#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
HSD3B1	3283	genome.wustl.edu	37	1	120057191	120057191	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr1:120057191G>T	ENST00000369413.3	+	4	1190	c.1045G>T	c.(1045-1047)Gcc>Tcc	p.A349S	HSD3B1_ENST00000235547.6_Missense_Mutation_p.A351S|HSD3B1_ENST00000528909.1_Missense_Mutation_p.A349S			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	349					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)	p.A349S(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	CTGGGAGGAAGCCAAGCAGAA	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											71.0	59.0	63.0					1																	120057191		2203	4300	6503	119858714	SO:0001583	missense	3283			S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.1045G>T	1.37:g.120057191G>T	ENSP00000358421:p.Ala349Ser	Somatic		Capture	Illumina GAIIx	4	119858714	A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	HMMPfam_3Beta_HSD;superfamily_NAD(P)-binding Rossmann-fold domains	p.A349S	ENST00000369413.3	37	c.1045	CCDS903.1	1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518590	0.44763	.	.	ENSG00000203857	ENST00000369413;ENST00000235547;ENST00000528909	D;D;D	0.88896	-2.44;-2.44;-2.44	3.26	3.26	0.37387	.	0.052181	0.85682	D	0.000000	D	0.89767	0.6810	M	0.63843	1.955	0.50313	D	0.999867	D;D	0.89917	0.988;1.0	P;D	0.91635	0.668;0.999	D	0.88908	0.3357	10	0.46703	T	0.11	-1.7518	7.907	0.29767	0.0:0.0:0.7541:0.2459	.	351;349	Q5TDG2;P14060	.;3BHS1_HUMAN	S	349;351;349	ENSP00000358421:A349S;ENSP00000235547:A351S;ENSP00000432268:A349S	ENSP00000235547:A351S	A	+	1	0	HSD3B1	119858714	1.000000	0.71417	1.000000	0.80357	0.332000	0.28634	3.326000	0.52037	1.799000	0.52666	0.313000	0.20887	GCC	-	NULL		0.498	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HSD3B1	protein_coding	OTTHUMT00000034993.3	G	NM_000862		119858714	1	no_errors	NM_000862	genbank	human	validated	54_36p	missense	SNP	1	T
PGLYRP3	114771	genome.wustl.edu	37	1	153283093	153283093	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr1:153283093C>T	ENST00000290722.1	-	1	101	c.49G>A	c.(49-51)Gct>Act	p.A17T		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	17					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.A17T(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTACCCCAAGCCTGGAGACCC	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											154.0	156.0	155.0					1																	153283093		2203	4300	6503	151549717	SO:0001583	missense	114771			AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.49G>A	1.37:g.153283093C>T	ENSP00000290722:p.Ala17Thr	Somatic		Capture	Illumina GAIIx	4	151549717	A1A4U8|Q5SY65	Missense_Mutation	SNP	-	p.A17T	ENST00000290722.1	37	c.49	CCDS1035.1	1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.779066	0.49891	.	.	ENSG00000159527	ENST00000290722	T	0.07021	3.23	3.22	3.22	0.36961	N-acetylmuramoyl-L-alanine amidase domain (1);	0.194892	0.25581	N	0.029699	T	0.03871	0.0109	L	0.55990	1.75	0.09310	N	1	P	0.46784	0.884	B	0.41374	0.355	T	0.31081	-0.9956	10	0.38643	T	0.18	-0.1639	10.2206	0.43194	0.0:1.0:0.0:0.0	.	17	Q96LB9	PGRP3_HUMAN	T	17	ENSP00000290722:A17T	ENSP00000290722:A17T	A	-	1	0	PGLYRP3	151549717	0.003000	0.15002	0.003000	0.11579	0.008000	0.06430	0.850000	0.27737	2.076000	0.62316	0.655000	0.94253	GCT	-	NULL		0.502	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP3	protein_coding	OTTHUMT00000039488.1	C	NM_052891		151549717	-1	no_errors	NM_052891	genbank	human	provisional	54_36p	missense	SNP	0.02	T
INSRR	3645	genome.wustl.edu	37	1	156823702	156823702	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr1:156823702G>C	ENST00000368195.3	-	2	875	c.479C>G	c.(478-480)cCa>cGa	p.P160R	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	160					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P160R(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCCAGGTGCTGGCTGCAGCAG	0.652																																																1	Substitution - Missense(1)	ovary(1)	1											62.0	55.0	57.0					1																	156823702		2203	4300	6503	155090326	SO:0001583	missense	3645			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.479C>G	1.37:g.156823702G>C	ENSP00000357178:p.Pro160Arg	Somatic		Capture	Illumina GAIIx	4	155090326	O60724|Q5VZS3	Missense_Mutation	SNP	Recep_L_domain;HMMPfam_Recep_L_domain;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;fn3;HMMPfam_fn3;Furin-like;HMMPfam_Furin-like	p.P160R	ENST00000368195.3	37	c.479	CCDS1160.1	1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214286	0.39102	.	.	ENSG00000027644	ENST00000368195	T	0.28666	1.6	5.11	5.11	0.69529	.	0.000000	0.45867	D	0.000323	T	0.17746	0.0426	.	.	.	0.41359	D	0.987411	P	0.51933	0.949	B	0.43331	0.416	T	0.01982	-1.1235	9	0.42905	T	0.14	.	11.1849	0.48650	0.0:0.0:0.8163:0.1837	.	160	P14616	INSRR_HUMAN	R	160	ENSP00000357178:P160R	ENSP00000357178:P160R	P	-	2	0	INSRR	155090326	1.000000	0.71417	0.926000	0.36857	0.900000	0.52787	3.255000	0.51484	2.381000	0.81170	0.557000	0.71058	CCA	-	NULL		0.652	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	protein_coding	OTTHUMT00000098929.1	G	NM_014215		155090326	-1	no_errors	NM_014215	genbank	human	validated	54_36p	missense	SNP	0.58	C
Unknown	0	genome.wustl.edu	37	1	161376569	161376569	+	IGR	SNP	C	C	G			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr1:161376569C>G								RNU6-481P (5384 upstream) : FCGR2A (98650 downstream)																							CGGCTCCGTGCTGGTGCACCT	0.612																																																0			1																																								159643193	SO:0001628	intergenic_variant	148430																															1.37:g.161376569C>G		Somatic		Capture	Illumina GAIIx	4	159643193		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.612					LOC148430			C			159643193	1	pseudogene	XR_017209	genbank	human	model	54_36p	rna	SNP	1	G
SRGAP2	23380	genome.wustl.edu	37	1	206632235	206632235	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr1:206632235C>A	ENST00000414007.1	+	18	2354	c.2354C>A	c.(2353-2355)gCg>gAg	p.A785E	SRGAP2_ENST00000419187.2_Missense_Mutation_p.A243E			O75044	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	925	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament severing (GO:0051014)|axon guidance (GO:0007411)|dendritic spine development (GO:0060996)|extension of a leading process involved in cell motility in cerebral cortex radial glia guided migration (GO:0021816)|filopodium assembly (GO:0046847)|lamellipodium assembly involved in ameboidal cell migration (GO:0003363)|negative regulation of neuron migration (GO:2001223)|neuron projection morphogenesis (GO:0048812)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine head (GO:0044327)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein homodimerization activity (GO:0042803)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			NS(1)|breast(1)|kidney(1)|lung(1)	4	Breast(84;0.137)					ACTGCCACAGCGGGAAGGTCA	0.542																																																0			1											33.0	37.0	35.0					1																	206632235		2006	4173	6179	204698858	SO:0001583	missense	23380			AB007925	CCDS73017.1	1q32.1	2014-08-13	2004-11-12	2004-11-12	ENSG00000163486	ENSG00000266028		"""Rho GTPase activating proteins"""	19751	protein-coding gene	gene with protein product		606524	"""formin binding protein 2"""	FNBP2		15046868, 11672528	Standard	XM_005277510		Approved	KIAA0456, ARHGAP34, SRGAP2A	uc001hdy.3	O75044	OTTHUMG00000184381	ENST00000414007.1:c.2354C>A	1.37:g.206632235C>A	ENSP00000390898:p.Ala785Glu	Somatic		Capture	Illumina GAIIx	4	204698858		Missense_Mutation	SNP	-	p.A243E	ENST00000414007.1	37	c.728		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.469656|5.469656	0.96274|0.96274	.|.	.|.	ENSG00000163486|ENSG00000163486	ENST00000414007;ENST00000419187|ENST00000295713	T;T|.	0.38722|.	2.94;1.12|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	0.053404|.	0.85682|.	D|.	0.000000|.	T|T	0.79839|0.79839	0.4515|0.4515	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.76898|0.76898	-0.2789|-0.2789	6|3	0.27785|.	T|.	0.31|.	.|.	19.609|19.609	0.95594|0.95594	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	E|R	785;243|838	ENSP00000390898:A785E;ENSP00000397990:A243E|.	ENSP00000390898:A785E|.	A|S	+|+	2|3	0|2	SRGAP2|SRGAP2	204698858|204698858	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.336000|7.336000	0.79245|0.79245	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	GCG|AGC	-	NULL		0.542	SRGAP2-201	KNOWN	basic	protein_coding	SRGAP2	protein_coding		C	NM_015326		204698858	1	no_stop_codon	ENST00000367123	ensembl	human	known	54_36p	missense	SNP	0.997	A
LAMB3	3914	genome.wustl.edu	37	1	209790790	209790790	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr1:209790790C>A	ENST00000356082.4	-	21	3327	c.3193G>T	c.(3193-3195)Gaa>Taa	p.E1065*	LAMB3_ENST00000391911.1_Nonsense_Mutation_p.E1065*|LAMB3_ENST00000367030.3_Nonsense_Mutation_p.E1065*	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	1065	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.E1065*(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		CTGGCACCTTCCGCAAGCTGC	0.627																																																1	Substitution - Nonsense(1)	ovary(1)	1											77.0	74.0	75.0					1																	209790790		2203	4300	6503	207857413	SO:0001587	stop_gained	3914			D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.3193G>T	1.37:g.209790790C>A	ENSP00000348384:p.Glu1065*	Somatic		Capture	Illumina GAIIx	4	207857413	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Nonsense_Mutation	SNP	HMMPfam_Laminin_EGF;HMMPfam_Laminin_N;superfamily_Galactose-binding domain-like;superfamily_Cytochrome c;superfamily_Spectrin repeat;superfamily_EGF/Laminin	p.E1065*	ENST00000356082.4	37	c.3193	CCDS1487.1	1	.	.	.	.	.	.	.	.	.	.	C	38	7.107272	0.98066	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030;ENST00000455193	.	.	.	5.77	1.44	0.22558	.	0.529886	0.20647	N	0.088292	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	6.6558	0.22986	0.0:0.6166:0.1404:0.2431	.	.	.	.	X	1065;1065;1065;134	.	ENSP00000348384:E1065X	E	-	1	0	LAMB3	207857413	0.000000	0.05858	0.005000	0.12908	0.276000	0.26787	-0.218000	0.09240	0.371000	0.24564	0.456000	0.33151	GAA	-	NULL		0.627	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB3	protein_coding	OTTHUMT00000088525.2	C	NM_000228		207857413	-1	no_errors	NM_000228	genbank	human	reviewed	54_36p	nonsense	SNP		A
CAPN9	10753	genome.wustl.edu	37	1	230928621	230928621	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr1:230928621A>T	ENST00000271971.2	+	17	1930	c.1817A>T	c.(1816-1818)gAc>gTc	p.D606V	CAPN9_ENST00000480004.1_3'UTR|RP11-99J16__A.2_ENST00000428480.1_RNA|RP11-99J16__A.2_ENST00000452640.1_RNA|CAPN9_ENST00000354537.1_Missense_Mutation_p.D580V|CAPN9_ENST00000366666.2_Missense_Mutation_p.D543V|RP11-99J16__A.2_ENST00000412344.1_RNA	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	606	Domain IV.|EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.D580V(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				TTTGATGCTGACAAGTCCGGC	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											157.0	159.0	158.0					1																	230928621		2203	4300	6503	228995244	SO:0001583	missense	10753			AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.1817A>T	1.37:g.230928621A>T	ENSP00000271971:p.Asp606Val	Somatic		Capture	Illumina GAIIx	4	228995244	B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	-	p.D606V	ENST00000271971.2	37	c.1817	CCDS1586.1	1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.304357	0.81136	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	T;T;T	0.77229	-1.08;-1.08;-1.08	5.49	5.49	0.81192	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.93028	0.7781	H	0.98965	4.385	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	0.999;1.0;0.996	D	0.95715	0.8761	10	0.87932	D	0	.	15.2417	0.73476	1.0:0.0:0.0:0.0	.	543;580;606	E7ESS6;O14815-2;O14815	.;.;CAN9_HUMAN	V	606;580;543	ENSP00000271971:D606V;ENSP00000346538:D580V;ENSP00000355626:D543V	ENSP00000271971:D606V	D	+	2	0	CAPN9	228995244	1.000000	0.71417	0.988000	0.46212	0.971000	0.66376	6.965000	0.76067	2.082000	0.62665	0.533000	0.62120	GAC	-	NULL		0.507	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN9	protein_coding	OTTHUMT00000092179.1	A	NM_006615		228995244	1	no_errors	NM_006615	genbank	human	reviewed	54_36p	missense	SNP	1	T
ZNF644	84146	genome.wustl.edu	37	1	91490273	91490273	+	5'Flank	SNP	C	C	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr1:91490273C>T	ENST00000337393.5	-	0	0				ZNF644_ENST00000361321.5_5'Flank|ZNF644_ENST00000467231.1_5'Flank	NM_201269.2	NP_958357.1	Q9H582	ZN644_HUMAN	zinc finger protein 644						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		AGAAGTGGAACCGACCCAAAA	0.458																																																0			1																																								91262861	SO:0001631	upstream_gene_variant	646784			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078		1.37:g.91490273C>T	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	91262861	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	RNA	SNP	-	NULL	ENST00000337393.5	37	NULL	CCDS731.1	1																																																																																			-	-		0.458	ZNF644-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC646784	protein_coding	OTTHUMT00000027846.2	C	NM_032186		91262861	1	pseudogene	XR_017249	genbank	human	model	54_36p	rna	SNP	1	T
PLD5	200150	genome.wustl.edu	37	1	242277237	242277237	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr1:242277237A>C	ENST00000536534.2	-	7	1266	c.1025T>G	c.(1024-1026)aTc>aGc	p.I342S	PLD5_ENST00000427495.1_Missense_Mutation_p.I280S|PLD5_ENST00000442594.2_Missense_Mutation_p.I250S			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	342						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.I250S(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CATGACAGCGATGTACACATA	0.453																																																1	Substitution - Missense(1)	ovary(1)	1											194.0	145.0	162.0					1																	242277237		2203	4300	6503	240343860	SO:0001583	missense	200150			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1025T>G	1.37:g.242277237A>C	ENSP00000440896:p.Ile342Ser	Somatic		Capture	Illumina GAIIx	4	240343860	A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	-	p.I250S	ENST00000536534.2	37	c.749	CCDS1621.2	1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.062365	0.76187	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.37411	1.2;1.2;1.2	5.48	5.48	0.80851	Phospholipase D/viral envelope (1);	0.000000	0.85682	D	0.000000	T	0.65238	0.2672	M	0.88241	2.94	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.72075	0.976;0.966;0.976	T	0.72811	-0.4180	10	0.87932	D	0	-14.6395	13.8095	0.63253	1.0:0.0:0.0:0.0	.	250;342;280	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	S	280;250;342	ENSP00000401285:I280S;ENSP00000414188:I250S;ENSP00000440896:I342S	ENSP00000401285:I280S	I	-	2	0	PLD5	240343860	1.000000	0.71417	0.992000	0.48379	0.892000	0.51952	7.485000	0.81204	2.078000	0.62432	0.523000	0.50628	ATC	-	NULL		0.453	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	protein_coding	OTTHUMT00000397213.2	A	NM_152666		240343860	-1	no_errors	NM_152666	genbank	human	provisional	54_36p	missense	SNP	1	C
C10orf2	56652	genome.wustl.edu	37	10	102748277	102748277	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr10:102748277A>T	ENST00000311916.2	+	1	495	c.310A>T	c.(310-312)Att>Ttt	p.I104F	MRPL43_ENST00000370236.1_5'Flank|MRPL43_ENST00000299179.5_5'Flank|C10orf2_ENST00000473656.1_Intron|MRPL43_ENST00000318325.2_5'Flank|C10orf2_ENST00000370228.1_Missense_Mutation_p.I104F|MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000342071.1_5'Flank|MRPL43_ENST00000318364.8_5'Flank|MRPL43_ENST00000370242.4_5'Flank|MRPL43_ENST00000370241.3_5'Flank|MRPL43_ENST00000477279.1_5'Flank|MRPL43_ENST00000370234.4_5'Flank|RP11-108L7.4_ENST00000447344.1_RNA	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	104					cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.I104F(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CAGCCTCTTCATTGACAAGAC	0.587																																																1	Substitution - Missense(1)	ovary(1)	10											119.0	125.0	123.0					10																	102748277		2203	4300	6503	102738267	SO:0001583	missense	56652			AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.310A>T	10.37:g.102748277A>T	ENSP00000309595:p.Ile104Phe	Somatic		Capture	Illumina GAIIx	4	102738267	B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Missense_Mutation	SNP	-	p.I104F	ENST00000311916.2	37	c.310	CCDS7506.1	10	.	.	.	.	.	.	.	.	.	.	A	18.44	3.625553	0.66901	.	.	ENSG00000107815	ENST00000311916;ENST00000370228	D;D	0.97041	-3.93;-4.22	5.51	5.51	0.81932	.	0.053009	0.64402	D	0.000001	D	0.97867	0.9299	M	0.65498	2.005	0.50039	D	0.999843	D;D	0.76494	0.999;0.999	D;D	0.68192	0.956;0.946	D	0.98348	1.0542	10	0.56958	D	0.05	-17.9654	14.4616	0.67453	1.0:0.0:0.0:0.0	.	104;104	Q96RR1-2;Q96RR1	.;PEO1_HUMAN	F	104	ENSP00000309595:I104F;ENSP00000359248:I104F	ENSP00000309595:I104F	I	+	1	0	C10orf2	102738267	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	5.098000	0.64548	2.096000	0.63516	0.374000	0.22700	ATT	-	NULL		0.587	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf2	protein_coding	OTTHUMT00000049886.1	A	NM_021830		102738267	1	no_errors	NM_021830	genbank	human	validated	54_36p	missense	SNP	1	T
CRTAC1	55118	genome.wustl.edu	37	10	99655652	99655652	+	Missense_Mutation	SNP	C	C	A	rs370948741		TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr10:99655652C>A	ENST00000370597.3	-	10	1662	c.1307G>T	c.(1306-1308)cGg>cTg	p.R436L	CRTAC1_ENST00000298819.4_Missense_Mutation_p.R436L|CRTAC1_ENST00000370591.2_Missense_Mutation_p.R436L	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	436						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.R436L(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		CTGATTGCCCCGGAAGACGGA	0.612																																																1	Substitution - Missense(1)	ovary(1)	10											91.0	78.0	83.0					10																	99655652		2203	4300	6503	99645642	SO:0001583	missense	55118			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.1307G>T	10.37:g.99655652C>A	ENSP00000359629:p.Arg436Leu	Somatic		Capture	Illumina GAIIx	4	99645642	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	SNP	HMMPfam_UnbV_ASPIC,HMMPfam_EGF_CA,HMMPfam_FG-GAP,superfamily_EGF/Laminin,superfamily_Integrin alpha N-terminal domain	p.R436L	ENST00000370597.3	37	c.1307	CCDS31266.1	10	.	.	.	.	.	.	.	.	.	.	C	16.53	3.148456	0.57151	.	.	ENSG00000095713	ENST00000413387;ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	T;T;T;T;T	0.76968	1.19;-1.06;1.19;-0.22;-0.23	5.26	5.26	0.73747	.	0.227351	0.36893	N	0.002353	T	0.68311	0.2987	L	0.42744	1.35	0.34848	D	0.741369	B;B;B	0.33198	0.339;0.304;0.401	B;B;B	0.33568	0.166;0.1;0.117	T	0.76044	-0.3103	10	0.62326	D	0.03	-15.4908	6.8522	0.24020	0.0:0.7845:0.0:0.2155	.	436;436;332	Q9NQ79-2;Q9NQ79;Q5T4F6	.;CRAC1_HUMAN;.	L	332;436;436;428;436	ENSP00000408445:R332L;ENSP00000359629:R436L;ENSP00000298819:R436L;ENSP00000310810:R428L;ENSP00000359623:R436L	ENSP00000298819:R436L	R	-	2	0	CRTAC1	99645642	1.000000	0.71417	1.000000	0.80357	0.535000	0.34838	3.227000	0.51262	2.423000	0.82170	0.655000	0.94253	CGG	-	NULL		0.612	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	CRTAC1	protein_coding	OTTHUMT00000049754.1	C	NM_018058		99645642	-1	no_errors	NM_018058	genbank	human	validated	54_36p	missense	SNP	0.996	A
PNLIPRP3	119548	genome.wustl.edu	37	10	118236234	118236234	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr10:118236234A>T	ENST00000369230.3	+	11	1389	c.1243A>T	c.(1243-1245)Agt>Tgt	p.S415C		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	415	PLAT.				lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)	p.S415C(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		AAACATTACAAGTGTTCAGTT	0.338																																																1	Substitution - Missense(1)	ovary(1)	10											119.0	118.0	118.0					10																	118236234		2203	4300	6503	118226224	SO:0001583	missense	119548			BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.1243A>T	10.37:g.118236234A>T	ENSP00000358232:p.Ser415Cys	Somatic		Capture	Illumina GAIIx	4	118226224		Missense_Mutation	SNP	-	p.S415C	ENST00000369230.3	37	c.1243	CCDS31292.1	10	.	.	.	.	.	.	.	.	.	.	A	12.64	1.998153	0.35226	.	.	ENSG00000203837	ENST00000369230	T	0.65178	-0.14	3.88	2.71	0.32032	Lipoxygenase, LH2 (2);Lipase/lipooxygenase, PLAT/LH2 (1);	0.640922	0.13650	N	0.372357	T	0.64638	0.2616	L	0.40543	1.245	0.22342	N	0.999188	D	0.55605	0.972	P	0.58520	0.84	T	0.53222	-0.8469	10	0.87932	D	0	.	7.5342	0.27700	0.893:0.0:0.107:0.0	.	415	Q17RR3	LIPR3_HUMAN	C	415	ENSP00000358232:S415C	ENSP00000358232:S415C	S	+	1	0	PNLIPRP3	118226224	0.891000	0.30450	0.247000	0.24249	0.148000	0.21650	1.114000	0.31196	0.617000	0.30160	-0.290000	0.09829	AGT	-	NULL		0.338	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIPRP3	protein_coding	OTTHUMT00000050520.1	A	XM_058404		118226224	1	no_errors	NM_001011709	genbank	human	validated	54_36p	missense	SNP	0.74	T
IGSF22	283284	genome.wustl.edu	37	11	18730933	18730933	+	Splice_Site	SNP	C	C	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr11:18730933C>T	ENST00000513874.1	-	18	3138		c.e18+1		RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22									p.?(1)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						TGTGTCCTCACCTGGTGGTGG	0.562																																																1	Unknown(1)	ovary(1)	11											60.0	62.0	61.0					11																	18730933		1989	4156	6145	18687509	SO:0001630	splice_region_variant	283284			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.2998+1G>A	11.37:g.18730933C>T		Somatic		Capture	Illumina GAIIx	4	18687509	A6NNA0|D6RGV7	Splice_Site	SNP	-	e16+1	ENST00000513874.1	37	c.2695+1	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	C	17.99	3.524059	0.64747	.	.	ENSG00000179057	ENST00000513874	.	.	.	4.46	3.51	0.40186	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5677	0.50815	0.1788:0.8212:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IGSF22	18687509	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.014000	0.49590	1.044000	0.40200	0.655000	0.94253	.	-	-		0.562	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	protein_coding	OTTHUMT00000360850.2	C	NM_173588	Intron	18687509	-1	no_errors	NM_173588	genbank	human	validated	54_36p	splice_site	SNP	1	T
CKAP5	9793	genome.wustl.edu	37	11	46818491	46818491	+	Splice_Site	SNP	C	C	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr11:46818491C>T	ENST00000529230.1	-	12	1385		c.e12-1		CKAP5_ENST00000415402.1_Splice_Site|CKAP5_ENST00000354558.3_Splice_Site|CKAP5_ENST00000312055.5_Splice_Site|CKAP5_ENST00000532321.1_5'Flank			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5						centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)		p.?(1)		breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						CATTGATGTGCTATAGTCCAG	0.383																																					Ovarian(4;85 273 2202 4844 13323)											1	Unknown(1)	ovary(1)	11											113.0	101.0	105.0					11																	46818491		2201	4299	6500	46775067	SO:0001630	splice_region_variant	9793				CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.1339-1G>A	11.37:g.46818491C>T		Somatic		Capture	Illumina GAIIx	4	46775067	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Splice_Site	SNP	-	e11-1	ENST00000529230.1	37	c.1339-1	CCDS31477.1	11	.	.	.	.	.	.	.	.	.	.	C	26.6	4.757873	0.89843	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5394	0.95268	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CKAP5	46775067	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.776000	0.85560	2.703000	0.92315	0.650000	0.86243	.	-	-		0.383	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP5	protein_coding	OTTHUMT00000390679.1	C	NM_014756	Intron	46775067	-1	no_errors	NM_001008938	genbank	human	validated	54_36p	splice_site	SNP	1	T
PATL1	219988	genome.wustl.edu	37	11	59423058	59423058	+	Silent	SNP	G	G	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr11:59423058G>C	ENST00000300146.9	-	8	1053	c.969C>G	c.(967-969)ccC>ccG	p.P323P		NM_152716.2	NP_689929.2	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog 1 (yeast)	323	Involved in RNA-binding.|Involved in nuclear foci localization.|Pro-rich.|Region N; interaction with decapping machinery.				cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)	p.P323P(1)		central_nervous_system(1)|endometrium(2)|lung(5)|ovary(1)|prostate(2)	11						GTGTAGCGGAGGGTGGAGCAC	0.552																																																1	Substitution - coding silent(1)	ovary(1)	11											61.0	64.0	63.0					11																	59423058		1980	4147	6127	59179634	SO:0001819	synonymous_variant	219988			AK094193	CCDS44613.1	11q12.1	2012-06-07	2007-10-18		ENSG00000166889	ENSG00000166889			26721	protein-coding gene	gene with protein product		614660				17936923	Standard	NM_152716		Approved	FLJ36874, Pat1b	uc001noe.4	Q86TB9	OTTHUMG00000167423	ENST00000300146.9:c.969C>G	11.37:g.59423058G>C		Somatic		Capture	Illumina GAIIx	Phase_III	59179634	B3KXT9|Q2TA86|Q6P166|Q8N9M6|Q8NI63	Silent	SNP	-	p.P180	ENST00000300146.9	37	c.540	CCDS44613.1	11																																																																																			-	NULL		0.552	PATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATL1	protein_coding	OTTHUMT00000394559.1	G	NM_152716		59179634	-1	no_errors	NM_152716	genbank	human	validated	54_36p	silent	SNP	0.908	C
SUV420H1	51111	genome.wustl.edu	37	11	67925805	67925805	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr11:67925805G>T	ENST00000304363.4	-	11	2361	c.2008C>A	c.(2008-2010)Cct>Act	p.P670T		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	670					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)	p.P670T(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						ACGGGTGAAGGAGCACAGTCT	0.488																																																1	Substitution - Missense(1)	ovary(1)	11											89.0	79.0	82.0					11																	67925805		2200	4294	6494	67682381	SO:0001583	missense	51111			AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.2008C>A	11.37:g.67925805G>T	ENSP00000305899:p.Pro670Thr	Somatic		Capture	Illumina GAIIx	4	67682381	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	HMMPfam_SET;superfamily_SET domain	p.P670T	ENST00000304363.4	37	c.2008	CCDS31623.1	11	.	.	.	.	.	.	.	.	.	.	G	17.40	3.379190	0.61735	.	.	ENSG00000110066	ENST00000304363	T	0.43688	0.94	5.04	3.15	0.36227	.	0.532175	0.19788	N	0.106057	T	0.26593	0.0650	N	0.19112	0.55	0.09310	N	0.999995	B	0.23442	0.085	B	0.19666	0.026	T	0.21008	-1.0258	10	0.72032	D	0.01	-5.0111	8.3334	0.32200	0.1448:0.1295:0.7257:0.0	.	670	Q4FZB7	SV421_HUMAN	T	670	ENSP00000305899:P670T	ENSP00000305899:P670T	P	-	1	0	SUV420H1	67682381	0.742000	0.28228	0.021000	0.16686	0.926000	0.56050	1.433000	0.34947	0.701000	0.31803	0.491000	0.48974	CCT	-	NULL		0.488	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H1	protein_coding	OTTHUMT00000318319.1	G	NM_017635		67682381	-1	no_errors	NM_017635	genbank	human	reviewed	54_36p	missense	SNP	0.71	T
CCDC60	160777	genome.wustl.edu	37	12	119937928	119937928	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr12:119937928C>A	ENST00000327554.2	+	6	1068	c.603C>A	c.(601-603)gaC>gaA	p.D201E	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	201								p.D201E(1)		endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TCAATAAGGACAAGTCCATGG	0.463																																																1	Substitution - Missense(1)	ovary(1)	12											108.0	110.0	109.0					12																	119937928		2203	4300	6503	118422311	SO:0001583	missense	160777			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.603C>A	12.37:g.119937928C>A	ENSP00000333374:p.Asp201Glu	Somatic		Capture	Illumina GAIIx	4	118422311		Missense_Mutation	SNP	-	p.D201E	ENST00000327554.2	37	c.603	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079237	0.36662	.	.	ENSG00000183273	ENST00000327554	T	0.21191	2.02	5.57	3.52	0.40303	.	0.109649	0.40302	N	0.001128	T	0.16769	0.0403	L	0.50993	1.605	0.80722	D	1	P	0.36683	0.565	B	0.33690	0.168	T	0.01800	-1.1271	9	.	.	.	-34.3501	8.7776	0.34771	0.1661:0.6731:0.1608:0.0	.	201	Q8IWA6	CCD60_HUMAN	E	201	ENSP00000333374:D201E	.	D	+	3	2	CCDC60	118422311	0.999000	0.42202	1.000000	0.80357	0.986000	0.74619	0.272000	0.18644	2.599000	0.87857	0.650000	0.86243	GAC	-	NULL		0.463	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	protein_coding	OTTHUMT00000401680.1	C	NM_178499		118422311	1	no_errors	NM_178499	genbank	human	validated	54_36p	missense	SNP	1	A
CNTN1	1272	genome.wustl.edu	37	12	41419103	41419103	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr12:41419103C>A	ENST00000551295.2	+	21	2792	c.2675C>A	c.(2674-2676)cCa>cAa	p.P892Q	CNTN1_ENST00000347616.1_Missense_Mutation_p.P892Q|CNTN1_ENST00000348761.2_Missense_Mutation_p.P881Q|CNTN1_ENST00000550305.1_3'UTR	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	892	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.P892Q(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TGTGGACCTCCAAGTGACATG	0.473																																																1	Substitution - Missense(1)	ovary(1)	12											170.0	181.0	177.0					12																	41419103		2203	4300	6503	39705370	SO:0001583	missense	1272			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2675C>A	12.37:g.41419103C>A	ENSP00000447006:p.Pro892Gln	Somatic		Capture	Illumina GAIIx	4	39705370	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_I-set;HMMPfam_ig;superfamily_Immunoglobulin	p.P892Q	ENST00000551295.2	37	c.2675	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501718	0.85176	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.57436	0.4;0.4;0.4	4.88	4.88	0.63580	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.179496	0.49916	D	0.000138	T	0.68256	0.2981	L	0.54323	1.7	0.80722	D	1	D;D	0.57257	0.974;0.979	D;D	0.67900	0.923;0.954	T	0.67929	-0.5543	10	0.48119	T	0.1	.	18.9334	0.92576	0.0:1.0:0.0:0.0	.	881;892	Q12860-2;Q12860	.;CNTN1_HUMAN	Q	892;892;881	ENSP00000447006:P892Q;ENSP00000325660:P892Q;ENSP00000261160:P881Q	ENSP00000325660:P892Q	P	+	2	0	CNTN1	39705370	1.000000	0.71417	0.997000	0.53966	0.884000	0.51177	7.174000	0.77620	2.631000	0.89168	0.655000	0.94253	CCA	-	HMMPfam_fn3		0.473	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	protein_coding	OTTHUMT00000403692.2	C	NM_001843		39705370	1	no_errors	NM_001843	genbank	human	reviewed	54_36p	missense	SNP	1	A
MARS	4141	genome.wustl.edu	37	12	57908505	57908505	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr12:57908505C>T	ENST00000262027.5	+	16	2104	c.1970C>T	c.(1969-1971)gCt>gTt	p.A657V	MARS_ENST00000315473.5_Missense_Mutation_p.A423V|RN7SL312P_ENST00000582079.1_RNA	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	657					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)	p.A657V(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CAACCAAGAGCTGGGATGTTT	0.502																																																1	Substitution - Missense(1)	ovary(1)	12											226.0	231.0	229.0					12																	57908505		2203	4300	6503	56194772	SO:0001583	missense	4141			X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.1970C>T	12.37:g.57908505C>T	ENSP00000262027:p.Ala657Val	Somatic		Capture	Illumina GAIIx	4	56194772	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	HMMPfam_WHEP-TRS;HMMPfam_GST_C;superfamily_S15/NS1 RNA-binding domain;superfamily_Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases;superfamily_Glutathione S-transferase (GST) C-terminal domain;superfamily_Thioredoxin-like;HMMPfam_tRNA-synt_1g;superfamily_Nucleotidylyl transferase;superfamily_Methionyl-tRNA synthetase (MetRS) Zn-domain	p.A657V	ENST00000262027.5	37	c.1970	CCDS8942.1	12	.	.	.	.	.	.	.	.	.	.	C	24.5	4.536665	0.85812	.	.	ENSG00000166986	ENST00000262027;ENST00000315473;ENST00000552914	T;T;T	0.39997	1.05;1.05;1.05	5.02	5.02	0.67125	Aminoacyl-tRNA synthetase, class I (M) (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.107328	0.64402	D	0.000007	T	0.30634	0.0771	N	0.11673	0.155	0.80722	D	1	B;B	0.23591	0.007;0.088	B;B	0.34180	0.013;0.177	T	0.10042	-1.0647	10	0.22109	T	0.4	-12.1823	17.6356	0.88121	0.0:1.0:0.0:0.0	.	423;657	A6NC17;P56192	.;SYMC_HUMAN	V	657;423;13	ENSP00000262027:A657V;ENSP00000314653:A423V;ENSP00000449787:A13V	ENSP00000262027:A657V	A	+	2	0	MARS	56194772	1.000000	0.71417	1.000000	0.80357	0.611000	0.37282	5.340000	0.65958	2.767000	0.95098	0.591000	0.81541	GCT	-	HMMPfam_tRNA-synt_1g		0.502	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS	protein_coding	OTTHUMT00000407014.1	C	NM_004990		56194772	1	no_errors	NM_004990	genbank	human	reviewed	54_36p	missense	SNP	1	T
TMEM132B	114795	genome.wustl.edu	37	12	126068411	126068411	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr12:126068411G>T	ENST00000299308.3	+	5	1301	c.1293G>T	c.(1291-1293)ttG>ttT	p.L431F		NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	431						integral component of membrane (GO:0016021)		p.L431F(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CCGAGGTTTTGAACACTGCCA	0.542																																																1	Substitution - Missense(1)	ovary(1)	12											227.0	222.0	224.0					12																	126068411		1983	4137	6120	124634364	SO:0001583	missense	114795			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1293G>T	12.37:g.126068411G>T	ENSP00000299308:p.Leu431Phe	Somatic		Capture	Illumina GAIIx	4	124634364	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	-	p.L431F	ENST00000299308.3	37	c.1293	CCDS41859.1	12	.	.	.	.	.	.	.	.	.	.	G	13.23	2.176264	0.38413	.	.	ENSG00000139364	ENST00000299308	T	0.52754	0.65	4.83	3.87	0.44632	.	0.000000	0.30464	U	0.009576	T	0.61375	0.2342	M	0.70595	2.14	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.62973	-0.6740	10	0.56958	D	0.05	.	6.589	0.22636	0.0979:0.2984:0.6038:0.0	.	431	Q14DG7	T132B_HUMAN	F	431	ENSP00000299308:L431F	ENSP00000299308:L431F	L	+	3	2	TMEM132B	124634364	0.997000	0.39634	1.000000	0.80357	0.157000	0.22087	0.274000	0.18680	2.218000	0.71995	0.655000	0.94253	TTG	-	NULL		0.542	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	protein_coding	OTTHUMT00000400043.1	G	NM_052907		124634364	1	no_errors	NM_052907	genbank	human	provisional	54_36p	missense	SNP	0.997	T
STARD13	90627	genome.wustl.edu	37	13	33716466	33716466	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr13:33716466A>T	ENST00000336934.5	-	4	484	c.368T>A	c.(367-369)gTg>gAg	p.V123E	STARD13_ENST00000255486.4_Missense_Mutation_p.V115E|STARD13_ENST00000399365.3_Missense_Mutation_p.V5E|STARD13_ENST00000487412.1_5'UTR	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	123					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)	p.V123E(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		TTGGAAGTTCACATCAAGTTT	0.378																																																1	Substitution - Missense(1)	ovary(1)	13											163.0	142.0	149.0					13																	33716466		2203	4300	6503	32614466	SO:0001583	missense	90627			AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.368T>A	13.37:g.33716466A>T	ENSP00000338785:p.Val123Glu	Somatic		Capture	Illumina GAIIx	4	32614466	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	HMMPfam_RhoGAP;HMMPfam_START;superfamily_GTPase activation domain GAP;HMMPfam_SAM_2;superfamily_Bet v1-like	p.V123E	ENST00000336934.5	37	c.368	CCDS9348.1	13	.	.	.	.	.	.	.	.	.	.	A	22.7	4.320195	0.81469	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934;ENST00000399364	T;T;T	0.39406	3.06;1.08;1.08	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.63745	0.2537	M	0.73962	2.25	0.80722	D	1	D;D;D;P	0.67145	0.991;0.996;0.996;0.785	P;D;P;P	0.68192	0.892;0.956;0.905;0.596	T	0.67749	-0.5590	10	0.62326	D	0.03	.	15.1508	0.72696	1.0:0.0:0.0:0.0	.	115;88;123;115	Q9Y3M8-5;Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;.;STA13_HUMAN;.	E	5;115;123;115	ENSP00000382300:V5E;ENSP00000255486:V115E;ENSP00000338785:V123E	ENSP00000255486:V115E	V	-	2	0	STARD13	32614466	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.348000	0.79366	2.122000	0.65172	0.528000	0.53228	GTG	-	NULL		0.378	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD13	protein_coding	OTTHUMT00000276118.2	A	NM_001243466		32614466	-1	no_errors	NM_178006	genbank	human	validated	54_36p	missense	SNP	1	T
CEBPE	1053	genome.wustl.edu	37	14	23588243	23588243	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr14:23588243A>T	ENST00000206513.5	-	1	582	c.58T>A	c.(58-60)Ttc>Atc	p.F20I		NM_001805.3	NP_001796.2	Q15744	CEBPE_HUMAN	CCAAT/enhancer binding protein (C/EBP), epsilon	20					cellular response to lipopolysaccharide (GO:0071222)|cytokine biosynthetic process (GO:0042089)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|macrophage differentiation (GO:0030225)|phagocytosis (GO:0006909)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.F20I(1)		large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)	9	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.0064)		CCCCCTGAGAACTCGAGTGGC	0.682																																					NSCLC(63;1230 1818 14565 22565)											1	Substitution - Missense(1)	ovary(1)	14											20.0	24.0	23.0					14																	23588243		2197	4295	6492	22658083	SO:0001583	missense	1053				CCDS9589.1	14q11.2	2014-09-17			ENSG00000092067	ENSG00000092067		"""basic leucine zipper proteins"""	1836	protein-coding gene	gene with protein product		600749				8661101	Standard	NM_001805		Approved	CRP1	uc001wiv.2	Q15744	OTTHUMG00000028719	ENST00000206513.5:c.58T>A	14.37:g.23588243A>T	ENSP00000206513:p.Phe20Ile	Somatic		Capture	Illumina GAIIx	4	22658083	Q15745|Q8IYI2|Q99803	Missense_Mutation	SNP	HMMPfam_bZIP_2	p.F20I	ENST00000206513.5	37	c.58	CCDS9589.1	14	.	.	.	.	.	.	.	.	.	.	A	12.66	2.003840	0.35320	.	.	ENSG00000092067	ENST00000206513	T	0.29655	1.56	4.24	4.24	0.50183	.	0.271190	0.37304	N	0.002148	T	0.16557	0.0398	L	0.29908	0.895	0.35997	D	0.837126	P	0.42827	0.791	B	0.31751	0.135	T	0.18967	-1.0320	10	0.22706	T	0.39	-26.9489	9.2637	0.37627	0.8183:0.1817:0.0:0.0	.	20	Q15744	CEBPE_HUMAN	I	20	ENSP00000206513:F20I	ENSP00000206513:F20I	F	-	1	0	CEBPE	22658083	0.733000	0.28132	1.000000	0.80357	0.741000	0.42261	0.165000	0.16564	1.784000	0.52394	0.402000	0.26972	TTC	-	NULL		0.682	CEBPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEBPE	protein_coding	OTTHUMT00000071716.2	A	NM_001805		22658083	-1	no_errors	NM_001805	genbank	human	reviewed	54_36p	missense	SNP	1	T
RTN1	6252	genome.wustl.edu	37	14	60212554	60212554	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr14:60212554G>T	ENST00000267484.5	-	2	1222	c.887C>A	c.(886-888)aCc>aAc	p.T296N		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	296					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.T296N(1)		central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		CTTCTCTTGGGTAGTGGTTTC	0.498																																																1	Substitution - Missense(1)	ovary(1)	14											100.0	94.0	96.0					14																	60212554		2203	4300	6503	59282307	SO:0001583	missense	6252			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.887C>A	14.37:g.60212554G>T	ENSP00000267484:p.Thr296Asn	Somatic		Capture	Illumina GAIIx	4	59282307	Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	Reticulon;HMMPfam_Reticulon	p.T296N	ENST00000267484.5	37	c.887	CCDS9740.1	14	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285845	0.23478	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.23754	1.89	5.53	3.68	0.42216	.	0.756701	0.12837	N	0.435101	T	0.17746	0.0426	L	0.57536	1.79	0.09310	N	0.999991	P	0.40144	0.704	B	0.31442	0.13	T	0.15954	-1.0419	10	0.15066	T	0.55	.	4.0203	0.09662	0.0755:0.2649:0.425:0.2346	.	296	Q16799	RTN1_HUMAN	N	296;222	ENSP00000267484:T296N	ENSP00000267484:T296N	T	-	2	0	RTN1	59282307	0.596000	0.26866	0.011000	0.14972	0.954000	0.61252	0.752000	0.26362	0.670000	0.31165	0.557000	0.71058	ACC	-	NULL		0.498	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	protein_coding	OTTHUMT00000072278.2	G			59282307	-1	no_errors	NM_021136	genbank	human	reviewed	54_36p	missense	SNP	0.25	T
VSX2	338917	genome.wustl.edu	37	14	74711917	74711917	+	Missense_Mutation	SNP	G	G	A	rs573993188		TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr14:74711917G>A	ENST00000261980.2	+	3	595	c.505G>A	c.(505-507)Gaa>Aaa	p.E169K		NM_182894.2	NP_878314.1	P58304	VSX2_HUMAN	visual system homeobox 2	169					cell fate commitment (GO:0045165)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.E169K(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00154)		GGCATTCAACGAAGCCCACTA	0.562																																																1	Substitution - Missense(1)	ovary(1)	14											78.0	66.0	70.0					14																	74711917		2203	4300	6503	73781670	SO:0001583	missense	338917			AC005519	CCDS9827.1	14q24.3	2011-06-20	2007-08-21	2007-08-21		ENSG00000119614		"""Homeoboxes / PRD class"""	1975	protein-coding gene	gene with protein product		142993	"""C elegans ceh-10 homeo domain-containing homolog"", ""ceh-10 homeo domain containing homolog (C. elegans)"", ""ceh-10 homeodomain containing homolog (C. elegans)"""	HOX10, CHX10		1973146	Standard	NM_182894		Approved	RET1	uc001xpq.3	P58304		ENST00000261980.2:c.505G>A	14.37:g.74711917G>A	ENSP00000261980:p.Glu169Lys	Somatic		Capture	Illumina GAIIx	4	73781670	A1A4X6	Missense_Mutation	SNP	HMMPfam_Homeobox;HMMPfam_OAR;superfamily_Homeodomain-like	p.E169K	ENST00000261980.2	37	c.505	CCDS9827.1	14	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717386	0.89205	.	.	ENSG00000119614	ENST00000261980	D	0.96041	-3.89	4.82	4.82	0.62117	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.93350	0.7880	N	0.02721	-0.515	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.93260	0.6642	10	0.25751	T	0.34	.	18.0779	0.89433	0.0:0.0:1.0:0.0	.	169	P58304	VSX2_HUMAN	K	169	ENSP00000261980:E169K	ENSP00000261980:E169K	E	+	1	0	VSX2	73781670	1.000000	0.71417	0.963000	0.40424	0.914000	0.54420	7.566000	0.82347	2.502000	0.84385	0.655000	0.94253	GAA	-	NULL		0.562	VSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSX2	protein_coding	OTTHUMT00000412323.1	G	NM_182894		73781670	1	no_errors	NM_182894	genbank	human	validated	54_36p	missense	SNP	1	A
TDRD9	122402	genome.wustl.edu	37	14	104482383	104482383	+	Silent	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr14:104482383G>T	ENST00000409874.4	+	22	2337	c.2289G>T	c.(2287-2289)gcG>gcT	p.A763A	RN7SL634P_ENST00000485467.2_RNA|TDRD9_ENST00000339063.5_Silent_p.A763A	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	763					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.A478A(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				AGGAGATGGCGGTGAGGGAGC	0.498																																																1	Substitution - coding silent(1)	ovary(1)	14											43.0	44.0	44.0					14																	104482383		2203	4299	6502	103552136	SO:0001819	synonymous_variant	122402			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.2289G>T	14.37:g.104482383G>T		Somatic		Capture	Illumina GAIIx	4	103552136	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Silent	SNP	-	p.A478	ENST00000409874.4	37	c.1434	CCDS9987.2	14	.	.	.	.	.	.	.	.	.	.	G	0.063	-1.220449	0.01530	.	.	ENSG00000156414	ENST00000557332	.	.	.	4.84	-9.68	0.00528	.	.	.	.	.	T	0.30759	0.0775	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41251	-0.9519	4	.	.	.	.	0.3254	0.00310	0.1911:0.227:0.2047:0.3772	.	.	.	.	C	490	.	.	G	+	1	0	TDRD9	103552136	0.000000	0.05858	0.011000	0.14972	0.056000	0.15407	-2.682000	0.00836	-2.849000	0.00332	-1.710000	0.00715	GGT	-	NULL		0.498	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD9	protein_coding	OTTHUMT00000328325.3	G	NM_153046		103552136	1	no_errors	NM_153046	genbank	human	validated	54_36p	silent	SNP	0.025	T
VPS18	57617	genome.wustl.edu	37	15	41193072	41193072	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr15:41193072G>A	ENST00000220509.5	+	4	2395	c.2056G>A	c.(2056-2058)Gct>Act	p.A686T	VPS18_ENST00000558474.1_Intron	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	686					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)	p.A686T(1)		autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		TCTGGAGCAGGCTGGGGCCAG	0.637																																																1	Substitution - Missense(1)	ovary(1)	15											71.0	68.0	69.0					15																	41193072		2203	4300	6503	38980364	SO:0001583	missense	57617			AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.2056G>A	15.37:g.41193072G>A	ENSP00000220509:p.Ala686Thr	Somatic		Capture	Illumina GAIIx	Phase_III	38980364	Q8TCG0|Q96DI3|Q9H268	Missense_Mutation	SNP	-	p.A686T	ENST00000220509.5	37	c.2056	CCDS10069.1	15	.	.	.	.	.	.	.	.	.	.	G	23.7	4.445342	0.83993	.	.	ENSG00000104142	ENST00000220509	T	0.43688	0.94	5.93	5.93	0.95920	.	0.045909	0.85682	D	0.000000	T	0.42359	0.1199	L	0.46157	1.445	0.80722	D	1	B	0.32968	0.392	B	0.37989	0.262	T	0.16748	-1.0392	10	0.10377	T	0.69	-14.2638	20.3437	0.98782	0.0:0.0:1.0:0.0	.	686	Q9P253	VPS18_HUMAN	T	686	ENSP00000220509:A686T	ENSP00000220509:A686T	A	+	1	0	VPS18	38980364	1.000000	0.71417	0.995000	0.50966	0.888000	0.51559	6.652000	0.74377	2.815000	0.96918	0.561000	0.74099	GCT	-	NULL		0.637	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS18	protein_coding	OTTHUMT00000252443.2	G			38980364	1	no_errors	NM_020857	genbank	human	reviewed	54_36p	missense	SNP	1	A
GPR139	124274	genome.wustl.edu	37	16	20043233	20043233	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr16:20043233C>A	ENST00000570682.1	-	2	1186	c.886G>T	c.(886-888)Gca>Tca	p.A296S		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	296					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)	p.A296S(1)		autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						GTGGCGGCTGCCATGGTGCGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	16											116.0	113.0	114.0					16																	20043233		2203	4300	6503	19950734	SO:0001583	missense	124274			AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.886G>T	16.37:g.20043233C>A	ENSP00000458791:p.Ala296Ser	Somatic		Capture	Illumina GAIIx	4	19950734	A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	-	p.A296S	ENST00000570682.1	37	c.886	CCDS32398.1	16	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324215	0.81580	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.56934	0.2019	N	0.19112	0.55	0.58432	D	0.999999	D	0.63880	0.993	P	0.52957	0.714	T	0.62025	-0.6941	9	0.62326	D	0.03	-19.5674	18.4466	0.90686	0.0:1.0:0.0:0.0	.	296	Q6DWJ6	GP139_HUMAN	S	296	.	ENSP00000370779:A296S	A	-	1	0	GPR139	19950734	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.484000	0.81180	2.581000	0.87130	0.655000	0.94253	GCA	-	NULL		0.507	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR139	protein_coding	OTTHUMT00000438522.1	C	NM_001002911		19950734	-1	no_errors	NM_001002911	genbank	human	validated	54_36p	missense	SNP	1	A
GPR139	124274	genome.wustl.edu	37	16	20043353	20043353	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr16:20043353G>A	ENST00000570682.1	-	2	1066	c.766C>T	c.(766-768)Ccc>Tcc	p.P256S		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	256					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)	p.P256S(1)		autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						TTCTGGATGGGCGCCCCATAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	16											61.0	66.0	64.0					16																	20043353		2203	4300	6503	19950854	SO:0001583	missense	124274			AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.766C>T	16.37:g.20043353G>A	ENSP00000458791:p.Pro256Ser	Somatic		Capture	Illumina GAIIx	4	19950854	A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	-	p.P256S	ENST00000570682.1	37	c.766	CCDS32398.1	16	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253491	0.39797	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.72	5.72	0.89469	GPCR, rhodopsin-like superfamily (1);	0.054949	0.85682	D	0.000000	T	0.44932	0.1317	N	0.20986	0.625	0.58432	D	0.999999	B	0.28933	0.228	B	0.33454	0.164	T	0.36890	-0.9729	9	0.05620	T	0.96	-52.7686	18.8716	0.92317	0.0:0.0:1.0:0.0	.	256	Q6DWJ6	GP139_HUMAN	S	256	.	ENSP00000370779:P256S	P	-	1	0	GPR139	19950854	1.000000	0.71417	0.992000	0.48379	0.988000	0.76386	9.471000	0.97696	2.694000	0.91930	0.655000	0.94253	CCC	-	NULL		0.532	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR139	protein_coding	OTTHUMT00000438522.1	G	NM_001002911		19950854	-1	no_errors	NM_001002911	genbank	human	validated	54_36p	missense	SNP	1	A
FBRS	64319	genome.wustl.edu	37	16	30680724	30680724	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr16:30680724G>T	ENST00000287468.5	+	12	1404	c.1141G>T	c.(1141-1143)Ggt>Tgt	p.G381C	FBRS_ENST00000356166.6_Missense_Mutation_p.G901C|FBRS_ENST00000568722.1_Missense_Mutation_p.G293C|FBRS_ENST00000395073.2_Missense_Mutation_p.G293C	NM_001105079.1	NP_001098549.1	Q9HAH7	FBRS_HUMAN	fibrosin	381	Pro-rich.							p.G381C(1)		ovary(1)	1			Colorectal(24;0.103)			CTATGAGGCGGGTGAGGAGCT	0.677																																																1	Substitution - Missense(1)	ovary(1)	16											28.0	34.0	32.0					16																	30680724		2194	4293	6487	30588225	SO:0001583	missense	64319			AK021680		16p11.2	2008-02-05	2007-04-18	2007-04-18	ENSG00000156860	ENSG00000156860			20442	protein-coding gene	gene with protein product		608601	"""fibrosin 1"""	FBS1		7892239, 9809749	Standard	NM_001105079		Approved	FBS, FLJ11618	uc002dzd.4	Q9HAH7	OTTHUMG00000132390	ENST00000287468.5:c.1141G>T	16.37:g.30680724G>T	ENSP00000287468:p.Gly381Cys	Somatic		Capture	Illumina GAIIx	4	30588225	B4DP86|Q96CI9|Q9H9X4	Missense_Mutation	SNP	-	p.G381C	ENST00000287468.5	37	c.1141		16	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914066	0.52546	.	.	ENSG00000156860	ENST00000356166;ENST00000287468;ENST00000395073	T	0.36340	1.26	5.09	5.09	0.68999	.	0.092218	0.44483	D	0.000446	T	0.42607	0.1210	N	0.22421	0.69	0.35164	D	0.770954	D	0.89917	1.0	D	0.76575	0.988	T	0.53933	-0.8368	10	0.66056	D	0.02	-2.9202	9.401	0.38433	0.0936:0.0:0.9064:0.0	.	381	Q9HAH7	FBRS_HUMAN	C	901;381;293	ENSP00000348489:G901C	ENSP00000287468:G381C	G	+	1	0	FBRS	30588225	1.000000	0.71417	0.968000	0.41197	0.962000	0.63368	4.547000	0.60712	2.656000	0.90262	0.561000	0.74099	GGT	-	NULL		0.677	FBRS-201	KNOWN	basic|appris_principal	protein_coding	FBRS	protein_coding		G	NM_022452		30588225	1	no_errors	NM_001105079	genbank	human	validated	54_36p	missense	SNP	0.91	T
ITGAX	3687	genome.wustl.edu	37	16	31374588	31374588	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr16:31374588A>C	ENST00000268296.4	+	14	1724	c.1603A>C	c.(1603-1605)Aag>Cag	p.K535Q	ITGAX_ENST00000562522.1_Missense_Mutation_p.K535Q	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	535					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.K535Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						GAATGGGGACAAGCTGACAGA	0.632																																																1	Substitution - Missense(1)	ovary(1)	16											130.0	137.0	135.0					16																	31374588		2197	4300	6497	31282089	SO:0001583	missense	3687			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1603A>C	16.37:g.31374588A>C	ENSP00000268296:p.Lys535Gln	Somatic		Capture	Illumina GAIIx	4	31282089	Q8IVA6	Missense_Mutation	SNP	HMMPfam_VWA;HMMPfam_Integrin_alpha;HMMPfam_FG-GAP;HMMPfam_Integrin_alpha2;superfamily_vWA-like;superfamily_Integrin domains;superfamily_Integrin alpha N-terminal domain	p.K535Q	ENST00000268296.4	37	c.1603	CCDS10711.1	16	.	.	.	.	.	.	.	.	.	.	A	6.341	0.430926	0.12045	.	.	ENSG00000140678	ENST00000268296	T	0.68025	-0.3	4.03	-5.64	0.02466	.	.	.	.	.	T	0.49115	0.1538	L	0.39147	1.195	0.09310	N	1	B	0.20368	0.044	B	0.16289	0.015	T	0.29427	-1.0012	9	0.27785	T	0.31	.	7.547	0.27772	0.2119:0.5197:0.2684:0.0	.	535	P20702	ITAX_HUMAN	Q	535	ENSP00000268296:K535Q	ENSP00000268296:K535Q	K	+	1	0	ITGAX	31282089	0.002000	0.14202	0.063000	0.19743	0.264000	0.26372	-0.188000	0.09642	-1.191000	0.02695	0.377000	0.23210	AAG	-	HMMPfam_FG-GAP		0.632	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	protein_coding	OTTHUMT00000255628.2	A	NM_000887		31282089	1	no_errors	NM_000887	genbank	human	reviewed	54_36p	missense	SNP	0.2	C
RBL2	5934	genome.wustl.edu	37	16	53524061	53524061	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr16:53524061G>T	ENST00000262133.6	+	22	3406	c.3269G>T	c.(3268-3270)aGt>aTt	p.S1090I	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Missense_Mutation_p.S469I	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	1090					chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)	p.S1090I(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GAAATTAATAGTATGATACGC	0.333																																																1	Substitution - Missense(1)	ovary(1)	16											56.0	60.0	59.0					16																	53524061		2198	4300	6498	52081562	SO:0001583	missense	5934			X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.3269G>T	16.37:g.53524061G>T	ENSP00000262133:p.Ser1090Ile	Somatic		Capture	Illumina GAIIx	Phase_III	52081562	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	RB_B,HMMPfam_RB_B,RB_A,HMMPfam_RB_A	p.S1090I	ENST00000262133.6	37	c.3269	CCDS10748.1	16	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029398	0.75504	.	.	ENSG00000103479	ENST00000262133;ENST00000379935;ENST00000544545	T;T	0.55588	0.51;0.51	5.63	5.63	0.86233	.	0.042083	0.85682	D	0.000000	T	0.67202	0.2868	M	0.63843	1.955	0.30883	N	0.731171	D;D;D	0.56521	0.965;0.964;0.976	P;P;P	0.56088	0.742;0.791;0.675	T	0.68603	-0.5365	10	0.62326	D	0.03	-26.1697	20.0401	0.97581	0.0:0.0:1.0:0.0	.	469;800;1090	B7Z913;E9PG04;Q08999	.;.;RBL2_HUMAN	I	1090;800;469	ENSP00000262133:S1090I;ENSP00000444685:S469I	ENSP00000262133:S1090I	S	+	2	0	RBL2	52081562	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.890000	0.75633	2.805000	0.96524	0.655000	0.94253	AGT	-	NULL		0.333	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL2	protein_coding	OTTHUMT00000256908.3	G	NM_005611		52081562	1	no_errors	NM_005611	genbank	human	validated	54_36p	missense	SNP	1	T
HYDIN	54768	genome.wustl.edu	37	16	71103360	71103360	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr16:71103360A>T	ENST00000393567.2	-	14	1934	c.1784T>A	c.(1783-1785)aTc>aAc	p.I595N	HYDIN_ENST00000321489.5_Missense_Mutation_p.I595N|HYDIN_ENST00000448089.2_Missense_Mutation_p.I595N|HYDIN_ENST00000541601.1_Missense_Mutation_p.I612N|HYDIN_ENST00000538248.1_Missense_Mutation_p.I622N|HYDIN_ENST00000288168.10_Missense_Mutation_p.I612N|HYDIN_ENST00000543639.1_5'UTR|HYDIN_ENST00000448691.1_Missense_Mutation_p.I595N|HYDIN_ENST00000393550.2_Missense_Mutation_p.I610N	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	595					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.I595N(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				AGTCATGGGGATCAAAGAGGT	0.443																																																2	Substitution - Missense(2)	ovary(2)	16											28.0	29.0	29.0					16																	71103360		2196	4297	6493	69660861	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.1784T>A	16.37:g.71103360A>T	ENSP00000377197:p.Ile595Asn	Somatic		Capture	Illumina GAIIx	4	69660861	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	-	p.I595N	ENST00000393567.2	37	c.1784	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	A	17.74	3.464288	0.63513	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489;ENST00000538248;ENST00000541601;ENST00000288168;ENST00000393550	T;T;T;T;T;T;T;T	0.20881	5.17;3.45;3.48;3.48;3.47;3.48;3.02;2.04	4.98	4.98	0.66077	.	0.286356	0.17311	U	0.178898	T	0.36413	0.0966	L	0.41492	1.28	0.24195	N	0.995539	P;P;D;P;P	0.65815	0.938;0.938;0.995;0.876;0.471	P;P;D;P;B	0.66847	0.905;0.905;0.947;0.698;0.323	T	0.13098	-1.0522	10	0.66056	D	0.02	.	13.6945	0.62569	1.0:0.0:0.0:0.0	.	622;612;612;595;595	B4DRN4;F5H6V3;F8WD03;Q4G0P3-5;F8WD23	.;.;.;.;.	N	595;595;595;595;595;622;612;612;610	ENSP00000377197:I595N;ENSP00000398544:I595N;ENSP00000394826:I595N;ENSP00000314736:I595N;ENSP00000444970:I622N;ENSP00000437341:I612N;ENSP00000288168:I612N;ENSP00000377181:I610N	ENSP00000288168:I612N	I	-	2	0	HYDIN	69660861	1.000000	0.71417	0.997000	0.53966	0.620000	0.37586	6.983000	0.76180	1.880000	0.54463	0.438000	0.28831	ATC	-	NULL		0.443	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	protein_coding	OTTHUMT00000398624.3	A			69660861	-1	no_errors	NM_032821	genbank	human	validated	54_36p	missense	SNP	1	T
Unknown	0	genome.wustl.edu	37	17	60214287	60214287	+	IGR	SNP	C	C	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr17:60214287C>A								Y_RNA (14505 upstream) : TBC1D3P2 (127778 downstream)																							TTTTTTTTGGCAAAAGAGCTT	0.502																																																0			17																																								57569069	SO:0001628	intergenic_variant	284167																															17.37:g.60214287C>A		Somatic		Capture	Illumina GAIIx	4	57569069		RNA	SNP	-	NULL		37	NULL		17																																																																																			-	-	0	0.502					LOC284167			C			57569069	-1	pseudogene	XR_017049	genbank	human	model	54_36p	rna	SNP	0.768	A
TP53	7157	genome.wustl.edu	37	17	7578479	7578479	+	Missense_Mutation	SNP	G	G	A	rs28934874|rs137852790|rs137852791		TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr17:7578479G>A	ENST00000269305.4	-	5	640	c.451C>T	c.(451-453)Ccc>Tcc	p.P151S	TP53_ENST00000413465.2_Missense_Mutation_p.P151S|TP53_ENST00000445888.2_Missense_Mutation_p.P151S|TP53_ENST00000359597.4_Missense_Mutation_p.P151S|TP53_ENST00000420246.2_Missense_Mutation_p.P151S|TP53_ENST00000455263.2_Missense_Mutation_p.P151S|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	151	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934874). {ECO:0000269|PubMed:7682763}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P151S(68)|p.P151T(16)|p.P151A(13)|p.P152fs*18(9)|p.0?(8)|p.T150fs*16(6)|p.P151fs*30(6)|p.?(5)|p.P58A(2)|p.P58S(2)|p.P19A(2)|p.P19S(2)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.P58T(1)|p.S149fs*17(1)|p.Q144_G154del11(1)|p.Q144fs*16(1)|p.P19T(1)|p.P152fs*14(1)|p.T18fs*16(1)|p.T150_P151delTP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGGCGGGGGTGTGGAATCA	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	156	Substitution - Missense(107)|Deletion - Frameshift(23)|Whole gene deletion(8)|Deletion - In frame(7)|Insertion - Frameshift(6)|Unknown(5)	upper_aerodigestive_tract(20)|large_intestine(17)|ovary(16)|lung(15)|oesophagus(12)|endometrium(11)|stomach(9)|breast(9)|central_nervous_system(7)|liver(7)|skin(7)|haematopoietic_and_lymphoid_tissue(5)|soft_tissue(4)|urinary_tract(4)|prostate(4)|bone(4)|vulva(2)|pancreas(2)|biliary_tract(1)	17	GRCh37	CM012662|CM941326	TP53	M	rs28934874						55.0	55.0	55.0					17																	7578479		2203	4300	6503	7519204	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.451C>T	17.37:g.7578479G>A	ENSP00000269305:p.Pro151Ser	Somatic		Capture	Illumina GAIIx	4	7519204	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.P151S	ENST00000269305.4	37	c.451	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.73	3.460739	0.63513	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99881	-7.47;-7.47;-7.47;-7.47;-7.47;-7.47;-7.47;-7.47;-7.47	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110207	0.64402	D	0.000007	D	0.99894	0.9949	M	0.87038	2.855	0.54753	D	0.999985	D;P;P;P;D;P;D	0.89917	0.99;0.941;0.92;0.835;0.98;0.953;1.0	P;P;P;P;P;P;D	0.97110	0.793;0.749;0.814;0.652;0.837;0.837;1.0	D	0.96419	0.9310	10	0.87932	D	0	-14.1156	17.4784	0.87667	0.0:0.0:1.0:0.0	rs28934874	112;151;151;58;151;151;151	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	S	151;151;151;151;151;151;140;58;19;58;19;151	ENSP00000410739:P151S;ENSP00000352610:P151S;ENSP00000269305:P151S;ENSP00000398846:P151S;ENSP00000391127:P151S;ENSP00000391478:P151S;ENSP00000425104:P19S;ENSP00000423862:P58S;ENSP00000424104:P151S	ENSP00000269305:P151S	P	-	1	0	TP53	7519204	1.000000	0.71417	0.971000	0.41717	0.067000	0.16453	7.823000	0.86660	2.804000	0.96469	0.655000	0.94253	CCC	-	HMMPfam_P53		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7519204	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	A
TNRC6C	57690	genome.wustl.edu	37	17	76046839	76046839	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr17:76046839G>T	ENST00000588061.1	+	5	2423	c.1696G>T	c.(1696-1698)Gac>Tac	p.D566Y	TNRC6C_ENST00000588847.1_Missense_Mutation_p.D566Y|TNRC6C_ENST00000301624.4_Missense_Mutation_p.D566Y|TNRC6C_ENST00000335749.4_Missense_Mutation_p.D566Y|TNRC6C_ENST00000544502.1_Missense_Mutation_p.D566Y|TNRC6C_ENST00000541771.1_Missense_Mutation_p.D566Y			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	566	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.D566Y(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AAATCAGGAGGACAAGTCACC	0.582																																																1	Substitution - Missense(1)	ovary(1)	17											53.0	57.0	56.0					17																	76046839		2026	4186	6212	73558434	SO:0001583	missense	57690			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1696G>T	17.37:g.76046839G>T	ENSP00000468647:p.Asp566Tyr	Somatic		Capture	Illumina GAIIx	4	73558434	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	-	p.D566Y	ENST00000588061.1	37	c.1696	CCDS45798.1	17	.	.	.	.	.	.	.	.	.	.	G	16.97	3.269088	0.59540	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.16073	2.37;2.37;2.37;2.37	5.75	5.75	0.90469	.	0.147934	0.64402	D	0.000007	T	0.43055	0.1230	M	0.64997	1.995	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.996;0.997;0.979	T	0.13072	-1.0523	10	0.62326	D	0.03	-27.8981	19.9417	0.97165	0.0:0.0:1.0:0.0	.	566;566;566	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	Y	566	ENSP00000336783:D566Y;ENSP00000301624:D566Y;ENSP00000440310:D566Y;ENSP00000442421:D566Y	ENSP00000301624:D566Y	D	+	1	0	TNRC6C	73558434	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.784000	0.85713	2.720000	0.93068	0.655000	0.94253	GAC	-	NULL		0.582	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	protein_coding	OTTHUMT00000395947.1	G	NM_018996		73558434	1	no_errors	NM_018996	genbank	human	validated	54_36p	missense	SNP	1	T
GALNT1	2589	genome.wustl.edu	37	18	33272183	33272183	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr18:33272183G>A	ENST00000269195.5	+	8	1301	c.1198G>A	c.(1198-1200)Gtt>Att	p.V400I	GALNT1_ENST00000537549.1_Missense_Mutation_p.V340I	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	400					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.V400I(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						ATCGTCAAGAGTTGGTCTAAG	0.333																																																1	Substitution - Missense(1)	ovary(1)	18											149.0	153.0	152.0					18																	33272183		2203	4298	6501	31526181	SO:0001583	missense	2589				CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.1198G>A	18.37:g.33272183G>A	ENSP00000269195:p.Val400Ile	Somatic		Capture	Illumina GAIIx	4	31526181	Q86TJ7|Q9UM86	Missense_Mutation	SNP	HMMPfam_Ricin_B_lectin;HMMPfam_Glycos_transf_2;superfamily_Ricin B-like lectins;superfamily_Nucleotide-diphospho-sugar transferases	p.V400I	ENST00000269195.5	37	c.1198	CCDS11915.1	18	.	.	.	.	.	.	.	.	.	.	G	7.446	0.641671	0.14451	.	.	ENSG00000141429	ENST00000537748;ENST00000269195;ENST00000537549	T;T	0.29142	1.58;1.58	5.6	-0.271	0.12922	.	0.569932	0.19834	N	0.105024	T	0.14356	0.0347	N	0.10618	0.005	0.22253	N	0.999256	B	0.06786	0.001	B	0.09377	0.004	T	0.23904	-1.0175	10	0.19147	T	0.46	.	13.4837	0.61353	0.1003:0.3514:0.5483:0.0	.	400	Q10472	GALT1_HUMAN	I	400;400;340	ENSP00000269195:V400I;ENSP00000440910:V340I	ENSP00000269195:V400I	V	+	1	0	GALNT1	31526181	0.872000	0.30054	0.981000	0.43875	0.985000	0.73830	0.691000	0.25467	-0.008000	0.14320	-0.165000	0.13383	GTT	-	NULL		0.333	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT1	protein_coding	OTTHUMT00000255771.2	G	NM_020474		31526181	1	no_errors	NM_020474	genbank	human	reviewed	54_36p	missense	SNP	0.78	A
SLC14A2	8170	genome.wustl.edu	37	18	43262376	43262376	+	Silent	SNP	G	G	A	rs143610580		TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr18:43262376G>A	ENST00000255226.6	+	20	3471	c.2655G>A	c.(2653-2655)ccG>ccA	p.P885P	SLC14A2_ENST00000586448.1_Silent_p.P885P|SLC14A2_ENST00000589658.1_Silent_p.P362P|RP11-116O18.3_ENST00000589510.1_RNA	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	885					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)	p.P885P(1)		NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACAAGCTCCCGCTCAGCAAAG	0.542																																																1	Substitution - coding silent(1)	ovary(1)	18						G	,	2,4404	4.2+/-10.8	0,2,2201	250.0	240.0	244.0		2655,2655	-10.3	0.3	18	dbSNP_134	244	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SLC14A2	NM_001242692.1,NM_007163.3	,	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	,	885/921,885/921	43262376	3,13003	2203	4300	6503	41516374	SO:0001819	synonymous_variant	8170			X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.2655G>A	18.37:g.43262376G>A		Somatic		Capture	Illumina GAIIx	4	41516374	A8K8Q7|Q2TBD6|Q96PH5	Silent	SNP	HMMPfam_UT,superfamily_Multiheme cytochromes	p.P885	ENST00000255226.6	37	c.2655	CCDS11924.1	18																																																																																			-	NULL		0.542	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC14A2	protein_coding	OTTHUMT00000255858.1	G			41516374	1	no_errors	NM_007163	genbank	human	validated	54_36p	silent	SNP	0.431	A
OR10H5	284433	genome.wustl.edu	37	19	15904980	15904980	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr19:15904980G>A	ENST00000308940.8	+	1	220	c.122G>A	c.(121-123)gGc>gAc	p.G41D		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G41D(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						ACGCTGCTGGGCAACCTGCTC	0.577																																																1	Substitution - Missense(1)	ovary(1)	19											222.0	177.0	192.0					19																	15904980		2203	4300	6503	15765980	SO:0001583	missense	284433			AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.122G>A	19.37:g.15904980G>A	ENSP00000310704:p.Gly41Asp	Somatic		Capture	Illumina GAIIx	4	15765980	Q6IFJ0|Q96R60	Missense_Mutation	SNP	-	p.G41D	ENST00000308940.8	37	c.122	CCDS32940.1	19	.	.	.	.	.	.	.	.	.	.	.	16.55	3.156004	0.57259	.	.	ENSG00000172519	ENST00000308940	T	0.04360	3.64	3.47	3.47	0.39725	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000103	T	0.30008	0.0751	H	0.95079	3.62	0.31580	N	0.655224	D	0.89917	1.0	D	0.97110	1.0	T	0.54330	-0.8310	10	0.87932	D	0	.	12.818	0.57677	0.0:0.0:1.0:0.0	.	41	Q8NGA6	O10H5_HUMAN	D	41	ENSP00000310704:G41D	ENSP00000310704:G41D	G	+	2	0	OR10H5	15765980	0.462000	0.25791	0.998000	0.56505	0.993000	0.82548	1.280000	0.33202	1.647000	0.50633	0.585000	0.79938	GGC	-	NULL		0.577	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H5	protein_coding	OTTHUMT00000460363.1	G			15765980	1	no_errors	NM_001004466	genbank	human	provisional	54_36p	missense	SNP	0.01	A
DDA1	79016	genome.wustl.edu	37	19	17425170	17425170	+	Silent	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr19:17425170G>T	ENST00000359866.4	+	3	232	c.108G>T	c.(106-108)ctG>ctT	p.L36L		NM_024050.5	NP_076955.1	Q9BW61	DDA1_HUMAN	DET1 and DDB1 associated 1	36								p.L36L(1)		kidney(1)|large_intestine(1)|lung(1)|ovary(1)	4						CAGTCTACCTGCCTACCCGCG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	19											107.0	82.0	90.0					19																	17425170		2203	4300	6503	17286170	SO:0001819	synonymous_variant	79016			BC000615	CCDS12357.1	19p13.11	2008-02-05	2007-10-25	2007-10-25		ENSG00000130311			28360	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 58"""	C19orf58		17452440	Standard	NM_024050		Approved	PCIA1, MGC2594	uc002ngd.3	Q9BW61		ENST00000359866.4:c.108G>T	19.37:g.17425170G>T		Somatic		Capture	Illumina GAIIx	Phase_III	17286170		Silent	SNP	-	p.L36	ENST00000359866.4	37	c.108	CCDS12357.1	19																																																																																			-	NULL		0.627	DDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDA1	protein_coding	OTTHUMT00000463519.1	G	NM_024050		17286170	1	no_errors	NM_024050	genbank	human	validated	54_36p	silent	SNP	1	T
ZNF222	7673	genome.wustl.edu	37	19	44536079	44536079	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr19:44536079A>C	ENST00000187879.8	+	4	414	c.252A>C	c.(250-252)caA>caC	p.Q84H	ZNF222_ENST00000391960.3_Missense_Mutation_p.Q124H|ZNF223_ENST00000591793.1_Intron	NM_013360.2	NP_037492.2	Q9UK12	ZN222_HUMAN	zinc finger protein 222	84	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q84H(1)		endometrium(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20		Prostate(69;0.0435)				CCAGGTCTCAAGATACCACCA	0.403																																																1	Substitution - Missense(1)	ovary(1)	19											105.0	103.0	104.0					19																	44536079		2203	4300	6503	49227919	SO:0001583	missense	7673			AF187988	CCDS33045.1, CCDS46098.1	19q13.2	2013-01-08				ENSG00000159885		"""Zinc fingers, C2H2-type"", ""-"""	13015	protein-coding gene	gene with protein product							Standard	NM_013360		Approved		uc002oye.3	Q9UK12		ENST00000187879.8:c.252A>C	19.37:g.44536079A>C	ENSP00000187879:p.Gln84His	Somatic		Capture	Illumina GAIIx	4	49227919	G5E9B9|Q8N6G7|Q9P1U5	Missense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.Q84H	ENST00000187879.8	37	c.252	CCDS33045.1	19	.	.	.	.	.	.	.	.	.	.	A	12.14	1.847414	0.32606	.	.	ENSG00000159885	ENST00000391960;ENST00000187879;ENST00000251272	T;T	0.06294	3.32;3.37	2.14	-0.0708	0.13746	.	.	.	.	.	T	0.13286	0.0322	L	0.51914	1.62	0.09310	N	1	D;D	0.60160	0.987;0.978	D;P	0.65684	0.937;0.867	T	0.19289	-1.0310	9	0.35671	T	0.21	.	5.595	0.17321	0.5054:0.0:0.4946:0.0	.	124;84	G5E9B9;Q9UK12	.;ZN222_HUMAN	H	124;84;30	ENSP00000375822:Q124H;ENSP00000187879:Q84H	ENSP00000187879:Q84H	Q	+	3	2	ZNF222	49227919	0.000000	0.05858	0.001000	0.08648	0.218000	0.24690	-0.799000	0.04560	-0.097000	0.12307	0.172000	0.16884	CAA	-	NULL		0.403	ZNF222-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF222	protein_coding	OTTHUMT00000460465.2	A			49227919	1	no_errors	NM_013360	genbank	human	validated	54_36p	missense	SNP		C
ZNF649	65251	genome.wustl.edu	37	19	52400191	52400191	+	Nonsense_Mutation	SNP	C	C	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr19:52400191C>T	ENST00000354957.3	-	3	340	c.56G>A	c.(55-57)tGg>tAg	p.W19*	ZNF649_ENST00000600738.1_Nonsense_Mutation_p.W19*|CTC-429C10.2_ENST00000600329.1_RNA	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	19	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.W19*(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		CCACTCCTCCCAGGTGAAGTC	0.488																																																1	Substitution - Nonsense(1)	ovary(1)	19											170.0	163.0	165.0					19																	52400191		2203	4300	6503	57092003	SO:0001587	stop_gained	65251			BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.56G>A	19.37:g.52400191C>T	ENSP00000347043:p.Trp19*	Somatic		Capture	Illumina GAIIx	4	57092003	A8MYJ5|B2RDC4|Q9H9N2	Nonsense_Mutation	SNP	-	p.W19*	ENST00000354957.3	37	c.56	CCDS12843.1	19	.	.	.	.	.	.	.	.	.	.	C	33	5.258337	0.95368	.	.	ENSG00000198093	ENST00000354957	.	.	.	2.51	1.28	0.21552	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	6.4411	0.21851	0.0:0.6902:0.3098:0.0	.	.	.	.	X	19	.	ENSP00000347043:W19X	W	-	2	0	ZNF649	57092003	0.000000	0.05858	0.994000	0.49952	0.745000	0.42441	-1.176000	0.03099	1.402000	0.46780	0.543000	0.68304	TGG	-	NULL		0.488	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF649	protein_coding	OTTHUMT00000461097.1	C	NM_023074		57092003	-1	no_errors	NM_023074	genbank	human	provisional	54_36p	nonsense	SNP	0.97	T
ZNF813	126017	genome.wustl.edu	37	19	53995002	53995002	+	Missense_Mutation	SNP	C	C	T	rs199775956		TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr19:53995002C>T	ENST00000396403.4	+	4	1644	c.1516C>T	c.(1516-1518)Cgg>Tgg	p.R506W	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	506					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		GGGTTTTAATCGGAAAACACA	0.403																																																0			19						C	TRP/ARG	0,4396		0,0,2198	50.0	54.0	53.0		1516	-2.6	0.0	19		53	5,8593	3.7+/-12.6	0,5,4294	no	missense	ZNF813	NM_001004301.3	101	0,5,6492	TT,TC,CC		0.0582,0.0,0.0385	probably-damaging	506/618	53995002	5,12989	2198	4299	6497	58686814	SO:0001583	missense	126017			AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.1516C>T	19.37:g.53995002C>T	ENSP00000379684:p.Arg506Trp	Somatic		Capture	Illumina GAIIx	4	58686814		Missense_Mutation	SNP	-	p.R506W	ENST00000396403.4	37	c.1516	CCDS46172.1	19	.	.	.	.	.	.	.	.	.	.	c	6.236	0.411728	0.11812	0.0	5.82E-4	ENSG00000198346	ENST00000396403	T	0.16073	2.37	1.32	-2.63	0.06133	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26412	0.0645	M	0.71036	2.16	0.09310	N	1	D	0.89917	1.0	D	0.63597	0.916	T	0.11227	-1.0596	9	0.28530	T	0.3	.	0.2847	0.00249	0.364:0.171:0.1427:0.3222	.	506	Q6ZN06	ZN813_HUMAN	W	506	ENSP00000379684:R506W	ENSP00000379684:R506W	R	+	1	2	ZNF813	58686814	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.809000	0.00361	-1.896000	0.01102	-1.139000	0.01908	CGG	-	NULL		0.403	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF813	protein_coding	OTTHUMT00000350638.1	C	NM_001004301		58686814	1	no_errors	NM_001004301	genbank	human	validated	54_36p	missense	SNP		T
LILRA2	11027	genome.wustl.edu	37	19	55086380	55086380	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr19:55086380A>G	ENST00000251377.3	+	5	668	c.535A>G	c.(535-537)Atc>Gtc	p.I179V	LILRA2_ENST00000251376.3_Missense_Mutation_p.I179V|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000391738.3_Missense_Mutation_p.I179V|LILRA2_ENST00000391737.1_Missense_Mutation_p.I167V			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	179	Ig-like C2-type 2.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.I179V(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		GTCCTGGGCCATCTTCTCCGT	0.562																																																1	Substitution - Missense(1)	ovary(1)	19											160.0	150.0	154.0					19																	55086380		2203	4300	6503	59778192	SO:0001583	missense	11027			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.535A>G	19.37:g.55086380A>G	ENSP00000251377:p.Ile179Val	Somatic		Capture	Illumina GAIIx	4	59778192	O75020	Missense_Mutation	SNP	-	p.I179V	ENST00000251377.3	37	c.535	CCDS46179.1	19	.	.	.	.	.	.	.	.	.	.	G	7.518	0.656085	0.14580	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.02787	4.16;4.16;4.16;4.16;4.16	2.93	-5.86	0.02304	Immunoglobulin-like fold (1);	0.746744	0.11359	N	0.572090	T	0.00845	0.0028	N	0.01817	-0.705	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.001;0.003;0.001;0.002	T	0.44742	-0.9308	9	.	.	.	.	2.0011	0.03467	0.4159:0.1938:0.2836:0.1067	.	179;167;179;179	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	V	179;179;179;179;167	ENSP00000388131:I179V;ENSP00000251377:I179V;ENSP00000375618:I179V;ENSP00000251376:I179V;ENSP00000375617:I167V	.	I	+	1	0	LILRA2	59778192	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.973000	0.03798	-1.127000	0.02925	-2.500000	0.00191	ATC	-	NULL		0.562	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LILRA2	protein_coding	OTTHUMT00000140813.2	A			59778192	1	no_errors	NM_006866	genbank	human	validated	54_36p	missense	SNP		G
NLRP8	126205	genome.wustl.edu	37	19	56477747	56477747	+	Splice_Site	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr19:56477747G>T	ENST00000291971.3	+	5	2452		c.e5+1		NLRP8_ENST00000590542.1_Splice_Site	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8						neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.?(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		AGTGTCTCAGGTGAGATTTGA	0.532																																																1	Unknown(1)	ovary(1)	19											60.0	62.0	61.0					19																	56477747		2203	4300	6503	61169559	SO:0001630	splice_region_variant	126205			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2381+1G>T	19.37:g.56477747G>T		Somatic		Capture	Illumina GAIIx	4	61169559	Q7RTR4	Splice_Site	SNP	-	e5+1	ENST00000291971.3	37	c.2381+1	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	G	6.782	0.513167	0.12944	.	.	ENSG00000179709	ENST00000291971	.	.	.	1.69	1.69	0.24217	.	.	.	.	.	.	.	.	.	.	.	0.29051	N	0.88452	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.8465	0.23990	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NLRP8	61169559	0.910000	0.30920	0.060000	0.19600	0.011000	0.07611	2.303000	0.43646	1.232000	0.43678	0.455000	0.32223	.	-	-		0.532	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	protein_coding	OTTHUMT00000457462.1	G	NM_176811	Intron	61169559	1	no_errors	NM_176811	genbank	human	provisional	54_36p	splice_site	SNP	0.02	T
ZC3H6	376940	genome.wustl.edu	37	2	113088582	113088582	+	Splice_Site	SNP	A	A	G			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr2:113088582A>G	ENST00000409871.1	+	12	2488	c.2087A>G	c.(2086-2088)gAt>gGt	p.D696G	AC115115.2_ENST00000607612.1_RNA|ZC3H6_ENST00000343936.4_Splice_Site_p.D696G	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	696							metal ion binding (GO:0046872)	p.D696G(1)		central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						CTGCATTTAGATGATACAGTT	0.229																																																1	Substitution - Missense(1)	ovary(1)	2											22.0	17.0	19.0					2																	113088582		1763	3987	5750	112805053	SO:0001630	splice_region_variant	376940			AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.2087-1A>G	2.37:g.113088582A>G		Somatic		Capture	Illumina GAIIx	4	112805053	A9JR71|Q6ZW96	Missense_Mutation	SNP	-	p.D696G	ENST00000409871.1	37	c.2087	CCDS46393.1	2	.	.	.	.	.	.	.	.	.	.	A	15.11	2.736116	0.49045	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	T;T	0.14391	2.51;2.51	5.4	5.4	0.78164	.	0.052835	0.64402	D	0.000001	T	0.14356	0.0347	L	0.43152	1.355	0.58432	D	0.999991	P	0.43750	0.816	B	0.39840	0.311	T	0.03493	-1.1031	9	.	.	.	.	15.7209	0.77710	1.0:0.0:0.0:0.0	.	696	P61129	ZC3H6_HUMAN	G	696;696;673	ENSP00000386764:D696G;ENSP00000340298:D696G	.	D	+	2	0	ZC3H6	112805053	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.775000	0.75018	2.173000	0.68751	0.533000	0.62120	GAT	-	NULL		0.229	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H6	protein_coding	OTTHUMT00000330551.1	A	NM_198581	Missense_Mutation	112805053	1	no_errors	NM_198581	genbank	human	validated	54_36p	missense	SNP	1	G
PKP4	8502	genome.wustl.edu	37	2	159477843	159477843	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr2:159477843G>C	ENST00000389759.3	+	6	625	c.513G>C	c.(511-513)aaG>aaC	p.K171N	PKP4_ENST00000389757.3_Missense_Mutation_p.K171N	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	171					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)		p.K171N(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						ACGTGAGCAAGGCAGACAACA	0.443										HNSCC(62;0.18)																																						1	Substitution - Missense(1)	ovary(1)	2											140.0	117.0	125.0					2																	159477843		2203	4300	6503	159186089	SO:0001583	missense	8502			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.513G>C	2.37:g.159477843G>C	ENSP00000374409:p.Lys171Asn	Somatic		Capture	Illumina GAIIx	4	159186089	Q86W91	Missense_Mutation	SNP	-	p.K171N	ENST00000389759.3	37	c.513	CCDS33305.1	2	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673457	0.67928	.	.	ENSG00000144283	ENST00000428353;ENST00000389757;ENST00000389759	T;T	0.75050	-0.9;-0.9	5.79	1.87	0.25490	.	0.269624	0.41938	D	0.000797	T	0.77519	0.4142	L	0.44542	1.39	0.51482	D	0.999927	D;D;D;D	0.71674	0.993;0.994;0.996;0.998	P;P;P;D	0.65573	0.893;0.785;0.711;0.936	T	0.75536	-0.3283	10	0.44086	T	0.13	-18.9021	11.0315	0.47776	0.3227:0.0:0.6773:0.0	.	23;171;171;23	Q6LCG8;Q99569-2;Q99569;F8W7E2	.;.;PKP4_HUMAN;.	N	23;171;171	ENSP00000374407:K171N;ENSP00000374409:K171N	ENSP00000374407:K171N	K	+	3	2	PKP4	159186089	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.239000	0.32719	0.750000	0.32877	0.655000	0.94253	AAG	-	NULL		0.443	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	protein_coding	OTTHUMT00000333250.1	G			159186089	1	no_errors	NM_003628	genbank	human	reviewed	54_36p	missense	SNP	1	C
GGCX	2677	genome.wustl.edu	37	2	85785630	85785643	+	Frame_Shift_Del	DEL	TCCATGATGTCTTG	TCCATGATGTCTTG	-	rs371283360		TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	TCCATGATGTCTTG	TCCATGATGTCTTG	TCCATGATGTCTTG	-	TCCATGATGTCTTG	TCCATGATGTCTTG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr2:85785630_85785643delTCCATGATGTCTTG	ENST00000233838.4	-	4	539_552	c.459_472delCAAGACATCATGGA	c.(457-474)gacaagacatcatggaacfs	p.DKTSWN153fs	GGCX_ENST00000430215.3_Frame_Shift_Del_p.DKTSWN96fs	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase	153					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)	p.D153fs*33(1)		endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	GAGTGGTTGTTCCATGATGTCTTGTCCAGGAGAA	0.514																																																1	Deletion - Frameshift(1)	ovary(1)	2	GRCh37	CM064017	GGCX	M																																				85639154	SO:0001589	frameshift_variant	2677				CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.459_472delCAAGACATCATGGA	2.37:g.85785630_85785643delTCCATGATGTCTTG	ENSP00000233838:p.Asp153fs	Somatic		Capture	Illumina GAIIx	4	85639141	B4DMC5|E9PEE1|Q14415|Q6GU45	Frame_Shift_Del	DEL	HMMPfam_VKG_Carbox;superfamily_RmlC-like cupins	p.D153fs	ENST00000233838.4	37	c.472_459	CCDS1978.1	2																																																																																			(deletion:cds_exon[85639074;85639239])	HMMPfam_VKG_Carbox		0.514	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGCX	protein_coding	OTTHUMT00000252490.3	TCCATGATGTCTTG	NM_000821		85639154	-1	no_errors	NM_000821	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:0.987:0.998:0.984:0.965:1.000:1.000:1.000:1.000:1.000:1.000	-
ASNSD1	54529	genome.wustl.edu	37	2	190531843	190531843	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr2:190531843G>T	ENST00000260952.4	+	4	1398	c.985G>T	c.(985-987)Ggc>Tgc	p.G329C	ASNSD1_ENST00000607062.1_Intron	NM_019048.2	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	329	Asparagine synthetase.				asparagine biosynthetic process (GO:0006529)|glutamine metabolic process (GO:0006541)		asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)	p.G329C(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(3)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			GTTTTCTGGGGGCATTGATTC	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											213.0	203.0	206.0					2																	190531843		2203	4300	6503	190240088	SO:0001583	missense	54529			AY116969	CCDS2300.1	2q32.2	2012-09-20			ENSG00000138381	ENSG00000138381			24910	protein-coding gene	gene with protein product							Standard	NM_019048		Approved	NS3TP1, FLJ20752, NBLA00058	uc002uqt.3	Q9NWL6	OTTHUMG00000132665	ENST00000260952.4:c.985G>T	2.37:g.190531843G>T	ENSP00000260952:p.Gly329Cys	Somatic		Capture	Illumina GAIIx	Phase_III	190240088	D3DPH6|Q3LIC3|Q4ZG45	Missense_Mutation	SNP	-	p.G329C	ENST00000260952.4	37	c.985	CCDS2300.1	2	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523175	0.85600	.	.	ENSG00000138381	ENST00000260952;ENST00000420250	D;D	0.97642	-4.47;-4.47	6.17	6.17	0.99709	Rossmann-like alpha/beta/alpha sandwich fold (1);Asparagine synthase (1);	0.042911	0.85682	D	0.000000	D	0.99152	0.9707	H	0.96576	3.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98826	1.0749	10	0.87932	D	0	-0.0047	20.8794	0.99867	0.0:0.0:1.0:0.0	.	329	Q9NWL6	ASND1_HUMAN	C	329	ENSP00000260952:G329C;ENSP00000406790:G329C	ENSP00000260952:G329C	G	+	1	0	ASNSD1	190240088	1.000000	0.71417	0.957000	0.39632	0.998000	0.95712	9.430000	0.97488	2.941000	0.99782	0.655000	0.94253	GGC	-	NULL		0.393	ASNSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASNSD1	protein_coding	OTTHUMT00000255919.3	G	NM_019048		190240088	1	no_errors	NM_019048	genbank	human	validated	54_36p	missense	SNP	1	T
ZSWIM3	140831	genome.wustl.edu	37	20	44505469	44505469	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr20:44505469T>A	ENST00000255152.2	+	2	481	c.272T>A	c.(271-273)cTa>cAa	p.L91Q	ZSWIM3_ENST00000454862.2_Missense_Mutation_p.L85Q	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	91							zinc ion binding (GO:0008270)	p.L91Q(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				CTAGATAGACTATTTATCAGT	0.473																																																1	Substitution - Missense(1)	ovary(1)	20											131.0	116.0	121.0					20																	44505469		2203	4300	6503	43938876	SO:0001583	missense	140831			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.272T>A	20.37:g.44505469T>A	ENSP00000255152:p.Leu91Gln	Somatic		Capture	Illumina GAIIx	4	43938876	Q9BR13	Missense_Mutation	SNP	-	p.L91Q	ENST00000255152.2	37	c.272	CCDS13381.1	20	.	.	.	.	.	.	.	.	.	.	T	16.64	3.180496	0.57800	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.58060	0.36;0.86	5.36	5.36	0.76844	.	0.000000	0.52532	D	0.000061	T	0.63082	0.2481	L	0.34521	1.04	0.40414	D	0.97977	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.67397	-0.5681	10	0.72032	D	0.01	-13.5129	15.1751	0.72903	0.0:0.0:0.0:1.0	.	85;91	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	Q	91;85	ENSP00000255152:L91Q;ENSP00000406313:L85Q	ENSP00000255152:L91Q	L	+	2	0	ZSWIM3	43938876	0.958000	0.32768	0.770000	0.31555	0.749000	0.42624	4.677000	0.61634	2.257000	0.74773	0.459000	0.35465	CTA	-	NULL		0.473	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM3	protein_coding	OTTHUMT00000079540.1	T	NM_080752		43938876	1	no_errors	NM_080752	genbank	human	validated	54_36p	missense	SNP	0.99	A
NCOA3	8202	genome.wustl.edu	37	20	46262903	46262903	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr20:46262903A>T	ENST00000371998.3	+	10	1267	c.1076A>T	c.(1075-1077)gAt>gTt	p.D359V	NCOA3_ENST00000371997.3_Missense_Mutation_p.D369V|NCOA3_ENST00000372004.3_Missense_Mutation_p.D359V|NCOA3_ENST00000341724.6_Missense_Mutation_p.D369V			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	359					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.D359V(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GTAACAAATGATCGACATGGC	0.398																																																1	Substitution - Missense(1)	ovary(1)	20											173.0	148.0	156.0					20																	46262903		2203	4300	6503	45696310	SO:0001583	missense	8202			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.1076A>T	20.37:g.46262903A>T	ENSP00000361066:p.Asp359Val	Somatic		Capture	Illumina GAIIx	4	45696310	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	HMMPfam_HLH;superfamily_Nuclear receptor coactivator interlocking domain;HMMPfam_DUF1518;superfamily_HLH helix-loop-helix DNA-binding domain;HMMPfam_PAS;HMMPfam_Nuc_rec_co-act;HMMPfam_SRC-1;superfamily_PYP-like sensor domain (PAS domain)	p.D359V	ENST00000371998.3	37	c.1076	CCDS13407.1	20	.	.	.	.	.	.	.	.	.	.	A	23.4	4.409980	0.83340	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997;ENST00000542882	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	5.75	5.75	0.90469	.	0.052398	0.64402	D	0.000001	T	0.34164	0.0888	L	0.39397	1.21	0.80722	D	1	B;D;B;B;B;B	0.89917	0.125;1.0;0.125;0.125;0.198;0.125	B;D;B;B;B;B	0.74023	0.082;0.982;0.082;0.082;0.171;0.082	T	0.04400	-1.0954	10	0.87932	D	0	-28.5847	16.0663	0.80878	1.0:0.0:0.0:0.0	.	359;369;363;359;359;359	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	V	359;369;359;359;369;125	ENSP00000342123:D369V;ENSP00000361073:D359V;ENSP00000361066:D359V;ENSP00000361065:D369V	ENSP00000345671:D359V	D	+	2	0	NCOA3	45696310	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAT	-	NULL		0.398	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	protein_coding	OTTHUMT00000080405.1	A	NM_006534		45696310	1	no_errors	NM_181659	genbank	human	reviewed	54_36p	missense	SNP	1	T
RIPK4	54101	genome.wustl.edu	37	21	43161430	43161430	+	Silent	SNP	C	C	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr21:43161430C>T	ENST00000352483.2	-	9	2131	c.2067G>A	c.(2065-2067)ctG>ctA	p.L689L	RIPK4_ENST00000542057.1_Silent_p.L578L|AP001615.9_ENST00000423276.1_RNA|RIPK4_ENST00000332512.3_Silent_p.L641L|RIPK4_ENST00000544709.1_Silent_p.L578L			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	689					morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L641L(1)		NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CGGCCACGTGCAGGGGTGTCT	0.692																																																1	Substitution - coding silent(1)	ovary(1)	21											43.0	46.0	45.0					21																	43161430		2202	4298	6500	42034499	SO:0001819	synonymous_variant	54101			AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.2067G>A	21.37:g.43161430C>T		Somatic		Capture	Illumina GAIIx	4	42034499	Q96KH0	Missense_Mutation	SNP	-	p.A378T	ENST00000352483.2	37	c.1132		21	.	.	.	.	.	.	.	.	.	.	C	9.738	1.164219	0.21538	.	.	ENSG00000183421	ENST00000330470	.	.	.	4.75	2.82	0.32997	.	.	.	.	.	T	0.35038	0.0918	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.04976	-1.0914	5	0.08179	T	0.78	-19.5169	7.8049	0.29195	0.2393:0.5405:0.2202:0.0	.	.	.	.	T	378	.	ENSP00000330975:A378T	A	-	1	0	RIPK4	42034499	1.000000	0.71417	1.000000	0.80357	0.373000	0.29922	0.727000	0.25999	0.954000	0.37851	0.655000	0.94253	GCA	-	NULL		0.692	RIPK4-201	KNOWN	basic	protein_coding	RIPK4	protein_coding		C	NM_020639		42034499	-1	no_errors	ENST00000330470	ensembl	human	known	54_36p	missense	SNP	1	T
MYO18B	84700	genome.wustl.edu	37	22	26388430	26388430	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr22:26388430A>C	ENST00000407587.2	+	40	6430	c.6261A>C	c.(6259-6261)gaA>gaC	p.E2087D	MYO18B_ENST00000536101.1_Missense_Mutation_p.E2086D|MYO18B_ENST00000335473.7_Missense_Mutation_p.E2086D			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2086						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E2087D(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CCTTGGAAGAAGTGGCATCCA	0.597																																																1	Substitution - Missense(1)	ovary(1)	22											55.0	58.0	57.0					22																	26388430		2016	4168	6184	24718430	SO:0001583	missense	84700			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6261A>C	22.37:g.26388430A>C	ENSP00000386096:p.Glu2087Asp	Somatic		Capture	Illumina GAIIx	4	24718430	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	HMMPfam_Myosin_head;superfamily_tRNA-binding arm;superfamily_P-loop containing nucleoside triphosphate hydrolases;HMMPfam_IQ	p.E2086D	ENST00000407587.2	37	c.6258		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.00|13.00	2.106538|2.106538	0.37145|0.37145	.|.	.|.	ENSG00000133454|ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587|ENST00000543971	D;D;D|.	0.87650|.	-2.28;-2.28;-2.28|.	5.26|5.26	-1.31|-1.31	0.09230|0.09230	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.49440|0.49440	0.1557|0.1557	L|L	0.58428|0.58428	1.81|1.81	0.33060|0.33060	D|D	0.533894|0.533894	B;B;B;B;B|.	0.33448|.	0.011;0.022;0.022;0.412;0.037|.	B;B;B;B;B|.	0.39068|.	0.011;0.011;0.011;0.289;0.024|.	T|T	0.56745|0.56745	-0.7928|-0.7928	10|5	0.23302|.	T|.	0.38|.	.|.	5.4145|5.4145	0.16365|0.16365	0.4371:0.0:0.4219:0.141|0.4371:0.0:0.4219:0.141	.|.	1599;2088;2086;2087;2086|.	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7|.	.;.;MY18B_HUMAN;.;.|.	D|T	2086;2086;2087|51	ENSP00000441229:E2086D;ENSP00000334563:E2086D;ENSP00000386096:E2087D|.	ENSP00000334563:E2086D|.	E|K	+|+	3|2	2|0	MYO18B|MYO18B	24718430|24718430	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.824000|0.824000	0.46624|0.46624	0.634000|0.634000	0.24614|0.24614	-0.015000|-0.015000	0.14150|0.14150	-0.242000|-0.242000	0.12053|0.12053	GAA|AAG	-	NULL		0.597	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	protein_coding	OTTHUMT00000400691.1	A	NM_032608		24718430	1	no_errors	NM_032608	genbank	human	reviewed	54_36p	missense	SNP	1	C
SEC14L6	730005	genome.wustl.edu	37	22	30921840	30921840	+	Silent	SNP	G	G	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr22:30921840G>A	ENST00000402034.2	-	9	743	c.744C>T	c.(742-744)ccC>ccT	p.P248P		NM_001193336.2	NP_001180265.2	B5MCN3	S14L6_HUMAN	SEC14-like 6 (S. cerevisiae)	248	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			lung(3)	3						GGTTGCCATCGGGGTCAGTCA	0.607																																																0			22																																								29251840	SO:0001819	synonymous_variant	730005				CCDS54518.1	22q12.2	2011-05-06			ENSG00000214491	ENSG00000214491			40047	protein-coding gene	gene with protein product							Standard	NM_001193336		Approved		uc021wnu.1	B5MCN3	OTTHUMG00000151267	ENST00000402034.2:c.744C>T	22.37:g.30921840G>A		Somatic		Capture	Illumina GAIIx	4	29251840		Silent	SNP	-	p.P248	ENST00000402034.2	37	c.744	CCDS54518.1	22	.	.	.	.	.	.	.	.	.	.	.	0.537	-0.855407	0.02630	.	.	ENSG00000214491	ENST00000437871	.	.	.	3.99	-6.65	0.01795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.323	8.1833	0.31324	0.5089:0.1069:0.3842:0.0	.	.	.	.	X	53	.	.	R	-	1	2	SEC14L6	29251840	0.000000	0.05858	0.095000	0.20976	0.086000	0.17979	-3.491000	0.00453	-0.852000	0.04141	-0.450000	0.05554	CGA	-	NULL		0.607	SEC14L6-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	LOC730005	protein_coding	OTTHUMT00000322022.2	G			29251840	-1	no_errors	XM_001132040	genbank	human	model	54_36p	silent	SNP	0.92	A
CRBN	51185	genome.wustl.edu	37	3	3215765	3215765	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr3:3215765T>C	ENST00000231948.4	-	3	377	c.355A>G	c.(355-357)Acc>Gcc	p.T119A	CRBN_ENST00000432408.2_Missense_Mutation_p.T118A	NM_016302.3	NP_057386.2	Q96SW2	CRBN_HUMAN	cereblon	119	Lon.				negative regulation of ion transmembrane transport (GO:0034766)|negative regulation of protein homooligomerization (GO:0032463)|positive regulation of protein homodimerization activity (GO:0090073)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP-dependent peptidase activity (GO:0004176)	p.T119A(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	11				Epithelial(13;0.00244)|OV - Ovarian serous cystadenocarcinoma(96;0.00617)|all cancers(10;0.0079)	Lenalidomide(DB00480)|Pomalidomide(DB08910)|Thalidomide(DB01041)	ACAGCAAAGGTTCTATCTTTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	3											87.0	88.0	88.0					3																	3215765		2203	4300	6503	3190765	SO:0001583	missense	51185			BC017419	CCDS2562.1, CCDS54547.1	3p26.3	2014-05-27			ENSG00000113851	ENSG00000113851			30185	protein-coding gene	gene with protein product		609262	"""mental retardation, non-syndromic, autosomal recessive, 2A"""	MRT2A		15557513	Standard	NM_016302		Approved	MRT2	uc003bpq.3	Q96SW2	OTTHUMG00000090261	ENST00000231948.4:c.355A>G	3.37:g.3215765T>C	ENSP00000231948:p.Thr119Ala	Somatic		Capture	Illumina GAIIx	4	3190765	B2R6H4|C9IZA9|C9JAH6|Q6AI62|Q6NVZ0|Q9UHW4	Missense_Mutation	SNP	-	p.T119A	ENST00000231948.4	37	c.355	CCDS2562.1	3	.	.	.	.	.	.	.	.	.	.	T	22.1	4.244536	0.79912	.	.	ENSG00000113851	ENST00000231948;ENST00000432408;ENST00000546075	T;T	0.39787	1.06;1.06	5.75	5.75	0.90469	Peptidase S16, lon N-terminal (2);PUA-like domain (1);	0.000000	0.85682	D	0.000000	T	0.57036	0.2026	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;0.99;0.992	D;D;D	0.85130	0.997;0.98;0.989	T	0.51434	-0.8706	10	0.10111	T	0.7	-19.6453	16.0563	0.80809	0.0:0.0:0.0:1.0	.	56;118;119	F5H3U1;Q96SW2-2;Q96SW2	.;.;CRBN_HUMAN	A	119;118;56	ENSP00000231948:T119A;ENSP00000412499:T118A	ENSP00000231948:T119A	T	-	1	0	CRBN	3190765	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	7.855000	0.86950	2.183000	0.69458	0.528000	0.53228	ACC	-	NULL		0.408	CRBN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CRBN	protein_coding	OTTHUMT00000206579.3	T	NM_016302		3190765	-1	no_errors	NM_016302	genbank	human	validated	54_36p	missense	SNP	1	C
CDCP1	64866	genome.wustl.edu	37	3	45127495	45127495	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr3:45127495G>C	ENST00000296129.1	-	9	2280	c.2146C>G	c.(2146-2148)Ccg>Gcg	p.P716A		NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	716						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P716A(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		GGCTGCCTCGGCATCTCAGTA	0.448																																																1	Substitution - Missense(1)	ovary(1)	3											204.0	200.0	202.0					3																	45127495		2203	4300	6503	45102499	SO:0001583	missense	64866			AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.2146C>G	3.37:g.45127495G>C	ENSP00000296129:p.Pro716Ala	Somatic		Capture	Illumina GAIIx	4	45102499	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain	p.P716A	ENST00000296129.1	37	c.2146	CCDS2727.1	3	.	.	.	.	.	.	.	.	.	.	G	15.25	2.776772	0.49786	.	.	ENSG00000163814	ENST00000296129	T	0.34667	1.35	5.7	5.7	0.88788	.	0.048676	0.85682	D	0.000000	T	0.56702	0.2003	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.65443	0.935	T	0.58216	-0.7675	10	0.62326	D	0.03	.	13.0801	0.59109	0.0732:0.0:0.9268:0.0	.	716	Q9H5V8	CDCP1_HUMAN	A	716	ENSP00000296129:P716A	ENSP00000296129:P716A	P	-	1	0	CDCP1	45102499	1.000000	0.71417	0.998000	0.56505	0.035000	0.12851	4.278000	0.58946	2.692000	0.91855	0.467000	0.42956	CCG	-	NULL		0.448	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCP1	protein_coding	OTTHUMT00000256748.3	G	NM_022842		45102499	-1	no_errors	NM_022842	genbank	human	reviewed	54_36p	missense	SNP	0.982	C
FAM208A	23272	genome.wustl.edu	37	3	56675697	56675697	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr3:56675697C>G	ENST00000493960.2	-	15	2309	c.2299G>C	c.(2299-2301)Gac>Cac	p.D767H	FAM208A_ENST00000355628.5_Missense_Mutation_p.D767H|FAM208A_ENST00000431842.2_Missense_Mutation_p.D371H	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	767							poly(A) RNA binding (GO:0044822)	p.D371H(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						CTATGGATGTCAGCAATGCCG	0.478																																																1	Substitution - Missense(1)	ovary(1)	3											108.0	99.0	102.0					3																	56675697		2203	4300	6503	56650737	SO:0001583	missense	23272			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.2299G>C	3.37:g.56675697C>G	ENSP00000417509:p.Asp767His	Somatic		Capture	Illumina GAIIx	4	56650737	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	-	p.D371H	ENST00000493960.2	37	c.1111	CCDS46853.1	3	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548060	0.65311	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.15372	2.43;2.58;2.57	5.99	4.21	0.49690	.	0.151519	0.46758	D	0.000274	T	0.25195	0.0612	L	0.27053	0.805	0.44611	D	0.997586	D;D;D	0.64830	0.972;0.98;0.994	P;P;D	0.63877	0.805;0.835;0.919	T	0.01587	-1.1318	10	0.72032	D	0.01	-4.5504	11.0919	0.48121	0.0:0.858:0.0:0.142	.	767;767;371	Q9UK61-3;Q9UK61-4;Q9UK61-2	.;.;.	H	371;767;767	ENSP00000399410:D371H;ENSP00000417509:D767H;ENSP00000347845:D767H	ENSP00000347845:D767H	D	-	1	0	C3orf63	56650737	1.000000	0.71417	0.603000	0.28903	0.655000	0.38815	2.478000	0.45189	0.872000	0.35775	0.655000	0.94253	GAC	-	NULL		0.478	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C3orf63	protein_coding	OTTHUMT00000352352.2	C	NM_015224		56650737	-1	no_errors	NM_015224	genbank	human	validated	54_36p	missense	SNP	1	G
CORIN	10699	genome.wustl.edu	37	4	47667238	47667238	+	Missense_Mutation	SNP	G	G	C	rs193921036		TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr4:47667238G>C	ENST00000273857.4	-	11	1399	c.1400C>G	c.(1399-1401)cCc>cGc	p.P467R	CORIN_ENST00000504584.1_Missense_Mutation_p.P430R|CORIN_ENST00000502252.1_Missense_Mutation_p.P400R|CORIN_ENST00000505909.1_Missense_Mutation_p.P430R|CORIN_ENST00000508498.1_Missense_Mutation_p.P328R	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	467	FZ 2. {ECO:0000255|PROSITE- ProRule:PRU00090}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.P467R(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						ACTGTTGTAGGGCAAATTCAT	0.358																																																1	Substitution - Missense(1)	ovary(1)	4											90.0	89.0	90.0					4																	47667238		2203	4300	6503	47361995	SO:0001583	missense	10699			AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.1400C>G	4.37:g.47667238G>C	ENSP00000273857:p.Pro467Arg	Somatic		Capture	Illumina GAIIx	4	47361995	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	-	p.P467R	ENST00000273857.4	37	c.1400	CCDS3477.1	4	.	.	.	.	.	.	.	.	.	.	G	16.45	3.125901	0.56721	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	T;T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42;-1.42	5.25	5.25	0.73442	Frizzled domain (5);	0.000000	0.85682	D	0.000000	D	0.90964	0.7159	M	0.85041	2.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.997;0.997	D	0.91486	0.5208	10	0.59425	D	0.04	.	19.0552	0.93062	0.0:0.0:1.0:0.0	.	430;430;400;467	B7Z4R1;B4E2W9;B4E1Y7;Q9Y5Q5	.;.;.;CORIN_HUMAN	R	467;328;400;430;430	ENSP00000273857:P467R;ENSP00000425597:P328R;ENSP00000424212:P400R;ENSP00000425401:P430R;ENSP00000423216:P430R	ENSP00000273857:P467R	P	-	2	0	CORIN	47361995	1.000000	0.71417	1.000000	0.80357	0.158000	0.22134	8.853000	0.92222	2.729000	0.93468	0.650000	0.86243	CCC	-	NULL		0.358	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORIN	protein_coding	OTTHUMT00000216906.2	G			47361995	-1	no_errors	NM_006587	genbank	human	reviewed	54_36p	missense	SNP	1	C
NUDT6	11162	genome.wustl.edu	37	4	123813548	123813548	+	IGR	SNP	C	C	G			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr4:123813548C>G	ENST00000304430.5	-	0	1169				FGF2_ENST00000608478.1_Missense_Mutation_p.S155R|NUDT6_ENST00000608639.1_Intron|FGF2_ENST00000264498.3_Missense_Mutation_p.S288R	NM_007083.4	NP_009014.2	P53370	NUDT6_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 6							mitochondrion (GO:0005739)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|hydrolase activity (GO:0016787)	p.S288R(1)		endometrium(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	6						CTGCTAAGAGCTGATTTTAAT	0.353																																																1	Substitution - Missense(1)	ovary(1)	4											110.0	106.0	107.0					4																	123813548		2203	4300	6503	124032998	SO:0001628	intergenic_variant	2247			AF019632	CCDS3729.1, CCDS43268.1	4q26	2011-02-21			ENSG00000170917	ENSG00000170917		"""Nudix motif containing"""	8053	protein-coding gene	gene with protein product		606261				7984147, 10022609	Standard	NM_198041		Approved	gfg-1, gfg, FGF2AS, FGF-AS	uc003iew.3	P53370	OTTHUMG00000039507		4.37:g.123813548C>G		Somatic		Capture	Illumina GAIIx	4	124032998	A8K756|O95097|Q9UQD9	Missense_Mutation	SNP	HMMPfam_FGF;superfamily_Cytokine	p.S288R	ENST00000304430.5	37	c.864	CCDS43268.1	4	.	.	.	.	.	.	.	.	.	.	C	19.00	3.741864	0.69304	.	.	ENSG00000138685	ENST00000264498	T	0.79653	-1.29	5.54	4.7	0.59300	.	0.241565	0.41396	D	0.000893	T	0.81645	0.4866	N	0.21448	0.665	0.31099	N	0.710612	D	0.76494	0.999	D	0.73708	0.981	D	0.86552	0.1835	9	0.87932	D	0	.	11.1609	0.48516	0.0:0.8532:0.0:0.1468	.	288	P09038	FGF2_HUMAN	R	288	ENSP00000264498:S288R	ENSP00000264498:S288R	S	+	3	2	FGF2	124032998	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.972000	0.49256	1.339000	0.45563	0.585000	0.79938	AGC	-	NULL		0.353	NUDT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF2	protein_coding	OTTHUMT00000095331.3	C	NM_007083		124032998	1	no_errors	NM_002006	genbank	human	reviewed	54_36p	missense	SNP	1	G
TRIM23	373	genome.wustl.edu	37	5	64892342	64892342	+	Silent	SNP	A	A	G			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr5:64892342A>G	ENST00000231524.9	-	9	1697	c.1326T>C	c.(1324-1326)acT>acC	p.T442T	TRIM23_ENST00000274327.7_Silent_p.T442T|TRIM23_ENST00000381018.3_Silent_p.T442T	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	442	ARF-like.				GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T442T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		TATATTCTACAGTTTCCACGT	0.289																																																1	Substitution - coding silent(1)	ovary(1)	5											88.0	88.0	88.0					5																	64892342		2201	4291	6492	64928098	SO:0001819	synonymous_variant	373			L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.1326T>C	5.37:g.64892342A>G		Somatic		Capture	Illumina GAIIx	Phase_III	64928098	Q9BZY4|Q9BZY5	Silent	SNP	superfamily_RING/U-box,HMMPfam_zf-B_box,HMMPfam_zf-C3HC4,HMMPfam_Arf,superfamily_P-loop containing nucleoside triphosphate hydrolases,superfamily_C2H2 and C2HC zinc fingers	p.T442	ENST00000231524.9	37	c.1326	CCDS3987.1	5																																																																																			-	HMMPfam_Arf		0.289	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM23	protein_coding	OTTHUMT00000215058.2	A	NM_001656		64928098	-1	no_errors	NM_001656	genbank	human	reviewed	54_36p	silent	SNP	0.997	G
ANKHD1	54882	genome.wustl.edu	37	5	139903719	139903719	+	Silent	SNP	G	G	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr5:139903719G>A	ENST00000360839.2	+	25	4540	c.4386G>A	c.(4384-4386)aaG>aaA	p.K1462K	ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.K1462K|ANKHD1_ENST00000297183.6_Silent_p.K1462K|ANKHD1_ENST00000544120.1_5'Flank	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1462						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K1462K(2)		breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			agagaaaaaagaaaaaagagg	0.358																																																2	Substitution - coding silent(2)	ovary(2)	5											76.0	75.0	76.0					5																	139903719		2203	4299	6502	139883903	SO:0001819	synonymous_variant	404734			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.4386G>A	5.37:g.139903719G>A		Somatic		Capture	Illumina GAIIx	4	139883903	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	-	p.K1462	ENST00000360839.2	37	c.4386	CCDS4225.1	5	.	.	.	.	.	.	.	.	.	.	G	9.009	0.981989	0.18812	.	.	ENSG00000131503	ENST00000310356	.	.	.	5.0	4.12	0.48240	.	.	.	.	.	T	0.63593	0.2524	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62011	-0.6944	4	.	.	.	.	12.6156	0.56576	0.082:0.0:0.918:0.0	.	.	.	.	K	996	.	.	E	+	1	0	ANKHD1	139883903	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.350000	0.73017	1.233000	0.43693	0.650000	0.86243	GAA	-	NULL		0.358	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ANKHD1-EIF4EBP3	protein_coding	OTTHUMT00000251672.1	G	NM_017747		139883903	1	no_errors	NM_020690	genbank	human	reviewed	54_36p	silent	SNP	1	A
VNN1	8876	genome.wustl.edu	37	6	133004364	133004364	+	Nonsense_Mutation	SNP	G	G	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr6:133004364G>C	ENST00000367928.4	-	7	1470	c.1457C>G	c.(1456-1458)tCa>tGa	p.S486*		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	486					acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)	p.S486*(1)		NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		TGAAGCATTTGATGCCCAGTC	0.418																																																1	Substitution - Nonsense(1)	ovary(1)	6											143.0	131.0	135.0					6																	133004364		2203	4300	6503	133046057	SO:0001587	stop_gained	8876			AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.1457C>G	6.37:g.133004364G>C	ENSP00000356905:p.Ser486*	Somatic		Capture	Illumina GAIIx	4	133046057	A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	Nonsense_Mutation	SNP	HMMPfam_CN_hydrolase;superfamily_Carbon-nitrogen hydrolase	p.S486*	ENST00000367928.4	37	c.1457	CCDS5159.1	6	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688968	0.68271	.	.	ENSG00000112299	ENST00000367928	.	.	.	5.86	-0.294	0.12831	.	1.217070	0.05699	N	0.593683	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-25.3861	1.4841	0.02443	0.278:0.2367:0.3638:0.1215	.	.	.	.	X	486	.	ENSP00000356905:S486X	S	-	2	0	VNN1	133046057	0.000000	0.05858	0.000000	0.03702	0.099000	0.18886	0.243000	0.18106	-0.371000	0.08004	0.650000	0.86243	TCA	-	NULL		0.418	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VNN1	protein_coding	OTTHUMT00000042263.1	G			133046057	-1	no_errors	NM_004666	genbank	human	reviewed	54_36p	nonsense	SNP		C
SYNGAP1	8831	genome.wustl.edu	37	6	33405745	33405745	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr6:33405745G>A	ENST00000418600.2	+	8	1164	c.1063G>A	c.(1063-1065)Ggg>Agg	p.G355R	SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.G355R|SYNGAP1_ENST00000428982.2_Missense_Mutation_p.G296R|MIR5004_ENST00000579078.1_RNA	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	355					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.G340R(1)|p.G355R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CACCCTGGCTGGGCGCCACTT	0.647																																																2	Substitution - Missense(2)	ovary(2)	6											45.0	44.0	44.0					6																	33405745		2203	4300	6503	33513723	SO:0001583	missense	8831			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.1063G>A	6.37:g.33405745G>A	ENSP00000403636:p.Gly355Arg	Somatic		Capture	Illumina GAIIx	4	33513723	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	HMMPfam_C2;HMMPfam_PH;HMMPfam_RasGAP;superfamily_GTPase activation domain GAP;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);superfamily_PH domain-like	p.G340R	ENST00000418600.2	37	c.1018	CCDS34434.2	6	.	.	.	.	.	.	.	.	.	.	G	22.7	4.326020	0.81580	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.38401	1.14;1.14;1.14	4.75	4.75	0.60458	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.126702	0.53938	D	0.000058	T	0.50956	0.1646	M	0.66297	2.02	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.983	D;D;D;D	0.97110	0.999;1.0;1.0;0.923	T	0.55159	-0.8184	10	0.87932	D	0	.	15.2813	0.73787	0.0:0.0:1.0:0.0	.	355;355;355;355	Q96PV0;Q96PV0-2;Q96PV0-4;B7ZCA0	SYGP1_HUMAN;.;.;.	R	355;355;355;296	ENSP00000293748:G355R;ENSP00000403636:G355R;ENSP00000412475:G296R	ENSP00000293748:G355R	G	+	1	0	SYNGAP1	33513723	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.446000	0.82766	0.655000	0.94253	GGG	-	NULL		0.647	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGAP1	protein_coding	OTTHUMT00000076151.4	G	XM_166407		33513723	1	no_errors	NM_006772	genbank	human	validated	54_36p	missense	SNP	1	A
RBBP4P4	727842	genome.wustl.edu	37	6	58446138	58446138	+	IGR	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr6:58446138G>T								XXbac-BPG55C20.7 (147642 upstream) : RP11-143A22.1 (42749 downstream)																							ATCACCCAAGGTTCGTTGGGA	0.438																																																0			6																																								58554097	SO:0001628	intergenic_variant	727842																															6.37:g.58446138G>T		Somatic		Capture	Illumina GAIIx	4	58554097		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.438					LOC727842			G			58554097	-1	pseudogene	XR_015140	genbank	human	model	54_36p	rna	SNP	1	T
ME1	4199	genome.wustl.edu	37	6	83926303	83926303	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr6:83926303G>T	ENST00000369705.3	-	13	1578	c.1462C>A	c.(1462-1464)Caa>Aaa	p.Q488K	ME1_ENST00000541327.1_Missense_Mutation_p.Q322K|ME1_ENST00000543031.1_Missense_Mutation_p.Q413K	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	488					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)	p.Q488K(1)		NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		TCTGACACTTGCTGAGCTATA	0.363																																																1	Substitution - Missense(1)	ovary(1)	6											85.0	91.0	89.0					6																	83926303		2203	4300	6503	83983022	SO:0001583	missense	4199			X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.1462C>A	6.37:g.83926303G>T	ENSP00000358719:p.Gln488Lys	Somatic		Capture	Illumina GAIIx	4	83983022	B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Missense_Mutation	SNP	HMMPfam_malic;HMMPfam_Malic_M;superfamily_NAD(P)-binding Rossmann-fold domains;superfamily_Aminoacid dehydrogenase-like N-terminal domain	p.Q488K	ENST00000369705.3	37	c.1462	CCDS34492.1	6	.	.	.	.	.	.	.	.	.	.	G	13.41	2.227494	0.39399	.	.	ENSG00000065833	ENST00000369705;ENST00000540036;ENST00000541327;ENST00000543031	T;T;T	0.29917	1.55;1.55;1.55	5.41	3.47	0.39725	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.361383	0.32608	N	0.005863	T	0.18509	0.0444	L	0.59436	1.845	0.35551	D	0.803846	B	0.21753	0.06	B	0.26693	0.072	T	0.08722	-1.0708	10	0.27785	T	0.31	-10.5691	16.9189	0.86159	0.0:0.3312:0.6688:0.0	.	488	P48163	MAOX_HUMAN	K	488;148;322;413	ENSP00000358719:Q488K;ENSP00000439912:Q322K;ENSP00000446114:Q413K	ENSP00000358719:Q488K	Q	-	1	0	ME1	83983022	0.989000	0.36119	1.000000	0.80357	0.986000	0.74619	0.812000	0.27211	1.393000	0.46605	0.650000	0.86243	CAA	-	HMMPfam_Malic_M		0.363	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ME1	protein_coding	OTTHUMT00000041350.1	G			83983022	-1	no_errors	NM_002395	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
SLC35D3	340146	genome.wustl.edu	37	6	137245563	137245563	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr6:137245563G>C	ENST00000331858.4	+	2	1145	c.980G>C	c.(979-981)gGa>gCa	p.G327A		NM_001008783.1	NP_001008783.1	Q5M8T2	S35D3_HUMAN	solute carrier family 35, member D3	327					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)		p.G327A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	13	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)		CAGCTAAGTGGAGACCAGCTG	0.617																																																1	Substitution - Missense(1)	ovary(1)	6											28.0	30.0	29.0					6																	137245563		2203	4300	6503	137287256	SO:0001583	missense	340146				CCDS34544.1	6q23.2	2013-05-22			ENSG00000182747	ENSG00000182747		"""Solute carriers"""	15621	protein-coding gene	gene with protein product		612519		FRCL1			Standard	NM_001008783		Approved		uc003qhe.3	Q5M8T2	OTTHUMG00000015651	ENST00000331858.4:c.980G>C	6.37:g.137245563G>C	ENSP00000333591:p.Gly327Ala	Somatic		Capture	Illumina GAIIx	4	137287256	B4DI58|Q5QNZ6|Q6NX71	Missense_Mutation	SNP	-	p.G327A	ENST00000331858.4	37	c.980	CCDS34544.1	6	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430201	0.62844	.	.	ENSG00000182747	ENST00000331858	T	0.59224	0.28	5.99	5.99	0.97316	.	0.256834	0.39687	N	0.001285	T	0.61912	0.2385	L	0.27053	0.805	0.51233	D	0.999915	D	0.76494	0.999	D	0.85130	0.997	T	0.63233	-0.6683	10	0.54805	T	0.06	-7.6185	20.4724	0.99163	0.0:0.0:1.0:0.0	.	327	Q5M8T2	S35D3_HUMAN	A	327	ENSP00000333591:G327A	ENSP00000333591:G327A	G	+	2	0	SLC35D3	137287256	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	4.758000	0.62220	2.848000	0.98002	0.609000	0.83330	GGA	-	NULL		0.617	SLC35D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35D3	protein_coding	OTTHUMT00000042389.2	G	XM_294017		137287256	1	no_errors	NM_001008783	genbank	human	provisional	54_36p	missense	SNP	1	C
TRRAP	8295	genome.wustl.edu	37	7	98592278	98592278	+	Silent	SNP	G	G	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr7:98592278G>T	ENST00000359863.4	+	66	10283	c.10074G>T	c.(10072-10074)gtG>gtT	p.V3358V	TRRAP_ENST00000446306.3_Silent_p.V3347V|TRRAP_ENST00000355540.3_Silent_p.V3329V	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3358					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.V3329V(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GTGGAGCGGTGTCCGATGCTA	0.517																																																1	Substitution - coding silent(1)	ovary(1)	7											197.0	186.0	189.0					7																	98592278		2203	4300	6503	98430214	SO:0001819	synonymous_variant	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10074G>T	7.37:g.98592278G>T		Somatic		Capture	Illumina GAIIx	4	98430214	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	HMMPfam_PI3_PI4_kinase;HMMPfam_FAT;superfamily_Protein kinase-like (PK-like);superfamily_ARM repeat;superfamily_Protein prenylyltransferase;superfamily_TPR-like;superfamily_TolA/TonB C-terminal domain	p.V3329	ENST00000359863.4	37	c.9987	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	G	4.929	0.172694	0.09391	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.05	3.0	0.34707	.	.	.	.	.	T	0.56659	0.2000	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52193	-0.8608	4	.	.	.	.	8.0923	0.30807	0.0939:0.0:0.6716:0.2345	.	.	.	.	F	3087	.	.	C	+	2	0	TRRAP	98430214	1.000000	0.71417	0.959000	0.39883	0.547000	0.35210	2.076000	0.41548	1.091000	0.41335	0.462000	0.41574	TGT	-	NULL		0.517	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	protein_coding	OTTHUMT00000317978.1	G	NM_003496		98430214	1	no_errors	NM_003496	genbank	human	validated	54_36p	silent	SNP	1	T
ZKSCAN1	7586	genome.wustl.edu	37	7	99621928	99621928	+	Missense_Mutation	SNP	G	G	A	rs148037051	byFrequency	TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr7:99621928G>A	ENST00000324306.6	+	3	812	c.578G>A	c.(577-579)cGa>cAa	p.R193Q	ZKSCAN1_ENST00000535170.1_Intron|ZKSCAN1_ENST00000426572.1_Missense_Mutation_p.R157Q	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R193Q(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TTACAGTCACGAGGTAAGAAG	0.512													G|||	3	0.000599042	0.0015	0.0	5008	,	,		18560	0.001		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	urinary_tract(1)|ovary(1)	7						G	GLN/ARG	4,4402	8.1+/-20.4	0,4,2199	59.0	53.0	55.0		578	2.5	0.5	7	dbSNP_134	55	0,8600		0,0,4300	yes	missense	ZKSCAN1	NM_003439.1	43	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	benign	193/564	99621928	4,13002	2203	4300	6503	99459864	SO:0001583	missense	7586			X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.578G>A	7.37:g.99621928G>A	ENSP00000323148:p.Arg193Gln	Somatic		Capture	Illumina GAIIx	4	99459864	A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	-	p.R193Q	ENST00000324306.6	37	c.578	CCDS34698.1	7	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	1	0.0017482517482517483	0	0.0	G	13.96	2.391957	0.42410	9.08E-4	0.0	ENSG00000106261	ENST00000324306;ENST00000426572	T;T	0.06608	3.32;3.28	4.51	2.46	0.29980	.	0.179711	0.26875	N	0.022049	T	0.03263	0.0095	N	0.08118	0	0.20307	N	0.999913	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40979	-0.9534	10	0.42905	T	0.14	.	7.5794	0.27955	0.1895:0.0:0.8105:0.0	.	193;157	P17029;E9PC66	ZKSC1_HUMAN;.	Q	193;157	ENSP00000323148:R193Q;ENSP00000409172:R157Q	ENSP00000323148:R193Q	R	+	2	0	ZKSCAN1	99459864	0.277000	0.24220	0.524000	0.27887	0.964000	0.63967	1.331000	0.33793	0.391000	0.25143	0.491000	0.48974	CGA	-	NULL		0.512	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN1	protein_coding	OTTHUMT00000344550.2	G	NM_003439		99459864	1	no_errors	NM_003439	genbank	human	validated	54_36p	missense	SNP	0.55	A
GSR	2936	genome.wustl.edu	37	8	30567420	30567420	+	Splice_Site	DEL	C	C	-			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	-	C	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr8:30567420delC	ENST00000221130.5	-	3	424		c.e3-1		GSR_ENST00000537535.1_Splice_Site|GSR_ENST00000414019.1_Splice_Site|GSR_ENST00000541648.1_Splice_Site|GSR_ENST00000546342.1_Splice_Site	NM_000637.3|NM_001195102.1|NM_001195103.1	NP_000628.2|NP_001182031.1|NP_001182032.1	P00390	GSHR_HUMAN	glutathione reductase						cell redox homeostasis (GO:0045454)|glutathione metabolic process (GO:0006749)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|glutathione-disulfide reductase activity (GO:0004362)|NADP binding (GO:0050661)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	23				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Flavin adenine dinucleotide(DB03147)|Glutathione(DB00143)	TCCACATTACCTGTAAAAAAA	0.368																																																1	Unknown(1)	ovary(1)	8											42.0	38.0	39.0					8																	30567420		2203	4300	6503	30686962	SO:0001630	splice_region_variant	2936				CCDS34877.1, CCDS56530.1, CCDS56531.1, CCDS56532.1	8p21.1	2012-10-02			ENSG00000104687	ENSG00000104687	1.8.1.7		4623	protein-coding gene	gene with protein product		138300					Standard	NM_000637		Approved		uc003xih.2	P00390	OTTHUMG00000163946	ENST00000221130.5:c.334-1G>-	8.37:g.30567420delC		Somatic		Capture	Illumina GAIIx	Phase_III	30686962	C8KIL8|C8KIL9|C8KIM0|D3DSV3|Q7Z5C9|Q9NP63	Splice_Site	DEL	-	e3-1	ENST00000221130.5	37	c.NULL	CCDS34877.1	8																																																																																			(deletion:intron[30686962;30689120])	-		0.368	GSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSR	protein_coding	OTTHUMT00000376519.1	C		Intron	30686962	-1	no_errors	NM_000637	genbank	human	validated	54_36p	splice_site_del	DEL	1.000:0.997	-
PENK	5179	genome.wustl.edu	37	8	57353989	57353989	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr8:57353989T>C	ENST00000314922.3	-	2	722	c.646A>G	c.(646-648)Aga>Gga	p.R216G	PENK_ENST00000523274.1_5'UTR|PENK_ENST00000451791.2_Missense_Mutation_p.R216G	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	216					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)	p.R216G(1)		central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			CGACCTACTCTTCTCATGAAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	8											103.0	104.0	104.0					8																	57353989		2203	4300	6503	57516543	SO:0001583	missense	5179				CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.646A>G	8.37:g.57353989T>C	ENSP00000324248:p.Arg216Gly	Somatic		Capture	Illumina GAIIx	4	57516543	B2RC23|Q6FHC6|Q6FHE6	Missense_Mutation	SNP	HMMPfam_Opiods_neuropep	p.R216G	ENST00000314922.3	37	c.646	CCDS6168.1	8	.	.	.	.	.	.	.	.	.	.	T	20.1	3.934999	0.73442	.	.	ENSG00000181195	ENST00000314922;ENST00000451791	T;T	0.19669	2.13;2.13	5.91	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.50718	0.1632	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57659	-0.7773	10	0.87932	D	0	-32.7907	12.3965	0.55389	0.0:0.0:0.1407:0.8593	.	216	P01210	PENK_HUMAN	G	216	ENSP00000324248:R216G;ENSP00000400894:R216G	ENSP00000324248:R216G	R	-	1	2	PENK	57516543	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.887000	0.48586	1.023000	0.39654	0.533000	0.62120	AGA	-	NULL		0.542	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PENK	protein_coding	OTTHUMT00000378645.1	T			57516543	-1	no_errors	NM_006211	genbank	human	validated	54_36p	missense	SNP	1	C
MELK	9833	genome.wustl.edu	37	9	36671029	36671029	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr9:36671029C>T	ENST00000298048.2	+	16	1724	c.1540C>T	c.(1540-1542)Cat>Tat	p.H514Y	MELK_ENST00000536987.1_Missense_Mutation_p.H383Y|MELK_ENST00000536860.1_Missense_Mutation_p.H466Y|MELK_ENST00000543751.1_Missense_Mutation_p.H482Y|MELK_ENST00000541717.1_Missense_Mutation_p.H473Y|MELK_ENST00000545008.1_Missense_Mutation_p.H443Y|MELK_ENST00000538311.1_Missense_Mutation_p.H320Y|MELK_ENST00000536329.1_Missense_Mutation_p.H443Y	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	514	Autoinhibitory region.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)	p.H514Y(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			CAACCAAGCACATATGGAGGA	0.502																																					Ovarian(82;980 1317 7225 14391 18624)											1	Substitution - Missense(1)	ovary(1)	9											102.0	100.0	101.0					9																	36671029		2203	4300	6503	36661029	SO:0001583	missense	9833			D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1540C>T	9.37:g.36671029C>T	ENSP00000298048:p.His514Tyr	Somatic		Capture	Illumina GAIIx	4	36661029	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_KA1;superfamily_Protein kinase-like (PK-like);superfamily_Kinase associated domain 1 KA1	p.H514Y	ENST00000298048.2	37	c.1540	CCDS6606.1	9	.	.	.	.	.	.	.	.	.	.	C	17.13	3.311412	0.60414	.	.	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.71698	-0.4;0.58;0.36;0.9;0.27;-0.59;-0.42;-0.41	5.95	5.06	0.68205	.	0.203413	0.51477	D	0.000085	T	0.69788	0.3150	M	0.65498	2.005	0.58432	D	0.999993	B;B;B;B;B;B;B	0.19331	0.013;0.035;0.003;0.001;0.024;0.003;0.002	B;B;B;B;B;B;B	0.21151	0.017;0.033;0.012;0.009;0.025;0.013;0.002	T	0.67499	-0.5655	10	0.48119	T	0.1	-10.8298	14.947	0.71039	0.0:0.9321:0.0:0.0679	.	434;443;466;473;443;482;514	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	Y	514;320;383;443;466;443;473;482	ENSP00000298048:H514Y;ENSP00000438226:H320Y;ENSP00000439184:H383Y;ENSP00000445452:H443Y;ENSP00000439792:H466Y;ENSP00000443550:H443Y;ENSP00000437804:H473Y;ENSP00000441596:H482Y	ENSP00000298048:H514Y	H	+	1	0	MELK	36661029	1.000000	0.71417	0.951000	0.38953	0.983000	0.72400	4.031000	0.57267	1.531000	0.49152	0.655000	0.94253	CAT	-	NULL		0.502	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MELK	protein_coding	OTTHUMT00000052428.3	C	NM_014791		36661029	1	no_errors	NM_014791	genbank	human	provisional	54_36p	missense	SNP	1	T
SLC25A5	292	genome.wustl.edu	37	X	118603984	118603984	+	Missense_Mutation	SNP	G	G	A	rs199678822		TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chrX:118603984G>A	ENST00000317881.8	+	2	588	c.472G>A	c.(472-474)Ggt>Agt	p.G158S	SLC25A5_ENST00000460013.1_3'UTR|SLC25A5-AS1_ENST00000446986.1_RNA	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	158					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)	p.G158S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	CCGAGGCCTCGGTGACTGCCT	0.512																																																1	Substitution - Missense(1)	ovary(1)	X											92.0	97.0	96.0					X																	118603984		2203	4300	6503	118488012	SO:0001583	missense	292			BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.472G>A	X.37:g.118603984G>A	ENSP00000360671:p.Gly158Ser	Somatic		Capture	Illumina GAIIx	4	118488012	B2RCV1|O43350	Missense_Mutation	SNP	HMMPfam_Mito_carr,superfamily_Mitochondrial carrier	p.G158S	ENST00000317881.8	37	c.472	CCDS14578.1	X	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336216	0.41398	.	.	ENSG00000005022	ENST00000317881	T	0.78481	-1.18	4.35	4.35	0.52113	Mitochondrial carrier domain (2);	0.049000	0.85682	N	0.000000	T	0.71134	0.3304	L	0.43757	1.38	0.58432	D	0.999999	B	0.15719	0.014	B	0.24394	0.053	T	0.66176	-0.5989	10	0.21014	T	0.42	.	15.7288	0.77784	0.0:0.0:1.0:0.0	.	158	P05141	ADT2_HUMAN	S	158	ENSP00000360671:G158S	ENSP00000360671:G158S	G	+	1	0	SLC25A5	118488012	1.000000	0.71417	0.992000	0.48379	0.931000	0.56810	9.347000	0.97059	2.100000	0.63781	0.529000	0.55759	GGT	-	HMMPfam_Mito_carr		0.512	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A5	protein_coding	OTTHUMT00000058952.2	G	NM_001152		118488012	1	no_errors	NM_001152	genbank	human	validated	54_36p	missense	SNP	1	A
HCFC1	3054	genome.wustl.edu	37	X	153222894	153222894	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chrX:153222894T>C	ENST00000310441.7	-	13	3190	c.2224A>G	c.(2224-2226)Agt>Ggt	p.S742G	HCFC1_ENST00000354233.3_Missense_Mutation_p.S673G|HCFC1_ENST00000461098.1_5'Flank|HCFC1_ENST00000369984.4_Missense_Mutation_p.S742G	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	742					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.S645G(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCGCCCCACTGGCCTGCGTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	X											93.0	100.0	98.0					X																	153222894		2151	4220	6371	152876088	SO:0001583	missense	3054				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.2224A>G	X.37:g.153222894T>C	ENSP00000309555:p.Ser742Gly	Somatic		Capture	Illumina GAIIx	Phase_III	152876088	Q6P4G5	Missense_Mutation	SNP	-	p.S742G	ENST00000310441.7	37	c.2224	CCDS44020.1	X	.	.	.	.	.	.	.	.	.	.	T	8.536	0.872032	0.17322	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.02812	4.16;4.15;4.16	5.64	3.25	0.37280	.	0.092556	0.85682	N	0.000000	T	0.01092	0.0036	N	0.01352	-0.895	0.31310	N	0.687256	B	0.06786	0.001	B	0.01281	0.0	T	0.38929	-0.9638	10	0.15499	T	0.54	.	7.2049	0.25901	0.0:0.3499:0.0:0.6501	.	742	P51610	HCFC1_HUMAN	G	742;742;673	ENSP00000309555:S742G;ENSP00000359001:S742G;ENSP00000346174:S673G	ENSP00000309555:S742G	S	-	1	0	HCFC1	152876088	1.000000	0.71417	0.943000	0.38184	0.747000	0.42532	3.672000	0.54583	0.271000	0.22005	0.486000	0.48141	AGT	-	NULL		0.622	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	protein_coding	OTTHUMT00000061099.4	T	NM_005334		152876088	-1	no_errors	NM_005334	genbank	human	reviewed	54_36p	missense	SNP	1	C
PELI1	57162	genome.wustl.edu	37	2	64322049	64322050	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	TC	TC	TC	AT	TC	TC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr2:64322049_64322050TC>AT	ENST00000358912.4	-	7	1485_1486	c.1043_1044GA>AT	c.(1042-1044)gGA>gAT	p.G348D		NM_020651.3	NP_065702.2	Q96FA3	PELI1_HUMAN	pellino E3 ubiquitin protein ligase 1	348					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|protein K48-linked ubiquitination (GO:0070936)|response to dsRNA (GO:0043331)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	19						CAGCTTCACATCCAAGCCACAG	0.49																																																0			2																																								64175554	SO:0001583	missense	57162				CCDS1876.1	2p13.3	2012-02-23	2012-02-23		ENSG00000197329	ENSG00000197329		"""Pellino homologs"""	8827	protein-coding gene	gene with protein product		614797	"""pellino (Drosophila) homolog 1"", ""pellino homolog 1 (Drosophila)"""			11306823, 16951688	Standard	NM_020651		Approved		uc002sct.4	Q96FA3	OTTHUMG00000129511	ENST00000358912.4:c.1043_1044delinsAT	2.37:g.64322049_64322050delinsAT	ENSP00000351789:p.Gly348Asp	Somatic		Capture	Illumina GAIIx	4	64175553	Q96SM0|Q9GZY5|Q9HCX0	Missense_Mutation	DNP	HMMPfam_Pellino	p.G348D	ENST00000358912.4	37	c.1044_1043	CCDS1876.1	2																																																																																			-	HMMPfam_Pellino		0.490	PELI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PELI1	protein_coding	OTTHUMT00000251686.1	TC	NM_020651		64175554	-1	no_errors	NM_020651	genbank	human	validated	54_36p	missense	DNP	1.000:1.000	AT
THBS1	7057	genome.wustl.edu	37	15	39874834	39874835	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-23-1118-01A-01W-0488-09	TCGA-23-1118-10A-01W-0488-09	GA	GA	GA	TT	GA	GA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	00c41845-6b48-40fa-82e9-1b436e7d91c3	4c9bc38a-51ca-49dc-9120-68e7c490c62a	g.chr15:39874834_39874835GA>TT	ENST00000260356.5	+	3	673_674	c.508_509GA>TT	c.(508-510)GAc>TTc	p.D170F		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	170	Laminin G-like.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		GCTGTACATCGACTGTGAAAAG	0.574																																																0			15																																								37662127	SO:0001583	missense	7057				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	Exception_encountered	15.37:g.39874834_39874835delinsTT	ENSP00000260356:p.Asp170Phe	Somatic		Capture	Illumina GAIIx	4	37662126	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	DNP	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_VWC,HMMSmart_SM00214,PatternScan_VWFC_1,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_2,superfamily_TSP type-3 repeat,HMMPfam_TSP_3,HMMPfam_TSP_C	p.D170F	ENST00000260356.5	37	c.508_509	CCDS32194.1	15																																																																																			-	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases		0.574	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS1	protein_coding	OTTHUMT00000257831.2	GA	NM_003246		37662127	1	no_errors	NM_003246	genbank	human	reviewed	54_36p	missense	DNP	1.000:1.000	TT
