#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LRRC40	55631	broad.mit.edu	37	1	70650576	70650576	+	Silent	SNP	G	G	C	rs75077715		TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr1:70650576G>C	ENST00000370952.3	-	4	508	c.429C>G	c.(427-429)ctC>ctG	p.L143L		NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	143						membrane (GO:0016020)		p.L143L(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						TTTCTTCAGGGAGTATTTTCA	0.308																																																1	Substitution - coding silent(1)	ovary(1)	1											142.0	143.0	143.0					1																	70650576		2202	4300	6502	70423164	SO:0001819	synonymous_variant	55631				CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.429C>G	1.37:g.70650576G>C		Somatic		Capture	Illumina GAIIx	Phase_I	70423164	Q9BTR7|Q9NSK1|Q9NXC1	Silent	SNP	ENST00000370952.3	37	CCDS646.1																																																																																				0.308	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025914.1	NM_017768	
KCND3	3752	broad.mit.edu	37	1	112524271	112524271	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr1:112524271A>G	ENST00000315987.2	-	2	1557	c.1078T>C	c.(1078-1080)Tac>Cac	p.Y360H	KCND3_ENST00000302127.4_Missense_Mutation_p.Y360H|KCND3_ENST00000369697.1_Missense_Mutation_p.Y360H	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	360					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.Y360H(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	ACAATGGTGTACCAAAACGAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											106.0	88.0	94.0					1																	112524271		2203	4300	6503	112325794	SO:0001583	missense	3752			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.1078T>C	1.37:g.112524271A>G	ENSP00000319591:p.Tyr360His	Somatic		Capture	Illumina GAIIx	Phase_I	112325794	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	ENST00000315987.2	37	CCDS843.1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.780927	0.70222	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.97620	-4.46;-4.46;-4.46	5.59	5.59	0.84812	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98704	0.9565	M	0.93106	3.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.99826	1.1050	10	0.87932	D	0	.	15.4356	0.75143	1.0:0.0:0.0:0.0	.	360;360	Q14D71;Q9UK17	.;KCND3_HUMAN	H	360	ENSP00000358711:Y360H;ENSP00000319591:Y360H;ENSP00000306923:Y360H	ENSP00000306923:Y360H	Y	-	1	0	KCND3	112325794	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.339000	0.96797	2.130000	0.65690	0.533000	0.62120	TAC		0.542	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	
KCTD3	51133	broad.mit.edu	37	1	215785206	215785206	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr1:215785206A>G	ENST00000259154.4	+	15	1799	c.1505A>G	c.(1504-1506)cAg>cGg	p.Q502R		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	502					protein homooligomerization (GO:0051260)			p.Q502R(1)		breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		GTGTTTATCCAGAAAGTTGTT	0.313																																																1	Substitution - Missense(1)	ovary(1)	1											92.0	98.0	96.0					1																	215785206		2203	4300	6503	213851829	SO:0001583	missense	51133			AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.1505A>G	1.37:g.215785206A>G	ENSP00000259154:p.Gln502Arg	Somatic		Capture	Illumina GAIIx	Phase_I	213851829	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	ENST00000259154.4	37	CCDS1515.1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.882327	0.91740	.	.	ENSG00000136636	ENST00000259154;ENST00000366946	T	0.52754	0.65	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.72787	0.3504	M	0.87682	2.9	0.80722	D	1	D;D;D;D	0.89917	0.996;0.999;0.999;1.0	D;D;D;D	0.91635	0.986;0.997;0.997;0.999	T	0.78489	-0.2184	10	0.87932	D	0	-19.2743	14.9223	0.70847	1.0:0.0:0.0:0.0	.	254;254;502;502	B7ZAF7;B4DJX2;Q9Y597-2;Q9Y597	.;.;.;KCTD3_HUMAN	R	502;154	ENSP00000259154:Q502R	ENSP00000259154:Q502R	Q	+	2	0	KCTD3	213851829	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.887000	0.92456	2.114000	0.64651	0.383000	0.25322	CAG		0.313	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121	
LYST	1130	broad.mit.edu	37	1	235840882	235840882	+	Missense_Mutation	SNP	T	T	C	rs151167023		TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr1:235840882T>C	ENST00000389794.3	-	49	11012	c.10838A>G	c.(10837-10839)tAt>tGt	p.Y3613C	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Missense_Mutation_p.Y3613C			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3613					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.Y3613C(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGTGTGACCATAGAGATGTAT	0.338																																																1	Substitution - Missense(1)	ovary(1)	1						T	CYS/TYR	0,4406		0,0,2203	147.0	130.0	136.0		10838	5.7	1.0	1	dbSNP_134	136	1,8599	1.2+/-3.3	0,1,4299	no	missense	LYST	NM_000081.2	194	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	3613/3802	235840882	1,13005	2203	4300	6503	233907505	SO:0001583	missense	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.10838A>G	1.37:g.235840882T>C	ENSP00000374444:p.Tyr3613Cys	Somatic		Capture	Illumina GAIIx	Phase_I	233907505	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388862	0.82902	0.0	1.16E-4	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.28895	1.59;1.59	5.7	5.7	0.88788	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.46328	0.1387	L	0.33245	0.995	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.46373	-0.9196	10	0.87932	D	0	.	15.9462	0.79796	0.0:0.0:0.0:1.0	.	3613	Q99698	LYST_HUMAN	C	3613	ENSP00000374444:Y3613C;ENSP00000374443:Y3613C	ENSP00000374443:Y3613C	Y	-	2	0	LYST	233907505	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.950000	0.87804	2.168000	0.68352	0.533000	0.62120	TAT		0.338	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
LARP4B	23185	broad.mit.edu	37	10	871158	871158	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr10:871158C>T	ENST00000316157.3	-	12	1371	c.1331G>A	c.(1330-1332)cGa>cAa	p.R444Q		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	444					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)	p.R444Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						ATTAATTAATCGATCTGCAGT	0.458																																																1	Substitution - Missense(1)	ovary(1)	10											149.0	159.0	155.0					10																	871158		2203	4300	6503	861158	SO:0001583	missense	23185			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1331G>A	10.37:g.871158C>T	ENSP00000326128:p.Arg444Gln	Somatic		Capture	Illumina GAIIx	Phase_I	861158	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	ENST00000316157.3	37	CCDS31131.1	.	.	.	.	.	.	.	.	.	.	C	19.39	3.818557	0.71028	.	.	ENSG00000107929	ENST00000316157	T	0.34667	1.35	5.57	4.67	0.58626	.	0.114761	0.64402	D	0.000012	T	0.25975	0.0633	N	0.14661	0.345	0.58432	D	0.999998	D	0.64830	0.994	B	0.43916	0.436	T	0.04961	-1.0915	10	0.44086	T	0.13	-14.6697	14.4915	0.67654	0.0:0.9296:0.0:0.0704	.	444	Q92615	LAR4B_HUMAN	Q	444	ENSP00000326128:R444Q	ENSP00000326128:R444Q	R	-	2	0	LARP4B	861158	1.000000	0.71417	0.977000	0.42913	0.990000	0.78478	4.781000	0.62389	1.379000	0.46325	0.655000	0.94253	CGA		0.458	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155	
HELLS	3070	broad.mit.edu	37	10	96341236	96341236	+	Silent	SNP	T	T	C			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr10:96341236T>C	ENST00000348459.5	+	11	1291	c.1186T>C	c.(1186-1188)Ttg>Ctg	p.L396L	HELLS_ENST00000394045.1_Intron|HELLS_ENST00000371332.4_Silent_p.L396L|HELLS_ENST00000239026.6_3'UTR|RP11-119K6.6_ENST00000432120.1_RNA|HELLS_ENST00000394036.1_3'UTR	NM_018063.3	NP_060533.2			helicase, lymphoid-specific									p.L396L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		ACTTTGGTCATTGCTAAACTT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	10											94.0	89.0	91.0					10																	96341236		2203	4300	6503	96331226	SO:0001819	synonymous_variant	3070			AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.1186T>C	10.37:g.96341236T>C		Somatic		Capture	Illumina GAIIx	Phase_I	96331226		Silent	SNP	ENST00000348459.5	37	CCDS7434.1																																																																																				0.348	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049475.1	NM_018063	
PPFIBP2	8495	broad.mit.edu	37	11	7670885	7670885	+	Splice_Site	SNP	G	G	C			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr11:7670885G>C	ENST00000299492.4	+	21	2509	c.2121G>C	c.(2119-2121)gaG>gaC	p.E707D	PPFIBP2_ENST00000530181.1_Splice_Site_p.E564D|PPFIBP2_ENST00000528883.1_Splice_Site_p.E595D|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000533792.1_Splice_Site_p.E549D	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	707					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)	p.E707D(1)		breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CAGCTGATGAGGTGAGACCAC	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											199.0	208.0	205.0					11																	7670885		2201	4296	6497	7627461	SO:0001630	splice_region_variant	8495			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.2121+1G>C	11.37:g.7670885G>C		Somatic		Capture	Illumina GAIIx	Phase_I	7627461	B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	ENST00000299492.4	37	CCDS31419.1	.	.	.	.	.	.	.	.	.	.	G	33	5.211383	0.95069	.	.	ENSG00000166387	ENST00000299492;ENST00000537211;ENST00000533792;ENST00000541115;ENST00000528883;ENST00000530181	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.3	5.3	0.74995	Sterile alpha motif/pointed domain (2);	0.000000	0.64402	D	0.000001	T	0.63367	0.2505	L	0.38838	1.175	0.80722	D	1	D;B;D;P;P;D	0.64830	0.99;0.027;0.994;0.903;0.942;0.99	D;B;D;P;P;D	0.70016	0.947;0.023;0.967;0.851;0.761;0.928	T	0.61802	-0.6988	10	0.44086	T	0.13	-23.2599	16.8132	0.85726	0.0:0.0:1.0:0.0	.	595;595;630;549;564;707	E9PK77;B7Z433;F5GWB0;E9PP16;E9PMU1;Q8ND30	.;.;.;.;.;LIPB2_HUMAN	D	707;48;549;630;595;564	ENSP00000299492:E707D;ENSP00000436498:E549D;ENSP00000435469:E595D;ENSP00000437321:E564D	ENSP00000299492:E707D	E	+	3	2	PPFIBP2	7627461	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	9.813000	0.99286	2.629000	0.89072	0.563000	0.77884	GAG		0.498	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621	Missense_Mutation
OR5F1	338674	broad.mit.edu	37	11	55761891	55761891	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr11:55761891C>G	ENST00000278409.1	-	1	210	c.211G>C	c.(211-213)Gtt>Ctt	p.V71L		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	71					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V71L(1)		endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					GAGTTACAAACGTCCACAAAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	11											62.0	58.0	59.0					11																	55761891		2201	4296	6497	55518467	SO:0001583	missense	338674			AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.211G>C	11.37:g.55761891C>G	ENSP00000278409:p.Val71Leu	Somatic		Capture	Illumina GAIIx	Phase_I	55518467	Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.668372	0.00105	.	.	ENSG00000149133	ENST00000278409	T	0.77750	-1.12	3.02	-0.899	0.10547	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.42988	0.1227	N	0.02368	-0.58	0.09310	N	1	B	0.25105	0.118	B	0.22152	0.038	T	0.43245	-0.9403	9	0.02654	T	1	.	4.543	0.12067	0.0:0.414:0.1687:0.4172	.	71	O95221	OR5F1_HUMAN	L	71	ENSP00000278409:V71L	ENSP00000278409:V71L	V	-	1	0	OR5F1	55518467	0.000000	0.05858	0.301000	0.25044	0.204000	0.24138	-2.119000	0.01324	-0.001000	0.14495	-0.734000	0.03567	GTT		0.438	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697	
ANO2	57101	broad.mit.edu	37	12	5708776	5708776	+	Nonsense_Mutation	SNP	G	G	A	rs368566641		TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr12:5708776G>A	ENST00000356134.5	-	22	2181	c.2110C>T	c.(2110-2112)Cga>Tga	p.R704*	ANO2_ENST00000327087.8_Nonsense_Mutation_p.R703*|ANO2_ENST00000546188.1_Nonsense_Mutation_p.R704*	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	708					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.R704*(1)		central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						TTCAGCTTTCGAAATAGTTTC	0.428																																																1	Substitution - Nonsense(1)	ovary(1)	12						G	stop/ARG	0,4014		0,0,2007	104.0	99.0	101.0		2107	5.9	1.0	12		101	1,8357		0,1,4178	no	stop-gained	ANO2	NM_020373.2		0,1,6185	AA,AG,GG		0.012,0.0,0.0081		703/999	5708776	1,12371	2007	4179	6186	5579037	SO:0001587	stop_gained	57101			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2110C>T	12.37:g.5708776G>A	ENSP00000348453:p.Arg704*	Somatic		Capture	Illumina GAIIx	Phase_I	5579037	C4N787|Q9H847	Nonsense_Mutation	SNP	ENST00000356134.5	37		.	.	.	.	.	.	.	.	.	.	G	40	8.262735	0.98732	0.0	1.2E-4	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	.	.	.	5.9	5.9	0.94986	.	0.067886	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6796	0.56914	0.0:0.0:0.8353:0.1647	.	.	.	.	X	703;704;704;708	.	ENSP00000314048:R703X	R	-	1	2	ANO2	5579037	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.158000	0.42329	2.793000	0.96121	0.563000	0.77884	CGA		0.428	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373	
ATF1	466	broad.mit.edu	37	12	51213428	51213428	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr12:51213428C>G	ENST00000262053.3	+	7	704	c.682C>G	c.(682-684)Cga>Gga	p.R228G	ATF1_ENST00000539132.1_Missense_Mutation_p.R93G	NM_005171.4	NP_005162.1	P18846	ATF1_HUMAN	activating transcription factor 1	228	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular protein complex assembly (GO:0043623)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to cobalt ion (GO:0032025)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R228G(1)	EWSR1/ATF1(347)|FUS/ATF1(4)	breast(1)|large_intestine(1)|ovary(2)	4					Pseudoephedrine(DB00852)	AGAAGCTGCTCGAGAATGTCG	0.328			T	"""EWSR1, FUS"""	"""malignant melanoma of soft parts , angiomatoid fibrous histiocytoma """																																		Dom	yes		12	12q13	466	activating transcription factor 1		"""E, M"""	1	Substitution - Missense(1)	ovary(1)	12											43.0	47.0	46.0					12																	51213428		2203	4297	6500	49499695	SO:0001583	missense	466			BC029619	CCDS8803.1	12q13	2014-05-13			ENSG00000123268	ENSG00000123268		"""basic leucine zipper proteins"""	783	protein-coding gene	gene with protein product		123803				8401579	Standard	NM_005171		Approved	TREB36	uc001rww.4	P18846		ENST00000262053.3:c.682C>G	12.37:g.51213428C>G	ENSP00000262053:p.Arg228Gly	Somatic		Capture	Illumina GAIIx	Phase_I	49499695	B4DRF9|P25168|Q9H4A8	Missense_Mutation	SNP	ENST00000262053.3	37	CCDS8803.1	.	.	.	.	.	.	.	.	.	.	C	16.40	3.112516	0.56398	.	.	ENSG00000123268	ENST00000262053;ENST00000539132	T;T	0.61392	0.11;0.11	5.24	4.33	0.51752	Basic-leucine zipper (bZIP) transcription factor (3);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	T	0.82042	0.4951	H	0.95679	3.705	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.86975	0.2100	10	0.87932	D	0	0.9326	13.1532	0.59500	0.2904:0.7096:0.0:0.0	.	228	P18846	ATF1_HUMAN	G	228;93	ENSP00000262053:R228G;ENSP00000438403:R93G	ENSP00000262053:R228G	R	+	1	2	ATF1	49499695	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.900000	0.48687	1.305000	0.44909	0.643000	0.83706	CGA		0.328	ATF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404285.1	NM_005171	
KRT78	196374	broad.mit.edu	37	12	53242380	53242380	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr12:53242380G>A	ENST00000304620.4	-	1	398	c.335C>T	c.(334-336)aCc>aTc	p.T112I	KRT78_ENST00000359499.4_5'Flank	NM_173352.2	NP_775487.2	Q8N1N4	K2C78_HUMAN	keratin 78	112	Coil 1A.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.T112I(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18						GATCTCCTGGGTCTCCTGCGT	0.567																																																1	Substitution - Missense(1)	ovary(1)	12											108.0	91.0	97.0					12																	53242380		2203	4300	6503	51528647	SO:0001583	missense	196374			AK096419	CCDS8840.1, CCDS73473.1	12q13.13	2013-06-25			ENSG00000170423	ENSG00000170423		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28926	protein-coding gene	gene with protein product		611159				16831889	Standard	XM_005268695		Approved	K5B	uc001sbc.1	Q8N1N4	OTTHUMG00000169880	ENST00000304620.4:c.335C>T	12.37:g.53242380G>A	ENSP00000306261:p.Thr112Ile	Somatic		Capture	Illumina GAIIx	Phase_I	51528647	A8K4D6|Q5HYM7|Q7RTT2	Missense_Mutation	SNP	ENST00000304620.4	37	CCDS8840.1	.	.	.	.	.	.	.	.	.	.	G	19.59	3.856381	0.71834	.	.	ENSG00000170423	ENST00000304620	D	0.88741	-2.42	5.18	4.22	0.49857	Filament (1);	.	.	.	.	D	0.91994	0.7464	M	0.63428	1.95	0.30469	N	0.773525	D	0.76494	0.999	D	0.68483	0.958	D	0.87891	0.2684	9	0.87932	D	0	.	8.5513	0.33453	0.0:0.2627:0.5868:0.1505	.	112	Q8N1N4	K2C78_HUMAN	I	112	ENSP00000306261:T112I	ENSP00000306261:T112I	T	-	2	0	KRT78	51528647	0.997000	0.39634	0.994000	0.49952	0.985000	0.73830	1.405000	0.34635	2.575000	0.86900	0.491000	0.48974	ACC		0.567	KRT78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406380.1	NM_173352	
ALX1	8092	broad.mit.edu	37	12	85680720	85680720	+	Nonsense_Mutation	SNP	T	T	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr12:85680720T>A	ENST00000316824.3	+	3	776	c.621T>A	c.(619-621)taT>taA	p.Y207*		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	207					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.Y207*(1)		breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		CTGCCACCTATGATATATCAG	0.368																																																1	Substitution - Nonsense(1)	ovary(1)	12											122.0	111.0	115.0					12																	85680720		2203	4300	6503	84204851	SO:0001587	stop_gained	8092			U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.621T>A	12.37:g.85680720T>A	ENSP00000315417:p.Tyr207*	Somatic		Capture	Illumina GAIIx	Phase_I	84204851	Q546C8|Q96FH4	Nonsense_Mutation	SNP	ENST00000316824.3	37	CCDS9028.1	.	.	.	.	.	.	.	.	.	.	t	37	6.161046	0.97338	.	.	ENSG00000180318	ENST00000316824	.	.	.	5.78	2.21	0.28008	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4906	0.33098	0.0:0.2768:0.0:0.7232	.	.	.	.	X	207	.	ENSP00000315417:Y207X	Y	+	3	2	ALX1	84204851	0.994000	0.37717	0.999000	0.59377	0.992000	0.81027	0.331000	0.19733	0.139000	0.18822	-0.266000	0.10368	TAT		0.368	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	NM_006982	
MYBPC1	4604	broad.mit.edu	37	12	102043146	102043146	+	Silent	SNP	T	T	C			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr12:102043146T>C	ENST00000550270.1	+	13	1230	c.1230T>C	c.(1228-1230)gcT>gcC	p.A410A	MYBPC1_ENST00000545503.2_Silent_p.A410A|MYBPC1_ENST00000360610.2_Silent_p.A410A|MYBPC1_ENST00000361685.2_Silent_p.A435A|MYBPC1_ENST00000536007.1_Silent_p.A391A|MYBPC1_ENST00000547405.1_Silent_p.A384A|MYBPC1_ENST00000361466.2_Silent_p.A435A|MYBPC1_ENST00000553190.1_Silent_p.A410A|MYBPC1_ENST00000392934.3_Silent_p.A397A|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000547509.1_Silent_p.A396A|MYBPC1_ENST00000452455.2_Silent_p.A410A|MYBPC1_ENST00000550501.1_Intron|RP11-755O11.2_ENST00000552081.1_RNA|MYBPC1_ENST00000549145.1_Silent_p.A423A|MYBPC1_ENST00000551300.1_Silent_p.A311A|MYBPC1_ENST00000441232.1_Silent_p.A410A|MYBPC1_ENST00000541119.1_Silent_p.A398A			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	410	Ig-like C2-type 3.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.A435A(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						AGGCTGATGCTGCAGAATATT	0.393																																																1	Substitution - coding silent(1)	ovary(1)	12											191.0	174.0	180.0					12																	102043146		2203	4300	6503	100567277	SO:0001819	synonymous_variant	4604				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.1230T>C	12.37:g.102043146T>C		Somatic		Capture	Illumina GAIIx	Phase_I	100567277	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Silent	SNP	ENST00000550270.1	37	CCDS9085.1																																																																																				0.393	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1		
CATSPERB	79820	broad.mit.edu	37	14	92102892	92102892	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr14:92102892G>C	ENST00000256343.3	-	17	1775	c.1619C>G	c.(1618-1620)gCc>gGc	p.A540G		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	540					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)		p.A540G(1)		NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				GTGCTGTGGGGCAAGCGCAGT	0.383																																																1	Substitution - Missense(1)	ovary(1)	14											101.0	93.0	96.0					14																	92102892		2203	4300	6503	91172645	SO:0001583	missense	79820			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.1619C>G	14.37:g.92102892G>C	ENSP00000256343:p.Ala540Gly	Somatic		Capture	Illumina GAIIx	Phase_I	91172645	A0AV51	Missense_Mutation	SNP	ENST00000256343.3	37	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.379271	0.42207	.	.	ENSG00000133962	ENST00000256343	T	0.54071	0.59	4.63	3.72	0.42706	.	0.116455	0.38548	N	0.001645	T	0.63815	0.2543	L	0.61218	1.895	0.24151	N	0.995697	D	0.89917	1.0	D	0.70935	0.971	T	0.53049	-0.8493	10	0.44086	T	0.13	-19.0323	7.7057	0.28648	0.1162:0.0:0.8838:0.0	.	540	Q9H7T0	CTSRB_HUMAN	G	540	ENSP00000256343:A540G	ENSP00000256343:A540G	A	-	2	0	CATSPERB	91172645	0.930000	0.31532	0.243000	0.24186	0.332000	0.28634	2.620000	0.46410	1.150000	0.42419	0.491000	0.48974	GCC		0.383	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764	
SCAPER	49855	broad.mit.edu	37	15	77096971	77096971	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr15:77096971C>T	ENST00000563290.1	-	6	492	c.397G>A	c.(397-399)Gtg>Atg	p.V133M	SCAPER_ENST00000324767.7_Missense_Mutation_p.V133M|SCAPER_ENST00000538941.2_De_novo_Start_InFrame			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	133						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.V133M(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						ATCATTAGCACCTCCTAAAAG	0.318																																																1	Substitution - Missense(1)	ovary(1)	15											77.0	67.0	70.0					15																	77096971		1815	4063	5878	74884026	SO:0001583	missense	49855			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.397G>A	15.37:g.77096971C>T	ENSP00000454973:p.Val133Met	Somatic		Capture	Illumina GAIIx	Phase_I	74884026	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.482083	0.84747	.	.	ENSG00000140386	ENST00000324767;ENST00000303521	T	0.28666	1.6	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.53110	0.1776	L	0.58428	1.81	0.58432	D	0.999999	D;D	0.60160	0.974;0.987	P;D	0.65684	0.876;0.937	T	0.53767	-0.8392	10	0.72032	D	0.01	.	19.2746	0.94026	0.0:1.0:0.0:0.0	.	133;148	Q6NSF1;Q9BY12-2	.;.	M	133;149	ENSP00000326924:V133M	ENSP00000303560:V149M	V	-	1	0	SCAPER	74884026	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.415000	0.80131	2.541000	0.85698	0.650000	0.86243	GTG		0.318	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
FAM65A	79567	broad.mit.edu	37	16	67575618	67575618	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr16:67575618C>G	ENST00000379312.3	+	12	1146	c.1025C>G	c.(1024-1026)aCc>aGc	p.T342S	FAM65A_ENST00000540839.3_Missense_Mutation_p.T358S|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.T338S|FAM65A_ENST00000422602.2_Missense_Mutation_p.T358S|CTD-2012K14.2_ENST00000567122.1_RNA|FAM65A_ENST00000428437.2_Missense_Mutation_p.T352S|CTD-2012K14.3_ENST00000563083.1_RNA	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	342						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.T338S(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		TCCACAGTCACCAAGCGCTTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	16											107.0	103.0	104.0					16																	67575618		2198	4300	6498	66133119	SO:0001583	missense	79567			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.1025C>G	16.37:g.67575618C>G	ENSP00000368614:p.Thr342Ser	Somatic		Capture	Illumina GAIIx	Phase_I	66133119	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.93|10.93	1.490681|1.490681	0.26686|0.26686	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000428437|ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	.|T;T;T	.|0.01685	.|4.69;4.69;4.69	4.8|4.8	3.82|3.82	0.43975|0.43975	.|.	.|0.217050	.|0.50627	.|D	.|0.000112	T|T	0.00496|0.00496	0.0016|0.0016	N|N	0.00260|0.00260	-1.75|-1.75	0.27504|0.27504	N|N	0.951901|0.951901	.|B;B;B;B	.|0.23128	.|0.01;0.01;0.01;0.08	.|B;B;B;B	.|0.18871	.|0.004;0.007;0.004;0.023	T|T	0.46205|0.46205	-0.9208|-0.9208	5|10	.|0.06494	.|T	.|0.89	-20.8064|-20.8064	6.3094|6.3094	0.21156|0.21156	0.3355:0.466:0.1985:0.0|0.3355:0.466:0.1985:0.0	.|.	.|352;358;342;358	.|B4DIM2;E9PBS3;Q6ZS17;B4DEQ9	.|.;.;FA65A_HUMAN;.	Q|S	332|342;338;358;352	.|ENSP00000368614:T342S;ENSP00000042381:T338S;ENSP00000400099:T358S	.|ENSP00000042381:T338S	H|T	+|+	3|2	2|0	FAM65A|FAM65A	66133119|66133119	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.948000|0.948000	0.59901|0.59901	1.731000|1.731000	0.38135|0.38135	2.212000|2.212000	0.71576|0.71576	0.561000|0.561000	0.74099|0.74099	CAC|ACC		0.592	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519	
TP53	7157	broad.mit.edu	37	17	7576852	7576852	+	Splice_Site	SNP	C	C	T	rs11575997		TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr17:7576852C>T	ENST00000269305.4	-	9	1183		c.e9+1		TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(24)|p.0?(8)|p.I332fs*49(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGACTTAGTACCTGAAGGGTG	0.458		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	33	Unknown(24)|Whole gene deletion(8)|Insertion - Frameshift(1)	ovary(8)|lung(4)|breast(4)|bone(4)|stomach(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|NS(2)|pancreas(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|skin(1)	17	GRCh37	CD002536	TP53	D	rs11575997						115.0	108.0	111.0					17																	7576852		2203	4300	6503	7517577	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.993+1G>A	17.37:g.7576852C>T		Somatic		Capture	Illumina GAIIx	Phase_I	7517577	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361474	0.41801	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000419024	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6932	0.56988	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517577	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	2.315000	0.43752	2.462000	0.83206	0.561000	0.74099	.		0.458	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron
ENOSF1	55556	broad.mit.edu	37	18	688606	688606	+	Silent	SNP	G	G	C			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr18:688606G>C	ENST00000251101.7	-	9	709	c.621C>G	c.(619-621)ctC>ctG	p.L207L	ENOSF1_ENST00000340116.7_Silent_p.L228L|ENOSF1_ENST00000580982.1_Silent_p.L131L|ENOSF1_ENST00000319815.6_5'Flank|ENOSF1_ENST00000583973.1_5'Flank|ENOSF1_ENST00000383578.3_Silent_p.L125L	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1	207					cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)	p.L207L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						CCTGGGCACAGAGCTGTGGGA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	18											99.0	78.0	85.0					18																	688606		2203	4300	6503	678606	SO:0001819	synonymous_variant	55556			X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.621C>G	18.37:g.688606G>C		Somatic		Capture	Illumina GAIIx	Phase_I	678606	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Silent	SNP	ENST00000251101.7	37	CCDS11822.1																																																																																				0.547	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254312.2	NM_017512	
ZNF257	113835	broad.mit.edu	37	19	22271223	22271223	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr19:22271223C>T	ENST00000594947.1	+	4	815	c.671C>T	c.(670-672)aCt>aTt	p.T224I		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.T224I(1)		haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATGACTCATACTGGAGAGAAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	19											38.0	42.0	41.0					19																	22271223		2174	4286	6460	22063063	SO:0001583	missense	113835			AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.671C>T	19.37:g.22271223C>T	ENSP00000470209:p.Thr224Ile	Somatic		Capture	Illumina GAIIx	Phase_I	22063063	B3KPS4|E9PG34|Q8NE34	Missense_Mutation	SNP	ENST00000594947.1	37	CCDS46030.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.529028	0.44969	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	1.11	-1.34	0.09143	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36799	0.0980	M	0.70842	2.15	0.29830	N	0.830079	P	0.42871	0.792	B	0.38428	0.273	T	0.33420	-0.9869	8	0.41790	T	0.15	.	7.5524	0.27804	0.0:0.7306:0.2694:0.0	.	224	Q9Y2Q1	ZN257_HUMAN	I	224;196	.	ENSP00000380312:T196I	T	+	2	0	ZNF257	22063063	0.028000	0.19301	0.053000	0.19242	0.709000	0.40893	1.613000	0.36900	-0.455000	0.07054	0.313000	0.20887	ACT		0.393	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1		
HKR1	284459	broad.mit.edu	37	19	37835589	37835589	+	Start_Codon_SNP	SNP	G	G	T			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr19:37835589G>T	ENST00000324411.4	+	3	272	c.3G>T	c.(1-3)atG>atT	p.M1I	HKR1_ENST00000541583.2_5'Flank|HKR1_ENST00000591259.1_Intron|HKR1_ENST00000592168.1_Intron|HKR1_ENST00000544914.1_Intron|HKR1_ENST00000392153.3_Intron|HKR1_ENST00000591471.1_Intron|HKR1_ENST00000586897.1_5'Flank|HKR1_ENST00000591134.1_5'Flank|HKR1_ENST00000591417.1_Intron|HKR1_ENST00000589392.1_Intron	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	1					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M1I(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGTGAATCATGAGGGTCAACC	0.428																																																1	Substitution - Missense(1)	ovary(1)	19											159.0	143.0	148.0					19																	37835589		2203	4300	6503	42527429	SO:0001582	initiator_codon_variant	284459			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.3G>T	19.37:g.37835589G>T	ENSP00000315505:p.Met1Ile	Somatic		Capture	Illumina GAIIx	Phase_I	42527429	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	G	8.775	0.926893	0.18056	.	.	ENSG00000181666	ENST00000324411	T	0.04862	3.54	1.09	1.09	0.20402	.	.	.	.	.	T	0.05044	0.0135	.	.	.	0.09310	N	0.999994	B	0.06786	0.001	B	0.04013	0.001	T	0.35549	-0.9784	8	0.87932	D	0	.	5.5467	0.17067	0.0:0.0:1.0:0.0	.	1	P10072	HKR1_HUMAN	I	1	ENSP00000315505:M1I	ENSP00000315505:M1I	M	+	3	0	HKR1	42527429	0.000000	0.05858	0.046000	0.18839	0.043000	0.13939	-0.120000	0.10660	0.890000	0.36211	0.491000	0.48974	ATG		0.428	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786	Missense_Mutation
KCNK6	9424	broad.mit.edu	37	19	38817898	38817898	+	Missense_Mutation	SNP	C	C	T	rs555738978		TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr19:38817898C>T	ENST00000263372.3	+	3	904	c.797C>T	c.(796-798)aCg>aTg	p.T266M		NM_004823.1	NP_004814.1	Q9Y257	KCNK6_HUMAN	potassium channel, subfamily K, member 6	266					negative regulation of systemic arterial blood pressure (GO:0003085)|potassium ion transport (GO:0006813)|regulation of resting membrane potential (GO:0060075)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)	p.T266M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)	17	all_cancers(60;5.83e-07)		Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		Ibutilide(DB00308)|Quinidine(DB00908)	CACGGCCTCACGGAGCTCATC	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		18376	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19											71.0	59.0	63.0					19																	38817898		2203	4300	6503	43509738	SO:0001583	missense	9424			AF117708	CCDS12513.1	19q13.1	2012-03-07				ENSG00000099337		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6281	protein-coding gene	gene with protein product		603939				10075682, 10393428, 16382106	Standard	NM_004823		Approved	K2p6.1, TWIK-2	uc002oic.3	Q9Y257		ENST00000263372.3:c.797C>T	19.37:g.38817898C>T	ENSP00000263372:p.Thr266Met	Somatic		Capture	Illumina GAIIx	Phase_I	43509738	Q9HB47	Missense_Mutation	SNP	ENST00000263372.3	37	CCDS12513.1	.	.	.	.	.	.	.	.	.	.	C	17.97	3.517649	0.64634	.	.	ENSG00000099337	ENST00000263372	T	0.23950	1.88	5.36	5.36	0.76844	.	0.214951	0.47093	D	0.000260	T	0.32224	0.0822	M	0.72118	2.19	0.51767	D	0.999932	P	0.52692	0.955	B	0.41988	0.372	T	0.15752	-1.0426	10	0.41790	T	0.15	.	16.5833	0.84720	0.0:1.0:0.0:0.0	.	266	Q9Y257	KCNK6_HUMAN	M	266	ENSP00000263372:T266M	ENSP00000263372:T266M	T	+	2	0	KCNK6	43509738	0.987000	0.35691	0.951000	0.38953	0.875000	0.50365	2.841000	0.48223	2.529000	0.85273	0.561000	0.74099	ACG		0.657	KCNK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460524.1	NM_004823	
KIR3DL2	3812	broad.mit.edu	37	19	55377869	55377869	+	Missense_Mutation	SNP	A	A	G	rs150305828		TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr19:55377869A>G	ENST00000326321.3	+	8	1183	c.1150A>G	c.(1150-1152)Aat>Gat	p.N384D	KIR3DL1_ENST00000402254.2_Missense_Mutation_p.N384D|RNU6-222P_ENST00000362438.1_RNA|KIR3DL2_ENST00000270442.5_Missense_Mutation_p.N367D	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	384					cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.N384D(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		CAGAACAGTGAATAGGCAGGT	0.537																																																1	Substitution - Missense(1)	ovary(1)	19											137.0	140.0	139.0					19																	55377869		2203	4300	6503	60069681	SO:0001583	missense	3812			L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.1150A>G	19.37:g.55377869A>G	ENSP00000325525:p.Asn384Asp	Somatic		Capture	Illumina GAIIx	Phase_I	60069681	Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	ENST00000326321.3	37	CCDS12906.1	.	.	.	.	.	.	.	.	.	.	A	6.701	0.497962	0.12762	.	.	ENSG00000167633;ENSG00000240403;ENSG00000240403	ENST00000402254;ENST00000326321;ENST00000270442	T;T;T	0.00481	7.24;7.21;7.11	1.05	-0.0311	0.13911	.	.	.	.	.	T	0.00695	0.0023	L	0.51422	1.61	0.09310	N	1	P;P;D	0.69078	0.588;0.547;0.997	B;B;D	0.64237	0.146;0.155;0.923	T	0.53913	-0.8371	9	0.87932	D	0	.	2.9856	0.05966	0.7032:0.0:0.2968:0.0	.	367;384;384	Q95366;P43630;F6QF33	.;KI3L2_HUMAN;.	D	384;384;367	ENSP00000384528:N384D;ENSP00000325525:N384D;ENSP00000270442:N367D	ENSP00000384528:N384D	N	+	1	0	KIR3DL1;KIR3DL2	60069681	0.031000	0.19500	0.000000	0.03702	0.005000	0.04900	0.863000	0.27913	-0.043000	0.13513	0.324000	0.21423	AAT		0.537	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141241.1		
APOB	338	broad.mit.edu	37	2	21235485	21235485	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr2:21235485T>C	ENST00000233242.1	-	26	4382	c.4255A>G	c.(4255-4257)Aca>Gca	p.T1419A		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1419					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.T1419A(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TATGATAGTGTGAACGTATTC	0.343																																																1	Substitution - Missense(1)	ovary(1)	2											75.0	79.0	78.0					2																	21235485		2199	4300	6499	21088990	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4255A>G	2.37:g.21235485T>C	ENSP00000233242:p.Thr1419Ala	Somatic		Capture	Illumina GAIIx	Phase_I	21088990	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	10.74	1.434964	0.25813	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00737	5.76	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000004	T	0.02807	0.0084	M	0.70595	2.14	0.80722	D	1	D	0.60575	0.988	P	0.54759	0.76	T	0.54781	-0.8242	10	0.54805	T	0.06	.	14.398	0.67025	0.0:0.0:0.0:1.0	.	1419	P04114	APOB_HUMAN	A	1419	ENSP00000233242:T1419A	ENSP00000233242:T1419A	T	-	1	0	APOB	21088990	0.949000	0.32298	0.521000	0.27850	0.075000	0.17131	2.141000	0.42168	2.129000	0.65627	0.533000	0.62120	ACA		0.343	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
HADHA	3030	broad.mit.edu	37	2	26424110	26424110	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr2:26424110C>G	ENST00000380649.3	-	13	1429	c.1300G>C	c.(1300-1302)Gat>Cat	p.D434H		NM_000182.4	NP_000173.2	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit	434					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)	p.D434H(1)		autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(4)|skin(1)	30	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTTGGTAATCAAGCTGCCCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											99.0	91.0	94.0					2																	26424110		2203	4300	6503	26277614	SO:0001583	missense	3030			D16480	CCDS1721.1	2p23	2014-09-17	2010-04-30		ENSG00000084754	ENSG00000084754	1.1.1.211, 4.2.1.17		4801	protein-coding gene	gene with protein product	"""gastrin-binding protein"", ""long-chain-3-hydroxyacyl-CoA dehydrogenase"", ""long-chain 2-enoyl-CoA hydratase"", ""mitochondrial trifunctional protein, alpha subunit"""	600890	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit"""			9605857, 7918661	Standard	NM_000182		Approved	GBP, LCEH, LCHAD, MTPA	uc002rgy.3	P40939	OTTHUMG00000096979	ENST00000380649.3:c.1300G>C	2.37:g.26424110C>G	ENSP00000370023:p.Asp434His	Somatic		Capture	Illumina GAIIx	Phase_I	26277614	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	ENST00000380649.3	37	CCDS1721.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102746	0.76983	.	.	ENSG00000084754	ENST00000380649	T	0.80393	-1.37	5.43	4.56	0.56223	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.042848	0.85682	D	0.000000	D	0.88489	0.6450	M	0.77486	2.375	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.69479	0.964;0.964	D	0.89621	0.3848	10	0.87932	D	0	.	12.9488	0.58388	0.0:0.9214:0.0:0.0786	.	434;434	E9KL44;P40939	.;ECHA_HUMAN	H	434	ENSP00000370023:D434H	ENSP00000370023:D434H	D	-	1	0	HADHA	26277614	1.000000	0.71417	0.847000	0.33407	0.963000	0.63663	6.031000	0.70911	1.305000	0.44909	-0.140000	0.14226	GAT		0.408	HADHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214051.1	NM_000182	
SLC5A6	8884	broad.mit.edu	37	2	27423930	27423930	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr2:27423930G>A	ENST00000310574.3	-	16	2173	c.1700C>T	c.(1699-1701)cCa>cTa	p.P567L	SLC5A6_ENST00000461319.1_5'Flank|SLC5A6_ENST00000408041.1_Missense_Mutation_p.P567L	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	567					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.P567L(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	CAGGAGCTTTGGCAACACTGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	2											116.0	111.0	112.0					2																	27423930		2203	4300	6503	27277434	SO:0001583	missense	8884			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.1700C>T	2.37:g.27423930G>A	ENSP00000310208:p.Pro567Leu	Somatic		Capture	Illumina GAIIx	Phase_I	27277434	B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	ENST00000310574.3	37	CCDS1740.1	.	.	.	.	.	.	.	.	.	.	G	10.69	1.422221	0.25639	.	.	ENSG00000138074	ENST00000310574;ENST00000408041	D;D	0.85088	-1.94;-1.94	5.73	5.73	0.89815	.	0.381500	0.29307	N	0.012521	D	0.82287	0.5004	L	0.54323	1.7	0.40652	D	0.982042	B	0.16603	0.018	B	0.15484	0.013	T	0.77199	-0.2675	10	0.32370	T	0.25	.	15.4002	0.74834	0.0:0.0:1.0:0.0	.	567	Q9Y289	SC5A6_HUMAN	L	567	ENSP00000310208:P567L;ENSP00000384853:P567L	ENSP00000310208:P567L	P	-	2	0	SLC5A6	27277434	0.467000	0.25831	0.170000	0.22879	0.002000	0.02628	2.924000	0.48876	2.698000	0.92095	0.650000	0.86243	CCA		0.582	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214194.1	NM_021095	
LRP2	4036	broad.mit.edu	37	2	170068633	170068633	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr2:170068633G>C	ENST00000263816.3	-	37	6410	c.6125C>G	c.(6124-6126)tCc>tGc	p.S2042C		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2042	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.S2042C(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACAGGCGCAGGAAAACAATCC	0.448																																																1	Substitution - Missense(1)	ovary(1)	2											106.0	115.0	112.0					2																	170068633		2203	4300	6503	169776879	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.6125C>G	2.37:g.170068633G>C	ENSP00000263816:p.Ser2042Cys	Somatic		Capture	Illumina GAIIx	Phase_I	169776879	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707157	0.68615	.	.	ENSG00000081479	ENST00000263816	D	0.96651	-4.08	5.88	5.88	0.94601	Epidermal growth factor-like (1);	0.103397	0.64402	D	0.000002	D	0.98454	0.9485	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	P	0.62491	0.903	D	0.98139	1.0435	10	0.42905	T	0.14	.	20.2187	0.98312	0.0:0.0:1.0:0.0	.	2042	P98164	LRP2_HUMAN	C	2042	ENSP00000263816:S2042C	ENSP00000263816:S2042C	S	-	2	0	LRP2	169776879	1.000000	0.71417	0.996000	0.52242	0.561000	0.35649	6.074000	0.71253	2.780000	0.95670	0.655000	0.94253	TCC		0.448	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
FBLN2	2199	broad.mit.edu	37	3	13613028	13613028	+	Silent	SNP	A	A	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr3:13613028A>G	ENST00000295760.7	+	2	1242	c.1173A>G	c.(1171-1173)acA>acG	p.T391T	FBLN2_ENST00000404922.3_Silent_p.T391T|FBLN2_ENST00000492059.1_Silent_p.T391T|FBLN2_ENST00000535798.1_Silent_p.T417T	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	391	N.|Subdomain NB (Cys-free).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)	p.T391T(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			TCCTGTCCACATCACTGCCTG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	3											33.0	44.0	40.0					3																	13613028		2130	4221	6351	13588029	SO:0001819	synonymous_variant	2199			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.1173A>G	3.37:g.13613028A>G		Somatic		Capture	Illumina GAIIx	Phase_I	13588029	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	37	CCDS46762.1																																																																																				0.637	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
ZBTB20	26137	broad.mit.edu	37	3	114070129	114070129	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr3:114070129C>T	ENST00000474710.1	-	4	974	c.796G>A	c.(796-798)Gtg>Atg	p.V266M	ZBTB20_ENST00000393785.2_Missense_Mutation_p.V193M|ZBTB20_ENST00000462705.1_Missense_Mutation_p.V193M|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20_ENST00000481632.1_Missense_Mutation_p.V193M|ZBTB20_ENST00000464560.1_Missense_Mutation_p.V193M|ZBTB20_ENST00000357258.3_Missense_Mutation_p.V193M|ZBTB20_ENST00000471418.1_Missense_Mutation_p.V193M|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20-AS1_ENST00000496219.1_RNA	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	266				V -> M (in Ref. 1; AAG28340). {ECO:0000305}.		nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.V193M(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		TGGCTGACCACTGCGCCGCTG	0.637																																					NSCLC(69;748 1344 9802 11203 30933)											1	Substitution - Missense(1)	ovary(1)	3											47.0	47.0	47.0					3																	114070129		2203	4299	6502	115552819	SO:0001583	missense	26137			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.796G>A	3.37:g.114070129C>T	ENSP00000419153:p.Val266Met	Somatic		Capture	Illumina GAIIx	Phase_I	115552819	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	.	.	.	.	.	.	.	.	.	.	C	4.600	0.111457	0.08831	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.10668	2.88;2.88;2.88;2.88;2.85;2.88;2.88	5.52	5.52	0.82312	.	0.279795	0.37304	N	0.002156	T	0.08891	0.0220	N	0.19112	0.55	0.42943	D	0.99435	B	0.15930	0.015	B	0.09377	0.004	T	0.14727	-1.0462	10	0.49607	T	0.09	.	15.1528	0.72713	0.0:0.8595:0.1405:0.0	.	266	Q9HC78	ZBT20_HUMAN	M	193;193;193;193;266;193;193	ENSP00000420324:V193M;ENSP00000377375:V193M;ENSP00000418092:V193M;ENSP00000419902:V193M;ENSP00000419153:V266M;ENSP00000349803:V193M;ENSP00000417307:V193M	ENSP00000349803:V193M	V	-	1	0	ZBTB20	115552819	0.932000	0.31603	0.972000	0.41901	0.974000	0.67602	1.717000	0.37991	2.878000	0.98634	0.650000	0.86243	GTG		0.637	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642	
OSBPL11	114885	broad.mit.edu	37	3	125298793	125298793	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr3:125298793C>A	ENST00000296220.5	-	3	614	c.325G>T	c.(325-327)Gca>Tca	p.A109S		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	109	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)	p.A109S(1)		NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						ACAGCTCCTGCAAGCTGCAAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	3											120.0	123.0	122.0					3																	125298793		2203	4300	6503	126781483	SO:0001583	missense	114885			AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.325G>T	3.37:g.125298793C>A	ENSP00000296220:p.Ala109Ser	Somatic		Capture	Illumina GAIIx	Phase_I	126781483	A8K9I7	Missense_Mutation	SNP	ENST00000296220.5	37	CCDS3033.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580725	0.65992	.	.	ENSG00000144909	ENST00000296220	T	0.73789	-0.78	5.07	5.07	0.68467	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.113736	0.64402	D	0.000016	T	0.76528	0.4000	N	0.25789	0.76	0.80722	D	1	P	0.40230	0.708	P	0.59288	0.855	T	0.67995	-0.5526	10	0.09843	T	0.71	.	18.6341	0.91371	0.0:1.0:0.0:0.0	.	109	Q9BXB4	OSB11_HUMAN	S	109	ENSP00000296220:A109S	ENSP00000296220:A109S	A	-	1	0	OSBPL11	126781483	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.597000	0.82733	2.628000	0.89032	0.655000	0.94253	GCA		0.408	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
PLXNA1	5361	broad.mit.edu	37	3	126735405	126735405	+	Silent	SNP	C	C	T			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr3:126735405C>T	ENST00000393409.2	+	15	3060	c.3060C>T	c.(3058-3060)agC>agT	p.S1020S	PLXNA1_ENST00000251772.4_Silent_p.S997S	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1020	IPT/TIG 2.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)	p.S997S(1)		breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CCGGGCAGAGCCCTGGCAGCG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	3											91.0	96.0	95.0					3																	126735405		2203	4300	6503	128218095	SO:0001819	synonymous_variant	5361			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.3060C>T	3.37:g.126735405C>T		Somatic		Capture	Illumina GAIIx	Phase_I	128218095		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																				0.637	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
RNF175	285533	broad.mit.edu	37	4	154636783	154636783	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr4:154636783C>T	ENST00000347063.4	-	7	1034	c.662G>A	c.(661-663)aGc>aAc	p.S221N	RNF175_ENST00000274068.4_Missense_Mutation_p.S93N	NM_173662.2	NP_775933	Q8N4F7	RN175_HUMAN	ring finger protein 175	221						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.S221N(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	13	all_hematologic(180;0.093)	Renal(120;0.118)				GTCCGATAAGCTCCTTGTAGG	0.478																																																1	Substitution - Missense(1)	ovary(1)	4											86.0	83.0	84.0					4																	154636783		2038	4205	6243	154856233	SO:0001583	missense	285533			BC034385	CCDS47149.1	4q31.3	2008-02-05			ENSG00000145428	ENSG00000145428		"""RING-type (C3HC4) zinc fingers"""	27735	protein-coding gene	gene with protein product							Standard	NM_173662		Approved	FLJ34190	uc003int.3	Q8N4F7	OTTHUMG00000161557	ENST00000347063.4:c.662G>A	4.37:g.154636783C>T	ENSP00000340979:p.Ser221Asn	Somatic		Capture	Illumina GAIIx	Phase_I	154856233	C9JL66|Q8NB61	Missense_Mutation	SNP	ENST00000347063.4	37	CCDS47149.1	.	.	.	.	.	.	.	.	.	.	C	7.922	0.738816	0.15642	.	.	ENSG00000145428	ENST00000347063;ENST00000274068	T;T	0.19532	2.14;2.14	4.35	3.5	0.40072	Zinc finger, RING/FYVE/PHD-type (1);	0.110678	0.64402	N	0.000019	T	0.07863	0.0197	N	0.02916	-0.46	0.25480	N	0.987749	B;B	0.26081	0.141;0.001	B;B	0.26517	0.07;0.003	T	0.25606	-1.0127	10	0.27785	T	0.31	-10.0123	6.6249	0.22824	0.0:0.7938:0.0:0.2062	.	93;221	Q8NB61;Q8N4F7	.;RN175_HUMAN	N	221;93	ENSP00000340979:S221N;ENSP00000274068:S93N	ENSP00000274068:S93N	S	-	2	0	RNF175	154856233	0.009000	0.17119	0.182000	0.23118	0.408000	0.30992	1.064000	0.30579	1.422000	0.47177	0.591000	0.81541	AGC		0.478	RNF175-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365286.1	NM_173662	
IQGAP2	10788	broad.mit.edu	37	5	75970460	75970460	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr5:75970460C>G	ENST00000274364.6	+	27	3750	c.3453C>G	c.(3451-3453)aaC>aaG	p.N1151K	IQGAP2_ENST00000379730.3_Missense_Mutation_p.N653K|IQGAP2_ENST00000502745.1_Missense_Mutation_p.N647K|IQGAP2_ENST00000396234.3_Missense_Mutation_p.N647K	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1151					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.N1151K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		CAGCCTCCAACAAGCTGTTTG	0.438																																																1	Substitution - Missense(1)	ovary(1)	5											94.0	90.0	91.0					5																	75970460		2203	4300	6503	76006216	SO:0001583	missense	10788			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.3453C>G	5.37:g.75970460C>G	ENSP00000274364:p.Asn1151Lys	Somatic		Capture	Illumina GAIIx	Phase_I	76006216	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417376	0.42918	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000505766;ENST00000396234;ENST00000502745	D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57	5.67	4.81	0.61882	Rho GTPase activation protein (1);Ras GTPase-activating protein (2);	0.042899	0.85682	D	0.000000	T	0.77177	0.4092	L	0.53561	1.675	0.80722	D	1	B;B;B	0.23442	0.053;0.053;0.085	B;B;B	0.17433	0.018;0.018;0.017	T	0.72494	-0.4276	10	0.37606	T	0.19	-29.2834	9.2097	0.37311	0.0:0.7814:0.0:0.2186	.	653;647;1151	F5H7S7;Q13576-2;Q13576	.;.;IQGA2_HUMAN	K	1151;653;1101;647;647	ENSP00000274364:N1151K;ENSP00000442313:N653K;ENSP00000421097:N1101K;ENSP00000379535:N647K;ENSP00000426027:N647K	ENSP00000274364:N1151K	N	+	3	2	IQGAP2	76006216	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.184000	0.42575	1.400000	0.46741	0.591000	0.81541	AAC		0.438	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
PPIP5K2	23262	broad.mit.edu	37	5	102519086	102519086	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr5:102519086G>A	ENST00000358359.3	+	25	3583	c.3074G>A	c.(3073-3075)aGt>aAt	p.S1025N	PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.S1025N|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.S1025N	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	1025					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)	p.S1025N(1)|p.S1025I(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TTCACATCCAGTATTTTTGGC	0.438																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	5											102.0	100.0	101.0					5																	102519086		2203	4300	6503	102546985	SO:0001583	missense	23262			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.3074G>A	5.37:g.102519086G>A	ENSP00000351126:p.Ser1025Asn	Somatic		Capture	Illumina GAIIx	Phase_I	102546985	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	37		.	.	.	.	.	.	.	.	.	.	G	13.61	2.289351	0.40494	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217	T;T;T	0.15017	2.46;2.47;2.46	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	T	0.33644	0.0870	L	0.47716	1.5	0.49798	D	0.999823	D;D	0.57899	0.981;0.967	D;P	0.66351	0.943;0.878	T	0.01371	-1.1372	10	0.14656	T	0.56	-16.7021	19.661	0.95871	0.0:0.0:1.0:0.0	.	1025;1025	O43314-2;O43314	.;VIP2_HUMAN	N	1025;1025;1040;1025	ENSP00000313070:S1025N;ENSP00000351126:S1025N;ENSP00000416016:S1025N	ENSP00000313070:S1025N	S	+	2	0	PPIP5K2	102546985	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.075000	0.71261	2.706000	0.92434	0.591000	0.81541	AGT		0.438	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
SLIT3	6586	broad.mit.edu	37	5	168112727	168112727	+	Missense_Mutation	SNP	C	C	T	rs200822063		TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr5:168112727C>T	ENST00000519560.1	-	31	3939	c.3520G>A	c.(3520-3522)Gcc>Acc	p.A1174T	SLIT3_ENST00000404867.3_Missense_Mutation_p.A1174T|SLIT3_ENST00000332966.8_Missense_Mutation_p.A1181T	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	1174	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.A1174T(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGGACCTTGGCGGAGGCCAGT	0.627													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18331	0.0		0.0	False		,,,				2504	0.0				Ovarian(29;311 847 10864 17279 24903)											1	Substitution - Missense(1)	ovary(1)	5											73.0	78.0	76.0					5																	168112727		2203	4300	6503	168045305	SO:0001583	missense	6586			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.3520G>A	5.37:g.168112727C>T	ENSP00000430333:p.Ala1174Thr	Somatic		Capture	Illumina GAIIx	Phase_I	168045305	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	CCDS4369.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	8.487	0.861180	0.17178	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.68765	-0.35;-0.35;-0.35	4.76	3.87	0.44632	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.200754	0.53938	D	0.000050	T	0.45074	0.1324	N	0.19112	0.55	0.41357	D	0.987401	B	0.15473	0.013	B	0.14023	0.01	T	0.33214	-0.9877	10	0.14656	T	0.56	.	7.8458	0.29424	0.1612:0.7564:0.0:0.0823	.	1174	O75094	SLIT3_HUMAN	T	1174;1181;1174	ENSP00000430333:A1174T;ENSP00000332164:A1181T;ENSP00000384890:A1174T	ENSP00000332164:A1181T	A	-	1	0	SLIT3	168045305	1.000000	0.71417	0.984000	0.44739	0.925000	0.55904	3.095000	0.50235	2.349000	0.79799	0.561000	0.74099	GCC		0.627	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
SLIT3	6586	broad.mit.edu	37	5	168678454	168678454	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr5:168678454G>T	ENST00000519560.1	-	2	626	c.207C>A	c.(205-207)gaC>gaA	p.D69E	SLIT3_ENST00000404867.3_Missense_Mutation_p.D69E|SLIT3_ENST00000521130.1_5'UTR|SLIT3_ENST00000332966.8_Missense_Mutation_p.D69E	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	69					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.D69E(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TATTATTTCTGTCCAGGTCAC	0.433																																					Ovarian(29;311 847 10864 17279 24903)											1	Substitution - Missense(1)	ovary(1)	5											155.0	144.0	148.0					5																	168678454		2203	4300	6503	168611032	SO:0001583	missense	6586			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.207C>A	5.37:g.168678454G>T	ENSP00000430333:p.Asp69Glu	Somatic		Capture	Illumina GAIIx	Phase_I	168611032	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344651	0.41498	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.23754	1.89;1.89;1.89	4.95	4.95	0.65309	.	0.000000	0.64402	D	0.000003	T	0.33527	0.0866	N	0.17901	0.54	0.35953	D	0.834037	D;B	0.61697	0.99;0.086	D;B	0.70935	0.971;0.133	T	0.35500	-0.9786	10	0.35671	T	0.21	.	13.7144	0.62687	0.0:0.0:1.0:0.0	.	69;69	O75094-2;O75094	.;SLIT3_HUMAN	E	69	ENSP00000430333:D69E;ENSP00000332164:D69E;ENSP00000384890:D69E	ENSP00000332164:D69E	D	-	3	2	SLIT3	168611032	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.268000	0.43338	2.298000	0.77334	0.655000	0.94253	GAC		0.433	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
BMP6	654	broad.mit.edu	37	6	7845412	7845412	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr6:7845412A>G	ENST00000283147.6	+	2	863	c.704A>G	c.(703-705)cAc>cGc	p.H235R		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	235					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)	p.H235R(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					CAGCGACACCACAAAGAGTTC	0.458																																																1	Substitution - Missense(1)	ovary(1)	6											134.0	132.0	133.0					6																	7845412		2203	4300	6503	7790411	SO:0001583	missense	654			AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.704A>G	6.37:g.7845412A>G	ENSP00000283147:p.His235Arg	Somatic		Capture	Illumina GAIIx	Phase_I	7790411	Q5TCP3	Missense_Mutation	SNP	ENST00000283147.6	37	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	A	14.41	2.525973	0.44969	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.61859	0.07	5.41	5.41	0.78517	Transforming growth factor-beta, N-terminal (1);	0.048468	0.85682	D	0.000000	T	0.37237	0.0996	L	0.44542	1.39	0.80722	D	1	B	0.23442	0.085	B	0.29440	0.102	T	0.28808	-1.0032	10	0.25106	T	0.35	.	15.4422	0.75195	1.0:0.0:0.0:0.0	.	235	P22004	BMP6_HUMAN	R	157;235;198	ENSP00000283147:H235R	ENSP00000283147:H235R	H	+	2	0	BMP6	7790411	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.735000	0.91549	2.044000	0.60594	0.455000	0.32223	CAC		0.458	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718	
RNF8	9025	broad.mit.edu	37	6	37358531	37358531	+	Silent	SNP	C	C	T			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr6:37358531C>T	ENST00000373479.4	+	8	1648	c.1455C>T	c.(1453-1455)ttC>ttT	p.F485F	RNF8_ENST00000469731.1_Missense_Mutation_p.S417F	NM_003958.3|NM_183078.2	NP_003949.1|NP_898901.1	O76064	RNF8_HUMAN	ring finger protein 8, E3 ubiquitin protein ligase	485					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|histone exchange (GO:0043486)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A ubiquitination (GO:0033522)|histone H2B ubiquitination (GO:0033523)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|mitotic nuclear division (GO:0007067)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|response to ionizing radiation (GO:0010212)|spermatid development (GO:0007286)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome, telomeric region (GO:0000781)|nucleolus (GO:0005730)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.F485F(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	13						AGAGATTGTTCTGAAGACCGT	0.507																																																1	Substitution - coding silent(1)	ovary(1)	6											114.0	111.0	112.0					6																	37358531		2203	4300	6503	37466509	SO:0001819	synonymous_variant	9025			AB012770	CCDS4833.1, CCDS4834.1	6p21.3	2013-01-09	2012-02-23		ENSG00000112130	ENSG00000112130		"""RING-type (C3HC4) zinc fingers"""	10071	protein-coding gene	gene with protein product		611685	"""ring finger protein (C3HC4 type) 8"", ""ring finger protein 8"""			9734811, 9852682	Standard	NM_003958		Approved	KIAA0646	uc003onq.4	O76064	OTTHUMG00000014620	ENST00000373479.4:c.1455C>T	6.37:g.37358531C>T		Somatic		Capture	Illumina GAIIx	Phase_I	37466509	A6NN24|A8MYC0|B4DPG0|Q53H16|Q5NKW5	Missense_Mutation	SNP	ENST00000373479.4	37	CCDS4834.1	.	.	.	.	.	.	.	.	.	.	C	10.83	1.461741	0.26248	.	.	ENSG00000112130	ENST00000469731	T	0.55234	0.53	5.02	0.676	0.17958	.	.	.	.	.	T	0.26666	0.0652	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.14699	-1.0463	5	.	.	.	.	2.9089	0.05730	0.409:0.3646:0.1347:0.0917	.	.	.	.	F	417	ENSP00000418879:S417F	.	S	+	2	0	RNF8	37466509	0.000000	0.05858	0.870000	0.34147	0.540000	0.34992	-1.118000	0.03280	-0.012000	0.14223	0.655000	0.94253	TCT		0.507	RNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040403.2		
RBAK	57786	broad.mit.edu	37	7	5103357	5103357	+	Silent	SNP	A	A	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr7:5103357A>G	ENST00000353796.3	+	6	594	c.270A>G	c.(268-270)agA>agG	p.R90R	RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK_ENST00000396912.1_Silent_p.R90R|RBAK-RBAKDN_ENST00000407184.1_Silent_p.R90R	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	90					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R90R(1)		NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TGATAGAGAGAATCCAAGAAA	0.358																																																1	Substitution - coding silent(1)	ovary(1)	7											58.0	55.0	56.0					7																	5103357		2203	4300	6503	5069883	SO:0001819	synonymous_variant	57786			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.270A>G	7.37:g.5103357A>G		Somatic		Capture	Illumina GAIIx	Phase_I	5069883	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Silent	SNP	ENST00000353796.3	37	CCDS5337.1																																																																																				0.358	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163	
GPR141	353345	broad.mit.edu	37	7	37780440	37780440	+	Missense_Mutation	SNP	C	C	T	rs545002848	byFrequency	TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr7:37780440C>T	ENST00000447769.1	+	4	734	c.445C>T	c.(445-447)Ccc>Tcc	p.P149S	EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.P149S			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P149S(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CATTGTGGTACCCCTGGTTGT	0.438													C|||	2	0.000399361	0.0	0.0	5008	,	,		20490	0.0		0.0	False		,,,				2504	0.002															1	Substitution - Missense(1)	ovary(1)	7											151.0	146.0	147.0					7																	37780440		2203	4300	6503	37746965	SO:0001583	missense	353345			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.445C>T	7.37:g.37780440C>T	ENSP00000390410:p.Pro149Ser	Somatic		Capture	Illumina GAIIx	Phase_I	37746965	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	ENST00000447769.1	37	CCDS5451.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616473	0.46736	.	.	ENSG00000187037	ENST00000447769;ENST00000334425	T;T	0.50001	0.76;0.76	4.56	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.143577	0.47852	D	0.000220	T	0.69566	0.3125	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.73633	-0.3921	10	0.62326	D	0.03	-25.7606	16.6324	0.85037	0.0:1.0:0.0:0.0	.	149	Q7Z602	GP141_HUMAN	S	149	ENSP00000390410:P149S;ENSP00000334540:P149S	ENSP00000334540:P149S	P	+	1	0	GPR141	37746965	0.975000	0.34042	0.373000	0.26003	0.412000	0.31113	4.341000	0.59335	2.525000	0.85131	0.655000	0.94253	CCC		0.438	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219943.2	NM_181791	
COA1	55744	broad.mit.edu	37	7	43684999	43684999	+	Splice_Site	SNP	C	C	G	rs200911102		TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr7:43684999C>G	ENST00000395879.1	-	3	1797		c.e3-1		COA1_ENST00000310564.6_Splice_Site|COA1_ENST00000223336.6_Splice_Site|COA1_ENST00000395880.3_Splice_Site			Q9GZY4	COA1_HUMAN	cytochrome c oxidase assembly factor 1 homolog (S. cerevisiae)						mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex IV assembly (GO:0033617)	cytoplasm (GO:0005737)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrion (GO:0005739)		p.?(1)									GAATGAAACTCTAAGGACGAA	0.433													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16970	0.0		0.0	False		,,,				2504	0.0															1	Unknown(1)	ovary(1)	7											59.0	57.0	58.0					7																	43684999		2203	4300	6503	43651524	SO:0001630	splice_region_variant	55744			AK001665	CCDS5471.1	7p13	2012-12-05	2012-10-15	2012-06-25	ENSG00000106603	ENSG00000106603		"""Mitochondrial respiratory chain complex assembly factors"""	21868	protein-coding gene	gene with protein product		614769	"""chromosome 7 open reading frame 44"""	C7orf44		22356826	Standard	NM_018224		Approved	FLJ10803, MITRAC15	uc003tin.2	Q9GZY4	OTTHUMG00000128949	ENST00000395879.1:c.116-1G>C	7.37:g.43684999C>G		Somatic		Capture	Illumina GAIIx	Phase_I	43651524	A6NJU8|A8KAH8|Q9HAB7|Q9NVD2	Splice_Site	SNP	ENST00000395879.1	37	CCDS5471.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	12.66	2.004787	0.35320	.	.	ENSG00000106603	ENST00000395879;ENST00000310564;ENST00000395880;ENST00000223336;ENST00000415798;ENST00000431651	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7061	0.62639	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C7orf44	43651524	0.859000	0.29813	0.814000	0.32528	0.026000	0.11368	0.949000	0.29109	2.501000	0.84356	0.650000	0.86243	.		0.433	COA1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313664.1	NM_018224	Intron
FOXP2	93986	broad.mit.edu	37	7	114270012	114270012	+	Silent	SNP	G	G	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr7:114270012G>A	ENST00000393494.2	+	5	828	c.549G>A	c.(547-549)caG>caA	p.Q183Q	FOXP2_ENST00000390668.3_Silent_p.Q207Q|FOXP2_ENST00000408937.3_Silent_p.Q208Q|FOXP2_ENST00000360232.4_Silent_p.Q183Q|FOXP2_ENST00000393491.3_Silent_p.Q91Q|FOXP2_ENST00000393498.2_Silent_p.Q163Q|FOXP2_ENST00000393500.3_Silent_p.Q108Q|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000403559.4_Silent_p.Q200Q|FOXP2_ENST00000350908.4_Silent_p.Q183Q|FOXP2_ENST00000393489.3_Silent_p.Q91Q|FOXP2_ENST00000378237.3_Silent_p.Q183Q			O15409	FOXP2_HUMAN	forkhead box P2	183	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q208Q(2)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						agcagcagcagcaacagcagc	0.502																																																2	Substitution - coding silent(2)	ovary(1)|endometrium(1)	7											13.0	10.0	11.0					7																	114270012		2117	4096	6213	114057248	SO:0001819	synonymous_variant	93986			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.549G>A	7.37:g.114270012G>A		Somatic		Capture	Illumina GAIIx	Phase_I	114057248	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Silent	SNP	ENST00000393494.2	37	CCDS5760.1																																																																																				0.502	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491	
GIMAP1	170575	broad.mit.edu	37	7	150417157	150417157	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr7:150417157C>A	ENST00000307194.5	+	3	205	c.65C>A	c.(64-66)tCc>tAc	p.S22Y		NM_130759.3	NP_570115.1	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	22					B cell differentiation (GO:0030183)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)	p.S22Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AACGCTCAGTCCCGGCAGGAG	0.527																																																1	Substitution - Missense(1)	ovary(1)	7											137.0	160.0	152.0					7																	150417157		2167	4229	6396	150048090	SO:0001583	missense	170575			AJ306287	CCDS5906.1	7q36.1	2014-04-04			ENSG00000213203	ENSG00000213203		"""GTPases, IMAP"""	23237	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 2"""	608084				15474311, 18701445	Standard	NM_130759		Approved	HIMAP1, IMAP38, IMAP1, IAN2		Q8WWP7	OTTHUMG00000157489	ENST00000307194.5:c.65C>A	7.37:g.150417157C>A	ENSP00000302833:p.Ser22Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	150048090	B2RCI3|Q8NAZ0	Missense_Mutation	SNP	ENST00000307194.5	37	CCDS5906.1	.	.	.	.	.	.	.	.	.	.	C	2.499	-0.315639	0.05422	.	.	ENSG00000213203	ENST00000307194	T	0.05580	3.42	4.57	0.596	0.17496	.	1.573830	0.05104	U	0.487712	T	0.04907	0.0132	N	0.14661	0.345	0.09310	N	1	B	0.24092	0.097	B	0.26517	0.07	T	0.44697	-0.9311	10	0.40728	T	0.16	.	7.0074	0.24844	0.0:0.5961:0.0:0.4039	.	22	Q8WWP7	GIMA1_HUMAN	Y	22	ENSP00000302833:S22Y	ENSP00000302833:S22Y	S	+	2	0	GIMAP1	150048090	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.003000	0.13083	0.194000	0.20326	0.650000	0.86243	TCC		0.527	GIMAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348951.2	NM_130759	
DKK4	27121	broad.mit.edu	37	8	42231699	42231699	+	Silent	SNP	A	A	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr8:42231699A>G	ENST00000220812.2	-	4	780	c.594T>C	c.(592-594)ccT>ccC	p.P198P		NM_014420.2	NP_055235.1	Q9UBT3	DKK4_HUMAN	dickkopf WNT signaling pathway inhibitor 4	198	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)		p.P198P(1)		NS(1)|endometrium(1)|large_intestine(7)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	14	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|Lung(22;0.00597)|LUSC - Lung squamous cell carcinoma(45;0.024)			ACAGTAGTCCAGGGCCACAGT	0.448																																																1	Substitution - coding silent(1)	ovary(1)	8											91.0	91.0	91.0					8																	42231699		2203	4300	6503	42350856	SO:0001819	synonymous_variant	27121			AF177397	CCDS6130.1	8p11.2-p11.1	2013-05-15	2013-05-15		ENSG00000104371	ENSG00000104371			2894	protein-coding gene	gene with protein product		605417	"""dickkopf (Xenopus laevis) homolog 4"", ""dickkopf homolog 4 (Xenopus laevis)"""			10570958, 11701963	Standard	NM_014420		Approved		uc003xpb.3	Q9UBT3	OTTHUMG00000164167	ENST00000220812.2:c.594T>C	8.37:g.42231699A>G		Somatic		Capture	Illumina GAIIx	Phase_I	42350856	Q3KNX0|Q9Y4C3	Silent	SNP	ENST00000220812.2	37	CCDS6130.1																																																																																				0.448	DKK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377563.1		
TRPA1	8989	broad.mit.edu	37	8	72948576	72948576	+	Silent	SNP	A	A	G			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr8:72948576A>G	ENST00000262209.4	-	21	2709	c.2502T>C	c.(2500-2502)tgT>tgC	p.C834C	RP11-383H13.1_ENST00000457356.4_Intron|RP11-383H13.1_ENST00000524152.1_Intron|RP11-383H13.1_ENST00000537896.1_Intron|TRPA1_ENST00000519720.1_5'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	834					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.C834C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CAATTGCTCCACATTGCCACT	0.353																																																1	Substitution - coding silent(1)	ovary(1)	8											66.0	66.0	66.0					8																	72948576		2203	4300	6503	73111130	SO:0001819	synonymous_variant	8989			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2502T>C	8.37:g.72948576A>G		Somatic		Capture	Illumina GAIIx	Phase_I	73111130	A6NIN6	Silent	SNP	ENST00000262209.4	37	CCDS34908.1																																																																																				0.353	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
FOCAD	54914	broad.mit.edu	37	9	20923752	20923752	+	Silent	SNP	T	T	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr9:20923752T>A	ENST00000380249.1	+	27	3310	c.2946T>A	c.(2944-2946)tcT>tcA	p.S982S	FOCAD_ENST00000338382.6_Silent_p.S982S|FOCAD_ENST00000605086.1_Silent_p.S418S	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	982						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.S982S(1)									CCTCAGACTCTGACGGGCTCC	0.502																																																1	Substitution - coding silent(1)	ovary(1)	9											73.0	60.0	64.0					9																	20923752		2203	4300	6503	20913752	SO:0001819	synonymous_variant	54914			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.2946T>A	9.37:g.20923752T>A		Somatic		Capture	Illumina GAIIx	Phase_I	20913752	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Silent	SNP	ENST00000380249.1	37	CCDS34993.1																																																																																				0.502	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
TSTD2	158427	broad.mit.edu	37	9	100364996	100364996	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr9:100364996G>C	ENST00000341170.4	-	10	1688	c.1306C>G	c.(1306-1308)Cag>Gag	p.Q436E		NM_139246.4	NP_640339.4	Q5T7W7	TSTD2_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 2	436								p.Q436E(1)		large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	15						TGGCGGCACTGGGGAGTAGAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	9											105.0	98.0	100.0					9																	100364996		2203	4300	6503	99404817	SO:0001583	missense	158427			AF258575	CCDS6727.2	9q22.33	2013-09-20	2009-08-12	2009-08-12	ENSG00000136925	ENSG00000136925			30087	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 97"""	C9orf97		12477932	Standard	NM_139246		Approved	PP4189	uc004axn.3	Q5T7W7	OTTHUMG00000020328	ENST00000341170.4:c.1306C>G	9.37:g.100364996G>C	ENSP00000342499:p.Gln436Glu	Somatic		Capture	Illumina GAIIx	Phase_I	99404817	A6NMJ4|A8K584|Q6ZQZ6|Q8IYM3|Q8WY73|Q96ML6|Q96MU1	Missense_Mutation	SNP	ENST00000341170.4	37	CCDS6727.2	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323893	0.24080	.	.	ENSG00000136925	ENST00000375173;ENST00000375172;ENST00000341170	T;T	0.35605	1.3;1.3	5.63	4.73	0.59995	.	0.478865	0.24024	N	0.042242	T	0.24160	0.0585	N	0.25890	0.77	0.41728	D	0.989543	B	0.20887	0.049	B	0.16722	0.016	T	0.08432	-1.0722	10	0.02654	T	1	-2.9296	16.048	0.80734	0.0:0.0:0.8647:0.1353	.	436	Q5T7W7	TSTD2_HUMAN	E	32;210;436	ENSP00000364316:Q32E;ENSP00000342499:Q436E	ENSP00000342499:Q436E	Q	-	1	0	TSTD2	99404817	1.000000	0.71417	0.998000	0.56505	0.112000	0.19704	4.946000	0.63576	1.518000	0.48934	0.655000	0.94253	CAG		0.507	TSTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053325.4	NM_139246	
ALG2	85365	broad.mit.edu	37	9	101980977	101980977	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chr9:101980977C>A	ENST00000476832.1	-	2	551	c.490G>T	c.(490-492)Gaa>Taa	p.E164*	ALG2_ENST00000319033.6_Nonsense_Mutation_p.E71*	NM_033087.3	NP_149078.1	O75340	PDCD6_HUMAN	ALG2, alpha-1,3/1,6-mannosyltransferase	0	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)	p.E164*(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|prostate(2)	22		Acute lymphoblastic leukemia(62;0.0559)				GTGGTGTATTCCTCTATCCAG	0.443																																																1	Substitution - Nonsense(1)	ovary(1)	9											92.0	92.0	92.0					9																	101980977		2203	4300	6503	101020798	SO:0001587	stop_gained	85365			AK027417	CCDS6739.1	9q31.1	2013-02-22	2013-02-22		ENSG00000119523	ENSG00000119523	2.4.1.132, 2.4.1.257	"""Glycosyltransferase group 1 domain containing"""	23159	protein-coding gene	gene with protein product		607905	"""asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)"""			12684507	Standard	NR_024532		Approved	CDGIi, FLJ14511, hALPG2, NET38	uc004azf.3	Q9H553	OTTHUMG00000020355	ENST00000476832.1:c.490G>T	9.37:g.101980977C>A	ENSP00000417764:p.Glu164*	Somatic		Capture	Illumina GAIIx	Phase_I	101020798	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Nonsense_Mutation	SNP	ENST00000476832.1	37	CCDS6739.1	.	.	.	.	.	.	.	.	.	.	C	35	5.538588	0.96474	.	.	ENSG00000119523	ENST00000476832;ENST00000319033	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-8.2339	19.0186	0.92903	0.0:1.0:0.0:0.0	.	.	.	.	X	164;71	.	ENSP00000432675:E71X	E	-	1	0	ALG2	101020798	1.000000	0.71417	0.958000	0.39756	0.927000	0.56198	7.445000	0.80570	2.565000	0.86533	0.650000	0.86243	GAA		0.443	ALG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215080.1	NM_033087	
GRIPAP1	56850	broad.mit.edu	37	X	48855894	48855894	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chrX:48855894G>T	ENST00000376441.1	-	2	99	c.65C>A	c.(64-66)aCa>aAa	p.T22K	GRIPAP1_ENST00000376425.3_Missense_Mutation_p.T22K|GRIPAP1_ENST00000376423.4_Missense_Mutation_p.T22K|GRIPAP1_ENST00000376444.3_Missense_Mutation_p.T22K	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	22						blood microparticle (GO:0072562)|endosome (GO:0005768)		p.T22K(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						GTAGTTGTTTGTCCGGAGTTC	0.552																																																1	Substitution - Missense(1)	ovary(1)	X											118.0	94.0	102.0					X																	48855894		2203	4300	6503	48740838	SO:0001583	missense	56850			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.65C>A	X.37:g.48855894G>T	ENSP00000365624:p.Thr22Lys	Somatic		Capture	Illumina GAIIx	Phase_I	48740838	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	ENST00000376441.1	37	CCDS35248.1	.	.	.	.	.	.	.	.	.	.	g	26.9	4.784227	0.90282	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291;ENST00000376423	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.43875	0.1267	L	0.52364	1.645	0.42717	D	0.993665	D;D	0.89917	1.0;0.995	D;D	0.85130	0.997;0.932	T	0.30966	-0.9960	10	0.02654	T	1	-7.7684	14.4662	0.67485	0.0:0.0:1.0:0.0	.	22;22	Q4V328-2;Q4V328	.;GRAP1_HUMAN	K	22	ENSP00000365608:T22K;ENSP00000365627:T22K;ENSP00000365624:T22K;ENSP00000365606:T22K	ENSP00000365606:T22K	T	-	2	0	GRIPAP1	48740838	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.770000	0.85390	2.390000	0.81377	0.521000	0.50471	ACA		0.552	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	
DACH2	117154	broad.mit.edu	37	X	85994760	85994760	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chrX:85994760C>A	ENST00000373125.4	+	7	1115	c.1115C>A	c.(1114-1116)cCa>cAa	p.P372Q	DACH2_ENST00000373131.1_Missense_Mutation_p.P359Q|DACH2_ENST00000510272.1_Missense_Mutation_p.P153Q|DACH2_ENST00000508860.1_Missense_Mutation_p.P205Q	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	372					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P372Q(1)|p.P359Q(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						GAGCGGATCCCAGAGAGTCCT	0.488																																																2	Substitution - Missense(2)	ovary(2)	X											98.0	80.0	86.0					X																	85994760		2195	4286	6481	85881416	SO:0001583	missense	117154			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1115C>A	X.37:g.85994760C>A	ENSP00000362217:p.Pro372Gln	Somatic		Capture	Illumina GAIIx	Phase_I	85881416	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410284	0.25465	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297;ENST00000484479	D;D	0.82893	-1.66;-1.66	4.98	4.02	0.46733	.	0.176719	0.39083	N	0.001474	T	0.60932	0.2307	N	0.03324	-0.35	0.30044	N	0.812371	B;B;B;B	0.23316	0.013;0.013;0.079;0.083	B;B;B;B	0.24848	0.007;0.007;0.056;0.045	T	0.55003	-0.8208	10	0.13108	T	0.6	.	9.5704	0.39425	0.53:0.47:0.0:0.0	.	238;372;359;372	Q1RMF5;A8K3I1;Q96NX9-2;Q96NX9	.;.;.;DACH2_HUMAN	Q	372;359;372;205;153;205;27	ENSP00000362223:P359Q;ENSP00000362217:P372Q	ENSP00000345134:P372Q	P	+	2	0	DACH2	85881416	1.000000	0.71417	0.997000	0.53966	0.971000	0.66376	2.039000	0.41193	2.056000	0.61249	0.506000	0.49869	CCA		0.488	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
WDR44	54521	broad.mit.edu	37	X	117527021	117527021	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chrX:117527021G>A	ENST00000254029.3	+	4	1008	c.613G>A	c.(613-615)Gct>Act	p.A205T	WDR44_ENST00000371825.3_Missense_Mutation_p.A205T|WDR44_ENST00000371822.5_Missense_Mutation_p.A180T|WDR44_ENST00000493448.1_3'UTR	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	205						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.A205T(2)		breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						AGATTTTGCCGCTGTGGAAGA	0.493																																																2	Substitution - Missense(2)	ovary(2)	X											143.0	124.0	131.0					X																	117527021		2203	4300	6503	117411049	SO:0001583	missense	54521			AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.613G>A	X.37:g.117527021G>A	ENSP00000254029:p.Ala205Thr	Somatic		Capture	Illumina GAIIx	Phase_I	117411049	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	37	CCDS14572.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.075|0.075	-1.194118|-1.194118	0.01594|0.01594	.|.	.|.	ENSG00000131725|ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825|ENST00000371848	T;T;T|.	0.73047|.	-0.71;-0.12;0.01|.	5.17|5.17	2.41|2.41	0.29592|0.29592	.|.	0.818750|.	0.11442|.	N|.	0.563695|.	T|T	0.17831|0.17831	0.0428|0.0428	N|N	0.12182|0.12182	0.205|0.205	0.19775|0.19775	N|N	0.999953|0.999953	B;B;B|.	0.06786|.	0.001;0.0;0.0|.	B;B;B|.	0.04013|.	0.001;0.0;0.0|.	T|T	0.25152|0.25152	-1.0140|-1.0140	10|5	0.16896|.	T|.	0.51|.	-2.4172|-2.4172	4.2889|4.2889	0.10869|0.10869	0.3396:0.0:0.5056:0.1548|0.3396:0.0:0.5056:0.1548	.|.	180;205;205|.	F8W913;Q5JSH3-2;Q5JSH3|.	.;.;WDR44_HUMAN|.	T|H	180;205;205|104	ENSP00000360887:A180T;ENSP00000254029:A205T;ENSP00000360890:A205T|.	ENSP00000254029:A205T|.	A|R	+|+	1|2	0|0	WDR44|WDR44	117411049|117411049	0.901000|0.901000	0.30685|0.30685	0.108000|0.108000	0.21378|0.21378	0.125000|0.125000	0.20455|0.20455	0.149000|0.149000	0.16243|0.16243	0.177000|0.177000	0.19895|0.19895	-0.190000|-0.190000	0.12839|0.12839	GCT|CGC		0.493	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045	
ATP6AP1	537	broad.mit.edu	37	X	153663713	153663713	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-2072-01A-01W-0722-08	TCGA-23-2072-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	bb4767d9-4639-4023-bbfc-88a5cdefd136	92612e6b-b2d1-41be-a6a4-26d73360406b	g.chrX:153663713C>A	ENST00000369762.2	+	9	1126	c.1065C>A	c.(1063-1065)taC>taA	p.Y355*	GDI1_ENST00000447750.2_5'Flank	NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	355					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)	p.Y355*(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCGTCGCCTACTTCAATGCTT	0.602																																																1	Substitution - Nonsense(1)	ovary(1)	X											65.0	52.0	57.0					X																	153663713		2203	4300	6503	153316907	SO:0001587	stop_gained	537			D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.1065C>A	X.37:g.153663713C>A	ENSP00000358777:p.Tyr355*	Somatic		Capture	Illumina GAIIx	Phase_I	153316907	A6ZKI4|Q8NBT4|Q9H0C7	Nonsense_Mutation	SNP	ENST00000369762.2	37	CCDS35451.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.519275	0.44866	.	.	ENSG00000071553	ENST00000369762;ENST00000422890;ENST00000445849	.	.	.	5.69	2.97	0.34412	.	1.941890	0.01935	N	0.041465	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0649	8.5569	0.33487	0.0:0.736:0.0:0.264	.	.	.	.	X	355;269;179	.	ENSP00000358777:Y355X	Y	+	3	2	ATP6AP1	153316907	0.001000	0.12720	0.160000	0.22671	0.435000	0.31806	-0.154000	0.10130	0.200000	0.20447	-0.195000	0.12781	TAC		0.602	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081639.4	NM_001183	
