|p.D148fs*33(2)|p.P58H(2)|p.P58A(2)|p.P58S(2)|p.G154fs*16(2)|p.G154fs*14(2)|p.S149T(2)|p.Q144fs*26(2)|p.P152A(2)|p.Q51*(2)|p.Q144del(2)|p.Q144K(2)|p.P20L(2)|p.V147A(2)|p.L145V(2)|p.P59L(2)|p.D148V(2)|p.Q144Q(2)|p.P153fs*26(2)|p.P153fs*22(2)|p.D148fs*23(2)|p.D148fs*22(2)|p.W146C(2)|p.P19S(2)|p.P19H(2)|p.P19A(2)|p.L137_W146del10(1)|p.D148fs*34(1)|p.D148fs*32(1)|p.L145del(1)|p.P152fs*27(1)|p.G154_R156delGTR(1)|p.W146fs*25(1)|p.W146fs*22(1)|p.W146fs*23(1)|p.G61C(1)|p.W14S(1)|p.P58T(1)|p.P58R(1)|p.Q144_G154del11(1)|p.W146_V147insXXXXXXX(1)|p.Q144fs*32(1)|p.T150fs*31(1)|p.T150fs*23(1)|p.W53S(1)|p.T57fs*16(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.Q51fs*25(1)|p.P152del(1)|p.S149fs*72(1)|p.Q144fs*16(1)|p.P153_G154insX(1)|p.L145M(1)|p.P152_P153del(1)|p.T150R(1)|p.P20R(1)|p.P151del(1)|p.W146_S149>C(1)|p.D148del(1)|p.T150K(1)|p.S149fs*17(1)|p.V143_S149del(1)|p.P152_P153insXXX(1)|p.T150_P151delTP(1)|p.Q144fs*4(1)|p.P142_Q144delPVQ(1)|p.P153fs*16(1)|p.D148Y(1)|p.P151_V173del23(1)|p.D148D(1)|p.Q12fs*25(1)|p.D148H(1)|p.P59R(1)|p.G22C(1)|p.P153fs*20(1)|p.W146fs*1(1)|p.S149fs*31(1)|p.W146G(1)|p.V147E(1)|p.G154fs*22(1)|p.V147F(1)|p.P19R(1)|p.P19T(1)|p.P153F(1)|p.T18fs*16(1)|p.P153A(1)|p.D148*(1)|p.P153H(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACGCGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCACAGGGCAG	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	752	Substitution - Missense(444)|Substitution - Nonsense(119)|Deletion - Frameshift(72)|Substitution - coding silent(44)|Insertion - Frameshift(39)|Deletion - In frame(16)|Whole gene deletion(8)|Unknown(5)|Insertion - In frame(3)|Complex - frameshift(1)|Complex - deletion inframe(1)	large_intestine(112)|upper_aerodigestive_tract(82)|lung(81)|oesophagus(59)|breast(59)|haematopoietic_and_lymphoid_tissue(49)|ovary(41)|central_nervous_system(39)|stomach(39)|urinary_tract(39)|skin(30)|endometrium(23)|liver(23)|prostate(22)|soft_tissue(13)|pancreas(12)|biliary_tract(8)|bone(6)|vulva(5)|thyroid(3)|adrenal_gland(2)|pleura(1)|peritoneum(1)|cervix(1)|eye(1)|small_intestine(1)	17	GRCh37	CD044990|CD090894|CI920955|CM012662|CM023462|CM941326|CM941327	TP53	D|I|M	rs137852789|rs28934874																																			7519225	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.430_460delCAGCTGTGGGTTGATTCCACACCCCCGCCCG	17.37:g.7578470_7578500delCGGGCGGGGGTGTGGAATCAACCCACAGCTG	ENSP00000269305:p.Gln144fs	Somatic		Capture	Illumina GAIIx	4	7519195	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.Q144fs	ENST00000269305.4	37	c.460_430	CCDS11118.1	17																																																																																			(deletion:cds_exon[7519096;7519279])	HMMPfam_P53		0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	CGGGCGGGGGTGTGGAATCAACCCACAGCTG	NM_000546		7519225	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.496:0.001:0.001:0.001:0.001:0.996:0.998:0.906:0.998:0.997:0.001:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.014:0.987:0.994:0.947:0.886:0.843:0.860:0.979:0.970:0.987:0.998:1.000	-
ARHGEF15	22899	genome.wustl.edu	37	17	8215517	8215517	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr17:8215517C>G	ENST00000361926.3	+	2	270	c.160C>G	c.(160-162)Cca>Gca	p.P54A	ARHGEF15_ENST00000421050.1_Missense_Mutation_p.P54A	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	54	Pro-rich.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P54A(1)		breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						CAATGATGCACCAACCCCAAT	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											102.0	106.0	105.0					17																	8215517		2203	4300	6503	8156242	SO:0001583	missense	22899			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.160C>G	17.37:g.8215517C>G	ENSP00000355026:p.Pro54Ala	Somatic		Capture	Illumina GAIIx	4	8156242	A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	HMMPfam_RhoGEF;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like	p.P54A	ENST00000361926.3	37	c.160	CCDS11139.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.303|1.303	-0.604215|-0.604215	0.03717|0.03717	.|.	.|.	ENSG00000198844|ENSG00000198844	ENST00000455564|ENST00000361926;ENST00000421050	.|T;T	.|0.68624	.|-0.34;-0.34	5.0|5.0	1.66|1.66	0.24008|0.24008	.|.	.|0.707374	.|0.11585	.|N	.|0.549335	T|T	0.44623|0.44623	0.1302|0.1302	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	.|B;B	.|0.16603	.|0.018;0.018	.|B;B	.|0.14023	.|0.01;0.01	T|T	0.22382|0.22382	-1.0218|-1.0218	6|10	0.23891|0.25751	T|T	0.37|0.34	0.0478|0.0478	3.663|3.663	0.08245|0.08245	0.0:0.5523:0.2106:0.2372|0.0:0.5523:0.2106:0.2372	.|.	.|54;54	.|D3DTR7;O94989	.|.;ARHGF_HUMAN	Q|A	15|54	.|ENSP00000355026:P54A;ENSP00000412505:P54A	ENSP00000413324:H15Q|ENSP00000355026:P54A	H|P	+|+	3|1	2|0	ARHGEF15|ARHGEF15	8156242|8156242	0.000000|0.000000	0.05858|0.05858	0.009000|0.009000	0.14445|0.14445	0.198000|0.198000	0.23893|0.23893	-0.412000|-0.412000	0.07132|0.07132	0.664000|0.664000	0.31047|0.31047	0.650000|0.650000	0.86243|0.86243	CAC|CCA	-	NULL		0.637	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	protein_coding	OTTHUMT00000226993.2	C	NM_173728		8156242	1	no_errors	NM_173728	genbank	human	reviewed	54_36p	missense	SNP		G
SDK2	54549	genome.wustl.edu	37	17	71364621	71364621	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr17:71364621C>A	ENST00000392650.3	-	37	5092	c.5092G>T	c.(5092-5094)Gtc>Ttc	p.V1698F	SDK2_ENST00000410094.1_5'UTR|SDK2_ENST00000388726.3_Missense_Mutation_p.V1679F	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1698	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.V1698F(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GCCACGCTGACCATGTAGGCC	0.647																																																1	Substitution - Missense(1)	ovary(1)	17											58.0	43.0	48.0					17																	71364621		2203	4300	6503	68876216	SO:0001583	missense	54549			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.5092G>T	17.37:g.71364621C>A	ENSP00000376421:p.Val1698Phe	Somatic		Capture	Illumina GAIIx	4	68876216	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	-	p.V1377F	ENST00000392650.3	37	c.4129	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043926	0.75732	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893;ENST00000410094	T;T;T	0.56444	0.46;0.46;0.46	5.21	5.21	0.72293	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.060308	0.64402	D	0.000003	T	0.63908	0.2551	L	0.55017	1.72	0.41861	D	0.990222	D;B;B	0.58620	0.983;0.441;0.386	D;B;B	0.69654	0.965;0.393;0.273	T	0.64850	-0.6310	10	0.51188	T	0.08	.	9.5072	0.39053	0.0:0.843:0.0:0.157	.	1698;1698;1679	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	F	1322;1698;1679;855;1698;39	ENSP00000376421:V1698F;ENSP00000373378:V1679F;ENSP00000407098:V855F	ENSP00000324967:V1698F	V	-	1	0	SDK2	68876216	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.864000	0.39469	2.432000	0.82394	0.563000	0.77884	GTC	-	NULL		0.647	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	protein_coding	OTTHUMT00000327598.2	C	NM_019064		68876216	-1	no_errors	ENST00000334543	ensembl	human	known	54_36p	missense	SNP	1	A
DSG3	1830	genome.wustl.edu	37	18	29055844	29055844	+	Missense_Mutation	SNP	C	C	A	rs561235235		TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr18:29055844C>A	ENST00000257189.4	+	16	2704	c.2621C>A	c.(2620-2622)tCt>tAt	p.S874Y		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	874					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S874Y(1)		breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CAGCCACCCTCTAAAGACAGC	0.463																																																1	Substitution - Missense(1)	ovary(1)	18											129.0	125.0	126.0					18																	29055844		2203	4300	6503	27309842	SO:0001583	missense	1830			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.2621C>A	18.37:g.29055844C>A	ENSP00000257189:p.Ser874Tyr	Somatic		Capture	Illumina GAIIx	4	27309842	A8K2V2	Missense_Mutation	SNP	HMMPfam_Cadherin;superfamily_Cadherin-like	p.S874Y	ENST00000257189.4	37	c.2621	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	C	14.29	2.490396	0.44249	.	.	ENSG00000134757	ENST00000257189	T	0.60424	0.19	5.54	3.65	0.41850	.	0.766462	0.11481	N	0.559727	T	0.49864	0.1582	L	0.42245	1.32	0.09310	N	1	P	0.47841	0.901	B	0.42738	0.396	T	0.43261	-0.9402	10	0.66056	D	0.02	.	7.528	0.27666	0.1349:0.7233:0.0:0.1417	.	874	P32926	DSG3_HUMAN	Y	874	ENSP00000257189:S874Y	ENSP00000257189:S874Y	S	+	2	0	DSG3	27309842	0.004000	0.15560	0.006000	0.13384	0.011000	0.07611	1.870000	0.39529	1.489000	0.48450	0.655000	0.94253	TCT	-	NULL		0.463	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	protein_coding	OTTHUMT00000254949.1	C	NM_001944		27309842	1	no_errors	NM_001944	genbank	human	reviewed	54_36p	missense	SNP		A
TCF4	6925	genome.wustl.edu	37	18	52895488	52895488	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr18:52895488C>A	ENST00000356073.4	-	19	2583	c.1972G>T	c.(1972-1974)Gga>Tga	p.G658*	TCF4_ENST00000568740.1_Nonsense_Mutation_p.G633*|TCF4_ENST00000568673.1_Nonsense_Mutation_p.G638*|TCF4_ENST00000564403.2_Nonsense_Mutation_p.G668*|TCF4_ENST00000537578.1_Nonsense_Mutation_p.G638*|TCF4_ENST00000561831.3_Nonsense_Mutation_p.G498*|TCF4_ENST00000354452.3_Nonsense_Mutation_p.G662*|TCF4_ENST00000565018.2_Nonsense_Mutation_p.G662*|TCF4_ENST00000561992.1_Nonsense_Mutation_p.G528*|TCF4_ENST00000564999.1_Nonsense_Mutation_p.G658*|TCF4_ENST00000566286.1_Nonsense_Mutation_p.G655*|TCF4_ENST00000570287.2_Nonsense_Mutation_p.G498*|TCF4_ENST00000457482.3_Nonsense_Mutation_p.G502*|TCF4_ENST00000398339.1_Nonsense_Mutation_p.G764*|TCF4_ENST00000570177.2_Nonsense_Mutation_p.G528*|TCF4_ENST00000540999.1_Nonsense_Mutation_p.G634*|TCF4_ENST00000537856.3_Nonsense_Mutation_p.G528*|TCF4_ENST00000543082.1_Nonsense_Mutation_p.G616*|TCF4_ENST00000566279.1_Nonsense_Mutation_p.G602*|TCF4_ENST00000567880.1_Nonsense_Mutation_p.G598*|TCF4_ENST00000564228.1_Nonsense_Mutation_p.G587*|TCF4_ENST00000544241.2_Nonsense_Mutation_p.G591*	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	658					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)	p.G658*(1)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		GATGCGTCTCCCATTCCAGGG	0.498																																																1	Substitution - Nonsense(1)	ovary(1)	18											112.0	96.0	101.0					18																	52895488		2203	4300	6503	51046486	SO:0001587	stop_gained	6925			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1972G>T	18.37:g.52895488C>A	ENSP00000348374:p.Gly658*	Somatic		Capture	Illumina GAIIx	4	51046486	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Nonsense_Mutation	SNP	-	p.G662*	ENST00000356073.4	37	c.1984	CCDS11960.1	18	.	.	.	.	.	.	.	.	.	.	C	37	6.383347	0.97524	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	.	.	.	5.72	5.72	0.89469	.	0.298693	0.35936	N	0.002892	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-3.4491	18.6583	0.91462	0.0:1.0:0.0:0.0	.	.	.	.	X	662;502;658;616;634;638;591;528;764	.	ENSP00000346440:G662X	G	-	1	0	TCF4	51046486	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.047000	0.57383	2.689000	0.91719	0.650000	0.86243	GGA	-	NULL		0.498	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	protein_coding	OTTHUMT00000256014.1	C	NM_003199		51046486	-1	no_errors	NM_001083962	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
SERPINB11	89778	genome.wustl.edu	37	18	61390572	61390572	+	RNA	SNP	T	T	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr18:61390572T>A	ENST00000382749.5	+	0	1363				SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000536691.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				CCCTTCCTTTTCTTTATAAGG	0.527																																					Ovarian(27;496 784 5942 8975 23930)											0			18											139.0	130.0	133.0					18																	61390572		2177	4288	6465	59541552			89778					18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61390572T>A		Somatic		Capture	Illumina GAIIx	4	59541552	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Missense_Mutation	SNP	HMMPfam_Serpin,superfamily_Serpins	p.F171Y	ENST00000382749.5	37	c.512		18	.	.	.	.	.	.	.	.	.	.	T	23.1	4.374869	0.82573	.	.	ENSG00000206072	ENST00000544088;ENST00000538847;ENST00000536691	D;T;D	0.87334	-2.24;2.17;-2.24	5.27	5.27	0.74061	Serpin domain (3);Protease inhibitor I4, serpin, conserved site (1);	0.000000	0.64402	D	0.000016	D	0.92609	0.7652	M	0.71206	2.165	0.32591	N	0.527139	D;D;D;D	0.89917	0.998;1.0;1.0;0.999	D;D;D;D	0.87578	0.991;0.998;0.998;0.995	D	0.94568	0.7768	10	0.87932	D	0	.	14.6673	0.68918	0.0:0.0:0.0:1.0	.	198;171;286;373	F5GWT8;F5GY69;Q96P15-2;Q96P15	.;.;.;SPB11_HUMAN	Y	373;171;198	ENSP00000441497:F373Y;ENSP00000440795:F171Y;ENSP00000441708:F198Y	ENSP00000421854:F373Y	F	+	2	0	SERPINB11	59541552	1.000000	0.71417	1.000000	0.80357	0.564000	0.35744	7.663000	0.83820	2.106000	0.64143	0.533000	0.62120	TTC	-	NULL		0.527	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	SERPINB11	polymorphic_pseudogene	OTTHUMT00000207392.3	T	NM_080475		59541552	1	no_errors	ENST00000382749	ensembl	human	known	54_36p	missense	SNP	1	A
ZNF461	92283	genome.wustl.edu	37	19	37130147	37130147	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr19:37130147C>A	ENST00000588268.1	-	6	1327	c.1100G>T	c.(1099-1101)aGg>aTg	p.R367M	ZNF461_ENST00000540605.2_5'UTR|ZNF461_ENST00000360357.4_Missense_Mutation_p.R344M	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R240M(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TGAGCGATGCCTAAAAGTCTT	0.423																																																1	Substitution - Missense(1)	ovary(1)	19											76.0	84.0	81.0					19																	37130147		2196	4300	6496	41821987	SO:0001583	missense	92283			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.1100G>T	19.37:g.37130147C>A	ENSP00000467931:p.Arg367Met	Somatic		Capture	Illumina GAIIx	4	41821987	A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.R367M	ENST00000588268.1	37	c.1100	CCDS54257.1	19	.	.	.	.	.	.	.	.	.	.	C	13.36	2.212768	0.39102	.	.	ENSG00000197808	ENST00000396893;ENST00000396896;ENST00000360357;ENST00000540605	T	0.08193	3.12	3.48	2.32	0.28847	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18759	0.0450	L	0.49455	1.56	0.09310	N	1	D;D;D	0.89917	0.996;1.0;0.97	D;D;P	0.81914	0.993;0.995;0.843	T	0.04930	-1.0917	9	0.66056	D	0.02	.	6.1914	0.20526	0.185:0.4755:0.3395:0.0	.	344;289;367	B4DRP8;Q59G30;Q8TAF7	.;.;ZN461_HUMAN	M	367;98;344;240	ENSP00000353515:R344M	ENSP00000353515:R344M	R	-	2	0	ZNF461	41821987	0.000000	0.05858	0.321000	0.25320	0.981000	0.71138	-3.723000	0.00383	1.941000	0.56285	0.491000	0.48974	AGG	-	HMMPfam_zf-C2H2		0.423	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	protein_coding	OTTHUMT00000453202.1	C	NM_153257		41821987	-1	no_errors	NM_153257	genbank	human	validated	54_36p	missense	SNP		A
SIPA1L3	23094	genome.wustl.edu	37	19	38610261	38610261	+	Silent	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr19:38610261G>A	ENST00000222345.6	+	9	3116	c.2607G>A	c.(2605-2607)ggG>ggA	p.G869G		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	869					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)	p.G869G(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ACAGTGCAGGGGCCATCGCCT	0.572																																																1	Substitution - coding silent(1)	ovary(1)	19											70.0	77.0	75.0					19																	38610261		2203	4300	6503	43302101	SO:0001819	synonymous_variant	23094			AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.2607G>A	19.37:g.38610261G>A		Somatic		Capture	Illumina GAIIx	4	43302101	Q2TV87	Silent	SNP	HMMPfam_Rap_GAP;HMMPfam_PDZ;superfamily_PDZ domain-like;superfamily_Rap/Ran-GAP (Pfam 02145)	p.G869	ENST00000222345.6	37	c.2607	CCDS33007.1	19																																																																																			-	NULL		0.572	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L3	protein_coding	OTTHUMT00000156294.2	G	XM_032278		43302101	1	no_errors	NM_015073	genbank	human	validated	54_36p	silent	SNP	0.99	A
RYR1	6261	genome.wustl.edu	37	19	38924483	38924483	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr19:38924483A>T	ENST00000359596.3	+	1	14	c.14A>T	c.(13-15)gAa>gTa	p.E5V	RYR1_ENST00000360985.3_Missense_Mutation_p.E5V|RYR1_ENST00000355481.4_Missense_Mutation_p.E5V			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	5					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.E5V(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGTGACGCAGAAGGCGAAGAC	0.667																																																1	Substitution - Missense(1)	ovary(1)	19											139.0	137.0	138.0					19																	38924483		2203	4300	6503	43616323	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14A>T	19.37:g.38924483A>T	ENSP00000352608:p.Glu5Val	Somatic		Capture	Illumina GAIIx	4	43616323	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	HMMPfam_RYDR_ITPR;HMMPfam_RyR;HMMPfam_MIR;HMMPfam_SPRY;HMMPfam_Ion_trans;HMMPfam_RR_TM4-6;HMMPfam_RIH_assoc;HMMPfam_Ins145_P3_rec;superfamily_EF-hand;superfamily_MIR domain (Pfam 02815)	p.E5V	ENST00000359596.3	37	c.14	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	A	16.55	3.153425	0.57259	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97279	-4.32;-4.32;-4.32	4.81	4.81	0.61882	.	0.077847	0.48286	U	0.000185	D	0.97424	0.9157	L	0.55481	1.735	0.37484	D	0.916105	D;D	0.61080	0.989;0.964	D;P	0.75020	0.985;0.632	D	0.99013	1.0815	10	0.87932	D	0	.	10.9198	0.47158	1.0:0.0:0.0:0.0	.	5;5	P21817-2;P21817	.;RYR1_HUMAN	V	5	ENSP00000352608:E5V;ENSP00000347667:E5V;ENSP00000354254:E5V	ENSP00000347667:E5V	E	+	2	0	RYR1	43616323	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	4.891000	0.63185	2.144000	0.66660	0.459000	0.35465	GAA	-	NULL		0.667	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	protein_coding	OTTHUMT00000462137.1	A			43616323	1	no_errors	NM_000540	genbank	human	reviewed	54_36p	missense	SNP	1	T
MARCH2	51257	genome.wustl.edu	37	19	8491561	8491561	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr19:8491561G>C	ENST00000602117.1	+	3	700	c.245G>C	c.(244-246)tGc>tCc	p.C82S	MARCH2_ENST00000215555.2_Missense_Mutation_p.C82S|MARCH2_ENST00000601283.1_Intron|RP11-886P16.6_ENST00000595706.1_RNA|MARCH2_ENST00000393944.1_Missense_Mutation_p.C82S|MARCH2_ENST00000381035.4_Missense_Mutation_p.C82S			Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase	82					endocytosis (GO:0006897)|protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.C82S(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|skin(1)|urinary_tract(1)	10						CCGTGTGGCTGCACCGGCACG	0.582																																																1	Substitution - Missense(1)	ovary(1)	19											98.0	76.0	84.0					19																	8491561		2203	4300	6503	8397561	SO:0001583	missense	51257			AF151074	CCDS12202.1, CCDS32894.1	19p13.2	2013-01-09	2012-02-23			ENSG00000099785		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	28038	protein-coding gene	gene with protein product		613332	"""membrane-associated ring finger (C3HC4) 2"""			11042152, 14722266	Standard	NM_016496		Approved	HSPC240, MARCH-II, RNF172	uc002mjw.3	Q9P0N8		ENST00000602117.1:c.245G>C	19.37:g.8491561G>C	ENSP00000471536:p.Cys82Ser	Somatic		Capture	Illumina GAIIx	4	8397561	A6NP10|Q5H785|Q8N5A3|Q96B78	Missense_Mutation	SNP	-	p.C82S	ENST00000602117.1	37	c.245	CCDS12202.1	19	.	.	.	.	.	.	.	.	.	.	g	14.43	2.534429	0.45073	.	.	ENSG00000099785	ENST00000393944;ENST00000215555;ENST00000381035	D;D;D	0.86030	-2.06;-2.06;-2.06	5.41	5.41	0.78517	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-CH-type (2);	0.000000	0.85682	D	0.000000	D	0.91703	0.7377	H	0.97707	4.06	0.80722	D	1	P;P	0.46142	0.873;0.722	B;B	0.42625	0.356;0.393	D	0.94442	0.7659	10	0.87932	D	0	-14.9653	17.8494	0.88740	0.0:0.0:1.0:0.0	.	82;82	Q9P0N8-2;Q9P0N8	.;MARH2_HUMAN	S	82	ENSP00000377518:C82S;ENSP00000215555:C82S;ENSP00000370423:C82S	ENSP00000215555:C82S	C	+	2	0	MARCH2	8397561	1.000000	0.71417	0.823000	0.32752	0.155000	0.21991	9.623000	0.98386	2.562000	0.86427	0.574000	0.79327	TGC	-	NULL		0.582	MARCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH2	protein_coding	OTTHUMT00000460361.2	G	NM_016496		8397561	1	no_errors	NM_001005415	genbank	human	validated	54_36p	missense	SNP	1	C
IZUMO1	284359	genome.wustl.edu	37	19	49245071	49245071	+	Silent	SNP	G	G	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr19:49245071G>C	ENST00000332955.2	-	8	1276	c.729C>G	c.(727-729)gcC>gcG	p.A243A	RASIP1_ENST00000222145.4_5'Flank	NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	243	Ig-like C2-type.				cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.A243A(1)		endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		TGATGATCGTGGCTGGGCTGG	0.622																																																1	Substitution - coding silent(1)	ovary(1)	19											44.0	44.0	44.0					19																	49245071		2203	4300	6503	53936883	SO:0001819	synonymous_variant	284359			BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.729C>G	19.37:g.49245071G>C		Somatic		Capture	Illumina GAIIx	Phase_III	53936883	Q6Q8P6|Q6Q8P7	Silent	SNP	-	p.A243	ENST00000332955.2	37	c.729	CCDS12732.1	19																																																																																			-	NULL		0.622	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IZUMO1	protein_coding	OTTHUMT00000466189.1	G	NM_182575		53936883	-1	no_errors	NM_182575	genbank	human	validated	54_36p	silent	SNP	0.547	C
GLI2	2736	genome.wustl.edu	37	2	121748046	121748046	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:121748046G>A	ENST00000452319.1	+	14	4616	c.4556G>A	c.(4555-4557)gGc>gAc	p.G1519D	GLI2_ENST00000361492.4_Missense_Mutation_p.G1519D|GLI2_ENST00000314490.11_Intron					GLI family zinc finger 2									p.G1519D(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				ATGGATGATGGCGATCACTCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	2											118.0	130.0	126.0					2																	121748046		2203	4300	6503	121464516	SO:0001583	missense	2736				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.4556G>A	2.37:g.121748046G>A	ENSP00000390436:p.Gly1519Asp	Somatic		Capture	Illumina GAIIx	4	121464516		Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_Kazal-type serine protease inhibitors;superfamily_C2H2 and C2HC zinc fingers	p.G1519D	ENST00000452319.1	37	c.4556	CCDS33283.1	2	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772452	0.90108	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.24151	1.87;1.87	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.51024	0.1650	M	0.77313	2.365	0.80722	D	1	D;D	0.64830	0.99;0.994	P;P	0.60886	0.762;0.88	T	0.56727	-0.7931	10	0.87932	D	0	.	18.4555	0.90718	0.0:0.0:1.0:0.0	.	1519;1174	P10070;P10070-2	GLI2_HUMAN;.	D	1519	ENSP00000390436:G1519D;ENSP00000354586:G1519D	ENSP00000354586:G1519D	G	+	2	0	GLI2	121464516	1.000000	0.71417	0.671000	0.29857	0.989000	0.77384	9.657000	0.98554	2.581000	0.87130	0.555000	0.69702	GGC	-	NULL		0.622	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	protein_coding	OTTHUMT00000332293.3	G	NM_005270		121464516	1	no_errors	NM_005270	genbank	human	reviewed	54_36p	missense	SNP	1	A
ARL6IP6	151188	genome.wustl.edu	37	2	153572550	153572550	+	5'Flank	SNP	G	G	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:153572550G>C	ENST00000326446.5	+	0	0				PRPF40A_ENST00000410080.1_Missense_Mutation_p.P59A|PRPF40A_ENST00000486100.1_5'UTR	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6							integral component of membrane (GO:0016021)		p.P86A(1)		kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						ATCATCTGCGGCATCATTCCA	0.458																																																1	Substitution - Missense(1)	ovary(1)	2											146.0	142.0	143.0					2																	153572550		1914	4119	6033	153280796	SO:0001631	upstream_gene_variant	55660			AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901		2.37:g.153572550G>C	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	153280796	B2RDS6|Q7Z4G7	Missense_Mutation	SNP	-	p.P59A	ENST00000326446.5	37	c.175	CCDS2197.1	2	.	.	.	.	.	.	.	.	.	.	G	15.67	2.902269	0.52227	.	.	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000359961;ENST00000545856;ENST00000493468;ENST00000448428	T	0.43294	0.95	5.17	5.17	0.71159	.	0.049207	0.85682	D	0.000000	T	0.32734	0.0839	L	0.36672	1.1	0.58432	D	0.999995	B;B;B	0.25667	0.07;0.114;0.131	B;B;B	0.24394	0.016;0.053;0.039	T	0.11275	-1.0594	10	0.40728	T	0.16	-10.3854	11.0054	0.47631	0.0876:0.0:0.9124:0.0	.	86;86;59	O75400;O75400-3;E9PFS0	PR40A_HUMAN;.;.	A	59;86;59;86;79;65	ENSP00000386458:P59A	ENSP00000348770:P86A	P	-	1	0	PRPF40A	153280796	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.960000	0.70348	2.411000	0.81874	0.462000	0.41574	CCG	-	NULL		0.458	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF40A	protein_coding	OTTHUMT00000254852.3	G	NM_152522		153280796	-1	no_errors	NM_017892	genbank	human	validated	54_36p	missense	SNP	1	C
LRP2	4036	genome.wustl.edu	37	2	170034522	170034522	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	C	T	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:170034522T>C	ENST00000263816.3	-	53	10469	c.10184A>G	c.(10183-10185)gAg>gGg	p.E3395G	LRP2_ENST00000461418.1_5'UTR	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3395					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.E3395G(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ATGGTGGCCCTCCAAATCAGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											82.0	72.0	75.0					2																	170034522		2203	4300	6503	169742768	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.10184A>G	2.37:g.170034522T>C	ENSP00000263816:p.Glu3395Gly	Somatic		Capture	Illumina GAIIx	Phase_III	169742768	O00711|Q16215	Missense_Mutation	SNP	HMMPfam_Ldl_recept_b;HMMPfam_Ldl_recept_a;HMMPfam_EGF;superfamily_Growth factor receptor domain;HMMPfam_EGF_CA;HMMPfam_EGF_2;superfamily_EGF/Laminin;superfamily_LDL receptor-like module;superfamily_YWTD domain	p.E3395G	ENST00000263816.3	37	c.10184	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	T	19.63	3.863371	0.71949	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.96104	-3.91	5.88	5.88	0.94601	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.048433	0.85682	D	0.000000	D	0.96383	0.8820	L	0.59912	1.85	0.80722	D	1	D	0.56746	0.977	P	0.57152	0.814	D	0.96731	0.9539	10	0.72032	D	0.01	.	16.2881	0.82732	0.0:0.0:0.0:1.0	.	3395	P98164	LRP2_HUMAN	G	3395;90	ENSP00000263816:E3395G	ENSP00000263816:E3395G	E	-	2	0	LRP2	169742768	1.000000	0.71417	1.000000	0.80357	0.209000	0.24338	8.036000	0.88901	2.227000	0.72691	0.528000	0.53228	GAG	-	HMMPfam_Ldl_recept_b		0.418	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	T	NM_004525		169742768	-1	no_errors	NM_004525	genbank	human	validated	54_36p	missense	SNP	1	C
TTN	7273	genome.wustl.edu	37	2	179642016	179642016	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:179642016A>C	ENST00000591111.1	-	27	4898	c.4674T>G	c.(4672-4674)ttT>ttG	p.F1558L	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.F1512L|TTN_ENST00000360870.5_Missense_Mutation_p.F1558L|TTN_ENST00000342992.6_Missense_Mutation_p.F1558L|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.F1512L|TTN_ENST00000342175.6_Missense_Mutation_p.F1512L|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.F1558L			Q8WZ42	TITIN_HUMAN	titin	12415	Ig-like 7.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.F1558L(2)|p.F1512L(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTTTTCTACAAACATCGGTT	0.383																																																3	Substitution - Missense(3)	ovary(3)	2											105.0	99.0	101.0					2																	179642016		2203	4300	6503	179350261	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.4674T>G	2.37:g.179642016A>C	ENSP00000465570:p.Phe1558Leu	Somatic		Capture	Illumina GAIIx	Phase_III	179350261	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	-	p.F1558L	ENST00000591111.1	37	c.4674		2	.	.	.	.	.	.	.	.	.	.	A	10.88	1.476351	0.26511	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57;-0.57	5.9	3.53	0.40419	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80025	0.4548	M	0.83118	2.625	0.26888	N	0.967395	P;P;P;P;D	0.57571	0.63;0.63;0.63;0.76;0.98	B;B;B;B;P	0.54856	0.273;0.273;0.273;0.273;0.762	T	0.71649	-0.4529	9	0.87932	D	0	.	10.1519	0.42799	0.8652:0.0:0.1348:0.0	.	1512;1512;1512;1558;1558	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	L	1558;1512;1512;1512;1512;1558	ENSP00000343764:F1558L;ENSP00000434586:F1512L;ENSP00000340554:F1512L;ENSP00000352154:F1512L;ENSP00000354117:F1558L	ENSP00000340554:F1512L	F	-	3	2	TTN	179350261	1.000000	0.71417	0.997000	0.53966	0.906000	0.53458	2.524000	0.45589	0.496000	0.27904	0.528000	0.53228	TTT	-	NULL		0.383	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179350261	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	missense	SNP	1	C
UBE2E3	10477	genome.wustl.edu	37	2	181846835	181846835	+	Silent	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:181846835G>T	ENST00000410062.4	+	2	459	c.66G>T	c.(64-66)gcG>gcT	p.A22A	AC104076.3_ENST00000428080.1_RNA|UBE2E3_ENST00000392415.2_Silent_p.A22A|UBE2E3_ENST00000602710.1_Silent_p.A22A|UBE2E3_ENST00000602475.1_Silent_p.A22A|UBE2E3_ENST00000602632.1_Silent_p.A22A|UBE2E3_ENST00000602959.1_Silent_p.A22A	NM_006357.2	NP_006348.1	Q969T4	UB2E3_HUMAN	ubiquitin-conjugating enzyme E2E 3	22					protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.A22A(1)		breast(2)|endometrium(3)|lung(4)|ovary(1)|skin(1)	11						GTTCAGATGCGGACCAGCGAG	0.493																																																1	Substitution - coding silent(1)	ovary(1)	2											34.0	42.0	39.0					2																	181846835		2202	4279	6481	181555080	SO:0001819	synonymous_variant	10477			AB017644	CCDS2282.1	2q31.3	2011-05-19	2011-05-19		ENSG00000170035	ENSG00000170035		"""Ubiquitin-conjugating enzymes E2"""	12479	protein-coding gene	gene with protein product		604151	"""ubiquitin-conjugating enzyme E2E 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast)"""			10343118	Standard	NM_006357		Approved	UbcH9	uc002unq.1	Q969T4	OTTHUMG00000132585	ENST00000410062.4:c.66G>T	2.37:g.181846835G>T		Somatic		Capture	Illumina GAIIx	4	181555080	B2RAD6|D3DPG3|Q5U0R7|Q7Z4W4	Silent	SNP	HMMPfam_UQ_con;superfamily_UBC-like	p.A22	ENST00000410062.4	37	c.66	CCDS2282.1	2																																																																																			-	NULL		0.493	UBE2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2E3	protein_coding	OTTHUMT00000255795.6	G	NM_006357		181555080	1	no_errors	NM_006357	genbank	human	reviewed	54_36p	silent	SNP	0.66	T
PIKFYVE	200576	genome.wustl.edu	37	2	209201629	209201629	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:209201629C>G	ENST00000264380.4	+	28	4746	c.4588C>G	c.(4588-4590)Ctg>Gtg	p.L1530V		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1530					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.L1530V(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						TCCTGGAAGACTGAGACAAGG	0.368																																																1	Substitution - Missense(1)	ovary(1)	2											71.0	76.0	74.0					2																	209201629		2203	4300	6503	208909874	SO:0001583	missense	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.4588C>G	2.37:g.209201629C>G	ENSP00000264380:p.Leu1530Val	Somatic		Capture	Illumina GAIIx	4	208909874	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	"HMMPfam_FYVE;HMMPfam_DEP;HMMPfam_Cpn60_TCP1;HMMPfam_PIP5K;superfamily_FYVE/PHD zinc finger;superfamily_""Winged helix"" DNA-binding domain;superfamily_Spectrin repeat;superfamily_GroEL apical domain-like;superfamily_GroEL-intermediate domain like;superfamily_SAICAR synthase-like"	p.L1530V	ENST00000264380.4	37	c.4588	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	C	7.397	0.631891	0.14322	.	.	ENSG00000115020	ENST00000264380	T	0.27890	1.64	5.67	3.64	0.41730	.	0.234296	0.37393	N	0.002116	T	0.17704	0.0425	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04855	-1.0922	10	0.28530	T	0.3	-3.4948	11.6158	0.51090	0.2254:0.6655:0.1092:0.0	.	1530	Q9Y2I7	FYV1_HUMAN	V	1530	ENSP00000264380:L1530V	ENSP00000264380:L1530V	L	+	1	2	PIKFYVE	208909874	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.213000	0.32407	1.363000	0.46019	0.655000	0.94253	CTG	-	NULL		0.368	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP5K3	protein_coding	OTTHUMT00000256477.2	C	NM_015040		208909874	1	no_errors	NM_015040	genbank	human	validated	54_36p	missense	SNP	1	G
AAMP	14	genome.wustl.edu	37	2	219130790	219130790	+	Nonsense_Mutation	SNP	T	T	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:219130790T>A	ENST00000248450.4	-	6	930	c.760A>T	c.(760-762)Aaa>Taa	p.K254*	AAMP_ENST00000420660.1_Nonsense_Mutation_p.K235*|AAMP_ENST00000444053.1_Nonsense_Mutation_p.K255*			Q13685	AAMP_HUMAN	angio-associated, migratory cell protein	254					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|positive regulation of endothelial cell migration (GO:0010595)|smooth muscle cell migration (GO:0014909)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)	p.K254*(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(4)|ovary(2)|skin(1)	11		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGATACCTTTCAGTACATGG	0.557																																																1	Substitution - Nonsense(1)	ovary(1)	2											123.0	107.0	113.0					2																	219130790		2203	4300	6503	218839034	SO:0001587	stop_gained	14			AB209790	CCDS33378.1	2q	2013-01-10			ENSG00000127837	ENSG00000127837		"""WD repeat domain containing"""	18	protein-coding gene	gene with protein product		603488				7743515	Standard	XM_005246325		Approved		uc002vhk.3	Q13685	OTTHUMG00000155202	ENST00000248450.4:c.760A>T	2.37:g.219130790T>A	ENSP00000248450:p.Lys254*	Somatic		Capture	Illumina GAIIx	4	218839034	Q8WUJ9|Q96H92	Nonsense_Mutation	SNP	-	p.K254*	ENST00000248450.4	37	c.760	CCDS33378.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.9|28.9	4.963396|4.963396	0.92791|0.92791	.|.	.|.	ENSG00000127837|ENSG00000127837	ENST00000248450;ENST00000444053;ENST00000420660|ENST00000422731	.|.	.|.	.|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	.|.	12.1182|12.1182	0.53878|0.53878	0.0:0.0:0.1428:0.8572|0.0:0.0:0.1428:0.8572	.|.	.|.	.|.	.|.	X|C	254;255;235|5	.|.	ENSP00000248450:K254X|.	K|X	-|-	1|3	0|0	AAMP|AAMP	218839034|218839034	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.972000|0.972000	0.66771|0.66771	5.319000|5.319000	0.65835|0.65835	2.281000|2.281000	0.76405|0.76405	0.528000|0.528000	0.53228|0.53228	AAA|TGA	-	NULL		0.557	AAMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AAMP	protein_coding	OTTHUMT00000338756.1	T	NM_001087		218839034	-1	no_errors	NM_001087	genbank	human	reviewed	54_36p	nonsense	SNP	0.99	A
EML4	27436	genome.wustl.edu	37	2	42522282	42522282	+	Silent	SNP	T	T	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:42522282T>A	ENST00000318522.5	+	12	1498	c.1236T>A	c.(1234-1236)gtT>gtA	p.V412V	EML4_ENST00000401738.3_Silent_p.V423V|EML4_ENST00000402711.2_Silent_p.V354V	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	412					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)		p.V412V(1)	EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						ATGAAGTTGTTTTGGCTGTGG	0.348			T	ALK	NSCLC																																		Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	1	Substitution - coding silent(1)	ovary(1)	2											111.0	107.0	108.0					2																	42522282		2203	4300	6503	42375786	SO:0001819	synonymous_variant	27436			AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.1236T>A	2.37:g.42522282T>A		Somatic		Capture	Illumina GAIIx	4	42375786	A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Silent	SNP	HMMPfam_WD40;HMMPfam_HELP;superfamily_WD40 repeat-like	p.V412	ENST00000318522.5	37	c.1236	CCDS1807.1	2																																																																																			-	NULL		0.348	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EML4	protein_coding	OTTHUMT00000250463.3	T	NM_019063		42375786	1	no_errors	NM_019063	genbank	human	validated	54_36p	silent	SNP	0.99	A
MSH2	4436	genome.wustl.edu	37	2	47657031	47657031	+	Silent	SNP	G	G	A	rs63750086		TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:47657031G>A	ENST00000233146.2	+	7	1450	c.1227G>A	c.(1225-1227)caG>caA	p.Q409Q	MSH2_ENST00000406134.1_Silent_p.Q409Q|MSH2_ENST00000543555.1_Silent_p.Q343Q	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	409					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(2)|p.Q409Q(1)|p.Q409H(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GACTCTATCAGGGTATAAATC	0.348			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	6	Whole gene deletion(2)|Unknown(2)|Substitution - Missense(1)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(1)|ovary(1)	2											76.0	70.0	72.0					2																	47657031		2203	4300	6503	47510535	SO:0001819	synonymous_variant	4436	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.1227G>A	2.37:g.47657031G>A		Somatic		Capture	Illumina GAIIx	4	47510535	B4E2Z2|O75488	Silent	SNP	HMMPfam_MutS_I;MutS_III;HMMPfam_MutS_III;MutS_II;HMMPfam_MutS_II;MutS_IV;HMMPfam_MutS_IV;DNA repair protein MutS domain III;superfamily_DNA repair protein MutS domain III;P-loop containing nucleoside triphosphate hydrolases;superfamily_P-loop containing nucleoside triphosphate hydrolases;DNA repair protein MutS domain II;superfamily_DNA repair protein MutS domain II;MutS_V;HMMPfam_MutS_V;MutS_I	p.Q409	ENST00000233146.2	37	c.1227	CCDS1834.1	2	.	.	.	.	.	.	.	.	.	.	g	8.637	0.895125	0.17613	.	.	ENSG00000095002	ENST00000448533	.	.	.	5.45	4.37	0.52481	.	.	.	.	.	T	0.69133	0.3077	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67825	-0.5570	5	0.39692	T	0.17	-3.3463	14.0859	0.64957	0.1286:0.0:0.8714:0.0	.	.	.	.	K	409	.	ENSP00000415023:R409K	R	+	2	0	MSH2	47510535	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.772000	0.47678	2.571000	0.86741	0.651000	0.88453	AGG	-	HMMPfam_MutS_III		0.348	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH2	protein_coding	OTTHUMT00000250805.3	G			47510535	1	no_errors	NM_000251	genbank	human	reviewed	54_36p	silent	SNP	1	A
RTN4	57142	genome.wustl.edu	37	2	55214836	55214836	+	Splice_Site	SNP	T	T	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:55214836T>C	ENST00000337526.6	-	4	3257		c.e4-2		RTN4_ENST00000394609.2_Splice_Site|RTN4_ENST00000404909.1_Splice_Site|RTN4_ENST00000354474.6_Splice_Site|RTN4_ENST00000394611.2_Splice_Site|RTN4_ENST00000402434.2_Splice_Site|RTN4_ENST00000317610.7_Splice_Site|RTN4_ENST00000357376.3_Splice_Site|RTN4_ENST00000405240.1_Splice_Site|RTN4_ENST00000486085.1_5'Flank|RTN4_ENST00000357732.4_Splice_Site	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.?(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						GGTCAACAACTAAAAATTGAA	0.343																																																1	Unknown(1)	ovary(1)	2											36.0	34.0	35.0					2																	55214836		2203	4300	6503	55068340	SO:0001630	splice_region_variant	57142			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.3014-2A>G	2.37:g.55214836T>C		Somatic		Capture	Illumina GAIIx	4	55068340	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Splice_Site	SNP	-	e4-2	ENST00000337526.6	37	c.3014-2	CCDS42684.1	2	.	.	.	.	.	.	.	.	.	.	T	17.32	3.360116	0.61403	.	.	ENSG00000115310	ENST00000394609;ENST00000405240;ENST00000357376;ENST00000337526;ENST00000317610;ENST00000357732;ENST00000394611;ENST00000404909;ENST00000402434;ENST00000354474;ENST00000438462	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0979	0.72250	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RTN4	55068340	1.000000	0.71417	0.969000	0.41365	0.938000	0.57974	7.782000	0.85680	2.014000	0.59158	0.528000	0.53228	.	-	-		0.343	RTN4-001	KNOWN	basic|CCDS	protein_coding	RTN4	protein_coding	OTTHUMT00000251484.1	T		Intron	55068340	-1	no_errors	NM_020532	genbank	human	reviewed	54_36p	splice_site	SNP	1	C
COL4A4	1286	genome.wustl.edu	37	2	227924933	227924933	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr2:227924933C>A	ENST00000396625.3	-	27	2290	c.2083G>T	c.(2083-2085)Ggt>Tgt	p.G695C	COL4A4_ENST00000329662.7_Missense_Mutation_p.G695C	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	695	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.G695C(1)		breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CCAGGGGCACCTTGGGGACCT	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											83.0	84.0	84.0					2																	227924933		1846	4095	5941	227633177	SO:0001583	missense	1286				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2083G>T	2.37:g.227924933C>A	ENSP00000379866:p.Gly695Cys	Somatic		Capture	Illumina GAIIx	4	227633177	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	HMMPfam_Collagen;superfamily_C-type lectin-like;HMMPfam_C4	p.G695C	ENST00000396625.3	37	c.2083	CCDS42828.1	2	.	.	.	.	.	.	.	.	.	.	C	13.90	2.374055	0.42105	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.99369	-5.78;-5.78	5.75	4.84	0.62591	.	.	.	.	.	D	0.99566	0.9844	H	0.95402	3.665	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.97907	1.0306	9	0.87932	D	0	.	14.2258	0.65858	0.1485:0.8515:0.0:0.0	.	695	P53420	CO4A4_HUMAN	C	695	ENSP00000379866:G695C;ENSP00000328553:G695C	ENSP00000328553:G695C	G	-	1	0	COL4A4	227633177	0.982000	0.34865	0.192000	0.23308	0.014000	0.08584	3.849000	0.55910	2.725000	0.93324	0.655000	0.94253	GGT	-	HMMPfam_Collagen		0.433	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	protein_coding	OTTHUMT00000313770.1	C	NM_000092		227633177	-1	no_errors	NM_000092	genbank	human	reviewed	54_36p	missense	SNP	0.38	A
RPN2	6185	genome.wustl.edu	37	20	35862446	35862446	+	Silent	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr20:35862446C>T	ENST00000237530.6	+	15	2012	c.1701C>T	c.(1699-1701)gtC>gtT	p.V567V	RPN2_ENST00000470352.1_3'UTR|RPN2_ENST00000373622.5_Silent_p.V535V	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	567					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)	p.V567V(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				GTGCCAATGTCTCCAACTTCA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	20											175.0	147.0	156.0					20																	35862446		2203	4300	6503	35295860	SO:0001819	synonymous_variant	6185			Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.1701C>T	20.37:g.35862446C>T		Somatic		Capture	Illumina GAIIx	4	35295860	Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Silent	SNP	HMMPfam_Ribophorin_II	p.V567	ENST00000237530.6	37	c.1701	CCDS13291.1	20	.	.	.	.	.	.	.	.	.	.	C	8.721	0.914257	0.17907	.	.	ENSG00000118705	ENST00000456400	.	.	.	5.27	3.22	0.36961	.	.	.	.	.	T	0.53222	0.1783	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49485	-0.8935	4	.	.	.	-7.0535	5.5011	0.16829	0.0:0.698:0.0:0.302	.	.	.	.	F	92	.	.	L	+	1	0	RPN2	35295860	0.995000	0.38212	1.000000	0.80357	0.995000	0.86356	0.386000	0.20702	1.453000	0.47775	0.655000	0.94253	CTC	-	HMMPfam_Ribophorin_II		0.433	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPN2	protein_coding	OTTHUMT00000079076.2	C	NM_002951		35295860	1	no_errors	NM_002951	genbank	human	reviewed	54_36p	silent	SNP	1	T
GABPA	2551	genome.wustl.edu	37	21	27121414	27121414	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr21:27121414A>C	ENST00000354828.3	+	4	817	c.290A>C	c.(289-291)cAg>cCg	p.Q97P	GABPA_ENST00000487266.1_3'UTR|GABPA_ENST00000400075.3_Missense_Mutation_p.Q97P	NM_001197297.1	NP_001184226.1	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha subunit 60kDa	97					cell differentiation (GO:0030154)|in utero embryonic development (GO:0001701)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.Q97P(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	24						CTTAGTGTACAGGTAATTTCT	0.303																																																1	Substitution - Missense(1)	ovary(1)	21											72.0	68.0	69.0					21																	27121414		2203	4298	6501	26043285	SO:0001583	missense	2551				CCDS13575.1	21q21-q22.1	2008-07-31	2002-08-29		ENSG00000154727	ENSG00000154727			4071	protein-coding gene	gene with protein product	"""human nuclear respiratory factor-2 subunit alpha"", ""nuclear respiratory factor 2 alpha subunit"""	600609	"""GA-binding protein transcription factor, alpha subunit (60kD)"""			8441384	Standard	NM_002040		Approved	E4TF1A, NFT2, NRF2, E4TF1-60, NRF2A	uc002yly.4	Q06546	OTTHUMG00000078443	ENST00000354828.3:c.290A>C	21.37:g.27121414A>C	ENSP00000346886:p.Gln97Pro	Somatic		Capture	Illumina GAIIx	4	26043285	Q12939	Missense_Mutation	SNP	-	p.Q97P	ENST00000354828.3	37	c.290	CCDS13575.1	21	.	.	.	.	.	.	.	.	.	.	A	20.4	3.977484	0.74360	.	.	ENSG00000154727	ENST00000354828;ENST00000400075	T;T	0.18174	2.23;2.23	4.73	4.73	0.59995	GA-binding protein alpha subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.40886	0.1135	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.35101	-0.9802	10	0.87932	D	0	.	14.3334	0.66572	1.0:0.0:0.0:0.0	.	97	Q06546	GABPA_HUMAN	P	97	ENSP00000346886:Q97P;ENSP00000382948:Q97P	ENSP00000346886:Q97P	Q	+	2	0	GABPA	26043285	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.140000	0.89616	2.107000	0.64212	0.445000	0.29226	CAG	-	NULL		0.303	GABPA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GABPA	protein_coding	OTTHUMT00000171365.1	A	NM_002040		26043285	1	no_errors	NM_002040	genbank	human	validated	54_36p	missense	SNP	1	C
ETS2	2114	genome.wustl.edu	37	21	40191681	40191681	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr21:40191681G>T	ENST00000360214.3	+	9	1526	c.1066G>T	c.(1066-1068)Ggc>Tgc	p.G356C	ETS2_ENST00000360938.3_Missense_Mutation_p.G356C	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	356					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G356C(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				TGTGCTGGCCGGCTTCACAGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	21											36.0	30.0	32.0					21																	40191681		2203	4300	6503	39113551	SO:0001583	missense	2114				CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.1066G>T	21.37:g.40191681G>T	ENSP00000353344:p.Gly356Cys	Somatic		Capture	Illumina GAIIx	4	39113551	A6NM68|D3DSH6|Q53Y89	Missense_Mutation	SNP	"HMMPfam_Ets;HMMPfam_SAM_PNT;superfamily_SAM/Pointed domain;superfamily_""Winged helix"" DNA-binding domain"	p.G356C	ENST00000360214.3	37	c.1066	CCDS13659.1	21	.	.	.	.	.	.	.	.	.	.	G	27.7	4.851390	0.91355	.	.	ENSG00000157557	ENST00000360214;ENST00000360938	T;T	0.14391	2.51;2.51	5.9	5.9	0.94986	Winged helix-turn-helix transcription repressor DNA-binding (1);	.	.	.	.	T	0.32556	0.0833	M	0.76328	2.33	0.80722	D	1	P	0.51147	0.942	P	0.51385	0.668	T	0.02015	-1.1229	9	0.87932	D	0	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	356	P15036	ETS2_HUMAN	C	356	ENSP00000353344:G356C;ENSP00000354194:G356C	ENSP00000353344:G356C	G	+	1	0	ETS2	39113551	1.000000	0.71417	0.989000	0.46669	0.711000	0.40976	7.427000	0.80284	2.788000	0.95919	0.650000	0.86243	GGC	-	NULL		0.562	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETS2	protein_coding	OTTHUMT00000207544.1	G			39113551	1	no_errors	NM_005239	genbank	human	validated	54_36p	missense	SNP	1	T
RAB3GAP2	25782	genome.wustl.edu	37	1	220373999	220373999	+	Intron	SNP	C	C	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr1:220373999C>G	ENST00000358951.2	-	9	928				SNORA36B_ENST00000410438.1_RNA	NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)						establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CTACCCTGAACTGAACTTAAC	0.338																																																0			1											43.0	39.0	40.0					1																	220373999		1567	3580	5147	218440622	SO:0001627	intron_variant	677818			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.811+1618G>C	1.37:g.220373999C>G		Somatic		Capture	Illumina GAIIx	4	218440622	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	RNA	SNP	-	NULL	ENST00000358951.2	37	NULL	CCDS31028.1	1																																																																																			-	-		0.338	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA36B	protein_coding	OTTHUMT00000090205.2	C	NM_012414		218440622	1	no_errors	NR_002994	genbank	human	provisional	54_36p	rna	SNP	1	G
PI4KAP1	728233	genome.wustl.edu	37	22	20385740	20385743	+	RNA	DEL	TGTC	TGTC	-	rs2308063|rs146242498|rs113528696	byFrequency	TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	TGTC	TGTC	TGTC	-	TGTC	TGTC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr22:20385740_20385743delTGTC	ENST00000430523.3	-	0	2068_2071					NR_003563.1		Q8N8J0	PI4P1_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 1						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)												AGAACTTGATTGTCTGGCCGCGAA	0.559														3239	0.646765	0.7133	0.6614	5008	,	,		14171	0.5645		0.7147	False		,,,				2504	0.5613															0			22																																								18765743			728233					22q11.21	2007-08-14	2007-08-14			ENSG00000274602			33576	pseudogene	pseudogene							Standard	NR_003563		Approved		uc010gsg.2	Q8N8J0			22.37:g.20385740_20385743delTGTC		Somatic		Capture	Illumina GAIIx	Phase_III	18765740		RNA	DEL	-	NULL	ENST00000430523.3	37	NULL		22																																																																																			(deletion:rna[18765726,18765815])	-		0.559	PI4KAP1-005	KNOWN	basic	processed_transcript	PI4KAP1	pseudogene	OTTHUMT00000319534.5	TGTC			18765743	-1	pseudogene	NR_003563	genbank	human	provisional	54_36p	rna	DEL	1.000:1.000:1.000:1.000	-
FBLN2	2199	genome.wustl.edu	37	3	13679166	13679166	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr3:13679166C>A	ENST00000295760.7	+	17	3371	c.3302C>A	c.(3301-3303)gCg>gAg	p.A1101E	FBLN2_ENST00000535798.1_Missense_Mutation_p.A1127E|FBLN2_ENST00000404922.3_Missense_Mutation_p.A1148E|FBLN2_ENST00000492059.1_Missense_Mutation_p.A1148E	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	1101	Domain III.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)	p.A567E(1)|p.A1148E(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CTGGTGCCTGCGCATATCTTC	0.632																																																2	Substitution - Missense(2)	ovary(2)	3											46.0	50.0	49.0					3																	13679166		2175	4273	6448	13654167	SO:0001583	missense	2199			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.3302C>A	3.37:g.13679166C>A	ENSP00000295760:p.Ala1101Glu	Somatic		Capture	Illumina GAIIx	4	13654167	B7Z9C5|Q8IUI0|Q8IUI1	Nonsense_Mutation	SNP	-	p.C1148*	ENST00000295760.7	37	c.3444	CCDS46762.1	3	.	.	.	.	.	.	.	.	.	.	C	20.2	3.941483	0.73557	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	T;T;T;T	0.78816	-1.21;-1.21;-1.12;-1.21	4.73	4.73	0.59995	.	0.057560	0.64402	D	0.000001	D	0.86518	0.5952	M	0.78049	2.395	0.80722	D	1	D;D;D	0.67145	0.988;0.996;0.977	D;D;P	0.64144	0.914;0.922;0.838	D	0.84597	0.0670	10	0.25106	T	0.35	.	17.9076	0.88923	0.0:1.0:0.0:0.0	.	1101;1148;1127	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	E	1127;1148;1101;1148	ENSP00000445705:A1127E;ENSP00000384169:A1148E;ENSP00000295760:A1101E;ENSP00000420042:A1148E	ENSP00000295760:A1101E	A	+	2	0	FBLN2	13654167	1.000000	0.71417	0.018000	0.16275	0.589000	0.36550	4.745000	0.62125	2.456000	0.83038	0.563000	0.77884	GCG	-	NULL		0.632	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	protein_coding	OTTHUMT00000340083.3	C	NM_001004019		13654167	1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_001004019	genbank	human	reviewed	54_36p	nonsense	SNP	0.99	A
C3orf58	205428	genome.wustl.edu	37	3	143704415	143704415	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr3:143704415G>C	ENST00000315691.3	+	2	1223	c.688G>C	c.(688-690)Gca>Cca	p.A230P	C3orf58_ENST00000493396.1_Intron|C3orf58_ENST00000495414.1_Missense_Mutation_p.A21P|C3orf58_ENST00000441925.2_5'UTR	NM_173552.3	NP_775823.1	Q8NDZ4	DIA1_HUMAN	chromosome 3 open reading frame 58	230					cardiac muscle cell proliferation (GO:0060038)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	COPI vesicle coat (GO:0030126)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)		p.A230P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTGGCCATTTGCAAAGTATCT	0.383																																																1	Substitution - Missense(1)	ovary(1)	3											148.0	147.0	147.0					3																	143704415		2203	4300	6503	145187105	SO:0001583	missense	205428			AK095161	CCDS3130.1, CCDS46929.1	3q24	2013-12-06			ENSG00000181744	ENSG00000181744			28490	protein-coding gene	gene with protein product	"""deleted in autism 1"", ""hypoxia and Akt induced stem cell factor"""	612200				21283809, 23784961, 24269490	Standard	NM_173552		Approved	MGC33365, DIA1, HASF	uc003evo.3	Q8NDZ4	OTTHUMG00000159380	ENST00000315691.3:c.688G>C	3.37:g.143704415G>C	ENSP00000320081:p.Ala230Pro	Somatic		Capture	Illumina GAIIx	4	145187105	B2RCF2|B7Z1W3	Missense_Mutation	SNP	-	p.A230P	ENST00000315691.3	37	c.688	CCDS3130.1	3	.	.	.	.	.	.	.	.	.	.	G	7.593	0.671182	0.14776	.	.	ENSG00000181744	ENST00000315691;ENST00000495414;ENST00000492452	T	0.15718	2.4	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.08846	0.0219	N	0.03281	-0.365	0.80722	D	1	B;B	0.23128	0.003;0.08	B;B	0.29440	0.001;0.102	T	0.11567	-1.0582	10	0.02654	T	1	.	18.8382	0.92171	0.0:0.0:1.0:0.0	.	21;230	B7Z1W3;Q8NDZ4	.;CC058_HUMAN	P	230;21;36	ENSP00000320081:A230P	ENSP00000320081:A230P	A	+	1	0	C3orf58	145187105	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.461000	0.83175	0.655000	0.94253	GCA	-	NULL		0.383	C3orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf58	protein_coding	OTTHUMT00000355038.1	G	NM_173552		145187105	1	no_errors	NM_173552	genbank	human	validated	54_36p	missense	SNP	1	C
ITPR1	3708	genome.wustl.edu	37	3	4816925	4816925	+	Splice_Site	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr3:4816925G>T	ENST00000443694.2	+	44	5934		c.e44-1		ITPR1_ENST00000357086.4_Splice_Site|ITPR1_ENST00000456211.2_Splice_Site|ITPR1_ENST00000423119.2_Splice_Site|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Splice_Site|ITPR1_ENST00000302640.8_Splice_Site			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1						activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.?(2)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CCCAATTGCAGAACTTCCTCC	0.463																																																2	Unknown(2)	ovary(1)|kidney(1)	3											130.0	129.0	129.0					3																	4816925		1936	4151	6087	4791925	SO:0001630	splice_region_variant	3708			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.5935-1G>T	3.37:g.4816925G>T		Somatic		Capture	Illumina GAIIx	4	4791925	E7EPX7|E9PDE9|Q14660|Q99897	Splice_Site	SNP	-	e42-1	ENST00000443694.2	37	c.5836-1	CCDS54551.1	3	.	.	.	.	.	.	.	.	.	.	G	22.7	4.321952	0.81580	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2136	0.89878	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITPR1	4791925	1.000000	0.71417	0.999000	0.59377	0.902000	0.53008	9.787000	0.99055	2.301000	0.77427	0.591000	0.81541	.	-	-		0.463	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	protein_coding	OTTHUMT00000337982.3	G	NM_002222	Intron	4791925	1	no_errors	NM_001099952	genbank	human	validated	54_36p	splice_site	SNP	1	T
PRICKLE2	166336	genome.wustl.edu	37	3	64085392	64085392	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr3:64085392G>T	ENST00000295902.6	-	8	2455	c.1870C>A	c.(1870-1872)Ctc>Atc	p.L624I	PRICKLE2-AS1_ENST00000460946.1_RNA|PRICKLE2_ENST00000564377.1_Missense_Mutation_p.L680I|PRICKLE2-AS1_ENST00000476308.1_RNA|RP11-129B22.1_ENST00000482609.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	624					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.L624I(1)		breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GGGTTGCTGAGCTGGTGGAGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	3											114.0	105.0	108.0					3																	64085392		2203	4300	6503	64060432	SO:0001583	missense	166336			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.1870C>A	3.37:g.64085392G>T	ENSP00000295902:p.Leu624Ile	Somatic		Capture	Illumina GAIIx	4	64060432	Q0VF44	Missense_Mutation	SNP	-	p.L624I	ENST00000295902.6	37	c.1870	CCDS2902.1	3	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175496	0.38413	.	.	ENSG00000163637	ENST00000295902	T	0.59502	0.26	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000014	T	0.43853	0.1266	L	0.50333	1.59	0.42629	D	0.993379	P	0.40144	0.704	B	0.24394	0.053	T	0.43065	-0.9414	10	0.22706	T	0.39	-30.5079	12.9355	0.58311	0.0741:0.0:0.9259:0.0	.	624	Q7Z3G6	PRIC2_HUMAN	I	624	ENSP00000295902:L624I	ENSP00000295902:L624I	L	-	1	0	PRICKLE2	64060432	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.974000	0.56852	2.655000	0.90218	0.591000	0.81541	CTC	-	NULL		0.587	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	PRICKLE2	protein_coding	OTTHUMT00000352219.1	G	NM_198859		64060432	-1	no_errors	NM_198859	genbank	human	validated	54_36p	missense	SNP	1	T
CPN2	1370	genome.wustl.edu	37	3	194062469	194062469	+	Silent	SNP	T	T	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr3:194062469T>C	ENST00000323830.3	-	2	1052	c.963A>G	c.(961-963)tcA>tcG	p.S321S	CPN2_ENST00000429275.1_Silent_p.S321S	NM_001080513.2	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	321					protein stabilization (GO:0050821)|regulation of catalytic activity (GO:0050790)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme regulator activity (GO:0030234)	p.S321S(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(5)|prostate(1)	27	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		TGGCATTGTATGAGAGCATGA	0.587																																																1	Substitution - coding silent(1)	ovary(1)	3											50.0	46.0	47.0					3																	194062469		2203	4300	6503	195544164	SO:0001819	synonymous_variant	1370			J05158	CCDS33920.1	3q29	2012-02-10	2007-02-23		ENSG00000178772	ENSG00000178772	3.4.17.3		2313	protein-coding gene	gene with protein product		603104	"""carboxypeptidase N, polypeptide 2, 83kD"""	ACBP		2378615, 9628828	Standard	XM_005269280		Approved		uc003fts.3	P22792	OTTHUMG00000156047	ENST00000323830.3:c.963A>G	3.37:g.194062469T>C		Somatic		Capture	Illumina GAIIx	4	195544164	B2RPE7|Q86SU4|Q8N5V4	Silent	SNP	-	p.S321	ENST00000323830.3	37	c.963	CCDS33920.1	3																																																																																			-	NULL		0.587	CPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPN2	protein_coding	OTTHUMT00000342856.2	T	NM_001080513		195544164	-1	no_errors	NM_001080513	genbank	human	validated	54_36p	silent	SNP	0.225	C
MTTP	4547	genome.wustl.edu	37	4	100543935	100543935	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr4:100543935A>T	ENST00000265517.5	+	18	2818	c.2615A>T	c.(2614-2616)cAa>cTa	p.Q872L	MTTP_ENST00000457717.1_Missense_Mutation_p.Q872L|RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000511045.1_Missense_Mutation_p.Q899L			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	872					cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)	p.Q872L(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	CCGCTCCATCAAGAGAACTCA	0.433																																																1	Substitution - Missense(1)	ovary(1)	4											162.0	159.0	160.0					4																	100543935		2203	4300	6503	100762958	SO:0001583	missense	4547				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.2615A>T	4.37:g.100543935A>T	ENSP00000265517:p.Gln872Leu	Somatic		Capture	Illumina GAIIx	4	100762958	A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	-	p.Q872L	ENST00000265517.5	37	c.2615	CCDS3651.1	4	.	.	.	.	.	.	.	.	.	.	A	31	5.098753	0.94197	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517	T;T;T	0.67345	-0.26;-0.24;-0.24	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.81341	0.4802	M	0.71581	2.175	0.80722	D	1	D;D	0.76494	0.995;0.999	P;D	0.78314	0.889;0.991	T	0.82697	-0.0329	10	0.66056	D	0.02	-19.5906	16.4795	0.84153	1.0:0.0:0.0:0.0	.	899;872	E9PBP6;P55157	.;MTP_HUMAN	L	899;872;872	ENSP00000427679:Q899L;ENSP00000400821:Q872L;ENSP00000265517:Q872L	ENSP00000265517:Q872L	Q	+	2	0	MTTP	100762958	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	6.764000	0.74960	2.367000	0.80283	0.528000	0.53228	CAA	-	NULL		0.433	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	protein_coding	OTTHUMT00000253662.3	A			100762958	1	no_errors	NM_000253	genbank	human	reviewed	54_36p	missense	SNP	1	T
TRPC3	7222	genome.wustl.edu	37	4	122824122	122824122	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr4:122824122A>G	ENST00000379645.3	-	9	2421	c.2348T>C	c.(2347-2349)gTt>gCt	p.V783A	TRPC3_ENST00000513531.1_Missense_Mutation_p.V655A|TRPC3_ENST00000264811.5_Missense_Mutation_p.V710A	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	698	Binds to IP3R3.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.V710A(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGGACTAGGAACTAGACTGAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	4											113.0	110.0	111.0					4																	122824122		2203	4300	6503	123043572	SO:0001583	missense	7222			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.2348T>C	4.37:g.122824122A>G	ENSP00000368966:p.Val783Ala	Somatic		Capture	Illumina GAIIx	4	123043572	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	-	p.V710A	ENST00000379645.3	37	c.2129	CCDS47130.1	4	.	.	.	.	.	.	.	.	.	.	A	25.4	4.635980	0.87760	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.85088	-1.94;-1.94;-1.94	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000002	D	0.87180	0.6113	M	0.80746	2.51	0.58432	D	0.999999	P;P;P	0.37233	0.588;0.588;0.588	B;B;B	0.38880	0.206;0.284;0.269	D	0.88543	0.3111	10	0.87932	D	0	-11.259	16.0985	0.81148	1.0:0.0:0.0:0.0	.	698;655;783	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	A	710;783;655	ENSP00000264811:V710A;ENSP00000368966:V783A;ENSP00000426899:V655A	ENSP00000264811:V710A	V	-	2	0	TRPC3	123043572	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.230000	0.95299	2.197000	0.70478	0.455000	0.32223	GTT	-	NULL		0.373	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC3	protein_coding	OTTHUMT00000364252.1	A	NM_003305		123043572	-1	no_errors	NM_003305	genbank	human	validated	54_36p	missense	SNP	1	G
NUP54	53371	genome.wustl.edu	37	4	77051836	77051836	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr4:77051836C>T	ENST00000264883.3	-	8	1169	c.1029G>A	c.(1027-1029)atG>atA	p.M343I	NUP54_ENST00000458189.2_Missense_Mutation_p.M163I|NUP54_ENST00000342467.6_Missense_Mutation_p.M163I|NUP54_ENST00000514987.1_Missense_Mutation_p.M295I	NM_017426.2	NP_059122.2	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	343	9 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein targeting (GO:0006605)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nucleocytoplasmic transporter activity (GO:0005487)	p.M343I(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(3)|skin(1)|stomach(1)	19						GCTGCTTAGTCATCTGATCTT	0.383																																																1	Substitution - Missense(1)	ovary(1)	4											95.0	76.0	82.0					4																	77051836		2203	4300	6503	77270860	SO:0001583	missense	53371			AF157322	CCDS3576.1, CCDS63998.1	4q21.1	2008-07-03	2002-08-29		ENSG00000138750	ENSG00000138750			17359	protein-coding gene	gene with protein product		607607	"""nucleoporin 54kD"""			8707840	Standard	NM_017426		Approved		uc003hjs.3	Q7Z3B4	OTTHUMG00000130098	ENST00000264883.3:c.1029G>A	4.37:g.77051836C>T	ENSP00000264883:p.Met343Ile	Somatic		Capture	Illumina GAIIx	4	77270860	B2RCK7|B4DT35|Q96EA7|Q9NVL5|Q9P0I1	Missense_Mutation	SNP	-	p.M343I	ENST00000264883.3	37	c.1029	CCDS3576.1	4	.	.	.	.	.	.	.	.	.	.	C	27.0	4.788825	0.90367	.	.	ENSG00000138750	ENST00000264883;ENST00000342467;ENST00000514987;ENST00000458189	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.62270	0.2414	L	0.54323	1.7	0.80722	D	1	P;P;P	0.48694	0.719;0.914;0.6	B;P;B	0.48425	0.308;0.577;0.308	T	0.56571	-0.7957	9	0.22109	T	0.4	-17.6058	19.5275	0.95212	0.0:1.0:0.0:0.0	.	295;163;343	B4DT35;Q7Z3B4-2;Q7Z3B4	.;.;NUP54_HUMAN	I	343;163;295;163	.	ENSP00000264883:M343I	M	-	3	0	NUP54	77270860	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.402000	0.79972	2.616000	0.88540	0.563000	0.77884	ATG	-	NULL		0.383	NUP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP54	protein_coding	OTTHUMT00000252402.3	C			77270860	-1	no_errors	NM_017426	genbank	human	reviewed	54_36p	missense	SNP	1	T
DCLK2	166614	genome.wustl.edu	37	4	151168756	151168756	+	Splice_Site	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	A	G	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr4:151168756G>A	ENST00000296550.7	+	13	2534	c.1780G>A	c.(1780-1782)Gag>Aag	p.E594K	DCLK2_ENST00000302176.8_Splice_Site_p.E611K|DCLK2_ENST00000506325.1_Splice_Site_p.E593K	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	594	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E594K(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					CTGGCTTAGTGAGAACAATCT	0.488																																					GBM(195;186 2215 13375 16801 37459)											1	Substitution - Missense(1)	ovary(1)	4											64.0	67.0	66.0					4																	151168756		2203	4300	6503	151388206	SO:0001630	splice_region_variant	166614			BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1779-1G>A	4.37:g.151168756G>A		Somatic		Capture	Illumina GAIIx	Phase_III	151388206	C9J5Q9|Q59GC8|Q8N399	Missense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_DCX;superfamily_Protein kinase-like (PK-like);superfamily_Doublecortin (DC)	p.E594K	ENST00000296550.7	37	c.1780	CCDS34076.1	4	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862479	0.91511	.	.	ENSG00000170390	ENST00000296550;ENST00000506325;ENST00000302176	T;T;T	0.65364	-0.15;-0.15;-0.15	6.03	5.18	0.71444	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66386	0.2784	N	0.17631	0.505	0.58432	D	0.999999	P;D;B	0.71674	0.868;0.998;0.082	P;D;B	0.78314	0.511;0.991;0.166	T	0.67803	-0.5576	10	0.39692	T	0.17	.	15.0435	0.71811	0.0676:0.0:0.9324:0.0	.	611;593;594	Q8N568-3;Q8N568-2;Q8N568	.;.;DCLK2_HUMAN	K	594;593;611	ENSP00000296550:E594K;ENSP00000427235:E593K;ENSP00000303887:E611K	ENSP00000296550:E594K	E	+	1	0	DCLK2	151388206	1.000000	0.71417	0.996000	0.52242	0.957000	0.61999	9.229000	0.95273	1.551000	0.49450	0.655000	0.94253	GAG	-	HMMPfam_Pkinase		0.488	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCLK2	protein_coding	OTTHUMT00000364952.1	G	NM_001040260	Missense_Mutation	151388206	1	no_errors	NM_001040260	genbank	human	validated	54_36p	missense	SNP	1	A
LVRN	206338	genome.wustl.edu	37	5	115323552	115323552	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr5:115323552G>T	ENST00000357872.4	+	4	1145	c.1021G>T	c.(1021-1023)Gca>Tca	p.A341S	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		341						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A341S(1)									AAATGGAAGTGCAGACTTTGC	0.393																																																1	Substitution - Missense(1)	ovary(1)	5											183.0	170.0	174.0					5																	115323552		2202	4300	6502	115351451	SO:0001583	missense	206338																														ENST00000357872.4:c.1021G>T	5.37:g.115323552G>T	ENSP00000350541:p.Ala341Ser	Somatic		Capture	Illumina GAIIx	4	115351451	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	-	p.A341S	ENST00000357872.4	37	c.1021	CCDS4124.1	5	.	.	.	.	.	.	.	.	.	.	G	10.15	1.271839	0.23221	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.06218	3.33	5.14	3.3	0.37823	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.379490	0.24105	N	0.041511	T	0.09642	0.0237	L	0.54908	1.71	0.80722	D	1	P	0.39883	0.693	P	0.44990	0.466	T	0.18461	-1.0336	10	0.30078	T	0.28	.	8.8884	0.35418	0.0805:0.0:0.7669:0.1527	.	341	Q6Q4G3	AMPQ_HUMAN	S	341;330	ENSP00000350541:A341S	ENSP00000350541:A341S	A	+	1	0	AC010282.1	115351451	1.000000	0.71417	0.158000	0.22627	0.080000	0.17528	4.711000	0.61881	0.509000	0.28195	-0.217000	0.12591	GCA	-	NULL		0.393	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LVRN	protein_coding	OTTHUMT00000250852.1	G			115351451	1	no_errors	NM_173800	genbank	human	validated	54_36p	missense	SNP	0.72	T
SEMA6A	57556	genome.wustl.edu	37	5	115827448	115827448	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr5:115827448C>T	ENST00000343348.6	-	7	1310	c.523G>A	c.(523-525)Gca>Aca	p.A175T	CTB-118N6.3_ENST00000508640.1_RNA|SEMA6A_ENST00000503962.1_5'UTR|CTB-118N6.3_ENST00000510682.1_RNA|CTB-118N6.3_ENST00000514214.1_RNA|SEMA6A_ENST00000257414.8_Missense_Mutation_p.A175T|SEMA6A_ENST00000510263.1_Missense_Mutation_p.A175T	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	175	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.A175T(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		GCAAACAGTGCAACGTTGGCA	0.448																																																1	Substitution - Missense(1)	ovary(1)	5											130.0	132.0	132.0					5																	115827448		2004	4171	6175	115855347	SO:0001583	missense	57556			AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.523G>A	5.37:g.115827448C>T	ENSP00000345512:p.Ala175Thr	Somatic		Capture	Illumina GAIIx	Phase_III	115855347	Q9P2H9	Missense_Mutation	SNP	HMMPfam_Sema,superfamily_Sema domain,HMMPfam_PSI,superfamily_Plexin repeat	p.A175T	ENST00000343348.6	37	c.523	CCDS47256.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.295220	0.95574	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000510263	T;T;T	0.11277	2.79;2.79;2.79	6.08	6.08	0.98989	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.41696	0.1170	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.25984	-1.0116	10	0.87932	D	0	.	20.2672	0.98462	0.0:1.0:0.0:0.0	.	175;175	Q9H2E6;Q9H2E6-2	SEM6A_HUMAN;.	T	175	ENSP00000345512:A175T;ENSP00000257414:A175T;ENSP00000424388:A175T	ENSP00000257414:A175T	A	-	1	0	SEMA6A	115855347	1.000000	0.71417	0.936000	0.37596	0.645000	0.38454	7.487000	0.81328	2.894000	0.99253	0.591000	0.81541	GCA	-	HMMPfam_Sema		0.448	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6A	protein_coding	OTTHUMT00000371270.1	C	NM_020796		115855347	-1	no_errors	NM_020796	genbank	human	validated	54_36p	missense	SNP	1	T
PCDHGB4	8641	genome.wustl.edu	37	5	140768891	140768891	+	Silent	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr5:140768891G>T	ENST00000519479.1	+	1	1440	c.1440G>T	c.(1438-1440)ggG>ggT	p.G480G	PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	480	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGACTTGGGGCCCAACGGCC	0.577																																																0			5											68.0	77.0	74.0					5																	140768891		1960	4133	6093	140749075	SO:0001819	synonymous_variant	8641			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1440G>T	5.37:g.140768891G>T		Somatic		Capture	Illumina GAIIx	4	140749075	O15099|Q2M267|Q9UN64	Silent	SNP	-	p.G480	ENST00000519479.1	37	c.1440	CCDS54928.1	5																																																																																			-	NULL		0.577	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB4	protein_coding	OTTHUMT00000374745.1	G	NM_003736		140749075	1	no_errors	NM_003736	genbank	human	reviewed	54_36p	silent	SNP		T
CCDC69	26112	genome.wustl.edu	37	5	150581211	150581211	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr5:150581211G>C	ENST00000355417.2	-	3	337	c.163C>G	c.(163-165)Cgg>Ggg	p.R55G	CCDC69_ENST00000521308.1_5'UTR	NM_015621.2	NP_056436.2	A6NI79	CCD69_HUMAN	coiled-coil domain containing 69	55								p.R55G(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|stomach(1)	9		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCTGGTGCCGCTCAGCCTCC	0.448																																																1	Substitution - Missense(1)	ovary(1)	5											160.0	143.0	149.0					5																	150581211		2203	4300	6503	150561404	SO:0001583	missense	26112				CCDS4312.1	5q33.1	2008-02-05			ENSG00000198624	ENSG00000198624			24487	protein-coding gene	gene with protein product						12477932	Standard	NM_015621		Approved	FLJ13705, DKFZP434C171	uc011dcq.3	A6NI79	OTTHUMG00000130127	ENST00000355417.2:c.163C>G	5.37:g.150581211G>C	ENSP00000347586:p.Arg55Gly	Somatic		Capture	Illumina GAIIx	4	150561404	A8K9X6	Missense_Mutation	SNP	-	p.R55G	ENST00000355417.2	37	c.163	CCDS4312.1	5	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753024	0.31046	.	.	ENSG00000198624	ENST00000355417	T	0.23552	1.9	4.0	4.0	0.46444	.	0.987391	0.08243	N	0.975854	T	0.16085	0.0387	N	0.08118	0	0.24529	N	0.994125	B	0.22146	0.065	B	0.19666	0.026	T	0.10064	-1.0646	10	0.51188	T	0.08	-12.4226	11.8141	0.52199	0.0:0.0:1.0:0.0	.	55	A6NI79	CCD69_HUMAN	G	55	ENSP00000347586:R55G	ENSP00000347586:R55G	R	-	1	2	CCDC69	150561404	0.967000	0.33354	0.213000	0.23690	0.031000	0.12232	1.104000	0.31074	2.220000	0.72140	0.655000	0.94253	CGG	-	NULL		0.448	CCDC69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC69	protein_coding	OTTHUMT00000252435.1	G	NM_015621		150561404	-1	no_errors	NM_015621	genbank	human	validated	54_36p	missense	SNP	0.73	C
FAM153B	202134	genome.wustl.edu	37	5	175520250	175520250	+	Silent	SNP	A	A	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr5:175520250A>T	ENST00000253490.4	+	5	369	c.312A>T	c.(310-312)acA>acT	p.T104T	FAM153B_ENST00000510151.1_Silent_p.T27T|FAM153B_ENST00000512862.1_Silent_p.T27T|FAM153B_ENST00000515817.1_Silent_p.T27T			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	104								p.T104T(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		TATACAGCACATGGAAGAAGT	0.468																																																1	Substitution - coding silent(1)	ovary(1)	5											59.0	52.0	55.0					5																	175520250		2092	3608	5700	175452856	SO:0001819	synonymous_variant	202134			AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.312A>T	5.37:g.175520250A>T		Somatic		Capture	Illumina GAIIx	4	175452856	A8MTI1	Silent	SNP	-	p.T104	ENST00000253490.4	37	c.312		5																																																																																			-	NULL		0.468	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	FAM153B	protein_coding		A	NM_001079529		175452856	1	no_errors	NM_001079529	genbank	human	validated	54_36p	silent	SNP		T
AGXT2	64902	genome.wustl.edu	37	5	35035363	35035363	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr5:35035363C>G	ENST00000231420.6	-	5	745	c.545G>C	c.(544-546)aGg>aCg	p.R182T	AC010368.1_ENST00000390793.2_RNA	NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	182					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)	p.R182T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	TGAGTGCGCCCTGGCCATCAG	0.443																																																1	Substitution - Missense(1)	ovary(1)	5											134.0	143.0	140.0					5																	35035363		2203	4300	6503	35071120	SO:0001583	missense	64902			AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.545G>C	5.37:g.35035363C>G	ENSP00000231420:p.Arg182Thr	Somatic		Capture	Illumina GAIIx	4	35071120	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	HMMPfam_Aminotran_3;superfamily_PLP-dependent transferases	p.R182T	ENST00000231420.6	37	c.545	CCDS3908.1	5	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494928	0.85069	.	.	ENSG00000113492	ENST00000231420	T	0.27402	1.67	6.06	6.06	0.98353	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.63931	0.2553	M	0.85859	2.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.66536	-0.5899	10	0.87932	D	0	-2.0862	20.6282	0.99521	0.0:1.0:0.0:0.0	.	90;182;182	B7Z3M3;E9PDL7;Q9BYV1	.;.;AGT2_HUMAN	T	182	ENSP00000231420:R182T	ENSP00000231420:R182T	R	-	2	0	AGXT2	35071120	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	7.250000	0.78287	2.871000	0.98454	0.655000	0.94253	AGG	-	HMMPfam_Aminotran_3		0.443	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2	protein_coding	OTTHUMT00000207574.2	C	NM_031900		35071120	-1	no_errors	NM_031900	genbank	human	reviewed	54_36p	missense	SNP	1	G
UIMC1	51720	genome.wustl.edu	37	5	176396700	176396700	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr5:176396700C>T	ENST00000377227.4	-	5	497	c.365G>A	c.(364-366)cGg>cAg	p.R122Q	UIMC1_ENST00000506128.1_Missense_Mutation_p.R122Q|UIMC1_ENST00000503273.1_5'Flank|UIMC1_ENST00000377219.2_Missense_Mutation_p.R122Q|UIMC1_ENST00000511320.1_Missense_Mutation_p.R122Q			Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	122	Necessary for interaction with NR6A1 N- terminus.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)	p.R122Q(2)		NS(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	21	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATCAGAAGGCCGGCAACTCTG	0.498																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	5											103.0	99.0	100.0					5																	176396700		2203	4300	6503	176329306	SO:0001583	missense	51720			AF349313	CCDS4408.1	5q35.2	2008-02-05			ENSG00000087206	ENSG00000087206			30298	protein-coding gene	gene with protein product	"""receptor associated protein 80"""	609433				12080054	Standard	NM_001199297		Approved	RAP80	uc021yin.1	Q96RL1	OTTHUMG00000130852	ENST00000377227.4:c.365G>A	5.37:g.176396700C>T	ENSP00000366434:p.Arg122Gln	Somatic		Capture	Illumina GAIIx	4	176329306	A8MSA1|B3KMZ1|B4E3N2|Q5XKQ1|Q7Z3W7|Q8N5B9|Q9BZR1|Q9BZR5|Q9UHX7	Missense_Mutation	SNP	-	p.R122Q	ENST00000377227.4	37	c.365	CCDS4408.1	5	.	.	.	.	.	.	.	.	.	.	C	9.257	1.042222	0.19748	.	.	ENSG00000087206	ENST00000377227;ENST00000377219;ENST00000511320;ENST00000506128;ENST00000377220;ENST00000509236	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	5.64	2.47	0.30058	Ubiquitin interacting motif (1);	0.486110	0.19314	N	0.117319	T	0.16471	0.0396	N	0.19112	0.55	0.46542	D	0.999096	B	0.21147	0.052	B	0.08055	0.003	T	0.06625	-1.0816	10	0.26408	T	0.33	0.0817	7.2125	0.25941	0.0:0.6133:0.0:0.3867	.	122	Q96RL1	UIMC1_HUMAN	Q	122;122;122;122;44;122	ENSP00000366434:R122Q;ENSP00000366425:R122Q;ENSP00000421926:R122Q;ENSP00000427480:R122Q;ENSP00000423885:R122Q	ENSP00000366425:R122Q	R	-	2	0	UIMC1	176329306	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	0.491000	0.22419	0.747000	0.32809	-0.258000	0.10820	CGG	-	NULL		0.498	UIMC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UIMC1	protein_coding	OTTHUMT00000253422.1	C	NM_016290		176329306	-1	no_errors	NM_016290	genbank	human	provisional	54_36p	missense	SNP	1	T
HIST1H2BD	3017	genome.wustl.edu	37	6	26158751	26158751	+	Silent	SNP	C	C	G	rs541069056		TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr6:26158751C>G	ENST00000289316.2	+	1	378	c.354C>G	c.(352-354)gcC>gcG	p.A118A	HIST1H2BD_ENST00000377777.4_Silent_p.A118A	NM_138720.2	NP_619790.1	P58876	H2B1D_HUMAN	histone cluster 1, H2bd	118					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A118A(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	24						GCACCAAGGCCGTCACCAAGT	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		19344	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	6											70.0	76.0	74.0					6																	26158751		2203	4300	6503	26266730	SO:0001819	synonymous_variant	3017			M60751	CCDS4587.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158373	ENSG00000158373		"""Histones / Replication-dependent"""	4747	protein-coding gene	gene with protein product		602799	"""H2B histone family, member B"", ""histone 1, H2bd"""	H2BFB		1916825, 12408966	Standard	NM_021063		Approved	H2B/b	uc003ngr.3	P58876	OTTHUMG00000014426	ENST00000289316.2:c.354C>G	6.37:g.26158751C>G		Somatic		Capture	Illumina GAIIx	Phase_III	26266730		Silent	SNP	-	p.A118	ENST00000289316.2	37	c.354	CCDS4587.1	6																																																																																			-	NULL		0.547	HIST1H2BD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BD	protein_coding	OTTHUMT00000040088.1	C	NM_021063		26266730	1	no_errors	NM_021063	genbank	human	reviewed	54_36p	silent	SNP	0.998	G
PPP1R10	5514	genome.wustl.edu	37	6	30572486	30572486	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr6:30572486G>T	ENST00000376511.2	-	12	1533	c.981C>A	c.(979-981)agC>agA	p.S327R		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	327	Interaction with TOX4. {ECO:0000250}.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)	p.S327R(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						TTGGTTCTGTGCTCGTTTTCC	0.537																																																1	Substitution - Missense(1)	ovary(1)	6											304.0	296.0	299.0					6																	30572486		1511	2709	4220	30680465	SO:0001583	missense	5514			Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.981C>A	6.37:g.30572486G>T	ENSP00000365694:p.Ser327Arg	Somatic		Capture	Illumina GAIIx	4	30680465	O00405	Missense_Mutation	SNP	HMMPfam_zf-CCCH;superfamily_Conserved domain common to transcription factors TFIIS elongin A CRSP70;superfamily_CCCH zinc finger	p.S327R	ENST00000376511.2	37	c.981	CCDS4681.1	6	.	.	.	.	.	.	.	.	.	.	G	10.98	1.504392	0.26949	.	.	ENSG00000204569	ENST00000376511	T	0.47177	0.85	5.46	4.59	0.56863	.	0.499688	0.23801	N	0.044422	T	0.12263	0.0298	N	0.08118	0	0.37095	D	0.8996	B	0.33694	0.421	B	0.29942	0.109	T	0.06789	-1.0807	10	0.42905	T	0.14	-14.4655	9.3405	0.38076	0.1647:0.0:0.8353:0.0	.	327	Q96QC0	PP1RA_HUMAN	R	327	ENSP00000365694:S327R	ENSP00000365694:S327R	S	-	3	2	PPP1R10	30680465	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	1.158000	0.31737	1.308000	0.44962	0.655000	0.94253	AGC	-	NULL		0.537	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R10	protein_coding	OTTHUMT00000076556.2	G	NM_002714		30680465	-1	no_errors	NM_002714	genbank	human	reviewed	54_36p	missense	SNP	0.01	T
RIMS1	22999	genome.wustl.edu	37	6	72968728	72968728	+	Silent	SNP	T	T	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr6:72968728T>C	ENST00000521978.1	+	18	2967	c.2967T>C	c.(2965-2967)tcT>tcC	p.S989S	RIMS1_ENST00000491071.2_Silent_p.S989S|RIMS1_ENST00000523963.1_Silent_p.S463S|RIMS1_ENST00000264839.7_Silent_p.S989S|RIMS1_ENST00000425662.2_Silent_p.S382S|RIMS1_ENST00000401910.3_Silent_p.S462S|RIMS1_ENST00000517960.1_Silent_p.S988S|RIMS1_ENST00000538414.1_5'UTR|RIMS1_ENST00000348717.5_Silent_p.S988S|RIMS1_ENST00000518273.1_Silent_p.S989S|RIMS1_ENST00000520567.1_Silent_p.S988S|RIMS1_ENST00000517827.1_Silent_p.S448S|RIMS1_ENST00000522291.1_Silent_p.S988S	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	989					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.S989S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GGTCACGTTCTCCAACCAGAC	0.378																																																1	Substitution - coding silent(1)	ovary(1)	6											138.0	138.0	138.0					6																	72968728		1943	4127	6070	73025449	SO:0001819	synonymous_variant	22999			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2967T>C	6.37:g.72968728T>C		Somatic		Capture	Illumina GAIIx	4	73025449	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Silent	SNP	HMMPfam_C2;HMMPfam_PDZ;superfamily_PDZ domain-like;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);superfamily_FYVE/PHD zinc finger	p.S989	ENST00000521978.1	37	c.2967	CCDS47449.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.30|10.30	1.312011|1.312011	0.23821|0.23821	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000522211|ENST00000517433	.|T	.|0.15718	.|2.4	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.000000	.|0.64402	.|D	.|0.000005	T|T	0.23688|0.23688	0.0573|0.0573	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.00538|0.00538	-1.1682|-1.1682	4|7	.|0.46703	.|T	.|0.11	-13.104|-13.104	15.7332|15.7332	0.77822|0.77822	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	P|P	80|563	.|ENSP00000430359:S563P	.|ENSP00000430359:S563P	L|S	+|+	2|1	0|0	RIMS1|RIMS1	73025449|73025449	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.150000|4.150000	0.58098|0.58098	2.182000|2.182000	0.69389|0.69389	0.460000|0.460000	0.39030|0.39030	CTC|TCC	-	NULL		0.378	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	protein_coding	OTTHUMT00000374968.1	T			73025449	1	no_errors	NM_014989	genbank	human	validated	54_36p	silent	SNP	1	C
CEP57L1	285753	genome.wustl.edu	37	6	109480666	109480666	+	Splice_Site	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr6:109480666G>A	ENST00000517392.1	+	9	1442		c.e9+1		CEP57L1_ENST00000520883.1_Splice_Site|CEP57L1_ENST00000407272.1_Splice_Site|CEP57L1_ENST00000336977.4_Splice_Site|CEP57L1_ENST00000523787.1_Splice_Site|CEP57L1_ENST00000521522.1_Splice_Site|CEP57L1_ENST00000359793.3_Splice_Site|CEP57L1_ENST00000368968.2_Splice_Site|CEP57L1_ENST00000368970.2_Splice_Site	NM_001271852.1|NM_001271853.1	NP_001258781.1|NP_001258782.1	Q8IYX8	CE57L_HUMAN	centrosomal protein 57kDa-like 1						microtubule anchoring (GO:0034453)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.?(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)	11						AAATGAGCATGTAAGTATTTA	0.413																																																1	Unknown(1)	ovary(1)	6											48.0	50.0	49.0					6																	109480666		2203	4299	6502	109587359	SO:0001630	splice_region_variant	285753			AK092723	CCDS5071.1, CCDS64491.1	6q21	2014-01-28	2010-09-30	2010-09-30	ENSG00000183137	ENSG00000183137			21561	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 182"""	C6orf182			Standard	NM_001083535		Approved	bA487F23.2, MGC21731	uc003psy.4	Q8IYX8	OTTHUMG00000015336	ENST00000517392.1:c.1016+1G>A	6.37:g.109480666G>A		Somatic		Capture	Illumina GAIIx	Phase_III	109587359	G5E992	Splice_Site	SNP	-	e8+1	ENST00000517392.1	37	c.1016+1	CCDS5071.1	6	.	.	.	.	.	.	.	.	.	.	G	11.40	1.626609	0.28978	.	.	ENSG00000183137	ENST00000517392;ENST00000407272;ENST00000336977;ENST00000521522;ENST00000368968;ENST00000368970;ENST00000520883;ENST00000523787;ENST00000359793;ENST00000523174	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4538	0.87600	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CEP57L1	109587359	1.000000	0.71417	0.988000	0.46212	0.109000	0.19521	7.208000	0.77907	2.427000	0.82271	0.650000	0.86243	.	-	-		0.413	CEP57L1-001	KNOWN	basic|CCDS	protein_coding	C6orf182	protein_coding	OTTHUMT00000041734.4	G	NM_173830	Intron	109587359	1	no_errors	NM_001083535	genbank	human	validated	54_36p	splice_site	SNP	0.995	A
CUX1	1523	genome.wustl.edu	37	7	101840497	101840497	+	Silent	SNP	T	T	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr7:101840497T>G	ENST00000292535.7	+	15	1844	c.1806T>G	c.(1804-1806)cgT>cgG	p.R602R	CUX1_ENST00000547394.2_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Silent_p.R500R|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Silent_p.R613R|CUX1_ENST00000550008.2_Silent_p.R602R|CUX1_ENST00000546411.2_Silent_p.R500R|CUX1_ENST00000549414.2_Silent_p.R602R|CUX1_ENST00000560541.1_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	602					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.R602R(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						TGACTGTTCGTGGCAAGGAGC	0.522																																																1	Substitution - coding silent(1)	ovary(1)	7											81.0	76.0	78.0					7																	101840497		2203	4300	6503	101627217	SO:0001819	synonymous_variant	1523			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.1806T>G	7.37:g.101840497T>G		Somatic		Capture	Illumina GAIIx	4	101627217	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Silent	SNP	-	p.R602	ENST00000292535.7	37	c.1806	CCDS5721.1	7																																																																																			-	NULL		0.522	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CUX1	protein_coding	OTTHUMT00000347535.1	T	NM_001913		101627217	1	no_errors	NM_181552	genbank	human	reviewed	54_36p	silent	SNP	0.19	G
FLNC	2318	genome.wustl.edu	37	7	128484288	128484288	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr7:128484288G>T	ENST00000325888.8	+	20	3421	c.3160G>T	c.(3160-3162)Gtg>Ttg	p.V1054L	FLNC_ENST00000346177.6_Missense_Mutation_p.V1054L	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1054					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.V1054L(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CCCGTTTGCTGTGGAGGGTGT	0.617																																																1	Substitution - Missense(1)	ovary(1)	7											26.0	30.0	29.0					7																	128484288		2028	4170	6198	128271524	SO:0001583	missense	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3160G>T	7.37:g.128484288G>T	ENSP00000327145:p.Val1054Leu	Somatic		Capture	Illumina GAIIx	4	128271524	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	-	p.V1054L	ENST00000325888.8	37	c.3160	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727620	0.48833	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.92647	-3.08;-2.94	5.05	5.05	0.67936	Immunoglobulin E-set (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.90549	0.7038	L	0.52266	1.64	0.50171	D	0.999857	B;B	0.14438	0.01;0.001	B;B	0.26416	0.069;0.007	D	0.86897	0.2052	10	0.36615	T	0.2	.	18.4021	0.90520	0.0:0.0:1.0:0.0	.	1054;1054	Q14315-2;Q14315	.;FLNC_HUMAN	L	1054	ENSP00000327145:V1054L;ENSP00000344002:V1054L	ENSP00000327145:V1054L	V	+	1	0	FLNC	128271524	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.782000	0.75073	2.346000	0.79739	0.484000	0.47621	GTG	-	NULL		0.617	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	protein_coding	OTTHUMT00000059948.3	G			128271524	1	no_errors	NM_001458	genbank	human	reviewed	54_36p	missense	SNP	1	T
TSGA13	114960	genome.wustl.edu	37	7	130357608	130357608	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr7:130357608C>T	ENST00000456951.1	-	7	1347	c.496G>A	c.(496-498)Gat>Aat	p.D166N	TSGA13_ENST00000356588.3_Missense_Mutation_p.D166N			Q96PP4	TSG13_HUMAN	testis specific, 13	166								p.D166N(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	18	Melanoma(18;0.0435)					GTGGGATCATCCGACAGTATC	0.433																																																1	Substitution - Missense(1)	ovary(1)	7											193.0	181.0	185.0					7																	130357608		2203	4300	6503	130008148	SO:0001583	missense	114960			AK093329	CCDS5824.1	7q32	2008-02-04			ENSG00000213265	ENSG00000213265			12369	protein-coding gene	gene with protein product							Standard	NM_052933		Approved		uc003vqi.3	Q96PP4	OTTHUMG00000154999	ENST00000456951.1:c.496G>A	7.37:g.130357608C>T	ENSP00000406047:p.Asp166Asn	Somatic		Capture	Illumina GAIIx	4	130008148	B3KSC9	Missense_Mutation	SNP	-	p.D166N	ENST00000456951.1	37	c.496	CCDS5824.1	7	.	.	.	.	.	.	.	.	.	.	C	16.58	3.164185	0.57476	.	.	ENSG00000213265	ENST00000456951;ENST00000418126;ENST00000356588	.	.	.	5.52	3.68	0.42216	.	1.360770	0.04761	N	0.426324	T	0.28034	0.0691	N	0.19112	0.55	0.09310	N	1	P	0.36535	0.557	B	0.35971	0.215	T	0.27191	-1.0081	9	0.52906	T	0.07	-0.0326	9.1369	0.36879	0.0:0.8214:0.0:0.1786	.	166	Q96PP4	TSG13_HUMAN	N	166	.	ENSP00000348996:D166N	D	-	1	0	TSGA13	130008148	0.000000	0.05858	0.002000	0.10522	0.000000	0.00434	0.415000	0.21181	1.455000	0.47813	-0.150000	0.13652	GAT	-	NULL		0.433	TSGA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA13	protein_coding	OTTHUMT00000337997.1	C	NM_052933		130008148	-1	no_errors	NM_052933	genbank	human	provisional	54_36p	missense	SNP		T
Unknown	0	genome.wustl.edu	37	7	56358172	56358185	+	IGR	DEL	TCTCTAGCAGACTG	TCTCTAGCAGACTG	-	rs148378733	byFrequency	TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	TCTCTAGCAGACTG	TCTCTAGCAGACTG	TCTCTAGCAGACTG	-	TCTCTAGCAGACTG	TCTCTAGCAGACTG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr7:56358172_56358185delTCTCTAGCAGACTG								AC073136.1 (20628 upstream) : RNU6-1335P (49738 downstream)																							TAGGCAAGCCTCTCTAGCAGACTGTCTCAACCAT	0.421																																																0			7																																								56325679	SO:0001628	intergenic_variant	441228																															7.37:g.56358172_56358185delTCTCTAGCAGACTG		Somatic		Capture	Illumina GAIIx	4	56325666		RNA	DEL	-	NULL		37	NULL		7																																																																																			(deletion:rna[56325106;56327174])	-	0	0.421					LOC441228			TCTCTAGCAGACTG			56325679	1	no_errors	XR_016387	genbank	human	model	54_36p	rna	DEL	1.000:1.000:0.999:1.000:1.000:0.993:1.000:0.999:0.996:1.000:1.000:1.000:1.000:1.000	-
GALNTL5	168391	genome.wustl.edu	37	7	151716755	151716755	+	Missense_Mutation	SNP	G	G	A	rs150782880	byFrequency	TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr7:151716755G>A	ENST00000392800.2	+	9	1455	c.1201G>A	c.(1201-1203)Ggt>Agt	p.G401S	GALNTL5_ENST00000431418.2_Missense_Mutation_p.G401S	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	401					spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.G401S(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		TCGAAAGCCTGGTCTGAAATA	0.378													G|||	5	0.000998403	0.0038	0.0	5008	,	,		18963	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	7						G	SER/GLY	29,4377	35.2+/-66.4	0,29,2174	98.0	97.0	97.0		1201	-4.0	0.0	7	dbSNP_134	97	0,8600		0,0,4300	yes	missense	GALNTL5	NM_145292.3	56	0,29,6474	AA,AG,GG		0.0,0.6582,0.223	benign	401/444	151716755	29,12977	2203	4300	6503	151347688	SO:0001583	missense	168391			AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.1201G>A	7.37:g.151716755G>A	ENSP00000376548:p.Gly401Ser	Somatic		Capture	Illumina GAIIx	4	151347688	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	HMMPfam_Glycos_transf_2;superfamily_Nucleotide-diphospho-sugar transferases	p.G401S	ENST00000392800.2	37	c.1201	CCDS5929.1	7	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	6.321	0.427252	0.11987	0.006582	0.0	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.68181	-0.31;-0.31	4.91	-3.99	0.04069	.	1.368850	0.04740	N	0.422679	T	0.36193	0.0958	N	0.17674	0.51	0.09310	N	1	B;B	0.12013	0.004;0.005	B;B	0.13407	0.005;0.009	T	0.12372	-1.0550	10	0.39692	T	0.17	.	1.4341	0.02339	0.4105:0.1157:0.3072:0.1666	.	152;401	A8MZD3;Q7Z4T8	.;GLTL5_HUMAN	S	401	ENSP00000392582:G401S;ENSP00000376548:G401S	ENSP00000376548:G401S	G	+	1	0	GALNTL5	151347688	0.218000	0.23608	0.000000	0.03702	0.001000	0.01503	0.491000	0.22419	-0.747000	0.04759	-0.965000	0.02619	GGT	-	NULL		0.378	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL5	protein_coding	OTTHUMT00000348395.1	G	NM_145292		151347688	1	no_errors	NM_145292	genbank	human	provisional	54_36p	missense	SNP	0.42	A
Unknown	0	genome.wustl.edu	37	X	73351261	73351261	+	IGR	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chrX:73351261C>T								RP13-36G14.4 (119958 upstream) : RP3-368A4.5 (68802 downstream)																							GGCCCTTCATCAGTTTTGCTT	0.408																																																0			X																																								73267986	SO:0001628	intergenic_variant	100133180																															X.37:g.73351261C>T		Somatic		Capture	Illumina GAIIx	4	73267986		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.408					LOC100133180			C			73267986	1	pseudogene	XR_037576	genbank	human	model	54_36p	rna	SNP	1	T
NRG1	3084	genome.wustl.edu	37	8	32505637	32505637	+	Intron	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr8:32505637G>T	ENST00000405005.3	+	5	502				NRG1_ENST00000521670.1_Intron|NRG1_ENST00000341377.5_Intron|NRG1_ENST00000520407.1_Intron|NRG1_ENST00000338921.4_Intron|NRG1_ENST00000519301.1_Intron|NRG1_ENST00000520502.2_Missense_Mutation_p.W134L|NRG1_ENST00000523079.1_Intron|NRG1_ENST00000287842.3_Intron|NRG1_ENST00000287845.5_Intron|NRG1_ENST00000356819.4_Intron			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TCAGCTGTGTGGGTGTCGTCT	0.498																																																0			8											139.0	122.0	128.0					8																	32505637		2203	4300	6503	32625179	SO:0001627	intron_variant	3084			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.502+31234G>T	8.37:g.32505637G>T		Somatic		Capture	Illumina GAIIx	4	32625179	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	-	p.W134L	ENST00000405005.3	37	c.401	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	G	0.369	-0.935150	0.02340	.	.	ENSG00000157168	ENST00000520502;ENST00000523041	.	.	.	6.07	4.22	0.49857	.	.	.	.	.	T	0.35098	0.0920	N	0.12746	0.255	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.11329	0.006;0.003	T	0.23404	-1.0189	8	0.02654	T	1	.	14.0757	0.64889	0.0:0.0:0.5921:0.4078	.	134;134	Q53F54;Q02297-10	.;.	L	134;94	.	ENSP00000433289:W134L	W	+	2	0	NRG1	32625179	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.030000	0.49720	0.820000	0.34516	0.655000	0.94253	TGG	-	NULL		0.498	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	protein_coding	OTTHUMT00000472504.1	G			32625179	1	no_errors	NM_013959	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
SNAI2	6591	genome.wustl.edu	37	8	49831546	49831546	+	Splice_Site	SNP	C	C	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr8:49831546C>A	ENST00000396822.1	-	4	984	c.627G>T	c.(625-627)ggG>ggT	p.G209G	SNAI2_ENST00000020945.1_Splice_Site_p.G209G			O43623	SNAI2_HUMAN	snail family zinc finger 2	209					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)	p.G209G(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				AAGGCTTCTCCCCTGGGGGTG	0.408																																																1	Substitution - coding silent(1)	ovary(1)	8											59.0	60.0	60.0					8																	49831546		2203	4300	6503	49994099	SO:0001630	splice_region_variant	6591			U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.626-1G>T	8.37:g.49831546C>A		Somatic		Capture	Illumina GAIIx	4	49994099	B2R6P6|Q53FC1	Silent	SNP	HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.G209	ENST00000396822.1	37	c.627	CCDS6146.1	8																																																																																			-	NULL		0.408	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI2	protein_coding	OTTHUMT00000313873.2	C	NM_003068	Silent	49994099	-1	no_errors	NM_003068	genbank	human	reviewed	54_36p	silent	SNP	1	A
SLC25A32	81034	genome.wustl.edu	37	8	104419864	104419864	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr8:104419864G>T	ENST00000297578.4	-	2	469	c.303C>A	c.(301-303)ttC>ttA	p.F101L	SLC25A32_ENST00000543107.1_5'UTR	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32	101					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)	p.F101L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	CTACTCACAAGAAAAAGTAGA	0.348																																																1	Substitution - Missense(1)	ovary(1)	8											94.0	98.0	96.0					8																	104419864		2203	4300	6503	104489040	SO:0001583	missense	81034			AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.303C>A	8.37:g.104419864G>T	ENSP00000297578:p.Phe101Leu	Somatic		Capture	Illumina GAIIx	4	104489040	Q96JZ6|Q96SU7	Missense_Mutation	SNP	-	p.F101L	ENST00000297578.4	37	c.303	CCDS6300.1	8	.	.	.	.	.	.	.	.	.	.	G	12.45	1.942654	0.34283	.	.	ENSG00000164933	ENST00000297578;ENST00000424899	T	0.78481	-1.18	6.05	3.34	0.38264	Mitochondrial carrier domain (2);	0.093429	0.85682	N	0.000000	T	0.55878	0.1948	N	0.10707	0.03	0.80722	D	1	B	0.06786	0.001	B	0.15052	0.012	T	0.38757	-0.9646	10	0.16420	T	0.52	-22.8482	10.8297	0.46652	0.2564:0.0:0.7436:0.0	.	101	Q9H2D1	MFTC_HUMAN	L	101;85	ENSP00000297578:F101L	ENSP00000297578:F101L	F	-	3	2	SLC25A32	104489040	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.405000	0.52630	0.469000	0.27268	-0.142000	0.14014	TTC	-	NULL		0.348	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A32	protein_coding	OTTHUMT00000380290.2	G	NM_030780		104489040	-1	no_errors	NM_030780	genbank	human	validated	54_36p	missense	SNP	1	T
COL15A1	1306	genome.wustl.edu	37	9	101810247	101810247	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr9:101810247A>C	ENST00000375001.3	+	28	3181	c.2758A>C	c.(2758-2760)Aag>Cag	p.K920Q		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	920	Collagen-like 4.|Triple-helical region 5 (COL5).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.K920Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GAATGGCCTCAAGGGTACCAA	0.622																																																1	Substitution - Missense(1)	ovary(1)	9											58.0	50.0	53.0					9																	101810247		2202	4300	6502	100850068	SO:0001583	missense	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2758A>C	9.37:g.101810247A>C	ENSP00000364140:p.Lys920Gln	Somatic		Capture	Illumina GAIIx	4	100850068	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	HMMPfam_Collagen;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Endostatin;superfamily_C-type lectin-like	p.K920Q	ENST00000375001.3	37	c.2758	CCDS35081.1	9	.	.	.	.	.	.	.	.	.	.	A	13.88	2.368149	0.42003	.	.	ENSG00000204291	ENST00000375001	D	0.91464	-2.85	5.95	5.95	0.96441	C-type lectin fold (1);	0.110211	0.64402	D	0.000012	D	0.93403	0.7896	M	0.62016	1.91	0.43771	D	0.996292	D	0.89917	1.0	D	0.87578	0.998	D	0.91163	0.4962	10	0.17832	T	0.49	-19.8028	12.8155	0.57663	1.0:0.0:0.0:0.0	.	920	P39059	COFA1_HUMAN	Q	920	ENSP00000364140:K920Q	ENSP00000364140:K920Q	K	+	1	0	COL15A1	100850068	1.000000	0.71417	1.000000	0.80357	0.296000	0.27459	5.842000	0.69417	2.279000	0.76181	0.533000	0.62120	AAG	-	HMMPfam_Collagen		0.622	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL15A1	protein_coding	OTTHUMT00000053386.3	A	NM_001855		100850068	1	no_errors	NM_001855	genbank	human	reviewed	54_36p	missense	SNP	1	C
RNF20	56254	genome.wustl.edu	37	9	104312889	104312889	+	Splice_Site	SNP	T	T	G			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr9:104312889T>G	ENST00000389120.3	+	10	1184	c.1094T>G	c.(1093-1095)gTg>gGg	p.V365G	AL591377.1_ENST00000584534.1_RNA	NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	365					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V365G(1)		breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		CCTCCTAAGGTGGAATTGCGG	0.468																																																1	Substitution - Missense(1)	ovary(1)	9											150.0	146.0	148.0					9																	104312889		2203	4300	6503	103352710	SO:0001630	splice_region_variant	56254			AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.1093-1T>G	9.37:g.104312889T>G		Somatic		Capture	Illumina GAIIx	4	103352710	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;superfamily_Prefoldin;superfamily_STAT;superfamily_RING/U-box	p.V365G	ENST00000389120.3	37	c.1094	CCDS35084.1	9	.	.	.	.	.	.	.	.	.	.	T	16.02	3.005499	0.54254	.	.	ENSG00000155827	ENST00000389120	T	0.32515	1.45	5.92	4.79	0.61399	.	0.301944	0.37095	N	0.002247	T	0.27384	0.0672	L	0.59436	1.845	0.80722	D	1	B	0.22003	0.063	B	0.17433	0.018	T	0.06180	-1.0841	10	0.22109	T	0.4	-23.1326	8.711	0.34385	0.0:0.1461:0.0:0.8539	.	365	Q5VTR2	BRE1A_HUMAN	G	365	ENSP00000373772:V365G	ENSP00000373772:V365G	V	+	2	0	RNF20	103352710	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	2.272000	0.43373	1.079000	0.41038	0.528000	0.53228	GTG	-	NULL		0.468	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF20	protein_coding	OTTHUMT00000356402.1	T	NM_019592	Missense_Mutation	103352710	1	no_errors	NM_019592	genbank	human	reviewed	54_36p	missense	SNP	1	G
SCAI	286205	genome.wustl.edu	37	9	127828305	127828305	+	Intron	SNP	T	T	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr9:127828305T>A	ENST00000336505.6	-	3	157				SCAI_ENST00000373549.4_Missense_Mutation_p.Q44L	NM_001144877.2	NP_001138349.1	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion						negative regulation of cell migration (GO:0030336)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.Q44L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(5)|stomach(1)|urinary_tract(1)	35						cccttgagattgtgaatgact	0.284																																																1	Substitution - Missense(1)	ovary(1)	9											79.0	76.0	77.0					9																	127828305		1808	4059	5867	126868126	SO:0001627	intron_variant	286205			AK093983	CCDS43877.1, CCDS48017.1	9q34.11	2009-11-06	2009-07-09	2009-07-09	ENSG00000173611	ENSG00000173611			26709	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 126"""	C9orf126			Standard	NM_173690		Approved	FLJ36664, NET40	uc004bpd.3	Q8N9R8	OTTHUMG00000020667	ENST00000336505.6:c.99-10019A>T	9.37:g.127828305T>A		Somatic		Capture	Illumina GAIIx	4	126868126	Q3SXZ1|Q3SXZ2|Q5T163|Q8N1I4	Missense_Mutation	SNP	-	p.Q44L	ENST00000336505.6	37	c.131	CCDS48017.1	9	.	.	.	.	.	.	.	.	.	.	T	0.163	-1.079134	0.01903	.	.	ENSG00000173611	ENST00000373549	T	0.41758	0.99	0.502	0.502	0.16932	.	.	.	.	.	T	0.40670	0.1126	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39742	-0.9599	5	0.87932	D	0	.	.	.	.	.	44	Q8N9R8-2	.	L	44	ENSP00000362650:Q44L	ENSP00000362650:Q44L	Q	-	2	0	SCAI	126868126	0.465000	0.25815	0.428000	0.26697	0.589000	0.36550	0.479000	0.22228	0.454000	0.26884	0.102000	0.15555	CAA	-	NULL		0.284	SCAI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf126	protein_coding	OTTHUMT00000054055.3	T	NM_173690		126868126	-1	no_errors	NM_173690	genbank	human	validated	54_36p	missense	SNP	0.43	A
SLC24A2	25769	genome.wustl.edu	37	9	19550152	19550152	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr9:19550152G>T	ENST00000341998.2	-	7	1523	c.1462C>A	c.(1462-1464)Cct>Act	p.P488T	SLC24A2_ENST00000286344.3_Missense_Mutation_p.P471T	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	488					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)	p.P488T(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		CGAACGTCAGGTAACGTAATC	0.438																																																1	Substitution - Missense(1)	ovary(1)	9											114.0	107.0	109.0					9																	19550152		2203	4300	6503	19540152	SO:0001583	missense	25769			AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1462C>A	9.37:g.19550152G>T	ENSP00000344801:p.Pro488Thr	Somatic		Capture	Illumina GAIIx	4	19540152	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	HMMPfam_Na_Ca_ex	p.P488T	ENST00000341998.2	37	c.1462	CCDS6493.1	9	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436608	0.62955	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	D;D	0.81499	-1.5;-1.5	5.38	3.5	0.40072	.	0.171467	0.53938	D	0.000060	D	0.92107	0.7498	H	0.96833	3.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.92220	0.5783	9	.	.	.	.	10.138	0.42719	0.0762:0.1376:0.7863:0.0	.	471;488	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	T	488;471	ENSP00000344801:P488T;ENSP00000286344:P471T	.	P	-	1	0	SLC24A2	19540152	1.000000	0.71417	0.900000	0.35374	0.943000	0.58893	7.883000	0.87264	0.718000	0.32166	0.655000	0.94253	CCT	-	NULL		0.438	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A2	protein_coding	OTTHUMT00000051866.2	G	NM_020344		19540152	-1	no_errors	NM_020344	genbank	human	provisional	54_36p	missense	SNP	1	T
EXOSC2	23404	genome.wustl.edu	37	9	133578463	133578463	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chr9:133578463G>T	ENST00000372358.5	+	8	767	c.696G>T	c.(694-696)gaG>gaT	p.E232D	EXOSC2_ENST00000467138.1_3'UTR|EXOSC2_ENST00000546165.1_Missense_Mutation_p.E206D|EXOSC2_ENST00000372351.3_Missense_Mutation_p.E202D|EXOSC2_ENST00000372352.3_Missense_Mutation_p.E224D			Q13868	EXOS2_HUMAN	exosome component 2	232					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|7S RNA binding (GO:0008312)	p.E232D(1)		breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		CTGATCGAGAGGTGATATCCC	0.478																																					Pancreas(134;1683 1824 10118 27928 31640)											1	Substitution - Missense(1)	ovary(1)	9											158.0	144.0	149.0					9																	133578463		2203	4300	6503	132568284	SO:0001583	missense	23404			AK001916	CCDS6935.1, CCDS65160.1, CCDS65161.1	9q34	2008-02-05			ENSG00000130713	ENSG00000130713			17097	protein-coding gene	gene with protein product	"""homolog of yeast RRP4 (ribosomal RNA processing 4), 3' 5' exoribonuclease (RRP4)"""	602238				8600032, 1538749	Standard	XM_005272176		Approved	hRrp4p, Rrp4p, RRP4, p7	uc004bzu.2	Q13868	OTTHUMG00000020811	ENST00000372358.5:c.696G>T	9.37:g.133578463G>T	ENSP00000361433:p.Glu232Asp	Somatic		Capture	Illumina GAIIx	4	132568284	A3KFL3|B4DKK6|Q9NUY4	Missense_Mutation	SNP	-	p.E232D	ENST00000372358.5	37	c.696	CCDS6935.1	9	.	.	.	.	.	.	.	.	.	.	G	16.67	3.186983	0.57909	.	.	ENSG00000130713	ENST00000372358;ENST00000546165;ENST00000372352;ENST00000372351;ENST00000495699	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.56761	0.2007	L	0.58969	1.84	0.80722	D	1	B;B	0.24533	0.105;0.007	B;B	0.20955	0.032;0.005	T	0.54221	-0.8326	9	0.37606	T	0.19	-38.571	11.7974	0.52108	0.0797:0.0:0.9203:0.0	.	206;232	B4DKK6;Q13868	.;EXOS2_HUMAN	D	232;206;224;202;209	.	ENSP00000361426:E202D	E	+	3	2	EXOSC2	132568284	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	5.759000	0.68785	2.648000	0.89879	0.650000	0.86243	GAG	-	NULL		0.478	EXOSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC2	protein_coding	OTTHUMT00000054673.1	G	NM_014285		132568284	1	no_errors	NM_014285	genbank	human	validated	54_36p	missense	SNP	1	T
KRT18P44	139748	genome.wustl.edu	37	X	127848673	127848673	+	IGR	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chrX:127848673G>A								RP1-30E17.2 (114227 upstream) : RNA5SP513 (721833 downstream)																							TAGTTGCCTGGCCACGGGGAT	0.617																																																0			X																																								127676354	SO:0001628	intergenic_variant	139748																															X.37:g.127848673G>A		Somatic		Capture	Illumina GAIIx	4	127676354		Missense_Mutation	SNP	-	p.A243T		37	c.727		X																																																																																			-	NULL	0	0.617					KRT18P44			G			127676354	1	pseudogene	XM_001719134	genbank	human	model	54_36p	missense	SNP	0.91	A
PASD1	139135	genome.wustl.edu	37	X	150793954	150793954	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chrX:150793954C>T	ENST00000370357.4	+	8	826	c.581C>T	c.(580-582)gCt>gTt	p.A194V		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	194						nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.A194V(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					AGTGATGAAGCTGTACTTACA	0.323																																																1	Substitution - Missense(1)	ovary(1)	X											174.0	171.0	172.0					X																	150793954		2203	4300	6503	150544610	SO:0001583	missense	139135			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.581C>T	X.37:g.150793954C>T	ENSP00000359382:p.Ala194Val	Somatic		Capture	Illumina GAIIx	4	150544610	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	superfamily_PYP-like sensor domain (PAS domain)	p.A194V	ENST00000370357.4	37	c.581	CCDS35431.1	X	.	.	.	.	.	.	.	.	.	.	C	11.26	1.587528	0.28268	.	.	ENSG00000166049	ENST00000370357	T	0.70631	-0.5	4.0	-7.99	0.01131	.	.	.	.	.	T	0.48059	0.1479	N	0.22421	0.69	0.09310	N	1	B	0.14012	0.009	B	0.10450	0.005	T	0.28870	-1.0030	9	0.23891	T	0.37	-9.0989	8.4359	0.32786	0.1341:0.5742:0.0:0.2917	.	194	Q8IV76	PASD1_HUMAN	V	194	ENSP00000359382:A194V	ENSP00000359382:A194V	A	+	2	0	PASD1	150544610	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.099000	0.00295	-2.103000	0.00844	-0.515000	0.04445	GCT	-	NULL		0.323	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	protein_coding	OTTHUMT00000060879.2	C	NM_173493		150544610	1	no_errors	NM_173493	genbank	human	validated	54_36p	missense	SNP		T
IL1RAPL1	11141	genome.wustl.edu	37	X	29938089	29938089	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chrX:29938089A>C	ENST00000378993.1	+	8	1608	c.935A>C	c.(934-936)gAa>gCa	p.E312A	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.E312A	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	312	Ig-like C2-type 3.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.E312A(1)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						CATCTTGGGGAACAGGAAGTT	0.383																																																1	Substitution - Missense(1)	ovary(1)	X											208.0	177.0	187.0					X																	29938089		2202	4300	6502	29848010	SO:0001583	missense	11141			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.935A>C	X.37:g.29938089A>C	ENSP00000368278:p.Glu312Ala	Somatic		Capture	Illumina GAIIx	Phase_III	29848010	A0AVG4|Q9UJ53	Missense_Mutation	SNP	HMMPfam_TIR,superfamily_Toll/Interleukin receptor TIR domain,HMMPfam_ig,superfamily_Immunoglobulin	p.E312A	ENST00000378993.1	37	c.935	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	A	21.8	4.203993	0.79127	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.13307	2.6;2.6	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.38558	0.1045	M	0.75447	2.3	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.12863	-1.0531	9	.	.	.	.	15.3142	0.74059	1.0:0.0:0.0:0.0	.	312	Q9NZN1	IRPL1_HUMAN	A	312	ENSP00000368278:E312A;ENSP00000305200:E312A	.	E	+	2	0	IL1RAPL1	29848010	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.962000	0.93254	2.000000	0.58554	0.425000	0.28330	GAA	-	HMMPfam_ig		0.383	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	protein_coding	OTTHUMT00000056155.1	A	NM_014271		29848010	1	no_errors	NM_014271	genbank	human	reviewed	54_36p	missense	SNP	1	C
ATP2B3	492	genome.wustl.edu	37	X	152845739	152845739	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1117-01A-02W-0488-09	TCGA-23-1117-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	3a4b0c6a-1f43-437c-b715-fc50c1c0303d	4d020436-5a7e-42bc-af98-233e3d2d025d	g.chrX:152845739G>A	ENST00000349466.2	+	21	3972	c.3646G>A	c.(3646-3648)Gtg>Atg	p.V1216M	ATP2B3_ENST00000359149.3_3'UTR|ATP2B3_ENST00000263519.4_Missense_Mutation_p.V1216M|ATP2B3_ENST00000370186.1_3'UTR|ATP2B3_ENST00000370181.2_3'UTR			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	1216					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.V1216M(1)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCTCCACAGCGTGGAGACGTC	0.557																																																1	Substitution - Missense(1)	ovary(1)	X											88.0	76.0	80.0					X																	152845739		2203	4300	6503	152498933	SO:0001583	missense	492			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.3646G>A	X.37:g.152845739G>A	ENSP00000343886:p.Val1216Met	Somatic		Capture	Illumina GAIIx	4	152498933	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	HMMPfam_Cation_ATPase_N;HMMPfam_Hydrolase;HMMPfam_Cation_ATPase_C;HMMPfam_E1-E2_ATPase;superfamily_HAD-like;superfamily_Calcium ATPase transduction domain A;superfamily_Metal cation-transporting ATPase ATP-binding domain N;superfamily_Calcium ATPase transmembrane domain M	p.V1216M	ENST00000349466.2	37	c.3646	CCDS35440.1	X	.	.	.	.	.	.	.	.	.	.	g	12.80	2.045946	0.36085	.	.	ENSG00000067842	ENST00000349466;ENST00000263519	D;D	0.93953	-3.32;-3.32	5.04	1.46	0.22682	.	0.506810	0.20174	N	0.097671	T	0.82015	0.4945	N	0.04508	-0.205	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.11329	0.006;0.001	T	0.71434	-0.4594	10	0.52906	T	0.07	-17.4703	7.3049	0.26443	0.6198:0.0:0.3802:0.0	.	1202;1216	Q16720-4;Q16720	.;AT2B3_HUMAN	M	1216	ENSP00000343886:V1216M;ENSP00000263519:V1216M	ENSP00000263519:V1216M	V	+	1	0	ATP2B3	152498933	0.000000	0.05858	1.000000	0.80357	0.351000	0.29236	-0.849000	0.04322	0.207000	0.20607	-0.402000	0.06365	GTG	-	NULL		0.557	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B3	protein_coding	OTTHUMT00000060957.1	G	NM_021949		152498933	1	no_errors	NM_001001344	genbank	human	reviewed	54_36p	missense	SNP	0.98	A
