#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								12073	SO:0001628	intergenic_variant	4538																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	12073		Missense_Mutation	SNP	HMMPfam_Oxidored_q5_N,HMMPfam_Oxidored_q1	p.F438S		37	c.1313		MT																																																																																			-	NULL	0	0					MT-ND4			T			12073	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361381	ensembl	human	known	54_36p	missense	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								14601	SO:0001628	intergenic_variant	4541																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	14601		Missense_Mutation	SNP	HMMPfam_Oxidored_q3	p.P25L		37	c.74		MT																																																																																			-	HMMPfam_Oxidored_q3	0	0					MT-ND6			G			14601	-1	no_stop_codon	ENST00000361681	ensembl	human	known	54_36p	missense	SNP	NULL	A
DMRT3	58524	genome.wustl.edu	37	9	990520	990520	+	Missense_Mutation	SNP	C	C	T	rs117758829	byFrequency	TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr9:990520C>T	ENST00000190165.2	+	2	972	c.934C>T	c.(934-936)Cac>Tac	p.H312Y		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	312					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		CTCCAATGGGCACATCTTTGA	0.562													C|||	3	0.000599042	0.0	0.0014	5008	,	,		18921	0.0		0.002	False		,,,				2504	0.0															0			9						C	TYR/HIS	1,4405	2.1+/-5.4	0,1,2202	131.0	113.0	119.0		934	4.0	1.0	9	dbSNP_133	119	11,8589	8.4+/-32.0	0,11,4289	yes	missense	DMRT3	NM_021240.2	83	0,12,6491	TT,TC,CC		0.1279,0.0227,0.0923	benign	312/473	990520	12,12994	2203	4300	6503	980520	SO:0001583	missense	58524			AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.934C>T	9.37:g.990520C>T	ENSP00000190165:p.His312Tyr	Somatic		Capture	Illumina GAIIx	4	980520	Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Missense_Mutation	SNP	superfamily_DM_DNA_bd,HMMPfam_DM,HMMSmart_DM,PatternScan_DM_1,HMMPfam_DMA	p.H312Y	ENST00000190165.2	37	c.934	CCDS6443.1	9	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	11.50	1.658399	0.29425	2.27E-4	0.001279	ENSG00000064218	ENST00000190165	T	0.25085	1.82	4.94	3.98	0.46160	.	0.055932	0.64402	D	0.000001	T	0.18299	0.0439	L	0.29908	0.895	0.52501	D	0.999958	D	0.55385	0.971	P	0.45099	0.469	T	0.03259	-1.1055	10	0.02654	T	1	-46.0287	14.0292	0.64604	0.1516:0.8484:0.0:0.0	.	312	Q9NQL9	DMRT3_HUMAN	Y	312	ENSP00000190165:H312Y	ENSP00000190165:H312Y	H	+	1	0	DMRT3	980520	1.000000	0.71417	0.978000	0.43139	0.228000	0.25075	5.318000	0.65829	2.304000	0.77564	0.555000	0.69702	CAC	-	NULL		0.562	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT3	protein_coding	OTTHUMT00000051490.1	C	NM_021240		980520	+1	no_errors	NM_021240	genbank	human	validated	54_36p	missense	SNP	1.000	T
CLPTM1L	81037	genome.wustl.edu	37	5	1335172	1335172	+	Splice_Site	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr5:1335172C>T	ENST00000320895.5	-	6	1053	c.796G>A	c.(796-798)Ggg>Agg	p.G266R	CLPTM1L_ENST00000507807.1_Splice_Site_p.G133R|CLPTM1L_ENST00000320927.6_Splice_Site_p.G266R	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	266					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		CGGCACATACCGAACTGCTGC	0.682																																																0			5											55.0	55.0	55.0					5																	1335172		2203	4300	6503	1388172	SO:0001630	splice_region_variant	81037			AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.796+1G>A	5.37:g.1335172C>T		Somatic		Capture	Illumina GAIIx	4	1388172	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	HMMPfam_CLPTM1	p.G266R	ENST00000320895.5	37	c.796	CCDS3862.1	5	.	.	.	.	.	.	.	.	.	.	C	14.71	2.615724	0.46631	.	.	ENSG00000049656	ENST00000320895;ENST00000507807;ENST00000320927	T;T;T	0.59224	0.57;0.4;0.28	4.13	1.32	0.21799	.	0.000000	0.85682	D	0.000000	T	0.77039	0.4072	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77381	-0.2609	9	.	.	.	-20.8944	10.8587	0.46815	0.0:0.8158:0.0:0.1842	.	266;133	Q96KA5;G5E9Z2	CLP1L_HUMAN;.	R	266;133;266	ENSP00000313854:G266R;ENSP00000423321:G133R;ENSP00000315196:G266R	.	G	-	1	0	CLPTM1L	1388172	1.000000	0.71417	0.758000	0.31321	0.245000	0.25701	7.218000	0.77991	0.017000	0.15025	0.643000	0.83706	GGG	-	HMMPfam_CLPTM1		0.682	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1L	protein_coding	OTTHUMT00000253649.2	C	NM_030782	Missense_Mutation	1388172	-1	no_errors	NM_030782	genbank	human	provisional	54_36p	missense	SNP	1.000	T
OR56A4	120793	genome.wustl.edu	37	11	6023857	6023857	+	Silent	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr11:6023857G>C	ENST00000330728.4	-	1	567	c.522C>G	c.(520-522)gcC>gcG	p.A174A		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AACGGTCATAGGCCATGACCA	0.507																																																0			11											77.0	67.0	71.0					11																	6023857		2201	4296	6497	5980433	SO:0001819	synonymous_variant	120793			BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.522C>G	11.37:g.6023857G>C		Somatic		Capture	Illumina GAIIx	4	5980433	B9EH17	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1	p.A174	ENST00000330728.4	37	c.522	CCDS31404.1	11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.507	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56A4	protein_coding	OTTHUMT00000383756.2	G	NM_001005179		5980433	-1	no_errors	NM_001005179	genbank	human	provisional	54_36p	silent	SNP	0.898	C
TP53	7157	genome.wustl.edu	37	17	7578370	7578370	+	Splice_Site	SNP	C	C	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr17:7578370C>A	ENST00000269305.4	-	5	749		c.e5+1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(54)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCTGCTCACCATCGCTATC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	68	Unknown(54)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	lung(12)|breast(9)|oesophagus(7)|ovary(7)|liver(7)|urinary_tract(5)|NS(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(2)|stomach(1)|soft_tissue(1)	17											48.0	46.0	47.0					17																	7578370		2203	4300	6503	7519095	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.559+1G>T	17.37:g.7578370C>A		Somatic		Capture	Illumina GAIIx	4	7519095	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e4+1	ENST00000269305.4	37	c.559+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	11.69	1.713974	0.30413	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0738	0.59075	0.0:0.8363:0.1637:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519095	1.000000	0.71417	0.967000	0.41034	0.201000	0.24016	3.085000	0.50151	1.248000	0.43934	0.655000	0.94253	.	-	-		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Intron	7519095	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	0.998	A
CNTROB	116840	genome.wustl.edu	37	17	7836551	7836551	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr17:7836551G>A	ENST00000563694.1	+	1	1079	c.154G>A	c.(154-156)Gcc>Acc	p.A52T	CNTROB_ENST00000380255.3_Missense_Mutation_p.A52T|CNTROB_ENST00000565740.1_Missense_Mutation_p.A52T|TRAPPC1_ENST00000540486.1_5'Flank|CNTROB_ENST00000380262.3_Missense_Mutation_p.A52T|RP11-1099M24.7_ENST00000573621.1_5'Flank|TRAPPC1_ENST00000303731.4_5'Flank	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	52					centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				GGAGGCCACGGCCCGAGCCCA	0.577																																																0			17											61.0	65.0	63.0					17																	7836551		2203	4300	6503	7777276	SO:0001583	missense	116840			AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.154G>A	17.37:g.7836551G>A	ENSP00000456335:p.Ala52Thr	Somatic		Capture	Illumina GAIIx	4	7777276	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Missense_Mutation	SNP	NULL	p.A52T	ENST00000563694.1	37	c.154	CCDS11126.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.512696	0.96402	.	.	ENSG00000170037	ENST00000380262;ENST00000380255	T;T	0.62364	0.55;0.03	5.25	5.25	0.73442	.	0.000000	0.45867	D	0.000339	T	0.68851	0.3046	L	0.27053	0.805	0.36596	D	0.874404	D;D	0.89917	1.0;0.996	D;D	0.87578	0.998;0.993	T	0.71137	-0.4680	10	0.30854	T	0.27	-12.4968	17.6178	0.88072	0.0:0.0:1.0:0.0	.	52;52	Q8N137;Q8N137-2	CNTRB_HUMAN;.	T	52	ENSP00000369614:A52T;ENSP00000369605:A52T	ENSP00000369605:A52T	A	+	1	0	CNTROB	7777276	1.000000	0.71417	0.995000	0.50966	0.922000	0.55478	5.504000	0.66968	2.436000	0.82500	0.563000	0.77884	GCC	-	NULL		0.577	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CNTROB	protein_coding	OTTHUMT00000421372.1	G	NM_053051		7777276	+1	no_errors	NM_001037144	genbank	human	validated	54_36p	missense	SNP	0.994	A
PNPLA4	8228	genome.wustl.edu	37	X	7868839	7868839	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chrX:7868839A>T	ENST00000381042.4	-	7	820	c.650T>A	c.(649-651)gTg>gAg	p.V217E	PNPLA4_ENST00000444736.1_Missense_Mutation_p.V217E|PNPLA4_ENST00000537427.1_Missense_Mutation_p.V130E	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	217					lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				GTTGAGTCTCACCAGGTTTGC	0.348																																																0			X											52.0	47.0	49.0					X																	7868839		2203	4299	6502	7828839	SO:0001583	missense	8228			U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.650T>A	X.37:g.7868839A>T	ENSP00000370430:p.Val217Glu	Somatic		Capture	Illumina GAIIx	4	7828839	A8K1H3|B4E362|Q8WW83	Missense_Mutation	SNP	superfamily_FabD/lysophospholipase-like,HMMPfam_Patatin	p.V217E	ENST00000381042.4	37	c.650	CCDS14129.1	X	.	.	.	.	.	.	.	.	.	.	A	5.487	0.274833	0.10403	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000537427	T;T;T	0.77877	-1.13;-1.13;-1.13	4.38	1.93	0.25924	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.490144	0.20143	N	0.098324	T	0.69637	0.3133	M	0.67953	2.075	0.32309	N	0.563989	B	0.09022	0.002	B	0.06405	0.002	T	0.64550	-0.6381	10	0.49607	T	0.09	-17.5057	3.3518	0.07155	0.6835:0.0:0.1137:0.2029	.	217	P41247	PLPL4_HUMAN	E	217;217;130	ENSP00000370430:V217E;ENSP00000415245:V217E;ENSP00000443157:V130E	ENSP00000370430:V217E	V	-	2	0	PNPLA4	7828839	0.979000	0.34478	0.511000	0.27724	0.300000	0.27592	2.000000	0.40816	0.030000	0.15379	-0.376000	0.06991	GTG	-	NULL		0.348	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PNPLA4	protein_coding	OTTHUMT00000055687.1	A	NM_004650		7828839	-1	no_errors	NM_004650	genbank	human	validated	54_36p	missense	SNP	1.000	T
PLOD1	5351	genome.wustl.edu	37	1	12033052	12033052	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr1:12033052G>C	ENST00000196061.4	+	18	2053	c.2026G>C	c.(2026-2028)Gag>Cag	p.E676Q	PLOD1_ENST00000376369.3_Missense_Mutation_p.E723Q	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	676	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	GGTGGATTACGAGGTGAGCAG	0.632																																																0			1											69.0	57.0	61.0					1																	12033052		2203	4300	6503	11955639	SO:0001583	missense	5351			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.2026G>C	1.37:g.12033052G>C	ENSP00000196061:p.Glu676Gln	Somatic		Capture	Illumina GAIIx	4	11955639	B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	HMMSmart_P4Hc,HMMPfam_2OG-FeII_Oxy,PatternScan_LYS_HYDROXYLASE	p.E676Q	ENST00000196061.4	37	c.2026	CCDS142.1	1	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142149	0.37825	.	.	ENSG00000083444	ENST00000414311;ENST00000376369;ENST00000196061	T;T	0.76709	-1.04;-1.04	5.52	5.52	0.82312	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.154264	0.64402	D	0.000015	T	0.69860	0.3158	L	0.35542	1.07	0.54753	D	0.999986	B;B	0.20988	0.022;0.05	B;B	0.20767	0.029;0.031	T	0.63637	-0.6592	10	0.21540	T	0.41	.	18.4801	0.90808	0.0:0.0:1.0:0.0	.	723;676	B4DR87;Q02809	.;PLOD1_HUMAN	Q	340;723;676	ENSP00000365548:E723Q;ENSP00000196061:E676Q	ENSP00000196061:E676Q	E	+	1	0	PLOD1	11955639	1.000000	0.71417	0.997000	0.53966	0.659000	0.38960	5.996000	0.70639	2.597000	0.87782	0.549000	0.68633	GAG	-	HMMSmart_P4Hc,HMMPfam_2OG-FeII_Oxy		0.632	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD1	protein_coding	OTTHUMT00000006865.1	G	NM_000302		11955639	+1	no_errors	NM_000302	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CYP4F8	11283	genome.wustl.edu	37	19	15734012	15734012	+	RNA	SNP	C	C	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr19:15734012C>A	ENST00000441682.2	+	0	806							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						CCTGTACTTCCTCACTCCCTG	0.567																																																0			19											72.0	74.0	73.0					19																	15734012		2203	4300	6503	15595012			11283			AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15734012C>A		Somatic		Capture	Illumina GAIIx	4	15595012		Missense_Mutation	SNP	superfamily_Cytochrome P450,HMMPfam_p450,PatternScan_CYTOCHROME_P450	p.L248I	ENST00000441682.2	37	c.742		19	.	.	.	.	.	.	.	.	.	.	.	14.90	2.672667	0.47781	.	.	ENSG00000186526	ENST00000441682;ENST00000325723;ENST00000443973	.	.	.	3.2	3.2	0.36748	.	0.081791	0.45867	U	0.000335	T	0.51432	0.1674	.	.	.	0.29756	N	0.835921	B;P	0.43392	0.319;0.805	B;P	0.44811	0.314;0.461	T	0.68834	-0.5304	7	0.66056	D	0.02	.	11.8813	0.52578	0.0:1.0:0.0:0.0	.	61;249	B4DU85;P98187	.;CP4F8_HUMAN	I	248;61;98	.	ENSP00000314398:L61I	L	+	1	0	CYP4F8	15595012	0.672000	0.27530	0.855000	0.33649	0.120000	0.20174	2.545000	0.45769	1.607000	0.50170	0.411000	0.27672	CTC	-	superfamily_Cytochrome P450,HMMPfam_p450		0.567	CYP4F8-201	KNOWN	basic	processed_transcript	CYP4F8	processed_transcript		C	NM_007253		15595012	+1	no_errors	ENST00000325723	ensembl	human	known	54_36p	missense	SNP	0.977	A
MYH11	4629	genome.wustl.edu	37	16	15850216	15850216	+	Silent	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr16:15850216G>A	ENST00000300036.5	-	14	1840	c.1731C>T	c.(1729-1731)atC>atT	p.I577I	MYH11_ENST00000396324.3_Silent_p.I584I|MYH11_ENST00000452625.2_Silent_p.I584I|MYH11_ENST00000576790.2_Silent_p.I577I	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	577	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CATAATGGATGATGGAGAACT	0.597			T	CBFB	AML						OREG0023636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0			16											115.0	91.0	99.0					16																	15850216		2197	4300	6497	15757717	SO:0001819	synonymous_variant	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1731C>T	16.37:g.15850216G>A		Somatic	705	Capture	Illumina GAIIx	4	15757717	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_IQ,HMMPfam_Myosin_tail_1	p.I584	ENST00000300036.5	37	c.1752	CCDS10565.1	16																																																																																			-	superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head		0.597	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	protein_coding	OTTHUMT00000252192.2	G	NM_001040113		15757717	-1	no_errors	NM_001040114	genbank	human	reviewed	54_36p	silent	SNP	0.973	A
TMEM38A	79041	genome.wustl.edu	37	19	16799174	16799174	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr19:16799174G>T	ENST00000187762.2	+	6	983	c.892G>T	c.(892-894)Gcg>Tcg	p.A298S		NM_024074.1	NP_076979.1	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	298						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)	15						GGCCAAGAAGGCGGATTAGGG	0.652																																																0			19											23.0	24.0	24.0					19																	16799174		2202	4300	6502	16660174	SO:0001583	missense	79041			AK025981	CCDS12349.1	19p13.11	2013-05-23				ENSG00000072954			28462	protein-coding gene	gene with protein product		611235				17611541	Standard	NM_024074		Approved	MGC3169, TRIC-A	uc002nes.3	Q9H6F2		ENST00000187762.2:c.892G>T	19.37:g.16799174G>T	ENSP00000187762:p.Ala298Ser	Somatic		Capture	Illumina GAIIx	4	16660174	A8K9P9	Missense_Mutation	SNP	HMMPfam_DUF714	p.A298S	ENST00000187762.2	37	c.892	CCDS12349.1	19	.	.	.	.	.	.	.	.	.	.	g	12.78	2.040570	0.35989	.	.	ENSG00000072954	ENST00000187762	.	.	.	4.39	3.35	0.38373	.	0.171620	0.50627	D	0.000109	T	0.49029	0.1533	L	0.61218	1.895	0.58432	D	0.999999	P	0.36144	0.539	B	0.34991	0.193	T	0.39583	-0.9607	9	0.10636	T	0.68	-5.8014	11.3422	0.49539	0.0888:0.0:0.9112:0.0	.	298	Q9H6F2	TM38A_HUMAN	S	298	.	ENSP00000187762:A298S	A	+	1	0	TMEM38A	16660174	1.000000	0.71417	0.997000	0.53966	0.172000	0.22775	4.858000	0.62947	0.853000	0.35312	0.655000	0.94253	GCG	-	NULL		0.652	TMEM38A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM38A	protein_coding	OTTHUMT00000462841.1	G	NM_024074		16660174	+1	no_errors	NM_024074	genbank	human	provisional	54_36p	missense	SNP	1.000	T
NELL1	4745	genome.wustl.edu	37	11	20940857	20940857	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr11:20940857C>A	ENST00000357134.5	+	7	888	c.736C>A	c.(736-738)Ctt>Att	p.L246I	NELL1_ENST00000325319.5_Missense_Mutation_p.L189I|NELL1_ENST00000298925.5_Missense_Mutation_p.L274I|NELL1_ENST00000532434.1_Missense_Mutation_p.L246I	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	246					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TTTACAAGAGCTTTTGGCCAA	0.323																																																0			11											122.0	120.0	121.0					11																	20940857		2203	4299	6502	20897433	SO:0001583	missense	4745			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.736C>A	11.37:g.20940857C>A	ENSP00000349654:p.Leu246Ile	Somatic		Capture	Illumina GAIIx	4	20897433	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	HMMSmart_SM00210,HMMSmart_SM00282,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_VWC,HMMSmart_SM00214,HMMSmart_SM00215,PatternScan_VWFC_1,HMMSmart_SM00179,HMMSmart_SM00181,superfamily_EGF/Laminin,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,HMMPfam_EGF_2,PatternScan_EGF_1	p.L246I	ENST00000357134.5	37	c.736	CCDS7855.1	11	.	.	.	.	.	.	.	.	.	.	C	13.32	2.201372	0.38905	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.79247	-1.25;-1.22;-1.15;-1.11	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.66005	0.2746	N	0.20766	0.605	0.49798	D	0.999824	P;P;B;P	0.46512	0.879;0.807;0.264;0.807	B;B;B;B	0.41571	0.36;0.197;0.279;0.197	T	0.64123	-0.6481	10	0.07813	T	0.8	-12.8347	20.0128	0.97467	0.0:1.0:0.0:0.0	.	189;274;246;246	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	I	274;246;189;246	ENSP00000298925:L274I;ENSP00000349654:L246I;ENSP00000317837:L189I;ENSP00000437170:L246I	ENSP00000298925:L274I	L	+	1	0	NELL1	20897433	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.493000	0.53266	2.827000	0.97445	0.650000	0.86243	CTT	-	NULL		0.323	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	protein_coding	OTTHUMT00000387588.1	C	NM_006157		20897433	+1	no_errors	NM_006157	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MKRN3	7681	genome.wustl.edu	37	15	23811074	23811074	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr15:23811074C>A	ENST00000314520.3	+	1	621	c.145C>A	c.(145-147)Cca>Aca	p.P49T	MKRN3_ENST00000564592.1_Missense_Mutation_p.P49T|MKRN3_ENST00000568252.1_Missense_Mutation_p.P49T|RP11-73C9.1_ENST00000563044.1_RNA	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	49					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		TTCAGCCCTGCCACATGCGGC	0.692																																																0			15											32.0	36.0	34.0					15																	23811074		2203	4298	6501	21362167	SO:0001583	missense	7681			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.145C>A	15.37:g.23811074C>A	ENSP00000313881:p.Pro49Thr	Somatic		Capture	Illumina GAIIx	4	21362167		Missense_Mutation	SNP	HMMSmart_ZnF_C3H1,HMMPfam_zf-CCCH,superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1	p.P49T	ENST00000314520.3	37	c.145	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	c	10.52	1.373096	0.24857	.	.	ENSG00000179455	ENST00000314520	T	0.27720	1.65	2.83	-2.46	0.06461	.	.	.	.	.	T	0.10423	0.0255	N	0.08118	0	0.09310	N	1	B;B	0.15930	0.015;0.0	B;B	0.09377	0.004;0.001	T	0.30446	-0.9978	9	0.15499	T	0.54	.	0.8777	0.01227	0.3706:0.2848:0.2002:0.1444	.	49;49	Q6NSB6;Q13064	.;MKRN3_HUMAN	T	49	ENSP00000313881:P49T	ENSP00000313881:P49T	P	+	1	0	MKRN3	21362167	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.259000	0.02861	-0.511000	0.06514	0.563000	0.77884	CCA	-	NULL		0.692	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	protein_coding	OTTHUMT00000251225.1	C	NM_005664		21362167	+1	no_errors	NM_005664	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
BCR	613	genome.wustl.edu	37	22	23523956	23523956	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr22:23523956C>G	ENST00000305877.8	+	1	1560	c.809C>G	c.(808-810)cCt>cGt	p.P270R	BCR_ENST00000359540.3_Missense_Mutation_p.P270R|BCR_ENST00000398512.5_Missense_Mutation_p.P270R	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	270	Binding to ABL SH2-domain.|Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	AGCAGGCCCCCTTGGCCGCCC	0.667			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0			22											24.0	28.0	27.0					22																	23523956		2192	4280	6472	21853956	SO:0001583	missense	613				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.809C>G	22.37:g.23523956C>G	ENSP00000303507:p.Pro270Arg	Somatic		Capture	Illumina GAIIx	4	21853956	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	superfamily_Bcr-Abl oncoprotein oligomerization domain,HMMPfam_Bcr-Abl_Oligo,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,PatternScan_DH_1,superfamily_PH domain-like,HMMSmart_SM00233,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.P270R	ENST00000305877.8	37	c.809	CCDS13806.1	22	.	.	.	.	.	.	.	.	.	.	C	15.51	2.854554	0.51376	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000398512;ENST00000290956;ENST00000292697;ENST00000420248	T;T;T	0.48201	1.62;1.62;0.82	4.27	3.25	0.37280	.	0.150182	0.45361	N	0.000369	T	0.44932	0.1317	L	0.27053	0.805	0.44908	D	0.997928	P;B	0.48503	0.911;0.061	P;B	0.51833	0.681;0.01	T	0.47209	-0.9135	10	0.72032	D	0.01	.	11.7562	0.51875	0.0:0.9113:0.0:0.0887	.	270;270	P11274-2;P11274	.;BCR_HUMAN	R	270	ENSP00000303507:P270R;ENSP00000352535:P270R;ENSP00000381524:P270R	ENSP00000290956:P270R	P	+	2	0	BCR	21853956	0.035000	0.19736	0.978000	0.43139	0.213000	0.24496	2.165000	0.42396	1.097000	0.41459	0.557000	0.71058	CCT	-	NULL		0.667	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	protein_coding	OTTHUMT00000075819.1	C	NM_004327		21853956	+1	no_errors	NM_004327	genbank	human	reviewed	54_36p	missense	SNP	0.979	G
SMS	6611	genome.wustl.edu	37	X	21958888	21958888	+	5'UTR	SNP	C	C	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chrX:21958888C>A	ENST00000404933.2	+	0	198				SMS_ENST00000415881.2_5'UTR|SMS_ENST00000379404.1_5'UTR	NM_004595.4	NP_004586.2	P52788	SPSY_HUMAN	spermine synthase						cellular nitrogen compound metabolic process (GO:0034641)|methionine metabolic process (GO:0006555)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	spermidine synthase activity (GO:0004766)|spermine synthase activity (GO:0016768)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(2)	14					Spermine(DB00127)	CGCCGCGCGGCCCCCCAGTCT	0.756																																																0			X											1.0	2.0	1.0					X																	21958888		325	870	1195	21868809	SO:0001623	5_prime_UTR_variant	6611			AD001528	CCDS14203.1, CCDS59161.1	Xp22.1	2014-05-16			ENSG00000102172	ENSG00000102172			11123	protein-coding gene	gene with protein product		300105	"""Snyder-Robinson X-linked mental retardation syndrome"""	SRS		7546290, 9299240, 14508504	Standard	NM_004595		Approved	SPMSY, SpS, MRSR	uc004dag.4	P52788	OTTHUMG00000021239	ENST00000404933.2:c.-55C>A	X.37:g.21958888C>A		Somatic		Capture	Illumina GAIIx	4	21868809	A6NHA7|A6NI34|B2R9M0|O00544|Q9UQS1	Silent	SNP	HMMPfam_Spermine_synth,superfamily_S-adenosyl-L-methionine-dependent methyltransferases,PatternScan_SPERMIDINE_SYNTHASE_1	p.G17	ENST00000404933.2	37	c.51	CCDS14203.1	X																																																																																			-	NULL		0.756	SMS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMS	protein_coding	OTTHUMT00000056032.1	C	NM_004595		21868809	+1	no_start_codon	ENST00000265782	ensembl	human	known	54_36p	silent	SNP	0.903	A
ABCC9	10060	genome.wustl.edu	37	12	22012569	22012569	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr12:22012569C>A	ENST00000261201.4	-	20	2455	c.2456G>T	c.(2455-2457)aGa>aTa	p.R819I	RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000261200.4_Missense_Mutation_p.R819I|ABCC9_ENST00000345162.2_Missense_Mutation_p.R783I	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	819	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CACACAGATTCTCTGCCTCTG	0.403																																																0			12											188.0	187.0	187.0					12																	22012569		2203	4300	6503	21903836	SO:0001583	missense	10060			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2456G>T	12.37:g.22012569C>A	ENSP00000261201:p.Arg819Ile	Somatic		Capture	Illumina GAIIx	4	21903836	O60707	Missense_Mutation	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.R819I	ENST00000261201.4	37	c.2456	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914868	0.92178	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57	4.71	4.71	0.59529	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96278	0.8786	H	0.95745	3.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.994;1.0	D	0.97585	1.0113	10	0.87932	D	0	-17.83	17.8397	0.88712	0.0:1.0:0.0:0.0	.	819;819	O60706;O60706-2	ABCC9_HUMAN;.	I	819;446;819;783	ENSP00000261200:R819I;ENSP00000440521:R446I;ENSP00000261201:R819I;ENSP00000261202:R783I	ENSP00000261200:R819I	R	-	2	0	ABCC9	21903836	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.638000	0.83328	2.449000	0.82847	0.467000	0.42956	AGA	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1		0.403	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	protein_coding	OTTHUMT00000402230.1	C	NM_005691		21903836	-1	no_errors	NM_005691	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ANO5	203859	genome.wustl.edu	37	11	22261148	22261148	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr11:22261148C>T	ENST00000324559.8	+	9	1113	c.796C>T	c.(796-798)Cct>Tct	p.P266S		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	266					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACCTCCCAATCCTACCAATGA	0.403																																																0			11											143.0	146.0	145.0					11																	22261148		2203	4300	6503	22217724	SO:0001583	missense	203859			AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.796C>T	11.37:g.22261148C>T	ENSP00000315371:p.Pro266Ser	Somatic		Capture	Illumina GAIIx	4	22217724		Missense_Mutation	SNP	HMMPfam_DUF590	p.P266S	ENST00000324559.8	37	c.796	CCDS31444.1	11	.	.	.	.	.	.	.	.	.	.	C	5.348	0.249448	0.10130	.	.	ENSG00000171714	ENST00000324559	T	0.69175	-0.38	6.02	3.95	0.45737	.	0.277370	0.47093	D	0.000242	T	0.49813	0.1579	L	0.50333	1.59	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.26326	-1.0106	10	0.09338	T	0.73	.	2.4078	0.04417	0.2369:0.4737:0.0:0.2894	.	266	Q75V66	ANO5_HUMAN	S	266	ENSP00000315371:P266S	ENSP00000315371:P266S	P	+	1	0	ANO5	22217724	0.754000	0.28360	0.383000	0.26132	0.773000	0.43773	2.054000	0.41335	1.554000	0.49487	0.650000	0.86243	CCT	-	NULL		0.403	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO5	protein_coding	OTTHUMT00000387615.1	C	NM_213599		22217724	+1	no_errors	NM_213599	genbank	human	validated	54_36p	missense	SNP	0.460	T
PRMT5	10419	genome.wustl.edu	37	14	23395460	23395460	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr14:23395460C>T	ENST00000324366.8	-	7	882	c.659G>A	c.(658-660)cGc>cAc	p.R220H	PRMT5-AS1_ENST00000609885.1_RNA|PRMT5-AS1_ENST00000424245.2_RNA|PRMT5_ENST00000397441.2_Missense_Mutation_p.R203H|PRMT5-AS1_ENST00000457443.2_RNA|PRMT5_ENST00000538452.1_Missense_Mutation_p.R114H|PRMT5-AS1_ENST00000599580.2_RNA|PRMT5-AS1_ENST00000595662.1_RNA|PRMT5_ENST00000553897.1_Missense_Mutation_p.R176H|PRMT5_ENST00000216350.8_Missense_Mutation_p.R159H|PRMT5-AS1_ENST00000590290.1_RNA|PRMT5_ENST00000397440.4_Intron|PRMT5_ENST00000553641.1_5'UTR|PRMT5-AS1_ENST00000587245.2_RNA	NM_006109.3	NP_006100.2	O14744	ANM5_HUMAN	protein arginine methyltransferase 5	220	TIM barrel. {ECO:0000269|PubMed:23071334}.				cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|endothelial cell activation (GO:0042118)|gene expression (GO:0010467)|histone H4-R3 methylation (GO:0043985)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|peptidyl-arginine N-methylation (GO:0035246)|regulation of mitosis (GO:0007088)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|histone-arginine N-methyltransferase activity (GO:0008469)|methyltransferase activity (GO:0008168)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|transcription corepressor activity (GO:0003714)			endometrium(4)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	25	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		CCCAAGCCAGCGATCAATGAC	0.478																																																0			14											90.0	94.0	93.0					14																	23395460		2203	4300	6503	22465300	SO:0001583	missense	10419			AF015913	CCDS9579.1, CCDS41922.1, CCDS61394.1, CCDS61395.1, CCDS61396.1	14q11.2	2014-06-12	2006-02-16	2006-02-16	ENSG00000100462	ENSG00000100462	2.1.1.125	"""Protein arginine methyltransferases"""	10894	protein-coding gene	gene with protein product		604045	"""skb1 (S. pombe) homolog"", ""SKB1 homolog (S. pombe)"""	HRMT1L5, SKB1		9843966	Standard	NM_001282955		Approved	SKB1Hs	uc001whm.1	O14744	OTTHUMG00000028709	ENST00000324366.8:c.659G>A	14.37:g.23395460C>T	ENSP00000319169:p.Arg220His	Somatic		Capture	Illumina GAIIx	4	22465300	A8MTP3|A8MZ91|B4DX49|B4DY30|B5BU10|D3DS33|E2QRE7|Q6IBR1|Q9UKH1	Missense_Mutation	SNP	HMMPfam_PRMT5,superfamily_S-adenosyl-L-methionine-dependent methyltransferases	p.R220H	ENST00000324366.8	37	c.659	CCDS9579.1	14	.	.	.	.	.	.	.	.	.	.	C	29.4	5.003889	0.93287	.	.	ENSG00000100462	ENST00000324366;ENST00000397441;ENST00000216350;ENST00000538452;ENST00000553897;ENST00000555530;ENST00000554867;ENST00000556616	.	.	.	5.47	5.47	0.80525	.	0.047762	0.85682	D	0.000000	D	0.86797	0.6019	M	0.94063	3.49	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.77004	0.986;0.989;0.985;0.982	D	0.89787	0.3965	9	0.87932	D	0	-8.4532	18.472	0.90778	0.0:1.0:0.0:0.0	.	176;159;220;203	G3V5W5;B4DX49;O14744;A8MZ91	.;.;ANM5_HUMAN;.	H	220;203;159;114;176;115;175;182	.	ENSP00000216350:R159H	R	-	2	0	PRMT5	22465300	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.364000	0.66110	2.724000	0.93272	0.561000	0.74099	CGC	-	HMMPfam_PRMT5		0.478	PRMT5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT5	protein_coding	OTTHUMT00000071674.3	C			22465300	-1	no_errors	NM_006109	genbank	human	validated	54_36p	missense	SNP	1.000	T
SUSD2	56241	genome.wustl.edu	37	22	24583262	24583262	+	Missense_Mutation	SNP	A	A	G	rs199745266		TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr22:24583262A>G	ENST00000358321.3	+	11	1996	c.1735A>G	c.(1735-1737)Agt>Ggt	p.S579G		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	579	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CCCGTTCCTGAGTGTGTCCGT	0.657																																																0			22											164.0	128.0	140.0					22																	24583262		2203	4300	6503	22913262	SO:0001583	missense	56241			AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.1735A>G	22.37:g.24583262A>G	ENSP00000351075:p.Ser579Gly	Somatic		Capture	Illumina GAIIx	4	22913262	Q9H5Y6	Missense_Mutation	SNP	HMMSmart_SO,HMMPfam_Somatomedin_B,superfamily_SSF90188,PatternScan_SMB_1,HMMSmart_AMOP,HMMPfam_AMOP,HMMSmart_VWD,HMMPfam_VWD,superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP	p.S579G	ENST00000358321.3	37	c.1735	CCDS13824.1	22	.	.	.	.	.	.	.	.	.	.	A	11.00	1.510764	0.27036	.	.	ENSG00000099994	ENST00000358321	T	0.61158	0.13	4.49	3.43	0.39272	von Willebrand factor, type D domain (3);	0.203120	0.51477	D	0.000089	T	0.64472	0.2601	L	0.57536	1.79	0.33107	D	0.539996	D	0.64830	0.994	P	0.59357	0.856	T	0.70594	-0.4829	10	0.39692	T	0.17	-22.0675	8.842	0.35148	0.8319:0.0:0.0:0.1681	.	579	Q9UGT4	SUSD2_HUMAN	G	579	ENSP00000351075:S579G	ENSP00000351075:S579G	S	+	1	0	SUSD2	22913262	1.000000	0.71417	0.992000	0.48379	0.021000	0.10359	2.070000	0.41491	0.670000	0.31165	-0.522000	0.04353	AGT	-	HMMSmart_VWD,HMMPfam_VWD		0.657	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD2	protein_coding	OTTHUMT00000320088.1	A	NM_019601		22913262	+1	no_errors	NM_019601	genbank	human	validated	54_36p	missense	SNP	0.956	G
HIST1H3D	8351	genome.wustl.edu	37	6	26197305	26197305	+	Silent	SNP	C	C	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr6:26197305C>G	ENST00000356476.2	-	1	173	c.174G>C	c.(172-174)tcG>tcC	p.S58S	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000377831.5_Silent_p.S58S			P68431	H31_HUMAN	histone cluster 1, H3d	58					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)	14		all_hematologic(11;0.196)				GCAGCTCGGTCGACTTCTGGT	0.627																																					GBM(108;3816 4467)											0			6											62.0	64.0	63.0					6																	26197305		2203	4300	6503	26305284	SO:0001819	synonymous_variant	8351			Z80784	CCDS4590.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197409	ENSG00000197409		"""Histones / Replication-dependent"""	4767	protein-coding gene	gene with protein product		602811	"""H3 histone family, member B"", ""histone 1, H3d"""	H3FB		9119399, 12408966	Standard	NM_003530		Approved	H3/b	uc003ngv.4	P68431	OTTHUMG00000014433	ENST00000356476.2:c.174G>C	6.37:g.26197305C>G		Somatic		Capture	Illumina GAIIx	4	26305284	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	superfamily_Histone-fold,PatternScan_HISTONE_H3_1,HMMSmart_SM00428,HMMPfam_Histone,PatternScan_HISTONE_H3_2	p.S58	ENST00000356476.2	37	c.174	CCDS4590.1	6																																																																																			-	superfamily_Histone-fold,HMMSmart_SM00428,HMMPfam_Histone		0.627	HIST1H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3D	protein_coding	OTTHUMT00000040096.1	C	NM_003530		26305284	-1	no_errors	NM_003530	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
PRR30	339779	genome.wustl.edu	37	2	27360035	27360035	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr2:27360035G>T	ENST00000335524.3	-	3	1688	c.1163C>A	c.(1162-1164)tCc>tAc	p.S388Y	PREB_ENST00000260643.2_5'Flank|PREB_ENST00000416802.1_5'Flank|PREB_ENST00000406567.3_5'Flank	NM_178553.3	NP_848648.2	Q53SZ7	PRR30_HUMAN		388										cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGCTTCAGGGAGGTAGTGAC	0.587																																																0			2											86.0	94.0	91.0					2																	27360035		2203	4300	6503	27213539	SO:0001583	missense	339779																														ENST00000335524.3:c.1163C>A	2.37:g.27360035G>T	ENSP00000335017:p.Ser388Tyr	Somatic		Capture	Illumina GAIIx	4	27213539	Q86UE2	Missense_Mutation	SNP	NULL	p.S388Y	ENST00000335524.3	37	c.1163	CCDS1739.1	2	.	.	.	.	.	.	.	.	.	.	G	3.889	-0.024451	0.07589	.	.	ENSG00000186143	ENST00000335524	T	0.39997	1.05	4.85	1.81	0.25067	.	0.000000	0.35525	N	0.003153	T	0.29389	0.0732	L	0.29908	0.895	0.09310	N	1	P	0.44044	0.825	P	0.44897	0.463	T	0.12604	-1.0541	10	0.66056	D	0.02	-1.6215	3.2806	0.06913	0.2224:0.0:0.5705:0.2071	.	388	Q53SZ7	CB053_HUMAN	Y	388	ENSP00000335017:S388Y	ENSP00000335017:S388Y	S	-	2	0	C2orf53	27213539	0.004000	0.15560	0.008000	0.14137	0.097000	0.18754	0.076000	0.14712	0.631000	0.30412	-0.258000	0.10820	TCC	-	NULL		0.587	C2orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf53	protein_coding	OTTHUMT00000250188.1	G			27213539	-1	no_errors	NM_178553	genbank	human	validated	54_36p	missense	SNP	0.001	T
GPR3	2827	genome.wustl.edu	37	1	27720935	27720935	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr1:27720935G>C	ENST00000374024.3	+	2	732	c.633G>C	c.(631-633)caG>caC	p.Q211H		NM_005281.3	NP_005272.1	P46089	GPR3_HUMAN	G protein-coupled receptor 3	211					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|regulation of meiosis (GO:0040020)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(3)|ovary(1)|skin(1)	8		Breast(348;1.53e-05)|Ovarian(437;0.0606)|all_lung(284;0.157)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.81e-26)|Colorectal(126;1.24e-08)|KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;4.45e-06)|Lung(427;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|LUSC - Lung squamous cell carcinoma(448;0.008)|READ - Rectum adenocarcinoma(331;0.0419)		TCATGCTGCAGCTCTACGCCC	0.582																																																0			1											190.0	165.0	173.0					1																	27720935		2203	4300	6503	27593522	SO:0001583	missense	2827			BC032702	CCDS303.1	1p36.1-p35	2012-08-21			ENSG00000181773	ENSG00000181773		"""GPCR / Class A : Orphans"""	4484	protein-coding gene	gene with protein product		600241				7851889	Standard	NM_005281		Approved	ACCA	uc001bod.4	P46089	OTTHUMG00000003397	ENST00000374024.3:c.633G>C	1.37:g.27720935G>C	ENSP00000363136:p.Gln211His	Somatic		Capture	Illumina GAIIx	4	27593522	A8K570	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.Q211H	ENST00000374024.3	37	c.633	CCDS303.1	1	.	.	.	.	.	.	.	.	.	.	G	9.307	1.054650	0.19907	.	.	ENSG00000181773	ENST00000374024	T	0.36878	1.23	5.64	3.6	0.41247	GPCR, rhodopsin-like superfamily (1);	0.072221	0.56097	D	0.000026	T	0.23688	0.0573	L	0.28504	0.86	0.47778	D	0.999516	B	0.10296	0.003	B	0.08055	0.003	T	0.08597	-1.0714	10	0.59425	D	0.04	.	5.9119	0.19033	0.1632:0.0:0.6845:0.1522	.	211	P46089	GPR3_HUMAN	H	211	ENSP00000363136:Q211H	ENSP00000363136:Q211H	Q	+	3	2	GPR3	27593522	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.942000	0.49018	1.317000	0.45149	0.462000	0.41574	CAG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.582	GPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR3	protein_coding	OTTHUMT00000009522.1	G	NM_005281		27593522	+1	no_errors	NM_005281	genbank	human	provisional	54_36p	missense	SNP	1.000	C
OR10C1	442194	genome.wustl.edu	37	6	29408282	29408282	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr6:29408282T>C	ENST00000444197.2	+	1	1200	c.490T>C	c.(490-492)Tct>Cct	p.S164P	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TTTCATCTTCTCTTTGCCCTT	0.602																																																0			6											114.0	128.0	123.0					6																	29408282		1510	2709	4219	29516261	SO:0001583	missense	442194				CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.490T>C	6.37:g.29408282T>C	ENSP00000419119:p.Ser164Pro	Somatic		Capture	Illumina GAIIx	4	29516261	Q5SUN7|Q96R18	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S164P	ENST00000444197.2	37	c.490	CCDS34364.1	6	.	.	.	.	.	.	.	.	.	.	T	12.63	1.995885	0.35226	.	.	ENSG00000206474	ENST00000444197	T	0.00174	8.62	3.53	2.29	0.28610	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38778	N	0.001565	T	0.00144	0.0004	L	0.58669	1.825	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.35076	-0.9803	10	0.72032	D	0.01	.	3.3068	0.07002	0.1754:0.1989:0.0:0.6257	.	164	Q96KK4	O10C1_HUMAN	P	164	ENSP00000419119:S164P	ENSP00000419119:S164P	S	+	1	0	OR10C1	29516261	0.000000	0.05858	1.000000	0.80357	0.497000	0.33675	-2.245000	0.01192	1.473000	0.48159	0.416000	0.27883	TCT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.602	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10C1	protein_coding	OTTHUMT00000076415.2	T			29516261	+1	no_errors	NM_013941	genbank	human	provisional	54_36p	missense	SNP	0.007	C
ITGAX	3687	genome.wustl.edu	37	16	31388219	31388219	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr16:31388219T>A	ENST00000268296.4	+	21	2729	c.2608T>A	c.(2608-2610)Ttc>Atc	p.F870I	ITGAX_ENST00000562522.1_Missense_Mutation_p.F870I	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	870					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CCACCTCATCTTCCGTGGCGG	0.612																																																0			16											92.0	88.0	89.0					16																	31388219		2197	4300	6497	31295720	SO:0001583	missense	3687			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2608T>A	16.37:g.31388219T>A	ENSP00000268296:p.Phe870Ile	Somatic		Capture	Illumina GAIIx	4	31295720	Q8IVA6	Missense_Mutation	SNP	superfamily_SSF69318,HMMSmart_Int_alpha,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_SSF69179,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.F870I	ENST00000268296.4	37	c.2608	CCDS10711.1	16	.	.	.	.	.	.	.	.	.	.	T	14.00	2.403685	0.42613	.	.	ENSG00000140678	ENST00000268296	T	0.54071	0.59	4.33	2.05	0.26809	Integrin alpha-2 (1);	.	.	.	.	T	0.67249	0.2873	M	0.76170	2.325	0.27492	N	0.952244	D;D	0.76494	0.975;0.999	P;D	0.72338	0.854;0.977	T	0.56613	-0.7950	9	0.87932	D	0	.	6.824	0.23872	0.0:0.1956:0.0:0.8044	.	870;55	P20702;Q8TES5	ITAX_HUMAN;.	I	870	ENSP00000268296:F870I	ENSP00000268296:F870I	F	+	1	0	ITGAX	31295720	0.991000	0.36638	0.996000	0.52242	0.138000	0.21146	0.129000	0.15830	0.306000	0.22856	0.321000	0.21382	TTC	-	HMMPfam_Integrin_alpha2,superfamily_SSF69179		0.612	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	protein_coding	OTTHUMT00000255628.2	T	NM_000887		31295720	+1	no_errors	NM_000887	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CSNK2B	1460	genome.wustl.edu	37	6	31637142	31637142	+	Silent	SNP	C	C	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr6:31637142C>G	ENST00000375882.2	+	6	570	c.414C>G	c.(412-414)ccC>ccG	p.P138P	CSNK2B_ENST00000375865.2_Silent_p.P138P|LY6G5B_ENST00000409525.1_5'Flank|CSNK2B-LY6G5B-1181_ENST00000375880.2_Silent_p.P138P|CSNK2B_ENST00000375885.4_Silent_p.P157P|LY6G5B_ENST00000375864.4_5'Flank|CSNK2B_ENST00000375866.2_Silent_p.P138P	NM_001282385.1|NM_001320.5	NP_001269314.1|NP_001311.3	P67870	CSK2B_HUMAN	casein kinase 2, beta polypeptide	138					adiponectin-activated signaling pathway (GO:0033211)|axon guidance (GO:0007411)|cellular protein complex assembly (GO:0043623)|endothelial tube morphogenesis (GO:0061154)|mitotic cell cycle (GO:0000278)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell proliferation (GO:0008285)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|protein phosphorylation (GO:0006468)|regulation of DNA binding (GO:0051101)|regulation of protein kinase activity (GO:0045859)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein kinase CK2 complex (GO:0005956)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein kinase regulator activity (GO:0019887)|receptor binding (GO:0005102)|transcription factor binding (GO:0008134)			central_nervous_system(5)|endometrium(1)|large_intestine(2)|liver(1)|urinary_tract(1)	10						TCTACTGCCCCAAGTGCATGG	0.547																																																0			6											87.0	69.0	76.0					6																	31637142		2203	4300	6503	31745121	SO:0001819	synonymous_variant	1460			M30448	CCDS4712.1	6p21.33	2013-01-17			ENSG00000204435	ENSG00000204435	2.7.11.1		2460	protein-coding gene	gene with protein product		115441				2276748, 9503014	Standard	NM_001320		Approved		uc003nvr.1	P67870	OTTHUMG00000177888	ENST00000375882.2:c.414C>G	6.37:g.31637142C>G		Somatic		Capture	Illumina GAIIx	4	31745121	B0UXA9|P07312|P13862|Q4VX47	Silent	SNP	superfamily_Casein kinase II beta subunit,HMMPfam_CK_II_beta,PatternScan_CK2_BETA	p.P138	ENST00000375882.2	37	c.414	CCDS4712.1	6																																																																																			-	superfamily_Casein kinase II beta subunit,HMMPfam_CK_II_beta,PatternScan_CK2_BETA		0.547	CSNK2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK2B	protein_coding	OTTHUMT00000076063.8	C	NM_001320		31745121	+1	no_errors	NM_001320	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
C4A	720	genome.wustl.edu	37	6	31963527	31963527	+	Silent	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr6:31963527G>A	ENST00000428956.2	+	25	3270	c.3186G>A	c.(3184-3186)gcG>gcA	p.A1062A	C4A_ENST00000498271.1_Silent_p.A1062A	NM_007293.2	NP_009224.2	P0C0L4	CO4A_HUMAN	complement component 4A (Rodgers blood group)	1062					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement component C1q binding (GO:0001849)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	TTCGGAAGGCGGATGGTTCCT	0.617																																																0			6											74.0	62.0	67.0					6																	31963527		1498	2653	4151	32071506	SO:0001819	synonymous_variant	721			L26261, M14823, X77491, AY224378	CCDS47404.1, CCDS59005.1	6p21.3	2014-09-17	2006-01-19		ENSG00000244731	ENSG00000244731		"""Blood group antigens"", ""Complement system"""	1323	protein-coding gene	gene with protein product		120810	"""complement component 4A"""				Standard	NM_001252204		Approved	CPAMD2, C4S, CO4, C4, C4A3, C4A2, C4A4, C4A6, C4B, RG		P0C0L4	OTTHUMG00000031186	ENST00000428956.2:c.3186G>A	6.37:g.31963527G>A		Somatic		Capture	Illumina GAIIx	4	32071506	A6H8M8|A6NHJ5|A7E2V2|B0QZR6|B0V2C8|B2RUT6|B7ZVZ6|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q4LE82|Q5JNX2|Q5JQM8|Q6P4R1|Q6U2E5|Q6U2E8|Q6U2F0|Q6U2F3|Q6U2F4|Q6U2F6|Q6U2F8|Q6U2G0|Q96EG2|Q96SA8|Q9NPK5|Q9UIP5	Silent	SNP	HMMPfam_A2M_N,HMMPfam_A2M_N_2,superfamily_Anaphylatoxin,HMMPfam_ANATO,HMMSmart_ANATO,PatternScan_ANAPHYLATOXIN_1,HMMPfam_A2M,superfamily_Terp_cyc_toroid,HMMPfam_Thiol-ester_cl,PatternScan_ALPHA_2_MACROGLOBULIN,HMMPfam_A2M_comp,superfamily_AM_receptor_bind,HMMPfam_A2M_recep,HMMSmart_C345C,HMMPfam_NTR	p.A1062	ENST00000428956.2	37	c.3186	CCDS47404.1	6																																																																																			-	superfamily_Terp_cyc_toroid,HMMPfam_A2M_comp		0.617	C4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4B	protein_coding	OTTHUMT00000076364.3	G	NM_007293		32071506	+1	no_errors	NM_001002029	genbank	human	reviewed	54_36p	silent	SNP	0.154	A
ARHGAP12	94134	genome.wustl.edu	37	10	32197759	32197759	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr10:32197759T>G	ENST00000344936.2	-	3	259	c.25A>C	c.(25-27)Aag>Cag	p.K9Q	ARHGAP12_ENST00000375245.4_Missense_Mutation_p.K9Q|ARHGAP12_ENST00000311380.4_Missense_Mutation_p.K9Q|ARHGAP12_ENST00000375250.5_Missense_Mutation_p.K9Q|ARHGAP12_ENST00000396144.4_Missense_Mutation_p.K9Q	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	9					morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				GGAATAATCTTCCCACTTCTG	0.353																																																0			10											150.0	145.0	147.0					10																	32197759		2202	4300	6502	32237765	SO:0001583	missense	94134			AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.25A>C	10.37:g.32197759T>G	ENSP00000345808:p.Lys9Gln	Somatic		Capture	Illumina GAIIx	4	32237765	B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Missense_Mutation	SNP	superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.K9Q	ENST00000344936.2	37	c.25	CCDS7170.1	10	.	.	.	.	.	.	.	.	.	.	T	12.36	1.915483	0.33815	.	.	ENSG00000165322	ENST00000311380;ENST00000375250;ENST00000344936;ENST00000396144;ENST00000375245	T;T;T;T;T	0.08720	3.11;3.06;3.11;3.11;3.11	5.73	5.73	0.89815	.	0.560095	0.19277	N	0.118257	T	0.10165	0.0249	L	0.44542	1.39	0.28603	N	0.909034	B;B;B;B;B;P	0.41188	0.181;0.381;0.321;0.381;0.381;0.741	B;B;B;B;B;B	0.37091	0.1;0.101;0.206;0.101;0.101;0.241	T	0.05115	-1.0905	10	0.59425	D	0.04	.	16.013	0.80417	0.0:0.0:0.0:1.0	.	9;9;9;9;9;9	Q1RLN5;B3KR88;Q8IWW6-2;Q504X1;Q8IWW6;Q8IWW6-3	.;.;.;.;RHG12_HUMAN;.	Q	9	ENSP00000310984:K9Q;ENSP00000364399:K9Q;ENSP00000345808:K9Q;ENSP00000379448:K9Q;ENSP00000364394:K9Q	ENSP00000310984:K9Q	K	-	1	0	ARHGAP12	32237765	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	3.638000	0.54332	2.183000	0.69458	0.528000	0.53228	AAG	-	NULL		0.353	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	ARHGAP12	protein_coding	OTTHUMT00000047465.1	T			32237765	-1	no_errors	NM_018287	genbank	human	provisional	54_36p	missense	SNP	0.994	G
PBX2	5089	genome.wustl.edu	37	6	32156101	32156101	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr6:32156101G>C	ENST00000375050.4	-	3	746	c.476C>G	c.(475-477)tCg>tGg	p.S159W	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	159					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						GCGATAGTCCGAGTGTTCGAT	0.607																																																0			6											72.0	77.0	75.0					6																	32156101		2203	4300	6503	32264079	SO:0001583	missense	5089				CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.476C>G	6.37:g.32156101G>C	ENSP00000364190:p.Ser159Trp	Somatic		Capture	Illumina GAIIx	4	32264079	A2BFJ2	Missense_Mutation	SNP	HMMPfam_PBC,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.S159W	ENST00000375050.4	37	c.476	CCDS4748.1	6	.	.	.	.	.	.	.	.	.	.	G	24.0	4.487525	0.84854	.	.	ENSG00000204304	ENST00000375050	T	0.34072	1.38	4.89	4.89	0.63831	PBX (1);	0.000000	0.64402	D	0.000019	T	0.56717	0.2004	M	0.82923	2.615	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.972;0.999	T	0.64732	-0.6338	10	0.87932	D	0	-22.2054	15.5467	0.76108	0.0:0.0:1.0:0.0	.	159;159	Q7KZE5;P40425	.;PBX2_HUMAN	W	159	ENSP00000364190:S159W	ENSP00000364190:S159W	S	-	2	0	PBX2	32264079	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	9.450000	0.97607	2.257000	0.74773	0.462000	0.41574	TCG	-	HMMPfam_PBC		0.607	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PBX2	protein_coding	OTTHUMT00000076194.4	G			32264079	-1	no_errors	NM_002586	genbank	human	reviewed	54_36p	missense	SNP	0.999	C
ASIP	434	genome.wustl.edu	37	20	32856961	32856961	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr20:32856961C>G	ENST00000568305.1	+	4	589	c.387C>G	c.(385-387)agC>agG	p.S129R	RP4-785G19.5_ENST00000512005.1_RNA|ASIP_ENST00000374954.3_Missense_Mutation_p.S129R			P42127	ASIP_HUMAN	agouti signaling protein	129	Agouti. {ECO:0000255|PROSITE- ProRule:PRU00494}.				adult feeding behavior (GO:0008343)|cell-cell signaling (GO:0007267)|generation of precursor metabolites and energy (GO:0006091)|genetic imprinting (GO:0071514)|hormone-mediated signaling pathway (GO:0009755)|melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|regulation of molecular function, epigenetic (GO:0040030)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)			central_nervous_system(1)|lung(2)	3						GCGTGCTCAGCCTCAACTGCT	0.736																																																0			20											4.0	4.0	4.0					20																	32856961		1851	3700	5551	32320622	SO:0001583	missense	434				CCDS13232.1	20q11.2-q12	2010-06-24	2010-06-24		ENSG00000101440	ENSG00000101440			745	protein-coding gene	gene with protein product	"""nonagouti homolog (mouse)"""	600201	"""agouti (mouse)-signaling protein"", ""agouti signaling protein, nonagouti homolog (mouse)"""	AGTIL		7937887, 7757071	Standard	NM_001672		Approved	ASP	uc002xah.1	P42127	OTTHUMG00000032289	ENST00000568305.1:c.387C>G	20.37:g.32856961C>G	ENSP00000454804:p.Ser129Arg	Somatic		Capture	Illumina GAIIx	4	32320622	Q3SXL2	Missense_Mutation	SNP	HMMPfam_Agouti,HMMSmart_Agouti,superfamily_Agouti,PatternScan_AGOUTI_1	p.S129R	ENST00000568305.1	37	c.387	CCDS13232.1	20	.	.	.	.	.	.	.	.	.	.	C	6.212	0.407189	0.11754	.	.	ENSG00000101440	ENST00000374954	T	0.30981	1.51	4.72	0.45	0.16624	.	0.506742	0.19121	N	0.122193	T	0.13243	0.0321	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.12192	-1.0557	10	0.48119	T	0.1	-6.9426	1.5483	0.02569	0.1702:0.4807:0.1655:0.1835	.	129	P42127	ASIP_HUMAN	R	129	ENSP00000364092:S129R	ENSP00000364092:S129R	S	+	3	2	ASIP	32320622	0.000000	0.05858	0.007000	0.13788	0.056000	0.15407	0.232000	0.17891	0.615000	0.30124	0.485000	0.47835	AGC	-	superfamily_Agouti,PatternScan_AGOUTI_1		0.736	ASIP-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ASIP	protein_coding	OTTHUMT00000430541.1	C			32320622	+1	no_errors	NM_001672	genbank	human	reviewed	54_36p	missense	SNP	0.002	G
LHX1	3975	genome.wustl.edu	37	17	35300290	35300290	+	Silent	SNP	G	G	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr17:35300290G>T	ENST00000254457.5	+	5	2494	c.1083G>T	c.(1081-1083)ctG>ctT	p.L361L	RP11-445F12.2_ENST00000607336.1_RNA	NM_005568.3	NP_005559.2	P48742	LHX1_HUMAN	LIM homeobox 1	361					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell signaling (GO:0007267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|cerebellum development (GO:0021549)|cervix development (GO:0060067)|comma-shaped body morphogenesis (GO:0072049)|dorsal/ventral pattern formation (GO:0009953)|ectoderm formation (GO:0001705)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic viscerocranium morphogenesis (GO:0048703)|endoderm formation (GO:0001706)|epithelium development (GO:0060429)|forebrain regionalization (GO:0021871)|gastrulation with mouth forming second (GO:0001702)|head development (GO:0060322)|horizontal cell localization (GO:0035852)|kidney development (GO:0001822)|lateral motor column neuron migration (GO:0097477)|mesonephric duct development (GO:0072177)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerulus development (GO:0072224)|metanephric part of ureteric bud development (GO:0035502)|metanephric renal vesicle morphogenesis (GO:0072283)|metanephric S-shaped body morphogenesis (GO:0072284)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct elongation (GO:0035849)|nephric duct morphogenesis (GO:0072178)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|oviduct development (GO:0060066)|oviduct epithelium development (GO:0035846)|paramesonephric duct development (GO:0061205)|pattern specification process (GO:0007389)|positive regulation of anterior head development (GO:2000744)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primitive streak formation (GO:0090009)|pronephros development (GO:0048793)|regulation of gene expression (GO:0010468)|renal vesicle morphogenesis (GO:0072077)|retina layer formation (GO:0010842)|S-shaped body morphogenesis (GO:0072050)|somite rostral/caudal axis specification (GO:0032525)|spinal cord association neuron differentiation (GO:0021527)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)|uterine epithelium development (GO:0035847)|uterus development (GO:0060065)|vagina development (GO:0060068)|ventral spinal cord development (GO:0021517)	nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.L361L(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Breast(25;0.00607)				AGCCCAGCCTGCCCGGGCCTC	0.716																																																1	Substitution - coding silent(1)	lung(1)	17											10.0	14.0	13.0					17																	35300290		2160	4237	6397	32374403	SO:0001819	synonymous_variant	3975			U14755	CCDS11316.1	17q12	2014-04-11			ENSG00000132130	ENSG00000273706		"""Homeoboxes / LIM class"""	6593	protein-coding gene	gene with protein product		601999				9212161	Standard	NM_005568		Approved	LIM-1, LIM1	uc002hnh.2	P48742	OTTHUMG00000188456	ENST00000254457.5:c.1083G>T	17.37:g.35300290G>T		Somatic		Capture	Illumina GAIIx	4	32374403	Q3MIW0	Silent	SNP	superfamily_SSF57716,HMMSmart_LIM,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM,superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.L361	ENST00000254457.5	37	c.1083	CCDS11316.1	17																																																																																			-	NULL		0.716	LHX1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LHX1	protein_coding	OTTHUMT00000256704.3	G	NM_005568		32374403	+1	no_errors	NM_005568	genbank	human	reviewed	54_36p	silent	SNP	0.977	T
ZBTB22	9278	genome.wustl.edu	37	6	33282987	33282987	+	Silent	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr6:33282987C>T	ENST00000431845.2	-	2	1858	c.1707G>A	c.(1705-1707)ctG>ctA	p.L569L	TAPBP_ENST00000434618.2_5'Flank|TAPBP_ENST00000426633.2_5'Flank|ZBTB22_ENST00000418724.1_Silent_p.L569L|TAPBP_ENST00000456592.2_5'Flank|TAPBP_ENST00000489157.1_5'Flank|TAPBP_ENST00000475304.1_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	569					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						CGACCCCGCCCAGGCGGTGCC	0.687																																																0			6											26.0	30.0	28.0					6																	33282987		2200	4296	6496	33390965	SO:0001819	synonymous_variant	9278			Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.1707G>A	6.37:g.33282987C>T		Somatic		Capture	Illumina GAIIx	4	33390965	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Silent	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.L569	ENST00000431845.2	37	c.1707	CCDS4775.1	6																																																																																			-	superfamily_C2H2 and C2HC zinc fingers		0.687	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB22	protein_coding	OTTHUMT00000076183.2	C			33390965	-1	no_errors	NM_005453	genbank	human	validated	54_36p	silent	SNP	1.000	T
SLC1A2	6506	genome.wustl.edu	37	11	35327661	35327661	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr11:35327661G>C	ENST00000278379.3	-	5	972	c.690C>G	c.(688-690)atC>atG	p.I230M	SLC1A2_ENST00000606205.1_Missense_Mutation_p.I230M|SLC1A2_ENST00000395750.1_Missense_Mutation_p.I221M|SLC1A2_ENST00000395753.1_Missense_Mutation_p.I221M	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	230					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			GGCCCTTCTTGATAACCATCT	0.572											OREG0020883	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)											0			11											153.0	119.0	130.0					11																	35327661		2202	4298	6500	35284237	SO:0001583	missense	6506			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.690C>G	11.37:g.35327661G>C	ENSP00000278379:p.Ile230Met	Somatic	854	Capture	Illumina GAIIx	4	35284237	B4DQE9|Q14417|Q541G6|U3KQQ4	Missense_Mutation	SNP	HMMPfam_SDF,PatternScan_NA_DICARBOXYL_SYMP_1,PatternScan_NA_DICARBOXYL_SYMP_2	p.I230M	ENST00000278379.3	37	c.690	CCDS31459.1	11	.	.	.	.	.	.	.	.	.	.	G	9.384	1.073724	0.20147	.	.	ENSG00000110436	ENST00000278379;ENST00000395750;ENST00000395753	T;T;T	0.56444	0.46;0.47;0.47	5.45	2.54	0.30619	.	0.946576	0.08888	N	0.878983	T	0.36908	0.0984	N	0.17474	0.49	0.49915	D	0.999833	B;B	0.19073	0.033;0.018	B;B	0.23150	0.044;0.044	T	0.08722	-1.0708	10	0.33141	T	0.24	-11.6891	9.2177	0.37358	0.3375:0.0:0.6625:0.0	.	230;230	B4DQE9;P43004	.;EAA2_HUMAN	M	230;221;221	ENSP00000278379:I230M;ENSP00000379099:I221M;ENSP00000379102:I221M	ENSP00000278379:I230M	I	-	3	3	SLC1A2	35284237	1.000000	0.71417	0.982000	0.44146	0.514000	0.34195	2.689000	0.46993	0.790000	0.33803	-0.254000	0.11334	ATC	-	HMMPfam_SDF		0.572	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	SLC1A2	protein_coding	OTTHUMT00000258181.1	G	NM_004171		35284237	-1	no_errors	NM_004171	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
C5orf42	65250	genome.wustl.edu	37	5	37180169	37180169	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr5:37180169A>G	ENST00000508244.1	-	27	5780	c.5687T>C	c.(5686-5688)gTa>gCa	p.V1896A	C5orf42_ENST00000274258.7_Missense_Mutation_p.V776A|C5orf42_ENST00000425232.2_Missense_Mutation_p.V1896A			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1896						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			AAATGCTTCTACTTCTAAAAG	0.259																																																0			5											55.0	61.0	59.0					5																	37180169		2184	4264	6448	37215926	SO:0001583	missense	65250				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.5687T>C	5.37:g.37180169A>G	ENSP00000421690:p.Val1896Ala	Somatic		Capture	Illumina GAIIx	4	37215926	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	NULL	p.V776A	ENST00000508244.1	37	c.2327	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	A	0.028	-1.358107	0.01245	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.23754	1.9;1.9;1.9;1.89	5.5	-3.73	0.04398	.	1.500650	0.04554	N	0.390361	T	0.12178	0.0296	N	0.25647	0.755	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.14578	0.011;0.004	T	0.24083	-1.0170	10	0.02654	T	1	.	2.2987	0.04156	0.3435:0.3861:0.1459:0.1244	.	1896;776	E9PH94;Q9H799	.;CE042_HUMAN	A	1896;1896;776;944;776	ENSP00000421690:V1896A;ENSP00000389014:V1896A;ENSP00000274258:V776A;ENSP00000424223:V944A	ENSP00000274258:V776A	V	-	2	0	C5orf42	37215926	0.190000	0.23276	0.000000	0.03702	0.162000	0.22319	0.245000	0.18142	-0.949000	0.03663	-0.256000	0.11100	GTA	-	NULL		0.259	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	protein_coding	OTTHUMT00000360806.1	A	NM_023073		37215926	-1	no_errors	NM_023073	genbank	human	predicted	54_36p	missense	SNP	0.001	G
ZNF703	80139	genome.wustl.edu	37	8	37553648	37553648	+	Silent	SNP	A	A	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr8:37553648A>C	ENST00000331569.4	+	1	380	c.151A>C	c.(151-153)Agg>Cgg	p.R51R		NM_025069.1	NP_079345.1	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	51					adherens junction assembly (GO:0034333)|cellular response to estradiol stimulus (GO:0071392)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)		FGFR1/ZNF703(2)	breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)	7			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			GCTCCCGATCAGGGTCCTGAA	0.716																																																0			8											17.0	16.0	17.0					8																	37553648		2195	4289	6484	37672806	SO:0001819	synonymous_variant	80139			AK024361	CCDS6094.1	8p12	2008-05-02				ENSG00000183779			25883	protein-coding gene	gene with protein product						15897872	Standard	NM_025069		Approved	FLJ14299, ZNF503L	uc003xjy.1	Q9H7S9		ENST00000331569.4:c.151A>C	8.37:g.37553648A>C		Somatic		Capture	Illumina GAIIx	4	37672806	Q5XG76	Silent	SNP	NULL	p.R51	ENST00000331569.4	37	c.151	CCDS6094.1	8																																																																																			-	NULL		0.716	ZNF703-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF703	protein_coding	OTTHUMT00000376683.2	A	NM_025069		37672806	+1	no_errors	NM_025069	genbank	human	provisional	54_36p	silent	SNP	1.000	C
SCN11A	11280	genome.wustl.edu	37	3	38926838	38926838	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr3:38926838C>T	ENST00000302328.3	-	17	3203	c.3005G>A	c.(3004-3006)gGc>gAc	p.G1002D	SCN11A_ENST00000456224.3_Missense_Mutation_p.G964D|SCN11A_ENST00000444237.2_Missense_Mutation_p.G1002D|SCN11A_ENST00000450244.1_Missense_Mutation_p.G1002D	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1002					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCATCCAAAGCCATCCTGAAG	0.433																																																0			3											161.0	147.0	152.0					3																	38926838		2203	4300	6503	38901842	SO:0001583	missense	11280			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3005G>A	3.37:g.38926838C>T	ENSP00000307599:p.Gly1002Asp	Somatic		Capture	Illumina GAIIx	4	38901842	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc	p.G1002D	ENST00000302328.3	37	c.3005	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	C	5.149	0.213111	0.09757	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63	5.06	-1.73	0.08081	Sodium ion transport-associated (1);	10.251200	0.00481	N	0.000122	T	0.60996	0.2312	N	0.02539	-0.55	0.09310	N	1	B	0.24768	0.111	B	0.26693	0.072	T	0.54801	-0.8239	10	0.45353	T	0.12	.	1.6757	0.02821	0.2581:0.2556:0.3606:0.1257	.	1002	Q9UI33	SCNBA_HUMAN	D	1002;1002;964;1002	ENSP00000307599:G1002D;ENSP00000400945:G1002D;ENSP00000416757:G964D;ENSP00000408028:G1002D	ENSP00000307599:G1002D	G	-	2	0	SCN11A	38901842	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.380000	0.20602	-0.200000	0.10300	-0.998000	0.02512	GGC	-	HMMPfam_Na_trans_assoc,superfamily_Voltage-gated potassium channels		0.433	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	protein_coding	OTTHUMT00000109746.4	C	NM_014139		38901842	-1	no_errors	NM_014139	genbank	human	validated	54_36p	missense	SNP	0.000	T
PLEKHM1	9842	genome.wustl.edu	37	17	43516885	43516885	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr17:43516885T>A	ENST00000430334.3	-	11	3150	c.3017A>T	c.(3016-3018)cAc>cTc	p.H1006L	PLEKHM1_ENST00000421073.2_Missense_Mutation_p.H917L|PLEKHM1_ENST00000580404.1_5'UTR	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	1006					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GATGTCGTGGTGCTGGCAGAT	0.587																																																0			17											119.0	92.0	101.0					17																	43516885		2203	4300	6503	40872668	SO:0001583	missense	9842			X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.3017A>T	17.37:g.43516885T>A	ENSP00000389913:p.His1006Leu	Somatic		Capture	Illumina GAIIx	4	40872668	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	PatternScan_ZF_DAG_PE_1,HMMPfam_RUN,HMMSmart_RUN,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMSmart_C1	p.H1006L	ENST00000430334.3	37	c.3017	CCDS32671.1	17	.	.	.	.	.	.	.	.	.	.	T	19.32	3.804688	0.70682	.	.	ENSG00000225190	ENST00000430334;ENST00000421073	T;T	0.63417	-0.04;-0.04	5.2	5.2	0.72013	Protein kinase C-like, phorbol ester/diacylglycerol binding (2);	0.589122	0.19497	N	0.112837	T	0.52597	0.1744	L	0.29908	0.895	0.29529	N	0.852902	P;P	0.48089	0.905;0.762	B;B	0.42827	0.399;0.334	T	0.57010	-0.7884	10	0.52906	T	0.07	.	13.1378	0.59419	0.0:0.0:0.0:1.0	.	917;1006	F8W648;Q9Y4G2	.;PKHM1_HUMAN	L	1006;917	ENSP00000389913:H1006L;ENSP00000414352:H917L	ENSP00000414352:H917L	H	-	2	0	PLEKHM1	40872668	0.674000	0.27549	0.998000	0.56505	0.842000	0.47809	1.719000	0.38011	2.197000	0.70478	0.454000	0.30748	CAC	-	HMMSmart_C1		0.587	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM1	protein_coding	OTTHUMT00000444659.1	T	NM_014798		40872668	-1	no_errors	NM_014798	genbank	human	provisional	54_36p	missense	SNP	0.909	A
FANCM	57697	genome.wustl.edu	37	14	45645735	45645735	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr14:45645735T>C	ENST00000267430.5	+	14	3863	c.3778T>C	c.(3778-3780)Tat>Cat	p.Y1260H	FANCM_ENST00000542564.2_Missense_Mutation_p.Y1234H	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1260					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						AGATGATCTATATGGAAGGTA	0.313								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																							0			14											73.0	75.0	74.0					14																	45645735		2203	4297	6500	44715485	SO:0001583	missense	57697	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.3778T>C	14.37:g.45645735T>C	ENSP00000267430:p.Tyr1260His	Somatic		Capture	Illumina GAIIx	4	44715485	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD,HMMSmart_SM00490,HMMPfam_Helicase_C,superfamily_Restriction endonuclease-like,HMMPfam_ERCC4,superfamily_RuvA domain 2-like	p.Y1260H	ENST00000267430.5	37	c.3778	CCDS32070.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	1.675|1.675	-0.508050|-0.508050	0.04231|0.04231	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000554809|ENST00000267430;ENST00000542564;ENST00000556250	.|T;T;T	.|0.17054	.|2.89;2.89;2.3	5.91|5.91	-2.59|-2.59	0.06209|0.06209	.|.	.|0.950618	.|0.08760	.|N	.|0.897832	T|T	0.06872|0.06872	0.0175|0.0175	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B	.|0.21147	.|0.052;0.052	.|B;B	.|0.22601	.|0.04;0.04	T|T	0.34775|0.34775	-0.9815|-0.9815	5|10	.|0.42905	.|T	.|0.14	.|.	1.5886|1.5886	0.02649|0.02649	0.1194:0.2835:0.2461:0.3511|0.1194:0.2835:0.2461:0.3511	.|.	.|1234;1260	.|B2RTQ9;Q8IYD8	.|.;FANCM_HUMAN	T|H	192|1260;1234;776	.|ENSP00000267430:Y1260H;ENSP00000442493:Y1234H;ENSP00000452033:Y776H	.|ENSP00000267430:Y1260H	I|Y	+|+	2|1	0|0	FANCM|FANCM	44715485|44715485	0.001000|0.001000	0.12720|0.12720	0.003000|0.003000	0.11579|0.11579	0.031000|0.031000	0.12232|0.12232	-0.265000|-0.265000	0.08644|0.08644	-0.722000|-0.722000	0.04922|0.04922	-0.313000|-0.313000	0.08912|0.08912	ATA|TAT	-	NULL		0.313	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	protein_coding	OTTHUMT00000410474.1	T	XM_048128		44715485	+1	no_errors	NM_020937	genbank	human	reviewed	54_36p	missense	SNP	0.031	C
TRIM53CP	340970	genome.wustl.edu	37	11	49007643	49007643	+	IGR	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr11:49007643C>T								OR4A47 (496311 upstream) : TRIM49B (42860 downstream)																							ACATCCAAGACTAAAGAGTCC	0.438																																																0			11																																								48964219	SO:0001628	intergenic_variant	340970																															11.37:g.49007643C>T		Somatic		Capture	Illumina GAIIx	4	48964219		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.438					LOC340970			C			48964219	-1	pseudogene	XR_042351	genbank	human	model	54_36p	rna	SNP	0.001	T
KCNRG	283518	genome.wustl.edu	37	13	50590107	50590107	+	Nonsense_Mutation	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr13:50590107C>T	ENST00000312942.1	+	1	718	c.478C>T	c.(478-480)Cag>Tag	p.Q160*	TRIM13_ENST00000378182.3_3'UTR|TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000360473.4_Nonsense_Mutation_p.Q160*	NM_173605.1	NP_775876.1	Q8N5I3	KCNRG_HUMAN	potassium channel regulator	160					protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)	9		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)		TTTCCCTCCTCAGATGACCTT	0.468																																																0			13											120.0	103.0	109.0					13																	50590107		2203	4300	6503	49488108	SO:0001587	stop_gained	283518				CCDS9424.1, CCDS41889.1	13q14.11	2008-05-02			ENSG00000198553	ENSG00000198553			18893	protein-coding gene	gene with protein product							Standard	NM_173605		Approved		uc001vdu.3	Q8N5I3	OTTHUMG00000140140	ENST00000312942.1:c.478C>T	13.37:g.50590107C>T	ENSP00000324191:p.Gln160*	Somatic		Capture	Illumina GAIIx	4	49488108	A2A2X9|Q0P6D0|Q8IU75|Q8N3Q9	Nonsense_Mutation	SNP	superfamily_POZ domain,HMMSmart_SM00225,HMMPfam_K_tetra	p.Q160*	ENST00000312942.1	37	c.478	CCDS9424.1	13	.	.	.	.	.	.	.	.	.	.	C	21.7	4.192785	0.78902	.	.	ENSG00000198553	ENST00000360473;ENST00000312942	.	.	.	5.84	4.05	0.47172	.	0.315339	0.31507	N	0.007526	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	12.8563	0.57886	0.1304:0.7444:0.1252:0.0	.	.	.	.	X	160	.	ENSP00000324191:Q160X	Q	+	1	0	KCNRG	49488108	1.000000	0.71417	0.310000	0.25168	0.155000	0.21991	2.894000	0.48640	0.760000	0.33108	0.655000	0.94253	CAG	-	NULL		0.468	KCNRG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNRG	protein_coding	OTTHUMT00000276308.1	C			49488108	+1	no_errors	NM_173605	genbank	human	validated	54_36p	nonsense	SNP	0.843	T
ACR	49	genome.wustl.edu	37	22	51183314	51183314	+	Silent	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr22:51183314C>T	ENST00000216139.5	+	5	985	c.945C>T	c.(943-945)ccC>ccT	p.P315P	AC002056.5_ENST00000532913.1_RNA|ACR_ENST00000527761.1_3'UTR	NM_001097.2	NP_001088.2	P10323	ACRO_HUMAN	acrosin	315					acrosome matrix dispersal (GO:0002077)|acrosome reaction (GO:0007340)|activation of adenylate cyclase activity (GO:0007190)|binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|response to steroid hormone (GO:0048545)|single fertilization (GO:0007338)	acrosomal matrix (GO:0043159)|extracellular region (GO:0005576)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|protein complex (GO:0043234)	amidase activity (GO:0004040)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|drug binding (GO:0008144)|fucose binding (GO:0042806)|mannose binding (GO:0005537)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		TTCGACCCCCCTTCTCCCACC	0.617																																																0			22											38.0	33.0	35.0					22																	51183314		2197	4297	6494	49530180	SO:0001819	synonymous_variant	49			CR456366	CCDS14101.1	22q13.33	2012-10-23	2012-10-23		ENSG00000100312	ENSG00000100312	3.4.21.10		126	protein-coding gene	gene with protein product	"""preproacrosin"", ""acrosin light and heavy chain prepropeptide"""	102480				2298447, 12398221	Standard	NM_001097		Approved		uc003bnh.4	P10323	OTTHUMG00000150155	ENST00000216139.5:c.945C>T	22.37:g.51183314C>T		Somatic		Capture	Illumina GAIIx	4	49530180	Q6ICK2	Silent	SNP	superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.P315	ENST00000216139.5	37	c.945	CCDS14101.1	22																																																																																			-	NULL		0.617	ACR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ACR	protein_coding	OTTHUMT00000316605.2	C	NM_001097		49530180	+1	no_errors	NM_001097	genbank	human	reviewed	54_36p	silent	SNP	0.014	T
OR4A5	81318	genome.wustl.edu	37	11	51411697	51411697	+	Silent	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr11:51411697G>A	ENST00000319760.6	-	1	751	c.699C>T	c.(697-699)gcC>gcT	p.A233A		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A233A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				AGGTAGACAAGGCTTTACCCC	0.413																																																1	Substitution - coding silent(1)	large_intestine(1)	11											65.0	64.0	65.0					11																	51411697		2201	4295	6496	51268273	SO:0001819	synonymous_variant	81318			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.699C>T	11.37:g.51411697G>A		Somatic		Capture	Illumina GAIIx	4	51268273	Q6IF84	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,PatternScan_LECTIN_LEGUME_ALPHA,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A233	ENST00000319760.6	37	c.699	CCDS31497.1	11																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.413	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	protein_coding	OTTHUMT00000391399.1	G	NM_001005272		51268273	-1	no_errors	NM_001005272	genbank	human	provisional	54_36p	silent	SNP	0.978	A
ESPL1	9700	genome.wustl.edu	37	12	53671331	53671331	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr12:53671331T>G	ENST00000257934.4	+	10	2254	c.2163T>G	c.(2161-2163)gaT>gaG	p.D721E	ESPL1_ENST00000552462.1_Missense_Mutation_p.D721E	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	721					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						ACTATGAAGATAAACTCCAGG	0.507																																					Colon(53;1069 1201 2587 5382)											0			12											115.0	104.0	108.0					12																	53671331		2203	4300	6503	51957598	SO:0001583	missense	9700			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.2163T>G	12.37:g.53671331T>G	ENSP00000257934:p.Asp721Glu	Somatic		Capture	Illumina GAIIx	4	51957598		Missense_Mutation	SNP	HMMPfam_Peptidase_C50	p.D721E	ENST00000257934.4	37	c.2163	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	T	14.20	2.464252	0.43736	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.13778	2.56;2.56	5.18	0.00549	0.14063	.	0.199963	0.50627	N	0.000109	T	0.13500	0.0327	M	0.74881	2.28	0.41861	D	0.990223	B	0.22541	0.071	B	0.22386	0.039	T	0.06110	-1.0845	10	0.31617	T	0.26	.	5.1902	0.15205	0.0:0.2523:0.1422:0.6056	.	721	Q14674	ESPL1_HUMAN	E	721;396;721	ENSP00000257934:D721E;ENSP00000449831:D721E	ENSP00000257934:D721E	D	+	3	2	ESPL1	51957598	0.579000	0.26725	0.996000	0.52242	0.901000	0.52897	-0.501000	0.06398	-0.130000	0.11599	-0.408000	0.06270	GAT	-	NULL		0.507	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	protein_coding	OTTHUMT00000406899.2	T	NM_012291		51957598	+1	no_errors	NM_012291	genbank	human	validated	54_36p	missense	SNP	0.993	G
OR6C2	341416	genome.wustl.edu	37	12	55846843	55846843	+	Silent	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr12:55846843G>A	ENST00000322678.1	+	1	846	c.846G>A	c.(844-846)ttG>ttA	p.L282L	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA	NM_054105.1	NP_473446.1	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C, member 2	282					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(5)|lung(8)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	23						TCGCACCCTTGTTGAACCCCT	0.413																																																0			12											114.0	114.0	114.0					12																	55846843		2203	4300	6503	54133110	SO:0001819	synonymous_variant	341416			AF179766	CCDS31824.1	12q13.2	2012-08-09				ENSG00000179695		"""GPCR / Class A : Olfactory receptors"""	15436	protein-coding gene	gene with protein product							Standard	NM_054105		Approved	OR6C67	uc001sgz.1	Q9NZP2	OTTHUMG00000169957	ENST00000322678.1:c.846G>A	12.37:g.55846843G>A		Somatic		Capture	Illumina GAIIx	4	54133110		Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L282	ENST00000322678.1	37	c.846	CCDS31824.1	12																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.413	OR6C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C2	protein_coding	OTTHUMT00000406676.1	G	NM_054105		54133110	+1	no_errors	NM_054105	genbank	human	provisional	54_36p	silent	SNP	0.000	A
OR4P1P	79308	genome.wustl.edu	37	11	55451074	55451074	+	lincRNA	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr11:55451074G>A	ENST00000528000.1	-	0	690																											CCTACTAACAGAAAGGAAGAT	0.398																																																0			11																																								55207650			0																															11.37:g.55451074G>A		Somatic		Capture	Illumina GAIIx	4	55207650		Missense_Mutation	SNP	HMMPfam_7tm_1,superfamily_SSF81321	p.E30K	ENST00000528000.1	37	c.88		11																																																																																			-	HMMPfam_7tm_1,superfamily_SSF81321		0.398	RP11-674C21.9-001	KNOWN	basic	lincRNA	OR4P1P	lincRNA	OTTHUMT00000391507.1	G			55207650	+1	no_errors	ENST00000345013	ensembl	human	known	54_36p	missense	SNP	0.007	A
LRP1	4035	genome.wustl.edu	37	12	57603947	57603947	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr12:57603947C>T	ENST00000243077.3	+	81	13041	c.12575C>T	c.(12574-12576)cCa>cTa	p.P4192L		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	4192					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.D4193fs*9(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	ACGCCCCCCCCAGATGGTATG	0.632																																																1	Insertion - Frameshift(1)	central_nervous_system(1)	12											66.0	61.0	63.0					12																	57603947		2203	4300	6503	55890214	SO:0001583	missense	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.12575C>T	12.37:g.57603947C>T	ENSP00000243077:p.Pro4192Leu	Somatic		Capture	Illumina GAIIx	4	55890214	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b,PatternScan_EGF_1	p.P4192L	ENST00000243077.3	37	c.12575	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	C	21.1	4.101286	0.76983	.	.	ENSG00000123384	ENST00000243077	T	0.62941	-0.01	4.96	4.96	0.65561	Growth factor, receptor (1);	0.000000	0.64402	D	0.000003	T	0.54062	0.1835	L	0.45422	1.42	0.80722	D	1	P	0.42785	0.79	B	0.37650	0.255	T	0.53816	-0.8385	10	0.25751	T	0.34	.	17.3689	0.87371	0.0:1.0:0.0:0.0	.	4192	Q07954	LRP1_HUMAN	L	4192	ENSP00000243077:P4192L	ENSP00000243077:P4192L	P	+	2	0	LRP1	55890214	0.003000	0.15002	0.952000	0.39060	0.127000	0.20565	0.878000	0.28126	2.497000	0.84241	0.455000	0.32223	CCA	-	superfamily_EGF/Laminin		0.632	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	protein_coding	OTTHUMT00000412772.2	C	NM_002332		55890214	+1	no_errors	NM_002332	genbank	human	validated	54_36p	missense	SNP	0.638	T
CHCHD2	51142	genome.wustl.edu	37	7	56174185	56174185	+	5'UTR	SNP	T	T	C	rs371507821	byFrequency	TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr7:56174185T>C	ENST00000395422.3	-	0	84					NM_016139.2	NP_057223.1	Q9Y6H1	CHCH2_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 2							mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GACCGGAAGATGGGAGGCGGG	0.617													T|||	16	0.00319489	0.0	0.0	5008	,	,		17911	0.0149		0.0	False		,,,				2504	0.001															0			7																																								56141679	SO:0001623	5_prime_UTR_variant	51142			AF078845	CCDS5526.1	7p11.2	2014-07-14	2004-01-19	2004-01-21	ENSG00000106153	ENSG00000106153		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	21645	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 17"""	C7orf17		23303788	Standard	NM_016139		Approved		uc003tsa.3	Q9Y6H1	OTTHUMG00000129429	ENST00000395422.3:c.-79A>G	7.37:g.56174185T>C		Somatic		Capture	Illumina GAIIx	4	56141679	Q498C3|Q6NZ50	Silent	SNP	HMMPfam_CHCH	p.P2	ENST00000395422.3	37	c.6	CCDS5526.1	7																																																																																			-	NULL		0.617	CHCHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD2	protein_coding	OTTHUMT00000251589.1	T	NM_016139		56141679	-1	no_start_codon	ENST00000395422	ensembl	human	known	54_36p	silent	SNP	0.000	C
ARHGAP9	64333	genome.wustl.edu	37	12	57870186	57870186	+	Silent	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr12:57870186G>A	ENST00000356411.2	-	8	1215	c.1077C>T	c.(1075-1077)ttC>ttT	p.F359F	ARHGAP9_ENST00000393791.3_Silent_p.F359F|ARHGAP9_ENST00000550288.1_Silent_p.F438F|ARHGAP9_ENST00000393797.2_Silent_p.F430F|ARHGAP9_ENST00000424809.2_Silent_p.F359F|ARHGAP9_ENST00000550454.1_5'UTR|ARHGAP9_ENST00000430041.2_Silent_p.F175F			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	359	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			GCTCTCGGTAGAACACCAGGC	0.632																																																0			12											40.0	38.0	39.0					12																	57870186		2203	4300	6503	56156453	SO:0001819	synonymous_variant	64333			AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.1077C>T	12.37:g.57870186G>A		Somatic		Capture	Illumina GAIIx	4	56156453	B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Silent	SNP	superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,superfamily_WW_Rsp5_WWP,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,superfamily_Rho_GAP,HMMSmart_RhoGAP,HMMPfam_RhoGAP	p.F359	ENST00000356411.2	37	c.1077		12																																																																																			-	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH		0.632	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP9	protein_coding		G	NM_032496		56156453	-1	no_errors	NM_032496	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
SIGLEC9	27180	genome.wustl.edu	37	19	51630492	51630492	+	Silent	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr19:51630492C>T	ENST00000250360.3	+	4	1021	c.954C>T	c.(952-954)ttC>ttT	p.F318F	SIGLEC9_ENST00000440804.3_Silent_p.F318F	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	318	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CAGCTGAATTCACCTGCAGAG	0.627																																																0			19											39.0	38.0	38.0					19																	51630492		2203	4300	6503	56322304	SO:0001819	synonymous_variant	27180			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.954C>T	19.37:g.51630492C>T		Somatic		Capture	Illumina GAIIx	4	56322304	Q6GTU4|Q9BYI9	Silent	SNP	superfamily_SSF48726,HMMPfam_V-set,HMMSmart_IG,HMMPfam_ig	p.F318	ENST00000250360.3	37	c.954	CCDS12825.1	19																																																																																			-	superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig		0.627	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	protein_coding	OTTHUMT00000464224.1	C	NM_014441		56322304	+1	no_errors	NM_014441	genbank	human	provisional	54_36p	silent	SNP	0.012	T
SIGLECL1	284369	genome.wustl.edu	37	19	51770626	51770626	+	Splice_Site	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr19:51770626G>C	ENST00000316401.7	+	5	791		c.e5-1		SIGLECL1_ENST00000597824.1_Splice_Site|SIGLECL1_ENST00000593968.1_Splice_Site|CTD-3187F8.2_ENST00000597569.1_RNA	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										TATTTCCTTAGAGTGAAACAT	0.448																																																0			19											125.0	128.0	127.0					19																	51770626		2203	4300	6503	56462438	SO:0001630	splice_region_variant	284369			AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.411-1G>C	19.37:g.51770626G>C		Somatic		Capture	Illumina GAIIx	4	56462438	Q8IYH7	Splice_Site	SNP	-	e4-1	ENST00000316401.7	37	c.411-1	CCDS12827.1	19	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299995	0.40694	.	.	ENSG00000179213	ENST00000316401	.	.	.	3.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2495	0.49017	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C19orf75	56462438	0.939000	0.31865	0.699000	0.30290	0.742000	0.42306	1.857000	0.39399	2.346000	0.79739	0.650000	0.86243	.	-	-		0.448	SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLJ40235	protein_coding	OTTHUMT00000464161.2	G	NM_173635	Intron	56462438	+1	no_errors	NM_173635	genbank	human	predicted	54_36p	splice_site	SNP	0.279	C
DST	667	genome.wustl.edu	37	6	56504509	56504509	+	Silent	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr6:56504509C>T	ENST00000361203.3	-	16	2056	c.2049G>A	c.(2047-2049)caG>caA	p.Q683Q	DST_ENST00000370765.6_Silent_p.Q357Q|DST_ENST00000370769.4_Silent_p.Q683Q|DST_ENST00000244364.6_Silent_p.Q357Q|DST_ENST00000312431.6_Silent_p.Q683Q|DST_ENST00000370788.2_Silent_p.Q683Q|DST_ENST00000421834.2_Silent_p.Q683Q|DST_ENST00000446842.2_Silent_p.Q357Q|DST_ENST00000370754.5_Silent_p.Q861Q|DST_ENST00000518935.1_Silent_p.Q357Q			Q03001	DYST_HUMAN	dystonin	683					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTTTTGCATACTGACTCTCTA	0.318																																																0			6											122.0	138.0	132.0					6																	56504509		2202	4297	6499	56612468	SO:0001819	synonymous_variant	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.2049G>A	6.37:g.56504509C>T		Somatic		Capture	Illumina GAIIx	4	56612468	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMSmart_SM00150,HMMPfam_Spectrin,superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1,HMMPfam_GAS2,HMMSmart_SM00243	p.Q683	ENST00000361203.3	37	c.2049		6																																																																																			-	HMMSmart_SM00150,superfamily_Spectrin repeat		0.318	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	C	NM_001723		56612468	-1	no_errors	NM_183380	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
KCNQ2	3785	genome.wustl.edu	37	20	62039876	62039876	+	Missense_Mutation	SNP	C	C	A	rs372976131		TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr20:62039876C>A	ENST00000359125.2	-	16	1951	c.1777G>T	c.(1777-1779)Gtg>Ttg	p.V593L	KCNQ2_ENST00000354587.3_Missense_Mutation_p.V601L|KCNQ2_ENST00000360480.3_Missense_Mutation_p.V565L|KCNQ2_ENST00000357249.2_Missense_Mutation_p.V575L|KCNQ2_ENST00000370224.1_Missense_Mutation_p.V601L|KCNQ2_ENST00000344462.4_Missense_Mutation_p.V562L|KCNQ2_ENST00000359689.1_Missense_Mutation_p.V593L	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	593					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CCCCGCCCCACGATCTGGTCC	0.692																																																0			20											24.0	24.0	24.0					20																	62039876		2194	4298	6492	61510320	SO:0001583	missense	3785			AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.1777G>T	20.37:g.62039876C>A	ENSP00000352035:p.Val593Leu	Somatic		Capture	Illumina GAIIx	4	61510320	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_KCNQ_channel	p.V593L	ENST00000359125.2	37	c.1777	CCDS13520.1	20	.	.	.	.	.	.	.	.	.	.	C	17.49	3.401753	0.62288	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224	D;D;D;D;D;D;D;D;D	0.99479	-5.98;-5.98;-5.98;-5.98;-5.98;-5.98;-5.98;-5.98;-5.98	4.87	4.87	0.63330	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.500446	0.16356	N	0.217997	D	0.98735	0.9575	N	0.16743	0.435	0.48511	D	0.99966	P;P;D;D	0.58268	0.942;0.654;0.982;0.978	P;B;P;P	0.60789	0.749;0.173;0.603;0.879	D	0.99799	1.1035	10	0.42905	T	0.14	-15.6184	17.981	0.89141	0.0:1.0:0.0:0.0	.	565;575;562;593	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	L	575;593;563;601;593;562;565;589;601	ENSP00000349789:V575L;ENSP00000352035:V593L;ENSP00000359246:V563L;ENSP00000346601:V601L;ENSP00000352718:V593L;ENSP00000399612:V562L;ENSP00000353668:V565L;ENSP00000339611:V589L;ENSP00000359244:V601L	ENSP00000339611:V589L	V	-	1	0	KCNQ2	61510320	0.998000	0.40836	0.992000	0.48379	0.836000	0.47400	3.831000	0.55776	2.252000	0.74401	0.491000	0.48974	GTG	-	HMMPfam_KCNQ_channel		0.692	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	KCNQ2	protein_coding	OTTHUMT00000080353.1	C	NM_172109		61510320	-1	no_errors	NM_172107	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CACNG4	27092	genome.wustl.edu	37	17	65026879	65026879	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr17:65026879G>T	ENST00000262138.3	+	4	745	c.743G>T	c.(742-744)aGg>aTg	p.R248M	AC005544.1_ENST00000375684.1_5'Flank|RP11-74H8.1_ENST00000579138.1_RNA	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	248					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			TCCAGCTCAAGGTCCACCGAG	0.612																																																0			17											62.0	64.0	63.0					17																	65026879		2203	4300	6503	62457341	SO:0001583	missense	27092			AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.743G>T	17.37:g.65026879G>T	ENSP00000262138:p.Arg248Met	Somatic		Capture	Illumina GAIIx	4	62457341	B2RCK0	Missense_Mutation	SNP	HMMPfam_PMP22_Claudin,PatternScan_CLAUDIN	p.R248M	ENST00000262138.3	37	c.743	CCDS11667.1	17	.	.	.	.	.	.	.	.	.	.	G	11.52	1.661833	0.29515	.	.	ENSG00000075461	ENST00000262138	T	0.59772	0.24	4.98	3.79	0.43588	.	0.336079	0.28958	N	0.013586	T	0.56093	0.1962	M	0.72353	2.195	0.09310	N	0.999992	P	0.37955	0.612	B	0.39419	0.299	T	0.53746	-0.8395	10	0.39692	T	0.17	-16.494	10.9103	0.47106	0.1636:0.0:0.8364:0.0	.	248	Q9UBN1	CCG4_HUMAN	M	248	ENSP00000262138:R248M	ENSP00000262138:R248M	R	+	2	0	CACNG4	62457341	0.697000	0.27767	0.932000	0.37286	0.668000	0.39293	3.751000	0.55165	2.344000	0.79699	0.650000	0.86243	AGG	-	NULL		0.612	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG4	protein_coding	OTTHUMT00000447036.1	G	NM_014405		62457341	+1	no_errors	NM_014405	genbank	human	reviewed	54_36p	missense	SNP	0.053	T
EHD1	10938	genome.wustl.edu	37	11	64622936	64622936	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr11:64622936G>C	ENST00000320631.3	-	4	1192	c.938C>G	c.(937-939)tCc>tGc	p.S313C	EHD1_ENST00000359393.2_Missense_Mutation_p.S313C|EHD1_ENST00000488711.1_5'Flank	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	313					blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						TTTCTTGAGGGAGCTGATGAT	0.547											OREG0004024	type=REGULATORY REGION|Gene=EHD1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			11											151.0	139.0	143.0					11																	64622936		2201	4297	6498	64379512	SO:0001583	missense	10938			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.938C>G	11.37:g.64622936G>C	ENSP00000320516:p.Ser313Cys	Somatic	1078	Capture	Illumina GAIIx	4	64379512	O14611|Q2M3Q4|Q9UNR3	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Dynamin_N,superfamily_EF-hand,HMMSmart_SM00027,PatternScan_EF_HAND_1	p.S313C	ENST00000320631.3	37	c.938	CCDS8084.1	11	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815782	0.50527	.	.	ENSG00000110047	ENST00000320631;ENST00000359393;ENST00000541001;ENST00000421303;ENST00000421510;ENST00000433803	T;T;T;T	0.44881	2.25;2.25;0.91;1.49	4.63	4.63	0.57726	.	0.111143	0.64402	D	0.000006	T	0.40670	0.1126	L	0.55834	1.745	0.44985	D	0.998004	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.34925	-0.9809	10	0.56958	D	0.05	.	15.0511	0.71872	0.0:0.0:1.0:0.0	.	313;313	B2R5U3;Q9H4M9	.;EHD1_HUMAN	C	313;313;289;327;177;327	ENSP00000320516:S313C;ENSP00000352354:S313C;ENSP00000391429:S177C;ENSP00000404944:S327C	ENSP00000320516:S313C	S	-	2	0	EHD1	64379512	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.567000	0.82357	2.420000	0.82092	0.561000	0.74099	TCC	-	NULL		0.547	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	protein_coding	OTTHUMT00000143229.2	G	NM_006795		64379512	-1	no_errors	NM_006795	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FRMD8	83786	genome.wustl.edu	37	11	65172367	65172367	+	Silent	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr11:65172367C>T	ENST00000317568.5	+	10	1267	c.1104C>T	c.(1102-1104)tgC>tgT	p.C368C	FRMD8_ENST00000355991.5_Silent_p.C312C|FRMD8_ENST00000416776.2_Silent_p.C334C	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	368	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						TTGAGTACTGCATCGAACTGA	0.662																																																0			11											31.0	33.0	32.0					11																	65172367		2201	4297	6498	64928943	SO:0001819	synonymous_variant	83786			AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.1104C>T	11.37:g.65172367C>T		Somatic		Capture	Illumina GAIIx	4	64928943	B4E2P1|Q86V56|Q8NCB5	Silent	SNP	HMMSmart_SM00295,superfamily_Second domain of FERM,HMMPfam_FERM_M	p.C368	ENST00000317568.5	37	c.1104	CCDS8102.1	11																																																																																			-	NULL		0.662	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD8	protein_coding	OTTHUMT00000388833.1	C	NM_031904		64928943	+1	no_errors	NM_031904	genbank	human	validated	54_36p	silent	SNP	1.000	T
PPP6R3	55291	genome.wustl.edu	37	11	68343468	68343468	+	Missense_Mutation	SNP	C	C	G	rs375667385		TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr11:68343468C>G	ENST00000393800.2	+	14	1756	c.1502C>G	c.(1501-1503)aCa>aGa	p.T501R	PPP6R3_ENST00000265636.5_Missense_Mutation_p.T450R|PPP6R3_ENST00000524845.1_Missense_Mutation_p.T501R|PPP6R3_ENST00000527403.2_Missense_Mutation_p.T501R|PPP6R3_ENST00000534534.1_Missense_Mutation_p.T269R|PPP6R3_ENST00000265637.4_Missense_Mutation_p.T501R|PPP6R3_ENST00000393799.2_Missense_Mutation_p.T501R|PPP6R3_ENST00000393801.3_Missense_Mutation_p.T501R|PPP6R3_ENST00000529710.1_Missense_Mutation_p.T450R|PPP6R3_ENST00000524904.1_Missense_Mutation_p.T501R	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	501					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						ACGTTCTGCACAAGCTCCTTA	0.428																																																0			11											156.0	147.0	150.0					11																	68343468		2200	4294	6494	68100044	SO:0001583	missense	55291			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.1502C>G	11.37:g.68343468C>G	ENSP00000377389:p.Thr501Arg	Somatic		Capture	Illumina GAIIx	4	68100044	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	HMMPfam_SAPS	p.T450R	ENST00000393800.2	37	c.1349	CCDS53672.1	11	.	.	.	.	.	.	.	.	.	.	C	16.62	3.174957	0.57692	.	.	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000534534;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000534190	T;T;T;T;T;T;T;T;T;T;T	0.22743	1.97;1.97;1.96;1.97;1.97;1.97;1.97;1.94;1.94;1.97;1.96	5.89	5.89	0.94794	.	0.236588	0.43747	D	0.000535	T	0.34687	0.0906	M	0.68593	2.085	0.50813	D	0.999893	B;D;B;B;B;B;B;B	0.53462	0.094;0.96;0.004;0.004;0.01;0.013;0.035;0.022	B;P;B;B;B;B;B;B	0.49387	0.211;0.609;0.038;0.038;0.056;0.051;0.054;0.03	T	0.01639	-1.1306	10	0.25751	T	0.34	.	19.2356	0.93858	0.0:1.0:0.0:0.0	.	213;269;450;501;501;501;501;450	B4DYU6;E9PQP7;Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4	.;.;.;.;.;PP6R3_HUMAN;.;.	R	501;501;269;501;501;501;501;450;450;501;237	ENSP00000377388:T501R;ENSP00000377389:T501R;ENSP00000434429:T269R;ENSP00000431415:T501R;ENSP00000265637:T501R;ENSP00000433058:T501R;ENSP00000377390:T501R;ENSP00000265636:T450R;ENSP00000437329:T450R;ENSP00000433565:T501R;ENSP00000436209:T237R	ENSP00000265636:T450R	T	+	2	0	PPP6R3	68100044	0.642000	0.27260	0.969000	0.41365	0.838000	0.47535	3.920000	0.56446	2.763000	0.94921	0.655000	0.94253	ACA	-	HMMPfam_SAPS		0.428	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAPS3	protein_coding	OTTHUMT00000395275.1	C	NM_018312		68100044	+1	no_errors	NM_018312	genbank	human	validated	54_36p	missense	SNP	0.957	G
CLEC4F	165530	genome.wustl.edu	37	2	71046519	71046519	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr2:71046519T>A	ENST00000272367.2	-	3	312	c.236A>T	c.(235-237)aAc>aTc	p.N79I	CLEC4F_ENST00000426626.1_Missense_Mutation_p.N79I	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	79					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						CCCAGTAATGTTGTCTCCCAG	0.527																																					Colon(107;10 2157 6841 26035)											0			2											130.0	111.0	117.0					2																	71046519		2203	4300	6503	70900027	SO:0001583	missense	165530			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.236A>T	2.37:g.71046519T>A	ENSP00000272367:p.Asn79Ile	Somatic		Capture	Illumina GAIIx	4	70900027	A4QPA5	Missense_Mutation	SNP	PatternScan_C_TYPE_LECTIN_1,superfamily_C-type_lectin_fold	p.N79I	ENST00000272367.2	37	c.236	CCDS1910.1	2	.	.	.	.	.	.	.	.	.	.	T	13.03	2.113910	0.37339	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.02498	4.31;4.27	3.59	-1.78	0.07957	.	.	.	.	.	T	0.02047	0.0064	L	0.46157	1.445	0.09310	N	1	P;P	0.36616	0.561;0.561	B;B	0.31245	0.126;0.126	T	0.44726	-0.9309	9	0.10902	T	0.67	.	3.135	0.06436	0.2038:0.3417:0.0:0.4545	.	79;79	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	I	79	ENSP00000272367:N79I;ENSP00000390581:N79I	ENSP00000272367:N79I	N	-	2	0	CLEC4F	70900027	0.003000	0.15002	0.000000	0.03702	0.545000	0.35147	-0.008000	0.12788	-0.314000	0.08716	0.254000	0.18369	AAC	-	NULL		0.527	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLEC4F	protein_coding	OTTHUMT00000251922.1	T	NM_173535		70900027	-1	no_errors	NM_173535	genbank	human	validated	54_36p	missense	SNP	0.000	A
FOXC2	2303	genome.wustl.edu	37	16	86601261	86601261	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr16:86601261C>A	ENST00000320354.4	+	1	405	c.320C>A	c.(319-321)cCc>cAc	p.P107H	RP11-463O9.5_ENST00000563280.1_RNA	NM_005251.2	NP_005242.1	Q99958	FOXC2_HUMAN	forkhead box C2 (MFH-1, mesenchyme forkhead 1)	107					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|embryonic viscerocranium morphogenesis (GO:0048703)|glomerular endothelium development (GO:0072011)|glomerular mesangial cell development (GO:0072144)|glomerular visceral epithelial cell differentiation (GO:0072112)|heart development (GO:0007507)|insulin receptor signaling pathway (GO:0008286)|lymphangiogenesis (GO:0001946)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|paraxial mesodermal cell fate commitment (GO:0048343)|patterning of blood vessels (GO:0001569)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular wound healing (GO:0035470)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|response to hormone (GO:0009725)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	15						GACCGCTTCCCCTTCTACCGG	0.587									Late-onset Hereditary Lymphedema																																							0			16											113.0	119.0	117.0					16																	86601261		2198	4300	6498	85158762	SO:0001583	missense	2303	Familial Cancer Database	Hereditary Lymphedema type II, Meige Lymphedema	Y08223	CCDS10958.1	16q24.1	2008-04-10			ENSG00000176692	ENSG00000176692		"""Forkhead boxes"""	3801	protein-coding gene	gene with protein product		602402		FKHL14		9169153, 8674414	Standard	NM_005251		Approved	MFH-1	uc002fjq.3	Q99958	OTTHUMG00000137652	ENST00000320354.4:c.320C>A	16.37:g.86601261C>A	ENSP00000326371:p.Pro107His	Somatic		Capture	Illumina GAIIx	4	85158762	C6KMR9|Q14DA6	Missense_Mutation	SNP	HMMSmart_FH,superfamily_SSF46785,PatternScan_FORK_HEAD_1,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2	p.P107H	ENST00000320354.4	37	c.320	CCDS10958.1	16	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856473	0.71834	.	.	ENSG00000176692	ENST00000320354	D	0.96992	-4.2	4.67	3.71	0.42584	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.109084	0.39759	U	0.001267	D	0.98820	0.9602	H	0.98802	4.335	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98433	1.0583	10	0.87932	D	0	.	11.3319	0.49482	0.0:0.9094:0.0:0.0906	.	107	Q99958	FOXC2_HUMAN	H	107	ENSP00000326371:P107H	ENSP00000326371:P107H	P	+	2	0	FOXC2	85158762	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.460000	0.80816	0.957000	0.37930	0.650000	0.86243	CCC	-	HMMSmart_FH,superfamily_SSF46785,HMMPfam_Fork_head		0.587	FOXC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXC2	protein_coding	OTTHUMT00000269104.2	C	NM_005251		85158762	+1	no_errors	NM_005251	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SMIM11P1	100127905	genome.wustl.edu	37	6	86445466	86445466	+	IGR	SNP	T	T	C	rs571897991		TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr6:86445466T>C								SNHG5 (58090 upstream) : RNU4-72P (15832 downstream)																							GAATATTCAGTTATCTTTTTT	0.368													T|||	1	0.000199681	0.0	0.0	5008	,	,		19247	0.0		0.0	False		,,,				2504	0.001															0			6																																								86502185	SO:0001628	intergenic_variant	0																															6.37:g.86445466T>C		Somatic		Capture	Illumina GAIIx	4	86502185		Missense_Mutation	SNP	NULL	p.N58S		37	c.173		6	.	.	.	.	.	.	.	.	.	.	T	7.948	0.744322	0.15710	.	.	ENSG00000198738	ENST00000369586	T	0.55588	0.51	1.87	0.667	0.17907	.	1.014580	0.07873	N	0.968196	T	0.17916	0.0430	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30090	-0.9990	7	0.29301	T	0.29	.	4.1139	0.10072	0.0:0.3991:0.0:0.6009	.	.	.	.	S	58	ENSP00000358599:N58S	ENSP00000358599:N58S	N	-	2	0	FAM165A	86502185	0.564000	0.26602	0.000000	0.03702	0.397000	0.30659	0.552000	0.23376	0.172000	0.19760	0.358000	0.22013	AAC	-	NULL	0	0.368					LOC100127905			T			86502185	-1	no_errors	XM_001720540	genbank	human	model	54_36p	missense	SNP	0.002	C
ABCB1	5243	genome.wustl.edu	37	7	87173486	87173486	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr7:87173486G>T	ENST00000265724.3	-	18	2587	c.2170C>A	c.(2170-2172)Ctg>Atg	p.L724M	ABCB1_ENST00000543898.1_Missense_Mutation_p.L660M	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	724	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	GCTGGTTGCAGGCCTCCATTT	0.358																																																0			7											109.0	109.0	109.0					7																	87173486		2203	4300	6503	87011422	SO:0001583	missense	5243			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2170C>A	7.37:g.87173486G>T	ENSP00000265724:p.Leu724Met	Somatic		Capture	Illumina GAIIx	4	87011422	A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.L724M	ENST00000265724.3	37	c.2170	CCDS5608.1	7	.	.	.	.	.	.	.	.	.	.	G	8.637	0.894987	0.17613	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.90385	-2.66;-2.66	6.01	-1.49	0.08718	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.391259	0.26116	N	0.026244	D	0.83321	0.5229	L	0.28115	0.83	0.25520	N	0.987377	B;B	0.27882	0.192;0.183	B;B	0.39562	0.118;0.303	T	0.73874	-0.3845	10	0.49607	T	0.09	-2.5009	4.8843	0.13696	0.4012:0.0:0.1676:0.4312	.	660;724	B5AK60;P08183	.;MDR1_HUMAN	M	505;724;660	ENSP00000265724:L724M;ENSP00000444095:L660M	ENSP00000265724:L724M	L	-	1	2	ABCB1	87011422	0.001000	0.12720	0.731000	0.30826	0.453000	0.32348	-0.095000	0.11077	-0.339000	0.08401	-0.145000	0.13849	CTG	-	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane		0.358	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	protein_coding	OTTHUMT00000335444.2	G	NM_000927		87011422	-1	no_errors	NM_000927	genbank	human	reviewed	54_36p	missense	SNP	0.273	T
RP11-202I11.2	0	genome.wustl.edu	37	9	88379812	88379812	+	lincRNA	SNP	T	T	C	rs536725994		TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr9:88379812T>C	ENST00000447148.1	-	0	192																											GATGAAAAACTTAAAAATGGT	0.378													T|||	1	0.000199681	0.0008	0.0	5008	,	,		18403	0.0		0.0	False		,,,				2504	0.0															0			9																																								87569632			0																															9.37:g.88379812T>C		Somatic		Capture	Illumina GAIIx	4	87569632		Silent	SNP	NULL	p.L106	ENST00000447148.1	37	c.316		9																																																																																			-	NULL		0.378	RP11-202I11.2-001	KNOWN	basic	lincRNA	LOC100129901	lincRNA	OTTHUMT00000052889.1	T			87569632	+1	no_errors	XM_001716099	genbank	human	model	54_36p	silent	SNP	0.988	C
LDB3	11155	genome.wustl.edu	37	10	88441363	88441363	+	Silent	SNP	G	G	C	rs368407147		TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr10:88441363G>C	ENST00000361373.4	+	4	513	c.492G>C	c.(490-492)ccG>ccC	p.P164P	LDB3_ENST00000372056.4_Silent_p.P164P|LDB3_ENST00000429277.2_Silent_p.P164P|LDB3_ENST00000263066.6_Intron|LDB3_ENST00000458213.2_Intron|LDB3_ENST00000310944.6_Silent_p.P164P|LDB3_ENST00000352360.5_Intron|LDB3_ENST00000542786.1_Silent_p.P164P|LDB3_ENST00000372066.3_Intron	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						CTGGCCCTCCGCGGGCCAGCC	0.706																																																0			10											18.0	21.0	20.0					10																	88441363		2201	4296	6497	88431343	SO:0001819	synonymous_variant	11155			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.492G>C	10.37:g.88441363G>C		Somatic		Capture	Illumina GAIIx	4	88431343		Silent	SNP	HMMPfam_PDZ,superfamily_PDZ domain-like,HMMSmart_SM00228,HMMSmart_SM00735,superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00132,HMMPfam_LIM,PatternScan_LIM_DOMAIN_1	p.P164	ENST00000361373.4	37	c.492	CCDS7377.1	10																																																																																			-	NULL		0.706	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LDB3	protein_coding	OTTHUMT00000049160.2	G			88431343	+1	no_errors	NM_007078	genbank	human	reviewed	54_36p	silent	SNP	0.044	C
Unknown	0	genome.wustl.edu	37	X	92477789	92477789	+	IGR	SNP	G	G	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chrX:92477789G>T								PCDH11X (599560 upstream) : NAP1L3 (448139 downstream)																							AGCTTTATTGGTGAAGTTCAT	0.468																																																0			X																																								92364445	SO:0001628	intergenic_variant	401602																															X.37:g.92477789G>T		Somatic		Capture	Illumina GAIIx	4	92364445		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.468					LOC401602			G			92364445	-1	pseudogene	XR_016272	genbank	human	model	54_36p	rna	SNP	1.000	T
ANKRD20A8P	729171	genome.wustl.edu	37	2	95481002	95481002	+	RNA	SNP	T	T	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr2:95481002T>C	ENST00000432432.2	-	0	2358					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		ATGAACGTCATCTAGTTGCTG	0.398																																																0			2																																								94844729			0					2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95481002T>C		Somatic		Capture	Illumina GAIIx	4	94844729	A6NC18	Missense_Mutation	SNP	NULL	p.D329G	ENST00000432432.2	37	c.986		2																																																																																			-	NULL		0.398	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	uc010fhq.1	pseudogene	OTTHUMT00000451404.1	T			94844729	-1	no_errors	ENST00000358870	ensembl	human	known	54_36p	missense	SNP	0.991	C
POP1	10940	genome.wustl.edu	37	8	99162737	99162737	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr8:99162737G>C	ENST00000401707.2	+	14	2008	c.1927G>C	c.(1927-1929)Ggg>Cgg	p.G643R	POP1_ENST00000349693.3_Missense_Mutation_p.G643R	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	643					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GAGAGTCGGAGGGTTGAAAGA	0.438																																																0			8											131.0	127.0	129.0					8																	99162737		2203	4300	6503	99231913	SO:0001583	missense	10940			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.1927G>C	8.37:g.99162737G>C	ENSP00000385787:p.Gly643Arg	Somatic		Capture	Illumina GAIIx	4	99231913	A8K5W9|Q15037	Missense_Mutation	SNP	HMMPfam_POP1,HMMPfam_POPLD	p.G643R	ENST00000401707.2	37	c.1927	CCDS6277.1	8	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377210	0.82682	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.71934	-0.61;-0.61	5.78	5.78	0.91487	POPLD (1);	0.000000	0.85682	D	0.000000	D	0.87924	0.6300	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89920	0.4058	10	0.87932	D	0	-15.7115	18.1929	0.89813	0.0:0.0:1.0:0.0	.	643	Q99575	POP1_HUMAN	R	643	ENSP00000385787:G643R;ENSP00000339529:G643R	ENSP00000339529:G643R	G	+	1	0	POP1	99231913	1.000000	0.71417	0.989000	0.46669	0.664000	0.39144	9.869000	0.99810	2.749000	0.94314	0.655000	0.94253	GGG	-	HMMPfam_POPLD		0.438	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP1	protein_coding	OTTHUMT00000379470.1	G	NM_015029		99231913	+1	no_errors	NM_015029	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
GIGYF1	64599	genome.wustl.edu	37	7	100279859	100279859	+	Splice_Site	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr7:100279859C>T	ENST00000275732.5	-	22	3971		c.e22-1		GIGYF1_ENST00000471340.2_5'Flank	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1						insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					GCCATGGGCACTGCAGGATGA	0.642																																																0			7											60.0	65.0	64.0					7																	100279859		2203	4300	6503	100117795	SO:0001630	splice_region_variant	64599			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.2762-1G>A	7.37:g.100279859C>T		Somatic		Capture	Illumina GAIIx	4	100117795	Q6Y7W7|Q8WZ38	Splice_Site	SNP	-	e22-1	ENST00000275732.5	37	c.2762-1	CCDS34708.1	7	.	.	.	.	.	.	.	.	.	.	C	15.89	2.967993	0.53507	.	.	ENSG00000146830	ENST00000539430;ENST00000275732	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6886	0.77430	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GIGYF1	100117795	1.000000	0.71417	0.989000	0.46669	0.680000	0.39746	7.320000	0.79064	2.562000	0.86427	0.555000	0.69702	.	-	-		0.642	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	protein_coding	OTTHUMT00000347205.2	C	NM_022574	Intron	100117795	-1	no_errors	NM_022574	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
DYNC1H1	1778	genome.wustl.edu	37	14	102449774	102449774	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr14:102449774T>G	ENST00000360184.4	+	7	1453	c.1289T>G	c.(1288-1290)cTt>cGt	p.L430R		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	430	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TATGAGAAACTTCAGGTATTG	0.403																																																0			14											87.0	89.0	89.0					14																	102449774		2203	4300	6503	101519527	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.1289T>G	14.37:g.102449774T>G	ENSP00000348965:p.Leu430Arg	Somatic		Capture	Illumina GAIIx	4	101519527	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.L430R	ENST00000360184.4	37	c.1289	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	T	18.16	3.563129	0.65538	.	.	ENSG00000197102	ENST00000360184	T	0.56776	0.44	5.58	5.58	0.84498	Dynein heavy chain, domain-1 (1);	0.000000	0.85682	D	0.000000	T	0.74831	0.3768	M	0.84948	2.725	0.80722	D	1	D	0.71674	0.998	D	0.74348	0.983	T	0.77112	-0.2708	10	0.44086	T	0.13	.	16.0131	0.80417	0.0:0.0:0.0:1.0	.	430	Q14204	DYHC1_HUMAN	R	430	ENSP00000348965:L430R	ENSP00000348965:L430R	L	+	2	0	DYNC1H1	101519527	1.000000	0.71417	0.770000	0.31555	0.947000	0.59692	7.655000	0.83696	2.245000	0.73994	0.482000	0.46254	CTT	-	HMMPfam_DHC_N1		0.403	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	T	NM_001376		101519527	+1	no_errors	NM_001376	genbank	human	reviewed	54_36p	missense	SNP	0.994	G
CUX1	1523	genome.wustl.edu	37	7	101833140	101833140	+	Silent	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr7:101833140G>A	ENST00000292535.7	+	12	1103	c.1065G>A	c.(1063-1065)aaG>aaA	p.K355K	CUX1_ENST00000550008.2_Silent_p.K355K|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000425244.2_Silent_p.K320K|CUX1_ENST00000546411.2_Silent_p.K355K|CUX1_ENST00000292538.4_Silent_p.K366K|CUX1_ENST00000437600.4_Silent_p.K364K|CUX1_ENST00000360264.3_Silent_p.K366K|CUX1_ENST00000549414.2_Silent_p.K355K|CUX1_ENST00000547394.2_Silent_p.K350K|CUX1_ENST00000556210.1_Silent_p.K355K|CUX1_ENST00000393824.3_Silent_p.K327K	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	355					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						AAGAGGTGAAGAAAGAGCTGA	0.532																																																0			7											115.0	110.0	112.0					7																	101833140		2203	4300	6503	101619860	SO:0001819	synonymous_variant	1523			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.1065G>A	7.37:g.101833140G>A		Somatic		Capture	Illumina GAIIx	4	101619860	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Silent	SNP	superfamily_lambda repressor-like DNA-binding domains,HMMPfam_CUT,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.K355	ENST00000292535.7	37	c.1065	CCDS5721.1	7																																																																																			-	NULL		0.532	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CUX1	protein_coding	OTTHUMT00000347535.1	G	NM_001913		101619860	+1	no_errors	NM_181552	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	X	103159422	103159422	+	IGR	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chrX:103159422G>A								RNA5SP511 (53582 upstream) : LL0XNC01-116E7.2 (12582 downstream)																							TGTCGTGAACGAAGGAATCTA	0.587													g|||	1	0.000264901	0.0	0.0	3775	,	,		14693	0.001		0.0	False		,,,				2504	0.0															0			X																																								103046078	SO:0001628	intergenic_variant	442461																															X.37:g.103159422G>A		Somatic		Capture	Illumina GAIIx	4	103046078		Silent	SNP	superfamily_Histone-fold,HMMSmart_SM00427,HMMPfam_Histone	p.F162		37	c.486		X																																																																																			-	superfamily_Histone-fold,HMMSmart_SM00427,HMMPfam_Histone	0	0.587					LOC442461			G			103046078	-1	no_errors	XM_498379	genbank	human	model	54_36p	silent	SNP	0.985	A
IRS4	8471	genome.wustl.edu	37	X	107978426	107978426	+	Silent	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chrX:107978426G>A	ENST00000372129.2	-	1	1225	c.1149C>T	c.(1147-1149)ctC>ctT	p.L383L	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	383					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CGATGGCCCTGAGGTGGCAAA	0.637																																																0			X											66.0	67.0	67.0					X																	107978426		2203	4300	6503	107865082	SO:0001819	synonymous_variant	8471			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1149C>T	X.37:g.107978426G>A		Somatic		Capture	Illumina GAIIx	4	107865082		Silent	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMPfam_IRS,HMMSmart_PTBI	p.L383	ENST00000372129.2	37	c.1149	CCDS14544.1	X																																																																																			-	NULL		0.637	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	protein_coding	OTTHUMT00000057879.1	G	NM_003604		107865082	-1	no_errors	NM_003604	genbank	human	reviewed	54_36p	silent	SNP	0.902	A
SH3RF3	344558	genome.wustl.edu	37	2	109960653	109960653	+	Intron	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr2:109960653G>C	ENST00000309415.6	+	2	573					NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3								zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						GAACAGCATAGTCTCTTCCTG	0.527																																																0			2											132.0	123.0	126.0					2																	109960653		692	1591	2283	109327085	SO:0001627	intron_variant	729164			AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.574-3477G>C	2.37:g.109960653G>C		Somatic		Capture	Illumina GAIIx	4	109327085	A0SDZ7|A8MPR1|Q8NDU1	RNA	SNP	-	NULL	ENST00000309415.6	37	NULL		2																																																																																			-	-		0.527	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	LOC729164	protein_coding		G	NM_001099289		109327085	-1	no_errors	XR_041020	genbank	human	model	54_36p	rna	SNP	0.001	C
EIF3IP1	442720	genome.wustl.edu	37	7	109600079	109600079	+	IGR	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr7:109600079C>T								AC073071.1 (362856 upstream) : AC003088.1 (472216 downstream)																							ACATACCACACAGCTCTGGTA	0.527																																																0			7																																								109387315	SO:0001628	intergenic_variant	442720																															7.37:g.109600079C>T		Somatic		Capture	Illumina GAIIx	4	109387315		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.527					EIF3IP1			C			109387315	-1	pseudogene	NR_003024	genbank	human	provisional	54_36p	rna	SNP	0.984	T
XPNPEP1	7511	genome.wustl.edu	37	10	111624957	111624957	+	Silent	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr10:111624957G>A	ENST00000502935.1	-	21	2105	c.1986C>T	c.(1984-1986)atC>atT	p.I662I	XPNPEP1_ENST00000322238.8_Silent_p.I638I|XPNPEP1_ENST00000369680.4_Silent_p.I619I|XPNPEP1_ENST00000369683.1_Silent_p.I548I					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		GCTGTTTGGAGATGGGTTGCG	0.488																																																0			10											149.0	150.0	150.0					10																	111624957		2203	4300	6503	111614947	SO:0001819	synonymous_variant	7511				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1986C>T	10.37:g.111624957G>A		Somatic		Capture	Illumina GAIIx	4	111614947		Silent	SNP	HMMPfam_Creatinase_N,superfamily_Creatinase/aminopeptidase,HMMPfam_Peptidase_M24,PatternScan_PROLINE_PEPTIDASE	p.I619	ENST00000502935.1	37	c.1857	CCDS7560.2	10																																																																																			-	NULL		0.488	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	protein_coding	OTTHUMT00000050264.2	G			111614947	-1	no_errors	NM_020383	genbank	human	provisional	54_36p	silent	SNP	0.986	A
NOTCH2	4853	genome.wustl.edu	37	1	120468135	120468135	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr1:120468135C>T	ENST00000256646.2	-	25	4523	c.4304G>A	c.(4303-4305)cGg>cAg	p.R1435Q	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1435	Negative regulatory region (NRR).				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GACGCCATCCCGAGCTTTGTC	0.622			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																														Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0			1											62.0	65.0	64.0					1																	120468135		2203	4300	6503	120269658	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.4304G>A	1.37:g.120468135C>T	ENSP00000256646:p.Arg1435Gln	Somatic		Capture	Illumina GAIIx	4	120269658	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,HMMSmart_NL,HMMPfam_Notch,superfamily_Notch_region,HMMPfam_NOD,HMMPfam_NODP,superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.R1435Q	ENST00000256646.2	37	c.4304	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043772	0.55003	.	.	ENSG00000134250	ENST00000256646	D	0.90069	-2.61	5.72	5.72	0.89469	Notch domain (4);	0.000000	0.35207	U	0.003375	D	0.90202	0.6937	L	0.57536	1.79	0.30082	N	0.809051	D	0.67145	0.996	P	0.57679	0.825	D	0.87007	0.2120	10	0.51188	T	0.08	.	18.8745	0.92329	0.0:1.0:0.0:0.0	.	1435	Q04721	NOTC2_HUMAN	Q	1435	ENSP00000256646:R1435Q	ENSP00000256646:R1435Q	R	-	2	0	NOTCH2	120269658	0.000000	0.05858	1.000000	0.80357	0.680000	0.39746	0.419000	0.21247	2.706000	0.92434	0.561000	0.74099	CGG	-	HMMSmart_NL,HMMPfam_Notch,superfamily_Notch_region		0.622	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	protein_coding	OTTHUMT00000033679.1	C	NM_024408		120269658	-1	no_errors	NM_024408	genbank	human	reviewed	54_36p	missense	SNP	0.918	T
Unknown	0	genome.wustl.edu	37	11	121233614	121233614	+	IGR	SNP	C	C	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr11:121233614C>G								SC5D (54211 upstream) : RP11-730K11.1 (84425 downstream)																							TTGAGATGCTCTTGCAATAAT	0.403																																																0			11																																								120738824	SO:0001628	intergenic_variant	283155																															11.37:g.121233614C>G		Somatic		Capture	Illumina GAIIx	4	120738824		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.403					LOC283155			C			120738824	-1	pseudogene	XR_016866	genbank	human	model	54_36p	rna	SNP	0.904	G
TAS2R16	50833	genome.wustl.edu	37	7	122635555	122635555	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr7:122635555A>G	ENST00000249284.2	-	1	199	c.134T>C	c.(133-135)gTg>gCg	p.V45A		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	45					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AATCATGTCCACAGGCATCAG	0.438																																																0			7											66.0	63.0	64.0					7																	122635555		2203	4300	6503	122422791	SO:0001583	missense	50833			AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.134T>C	7.37:g.122635555A>G	ENSP00000249284:p.Val45Ala	Somatic		Capture	Illumina GAIIx	4	122422791	A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	HMMPfam_TAS2R	p.V45A	ENST00000249284.2	37	c.134	CCDS5785.1	7	.	.	.	.	.	.	.	.	.	.	A	0.540	-0.853963	0.02630	.	.	ENSG00000128519	ENST00000249284	T	0.37411	1.2	4.61	2.29	0.28610	.	0.460841	0.18577	N	0.137161	T	0.23727	0.0574	L	0.50919	1.6	0.21020	N	0.999804	B	0.26577	0.153	B	0.25987	0.065	T	0.29701	-1.0003	10	0.02654	T	1	.	5.6672	0.17702	0.7874:0.0:0.2126:0.0	.	45	Q9NYV7	T2R16_HUMAN	A	45	ENSP00000249284:V45A	ENSP00000249284:V45A	V	-	2	0	TAS2R16	122422791	0.002000	0.14202	0.233000	0.24025	0.776000	0.43924	0.676000	0.25247	0.902000	0.36520	0.533000	0.62120	GTG	-	HMMPfam_TAS2R		0.438	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R16	protein_coding	OTTHUMT00000347409.1	A	NM_016945		122422791	-1	no_errors	NM_016945	genbank	human	reviewed	54_36p	missense	SNP	0.026	G
DPYSL4	10570	genome.wustl.edu	37	10	134008405	134008405	+	Missense_Mutation	SNP	C	C	T	rs537272168		TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr10:134008405C>T	ENST00000338492.4	+	4	534	c.370C>T	c.(370-372)Cgg>Tgg	p.R124W	DPYSL4_ENST00000493882.1_3'UTR|DPYSL4_ENST00000368627.1_Missense_Mutation_p.R47W|DPYSL4_ENST00000368629.1_Missense_Mutation_p.R47W	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	124					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)	cytosol (GO:0005829)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		CGAGCAGTGGCGGGAGCGGGC	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		14403	0.0		0.0	False		,,,				2504	0.001															0			10											64.0	60.0	61.0					10																	134008405		2203	4297	6500	133858395	SO:0001583	missense	10570			AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640			3016	protein-coding gene	gene with protein product		608407				8973361, 9652388	Standard	NM_006426		Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.370C>T	10.37:g.134008405C>T	ENSP00000339850:p.Arg124Trp	Somatic		Capture	Illumina GAIIx	4	133858395	B2RMQ1|D3DRG5|O00240|Q5T0Q7	Missense_Mutation	SNP	superfamily_Composite domain of metallo-dependent hydrolases,HMMPfam_Amidohydro_1,superfamily_Metallo-dependent hydrolases	p.R124W	ENST00000338492.4	37	c.370	CCDS7665.1	10	.	.	.	.	.	.	.	.	.	.	C	18.92	3.724747	0.68959	.	.	ENSG00000151640	ENST00000338492;ENST00000368629;ENST00000368627	D;D;D	0.90900	-2.75;-2.75;-2.75	4.48	4.48	0.54585	Amidohydrolase 1 (1);	0.114862	0.56097	D	0.000027	D	0.93956	0.8065	M	0.73372	2.23	0.52099	D	0.999945	D	0.89917	1.0	D	0.76071	0.987	D	0.94100	0.7361	10	0.87932	D	0	-7.9014	11.2412	0.48970	0.308:0.692:0.0:0.0	.	124	O14531	DPYL4_HUMAN	W	124;47;47	ENSP00000339850:R124W;ENSP00000357618:R47W;ENSP00000357616:R47W	ENSP00000339850:R124W	R	+	1	2	DPYSL4	133858395	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	0.929000	0.28844	2.344000	0.79699	0.555000	0.69702	CGG	-	superfamily_Composite domain of metallo-dependent hydrolases,HMMPfam_Amidohydro_1,superfamily_Metallo-dependent hydrolases		0.662	DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL4	protein_coding	OTTHUMT00000051050.2	C			133858395	+1	no_errors	NM_006426	genbank	human	validated	54_36p	missense	SNP	1.000	T
TG	7038	genome.wustl.edu	37	8	133911145	133911145	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr8:133911145C>T	ENST00000220616.4	+	14	3360	c.3320C>T	c.(3319-3321)gCc>gTc	p.A1107V	TG_ENST00000377869.1_Missense_Mutation_p.A1107V	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1107	Thyroglobulin type-1 9. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TTCGTCCCAGCCTGCCTAGAA	0.502																																																0			8											55.0	46.0	49.0					8																	133911145		2203	4300	6503	133980327	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3320C>T	8.37:g.133911145C>T	ENSP00000220616:p.Ala1107Val	Somatic		Capture	Illumina GAIIx	4	133980327	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	superfamily_Thyroglobulin type-1 domain,HMMPfam_Thyroglobulin_1,PatternScan_THYROGLOBULIN_1_1,HMMSmart_SM00211,superfamily_TNF receptor-like,HMMPfam_GCC2_GCC3,HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases,PatternScan_CARBOXYLESTERASE_B_2	p.A1107V	ENST00000220616.4	37	c.3320	CCDS34944.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.212|9.212	1.031171|1.031171	0.19590|0.19590	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000220616|ENST00000518505	T;T|.	0.64618|.	-0.11;-0.11|.	5.74|5.74	3.91|3.91	0.45181|0.45181	Thyroglobulin type-1 (6);|.	0.867777|.	0.10203|.	N|.	0.703150|.	T|T	0.24624|0.24624	0.0597|0.0597	L|L	0.28274|0.28274	0.84|0.84	0.21355|0.21355	N|N	0.999711|0.999711	B|.	0.13145|.	0.007|.	B|.	0.12156|.	0.007|.	T|T	0.19910|0.19910	-1.0291|-1.0291	10|5	0.18710|.	T|.	0.47|.	.|.	4.2845|4.2845	0.10848|0.10848	0.1623:0.5949:0.157:0.0858|0.1623:0.5949:0.157:0.0858	.|.	1107|.	P01266|.	THYG_HUMAN|.	V|S	1107|74	ENSP00000367100:A1107V;ENSP00000220616:A1107V|.	ENSP00000220616:A1107V|.	A|P	+|+	2|1	0|0	TG|TG	133980327|133980327	0.227000|0.227000	0.23707|0.23707	0.641000|0.641000	0.29422|0.29422	0.440000|0.440000	0.31957|0.31957	0.535000|0.535000	0.23114|0.23114	0.731000|0.731000	0.32448|0.32448	0.655000|0.655000	0.94253|0.94253	GCC|CCT	-	HMMPfam_Thyroglobulin_1,superfamily_Thyroglobulin type-1 domain,PatternScan_THYROGLOBULIN_1_1,HMMSmart_SM00211		0.502	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	protein_coding	OTTHUMT00000379606.1	C	NM_003235		133980327	+1	no_errors	NM_003235	genbank	human	validated	54_36p	missense	SNP	0.679	T
TG	7038	genome.wustl.edu	37	8	133925442	133925442	+	Nonsense_Mutation	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr8:133925442G>A	ENST00000220616.4	+	20	4350	c.4310G>A	c.(4309-4311)tGg>tAg	p.W1437*	TG_ENST00000377869.1_Nonsense_Mutation_p.W1437*	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1437			W -> R (in dbSNP:rs2069558). {ECO:0000269|PubMed:10199792, ECO:0000269|PubMed:3595599}.		hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCCAGGACATGGTTTGGGTGC	0.562																																																0			8	GRCh37	CM063191	TG	M							107.0	88.0	94.0					8																	133925442		2203	4300	6503	133994624	SO:0001587	stop_gained	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4310G>A	8.37:g.133925442G>A	ENSP00000220616:p.Trp1437*	Somatic		Capture	Illumina GAIIx	4	133994624	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Nonsense_Mutation	SNP	HMMPfam_Thyroglobulin_1,HMMSmart_SM00211,PatternScan_THYROGLOBULIN_1_1,superfamily_Thyroglobulin type-1 domain,HMMPfam_COesterase,HMMPfam_GCC2_GCC3,PatternScan_CARBOXYLESTERASE_B_2,superfamily_alpha/beta-Hydrolases,superfamily_TNF receptor-like	p.W1437*	ENST00000220616.4	37	c.4310	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	G	42	9.543138	0.99201	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616	.	.	.	5.81	0.0743	0.14394	.	1.612030	0.03081	N	0.158503	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	7.5624	0.27860	0.6316:0.0:0.3684:0.0	.	.	.	.	X	1437;243;1437	.	ENSP00000220616:W1437X	W	+	2	0	TG	133994624	0.765000	0.28485	0.001000	0.08648	0.676000	0.39594	1.216000	0.32443	0.073000	0.16731	0.650000	0.86243	TGG	-	NULL		0.562	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	protein_coding	OTTHUMT00000379606.1	G	NM_003235		133994624	+1	no_errors	NM_003235	genbank	human	validated	54_36p	nonsense	SNP	0.005	A
TF	7018	genome.wustl.edu	37	3	133483731	133483731	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr3:133483731G>T	ENST00000402696.3	+	11	1795	c.1310G>T	c.(1309-1311)tGt>tTt	p.C437F	TF_ENST00000264998.3_Missense_Mutation_p.C310F	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	437	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)			NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	AGCGATAATTGTGAGGATACA	0.363																																																0			3											139.0	153.0	148.0					3																	133483731		2203	4300	6503	134966421	SO:0001583	missense	7018				CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.1310G>T	3.37:g.133483731G>T	ENSP00000385834:p.Cys437Phe	Somatic		Capture	Illumina GAIIx	4	134966421	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like II,HMMPfam_Transferrin,HMMSmart_SM00094,PatternScan_TRANSFERRIN_1,PatternScan_TRANSFERRIN_2,PatternScan_TRANSFERRIN_3	p.C437F	ENST00000402696.3	37	c.1310	CCDS3080.1	3	.	.	.	.	.	.	.	.	.	.	G	11.77	1.737185	0.30774	.	.	ENSG00000091513	ENST00000402696;ENST00000264998	T;T	0.05855	3.38;3.38	5.24	5.24	0.73138	.	0.342854	0.39083	N	0.001468	T	0.16981	0.0408	M	0.92555	3.32	0.28962	N	0.889753	B	0.09022	0.002	B	0.14578	0.011	T	0.04268	-1.0964	10	0.59425	D	0.04	-8.247	14.5151	0.67814	0.0:0.0:1.0:0.0	.	437	P02787	TRFE_HUMAN	F	437;310	ENSP00000385834:C437F;ENSP00000264998:C310F	ENSP00000264998:C310F	C	+	2	0	TF	134966421	0.978000	0.34361	0.125000	0.21846	0.002000	0.02628	4.347000	0.59373	2.884000	0.98904	0.655000	0.94253	TGT	-	superfamily_Periplasmic binding protein-like II,HMMPfam_Transferrin,HMMSmart_SM00094		0.363	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TF	protein_coding	OTTHUMT00000317775.1	G	NM_001063		134966421	+1	no_errors	NM_001063	genbank	human	reviewed	54_36p	missense	SNP	0.042	T
VGLL1	51442	genome.wustl.edu	37	X	135630949	135630949	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chrX:135630949C>T	ENST00000370634.3	+	3	586	c.416C>T	c.(415-417)aCc>aTc	p.T139I	MIR934_ENST00000401241.1_RNA	NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	139					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					CTGGCGGGCACCAGCTCCTTA	0.627																																																0			X											146.0	116.0	126.0					X																	135630949		2203	4300	6503	135458615	SO:0001583	missense	51442			AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.416C>T	X.37:g.135630949C>T	ENSP00000359668:p.Thr139Ile	Somatic		Capture	Illumina GAIIx	4	135458615	Q5H915	Missense_Mutation	SNP	HMMPfam_Vg_Tdu,HMMSmart_SM00711	p.T139I	ENST00000370634.3	37	c.416	CCDS14658.1	X	.	.	.	.	.	.	.	.	.	.	C	5.244	0.230401	0.09969	.	.	ENSG00000102243	ENST00000370634	T	0.46819	0.86	5.81	4.04	0.47022	.	0.768878	0.12604	N	0.454453	T	0.26122	0.0637	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.21861	-1.0233	10	0.24483	T	0.36	-0.2165	7.8422	0.29406	0.0:0.8073:0.0:0.1927	.	139	Q99990	VGLL1_HUMAN	I	139	ENSP00000359668:T139I	ENSP00000359668:T139I	T	+	2	0	VGLL1	135458615	0.000000	0.05858	0.003000	0.11579	0.021000	0.10359	0.379000	0.20585	0.605000	0.29947	0.600000	0.82982	ACC	-	NULL		0.627	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VGLL1	protein_coding	OTTHUMT00000058493.1	C	NM_016267		135458615	+1	no_errors	NM_016267	genbank	human	provisional	54_36p	missense	SNP	0.001	T
PCDHA9	9752	genome.wustl.edu	37	5	140229994	140229994	+	Silent	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr5:140229994C>T	ENST00000532602.1	+	1	2947	c.1914C>T	c.(1912-1914)gaC>gaT	p.D638D	PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000378122.3_Silent_p.D638D|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	638	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCCTGGACGAAACGGACG	0.667																																					Melanoma(55;1800 1972 14909)											0			5											64.0	66.0	65.0					5																	140229994		2197	4272	6469	140210178	SO:0001819	synonymous_variant	9752			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1914C>T	5.37:g.140229994C>T		Somatic		Capture	Illumina GAIIx	4	140210178	O15053|Q2M3S5	Silent	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.D638	ENST00000532602.1	37	c.1914	CCDS54920.1	5																																																																																			-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.667	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	protein_coding	OTTHUMT00000372896.2	C	NM_031857		140210178	+1	no_errors	NM_031857	genbank	human	reviewed	54_36p	silent	SNP	0.110	T
PCDHB16	57717	genome.wustl.edu	37	5	140567091	140567091	+	IGR	SNP	G	G	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr5:140567091G>T	ENST00000361016.2	+	0	4814					NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACCAGGGTGGTTTCCGATGA	0.502																																																0			5											24.0	25.0	25.0					5																	140567091		2012	4169	6181	140547275	SO:0001628	intergenic_variant	56127			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325		5.37:g.140567091G>T		Somatic		Capture	Illumina GAIIx	4	140547275	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin-like,PatternScan_CADHERIN_1,HMMPfam_Cadherin,HMMSmart_SM00112	p.V67F	ENST00000361016.2	37	c.199	CCDS4251.1	5																																																																																			-	HMMPfam_Cadherin_2,superfamily_Cadherin-like		0.502	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB9	protein_coding	OTTHUMT00000251800.1	G	NM_020957		140547275	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_019119	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
PCDHGC5	56097	genome.wustl.edu	37	5	140869355	140869355	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr5:140869355A>G	ENST00000252087.1	+	1	548	c.548A>G	c.(547-549)aAg>aGg	p.K183R	PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGC4_ENST00000306593.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	183	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGAATGTGAAGACCCTAAAA	0.537																																																0			5											43.0	47.0	46.0					5																	140869355		2203	4300	6503	140849539	SO:0001583	missense	56097			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.548A>G	5.37:g.140869355A>G	ENSP00000252087:p.Lys183Arg	Somatic		Capture	Illumina GAIIx	4	140849539	Q9Y5C2	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.K183R	ENST00000252087.1	37	c.548	CCDS4263.1	5	.	.	.	.	.	.	.	.	.	.	A	10.02	1.237183	0.22711	.	.	ENSG00000240764	ENST00000252087	T	0.20069	2.1	6.08	6.08	0.98989	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000013	T	0.31389	0.0795	N	0.20328	0.56	0.30939	N	0.726033	D;D	0.71674	0.997;0.998	D;D	0.70716	0.963;0.97	T	0.17899	-1.0354	10	0.34782	T	0.22	.	16.3164	0.82930	1.0:0.0:0.0:0.0	.	183;183	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	R	183	ENSP00000252087:K183R	ENSP00000252087:K183R	K	+	2	0	PCDHGC5	140849539	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	7.101000	0.76997	2.330000	0.79161	0.533000	0.62120	AAG	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.537	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC5	protein_coding	OTTHUMT00000251819.1	A	NM_018929		140849539	+1	no_errors	NM_018929	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TRIM42	287015	genome.wustl.edu	37	3	140406647	140406647	+	Nonsense_Mutation	SNP	G	G	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr3:140406647G>T	ENST00000286349.3	+	3	1314	c.1123G>T	c.(1123-1125)Gag>Tag	p.E375*		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	375						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						AAAGCGAAAAGAGATCAGAAA	0.398																																																0			3											66.0	66.0	66.0					3																	140406647		2203	4300	6503	141889337	SO:0001587	stop_gained	287015			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1123G>T	3.37:g.140406647G>T	ENSP00000286349:p.Glu375*	Somatic		Capture	Illumina GAIIx	4	141889337	A1L4B4|Q8N832|Q8NDL3	Nonsense_Mutation	SNP	PatternScan_TNFR_NGFR_1,superfamily_RING/U-box,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMSmart_SM00336,HMMPfam_zf-B_box,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.E375*	ENST00000286349.3	37	c.1123	CCDS3113.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.141626	0.97320	.	.	ENSG00000155890	ENST00000286349	.	.	.	5.63	4.75	0.60458	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-2.6167	10.9826	0.47504	0.0884:0.0:0.9116:0.0	.	.	.	.	X	375	.	ENSP00000286349:E375X	E	+	1	0	TRIM42	141889337	1.000000	0.71417	0.997000	0.53966	0.592000	0.36648	3.127000	0.50484	2.676000	0.91093	0.555000	0.69702	GAG	-	NULL		0.398	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	protein_coding	OTTHUMT00000359531.2	G	NM_152616		141889337	+1	no_errors	NM_152616	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
FAM131B	9715	genome.wustl.edu	37	7	143053905	143053905	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr7:143053905G>C	ENST00000409408.1	-	6	2445	c.737C>G	c.(736-738)gCt>gGt	p.A246G	FAM131B_ENST00000409222.3_Missense_Mutation_p.A246G|FAM131B_ENST00000443739.2_Missense_Mutation_p.A274G|FAM131B_ENST00000409578.1_Missense_Mutation_p.A262G|FAM131B_ENST00000409346.1_Missense_Mutation_p.A246G			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	246										breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					AGGCTCCAGAGCAGAGTATCC	0.607																																																0			7											82.0	86.0	84.0					7																	143053905		2203	4300	6503	142764027	SO:0001583	missense	9715			BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.737C>G	7.37:g.143053905G>C	ENSP00000387017:p.Ala246Gly	Somatic		Capture	Illumina GAIIx	4	142764027	A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Missense_Mutation	SNP	NULL	p.A246G	ENST00000409408.1	37	c.737	CCDS5882.1	7	.	.	.	.	.	.	.	.	.	.	G	10.71	1.426491	0.25726	.	.	ENSG00000159784	ENST00000443739;ENST00000409578;ENST00000409346;ENST00000452076;ENST00000409408;ENST00000409222	T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9	5.46	4.52	0.55395	.	0.582437	0.18281	N	0.146033	T	0.13500	0.0327	N	0.04508	-0.205	0.31154	N	0.705093	B;B	0.09022	0.0;0.002	B;B	0.08055	0.002;0.003	T	0.04811	-1.0925	10	0.25751	T	0.34	-30.2412	15.6975	0.77512	0.0:0.1369:0.8631:0.0	.	262;246	Q86XD5-2;Q86XD5	.;F131B_HUMAN	G	274;262;246;250;246;246	ENSP00000410603:A274G;ENSP00000386568:A262G;ENSP00000386984:A246G;ENSP00000387017:A246G;ENSP00000387147:A246G	ENSP00000387147:A246G	A	-	2	0	FAM131B	142764027	0.518000	0.26234	1.000000	0.80357	0.736000	0.42039	1.667000	0.37471	2.561000	0.86390	0.655000	0.94253	GCT	-	NULL		0.607	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	FAM131B	protein_coding	OTTHUMT00000328057.1	G	NM_014690		142764027	-1	no_errors	NM_001031690	genbank	human	validated	54_36p	missense	SNP	0.425	C
GRPEL2	134266	genome.wustl.edu	37	5	148730727	148730727	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr5:148730727G>T	ENST00000329271.3	+	4	670	c.560G>T	c.(559-561)gGt>gTt	p.G187V	GRPEL2-AS1_ENST00000521295.1_RNA|GRPEL2_ENST00000416916.2_3'UTR|GRPEL2_ENST00000507562.1_3'UTR	NM_152407.3	NP_689620.2	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial (E. coli)	187					cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	adenyl-nucleotide exchange factor activity (GO:0000774)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCAGCTGGTGTTGGGGTG	0.527																																																0			5											131.0	124.0	126.0					5																	148730727		2203	4300	6503	148710920	SO:0001583	missense	134266			AL832325	CCDS4295.1	5q33.1	2008-02-05			ENSG00000164284	ENSG00000164284			21060	protein-coding gene	gene with protein product							Standard	NM_152407		Approved	DKFZp451C205, Mt-GrpE#2, FLJ23713	uc003lqj.3	Q8TAA5	OTTHUMG00000130048	ENST00000329271.3:c.560G>T	5.37:g.148730727G>T	ENSP00000329558:p.Gly187Val	Somatic		Capture	Illumina GAIIx	4	148710920	B4DFA6|Q49AJ6	Missense_Mutation	SNP	HMMPfam_GrpE,superfamily_GrpE_head,PatternScan_GRPE	p.G187V	ENST00000329271.3	37	c.560	CCDS4295.1	5	.	.	.	.	.	.	.	.	.	.	G	15.66	2.898000	0.52227	.	.	ENSG00000164284	ENST00000329271	.	.	.	5.9	3.89	0.44902	GrpE nucleotide exchange factor, head (2);	0.207319	0.41712	D	0.000834	T	0.39279	0.1072	L	0.42744	1.35	0.80722	D	1	P	0.36354	0.549	B	0.36534	0.227	T	0.26849	-1.0091	9	0.36615	T	0.2	-18.0841	4.2346	0.10620	0.4431:0.0:0.5569:0.0	.	187	Q8TAA5	GRPE2_HUMAN	V	187	.	ENSP00000329558:G187V	G	+	2	0	GRPEL2	148710920	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.665000	0.54532	1.512000	0.48834	0.644000	0.83932	GGT	-	HMMPfam_GrpE,superfamily_GrpE_head,PatternScan_GRPE		0.527	GRPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRPEL2	protein_coding	OTTHUMT00000252327.1	G	NM_152407		148710920	+1	no_errors	NM_152407	genbank	human	validated	54_36p	missense	SNP	1.000	T
DCHS2	54798	genome.wustl.edu	37	4	155219074	155219074	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr4:155219074T>A	ENST00000357232.4	-	18	5026	c.5027A>T	c.(5026-5028)gAa>gTa	p.E1676V		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1676	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATCTTCTCCTTCCATGTGAAT	0.448																																																0			4											79.0	79.0	79.0					4																	155219074		2203	4300	6503	155438524	SO:0001583	missense	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.5027A>T	4.37:g.155219074T>A	ENSP00000349768:p.Glu1676Val	Somatic		Capture	Illumina GAIIx	4	155438524	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1	p.E1676V	ENST00000357232.4	37	c.5027	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	T	20.8	4.054838	0.75960	.	.	ENSG00000197410	ENST00000357232	T	0.60920	0.15	5.82	5.82	0.92795	Cadherin (1);Cadherin-like (1);	0.245550	0.34700	N	0.003744	T	0.55737	0.1939	L	0.27053	0.805	0.80722	D	1	D	0.60575	0.988	P	0.51657	0.676	T	0.54227	-0.8325	10	0.33141	T	0.24	.	16.1966	0.82029	0.0:0.0:0.0:1.0	.	1676	Q6V1P9	PCD23_HUMAN	V	1676	ENSP00000349768:E1676V	ENSP00000349768:E1676V	E	-	2	0	DCHS2	155438524	0.996000	0.38824	1.000000	0.80357	0.852000	0.48524	2.224000	0.42945	2.232000	0.73038	0.528000	0.53228	GAA	-	HMMSmart_SM00112		0.448	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	protein_coding	OTTHUMT00000365281.2	T	NM_001142552		155438524	-1	no_errors	NM_017639	genbank	human	validated	54_36p	missense	SNP	1.000	A
ASIC5	51802	genome.wustl.edu	37	4	156751190	156751190	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr4:156751190C>A	ENST00000537611.2	-	10	1382	c.1336G>T	c.(1336-1338)Ggt>Tgt	p.G446C		NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	446					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)										AGCTGACCACCAAGATCTGCT	0.299																																																0			4											21.0	20.0	20.0					4																	156751190		2203	4297	6500	156970640	SO:0001583	missense	51802			AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.1336G>T	4.37:g.156751190C>A	ENSP00000442477:p.Gly446Cys	Somatic		Capture	Illumina GAIIx	4	156970640		Missense_Mutation	SNP	PatternScan_ASC,HMMPfam_ASC	p.G446C	ENST00000537611.2	37	c.1336	CCDS3793.1	4	.	.	.	.	.	.	.	.	.	.	C	15.97	2.989525	0.53934	.	.	ENSG00000256394	ENST00000537611	D	0.85955	-2.05	4.25	3.41	0.39046	.	0.000000	0.64402	D	0.000004	D	0.93887	0.8044	H	0.94808	3.585	0.48696	D	0.999691	D	0.89917	1.0	D	0.97110	1.0	D	0.94890	0.8047	10	0.87932	D	0	-21.7362	13.0059	0.58703	0.0:0.9191:0.0:0.0809	.	446	Q9NY37	ACCN5_HUMAN	C	446	ENSP00000442477:G446C	ENSP00000264432:G446C	G	-	1	0	ACCN5	156970640	0.999000	0.42202	0.664000	0.29753	0.847000	0.48162	3.642000	0.54367	1.080000	0.41073	0.655000	0.94253	GGT	-	HMMPfam_ASC		0.299	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCN5	protein_coding	OTTHUMT00000366464.1	C			156970640	-1	no_errors	NM_017419	genbank	human	reviewed	54_36p	missense	SNP	0.997	A
OR10J8P	343409	genome.wustl.edu	37	1	159336177	159336177	+	RNA	SNP	T	T	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr1:159336177T>A	ENST00000431862.1	-	0	227																											TACACCCTTGTCATTATACCA	0.448																																																0			1																																								157602801			26476																															1.37:g.159336177T>A		Somatic		Capture	Illumina GAIIx	4	157602801		Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V76D	ENST00000431862.1	37	c.227		1																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.448	RP11-550P17.5-001	KNOWN	basic	antisense	OR10J1	antisense	OTTHUMT00000090626.1	T			157602801	+1	no_stop_codon	ENST00000328408	ensembl	human	known	54_36p	missense	SNP	0.000	A
DUSP27	92235	genome.wustl.edu	37	1	167095721	167095721	+	Silent	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr1:167095721G>C	ENST00000361200.2	+	6	1519	c.1353G>C	c.(1351-1353)ctG>ctC	p.L451L	DUSP27_ENST00000443333.1_Silent_p.L451L|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Silent_p.L451L			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	451					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						TCTGGGTCCTGAAGCAGCAGC	0.697																																																0			1											15.0	14.0	14.0					1																	167095721		2198	4299	6497	165362345	SO:0001819	synonymous_variant	92235			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1353G>C	1.37:g.167095721G>C		Somatic		Capture	Illumina GAIIx	4	165362345	A0AUM4|Q9C074	Silent	SNP	PatternScan_TYR_PHOSPHATASE_1,superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc	p.L451	ENST00000361200.2	37	c.1353	CCDS30932.1	1																																																																																			-	NULL		0.697	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	protein_coding	OTTHUMT00000083244.1	G	NM_001080426		165362345	+1	no_errors	NM_001080426	genbank	human	provisional	54_36p	silent	SNP	1.000	C
SCN3A	6328	genome.wustl.edu	37	2	165947014	165947014	+	Silent	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr2:165947014G>A	ENST00000360093.3	-	28	6140	c.5649C>T	c.(5647-5649)ccC>ccT	p.P1883P	AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000409101.3_Silent_p.P1834P|SCN3A_ENST00000465043.1_5'Flank|SCN3A_ENST00000540861.1_Silent_p.P366P|SCN3A_ENST00000283254.7_Silent_p.P1883P	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1883					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGACTTTGGAGGGGTTTGATG	0.403																																																0			2											74.0	69.0	71.0					2																	165947014		2203	4300	6503	165655260	SO:0001819	synonymous_variant	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5649C>T	2.37:g.165947014G>A		Somatic		Capture	Illumina GAIIx	4	165655260	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,HMMSmart_IQ,HMMPfam_IQ	p.P1883	ENST00000360093.3	37	c.5649		2																																																																																			-	NULL		0.403	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	protein_coding		G	NM_006922		165655260	-1	no_errors	NM_006922	genbank	human	reviewed	54_36p	silent	SNP	0.999	A
CDHR2	54825	genome.wustl.edu	37	5	176017575	176017575	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr5:176017575G>C	ENST00000510636.1	+	28	3700	c.3426G>C	c.(3424-3426)gaG>gaC	p.E1142D	CDHR2_ENST00000506348.1_Missense_Mutation_p.E1142D|CDHR2_ENST00000261944.5_Missense_Mutation_p.E1142D	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	1142					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						GCTCCCAGGAGAGCCAGGAGT	0.587																																																0			5											158.0	136.0	143.0					5																	176017575		2203	4300	6503	175950181	SO:0001583	missense	54825			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.3426G>C	5.37:g.176017575G>C	ENSP00000424565:p.Glu1142Asp	Somatic		Capture	Illumina GAIIx	4	175950181	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1	p.E1142D	ENST00000510636.1	37	c.3426	CCDS34297.1	5	.	.	.	.	.	.	.	.	.	.	g	5.205	0.223302	0.09863	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.56444	0.46;0.46;0.46	4.61	2.77	0.32553	.	.	.	.	.	T	0.42177	0.1191	L	0.49126	1.545	0.18873	N	0.999987	B	0.02656	0.0	B	0.04013	0.001	T	0.30416	-0.9979	9	0.17832	T	0.49	-11.5487	7.6984	0.28608	0.0:0.1805:0.6324:0.1871	.	1142	Q9BYE9	CDHR2_HUMAN	D	1142	ENSP00000424565:E1142D;ENSP00000261944:E1142D;ENSP00000421078:E1142D	ENSP00000261944:E1142D	E	+	3	2	CDHR2	175950181	0.110000	0.22057	0.119000	0.21687	0.182000	0.23217	0.761000	0.26489	0.373000	0.24621	0.537000	0.68136	GAG	-	NULL		0.587	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH24	protein_coding	OTTHUMT00000372201.1	G	NM_017675		175950181	+1	no_errors	NM_017675	genbank	human	reviewed	54_36p	missense	SNP	0.820	C
GPRIN1	114787	genome.wustl.edu	37	5	176024996	176024996	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr5:176024996C>A	ENST00000303991.4	-	2	2017	c.1840G>T	c.(1840-1842)Ggg>Tgg	p.G614W		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	614					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACAGGACTCCCCTTCTCTAGA	0.587																																																0			5											66.0	67.0	67.0					5																	176024996		2203	4300	6503	175957602	SO:0001583	missense	114787			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.1840G>T	5.37:g.176024996C>A	ENSP00000305839:p.Gly614Trp	Somatic		Capture	Illumina GAIIx	4	175957602	C9JM70|Q8ND74|Q96PZ4	Missense_Mutation	SNP	NULL	p.G614W	ENST00000303991.4	37	c.1840	CCDS4405.1	5	.	.	.	.	.	.	.	.	.	.	C	15.64	2.893907	0.52121	.	.	ENSG00000169258	ENST00000303991;ENST00000335532	T	0.09445	2.98	4.26	2.25	0.28309	.	0.432942	0.17204	N	0.182995	T	0.22820	0.0551	L	0.56769	1.78	0.09310	N	1	D	0.76494	0.999	D	0.69479	0.964	T	0.01232	-1.1411	10	0.66056	D	0.02	0.0053	7.1739	0.25734	0.0:0.7218:0.1744:0.1038	.	614	Q7Z2K8	GRIN1_HUMAN	W	614	ENSP00000305839:G614W	ENSP00000305839:G614W	G	-	1	0	GPRIN1	175957602	0.000000	0.05858	0.018000	0.16275	0.011000	0.07611	0.046000	0.14035	1.926000	0.55796	0.455000	0.32223	GGG	-	NULL		0.587	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN1	protein_coding	OTTHUMT00000253149.1	C	NM_052899		175957602	-1	no_errors	NM_052899	genbank	human	validated	54_36p	missense	SNP	0.000	A
ZNF385B	151126	genome.wustl.edu	37	2	180634384	180634384	+	Silent	SNP	G	G	A			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr2:180634384G>A	ENST00000410066.1	-	3	702	c.99C>T	c.(97-99)ttC>ttT	p.F33F		NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	33	Required for induction of apoptosis.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			CACAGAAGGAGAAAAGAATTT	0.478																																					Colon(155;204 2491 32774 51842)											0			2											88.0	84.0	85.0					2																	180634384		2203	4300	6503	180342629	SO:0001819	synonymous_variant	151126			AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.99C>T	2.37:g.180634384G>A		Somatic		Capture	Illumina GAIIx	4	180342629	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Silent	SNP	HMMSmart_SM00451,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_C2H2 and C2HC zinc fingers	p.F33	ENST00000410066.1	37	c.99	CCDS33339.1	2																																																																																			-	HMMSmart_SM00451		0.478	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385B	protein_coding	OTTHUMT00000335972.1	G	NM_152520		180342629	-1	no_errors	NM_152520	genbank	human	validated	54_36p	silent	SNP	1.000	A
LAMC1	3915	genome.wustl.edu	37	1	183087281	183087281	+	Splice_Site	SNP	A	A	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr1:183087281A>G	ENST00000258341.4	+	11	2247	c.1990A>G	c.(1990-1992)Agt>Ggt	p.S664G		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	664	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						CAGTGAGAGAAGTAAGTTATG	0.348																																																0			1											78.0	83.0	81.0					1																	183087281		2203	4300	6503	181353904	SO:0001630	splice_region_variant	3915			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.1990+1A>G	1.37:g.183087281A>G		Somatic		Capture	Illumina GAIIx	4	181353904	Q5VYE7	Missense_Mutation	SNP	HMMSmart_LamNT,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,superfamily_SSF57196,PatternScan_EGF_1,PatternScan_EGF_LAM_1,superfamily_Grow_fac_recept,HMMSmart_LamB,HMMPfam_Laminin_B,PatternScan_EGF_2	p.S664G	ENST00000258341.4	37	c.1990	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	A	10.01	1.234317	0.22626	.	.	ENSG00000135862	ENST00000258341	T	0.36520	1.25	5.0	5.0	0.66597	Laminin B type IV (2);Laminin B, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.19967	0.0480	N	0.16130	0.375	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.07731	-1.0757	10	0.02654	T	1	.	14.7399	0.69445	1.0:0.0:0.0:0.0	.	664	P11047	LAMC1_HUMAN	G	664	ENSP00000258341:S664G	ENSP00000258341:S664G	S	+	1	0	LAMC1	181353904	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.867000	0.75511	1.879000	0.54435	0.528000	0.53228	AGT	-	superfamily_Grow_fac_recept,HMMSmart_LamB,HMMPfam_Laminin_B		0.348	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	protein_coding	OTTHUMT00000085954.2	A	NM_002293	Missense_Mutation	181353904	+1	no_errors	NM_002293	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
HMCN1	83872	genome.wustl.edu	37	1	186008089	186008089	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr1:186008089A>G	ENST00000271588.4	+	38	6209	c.5980A>G	c.(5980-5982)Atc>Gtc	p.I1994V	HMCN1_ENST00000367492.2_Missense_Mutation_p.I1994V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1994	Ig-like C2-type 17.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATGCGTGGCCATCAACTCAGC	0.428																																																0			1											107.0	99.0	102.0					1																	186008089		2203	4300	6503	184274712	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5980A>G	1.37:g.186008089A>G	ENSP00000271588:p.Ile1994Val	Somatic		Capture	Illumina GAIIx	4	184274712	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	superfamily_vWA-like,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,HMMSmart_SM00408,HMMPfam_I-set,HMMSmart_SM00406,PatternScan_CECROPIN,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMSmart_SM00682,HMMPfam_G2F,superfamily_GFP-like,PatternScan_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,HMMPfam_EGF_CA,PatternScan_EGF_2	p.I1994V	ENST00000271588.4	37	c.5980	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	A	2.861	-0.236239	0.05944	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.65916	-0.18;-0.18	5.85	1.04	0.20106	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.399659	0.28883	N	0.013838	T	0.30792	0.0776	N	0.03209	-0.39	0.30405	N	0.77963	B	0.15930	0.015	B	0.14023	0.01	T	0.14727	-1.0462	10	0.22109	T	0.4	.	5.7533	0.18158	0.3588:0.0:0.4851:0.1561	.	1994	Q96RW7	HMCN1_HUMAN	V	1994	ENSP00000271588:I1994V;ENSP00000356462:I1994V	ENSP00000271588:I1994V	I	+	1	0	HMCN1	184274712	0.030000	0.19436	0.998000	0.56505	0.938000	0.57974	0.364000	0.20325	0.143000	0.18926	0.533000	0.62120	ATC	-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408		0.428	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	A	NM_031935		184274712	+1	no_errors	NM_031935	genbank	human	reviewed	54_36p	missense	SNP	0.929	G
MCF2L2	23101	genome.wustl.edu	37	3	183013187	183013187	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr3:183013187G>C	ENST00000328913.3	-	13	1873	c.1576C>G	c.(1576-1578)Ctg>Gtg	p.L526V	MCF2L2_ENST00000447025.2_Missense_Mutation_p.L526V|B3GNT5_ENST00000462559.1_Intron|MCF2L2_ENST00000473233.1_Missense_Mutation_p.L526V|MCF2L2_ENST00000414362.2_Missense_Mutation_p.L526V	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	526							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TTGGCTGCCAGTTTCATCAGA	0.498																																																0			3											181.0	153.0	163.0					3																	183013187		2203	4300	6503	184495881	SO:0001583	missense	23101			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1576C>G	3.37:g.183013187G>C	ENSP00000328118:p.Leu526Val	Somatic		Capture	Illumina GAIIx	4	184495881	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	HMMSmart_SM00516,superfamily_Spectrin repeat,HMMSmart_SM00150,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.L526V	ENST00000328913.3	37	c.1576	CCDS3243.1	3	.	.	.	.	.	.	.	.	.	.	G	16.23	3.063246	0.55432	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000437431;ENST00000414362	T;T;T;T	0.07800	4.34;4.36;3.44;3.16	4.82	2.08	0.27032	.	0.000000	0.64402	D	0.000009	T	0.24314	0.0589	M	0.76328	2.33	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.78314	0.919;0.991	T	0.00311	-1.1827	10	0.54805	T	0.06	.	9.6793	0.40061	0.2249:0.0:0.7751:0.0	.	526;526	Q86YR7-2;Q86YR7	.;MF2L2_HUMAN	V	526;526;526;62;526	ENSP00000328118:L526V;ENSP00000420070:L526V;ENSP00000388190:L526V;ENSP00000414131:L526V	ENSP00000328118:L526V	L	-	1	2	MCF2L2	184495881	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.316000	0.51960	0.277000	0.22141	-0.141000	0.14075	CTG	-	NULL		0.498	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	protein_coding	OTTHUMT00000350868.1	G	NM_015078		184495881	-1	no_errors	NM_015078	genbank	human	validated	54_36p	missense	SNP	1.000	C
SLC51A	200931	genome.wustl.edu	37	3	195955761	195955761	+	Silent	SNP	C	C	T			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr3:195955761C>T	ENST00000296327.5	+	6	812	c.603C>T	c.(601-603)ctC>ctT	p.L201L		NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	201					bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)									Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	GCCTGTTTCTCGTCCCCGACG	0.522																																																0			3											128.0	112.0	117.0					3																	195955761		2203	4300	6503	197440158	SO:0001819	synonymous_variant	200931				CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.603C>T	3.37:g.195955761C>T		Somatic		Capture	Illumina GAIIx	4	197440158	Q6ZMC7	Silent	SNP	NULL	p.L201	ENST00000296327.5	37	c.603	CCDS3314.1	3																																																																																			-	NULL		0.522	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSTalpha	protein_coding	OTTHUMT00000341253.1	C	NM_152672		197440158	+1	no_errors	NM_152672	genbank	human	validated	54_36p	silent	SNP	0.683	T
TTC13	79573	genome.wustl.edu	37	1	231114465	231114465	+	Missense_Mutation	SNP	C	C	G	rs76376323	byFrequency	TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr1:231114465C>G	ENST00000366661.4	-	1	119	c.112G>C	c.(112-114)Ggg>Cgg	p.G38R	ARV1_ENST00000310256.2_5'Flank|TTC13_ENST00000366662.4_Missense_Mutation_p.G38R|TTC13_ENST00000414259.1_Missense_Mutation_p.G38R|ARV1_ENST00000366658.2_5'Flank	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	38				G -> R (in Ref. 1; BAC11700). {ECO:0000305}.						central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		GGCCGCAGCCCGGCGGACAGG	0.771													C|||	1288	0.257188	0.1498	0.1729	5008	,	,		7397	0.3899		0.2396	False		,,,				2504	0.3436															0			1											1.0	1.0	1.0					1																	231114465		757	1622	2379	229181088	SO:0001583	missense	79573				CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.112G>C	1.37:g.231114465C>G	ENSP00000355621:p.Gly38Arg	Somatic		Capture	Illumina GAIIx	4	229181088	B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation	SNP	HMMSmart_SM00028,superfamily_TPR-like,HMMPfam_TPR_1,HMMPfam_TPR_2	p.G38R	ENST00000366661.4	37	c.112	CCDS1588.1	1	532	0.24358974358974358	60	0.12195121951219512	69	0.19060773480662985	225	0.39335664335664333	178	0.23482849604221637	C	10.42	1.345811	0.24426	.	.	ENSG00000143643	ENST00000366661;ENST00000366662;ENST00000414259;ENST00000522399	T;T;T	0.51817	0.86;0.69;0.69	3.75	2.82	0.32997	.	1.184840	0.06392	N	0.717231	T	0.00012	0.0000	N	0.08118	0	0.45962	P	0.0012199999999999989	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.40194	-0.9576	9	0.30078	T	0.28	-4.4309	9.7005	0.40184	0.0:0.8995:0.0:0.1005	.	38;38;38	E9PGV4;Q8NBP0-2;Q8NBP0	.;.;TTC13_HUMAN	R	38	ENSP00000355621:G38R;ENSP00000355622:G38R;ENSP00000416631:G38R	ENSP00000355621:G38R	G	-	1	0	TTC13	229181088	0.864000	0.29904	0.003000	0.11579	0.032000	0.12392	1.922000	0.40045	0.882000	0.36016	0.289000	0.19496	GGG	-	NULL		0.771	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC13	protein_coding	OTTHUMT00000092229.2	C	NM_024525		229181088	-1	no_errors	NM_024525	genbank	human	validated	54_36p	missense	SNP	0.001	G
OR2G3	81469	genome.wustl.edu	37	1	247769215	247769215	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2641-01A-01D-1526-09	TCGA-23-2641-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f91a1a25-fede-4430-b5d9-d768bce3e101	3cc43868-18ab-4129-8ebf-af7cdfd93025	g.chr1:247769215A>C	ENST00000320002.2	+	1	360	c.328A>C	c.(328-330)Act>Cct	p.T110P	RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ACTGGGCTCCACTGAATGTAT	0.493																																																0			1											273.0	239.0	251.0					1																	247769215		2203	4300	6503	245835838	SO:0001583	missense	81469			BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.328A>C	1.37:g.247769215A>C	ENSP00000326301:p.Thr110Pro	Somatic		Capture	Illumina GAIIx	4	245835838	B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T110P	ENST00000320002.2	37	c.328	CCDS31093.1	1	.	.	.	.	.	.	.	.	.	.	A	15.38	2.817483	0.50633	.	.	ENSG00000177476	ENST00000320002	T	0.02236	4.38	3.68	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37623	U	0.002011	T	0.17323	0.0416	H	0.96239	3.79	0.09310	N	1	D	0.69078	0.997	D	0.69654	0.965	T	0.13019	-1.0525	10	0.87932	D	0	.	10.6394	0.45584	1.0:0.0:0.0:0.0	.	110	Q8NGZ4	OR2G3_HUMAN	P	110	ENSP00000326301:T110P	ENSP00000326301:T110P	T	+	1	0	OR2G3	245835838	0.000000	0.05858	0.950000	0.38849	0.981000	0.71138	0.268000	0.18571	1.674000	0.50907	0.403000	0.27427	ACT	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1		0.493	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G3	protein_coding	OTTHUMT00000097624.1	A			245835838	+1	no_errors	NM_001001914	genbank	human	provisional	54_36p	missense	SNP	0.001	C
