#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTOR	2475	broad.mit.edu	37	1	11307883	11307883	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr1:11307883A>T	ENST00000361445.4	-	7	1185	c.1109T>A	c.(1108-1110)tTt>tAt	p.F370Y		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	370	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.F370Y(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TACCTGATCAAATTTCTCCTC	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											61.0	66.0	64.0					1																	11307883		2203	4300	6503	11230470	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.1109T>A	1.37:g.11307883A>T	ENSP00000354558:p.Phe370Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	11230470	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	A	14.42	2.529328	0.44969	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.66280	-0.2	5.74	5.74	0.90152	Armadillo-like helical (1);Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	T	0.46560	0.1399	L	0.28014	0.82	0.80722	D	1	B	0.15141	0.012	B	0.11329	0.006	T	0.43988	-0.9357	10	0.02654	T	1	-6.1107	16.0546	0.80788	1.0:0.0:0.0:0.0	.	370	P42345	MTOR_HUMAN	Y	370	ENSP00000354558:F370Y	ENSP00000354558:F370Y	F	-	2	0	MTOR	11230470	1.000000	0.71417	0.981000	0.43875	0.965000	0.64279	8.923000	0.92808	2.191000	0.70037	0.528000	0.53228	TTT		0.542	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
HDAC1	3065	broad.mit.edu	37	1	32768246	32768246	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr1:32768246G>C	ENST00000373548.3	+	2	158	c.74G>C	c.(73-75)gGa>gCa	p.G25A	HDAC1_ENST00000373541.2_5'UTR	NM_004964.2	NP_004955.2	Q13547	HDAC1_HUMAN	histone deacetylase 1	25	Histone deacetylase.				ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|mitotic cell cycle (GO:0000278)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deacetylation (GO:0006476)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.G25A(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	TACTATTATGGACAAGGCCAC	0.438																																																1	Substitution - Missense(1)	ovary(1)	1											125.0	109.0	114.0					1																	32768246		2203	4300	6503	32540833	SO:0001583	missense	3065			D50405	CCDS360.1	1p34	2008-02-05			ENSG00000116478	ENSG00000116478			4852	protein-coding gene	gene with protein product		601241		RPD3L1		8602529	Standard	NM_004964		Approved	HD1, GON-10	uc001bvb.1	Q13547	OTTHUMG00000007529	ENST00000373548.3:c.74G>C	1.37:g.32768246G>C	ENSP00000362649:p.Gly25Ala	Somatic		Capture	Illumina GAIIx	Phase_I	32540833	Q92534	Missense_Mutation	SNP	ENST00000373548.3	37	CCDS360.1	.	.	.	.	.	.	.	.	.	.	G	35	5.429924	0.96131	.	.	ENSG00000116478	ENST00000373548;ENST00000428704	T;T	0.68624	-0.34;-0.34	5.43	5.43	0.79202	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	D	0.86948	0.6056	H	0.94183	3.505	0.80722	D	1	D;D	0.76494	0.969;0.999	P;D	0.68943	0.622;0.961	D	0.89742	0.3934	10	0.62326	D	0.03	-11.8068	19.275	0.94027	0.0:0.0:1.0:0.0	.	25;25	B4DSK9;Q13547	.;HDAC1_HUMAN	A	25	ENSP00000362649:G25A;ENSP00000407859:G25A	ENSP00000362649:G25A	G	+	2	0	HDAC1	32540833	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.140000	0.94607	2.738000	0.93877	0.650000	0.86243	GGA		0.438	HDAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019815.3	NM_004964	
AGO1	26523	broad.mit.edu	37	1	36367660	36367660	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr1:36367660T>C	ENST00000373204.4	+	10	1465	c.1252T>C	c.(1252-1254)Tac>Cac	p.Y418H	AGO1_ENST00000373206.1_Missense_Mutation_p.Y343H	NM_012199.2	NP_036331.1	Q9UL18	AGO1_HUMAN	argonaute RISC catalytic component 1	418					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process (GO:0000956)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.Y418H(1)									CATCTTGCAGTACGGCGGCCG	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											56.0	61.0	59.0					1																	36367660		2203	4300	6503	36140247	SO:0001583	missense	26523			AF093097	CCDS398.1	1p34.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000092847	ENSG00000092847		"""Argonaute/PIWI family"""	3262	protein-coding gene	gene with protein product	"""argonaute 1"""	606228	"""eukaryotic translation initiation factor 2C, 1"""	EIF2C1		10534406, 12906857	Standard	NM_012199		Approved	hAGO1	uc001bzl.3	Q9UL18	OTTHUMG00000007381	ENST00000373204.4:c.1252T>C	1.37:g.36367660T>C	ENSP00000362300:p.Tyr418His	Somatic		Capture	Illumina GAIIx	Phase_I	36140247	Q5TA57|Q6P4S0	Missense_Mutation	SNP	ENST00000373204.4	37	CCDS398.1	.	.	.	.	.	.	.	.	.	.	T	28.9	4.964341	0.92791	.	.	ENSG00000092847	ENST00000373206;ENST00000373204	T;T	0.06687	3.27;3.27	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.39708	0.1088	M	0.93808	3.46	0.80722	D	1	D	0.65815	0.995	D	0.67900	0.954	T	0.52823	-0.8524	10	0.87932	D	0	-25.8524	16.6093	0.84858	0.0:0.0:0.0:1.0	.	418	Q9UL18	AGO1_HUMAN	H	343;418	ENSP00000362302:Y343H;ENSP00000362300:Y418H	ENSP00000362300:Y418H	Y	+	1	0	EIF2C1	36140247	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.324000	0.78689	0.533000	0.62120	TAC		0.587	AGO1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019337.3		
KIF2C	11004	broad.mit.edu	37	1	45213058	45213058	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr1:45213058T>G	ENST00000372224.4	+	3	281	c.168T>G	c.(166-168)atT>atG	p.I56M	KIF2C_ENST00000493027.1_3'UTR|KIF2C_ENST00000372218.4_Missense_Mutation_p.I56M|KIF2C_ENST00000372217.1_Missense_Mutation_p.I2M|KIF2C_ENST00000372222.3_5'UTR	NM_006845.3	NP_006836.2	Q99661	KIF2C_HUMAN	kinesin family member 2C	56	Globular. {ECO:0000255}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|microtubule motor activity (GO:0003777)|microtubule plus-end binding (GO:0051010)	p.I56M(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(1)|skin(1)|urinary_tract(1)	34	Acute lymphoblastic leukemia(166;0.155)					CCTTGCAGATTGATTTTGATG	0.373																																																1	Substitution - Missense(1)	ovary(1)	1											120.0	117.0	118.0					1																	45213058		2203	4300	6503	44985645	SO:0001583	missense	11004			U63743	CCDS512.1, CCDS72774.1	1p34.1	2014-01-21	2003-01-13	2003-01-17	ENSG00000142945	ENSG00000142945		"""Kinesins"""	6393	protein-coding gene	gene with protein product		604538	"""kinesin-like 6 (mitotic centromere-associated kinesin)"""	KNSL6		9434124	Standard	NM_006845		Approved	MCAK, CT139	uc001cmg.4	Q99661	OTTHUMG00000008416	ENST00000372224.4:c.168T>G	1.37:g.45213058T>G	ENSP00000361298:p.Ile56Met	Somatic		Capture	Illumina GAIIx	Phase_I	44985645	B3ITR9|Q5JR88|Q6ICU1|Q96C18|Q96HB8|Q9BWV8	Missense_Mutation	SNP	ENST00000372224.4	37	CCDS512.1	.	.	.	.	.	.	.	.	.	.	t	19.07	3.755452	0.69648	.	.	ENSG00000142945	ENST00000452259;ENST00000372224;ENST00000372218;ENST00000455186;ENST00000372217	T;T;T;T;T	0.81078	0.53;-1.45;-1.26;0.14;-1.15	6.07	3.61	0.41365	.	0.224883	0.43260	D	0.000599	D	0.86104	0.5853	M	0.75085	2.285	0.80722	D	1	P;P;D	0.53312	0.895;0.836;0.959	P;P;P	0.59595	0.625;0.577;0.86	D	0.86619	0.1878	10	0.87932	D	0	.	10.1186	0.42607	0.2667:0.0:0.0:0.7333	.	56;2;56	B7Z6Q6;Q99661-2;Q99661	.;.;KIF2C_HUMAN	M	56;56;56;47;2	ENSP00000410346:I56M;ENSP00000361298:I56M;ENSP00000361292:I56M;ENSP00000395050:I47M;ENSP00000361291:I2M	ENSP00000361291:I2M	I	+	3	3	KIF2C	44985645	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.355000	0.44107	1.093000	0.41377	0.533000	0.62120	ATT		0.373	KIF2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023180.1	NM_006845	
NBPF14	25832	broad.mit.edu	37	1	148004589	148004589	+	Missense_Mutation	SNP	G	G	A	rs148079257	byFrequency	TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr1:148004589G>A	ENST00000369219.1	-	22	2741	c.2725C>T	c.(2725-2727)Ctc>Ttc	p.L909F				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	909	NBPF 10. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.L909F(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					ACCAGGTGGAGACTTGTCACC	0.468																																																1	Substitution - Missense(1)	ovary(1)	1											59.0	87.0	78.0					1																	148004589		2036	4211	6247	146471213	SO:0001583	missense	25832			AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.2725C>T	1.37:g.148004589G>A	ENSP00000358221:p.Leu909Phe	Somatic		Capture	Illumina GAIIx	Phase_I	146471213	Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	ENST00000369219.1	37		.	.	.	.	.	.	.	.	.	.	g	4.096	0.015819	0.07959	.	.	ENSG00000122497	ENST00000369219;ENST00000369368	T	0.04502	3.61	0.512	0.512	0.16994	DUF1220 (1);	.	.	.	.	T	0.03348	0.0097	L	0.48642	1.525	0.09310	N	1	B;D;D	0.56035	0.446;0.974;0.97	B;P;P	0.51806	0.058;0.497;0.68	T	0.41324	-0.9515	8	0.66056	D	0.02	.	.	.	.	.	257;890;909	F8WEX8;B4DH59;Q5TI25	.;.;NBPFE_HUMAN	F	909;257	ENSP00000358221:L909F	ENSP00000358221:L909F	L	-	1	0	NBPF14	146471213	0.892000	0.30473	0.002000	0.10522	0.006000	0.05464	0.775000	0.26689	0.585000	0.29608	0.433000	0.28618	CTC		0.468	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	
POGZ	23126	broad.mit.edu	37	1	151400883	151400883	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr1:151400883C>T	ENST00000271715.2	-	6	889	c.575G>A	c.(574-576)gGt>gAt	p.G192D	POGZ_ENST00000368863.2_Missense_Mutation_p.G97D|POGZ_ENST00000409503.1_Missense_Mutation_p.G192D|POGZ_ENST00000361398.3_Missense_Mutation_p.G139D|POGZ_ENST00000491586.1_Missense_Mutation_p.G139D|POGZ_ENST00000540984.1_Intron|POGZ_ENST00000531094.1_Missense_Mutation_p.G139D|POGZ_ENST00000392723.1_Missense_Mutation_p.G139D	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	192					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G192D(1)		NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AAACTGGGTACCTGGGGCTTT	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											127.0	137.0	134.0					1																	151400883		2203	4300	6503	149667507	SO:0001583	missense	23126			AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.575G>A	1.37:g.151400883C>T	ENSP00000271715:p.Gly192Asp	Somatic		Capture	Illumina GAIIx	Phase_I	149667507	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	37	CCDS997.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188619	0.78789	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000491586;ENST00000437847	T;T;T;T;T;T;T	0.03920	4.29;4.21;4.29;5.26;4.19;5.37;3.76	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000001	T	0.07503	0.0189	N	0.19112	0.55	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.996;1.0;0.999;0.998;0.998;0.999	T	0.42155	-0.9468	10	0.72032	D	0.01	-14.1448	17.436	0.87552	0.0:1.0:0.0:0.0	.	139;192;97;192;139;139;192	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-4;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;.;POGZ_HUMAN	D	139;192;139;97;192;139;139;192	ENSP00000376484:G139D;ENSP00000271715:G192D;ENSP00000354467:G139D;ENSP00000357856:G97D;ENSP00000386836:G192D;ENSP00000431259:G139D;ENSP00000418408:G139D	ENSP00000271715:G192D	G	-	2	0	POGZ	149667507	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.481000	0.66826	2.696000	0.92011	0.467000	0.42956	GGT		0.498	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
AXDND1	126859	broad.mit.edu	37	1	179347861	179347861	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr1:179347861A>T	ENST00000367618.3	+	5	851	c.464A>T	c.(463-465)cAg>cTg	p.Q155L	AXDND1_ENST00000457238.2_Missense_Mutation_p.Q155L|AXDND1_ENST00000461179.2_3'UTR	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	155								p.Q155L(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						CGTTCATTACAGTCACATGAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											118.0	97.0	104.0					1																	179347861		2203	4300	6503	177614484	SO:0001583	missense	0			BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.464A>T	1.37:g.179347861A>T	ENSP00000356590:p.Gln155Leu	Somatic		Capture	Illumina GAIIx	Phase_I	177614484	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	37	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	A	10.79	1.450359	0.26074	.	.	ENSG00000162779	ENST00000509175;ENST00000367618;ENST00000360322;ENST00000457238;ENST00000511889;ENST00000434088	T;T;T	0.45668	2.19;0.89;2.21	3.56	2.39	0.29439	.	1.066530	0.07255	N	0.866526	T	0.32224	0.0822	L	0.47716	1.5	0.09310	N	1	B;B	0.33694	0.421;0.421	B;B	0.25291	0.059;0.026	T	0.18808	-1.0325	10	0.30078	T	0.28	-1.2528	6.8382	0.23947	0.7608:0.2392:0.0:0.0	.	113;155	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	L	113;155;113;155;113;89	ENSP00000356590:Q155L;ENSP00000416712:Q155L;ENSP00000391716:Q89L	ENSP00000353471:Q113L	Q	+	2	0	AXDND1	177614484	0.070000	0.21116	0.002000	0.10522	0.249000	0.25844	2.261000	0.43276	0.697000	0.31718	0.383000	0.25322	CAG		0.363	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
DDX59	83479	broad.mit.edu	37	1	200619725	200619725	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr1:200619725A>G	ENST00000331314.6	-	5	1355	c.1142T>C	c.(1141-1143)aTt>aCt	p.I381T	DDX59_ENST00000447706.2_Missense_Mutation_p.I381T|DDX59_ENST00000367348.3_Missense_Mutation_p.I381T	NM_001031725.4	NP_001026895.2	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	381	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.I381T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(1)|lung(9)|ovary(3)	21						TGAAACCAAAATGGTCTGACA	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											98.0	91.0	93.0					1																	200619725		2203	4300	6503	198886348	SO:0001583	missense	83479			BC041801	CCDS30964.1	1q32.1	2010-07-14			ENSG00000118197	ENSG00000118197		"""Zinc fingers, HIT-type"", ""DEAD-boxes"""	25360	protein-coding gene	gene with protein product		615464					Standard	NM_001031725		Approved	DKFZP564B1023, ZNHIT5	uc009wzk.3	Q5T1V6	OTTHUMG00000035725	ENST00000331314.6:c.1142T>C	1.37:g.200619725A>G	ENSP00000330460:p.Ile381Thr	Somatic		Capture	Illumina GAIIx	Phase_I	198886348	Q6PJL2|Q8IVW3|Q9H0W3	Missense_Mutation	SNP	ENST00000331314.6	37	CCDS30964.1	.	.	.	.	.	.	.	.	.	.	A	19.16	3.773522	0.69992	.	.	ENSG00000118197	ENST00000447706;ENST00000413408;ENST00000367348;ENST00000331314;ENST00000433235;ENST00000453944	T;T;T;T;T;T	0.48522	2.15;3.38;2.15;2.15;3.38;0.81	5.75	5.75	0.90469	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.239170	0.41605	D	0.000845	T	0.47322	0.1439	L	0.42744	1.35	0.53005	D	0.999967	P;B	0.37688	0.605;0.316	B;B	0.40782	0.34;0.259	T	0.50608	-0.8808	10	0.72032	D	0.01	-3.4623	16.0479	0.80734	1.0:0.0:0.0:0.0	.	381;381	B7Z5N6;Q5T1V6	.;DDX59_HUMAN	T	381;19;381;381;24;24	ENSP00000394367:I381T;ENSP00000394304:I19T;ENSP00000356317:I381T;ENSP00000330460:I381T;ENSP00000409954:I24T;ENSP00000398152:I24T	ENSP00000330460:I381T	I	-	2	0	DDX59	198886348	1.000000	0.71417	0.496000	0.27539	0.996000	0.88848	9.281000	0.95811	2.195000	0.70347	0.467000	0.42956	ATT		0.363	DDX59-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086883.2	NM_001031725.4	
C1orf106	55765	broad.mit.edu	37	1	200876999	200876999	+	Silent	SNP	G	G	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr1:200876999G>T	ENST00000367342.4	+	6	1013	c.813G>T	c.(811-813)ggG>ggT	p.G271G	C1orf106_ENST00000413687.2_Silent_p.G186G	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	271								p.G271G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						TGTCAGATGGGCTCCTCCTGG	0.507																																																1	Substitution - coding silent(1)	ovary(1)	1											118.0	109.0	112.0					1																	200876999		2203	4300	6503	199143622	SO:0001819	synonymous_variant	55765			AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.813G>T	1.37:g.200876999G>T		Somatic		Capture	Illumina GAIIx	Phase_I	199143622	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Silent	SNP	ENST00000367342.4	37																																																																																					0.507	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
PRELP	5549	broad.mit.edu	37	1	203452815	203452815	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr1:203452815C>T	ENST00000343110.2	+	2	630	c.503C>T	c.(502-504)gCc>gTc	p.A168V		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	168					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.A168V(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			GTCCCCTCGGCCCTGCCCCGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											72.0	76.0	75.0					1																	203452815		2203	4300	6503	201719438	SO:0001583	missense	5549			BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.503C>T	1.37:g.203452815C>T	ENSP00000343924:p.Ala168Val	Somatic		Capture	Illumina GAIIx	Phase_I	201719438	Q6FG38	Missense_Mutation	SNP	ENST00000343110.2	37	CCDS1438.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.041823	0.35989	.	.	ENSG00000188783	ENST00000343110	T	0.04317	3.65	4.59	4.59	0.56863	.	0.283074	0.33534	N	0.004810	T	0.03915	0.0110	L	0.38953	1.18	0.09310	N	1	B	0.31581	0.329	B	0.28465	0.09	T	0.39187	-0.9626	10	0.30078	T	0.28	-10.3697	6.0043	0.19537	0.19:0.7125:0.0:0.0975	.	168	P51888	PRELP_HUMAN	V	168	ENSP00000343924:A168V	ENSP00000343924:A168V	A	+	2	0	PRELP	201719438	0.000000	0.05858	0.889000	0.34880	0.965000	0.64279	0.038000	0.13862	2.110000	0.64415	0.462000	0.41574	GCC		0.587	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087474.1	NM_002725	
EPHX1	2052	broad.mit.edu	37	1	226030165	226030165	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr1:226030165G>A	ENST00000366837.4	+	7	1226	c.1030G>A	c.(1030-1032)Ggc>Agc	p.G344S	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Missense_Mutation_p.G344S	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	344					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)	p.G344S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					GGAGGATGGAGGCCTGGAAAG	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											94.0	104.0	101.0					1																	226030165		2203	4300	6503	224096788	SO:0001583	missense	2052			J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.1030G>A	1.37:g.226030165G>A	ENSP00000355802:p.Gly344Ser	Somatic		Capture	Illumina GAIIx	Phase_I	224096788	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	37	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	G	35	5.431858	0.96150	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.61627	0.09;0.09	5.19	5.19	0.71726	Alpha/beta hydrolase fold-1 (1);	0.000000	0.85682	D	0.000000	T	0.76449	0.3989	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78411	-0.2214	10	0.66056	D	0.02	-12.171	19.084	0.93194	0.0:0.0:1.0:0.0	.	344	P07099	HYEP_HUMAN	S	344	ENSP00000272167:G344S;ENSP00000355802:G344S	ENSP00000272167:G344S	G	+	1	0	EPHX1	224096788	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.707000	0.98725	2.575000	0.86900	0.561000	0.74099	GGC		0.557	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
FAM208B	54906	broad.mit.edu	37	10	5790325	5790325	+	Silent	SNP	A	A	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr10:5790325A>C	ENST00000328090.5	+	15	5566	c.4941A>C	c.(4939-4941)acA>acC	p.T1647T		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1647								p.T1647T(1)									CTTATTCTACACAGGGATGCA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	10											61.0	63.0	62.0					10																	5790325		2115	4235	6350	5830331	SO:0001819	synonymous_variant	54906			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.4941A>C	10.37:g.5790325A>C		Somatic		Capture	Illumina GAIIx	Phase_I	5830331	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Silent	SNP	ENST00000328090.5	37	CCDS41485.1																																																																																				0.458	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
FBXO18	84893	broad.mit.edu	37	10	5978419	5978419	+	Splice_Site	SNP	G	G	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr10:5978419G>C	ENST00000362091.4	+	20	2945	c.2830G>C	c.(2830-2832)Gag>Cag	p.E944Q	RP11-536K7.3_ENST00000397264.4_RNA|FBXO18_ENST00000397269.3_Splice_Site_p.E448Q|FBXO18_ENST00000379999.5_Splice_Site_p.E995Q	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	944					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)	p.E995Q(1)		NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						TCTTTCTCAGGAGTACTTCTT	0.522																																																1	Substitution - Missense(1)	ovary(1)	10											104.0	84.0	91.0					10																	5978419		2203	4300	6503	6018425	SO:0001630	splice_region_variant	84893			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2830-1G>C	10.37:g.5978419G>C		Somatic		Capture	Illumina GAIIx	Phase_I	6018425	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537749	0.65085	.	.	ENSG00000134452	ENST00000397269;ENST00000362091;ENST00000379999	.	.	.	4.75	4.75	0.60458	.	0.115763	0.56097	D	0.000028	T	0.53658	0.1810	L	0.29908	0.895	0.58432	D	0.999994	P;P;P	0.48089	0.813;0.883;0.905	P;B;P	0.48270	0.572;0.399;0.479	T	0.51585	-0.8687	8	.	.	.	-12.4049	16.946	0.86230	0.0:0.0:1.0:0.0	.	995;944;870	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	Q	448;944;995	.	.	E	+	1	0	FBXO18	6018425	1.000000	0.71417	1.000000	0.80357	0.498000	0.33706	5.462000	0.66707	2.341000	0.79615	0.454000	0.30748	GAG		0.522	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	Missense_Mutation
GPAM	57678	broad.mit.edu	37	10	113933556	113933556	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr10:113933556C>A	ENST00000348367.4	-	7	658	c.461G>T	c.(460-462)gGt>gTt	p.G154V	GPAM_ENST00000423155.1_Missense_Mutation_p.G154V|GPAM_ENST00000369425.1_Missense_Mutation_p.G154V			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	154					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.G154V(1)		breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		CTGGGCAGAACCATCAGGGTT	0.403																																					Ovarian(161;1017 2606 18293 52943)											1	Substitution - Missense(1)	ovary(1)	10											99.0	87.0	91.0					10																	113933556		2203	4300	6503	113923546	SO:0001583	missense	57678			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.461G>T	10.37:g.113933556C>A	ENSP00000265276:p.Gly154Val	Somatic		Capture	Illumina GAIIx	Phase_I	113923546	Q5VW51|Q86TA3	Missense_Mutation	SNP	ENST00000348367.4	37	CCDS7570.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.401298	0.42613	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	T;T;T	0.71103	-0.54;-0.54;-0.53	6.02	5.06	0.68205	.	0.266734	0.41097	D	0.000944	T	0.66915	0.2838	L	0.58101	1.795	0.46823	D	0.999213	B;B	0.20671	0.047;0.019	B;B	0.21708	0.036;0.025	T	0.61088	-0.7133	10	0.27082	T	0.32	-22.6179	15.1506	0.72696	0.0:0.8598:0.1402:0.0	.	154;154	Q5VW52;Q9HCL2	.;GPAT1_HUMAN	V	154	ENSP00000265276:G154V;ENSP00000409242:G154V;ENSP00000358433:G154V	ENSP00000265276:G154V	G	-	2	0	GPAM	113923546	0.881000	0.30235	0.975000	0.42487	0.741000	0.42261	2.007000	0.40883	2.857000	0.98124	0.650000	0.86243	GGT		0.403	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
DMBT1	1755	broad.mit.edu	37	10	124377810	124377810	+	Silent	SNP	C	C	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr10:124377810C>T	ENST00000338354.3	+	38	4888	c.4782C>T	c.(4780-4782)ctC>ctT	p.L1594L	DMBT1_ENST00000344338.3_Silent_p.L1584L|DMBT1_ENST00000359586.6_Silent_p.L445L|DMBT1_ENST00000330163.4_Silent_p.L966L|DMBT1_ENST00000368955.3_Silent_p.L1584L|DMBT1_ENST00000368909.3_Silent_p.L1594L|DMBT1_ENST00000368956.2_Silent_p.L966L			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1594	SRCR 12. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.L1723L(1)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATGGCTGGCTCTCCCACAACT	0.557																																					Ovarian(182;93 2026 18125 22222 38972)											1	Substitution - coding silent(1)	ovary(1)	10											82.0	81.0	81.0					10																	124377810		1922	4144	6066	124367800	SO:0001819	synonymous_variant	1755				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.4782C>T	10.37:g.124377810C>T		Somatic		Capture	Illumina GAIIx	Phase_I	124367800	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	ENST00000338354.3	37																																																																																					0.557	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
CHRNA10	57053	broad.mit.edu	37	11	3687612	3687612	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr11:3687612A>G	ENST00000250699.2	-	5	1149	c.1078T>C	c.(1078-1080)Tcc>Ccc	p.S360P	Y_RNA_ENST00000364409.1_RNA|CHRNA10_ENST00000493827.2_5'Flank|Y_RNA_ENST00000363331.1_RNA|CHRNA10_ENST00000534359.1_3'UTR	NM_020402.2	NP_065135.2	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10 (neuronal)	360					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell proliferation (GO:0042127)|synaptic transmission, cholinergic (GO:0007271)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perikaryon (GO:0043204)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)|receptor binding (GO:0005102)	p.S360P(1)		breast(1)|endometrium(2)|lung(3)|ovary(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Galantamine(DB00674)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Succinylcholine(DB00202)|Trimethaphan(DB01116)	GGTGGCCTGGACTGCCCACAG	0.701																																					Melanoma(153;17 1869 2949 7120 36888)											1	Substitution - Missense(1)	ovary(1)	11											53.0	57.0	55.0					11																	3687612		2201	4297	6498	3644188	SO:0001583	missense	57053			AF199235	CCDS7745.1	11p15.5	2012-02-11	2012-02-07		ENSG00000129749	ENSG00000129749		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	13800	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 10 (neuronal)"""	606372	"""cholinergic receptor, nicotinic, alpha polypeptide 10"""				Standard	NM_020402		Approved		uc001lyf.3	Q9GZZ6	OTTHUMG00000011844	ENST00000250699.2:c.1078T>C	11.37:g.3687612A>G	ENSP00000250699:p.Ser360Pro	Somatic		Capture	Illumina GAIIx	Phase_I	3644188		Missense_Mutation	SNP	ENST00000250699.2	37	CCDS7745.1	.	.	.	.	.	.	.	.	.	.	A	2.332	-0.353110	0.05173	.	.	ENSG00000129749	ENST00000250699	D	0.85484	-1.99	5.61	-3.39	0.04868	Neurotransmitter-gated ion-channel transmembrane domain (2);	2.127130	0.02439	N	0.084345	T	0.64438	0.2598	N	0.02697	-0.525	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57493	-0.7802	10	0.16420	T	0.52	.	6.5739	0.22553	0.2469:0.4023:0.3508:0.0	.	360	Q9GZZ6	ACH10_HUMAN	P	360	ENSP00000250699:S360P	ENSP00000250699:S360P	S	-	1	0	CHRNA10	3644188	0.000000	0.05858	0.003000	0.11579	0.090000	0.18270	-0.373000	0.07494	-0.218000	0.10018	-0.366000	0.07423	TCC		0.701	CHRNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032763.2		
MRGPRX3	117195	broad.mit.edu	37	11	18159317	18159317	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr11:18159317G>T	ENST00000396275.2	+	3	929	c.568G>T	c.(568-570)Gtt>Ttt	p.V190F		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	190						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V190F(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						TTTATGTGTGGTTCTCTGTGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											142.0	132.0	135.0					11																	18159317		2200	4293	6493	18115893	SO:0001583	missense	117195				CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.568G>T	11.37:g.18159317G>T	ENSP00000379571:p.Val190Phe	Somatic		Capture	Illumina GAIIx	Phase_I	18115893	B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	ENST00000396275.2	37	CCDS7830.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.139508	0.37728	.	.	ENSG00000179826	ENST00000396275;ENST00000531264	T;T	0.74002	-0.8;-0.8	1.46	-2.82	0.05787	GPCR, rhodopsin-like superfamily (1);	1.016490	0.07876	N	0.968818	D	0.85513	0.5714	M	0.92367	3.3	0.25011	N	0.991407	D	0.67145	0.996	D	0.71184	0.972	T	0.73636	-0.3920	10	0.87932	D	0	.	3.679	0.08304	0.3211:0.2105:0.4685:0.0	.	190	Q96LB0	MRGX3_HUMAN	F	190	ENSP00000379571:V190F;ENSP00000436242:V190F	ENSP00000379571:V190F	V	+	1	0	MRGPRX3	18115893	0.420000	0.25457	0.030000	0.17652	0.017000	0.09413	-0.327000	0.07955	-0.873000	0.04032	0.430000	0.28490	GTT		0.507	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389767.1	NM_054031	
OR5M10	390167	broad.mit.edu	37	11	56344609	56344609	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr11:56344609T>A	ENST00000526812.2	-	1	654	c.589A>T	c.(589-591)Atg>Ttg	p.M197L		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						AACATTGCCATCTTTTTGACA	0.443																																																0			11											73.0	71.0	72.0					11																	56344609		1921	4114	6035	56101185	SO:0001583	missense	390167			BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.589A>T	11.37:g.56344609T>A	ENSP00000436004:p.Met197Leu	Somatic		Capture	Illumina GAIIx	Phase_I	56101185	B9EIL9	Missense_Mutation	SNP	ENST00000526812.2	37	CCDS53630.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.749438	0.00086	.	.	ENSG00000254834	ENST00000526812	T	0.00024	8.97	4.2	0.134	0.14771	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.00630	-1.315	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38178	-0.9673	9	0.02654	T	1	.	1.3898	0.02248	0.144:0.1772:0.1483:0.5305	.	197	Q6IEU7	OR5MA_HUMAN	L	197	ENSP00000436004:M197L	ENSP00000436004:M197L	M	-	1	0	OR5M10	56101185	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	-0.763000	0.04740	0.232000	0.21100	-0.283000	0.09986	ATG		0.443	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741	
SSH3	54961	broad.mit.edu	37	11	67075069	67075069	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr11:67075069G>T	ENST00000308127.4	+	7	830	c.652G>T	c.(652-654)Ggc>Tgc	p.G218C	SSH3_ENST00000308298.7_Missense_Mutation_p.G218C|SSH3_ENST00000532181.1_Intron|SSH3_ENST00000376757.5_Missense_Mutation_p.G218C	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	218					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.G218C(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			TCTAGGCAGCGGCCTTGTACC	0.617																																																1	Substitution - Missense(1)	ovary(1)	11											54.0	56.0	55.0					11																	67075069		2200	4295	6495	66831645	SO:0001583	missense	54961			AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.652G>T	11.37:g.67075069G>T	ENSP00000312081:p.Gly218Cys	Somatic		Capture	Illumina GAIIx	Phase_I	66831645	Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Missense_Mutation	SNP	ENST00000308127.4	37	CCDS8157.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.506997	0.27036	.	.	ENSG00000172830	ENST00000308127;ENST00000308298;ENST00000376757	T;T;T	0.31769	3.78;1.48;3.82	4.49	3.57	0.40892	.	0.305972	0.26153	N	0.026025	T	0.43523	0.1251	L	0.44542	1.39	0.28171	N	0.928589	D;D	0.89917	1.0;0.999	D;D	0.68621	0.959;0.951	T	0.30995	-0.9959	10	0.72032	D	0.01	-16.4393	10.2369	0.43288	0.1817:0.0:0.8183:0.0	.	72;218	Q8TE77-3;Q8TE77	.;SSH3_HUMAN	C	218	ENSP00000312081:G218C;ENSP00000310055:G218C;ENSP00000365948:G218C	ENSP00000312081:G218C	G	+	1	0	SSH3	66831645	0.001000	0.12720	0.721000	0.30653	0.207000	0.24258	0.713000	0.25794	0.469000	0.27268	-1.644000	0.00765	GGC		0.617	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393167.1	NM_018276	
TYR	7299	broad.mit.edu	37	11	88911742	88911742	+	Silent	SNP	T	T	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr11:88911742T>C	ENST00000263321.5	+	1	1123	c.621T>C	c.(619-621)ttT>ttC	p.F207F	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	207					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.F207F(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CACCAGCTTTTCTGCCTTGGC	0.458																																																1	Substitution - coding silent(1)	ovary(1)	11											157.0	151.0	153.0					11																	88911742		2201	4299	6500	88551390	SO:0001819	synonymous_variant	7299			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.621T>C	11.37:g.88911742T>C		Somatic		Capture	Illumina GAIIx	Phase_I	88551390	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Silent	SNP	ENST00000263321.5	37	CCDS8284.1																																																																																				0.458	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
KMT2A	4297	broad.mit.edu	37	11	118359387	118359387	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr11:118359387A>G	ENST00000389506.5	+	11	4391	c.4391A>G	c.(4390-4392)gAg>gGg	p.E1464G	KMT2A_ENST00000534358.1_Missense_Mutation_p.E1464G|KMT2A_ENST00000354520.4_Missense_Mutation_p.E1426G			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1464					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.E1464G(1)									GAGGAGAACGAGCGCCCTCTG	0.428																																																1	Substitution - Missense(1)	ovary(1)	11											134.0	121.0	125.0					11																	118359387		2200	4296	6496	117864597	SO:0001583	missense	4297			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.4391A>G	11.37:g.118359387A>G	ENSP00000374157:p.Glu1464Gly	Somatic		Capture	Illumina GAIIx	Phase_I	117864597	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	A	19.81	3.896118	0.72639	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313;ENST00000392873	D;D;D;D	0.90955	-1.75;-1.75;-1.69;-2.76	5.52	5.52	0.82312	Zinc finger, PHD-finger (1);Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.94928	0.8360	M	0.74881	2.28	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.80764	0.985;0.994	D	0.95450	0.8533	10	0.87932	D	0	.	15.938	0.79729	1.0:0.0:0.0:0.0	.	1464;1464	E9PQG7;Q03164	.;MLL1_HUMAN	G	1464;1464;1426;374;176	ENSP00000436786:E1464G;ENSP00000374157:E1464G;ENSP00000346516:E1426G;ENSP00000376612:E176G	ENSP00000346516:E1426G	E	+	2	0	MLL	117864597	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	8.905000	0.92613	2.222000	0.72286	0.533000	0.62120	GAG		0.428	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
GUCY2C	2984	broad.mit.edu	37	12	14796586	14796586	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr12:14796586T>C	ENST00000261170.3	-	17	1988	c.1852A>G	c.(1852-1854)Acc>Gcc	p.T618A		NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	618	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)	p.T618A(1)		breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	ACGCAGTTGGTAGATTTCAGA	0.388																																																1	Substitution - Missense(1)	ovary(1)	12											160.0	152.0	154.0					12																	14796586		2203	4300	6503	14687853	SO:0001583	missense	2984				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.1852A>G	12.37:g.14796586T>C	ENSP00000261170:p.Thr618Ala	Somatic		Capture	Illumina GAIIx	Phase_I	14687853	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.519930	0.85495	.	.	ENSG00000070019	ENST00000261170	D	0.82255	-1.59	5.47	5.47	0.80525	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.76090	0.3939	N	0.05280	-0.08	0.80722	D	1	P	0.39696	0.683	P	0.47528	0.549	T	0.81351	-0.0972	10	0.66056	D	0.02	.	15.5397	0.76031	0.0:0.0:0.0:1.0	.	618	P25092	GUC2C_HUMAN	A	618	ENSP00000261170:T618A	ENSP00000261170:T618A	T	-	1	0	GUCY2C	14687853	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	6.250000	0.72435	2.060000	0.61445	0.528000	0.53228	ACC		0.388	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
ZNF641	121274	broad.mit.edu	37	12	48739139	48739139	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr12:48739139A>G	ENST00000544117.2	-	4	1145	c.437T>C	c.(436-438)gTa>gCa	p.V146A	ZNF641_ENST00000448928.3_Intron|ZNF641_ENST00000547026.1_Missense_Mutation_p.V132A|ZNF641_ENST00000301042.3_Missense_Mutation_p.V146A			Q96N77	ZN641_HUMAN	zinc finger protein 641	146	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.V146A(1)		breast(1)|endometrium(2)|kidney(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	12						CAGAGAGACTACTATCCCACA	0.507																																																1	Substitution - Missense(1)	ovary(1)	12											94.0	89.0	91.0					12																	48739139		2203	4300	6503	47025406	SO:0001583	missense	121274			BC018090	CCDS8763.1, CCDS53787.1, CCDS53788.1	12q13.11	2013-01-08				ENSG00000167528		"""Zinc fingers, C2H2-type"", ""-"""	31834	protein-coding gene	gene with protein product		613906					Standard	NM_152320		Approved	FLJ31295	uc001rro.2	Q96N77		ENST00000544117.2:c.437T>C	12.37:g.48739139A>G	ENSP00000437832:p.Val146Ala	Somatic		Capture	Illumina GAIIx	Phase_I	47025406	B3KS43|B4DNU5|Q8TCQ7|Q8WVE1	Missense_Mutation	SNP	ENST00000544117.2	37	CCDS8763.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.229469	0.79688	.	.	ENSG00000167528	ENST00000301042;ENST00000544117;ENST00000547026	T;T;T	0.01963	4.53;4.53;4.53	5.54	5.54	0.83059	Krueppel-associated box (4);	0.000000	0.53938	D	0.000052	T	0.12305	0.0299	M	0.78637	2.42	0.41010	D	0.984994	D	0.69078	0.997	D	0.76071	0.987	T	0.00436	-1.1740	10	0.52906	T	0.07	.	13.9163	0.63899	1.0:0.0:0.0:0.0	.	146	Q96N77	ZN641_HUMAN	A	146;146;132	ENSP00000301042:V146A;ENSP00000437832:V146A;ENSP00000449974:V132A	ENSP00000301042:V146A	V	-	2	0	ZNF641	47025406	0.952000	0.32445	1.000000	0.80357	0.997000	0.91878	5.732000	0.68563	2.243000	0.73865	0.533000	0.62120	GTA		0.507	ZNF641-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000406518.1	NM_152320	
SCN8A	6334	broad.mit.edu	37	12	52200485	52200485	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr12:52200485C>A	ENST00000354534.6	+	27	5393	c.5215C>A	c.(5215-5217)Ccc>Acc	p.P1739T	SCN8A_ENST00000545061.1_Missense_Mutation_p.P1698T	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1739					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.P1739T(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TTGTGGGAACCCCTCAGTGGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	12											73.0	80.0	78.0					12																	52200485		2134	4269	6403	50486752	SO:0001583	missense	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.5215C>A	12.37:g.52200485C>A	ENSP00000346534:p.Pro1739Thr	Somatic		Capture	Illumina GAIIx	Phase_I	50486752	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.012259	0.54468	.	.	ENSG00000196876	ENST00000354534;ENST00000545061	D;D	0.98192	-4.78;-4.78	5.32	5.32	0.75619	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98890	0.9624	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.99698	1.1003	10	0.87932	D	0	.	19.5787	0.95455	0.0:1.0:0.0:0.0	.	1739	Q9UQD0	SCN8A_HUMAN	T	1739;1698	ENSP00000346534:P1739T;ENSP00000440360:P1698T	ENSP00000346534:P1739T	P	+	1	0	SCN8A	50486752	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.651000	0.83577	2.941000	0.99782	0.655000	0.94253	CCC		0.507	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
SCN8A	6334	broad.mit.edu	37	12	52200805	52200805	+	Silent	SNP	G	G	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr12:52200805G>A	ENST00000354534.6	+	27	5713	c.5535G>A	c.(5533-5535)ttG>ttA	p.L1845L	SCN8A_ENST00000545061.1_Silent_p.L1804L|RP11-923I11.3_ENST00000565518.1_lincRNA|AC068987.1_ENST00000599343.1_5'Flank	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1845					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.L1845L(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TCCACTGCTTGGACATCCTTT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	12											90.0	95.0	93.0					12																	52200805		2115	4255	6370	50487072	SO:0001819	synonymous_variant	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.5535G>A	12.37:g.52200805G>A		Somatic		Capture	Illumina GAIIx	Phase_I	50487072	B9VWG8|O95788|Q9NYX2|Q9UPB2	Silent	SNP	ENST00000354534.6	37	CCDS44891.1																																																																																				0.567	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
SPPL3	121665	broad.mit.edu	37	12	121204137	121204137	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr12:121204137C>T	ENST00000353487.2	-	10	1515	c.1012G>A	c.(1012-1014)Gcc>Acc	p.A338T		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	339						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)	p.A338T(1)				all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GGCTGGGCGGCCCGGTGAATG	0.547																																																1	Substitution - Missense(1)	ovary(1)	12											40.0	37.0	38.0					12																	121204137		2203	4298	6501	119688520	SO:0001583	missense	121665				CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.1012G>A	12.37:g.121204137C>T	ENSP00000288680:p.Ala338Thr	Somatic		Capture	Illumina GAIIx	Phase_I	119688520	Q3MJ04|Q8TAU4|Q96DD9	Missense_Mutation	SNP	ENST00000353487.2	37	CCDS9208.1	.	.	.	.	.	.	.	.	.	.	C	34	5.380902	0.95945	.	.	ENSG00000157837	ENST00000353487;ENST00000405631	T	0.17854	2.25	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.31040	0.0784	L	0.56769	1.78	0.80722	D	1	P;P	0.46020	0.871;0.811	P;B	0.52343	0.696;0.433	T	0.01195	-1.1422	10	0.14656	T	0.56	-15.7169	19.8579	0.96771	0.0:1.0:0.0:0.0	.	339;338	Q8TCT6;Q3MJ04	PSL4_HUMAN;.	T	338;337	ENSP00000288680:A338T	ENSP00000288680:A338T	A	-	1	0	AC069214.1	119688520	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	7.487000	0.81328	2.687000	0.91594	0.655000	0.94253	GCC		0.547	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402980.2	NM_139015	
DGKH	160851	broad.mit.edu	37	13	42772647	42772647	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr13:42772647G>C	ENST00000337343.4	+	18	2222	c.2201G>C	c.(2200-2202)gGg>gCg	p.G734A	DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000540693.1_Missense_Mutation_p.G734A|DGKH_ENST00000261491.5_Missense_Mutation_p.G734A|DGKH_ENST00000538674.1_Missense_Mutation_p.G489A|DGKH_ENST00000379274.2_Missense_Mutation_p.G598A|DGKH_ENST00000536612.1_Missense_Mutation_p.G598A	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	734					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.G734A(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TCAATTGCTGGGAGTTCGATT	0.418																																																1	Substitution - Missense(1)	ovary(1)	13											136.0	127.0	130.0					13																	42772647		2203	4300	6503	41670647	SO:0001583	missense	160851			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.2201G>C	13.37:g.42772647G>C	ENSP00000337572:p.Gly734Ala	Somatic		Capture	Illumina GAIIx	Phase_I	41670647	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717496	0.89205	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	D;T;D;D;D;T	0.82255	-1.58;-1.45;-1.58;-1.59;-1.59;1.64	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.90504	0.7025	M	0.71581	2.175	0.80722	D	1	D;D;D;B	0.89917	0.966;0.966;1.0;0.25	P;P;D;B	0.83275	0.747;0.73;0.996;0.109	D	0.87476	0.2417	10	0.27082	T	0.32	.	19.8372	0.96661	0.0:0.0:1.0:0.0	.	489;598;734;734	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	A	734;734;734;598;598;489	ENSP00000440823:G734A;ENSP00000337572:G734A;ENSP00000261491:G734A;ENSP00000368576:G598A;ENSP00000445114:G598A;ENSP00000441308:G489A	ENSP00000261491:G734A	G	+	2	0	DGKH	41670647	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.825000	0.92029	2.770000	0.95276	0.655000	0.94253	GGG		0.418	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
CHD8	57680	broad.mit.edu	37	14	21876941	21876941	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr14:21876941T>C	ENST00000557364.1	-	12	2671	c.2408A>G	c.(2407-2409)cAt>cGt	p.H803R	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Missense_Mutation_p.H524R|CHD8_ENST00000399982.2_Missense_Mutation_p.H803R			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	803					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)	p.H803R(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TTTATATTCATGTGATAGCTC	0.388																																																1	Substitution - Missense(1)	ovary(1)	14											89.0	76.0	80.0					14																	21876941		1810	4080	5890	20946781	SO:0001583	missense	57680			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.2408A>G	14.37:g.21876941T>C	ENSP00000451601:p.His803Arg	Somatic		Capture	Illumina GAIIx	Phase_I	20946781	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	37	CCDS53885.1	.	.	.	.	.	.	.	.	.	.	T	3.139	-0.176663	0.06380	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	D;D;D	0.93189	-3.18;-3.18;-3.18	5.31	5.31	0.75309	.	0.061993	0.64402	D	0.000007	T	0.71350	0.3329	N	0.00254	-1.765	0.34308	D	0.685128	B	0.02656	0.0	B	0.01281	0.0	T	0.73199	-0.4058	10	0.02654	T	1	-21.6595	8.9353	0.35695	0.0:0.0833:0.0:0.9167	.	524	Q9HCK8-2	.	R	524;803;523;803	ENSP00000406288:H524R;ENSP00000382863:H803R;ENSP00000451601:H803R	ENSP00000262707:H523R	H	-	2	0	CHD8	20946781	0.992000	0.36948	1.000000	0.80357	0.993000	0.82548	1.457000	0.35212	2.219000	0.72066	0.528000	0.53228	CAT		0.388	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
DCAF4	26094	broad.mit.edu	37	14	73420934	73420934	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr14:73420934T>A	ENST00000358377.2	+	10	1091	c.871T>A	c.(871-873)Tcc>Acc	p.S291T	DCAF4_ENST00000394234.2_Missense_Mutation_p.S191T|DCAF4_ENST00000553457.1_Missense_Mutation_p.S191T|DCAF4_ENST00000555042.1_Missense_Mutation_p.S292T|DCAF4_ENST00000353777.3_Intron|DCAF4_ENST00000509153.1_Missense_Mutation_p.S231T	NM_001163509.1|NM_015604.3	NP_001156981.1|NP_056419.2	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4	291					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)		p.S291T(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|skin(1)	22						CTGTGCCTGGTCCCTGAATAT	0.542																																																1	Substitution - Missense(1)	ovary(1)	14											183.0	187.0	185.0					14																	73420934		2203	4300	6503	72490687	SO:0001583	missense	26094			BC018979	CCDS9809.1, CCDS9810.1, CCDS41968.1, CCDS41968.2, CCDS55926.1	14q24.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000119599		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20229	protein-coding gene	gene with protein product			"""WD repeat domain 21"", ""WD repeat domain 21A"""	WDR21, WDR21A			Standard	NM_015604		Approved	DKFZp434K114	uc010ttr.2	Q8WV16		ENST00000358377.2:c.871T>A	14.37:g.73420934T>A	ENSP00000351147:p.Ser291Thr	Somatic		Capture	Illumina GAIIx	Phase_I	72490687	B4DUT6|G3V522|Q86U31|Q8IV10|Q96K22|Q9Y4P5	Missense_Mutation	SNP	ENST00000358377.2	37	CCDS9809.1	.	.	.	.	.	.	.	.	.	.	T	11.71	1.718941	0.30503	.	.	ENSG00000119599	ENST00000358377;ENST00000394234;ENST00000509153;ENST00000555042;ENST00000553457	T;T;T;T;T	0.61627	0.48;0.09;0.46;0.13;4.67	4.94	3.79	0.43588	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.183049	0.64402	D	0.000010	T	0.51805	0.1696	L	0.51422	1.61	0.36368	D	0.861115	B;B;P;P;B	0.35033	0.224;0.349;0.481;0.481;0.349	B;B;B;B;B	0.38500	0.145;0.142;0.275;0.204;0.101	T	0.59225	-0.7494	10	0.45353	T	0.12	.	9.4129	0.38503	0.0:0.081:0.0:0.919	.	231;270;291;292;291	B4DUT6;B4DN30;Q8WV16-2;G3V522;Q8WV16	.;.;.;.;DCAF4_HUMAN	T	291;191;231;292;191	ENSP00000351147:S291T;ENSP00000377781:S191T;ENSP00000426178:S231T;ENSP00000452131:S292T;ENSP00000451186:S191T	ENSP00000351147:S291T	S	+	1	0	DCAF4	72490687	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.706000	0.74649	1.018000	0.39521	0.448000	0.29417	TCC		0.542	DCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361058.1	NM_015604	
KCNK10	54207	broad.mit.edu	37	14	88652212	88652212	+	Silent	SNP	C	C	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr14:88652212C>T	ENST00000340700.5	-	7	1735	c.1284G>A	c.(1282-1284)ccG>ccA	p.P428P	KCNK10_ENST00000312350.5_Silent_p.P433P|KCNK10_ENST00000319231.5_Silent_p.P433P	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	428					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.P428P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						TCAGCTGCTCCGGCCCCTTCA	0.587																																																1	Substitution - coding silent(1)	ovary(1)	14											75.0	76.0	75.0					14																	88652212		2203	4300	6503	87721965	SO:0001819	synonymous_variant	54207			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1284G>A	14.37:g.88652212C>T		Somatic		Capture	Illumina GAIIx	Phase_I	87721965	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Silent	SNP	ENST00000340700.5	37	CCDS9880.1																																																																																				0.587	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
DYNC1H1	1778	broad.mit.edu	37	14	102505809	102505809	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr14:102505809T>C	ENST00000360184.4	+	61	11685	c.11521T>C	c.(11521-11523)Tac>Cac	p.Y3841H	RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3841					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.Y3841H(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CAACGTCCTATACGAGAACCC	0.537																																																1	Substitution - Missense(1)	ovary(1)	14											104.0	94.0	98.0					14																	102505809		2203	4300	6503	101575562	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.11521T>C	14.37:g.102505809T>C	ENSP00000348965:p.Tyr3841His	Somatic		Capture	Illumina GAIIx	Phase_I	101575562	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	T	8.082	0.772596	0.16051	.	.	ENSG00000197102	ENST00000360184	T	0.54279	0.58	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.37320	0.0999	N	0.13168	0.305	0.80722	D	1	B	0.12013	0.005	B	0.11329	0.006	T	0.14282	-1.0478	10	0.27785	T	0.31	.	15.745	0.77932	0.0:0.0:0.0:1.0	.	3841	Q14204	DYHC1_HUMAN	H	3841	ENSP00000348965:Y3841H	ENSP00000348965:Y3841H	Y	+	1	0	DYNC1H1	101575562	1.000000	0.71417	0.974000	0.42286	0.084000	0.17831	8.040000	0.89188	2.122000	0.65172	0.482000	0.46254	TAC		0.537	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
B2M	567	broad.mit.edu	37	15	45003745	45003745	+	Start_Codon_SNP	SNP	A	A	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr15:45003745A>G	ENST00000558401.1	+	1	71	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	B2M_ENST00000544417.1_Start_Codon_SNP_p.M1V|PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000559916.1_Start_Codon_SNP_p.M1V	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	1					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.M1L(3)|p.M1V(2)|p.?(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		TCGGGCCGAGATGTCTCGCTC	0.612																																																6	Substitution - Missense(5)|Unknown(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(2)|lung(1)|large_intestine(1)	15											126.0	92.0	104.0					15																	45003745		2198	4298	6496	42791037	SO:0001582	initiator_codon_variant	567			AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.1A>G	15.37:g.45003745A>G	ENSP00000452780:p.Met1Val	Somatic		Capture	Illumina GAIIx	Phase_I	42791037	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	A	19.48	3.836331	0.71373	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.01228	5.14	5.35	5.35	0.76521	.	.	.	.	.	T	0.02119	0.0066	.	.	.	0.80722	D	1	P;P;P	0.48407	0.86;0.91;0.78	B;B;B	0.41271	0.352;0.294;0.192	T	0.58912	-0.7552	8	0.87932	D	0	.	11.9	0.52678	1.0:0.0:0.0:0.0	.	1;1;1	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	V	1	ENSP00000437604:M1V	ENSP00000340858:M1V	M	+	1	0	B2M	42791037	0.891000	0.30450	0.406000	0.26421	0.024000	0.10985	1.849000	0.39318	2.371000	0.80710	0.533000	0.62120	ATG		0.612	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	Missense_Mutation
MTFMT	123263	broad.mit.edu	37	15	65295594	65295594	+	Splice_Site	SNP	C	C	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr15:65295594C>A	ENST00000220058.4	-	9	989	c.976G>T	c.(976-978)Gat>Tat	p.D326Y		NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	326						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)	p.D326Y(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	ATCCAACCATCCTAAAGGGCA	0.363																																																1	Substitution - Missense(1)	ovary(1)	15											56.0	48.0	51.0					15																	65295594		1846	4091	5937	63082647	SO:0001630	splice_region_variant	123263			AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.976-1G>T	15.37:g.65295594C>A		Somatic		Capture	Illumina GAIIx	Phase_I	63082647	B7Z734	Missense_Mutation	SNP	ENST00000220058.4	37	CCDS45280.1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.192763	0.38707	.	.	ENSG00000103707	ENST00000220058	T	0.52754	0.65	5.23	4.31	0.51392	Formyl transferase, C-terminal-like (1);Formyl transferase, C-terminal (2);	0.103551	0.64402	D	0.000005	T	0.67683	0.2919	M	0.80746	2.51	0.45541	D	0.998492	D	0.89917	1.0	D	0.74348	0.983	T	0.72077	-0.4399	10	0.87932	D	0	-19.8781	11.5388	0.50655	0.0:0.914:0.0:0.086	.	326	Q96DP5	FMT_HUMAN	Y	326	ENSP00000220058:D326Y	ENSP00000220058:D326Y	D	-	1	0	MTFMT	63082647	1.000000	0.71417	1.000000	0.80357	0.181000	0.23173	3.416000	0.52707	1.318000	0.45170	0.591000	0.81541	GAT		0.363	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418155.1	NM_139242	Missense_Mutation
TICRR	90381	broad.mit.edu	37	15	90168333	90168333	+	Nonsense_Mutation	SNP	G	G	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr15:90168333G>T	ENST00000268138.7	+	20	4897	c.4792G>T	c.(4792-4794)Gaa>Taa	p.E1598*	KIF7_ENST00000558928.1_Intron|TICRR_ENST00000560985.1_Nonsense_Mutation_p.E1597*			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1598					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.E1598*(1)									CTCTCTGGGAGAAGAGAGCTT	0.572																																																1	Substitution - Nonsense(1)	ovary(1)	15											53.0	52.0	52.0					15																	90168333		2200	4299	6499	87969337	SO:0001587	stop_gained	90381			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.4792G>T	15.37:g.90168333G>T	ENSP00000268138:p.Glu1598*	Somatic		Capture	Illumina GAIIx	Phase_I	87969337	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Nonsense_Mutation	SNP	ENST00000268138.7	37	CCDS10352.2	.	.	.	.	.	.	.	.	.	.	G	41	8.964155	0.99019	.	.	ENSG00000140534	ENST00000268138	.	.	.	4.9	3.98	0.46160	.	0.700448	0.13861	N	0.357660	.	.	.	.	.	.	0.18873	N	0.999984	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-7.2641	15.5703	0.76330	0.0:0.1385:0.8615:0.0	.	.	.	.	X	1598	.	ENSP00000268138:E1598X	E	+	1	0	C15orf42	87969337	0.997000	0.39634	0.089000	0.20774	0.023000	0.10783	5.149000	0.64863	1.155000	0.42497	0.563000	0.77884	GAA		0.572	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
IFT140	9742	broad.mit.edu	37	16	1636197	1636197	+	Silent	SNP	T	T	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr16:1636197T>G	ENST00000426508.2	-	10	1452	c.1089A>C	c.(1087-1089)gcA>gcC	p.A363A	IFT140_ENST00000439987.2_5'UTR|LA16c-395F10.2_ENST00000563162.1_RNA	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	363					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)		p.A363A(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				CCTTGCCCTCTGCCCCGGGGC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	16											126.0	111.0	116.0					16																	1636197		2199	4300	6499	1576198	SO:0001819	synonymous_variant	9742			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.1089A>C	16.37:g.1636197T>G		Somatic		Capture	Illumina GAIIx	Phase_I	1576198	A2A2A8|D3DU75|O60332|Q9UG52	Silent	SNP	ENST00000426508.2	37	CCDS10439.1																																																																																				0.582	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	
ABCC6	368	broad.mit.edu	37	16	16278888	16278888	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr16:16278888G>A	ENST00000205557.7	-	15	1900	c.1871C>T	c.(1870-1872)gCc>gTc	p.A624V	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	624					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.A624V(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	ATCCTTCCCGGCAGCTGCAGG	0.652																																																1	Substitution - Missense(1)	ovary(1)	16											130.0	99.0	109.0					16																	16278888		2197	4300	6497	16186389	SO:0001583	missense	368			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.1871C>T	16.37:g.16278888G>A	ENSP00000205557:p.Ala624Val	Somatic		Capture	Illumina GAIIx	Phase_I	16186389	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	37	CCDS10568.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.847192	0.32606	.	.	ENSG00000091262	ENST00000205557;ENST00000456970;ENST00000546056	D;D	0.90676	-2.71;-2.71	4.83	4.83	0.62350	.	1.436400	0.04905	U	0.452064	D	0.83594	0.5288	N	0.12182	0.205	0.58432	D	0.999999	B;B	0.28933	0.228;0.049	B;B	0.25140	0.058;0.026	T	0.61549	-0.7040	10	0.20519	T	0.43	.	13.7739	0.63041	0.0:0.0:1.0:0.0	.	636;624	F5GWQ0;O95255	.;MRP6_HUMAN	V	624;624;636	ENSP00000205557:A624V;ENSP00000405002:A624V	ENSP00000205557:A624V	A	-	2	0	ABCC6	16186389	0.000000	0.05858	0.005000	0.12908	0.206000	0.24218	0.497000	0.22514	2.384000	0.81235	0.655000	0.94253	GCC		0.652	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
SHCBP1	79801	broad.mit.edu	37	16	46615701	46615701	+	Silent	SNP	C	C	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr16:46615701C>G	ENST00000303383.3	-	13	2225	c.1959G>C	c.(1957-1959)ggG>ggC	p.G653G		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	653					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)			p.G653G(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				TCCCCACAATCCCAACAAACA	0.428																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	16											230.0	198.0	209.0					16																	46615701		2203	4300	6503	45173202	SO:0001819	synonymous_variant	79801			AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.1959G>C	16.37:g.46615701C>G		Somatic		Capture	Illumina GAIIx	Phase_I	45173202	Q96N60|Q9BVS0|Q9H6P6	Silent	SNP	ENST00000303383.3	37	CCDS10720.1																																																																																				0.428	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255740.1	NM_024745	
RSPRY1	89970	broad.mit.edu	37	16	57261340	57261340	+	Silent	SNP	T	T	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr16:57261340T>A	ENST00000537866.1	+	11	2121	c.1248T>A	c.(1246-1248)ccT>ccA	p.P416P	RSPRY1_ENST00000394420.4_Silent_p.P416P|RSPRY1_ENST00000563073.1_3'UTR			Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	416	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular region (GO:0005576)	zinc ion binding (GO:0008270)	p.P416P(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|urinary_tract(3)	27						GAAGTAAGCCTCACATACACC	0.428																																																1	Substitution - coding silent(1)	ovary(1)	16											120.0	103.0	109.0					16																	57261340		2198	4300	6498	55818841	SO:0001819	synonymous_variant	89970			AB075852	CCDS10775.1	16q13	2014-02-12			ENSG00000159579	ENSG00000159579		"""RING-type (C3HC4) zinc fingers"""	29420	protein-coding gene	gene with protein product						11853319	Standard	NM_133368		Approved	KIAA1972	uc002elb.3	Q96DX4	OTTHUMG00000133462	ENST00000537866.1:c.1248T>A	16.37:g.57261340T>A		Somatic		Capture	Illumina GAIIx	Phase_I	55818841	Q6UX21|Q8ND53	Silent	SNP	ENST00000537866.1	37	CCDS10775.1																																																																																				0.428	RSPRY1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432953.1	NM_133368	
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic		Capture	Illumina GAIIx	Phase_I	7519131	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ABCA9	10350	broad.mit.edu	37	17	67014629	67014629	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr17:67014629G>A	ENST00000340001.4	-	20	2903	c.2692C>T	c.(2692-2694)Cca>Tca	p.P898S	ABCA9_ENST00000453985.2_Missense_Mutation_p.P898S|ABCA9-AS1_ENST00000458677.1_RNA|ABCA9_ENST00000370732.2_Missense_Mutation_p.P898S	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	898					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.P898S(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					TATGTATTTGGAGACAGTTCC	0.418																																																1	Substitution - Missense(1)	ovary(1)	17											245.0	241.0	242.0					17																	67014629		2203	4300	6503	64526224	SO:0001583	missense	10350			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.2692C>T	17.37:g.67014629G>A	ENSP00000342216:p.Pro898Ser	Somatic		Capture	Illumina GAIIx	Phase_I	64526224	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	37	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951298	0.53186	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.82526	-1.62;-1.62	5.49	5.49	0.81192	.	0.000000	0.43579	D	0.000558	D	0.85279	0.5660	M	0.64676	1.99	0.32223	N	0.575016	D;P	0.54397	0.966;0.583	P;B	0.54270	0.747;0.222	D	0.85321	0.1084	10	0.25106	T	0.35	.	12.3621	0.55209	0.082:0.0:0.918:0.0	.	898;898	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	S	898;881;898;893	ENSP00000342216:P898S;ENSP00000359767:P898S	ENSP00000342216:P898S	P	-	1	0	ABCA9	64526224	1.000000	0.71417	0.868000	0.34077	0.162000	0.22319	2.776000	0.47709	2.577000	0.86979	0.655000	0.94253	CCA		0.418	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	
ABCA10	10349	broad.mit.edu	37	17	67171636	67171636	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr17:67171636G>A	ENST00000269081.4	-	24	3697	c.2788C>T	c.(2788-2790)Ctt>Ttt	p.L930F	ABCA10_ENST00000416101.2_3'UTR|ABCA10_ENST00000519732.1_5'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	930					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.L930F(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					ATAAAACCAAGATCCAGCACT	0.358																																																1	Substitution - Missense(1)	ovary(1)	17											99.0	89.0	92.0					17																	67171636		2203	4300	6503	64683231	SO:0001583	missense	10349			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.2788C>T	17.37:g.67171636G>A	ENSP00000269081:p.Leu930Phe	Somatic		Capture	Illumina GAIIx	Phase_I	64683231	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.408762	0.00193	.	.	ENSG00000154263	ENST00000269081	D	0.83250	-1.7	2.88	-5.76	0.02376	.	.	.	.	.	T	0.53753	0.1816	N	0.04880	-0.145	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.45411	-0.9263	9	0.09338	T	0.73	.	1.6779	0.02826	0.2036:0.1059:0.15:0.5405	.	930	Q8WWZ4	ABCAA_HUMAN	F	930	ENSP00000269081:L930F	ENSP00000269081:L930F	L	-	1	0	ABCA10	64683231	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.945000	0.01537	-2.938000	0.00298	-0.750000	0.03501	CTT		0.358	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
CD300A	11314	broad.mit.edu	37	17	72470705	72470705	+	Silent	SNP	G	G	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr17:72470705G>T	ENST00000360141.3	+	3	702	c.414G>T	c.(412-414)gcG>gcT	p.A138A	CD300A_ENST00000361933.3_Intron|CD300A_ENST00000310828.5_Silent_p.A25A|CD300A_ENST00000577511.1_Silent_p.A8A|CD300A_ENST00000392625.3_Silent_p.A25A	NM_001256841.1|NM_007261.3	NP_001243770.1|NP_009192.2	Q9UGN4	CLM8_HUMAN	CD300a molecule	138					cell adhesion (GO:0007155)|immune system process (GO:0002376)|negative regulation of activation of JAK2 kinase activity (GO:1902569)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of eosinophil activation (GO:1902567)|negative regulation of eosinophil migration (GO:2000417)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell activation involved in immune response (GO:0033007)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of neutrophil activation (GO:1902564)|negative regulation of NK T cell activation (GO:0051134)|negative regulation of phagocytosis, engulfment (GO:0060101)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|regulation of T cell receptor signaling pathway (GO:0050856)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)|signaling receptor activity (GO:0038023)	p.A138A(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|skin(4)|urinary_tract(1)	16						GTATCACTGCGGCCAAGACCT	0.547																																																1	Substitution - coding silent(1)	ovary(1)	17											234.0	173.0	194.0					17																	72470705		2203	4300	6503	69982300	SO:0001819	synonymous_variant	11314			BC032352	CCDS32720.1, CCDS58590.1	17q25.2	2013-01-11	2006-03-28		ENSG00000167851	ENSG00000167851		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19319	protein-coding gene	gene with protein product		606790	"""CD300a antigen"""			9701027, 10746781	Standard	NM_007261		Approved	Irp60, CMRF35H, CMRF-35-H9, IRC1, IRC2, IGSF12	uc002jkv.4	Q9UGN4	OTTHUMG00000067612	ENST00000360141.3:c.414G>T	17.37:g.72470705G>T		Somatic		Capture	Illumina GAIIx	Phase_I	69982300	A8MW96|O95100|Q9HD97|Q9P0F3|Q9UBK4|Q9UMS9|Q9UMT0	Silent	SNP	ENST00000360141.3	37	CCDS32720.1																																																																																				0.547	CD300A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145091.1	NM_007261	
CNDP2	55748	broad.mit.edu	37	18	72187269	72187269	+	Missense_Mutation	SNP	C	C	T	rs559463515		TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr18:72187269C>T	ENST00000324262.4	+	12	1710	c.1394C>T	c.(1393-1395)gCg>gTg	p.A465V	CNDP2_ENST00000579847.1_Missense_Mutation_p.A465V|CNDP2_ENST00000324301.8_Missense_Mutation_p.A381V	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	465					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.A465V(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		ATGCTGGCCGCGTACCTGTAT	0.537																																																1	Substitution - Missense(1)	ovary(1)	18											119.0	94.0	102.0					18																	72187269		2203	4300	6503	70338249	SO:0001583	missense	55748			AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.1394C>T	18.37:g.72187269C>T	ENSP00000325548:p.Ala465Val	Somatic		Capture	Illumina GAIIx	Phase_I	70338249	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Missense_Mutation	SNP	ENST00000324262.4	37	CCDS12006.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.188860	0.57909	.	.	ENSG00000133313	ENST00000324262;ENST00000324301	T;T	0.53423	0.62;0.62	5.44	5.44	0.79542	.	0.048840	0.85682	D	0.000000	T	0.48484	0.1502	M	0.85462	2.755	0.80722	D	1	P;P	0.46064	0.523;0.872	B;B	0.29663	0.076;0.105	T	0.61207	-0.7109	10	0.40728	T	0.16	-24.1893	17.4447	0.87574	0.0:1.0:0.0:0.0	.	381;465	Q96KP4-2;Q96KP4	.;CNDP2_HUMAN	V	465;381	ENSP00000325548:A465V;ENSP00000325756:A381V	ENSP00000325548:A465V	A	+	2	0	CNDP2	70338249	1.000000	0.71417	0.275000	0.24674	0.244000	0.25665	7.329000	0.79170	2.548000	0.85928	0.650000	0.86243	GCG		0.537	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235	
CYP4F2	8529	broad.mit.edu	37	19	16000331	16000331	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr19:16000331G>A	ENST00000221700.6	-	7	915	c.820C>T	c.(820-822)Cgg>Tgg	p.R274W	CYP4F2_ENST00000011989.7_Missense_Mutation_p.R125W	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2									p.R274W(1)		NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GTGCGGCGCCGCTCCTGGATG	0.562																																																1	Substitution - Missense(1)	ovary(1)	19											95.0	90.0	92.0					19																	16000331		2203	4300	6503	15861331	SO:0001583	missense	8529			U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.820C>T	19.37:g.16000331G>A	ENSP00000221700:p.Arg274Trp	Somatic		Capture	Illumina GAIIx	Phase_I	15861331		Missense_Mutation	SNP	ENST00000221700.6	37	CCDS12336.1	.	.	.	.	.	.	.	.	.	.	g	14.80	2.644070	0.47258	.	.	ENSG00000186115	ENST00000221700;ENST00000392846;ENST00000011989	T;T	0.73681	-0.77;1.07	2.72	1.65	0.23941	.	0.106930	0.36268	U	0.002685	D	0.84206	0.5421	H	0.95365	3.66	0.41827	D	0.990051	D;P	0.53885	0.963;0.886	P;P	0.56648	0.803;0.668	T	0.81618	-0.0851	10	0.87932	D	0	.	3.458	0.07523	0.1448:0.0:0.6077:0.2475	.	125;274	B4DV75;P78329	.;CP4F2_HUMAN	W	274;125;125	ENSP00000221700:R274W;ENSP00000011989:R125W	ENSP00000011989:R125W	R	-	1	2	CYP4F2	15861331	0.996000	0.38824	0.780000	0.31762	0.857000	0.48899	3.121000	0.50438	0.454000	0.26884	0.305000	0.20034	CGG		0.562	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082	
PGLYRP1	8993	broad.mit.edu	37	19	46522630	46522630	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr19:46522630C>G	ENST00000008938.4	-	3	500	c.457G>C	c.(457-459)Gcc>Ccc	p.A153P	CCDC61_ENST00000601763.1_Intron|MIR769_ENST00000390225.1_RNA	NM_005091.2	NP_005082.1	O75594	PGRP1_HUMAN	peptidoglycan recognition protein 1	153					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.A153P(1)		endometrium(2)|large_intestine(3)|lung(3)|ovary(2)	10		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.0036)|GBM - Glioblastoma multiforme(486;0.022)|Epithelial(262;0.208)		ACACCGCAGGCCAGTAGACCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	19											86.0	89.0	88.0					19																	46522630		2203	4300	6503	51214470	SO:0001583	missense	8993			AF076483	CCDS12680.1	19q13.2-q13.3	2008-02-05	2004-03-17	2004-03-19		ENSG00000008438			8904	protein-coding gene	gene with protein product		604963	"""peptidoglycan recognition protein"""	TNFSF3L, PGLYRP		9707603, 12669421	Standard	NM_005091		Approved	TAG7, PGRP, PGRP-S, PGRPS	uc002pdx.2	O75594		ENST00000008938.4:c.457G>C	19.37:g.46522630C>G	ENSP00000008938:p.Ala153Pro	Somatic		Capture	Illumina GAIIx	Phase_I	51214470	Q4VB36	Missense_Mutation	SNP	ENST00000008938.4	37	CCDS12680.1	.	.	.	.	.	.	.	.	.	.	C	11.27	1.590007	0.28357	.	.	ENSG00000008438	ENST00000008938	T	0.17691	2.26	4.71	-3.9	0.04181	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	1.137000	0.06796	N	0.787913	T	0.20047	0.0482	M	0.92738	3.34	0.09310	N	1	P	0.49185	0.92	B	0.38683	0.279	T	0.43877	-0.9364	10	0.27785	T	0.31	-2.2435	1.037	0.01551	0.1433:0.3056:0.2808:0.2703	.	153	O75594	PGRP1_HUMAN	P	153	ENSP00000008938:A153P	ENSP00000008938:A153P	A	-	1	0	PGLYRP1	51214470	0.074000	0.21230	0.722000	0.30670	0.210000	0.24377	-0.293000	0.08320	0.057000	0.16193	0.558000	0.71614	GCC		0.637	PGLYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461695.1	NM_005091	
KPTN	11133	broad.mit.edu	37	19	47979937	47979937	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr19:47979937G>C	ENST00000338134.3	-	11	1141	c.1034C>G	c.(1033-1035)tCg>tGg	p.S345W	KPTN_ENST00000536339.1_Missense_Mutation_p.S105W	NM_007059.2	NP_008990.2	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)	345					actin filament organization (GO:0007015)|cellular component movement (GO:0006928)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.S345W(1)		breast(1)|lung(3)|ovary(2)|pancreas(2)	8		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		AGGAAGCCCCGACTCTGGGCC	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											16.0	19.0	18.0					19																	47979937		1931	4129	6060	52671749	SO:0001583	missense	11133			AF105369	CCDS42583.1	19q13.32	2014-08-13	2001-11-28		ENSG00000118162	ENSG00000118162			6404	protein-coding gene	gene with protein product		615620	"""kaptin (actin-binding protein)"""			10099934	Standard	XM_005258467		Approved	2E4	uc002pgy.3	Q9Y664	OTTHUMG00000183443	ENST00000338134.3:c.1034C>G	19.37:g.47979937G>C	ENSP00000337850:p.Ser345Trp	Somatic		Capture	Illumina GAIIx	Phase_I	52671749	B3KN86|B4DQ76|Q96GT1	Missense_Mutation	SNP	ENST00000338134.3	37	CCDS42583.1	.	.	.	.	.	.	.	.	.	.	G	10.27	1.303893	0.23736	.	.	ENSG00000118162	ENST00000338134;ENST00000536339	T;T	0.59083	0.29;1.83	4.07	-0.694	0.11294	.	1.458410	0.04468	N	0.375557	T	0.49029	0.1533	L	0.46157	1.445	0.09310	N	1	P	0.52577	0.954	B	0.43413	0.419	T	0.44528	-0.9322	10	0.66056	D	0.02	-8.3366	2.3588	0.04302	0.1735:0.2863:0.4044:0.1358	.	345	Q9Y664	KPTN_HUMAN	W	345;105	ENSP00000337850:S345W;ENSP00000442579:S105W	ENSP00000337850:S345W	S	-	2	0	KPTN	52671749	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.002000	0.13061	0.013000	0.14918	-0.333000	0.08304	TCG		0.642	KPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466672.2		
FCGRT	2217	broad.mit.edu	37	19	50017245	50017245	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr19:50017245C>G	ENST00000221466.5	+	3	666	c.180C>G	c.(178-180)agC>agG	p.S60R	FCGRT_ENST00000596975.1_Missense_Mutation_p.S60R|FCGRT_ENST00000426395.3_Missense_Mutation_p.S60R|FCGRT_ENST00000599988.1_Intron|FCGRT_ENST00000594823.1_3'UTR	NM_001136019.2	NP_001129491.1	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	60	Alpha-1.				antigen processing and presentation (GO:0019882)|IgG immunoglobulin transcytosis in epithelial cells mediated by FcRn immunoglobulin receptor (GO:0002416)|immune response (GO:0006955)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG binding (GO:0019864)	p.S60R(1)		endometrium(3)|kidney(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	9		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		AGTACCTGAGCTACAATAGCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											67.0	73.0	71.0					19																	50017245		2203	4300	6503	54709057	SO:0001583	missense	2217			U12255	CCDS12770.1	19q13.3	2013-01-11				ENSG00000104870		"""Immunoglobulin superfamily / C1-set domain containing"""	3621	protein-coding gene	gene with protein product		601437				7964511, 8646894	Standard	NM_001136019		Approved	FCRN, alpha-chain	uc002pog.2	P55899		ENST00000221466.5:c.180C>G	19.37:g.50017245C>G	ENSP00000221466:p.Ser60Arg	Somatic		Capture	Illumina GAIIx	Phase_I	54709057	Q5HYM5|Q9HBV7|Q9NZ19	Missense_Mutation	SNP	ENST00000221466.5	37	CCDS12770.1	.	.	.	.	.	.	.	.	.	.	C	2.064	-0.414791	0.04766	.	.	ENSG00000104870	ENST00000221466;ENST00000426395;ENST00000415900;ENST00000452439	T;T	0.00633	6.08;6.08	4.6	3.57	0.40892	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.629272	0.14136	N	0.339012	T	0.00936	0.0031	N	0.20766	0.605	0.31735	N	0.636608	D	0.76494	0.999	P	0.58970	0.849	T	0.31641	-0.9936	10	0.02654	T	1	.	10.7232	0.46052	0.0:0.8072:0.1928:0.0	.	60	P55899	FCGRN_HUMAN	R	60	ENSP00000221466:S60R;ENSP00000410798:S60R	ENSP00000221466:S60R	S	+	3	2	FCGRT	54709057	1.000000	0.71417	1.000000	0.80357	0.114000	0.19823	0.882000	0.28186	1.172000	0.42781	-0.225000	0.12378	AGC		0.632	FCGRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465267.1		
ZNF765	91661	broad.mit.edu	37	19	53912239	53912239	+	Silent	SNP	G	G	T	rs535191602		TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr19:53912239G>T	ENST00000396408.3	+	4	1548	c.1431G>T	c.(1429-1431)cgG>cgT	p.R477R	ZNF765_ENST00000594030.1_Intron	NM_001040185.1	NP_001035275.1	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	477					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R477R(1)		endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		CCTTCAGCCGGACGTCATCCC	0.373													.|||	1	0.000199681	0.0008	0.0	5008	,	,		22917	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	19											98.0	103.0	102.0					19																	53912239		2202	4300	6502	58604051	SO:0001819	synonymous_variant	91661			BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000396408.3:c.1431G>T	19.37:g.53912239G>T		Somatic		Capture	Illumina GAIIx	Phase_I	58604051	A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Silent	SNP	ENST00000396408.3	37	CCDS46171.1																																																																																				0.373	ZNF765-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371603.1	NM_138372	
KLF11	8462	broad.mit.edu	37	2	10186296	10186296	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr2:10186296G>A	ENST00000305883.1	+	2	224	c.62G>A	c.(61-63)tGt>tAt	p.C21Y	KLF11_ENST00000535335.1_Missense_Mutation_p.C4Y|KLF11_ENST00000540845.1_Missense_Mutation_p.C4Y	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	21					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.C21Y(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		ATGGACATATGTGAGTCCATC	0.502																																					Melanoma(56;431 1507 23687 50789)											1	Substitution - Missense(1)	ovary(1)	2											127.0	106.0	113.0					2																	10186296		2203	4300	6503	10103747	SO:0001583	missense	8462			AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.62G>A	2.37:g.10186296G>A	ENSP00000307023:p.Cys21Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	10103747	B4DZE7|Q9EPF4	Missense_Mutation	SNP	ENST00000305883.1	37	CCDS1668.1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.216595	0.58452	.	.	ENSG00000172059	ENST00000401510;ENST00000305883;ENST00000448523;ENST00000540845;ENST00000440320;ENST00000535335	T;T;T;T;T;T	0.66460	-0.21;2.39;-0.15;2.39;-0.19;2.39	5.31	5.31	0.75309	.	0.044597	0.85682	D	0.000000	T	0.73329	0.3573	L	0.55834	1.745	0.52099	D	0.999949	D	0.76494	0.999	D	0.79784	0.993	T	0.68138	-0.5488	10	0.13470	T	0.59	.	10.1852	0.42993	0.123:0.0:0.877:0.0	.	21	O14901	KLF11_HUMAN	Y	4;21;4;4;4;4	ENSP00000386058:C4Y;ENSP00000307023:C21Y;ENSP00000387866:C4Y;ENSP00000444690:C4Y;ENSP00000388263:C4Y;ENSP00000442722:C4Y	ENSP00000307023:C21Y	C	+	2	0	KLF11	10103747	0.993000	0.37304	0.984000	0.44739	0.987000	0.75469	2.742000	0.47434	2.469000	0.83416	0.462000	0.41574	TGT		0.502	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000239202.3	NM_003597	
ITSN2	50618	broad.mit.edu	37	2	24524840	24524840	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr2:24524840G>C	ENST00000355123.4	-	10	1432	c.989C>G	c.(988-990)tCt>tGt	p.S330C	ITSN2_ENST00000361999.3_Missense_Mutation_p.S330C|ITSN2_ENST00000406921.3_Missense_Mutation_p.S330C	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	330	EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)	p.S329C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCACCTGAAAGATGGAGGAAC	0.423																																																1	Substitution - Missense(1)	ovary(1)	2											101.0	88.0	93.0					2																	24524840		2203	4300	6503	24378344	SO:0001583	missense	50618			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.989C>G	2.37:g.24524840G>C	ENSP00000347244:p.Ser330Cys	Somatic		Capture	Illumina GAIIx	Phase_I	24378344	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	37	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	G	18.21	3.574337	0.65878	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000445614;ENST00000406921;ENST00000412011	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	4.25	4.25	0.50352	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.33980	U	0.004370	T	0.72875	0.3515	M	0.94021	3.485	0.52501	D	0.999956	D;D;D;P	0.89917	1.0;1.0;1.0;0.94	D;D;D;P	0.83275	0.991;0.991;0.996;0.907	T	0.79769	-0.1664	10	0.45353	T	0.12	.	17.2187	0.86951	0.0:0.0:1.0:0.0	.	330;330;330;330	Q9NZM3-4;Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;.;ITSN2_HUMAN	C	330;330;330;354;330;355	ENSP00000354561:S330C;ENSP00000347244:S330C;ENSP00000370250:S330C;ENSP00000384499:S330C;ENSP00000391224:S355C	ENSP00000347244:S330C	S	-	2	0	ITSN2	24378344	1.000000	0.71417	0.956000	0.39512	0.549000	0.35272	7.407000	0.80029	2.376000	0.81061	0.491000	0.48974	TCT		0.423	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
TTN	7273	broad.mit.edu	37	2	179485181	179485181	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr2:179485181T>G	ENST00000591111.1	-	198	41368	c.41144A>C	c.(41143-41145)cAc>cCc	p.H13715P	TTN_ENST00000359218.5_Missense_Mutation_p.H6416P|TTN_ENST00000460472.2_Missense_Mutation_p.H6291P|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.H12788P|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.H15356P|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.H6483P|TTN-AS1_ENST00000604956.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13715	Ig-like 93.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.H6291P(1)|p.H12788P(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTAACATGTGCTTGTACTT	0.418																																																2	Substitution - Missense(2)	ovary(2)	2											164.0	161.0	162.0					2																	179485181		1933	4126	6059	179193426	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.41144A>C	2.37:g.179485181T>G	ENSP00000465570:p.His13715Pro	Somatic		Capture	Illumina GAIIx	Phase_I	179193426	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	8.630	0.893515	0.17613	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67040	0.2851	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.70898	-0.4747	9	0.87932	D	0	.	16.5582	0.84512	0.0:0.0:0.0:1.0	.	6291;6416;6483;13715	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	P	12788;6291;6483;6416;6291	ENSP00000343764:H12788P;ENSP00000434586:H6291P;ENSP00000340554:H6483P;ENSP00000352154:H6416P	ENSP00000340554:H6483P	H	-	2	0	TTN	179193426	1.000000	0.71417	1.000000	0.80357	0.041000	0.13682	7.991000	0.88244	2.308000	0.77769	0.533000	0.62120	CAC		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu	37	2	179485250	179485250	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr2:179485250T>A	ENST00000591111.1	-	198	41299	c.41075A>T	c.(41074-41076)aAg>aTg	p.K13692M	TTN_ENST00000359218.5_Missense_Mutation_p.K6393M|TTN_ENST00000460472.2_Missense_Mutation_p.K6268M|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K12765M|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K15333M|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K6460M|TTN-AS1_ENST00000604956.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13692	Ig-like 93.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K12765M(1)|p.K6268M(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGGTCCACTTCAGTGTTAC	0.403																																																2	Substitution - Missense(2)	ovary(2)	2											136.0	128.0	130.0					2																	179485250		1938	4131	6069	179193495	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.41075A>T	2.37:g.179485250T>A	ENSP00000465570:p.Lys13692Met	Somatic		Capture	Illumina GAIIx	Phase_I	179193495	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	12.41	1.930367	0.34096	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.9	5.9	0.94986	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62816	0.2459	L	0.47016	1.485	0.36228	D	0.852473	B;B;B;B	0.28128	0.201;0.201;0.201;0.201	B;B;B;B	0.33620	0.167;0.167;0.167;0.167	T	0.70121	-0.4959	9	0.87932	D	0	.	11.4123	0.49933	0.1347:0.0:0.0:0.8653	.	6268;6393;6460;13692	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	12765;6268;6460;6393;6268	ENSP00000343764:K12765M;ENSP00000434586:K6268M;ENSP00000340554:K6460M;ENSP00000352154:K6393M	ENSP00000340554:K6460M	K	-	2	0	TTN	179193495	1.000000	0.71417	0.996000	0.52242	0.945000	0.59286	3.966000	0.56795	2.254000	0.74563	0.460000	0.39030	AAG		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PDCD1	5133	broad.mit.edu	37	2	242794952	242794952	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr2:242794952C>G	ENST00000334409.5	-	2	326	c.257G>C	c.(256-258)cGc>cCc	p.R86P		NM_005018.2	NP_005009.2	Q15116	PDCD1_HUMAN	programmed cell death 1	86	Ig-like V-type.				apoptotic process (GO:0006915)|humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)	p.R86P(1)		endometrium(1)|lung(2)|ovary(1)|prostate(3)|skin(1)	8		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0219)		GGGCTGGCTGCGGTCCTCGGG	0.647																																																1	Substitution - Missense(1)	ovary(1)	2											45.0	44.0	44.0					2																	242794952		2203	4300	6503	242443625	SO:0001583	missense	5133			AY206416	CCDS33428.1	2q37.3	2014-01-29			ENSG00000188389	ENSG00000188389		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	8760	protein-coding gene	gene with protein product		600244	"""systemic lupus erythematosus susceptibility 2"""	SLEB2		7851902, 12402038	Standard	NM_005018		Approved	CD279, PD1, hSLE1	uc002wcq.4	Q15116	OTTHUMG00000151342	ENST00000334409.5:c.257G>C	2.37:g.242794952C>G	ENSP00000335062:p.Arg86Pro	Somatic		Capture	Illumina GAIIx	Phase_I	242443625	O00517|Q8IX89	Missense_Mutation	SNP	ENST00000334409.5	37	CCDS33428.1	.	.	.	.	.	.	.	.	.	.	.	12.12	1.841230	0.32513	.	.	ENSG00000188389	ENST00000334409;ENST00000539073	T	0.22336	1.96	3.38	-4.02	0.04034	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	2.336870	0.01232	N	0.008396	T	0.26048	0.0635	L	0.59436	1.845	0.09310	N	1	P;P	0.42518	0.782;0.782	P;P	0.46885	0.53;0.53	T	0.29366	-1.0014	10	0.34782	T	0.22	-0.4601	4.8651	0.13604	0.0:0.2175:0.3086:0.4739	.	86;86	Q8IX89;Q15116	.;PDCD1_HUMAN	P	86	ENSP00000335062:R86P	ENSP00000335062:R86P	R	-	2	0	PDCD1	242443625	0.000000	0.05858	0.000000	0.03702	0.800000	0.45204	-1.437000	0.02419	-1.010000	0.03396	-0.265000	0.10407	CGC		0.647	PDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322313.1	NM_005018	
RIMS4	140730	broad.mit.edu	37	20	43384921	43384921	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr20:43384921C>G	ENST00000372851.3	-	6	730	c.664G>C	c.(664-666)Gag>Cag	p.E222Q	RIMS4_ENST00000541604.2_Missense_Mutation_p.E223Q	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	222					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)		p.E222Q(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				AAGTCCAGCTCCTCCAGCAGC	0.642																																																1	Substitution - Missense(1)	ovary(1)	20											57.0	48.0	51.0					20																	43384921		2203	4300	6503	42818335	SO:0001583	missense	140730				CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546	ENST00000372851.3:c.664G>C	20.37:g.43384921C>G	ENSP00000361942:p.Glu222Gln	Somatic		Capture	Illumina GAIIx	Phase_I	42818335	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	ENST00000372851.3	37	CCDS13338.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490144	0.64074	.	.	ENSG00000101098	ENST00000372851;ENST00000541604	T;T	0.79845	-1.31;-1.31	5.07	5.07	0.68467	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.79341	0.4429	L	0.52905	1.665	0.80722	D	1	B;B	0.28324	0.207;0.207	B;B	0.29524	0.103;0.084	T	0.79142	-0.1925	10	0.72032	D	0.01	.	18.4886	0.90838	0.0:1.0:0.0:0.0	.	223;222	E1P613;Q9H426	.;RIMS4_HUMAN	Q	222;223	ENSP00000361942:E222Q;ENSP00000439287:E223Q	ENSP00000361942:E222Q	E	-	1	0	RIMS4	42818335	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.731000	0.84895	2.355000	0.79922	0.655000	0.94253	GAG		0.642	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	NM_182970	
DOK5	55816	broad.mit.edu	37	20	53205045	53205045	+	Silent	SNP	G	G	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr20:53205045G>A	ENST00000262593.5	+	3	548	c.198G>A	c.(196-198)aaG>aaA	p.K66K	DOK5_ENST00000395939.1_5'UTR	NM_018431.3	NP_060901.2	Q9P104	DOK5_HUMAN	docking protein 5	66	PH.				MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)	p.K66K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|skin(1)	19			Colorectal(105;0.202)			ATAATGTGAAGAACGTAGCTC	0.413																																																1	Substitution - coding silent(1)	ovary(1)	20											145.0	139.0	141.0					20																	53205045		2203	4300	6503	52638452	SO:0001819	synonymous_variant	55816			AF132732	CCDS13446.1, CCDS13447.1	20q13.2	2013-01-10	2002-11-28	2002-11-29	ENSG00000101134	ENSG00000101134		"""Pleckstrin homology (PH) domain containing"""	16173	protein-coding gene	gene with protein product		608334	"""chromosome 20 open reading frame 180"""	C20orf180		11470823	Standard	XM_005260451		Approved	dJ805C22.1	uc002xwy.3	Q9P104	OTTHUMG00000032778	ENST00000262593.5:c.198G>A	20.37:g.53205045G>A		Somatic		Capture	Illumina GAIIx	Phase_I	52638452	Q5T7Y0|Q5TE53|Q8TEW7|Q96H13|Q9BZ24|Q9NQF4|Q9Y411	Silent	SNP	ENST00000262593.5	37	CCDS13446.1																																																																																				0.413	DOK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079777.2		
MYO18B	84700	broad.mit.edu	37	22	26342103	26342103	+	Splice_Site	SNP	C	C	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr22:26342103C>G	ENST00000407587.2	+	35	5690	c.5521C>G	c.(5521-5523)Ctg>Gtg	p.L1841V	MYO18B_ENST00000536101.1_Splice_Site_p.L1840V|MYO18B_ENST00000335473.7_Splice_Site_p.L1840V			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1840	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.L1841V(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CCTGGTCCAGCTGGAGCAGAG	0.592																																																1	Substitution - Missense(1)	ovary(1)	22											30.0	32.0	31.0					22																	26342103		1984	4143	6127	24672103	SO:0001630	splice_region_variant	84700			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5521-1C>G	22.37:g.26342103C>G		Somatic		Capture	Illumina GAIIx	Phase_I	24672103	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	c	13.40	2.225694	0.39300	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.91464	-2.83;-2.83;-2.85	4.92	3.91	0.45181	.	0.000000	0.53938	D	0.000041	D	0.83972	0.5370	L	0.38531	1.155	0.35578	D	0.806065	B;B;B;B	0.23490	0.013;0.052;0.026;0.086	B;B;B;B	0.25291	0.014;0.026;0.017;0.059	T	0.80311	-0.1436	9	.	.	.	.	8.9374	0.35708	0.0:0.8218:0.0:0.1782	.	1353;1840;1841;1840	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	V	1840;1840;1841	ENSP00000441229:L1840V;ENSP00000334563:L1840V;ENSP00000386096:L1841V	.	L	+	1	2	MYO18B	24672103	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	0.968000	0.29357	1.076000	0.40961	0.598000	0.82781	CTG		0.592	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	Missense_Mutation
ADSL	158	broad.mit.edu	37	22	40745999	40745999	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr22:40745999T>C	ENST00000216194.7	+	2	373	c.317T>C	c.(316-318)aTt>aCt	p.I106T	ADSL_ENST00000454266.2_Missense_Mutation_p.I106T|ADSL_ENST00000342312.6_Missense_Mutation_p.I106T	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	106					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)	p.I106T(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						GCAGGCATTATTCACCTTGGT	0.428																																					Colon(4;65 130 1097 1516)											1	Substitution - Missense(1)	ovary(1)	22											156.0	123.0	134.0					22																	40745999		2203	4300	6503	39075945	SO:0001583	missense	158			X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.317T>C	22.37:g.40745999T>C	ENSP00000216194:p.Ile106Thr	Somatic		Capture	Illumina GAIIx	Phase_I	39075945	B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	ENST00000216194.7	37	CCDS14001.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.661452	0.88154	.	.	ENSG00000239900	ENST00000216194;ENST00000544206;ENST00000425605;ENST00000454266;ENST00000342312	D;D;D	0.99479	-3.87;-3.87;-5.98	5.59	5.59	0.84812	Lyase 1, N-terminal (1);L-Aspartase-like (1);L-Aspartase-like, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	H	0.96301	3.8	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.97347	0.9961	10	0.87932	D	0	-17.1412	15.8537	0.78956	0.0:0.0:0.0:1.0	.	106;106;106;106	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	T	106	ENSP00000216194:I106T;ENSP00000390107:I106T;ENSP00000341429:I106T	ENSP00000216194:I106T	I	+	2	0	ADSL	39075945	1.000000	0.71417	0.401000	0.26359	0.993000	0.82548	7.516000	0.81772	2.141000	0.66446	0.529000	0.55759	ATT		0.428	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321386.1	NM_000026	
ZNF620	253639	broad.mit.edu	37	3	40553904	40553904	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr3:40553904A>T	ENST00000314529.6	+	4	312	c.163A>T	c.(163-165)Acc>Tcc	p.T55S	ZNF620_ENST00000418905.1_Intron	NM_175888.3	NP_787084.1	Q6ZNG0	ZN620_HUMAN	zinc finger protein 620	55	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T55S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(1)|urinary_tract(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		ATTCCCATTCACCACGCCTGT	0.562																																																1	Substitution - Missense(1)	ovary(1)	3											78.0	76.0	77.0					3																	40553904		2203	4300	6503	40528908	SO:0001583	missense	253639			AK093599	CCDS33740.1, CCDS58825.1	3p21.33	2013-01-08			ENSG00000177842	ENSG00000177842		"""Zinc fingers, C2H2-type"", ""-"""	28742	protein-coding gene	gene with protein product						12477932	Standard	NM_175888		Approved	MGC50836	uc003ckk.4	Q6ZNG0	OTTHUMG00000156044	ENST00000314529.6:c.163A>T	3.37:g.40553904A>T	ENSP00000322265:p.Thr55Ser	Somatic		Capture	Illumina GAIIx	Phase_I	40528908	Q8N223	Missense_Mutation	SNP	ENST00000314529.6	37	CCDS33740.1	.	.	.	.	.	.	.	.	.	.	A	0.196	-1.048973	0.01981	.	.	ENSG00000177842	ENST00000420891;ENST00000314529	T;T	0.00745	5.75;5.75	2.19	-0.499	0.12015	Krueppel-associated box (3);	.	.	.	.	T	0.00356	0.0011	N	0.02830	-0.485	0.09310	N	0.999999	B	0.20887	0.049	B	0.19666	0.026	T	0.43048	-0.9415	9	0.02654	T	1	.	3.898	0.09147	0.3456:0.4387:0.0:0.2156	.	55	Q6ZNG0	ZN620_HUMAN	S	55	ENSP00000406156:T55S;ENSP00000322265:T55S	ENSP00000322265:T55S	T	+	1	0	ZNF620	40528908	0.000000	0.05858	0.019000	0.16419	0.160000	0.22226	-3.075000	0.00616	-0.121000	0.11787	0.455000	0.32223	ACC		0.562	ZNF620-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342824.1	XM_171060	
DNAH1	25981	broad.mit.edu	37	3	52394004	52394004	+	Missense_Mutation	SNP	G	G	T	rs369984253		TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr3:52394004G>T	ENST00000420323.2	+	27	4741	c.4480G>T	c.(4480-4482)Gtc>Ttc	p.V1494F		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1494	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V1494F(1)		cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGCGCTAATCGTCATTGAGGT	0.567																																																1	Substitution - Missense(1)	ovary(1)	3											165.0	172.0	170.0					3																	52394004		2159	4263	6422	52369044	SO:0001583	missense	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.4480G>T	3.37:g.52394004G>T	ENSP00000401514:p.Val1494Phe	Somatic		Capture	Illumina GAIIx	Phase_I	52369044	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093525	0.76756	.	.	ENSG00000114841	ENST00000420323	T	0.59083	0.29	5.13	5.13	0.70059	.	0.000000	0.46758	D	0.000266	D	0.85195	0.5641	H	0.97540	4.025	0.49130	D	0.999758	D	0.89917	1.0	D	0.83275	0.996	D	0.90370	0.4380	10	0.87932	D	0	.	18.7672	0.91878	0.0:0.0:1.0:0.0	.	1494	C9JXH6	.	F	1494	ENSP00000401514:V1494F	ENSP00000401514:V1494F	V	+	1	0	DNAH1	52369044	1.000000	0.71417	0.959000	0.39883	0.798000	0.45092	4.661000	0.61518	2.677000	0.91161	0.561000	0.74099	GTC		0.567	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
ITIH1	3697	broad.mit.edu	37	3	52814369	52814369	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr3:52814369A>T	ENST00000273283.2	+	6	682	c.658A>T	c.(658-660)Act>Tct	p.T220S	ITIH1_ENST00000540715.1_Missense_Mutation_p.T78S|ITIH1_ENST00000537050.1_5'UTR|ITIH1_ENST00000542827.1_Missense_Mutation_p.T220S|ITIH1_ENST00000487686.1_3'UTR	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	220					hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.T220S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		GGCAGCCCAAACTATCAAGAA	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											42.0	42.0	42.0					3																	52814369		2203	4300	6503	52789409	SO:0001583	missense	3697				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.658A>T	3.37:g.52814369A>T	ENSP00000273283:p.Thr220Ser	Somatic		Capture	Illumina GAIIx	Phase_I	52789409	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	A	15.62	2.888508	0.52014	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715	T;T;T	0.02177	4.41;4.9;4.77	6.07	-3.47	0.04753	.	0.885724	0.10177	N	0.706335	T	0.01287	0.0042	N	0.16233	0.39	0.09310	N	0.999995	B	0.26120	0.142	B	0.26614	0.071	T	0.47971	-0.9075	10	0.41790	T	0.15	-6.5651	0.9806	0.01435	0.3858:0.24:0.1099:0.2643	.	220	P19827	ITIH1_HUMAN	S	220;220;78	ENSP00000442584:T220S;ENSP00000273283:T220S;ENSP00000443973:T78S	ENSP00000273283:T220S	T	+	1	0	ITIH1	52789409	0.063000	0.20901	0.023000	0.16930	0.967000	0.64934	0.536000	0.23129	-0.007000	0.14345	0.533000	0.62120	ACT		0.537	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
ALCAM	214	broad.mit.edu	37	3	105266316	105266316	+	Silent	SNP	A	A	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr3:105266316A>G	ENST00000306107.5	+	11	1823	c.1323A>G	c.(1321-1323)ccA>ccG	p.P441P	ALCAM_ENST00000472644.2_Silent_p.P441P|ALCAM_ENST00000389927.4_Silent_p.P163P|ALCAM_ENST00000486979.2_Silent_p.P390P	NM_001627.3	NP_001618.2	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	441	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|motor neuron axon guidance (GO:0008045)|signal transduction (GO:0007165)	axon (GO:0030424)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	receptor binding (GO:0005102)	p.P441P(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						AAGGTTTTCCAAAGCCAGCCA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	3											94.0	89.0	91.0					3																	105266316		2203	4298	6501	106749006	SO:0001819	synonymous_variant	214			AK054632	CCDS33810.1, CCDS58841.1	3q13.1	2013-01-29	2002-08-08		ENSG00000170017	ENSG00000170017		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	400	protein-coding gene	gene with protein product		601662	"""activated leucocyte cell adhesion molecule"""			7760007	Standard	NM_001627		Approved	CD166, MEMD	uc003dvx.3	Q13740	OTTHUMG00000159192	ENST00000306107.5:c.1323A>G	3.37:g.105266316A>G		Somatic		Capture	Illumina GAIIx	Phase_I	106749006	B2RNS3|B4DTU0|O60892|Q1HGM8|Q1HGM9|Q6PEY4|Q6ZS95	Silent	SNP	ENST00000306107.5	37	CCDS33810.1	.	.	.	.	.	.	.	.	.	.	A	0.856	-0.736964	0.03111	.	.	ENSG00000170017	ENST00000465413	.	.	.	5.46	1.72	0.24424	.	.	.	.	.	T	0.53610	0.1807	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43605	-0.9381	4	.	.	.	-9.8939	6.1457	0.20285	0.5567:0.2083:0.235:0.0	.	.	.	.	E	202	.	.	K	+	1	0	ALCAM	106749006	1.000000	0.71417	1.000000	0.80357	0.082000	0.17680	0.847000	0.27696	0.457000	0.26962	0.383000	0.25322	AAA		0.373	ALCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353764.1	NM_001627	
BBX	56987	broad.mit.edu	37	3	107497277	107497277	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr3:107497277C>T	ENST00000325805.8	+	13	2401	c.2114C>T	c.(2113-2115)cCt>cTt	p.P705L	BBX_ENST00000406780.1_Missense_Mutation_p.P705L|BBX_ENST00000416476.2_Silent_p.L369L|BBX_ENST00000473542.1_3'UTR|BBX_ENST00000415149.2_Missense_Mutation_p.P705L|BBX_ENST00000402543.1_Missense_Mutation_p.P705L			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	705	Lys-rich.				bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P705L(1)		breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			CAATATAGTCCTGTTACATTT	0.418																																																1	Substitution - Missense(1)	ovary(1)	3											96.0	96.0	96.0					3																	107497277		2203	4300	6503	108979967	SO:0001583	missense	56987			AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.2114C>T	3.37:g.107497277C>T	ENSP00000319974:p.Pro705Leu	Somatic		Capture	Illumina GAIIx	Phase_I	108979967	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	ENST00000325805.8	37	CCDS46881.1	.	.	.	.	.	.	.	.	.	.	C	32	5.145413	0.94603	.	.	ENSG00000114439	ENST00000415149;ENST00000402543;ENST00000325805;ENST00000406780	T;T;T;T	0.61274	0.12;0.12;0.12;0.12	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.69860	0.3158	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.71241	-0.4651	10	0.87932	D	0	-9.5728	20.327	0.98704	0.0:1.0:0.0:0.0	.	705;705	Q8WY36;Q8WY36-2	BBX_HUMAN;.	L	705	ENSP00000408358:P705L;ENSP00000385317:P705L;ENSP00000319974:P705L;ENSP00000385530:P705L	ENSP00000319974:P705L	P	+	2	0	BBX	108979967	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.487000	0.81328	2.794000	0.96219	0.650000	0.86243	CCT		0.418	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235	
HTR3E	285242	broad.mit.edu	37	3	183819289	183819289	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr3:183819289T>C	ENST00000415389.2	+	3	717	c.251T>C	c.(250-252)cTc>cCc	p.L84P	HTR3E_ENST00000440596.2_Intron|HTR3E_ENST00000425359.2_Intron|HTR3E_ENST00000335304.2_Missense_Mutation_p.L99P|HTR3E_ENST00000436361.2_Intron|HTR3E-AS1_ENST00000431427.1_RNA	NM_001256613.1|NM_198313.2	NP_001243542.1|NP_938055.1	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine (serotonin) receptor 3E, ionotropic	84					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)	p.L99P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	40	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	CAGCTGCACCTCTTGTCATCA	0.393																																					Melanoma(7;227 727 6634 44770)											1	Substitution - Missense(1)	ovary(1)	3											222.0	212.0	216.0					3																	183819289		2203	4300	6503	185301983	SO:0001583	missense	285242			AY159813	CCDS3251.1, CCDS58868.1, CCDS58869.1, CCDS58870.1, CCDS58871.1	3q27	2012-05-22	2012-02-03		ENSG00000186038	ENSG00000186038		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24005	protein-coding gene	gene with protein product		610123	"""5-hydroxytryptamine (serotonin) receptor 3, family member E"""			12801637, 15157181	Standard	NM_001256613		Approved		uc010hxr.3	A5X5Y0	OTTHUMG00000156857	ENST00000415389.2:c.251T>C	3.37:g.183819289T>C	ENSP00000401444:p.Leu84Pro	Somatic		Capture	Illumina GAIIx	Phase_I	185301983	A8IKD7|E9PGF1|Q495G1|Q495G3|Q6V706|Q6V707|Q7Z6B2	Missense_Mutation	SNP	ENST00000415389.2	37	CCDS58868.1	.	.	.	.	.	.	.	.	.	.	t	15.89	2.967702	0.53507	.	.	ENSG00000186038	ENST00000415389;ENST00000335304;ENST00000431041	T;T;T	0.78481	-1.18;-1.18;-1.18	3.8	3.8	0.43715	Neurotransmitter-gated ion-channel ligand-binding (3);	0.232575	0.27331	U	0.019844	D	0.87164	0.6109	M	0.84846	2.72	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.69479	0.964;0.939	D	0.88614	0.3158	10	0.87932	D	0	.	10.8206	0.46601	0.0:0.0:0.0:1.0	.	84;99	A5X5Y0;A5X5Y0-3	5HT3E_HUMAN;.	P	84;99;13	ENSP00000401444:L84P;ENSP00000335511:L99P;ENSP00000391254:L13P	ENSP00000335511:L99P	L	+	2	0	HTR3E	185301983	0.980000	0.34600	1.000000	0.80357	0.819000	0.46315	3.761000	0.55242	1.713000	0.51359	0.533000	0.62120	CTC		0.393	HTR3E-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346284.1	NM_182589	
CLDN16	10686	broad.mit.edu	37	3	190126232	190126232	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr3:190126232C>A	ENST00000264734.2	+	4	970	c.722C>A	c.(721-723)gCt>gAt	p.A241D	CLDN16_ENST00000456423.1_Intron	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	241					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)	p.A241D(1)		breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		CTCGGAATGGCTGGGTCTCTG	0.388																																																1	Substitution - Missense(1)	ovary(1)	3											169.0	164.0	166.0					3																	190126232		2203	4300	6503	191608926	SO:0001583	missense	10686			AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.722C>A	3.37:g.190126232C>A	ENSP00000264734:p.Ala241Asp	Somatic		Capture	Illumina GAIIx	Phase_I	191608926		Missense_Mutation	SNP	ENST00000264734.2	37	CCDS3296.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644750	0.87859	.	.	ENSG00000113946	ENST00000264734	D	0.90133	-2.62	5.6	5.6	0.85130	.	0.316082	0.31323	N	0.007846	D	0.93884	0.8043	M	0.78049	2.395	0.80722	D	1	P	0.50369	0.934	P	0.52909	0.713	D	0.94413	0.7633	10	0.87932	D	0	-17.2997	18.5954	0.91228	0.0:1.0:0.0:0.0	.	241	Q9Y5I7	CLD16_HUMAN	D	241	ENSP00000264734:A241D	ENSP00000264734:A241D	A	+	2	0	CLDN16	191608926	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.010000	0.57117	2.624000	0.88883	0.557000	0.71058	GCT		0.388	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343519.1	NM_006580	
GRID2	2895	broad.mit.edu	37	4	94137990	94137990	+	Silent	SNP	G	G	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr4:94137990G>T	ENST00000282020.4	+	6	1149	c.891G>T	c.(889-891)cgG>cgT	p.R297R	GRID2_ENST00000510992.1_Silent_p.R202R|GRID2_ENST00000505687.1_3'UTR	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	297					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.R297R(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TAAGTCAGCGGTGTTTCCGTG	0.393																																																1	Substitution - coding silent(1)	ovary(1)	4											160.0	156.0	157.0					4																	94137990		2203	4300	6503	94357013	SO:0001819	synonymous_variant	2895			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.891G>T	4.37:g.94137990G>T		Somatic		Capture	Illumina GAIIx	Phase_I	94357013	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Silent	SNP	ENST00000282020.4	37	CCDS3637.1																																																																																				0.393	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
ALPK1	80216	broad.mit.edu	37	4	113353419	113353419	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr4:113353419A>T	ENST00000458497.1	+	11	2995	c.2716A>T	c.(2716-2718)Act>Tct	p.T906S	ALPK1_ENST00000504176.2_Missense_Mutation_p.T828S|ALPK1_ENST00000177648.9_Missense_Mutation_p.T906S	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	906							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T906S(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		CGAGGACTGCACTACCACAGA	0.537																																																1	Substitution - Missense(1)	ovary(1)	4											122.0	119.0	120.0					4																	113353419		2203	4300	6503	113572868	SO:0001583	missense	80216			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.2716A>T	4.37:g.113353419A>T	ENSP00000398048:p.Thr906Ser	Somatic		Capture	Illumina GAIIx	Phase_I	113572868	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	37	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	A	13.32	2.202356	0.38905	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.02525	4.33;4.33;4.26	5.47	-2.73	0.05950	.	0.648638	0.15215	N	0.274233	T	0.02455	0.0075	L	0.48642	1.525	0.09310	N	1	B;B;B	0.20052	0.041;0.01;0.024	B;B;B	0.16722	0.016;0.005;0.007	T	0.48139	-0.9061	10	0.12766	T	0.61	-4.7301	7.8153	0.29256	0.2665:0.0:0.5834:0.1502	.	828;828;906	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	S	906;906;828	ENSP00000398048:T906S;ENSP00000177648:T906S;ENSP00000426044:T828S	ENSP00000177648:T906S	T	+	1	0	ALPK1	113572868	0.001000	0.12720	0.237000	0.24090	0.914000	0.54420	0.100000	0.15231	-0.463000	0.06973	0.533000	0.62120	ACT		0.537	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144	
DCLK2	166614	broad.mit.edu	37	4	151160899	151160899	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr4:151160899T>G	ENST00000296550.7	+	11	2326	c.1572T>G	c.(1570-1572)tgT>tgG	p.C524W	DCLK2_ENST00000506325.1_Missense_Mutation_p.C523W|DCLK2_ENST00000302176.8_Missense_Mutation_p.C541W	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	524	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.C524W(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TTCAGGTGTGTGAATATCCTG	0.428																																					GBM(195;186 2215 13375 16801 37459)											1	Substitution - Missense(1)	ovary(1)	4											129.0	131.0	130.0					4																	151160899		2203	4300	6503	151380349	SO:0001583	missense	166614			BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1572T>G	4.37:g.151160899T>G	ENSP00000296550:p.Cys524Trp	Somatic		Capture	Illumina GAIIx	Phase_I	151380349	C9J5Q9|Q59GC8|Q8N399	Missense_Mutation	SNP	ENST00000296550.7	37	CCDS34076.1	.	.	.	.	.	.	.	.	.	.	T	12.95	2.090418	0.36855	.	.	ENSG00000170390	ENST00000296550;ENST00000506325;ENST00000302176	T;T;T	0.65364	-0.15;-0.15;-0.15	5.84	2.13	0.27403	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.096907	0.64402	D	0.000001	T	0.65709	0.2717	L	0.49571	1.57	0.80722	D	1	P;D;P	0.67145	0.905;0.996;0.727	P;P;P	0.59288	0.753;0.855;0.796	T	0.60490	-0.7253	10	0.38643	T	0.18	.	9.1366	0.36877	0.0:0.21:0.0:0.79	.	541;523;524	Q8N568-3;Q8N568-2;Q8N568	.;.;DCLK2_HUMAN	W	524;523;541	ENSP00000296550:C524W;ENSP00000427235:C523W;ENSP00000303887:C541W	ENSP00000296550:C524W	C	+	3	2	DCLK2	151380349	0.995000	0.38212	1.000000	0.80357	0.978000	0.69477	0.271000	0.18626	0.145000	0.18977	0.528000	0.53228	TGT		0.428	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364952.1	NM_001040260	
WWC2	80014	broad.mit.edu	37	4	184190299	184190299	+	Nonsense_Mutation	SNP	C	C	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr4:184190299C>T	ENST00000403733.3	+	15	2582	c.2383C>T	c.(2383-2385)Cga>Tga	p.R795*	WWC2_ENST00000506225.1_3'UTR|WWC2_ENST00000504005.1_Nonsense_Mutation_p.R477*|WWC2_ENST00000378925.3_Intron|WWC2_ENST00000513834.1_Nonsense_Mutation_p.R746*|WWC2_ENST00000448232.2_Nonsense_Mutation_p.R795*	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	795	C2.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.R795*(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		CAGTAAACACCGAAGGGAAGA	0.413																																																1	Substitution - Nonsense(1)	ovary(1)	4											78.0	76.0	76.0					4																	184190299		2203	4300	6503	184427293	SO:0001587	stop_gained	80014			BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.2383C>T	4.37:g.184190299C>T	ENSP00000384222:p.Arg795*	Somatic		Capture	Illumina GAIIx	Phase_I	184427293	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Nonsense_Mutation	SNP	ENST00000403733.3	37	CCDS34109.2	.	.	.	.	.	.	.	.	.	.	C	25.5	4.649584	0.87958	.	.	ENSG00000151718	ENST00000403733;ENST00000513834;ENST00000448232;ENST00000504005	.	.	.	5.35	3.6	0.41247	.	0.532203	0.18140	N	0.150455	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-0.4876	10.1123	0.42570	0.1444:0.7849:0.0:0.0707	.	.	.	.	X	795;746;795;477	.	ENSP00000384222:R795X	R	+	1	2	WWC2	184427293	0.337000	0.24766	0.006000	0.13384	0.346000	0.29079	2.203000	0.42752	0.796000	0.33947	0.555000	0.69702	CGA		0.413	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319608.1	NM_024949	
PCDHA10	56139	broad.mit.edu	37	5	140236992	140236992	+	Silent	SNP	G	G	A	rs372428918		TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr5:140236992G>A	ENST00000307360.5	+	1	1359	c.1359G>A	c.(1357-1359)gcG>gcA	p.A453A	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Silent_p.A453A|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	453	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A453A(2)		NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGCGCCTGCGTTCGCGCAGT	0.677																																																2	Substitution - coding silent(2)	ovary(2)	5											101.0	94.0	97.0					5																	140236992		2196	4274	6470	140217176	SO:0001819	synonymous_variant	56139			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1359G>A	5.37:g.140236992G>A		Somatic		Capture	Illumina GAIIx	Phase_I	140217176	A1L493|O75280|Q9NRU2	Silent	SNP	ENST00000307360.5	37	CCDS54921.1																																																																																				0.677	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
BRPF3	27154	broad.mit.edu	37	6	36185695	36185695	+	Splice_Site	SNP	C	C	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr6:36185695C>T	ENST00000357641.6	+	9	3244	c.2991C>T	c.(2989-2991)ggC>ggT	p.G997G	BRPF3_ENST00000543502.1_Splice_Site_p.G727G|BRPF3_ENST00000443324.2_Intron|BRPF3_ENST00000534694.1_Intron|BRPF3_ENST00000534400.1_Splice_Site_p.G997G|BRPF3_ENST00000339717.7_Splice_Site_p.G727G	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	997					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)	p.G997G(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						CCTTGGCAGGCATGACCAACG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	6											148.0	122.0	131.0					6																	36185695		2203	4300	6503	36293673	SO:0001630	splice_region_variant	27154			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.2990-1C>T	6.37:g.36185695C>T		Somatic		Capture	Illumina GAIIx	Phase_I	36293673	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Silent	SNP	ENST00000357641.6	37	CCDS34437.1																																																																																				0.537	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3	NM_015695	Silent
DNAH8	1769	broad.mit.edu	37	6	38919130	38919130	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr6:38919130A>T	ENST00000359357.3	+	80	11888	c.11634A>T	c.(11632-11634)agA>agT	p.R3878S	DNAH8_ENST00000449981.2_Missense_Mutation_p.R4095S|RP1-207H1.3_ENST00000416948.1_RNA|DNAH8_ENST00000441566.1_Missense_Mutation_p.R3842S			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3878	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3878S(1)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TTCAAGCAAGAAAGTATATTG	0.373																																																1	Substitution - Missense(1)	ovary(1)	6											126.0	134.0	131.0					6																	38919130		2203	4300	6503	39027108	SO:0001583	missense	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.11634A>T	6.37:g.38919130A>T	ENSP00000352312:p.Arg3878Ser	Somatic		Capture	Illumina GAIIx	Phase_I	39027108	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	A	19.88	3.909261	0.72868	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T;T	0.11277	2.79;3.06;3.06;3.06	5.6	3.21	0.36854	Dynein heavy chain (1);	0.048986	0.85682	D	0.000000	T	0.11153	0.0272	L	0.52364	1.645	0.51233	D	0.999912	D;D	0.67145	0.995;0.996	D;D	0.68039	0.925;0.955	T	0.04427	-1.0952	10	0.42905	T	0.14	.	5.4942	0.16793	0.6293:0.0:0.3707:0.0	.	3842;3878	Q96JB1-2;Q96JB1	.;DYH8_HUMAN	S	4083;4083;3878;3842	ENSP00000415331:R4083S;ENSP00000333363:R4083S;ENSP00000352312:R3878S;ENSP00000402294:R3842S	ENSP00000333363:R4083S	R	+	3	2	DNAH8	39027108	0.995000	0.38212	1.000000	0.80357	0.996000	0.88848	0.370000	0.20433	1.049000	0.40321	0.533000	0.62120	AGA		0.373	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
TAF8	129685	broad.mit.edu	37	6	42045277	42045277	+	Silent	SNP	C	C	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr6:42045277C>T	ENST00000372977.3	+	9	945	c.927C>T	c.(925-927)ctC>ctT	p.L309L	TAF8_ENST00000456846.2_Intron|TAF8_ENST00000494547.1_3'UTR|TAF8_ENST00000465926.1_Silent_p.L233L|TAF8_ENST00000372982.4_Intron	NM_138572.2	NP_612639.2	Q7Z7C8	TAF8_HUMAN	TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa	309					cell differentiation (GO:0030154)|inner cell mass cell proliferation (GO:0001833)|maintenance of protein location in nucleus (GO:0051457)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fat cell differentiation (GO:0045598)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|transcription factor TFIID complex (GO:0005669)		p.L309L(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	6	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00179)			CTAGGTCCCTCTCCTGAGCTG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	6											46.0	46.0	46.0					6																	42045277		1932	4129	6061	42153255	SO:0001819	synonymous_variant	129685			AK057383	CCDS43462.1	6p21.1	2008-10-23	2007-07-30	2007-07-30	ENSG00000137413	ENSG00000137413			17300	protein-coding gene	gene with protein product		609514	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 45/50kDa"", ""taube nuss homolog (mouse)"""	TBN			Standard	NM_138572		Approved	FLJ32821, TAF(II)43	uc003ors.3	Q7Z7C8	OTTHUMG00000014692	ENST00000372977.3:c.927C>T	6.37:g.42045277C>T		Somatic		Capture	Illumina GAIIx	Phase_I	42153255	Q5T0K1|Q8N4R9|Q96M52	Silent	SNP	ENST00000372977.3	37	CCDS43462.1																																																																																				0.577	TAF8-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357901.1	NM_138572	
TDRD6	221400	broad.mit.edu	37	6	46658991	46658991	+	Silent	SNP	C	C	G			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr6:46658991C>G	ENST00000316081.6	+	1	3126	c.3126C>G	c.(3124-3126)gcC>gcG	p.A1042A	TDRD6_ENST00000544460.1_Silent_p.A1042A	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1042	Tudor 5. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)		p.A1042A(1)		NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			TGTGCCTTGCCAAGTATACTG	0.343																																																1	Substitution - coding silent(1)	ovary(1)	6											70.0	75.0	73.0					6																	46658991		2203	4300	6503	46766950	SO:0001819	synonymous_variant	221400			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.3126C>G	6.37:g.46658991C>G		Somatic		Capture	Illumina GAIIx	Phase_I	46766950	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Silent	SNP	ENST00000316081.6	37	CCDS34470.1																																																																																				0.343	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
ERMARD	55780	broad.mit.edu	37	6	170168266	170168266	+	Splice_Site	SNP	T	T	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr6:170168266T>C	ENST00000366773.3	+	11	1091	c.1058T>C	c.(1057-1059)aTg>aCg	p.M353T	ERMARD_ENST00000392095.4_Splice_Site_p.M227T|ERMARD_ENST00000588451.1_Splice_Site_p.M217T|ERMARD_ENST00000418781.3_Splice_Site_p.M353T|RP1-266L20.9_ENST00000586101.1_RNA|ERMARD_ENST00000366772.2_Splice_Site_p.M353T	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	353					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.M353T(1)									GAGCCTGCTATGGTAAGTATT	0.328																																																1	Substitution - Missense(1)	ovary(1)	6											111.0	109.0	109.0					6																	170168266		2203	4300	6503	169910191	SO:0001630	splice_region_variant	55780			AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.1059+1T>C	6.37:g.170168266T>C		Somatic		Capture	Illumina GAIIx	Phase_I	169910191	B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	SNP	ENST00000366773.3	37	CCDS34576.1	.	.	.	.	.	.	.	.	.	.	T	14.58	2.577798	0.45902	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781;ENST00000392095;ENST00000366771	T;T	0.49432	0.79;0.78	5.1	5.1	0.69264	.	0.150630	0.46758	D	0.000263	T	0.64068	0.2565	M	0.80982	2.52	0.40748	D	0.98289	D;D;P	0.89917	1.0;0.999;0.651	D;D;B	0.83275	0.996;0.994;0.273	T	0.71283	-0.4639	10	0.87932	D	0	.	14.8493	0.70284	0.0:0.0:0.0:1.0	.	353;353;353	Q5T6L9-3;Q5T6L9-2;Q5T6L9	.;.;CF070_HUMAN	T	353;353;353;227;1	ENSP00000355735:M353T;ENSP00000375945:M227T	ENSP00000355733:M1T	M	+	2	0	C6orf70	169910191	1.000000	0.71417	0.992000	0.48379	0.865000	0.49528	4.675000	0.61619	2.059000	0.61396	0.533000	0.62120	ATG		0.328	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043238.2	NM_018341	Missense_Mutation
GHRHR	2692	broad.mit.edu	37	7	31013649	31013649	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr7:31013649A>C	ENST00000326139.2	+	7	693	c.647A>C	c.(646-648)aAc>aCc	p.N216T	GHRHR_ENST00000461424.1_3'UTR|GHRHR_ENST00000409904.3_Missense_Mutation_p.N152T|GHRHR_ENST00000409316.1_Intron	NM_000823.3	NP_000814.2	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	216					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP-mediated signaling (GO:0019933)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|determination of adult lifespan (GO:0008340)|growth hormone secretion (GO:0030252)|hormone metabolic process (GO:0042445)|lactation (GO:0007595)|multicellular organismal reproductive process (GO:0048609)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of intracellular steroid hormone receptor signaling pathway (GO:0033143)|regulation of protein metabolic process (GO:0051246)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|somatotropin secreting cell development (GO:0060133)|water homeostasis (GO:0030104)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nuclear matrix (GO:0016363)|nuclear outer membrane (GO:0005640)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	G-protein coupled receptor activity (GO:0004930)|growth factor binding (GO:0019838)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)	p.N216T(1)		biliary_tract(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35					Sermorelin(DB00010)|Tesamorelin(DB08869)	ACCATGACCAACTTCAGCTGG	0.632																																																1	Substitution - Missense(1)	ovary(1)	7											82.0	79.0	80.0					7																	31013649		2203	4300	6503	30980174	SO:0001583	missense	2692				CCDS5432.1	7p14	2012-08-10			ENSG00000106128	ENSG00000106128		"""GPCR / Class B : Glucagon receptors"""	4266	protein-coding gene	gene with protein product		139191				7680413, 7514564	Standard	NM_000823		Approved		uc003tbx.3	Q02643	OTTHUMG00000152801	ENST00000326139.2:c.647A>C	7.37:g.31013649A>C	ENSP00000320180:p.Asn216Thr	Somatic		Capture	Illumina GAIIx	Phase_I	30980174	Q99863	Missense_Mutation	SNP	ENST00000326139.2	37	CCDS5432.1	.	.	.	.	.	.	.	.	.	.	a	23.5	4.418380	0.83559	.	.	ENSG00000106128	ENST00000326139;ENST00000409904	T;T	0.36340	1.26;1.26	5.13	5.13	0.70059	GPCR, family 2-like (1);	.	.	.	.	T	0.66752	0.2821	M	0.90922	3.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.74887	-0.3511	9	0.87932	D	0	.	12.965	0.58480	1.0:0.0:0.0:0.0	.	152;216	Q9HB45;Q02643	.;GHRHR_HUMAN	T	216;152	ENSP00000320180:N216T;ENSP00000387113:N152T	ENSP00000320180:N216T	N	+	2	0	GHRHR	30980174	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	8.325000	0.90007	2.155000	0.67459	0.524000	0.50904	AAC		0.632	GHRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327967.2		
SEMA3D	223117	broad.mit.edu	37	7	84636125	84636125	+	Missense_Mutation	SNP	C	C	G	rs370785183		TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr7:84636125C>G	ENST00000284136.6	-	16	1944	c.1901G>C	c.(1900-1902)cGa>cCa	p.R634P	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	634	Ig-like C2-type.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.R634P(1)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TACCTCCTCTCGATGCTCATC	0.373																																					Ovarian(63;442 1191 17318 29975 31528)											1	Substitution - Missense(1)	ovary(1)	7											224.0	209.0	214.0					7																	84636125		2203	4299	6502	84474061	SO:0001583	missense	223117			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1901G>C	7.37:g.84636125C>G	ENSP00000284136:p.Arg634Pro	Somatic		Capture	Illumina GAIIx	Phase_I	84474061	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.162163	0.38217	.	.	ENSG00000153993	ENST00000284136	T	0.66280	-0.2	6.01	6.01	0.97437	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	3.808830	0.01029	N	0.004110	T	0.64516	0.2605	L	0.50333	1.59	0.80722	D	1	B	0.12013	0.005	B	0.10450	0.005	T	0.30149	-0.9988	10	0.41790	T	0.15	.	13.6832	0.62499	0.0:0.9299:0.0:0.0701	.	634	O95025	SEM3D_HUMAN	P	634	ENSP00000284136:R634P	ENSP00000284136:R634P	R	-	2	0	SEMA3D	84474061	0.998000	0.40836	0.995000	0.50966	0.938000	0.57974	1.543000	0.36147	2.861000	0.98227	0.650000	0.86243	CGA		0.373	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
ADAM22	53616	broad.mit.edu	37	7	87763699	87763699	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr7:87763699T>C	ENST00000265727.7	+	13	1212	c.1133T>C	c.(1132-1134)aTt>aCt	p.I378T	ADAM22_ENST00000398204.4_Missense_Mutation_p.I378T|ADAM22_ENST00000398209.3_Missense_Mutation_p.I378T|ADAM22_ENST00000315984.7_Missense_Mutation_p.I378T|ADAM22_ENST00000398201.4_Missense_Mutation_p.I378T			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	378	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.I378T(2)		endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			GCCCATAATATTGGTATTATC	0.289																																																2	Substitution - Missense(2)	ovary(2)	7											78.0	79.0	79.0					7																	87763699		1795	4066	5861	87601635	SO:0001583	missense	53616			AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.1133T>C	7.37:g.87763699T>C	ENSP00000265727:p.Ile378Thr	Somatic		Capture	Illumina GAIIx	Phase_I	87601635	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Missense_Mutation	SNP	ENST00000265727.7	37	CCDS47637.1	.	.	.	.	.	.	.	.	.	.	T	18.21	3.572987	0.65765	.	.	ENSG00000008277	ENST00000398204;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203	T;T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25;2.25	5.56	5.56	0.83823	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.157793	0.56097	D	0.000035	T	0.39517	0.1081	M	0.69823	2.125	0.58432	D	0.999999	P;B;B;B	0.39782	0.688;0.257;0.303;0.279	P;B;P;B	0.55545	0.778;0.424;0.56;0.345	T	0.15896	-1.0421	10	0.87932	D	0	.	15.7086	0.77606	0.0:0.0:0.0:1.0	.	430;378;378;378	E9PBH5;Q9P0K1-5;Q9P0K1;Q9P0K1-2	.;.;ADA22_HUMAN;.	T	378;378;378;378;378;345	ENSP00000381262:I378T;ENSP00000381260:I378T;ENSP00000265727:I378T;ENSP00000315900:I378T;ENSP00000381267:I378T;ENSP00000381261:I345T	ENSP00000265727:I378T	I	+	2	0	ADAM22	87601635	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.293000	0.78740	2.113000	0.64589	0.528000	0.53228	ATT		0.289	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723	
ZNF804B	219578	broad.mit.edu	37	7	88963451	88963451	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr7:88963451T>A	ENST00000333190.4	+	4	1764	c.1155T>A	c.(1153-1155)gaT>gaA	p.D385E		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	385							metal ion binding (GO:0046872)	p.D385E(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AATGCCTGGATGAGTTTTCAT	0.383										HNSCC(36;0.09)																																						1	Substitution - Missense(1)	ovary(1)	7											45.0	51.0	49.0					7																	88963451		2203	4300	6503	88801387	SO:0001583	missense	219578			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1155T>A	7.37:g.88963451T>A	ENSP00000329638:p.Asp385Glu	Somatic		Capture	Illumina GAIIx	Phase_I	88801387	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	T	10.60	1.395366	0.25205	.	.	ENSG00000182348	ENST00000333190	T	0.04970	3.52	5.19	5.19	0.71726	.	0.333086	0.25900	N	0.027563	T	0.08670	0.0215	M	0.65975	2.015	0.29169	N	0.877267	B	0.32918	0.39	B	0.27380	0.079	T	0.07328	-1.0778	10	0.59425	D	0.04	-20.5529	10.4536	0.44537	0.1451:0.0:0.0:0.8549	.	385	A4D1E1	Z804B_HUMAN	E	385	ENSP00000329638:D385E	ENSP00000329638:D385E	D	+	3	2	ZNF804B	88801387	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.921000	0.40035	2.188000	0.69820	0.533000	0.62120	GAT		0.383	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
ASIC3	9311	broad.mit.edu	37	7	150747657	150747657	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr7:150747657C>T	ENST00000349064.5	+	3	973	c.775C>T	c.(775-777)Ccg>Tcg	p.P259S	ASIC3_ENST00000297512.8_Missense_Mutation_p.P259S|ASIC3_ENST00000357922.4_Missense_Mutation_p.P259S	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	259					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)	p.P259S(1)									GGGGGTGTCCCCGGGCTACCA	0.612																																																1	Substitution - Missense(1)	ovary(1)	7											81.0	88.0	86.0					7																	150747657		2203	4300	6503	150378590	SO:0001583	missense	9311			AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.775C>T	7.37:g.150747657C>T	ENSP00000344838:p.Pro259Ser	Somatic		Capture	Illumina GAIIx	Phase_I	150378590	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Missense_Mutation	SNP	ENST00000349064.5	37	CCDS5916.1	.	.	.	.	.	.	.	.	.	.	C	19.64	3.864831	0.71949	.	.	ENSG00000213199	ENST00000357922;ENST00000349064;ENST00000297512	T;T;T	0.67698	-0.28;-0.28;-0.28	4.88	4.88	0.63580	.	0.000000	0.37906	U	0.001881	D	0.85106	0.5621	M	0.91249	3.19	0.58432	D	0.99999	D;P;D	0.89917	0.999;0.929;1.0	D;P;D	0.91635	0.976;0.834;0.999	D	0.88122	0.2832	10	0.59425	D	0.04	-11.9577	15.8774	0.79178	0.0:1.0:0.0:0.0	.	259;259;259	Q9UHC3-2;Q9UHC3-3;Q9UHC3	.;.;ACCN3_HUMAN	S	259	ENSP00000350600:P259S;ENSP00000344838:P259S;ENSP00000297512:P259S	ENSP00000297512:P259S	P	+	1	0	ACCN3	150378590	1.000000	0.71417	0.973000	0.42090	0.226000	0.24999	7.746000	0.85057	2.406000	0.81754	0.555000	0.69702	CCG		0.612	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	
MYOM2	9172	broad.mit.edu	37	8	2063847	2063847	+	Silent	SNP	T	T	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr8:2063847T>A	ENST00000262113.4	+	26	3417	c.3276T>A	c.(3274-3276)atT>atA	p.I1092I	MYOM2_ENST00000523438.1_Silent_p.I517I	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1092					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.I1092I(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CTGTGCAGATTCATGATGGGA	0.368																																																1	Substitution - coding silent(1)	ovary(1)	8											163.0	154.0	157.0					8																	2063847		2203	4300	6503	2051254	SO:0001819	synonymous_variant	9172				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.3276T>A	8.37:g.2063847T>A		Somatic		Capture	Illumina GAIIx	Phase_I	2051254	Q7Z3Y2	Silent	SNP	ENST00000262113.4	37	CCDS5957.1																																																																																				0.368	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
CSMD1	64478	broad.mit.edu	37	8	2820040	2820040	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr8:2820040T>A	ENST00000520002.1	-	62	10134	c.9579A>T	c.(9577-9579)agA>agT	p.R3193S	CSMD1_ENST00000602557.1_Missense_Mutation_p.R3193S|CSMD1_ENST00000602723.1_Missense_Mutation_p.R3016S|CSMD1_ENST00000537824.1_Missense_Mutation_p.R3192S|CSMD1_ENST00000400186.3_Missense_Mutation_p.R3016S|CSMD1_ENST00000542608.1_Missense_Mutation_p.R3015S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3193	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.R2921S(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGCAGACTCTTCTGGAGGATC	0.493																																																1	Substitution - Missense(1)	ovary(1)	8											64.0	63.0	64.0					8																	2820040		1929	4129	6058	2807447	SO:0001583	missense	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9579A>T	8.37:g.2820040T>A	ENSP00000430733:p.Arg3193Ser	Somatic		Capture	Illumina GAIIx	Phase_I	2807447	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.987|3.987	-0.005333|-0.005333	0.07773|0.07773	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	.|T;T;T;T	.|0.63913	.|-0.07;-0.07;-0.07;-0.07	5.6|5.6	-5.66|-5.66	0.02451|0.02451	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.162286	.|0.43416	.|D	.|0.000571	.|T	.|0.53465	.|0.1798	N|N	0.11106|0.11106	0.095|0.095	0.37608|0.37608	D|D	0.920818|0.920818	.|D;B;B	.|0.64830	.|0.994;0.04;0.013	.|D;B;B	.|0.75020	.|0.985;0.074;0.02	.|T	.|0.62868	.|-0.6763	.|10	.|0.13470	.|T	.|0.59	.|.	15.8887|15.8887	0.79273|0.79273	0.0:0.5816:0.0:0.4184|0.0:0.5816:0.0:0.4184	.|.	.|3193;3193;3015	.|E5RIG2;Q96PZ7;F5H2I8	.|.;CSMD1_HUMAN;.	X|S	2610|3016;3193;3054;3192;3015	.|ENSP00000383047:R3016S;ENSP00000430733:R3193S;ENSP00000441462:R3192S;ENSP00000446243:R3015S	.|ENSP00000320445:R3054S	K|R	-|-	1|3	0|2	CSMD1|CSMD1	2807447|2807447	0.018000|0.018000	0.18449|0.18449	0.000000|0.000000	0.03702|0.03702	0.068000|0.068000	0.16541|0.16541	-0.251000|-0.251000	0.08818|0.08818	-1.493000|-1.493000	0.01835|0.01835	-0.256000|-0.256000	0.11100|0.11100	AAG|AGA		0.493	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
PKHD1L1	93035	broad.mit.edu	37	8	110451188	110451188	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr8:110451188G>A	ENST00000378402.5	+	32	3927	c.3823G>A	c.(3823-3825)Gtg>Atg	p.V1275M		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1275	IPT/TIG 6.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.V1277M(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AAACATGGCGGTGTATGTTGG	0.338										HNSCC(38;0.096)																																						1	Substitution - Missense(1)	ovary(1)	8																																								110520364	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.3823G>A	8.37:g.110451188G>A	ENSP00000367655:p.Val1275Met	Somatic		Capture	Illumina GAIIx	Phase_I	110520364	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.379398	0.61845	.	.	ENSG00000205038	ENST00000378402	D	0.84442	-1.85	5.7	5.7	0.88788	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.93028	0.7781	M	0.89095	3.005	0.37311	D	0.909124	D	0.61080	0.989	P	0.62885	0.908	D	0.95211	0.8325	10	0.87932	D	0	.	17.338	0.87287	0.0:0.0:1.0:0.0	.	1275	Q86WI1	PKHL1_HUMAN	M	1275	ENSP00000367655:V1275M	ENSP00000367655:V1275M	V	+	1	0	PKHD1L1	110520364	1.000000	0.71417	0.173000	0.22940	0.375000	0.29983	6.377000	0.73145	2.689000	0.91719	0.655000	0.94253	GTG		0.338	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
CYP11B1	1584	broad.mit.edu	37	8	143957130	143957130	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr8:143957130C>A	ENST00000292427.4	-	6	1151	c.1119G>T	c.(1117-1119)ttG>ttT	p.L373F	CYP11B1_ENST00000377675.3_Missense_Mutation_p.L444F|CYP11B1_ENST00000517471.1_Missense_Mutation_p.L373F	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	373					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.L373F(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	GCACCCACCGCAAGGTCTCCT	0.672									Familial Hyperaldosteronism type I																																							1	Substitution - Missense(1)	ovary(1)	8											44.0	46.0	46.0					8																	143957130		2203	4300	6503	143954132	SO:0001583	missense	1584	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1119G>T	8.37:g.143957130C>A	ENSP00000292427:p.Leu373Phe	Somatic		Capture	Illumina GAIIx	Phase_I	143954132	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	13.37	2.217377	0.39201	.	.	ENSG00000160882	ENST00000519285;ENST00000292427;ENST00000517471;ENST00000377675	T;D;D;D	0.81659	-1.06;-1.52;-1.52;-1.52	4.42	3.47	0.39725	.	0.000000	0.39544	N	0.001325	D	0.87022	0.6074	M	0.80508	2.5	0.48975	D	0.999739	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.86104	0.1558	10	0.51188	T	0.08	.	5.9481	0.19229	0.19:0.7046:0.0:0.1054	.	444;373;373;373;89	Q4VAR0;Q8TDD0;Q4VAQ9;P15538;Q8N9P8	.;.;.;C11B1_HUMAN;.	F	28;373;373;444	ENSP00000430144:L28F;ENSP00000292427:L373F;ENSP00000428043:L373F;ENSP00000366903:L444F	ENSP00000292427:L373F	L	-	3	2	CYP11B1	143954132	0.990000	0.36364	0.986000	0.45419	0.226000	0.24999	0.305000	0.19254	2.169000	0.68431	0.555000	0.69702	TTG		0.672	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
FOCAD	54914	broad.mit.edu	37	9	20953038	20953038	+	Missense_Mutation	SNP	G	G	A	rs535565536		TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr9:20953038G>A	ENST00000380249.1	+	37	4470	c.4106G>A	c.(4105-4107)gGc>gAc	p.G1369D	FOCAD_ENST00000605086.1_Missense_Mutation_p.G805D|FOCAD_ENST00000338382.6_Missense_Mutation_p.G1369D	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1369						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.G1369D(1)									GCAGCTATTGGCTTCTTCATT	0.373																																																1	Substitution - Missense(1)	ovary(1)	9											121.0	116.0	118.0					9																	20953038		2203	4300	6503	20943038	SO:0001583	missense	54914			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.4106G>A	9.37:g.20953038G>A	ENSP00000369599:p.Gly1369Asp	Somatic		Capture	Illumina GAIIx	Phase_I	20943038	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	G	3.777	-0.046472	0.07407	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.30182	1.54;1.54	6.07	4.02	0.46733	.	0.212156	0.47093	D	0.000249	T	0.09423	0.0232	N	0.02960	-0.455	0.33898	D	0.638131	B	0.09022	0.002	B	0.12156	0.007	T	0.26395	-1.0104	10	0.02654	T	1	-20.2164	5.0518	0.14513	0.3666:0.0:0.6334:0.0	.	1369	Q5VW36	K1797_HUMAN	D	1369	ENSP00000369599:G1369D;ENSP00000344307:G1369D	ENSP00000344307:G1369D	G	+	2	0	KIAA1797	20943038	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.711000	0.54868	1.577000	0.49804	0.655000	0.94253	GGC		0.373	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
KIF4A	24137	broad.mit.edu	37	X	69563732	69563732	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chrX:69563732A>C	ENST00000374403.3	+	13	1413	c.1331A>C	c.(1330-1332)aAa>aCa	p.K444T	KIF4A_ENST00000374388.3_Missense_Mutation_p.K444T	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	444					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.K444T(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TTCAGCTGCAAACTGGATCTT	0.378																																																1	Substitution - Missense(1)	ovary(1)	X											46.0	41.0	43.0					X																	69563732		2203	4300	6503	69480457	SO:0001583	missense	24137			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1331A>C	X.37:g.69563732A>C	ENSP00000363524:p.Lys444Thr	Somatic		Capture	Illumina GAIIx	Phase_I	69480457	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	37	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	A	11.96	1.794949	0.31777	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.54479	0.57;0.57	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000009	T	0.39809	0.1092	L	0.46885	1.475	0.58432	D	0.999991	P;B	0.39535	0.677;0.019	B;B	0.29353	0.101;0.034	T	0.29243	-1.0018	10	0.22109	T	0.4	.	12.7735	0.57434	1.0:0.0:0.0:0.0	.	444;444	O95239;O95239-2	KIF4A_HUMAN;.	T	444	ENSP00000363509:K444T;ENSP00000363524:K444T	ENSP00000363509:K444T	K	+	2	0	KIF4A	69480457	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.229000	0.58625	1.894000	0.54839	0.486000	0.48141	AAA		0.378	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310	
NOX1	27035	broad.mit.edu	37	X	100117759	100117759	+	Silent	SNP	G	G	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chrX:100117759G>T	ENST00000372966.3	-	5	593	c.388C>A	c.(388-390)Cga>Aga	p.R130R	NOX1_ENST00000217885.5_Silent_p.R130R|NOX1_ENST00000372960.4_Silent_p.R93R|NOX1_ENST00000372964.1_Silent_p.R130R	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	130	Ferric oxidoreductase.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)	p.R130R(1)		cervix(1)|lung(3)|ovary(1)|skin(2)	7						GTGGCCTGTCGGCTTCTGCTA	0.453																																																1	Substitution - coding silent(1)	ovary(1)	X											142.0	141.0	141.0					X																	100117759		2203	4299	6502	100004415	SO:0001819	synonymous_variant	27035			AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.388C>A	X.37:g.100117759G>T		Somatic		Capture	Illumina GAIIx	Phase_I	100004415	A8K836|O95691|Q2PP02	Silent	SNP	ENST00000372966.3	37	CCDS14474.1																																																																																				0.453	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057495.1	NM_007052	
ARL13A	392509	broad.mit.edu	37	X	100240796	100240796	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chrX:100240796G>T	ENST00000450049.2	+	4	384	c.271G>T	c.(271-273)Ggg>Tgg	p.G91W		NM_001162491.1	NP_001155963.1	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13A	91					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)	p.G107W(1)		endometrium(1)|ovary(1)	2						ACAGGCCCATGGGCTTGTTTT	0.473																																																1	Substitution - Missense(1)	ovary(1)	X											98.0	91.0	93.0					X																	100240796		1936	4142	6078	100127452	SO:0001583	missense	392509				CCDS55463.1	Xq22.1	2014-05-09	2005-11-18	2005-11-18	ENSG00000174225	ENSG00000174225		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31709	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 13"""	ARL13			Standard	NM_001162491		Approved		uc011mrf.2	Q5H913	OTTHUMG00000022013	ENST00000450049.2:c.271G>T	X.37:g.100240796G>T	ENSP00000398637:p.Gly91Trp	Somatic		Capture	Illumina GAIIx	Phase_I	100127452	B2RTT6|B4DX50	Missense_Mutation	SNP	ENST00000450049.2	37	CCDS55463.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.600799	0.46423	.	.	ENSG00000174225	ENST00000450049	D	0.84070	-1.8	4.55	4.55	0.56014	.	0.050099	0.85682	D	0.000000	D	0.92737	0.7691	H	0.95004	3.61	0.44966	D	0.997986	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93811	0.7110	10	0.87932	D	0	.	11.6418	0.51237	0.0:0.0:1.0:0.0	.	91;91	B2RTT6;Q5H913	.;AR13A_HUMAN	W	91	ENSP00000398637:G91W	ENSP00000398637:G91W	G	+	1	0	ARL13A	100127452	1.000000	0.71417	0.394000	0.26270	0.318000	0.28184	4.353000	0.59411	2.522000	0.85027	0.594000	0.82650	GGG		0.473	ARL13A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000057504.2	XM_373358	
IKBKG	8517	broad.mit.edu	37	X	153770592	153770592	+	5'UTR	SNP	G	G	A			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chrX:153770592G>A	ENST00000369607.1	+	0	115				G6PD_ENST00000497281.1_Intron|G6PD_ENST00000369620.2_Intron|G6PD_ENST00000393562.2_Intron|IKBKG_ENST00000369609.5_Silent_p.E38E|G6PD_ENST00000393564.2_Intron			Q9Y6K9	NEMO_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma						activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of neuron death (GO:1901215)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to virus (GO:0009615)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular (GO:0005622)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	linear polyubiquitin binding (GO:1990450)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|lung(1)	2	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCATCATCGAGGTCCCATCAG	0.567																																																0			X											57.0	48.0	51.0					X																	153770592		1568	3581	5149	153423786	SO:0001623	5_prime_UTR_variant	8517			AF074382	CCDS14757.1, CCDS48196.1, CCDS48197.1	Xq28	2014-09-17			ENSG00000073009	ENSG00000269335		"""Zinc fingers, C2HC-type containing"""	5961	protein-coding gene	gene with protein product		300248	"""incontinentia pigmenti"""	IP2, IP1		9751060, 10087442, 11590134	Standard	NM_001099857		Approved	IKK-gamma, NEMO, Fip3p, FIP-3, FIP3, ZC2HC9	uc011mzr.2	Q9Y6K9	OTTHUMG00000024234	ENST00000369607.1:c.-26G>A	X.37:g.153770592G>A		Somatic		Capture	Illumina GAIIx	Phase_I	153423786	Q7LBY6|Q7Z7F1	Silent	SNP	ENST00000369607.1	37	CCDS14757.1																																																																																				0.567	IKBKG-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000061155.2	NM_003639	
NEB	4703	broad.mit.edu	37	2	152397960	152397960	+	Splice_Site	DEL	C	C	-			TCGA-23-1122-01A-01W-0486-08	TCGA-23-1122-10A-01W-0486-08	C	C	-	-	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina_Capture			Illumina GAIIx	ff74a9b0-a7f5-4f45-ace7-d7236efad78b	dfa95a8b-811f-4f82-8800-2f3710c0f78d	g.chr2:152397960delC	ENST00000172853.10	-	108	15727		c.e108+1		NEB_ENST00000427231.2_Splice_Site|NEB_ENST00000409198.1_Splice_Site|NEB_ENST00000603639.1_Splice_Site|NEB_ENST00000604864.1_Splice_Site|NEB_ENST00000397345.3_Splice_Site			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.?(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCTGAGCTTACCTGACTCTGA	0.507																																																1	Unknown(1)	ovary(1)	2											100.0	98.0	98.0					2																	152397960		2049	4202	6251	152106206	SO:0001630	splice_region_variant	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.15579+1G>-	2.37:g.152397960delC		Somatic		Capture	Illumina GAIIx	Phase_I	152106206	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Splice_Site	DEL	ENST00000172853.10	37																																																																																					0.507	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	Intron
