#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								7294	SO:0001628	intergenic_variant	4512																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	7294		Missense_Mutation	SNP	superfamily_Cytochrome c oxidase subunit I-like,HMMPfam_COX1,PatternScan_COX1_CUB	p.A464T		37	c.1390		MT																																																																																			-	superfamily_Cytochrome c oxidase subunit I-like	0	0					MT-CO1			G			7294	+1	no_stop_codon	ENST00000361624	ensembl	human	known	54_36p	missense	SNP	NULL	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								15340	SO:0001628	intergenic_variant	4519																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	15340		Missense_Mutation	SNP	superfamily_Transmembr_di-haem_cytochrome,HMMPfam_Cytochrom_B_N,HMMPfam_Cytochrom_B_C,superfamily_Cytochrome_b/b6_C	p.L198P		37	c.593		MT																																																																																			-	superfamily_Transmembr_di-haem_cytochrome,HMMPfam_Cytochrom_B_N	0	0					MT-CYB			T			15340	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361789	ensembl	human	known	54_36p	missense	SNP	NULL	C
CETN1	1068	genome.wustl.edu	37	18	580774	580774	+	Silent	SNP	G	G	A	rs199682997		TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr18:580774G>A	ENST00000327228.3	+	1	408	c.366G>A	c.(364-366)tcG>tcA	p.S122S		NM_004066.1	NP_004057.1	Q12798	CETN1_HUMAN	centrin, EF-hand protein, 1	122	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to heat (GO:0034605)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|photoreceptor connecting cilium (GO:0032391)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(3)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(2)	25						GGAAGATCTCGTTCAAAAACC	0.557																																																0			18											87.0	90.0	89.0					18																	580774		2203	4300	6503	570774	SO:0001819	synonymous_variant	1068			U03270	CCDS11820.1	18p11.32	2013-01-10			ENSG00000177143	ENSG00000177143		"""EF-hand domain containing"""	1866	protein-coding gene	gene with protein product		603187		CETN		8175926	Standard	NM_004066		Approved	CEN1	uc002kko.1	Q12798	OTTHUMG00000131471	ENST00000327228.3:c.366G>A	18.37:g.580774G>A		Somatic		Capture	Illumina GAIIx	4	570774	B2R536	Silent	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1,PatternScan_DEAD_ATP_HELICASE	p.S122	ENST00000327228.3	37	c.366	CCDS11820.1	18																																																																																			-	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand		0.557	CETN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CETN1	protein_coding	OTTHUMT00000254314.2	G	NM_004066		570774	+1	no_errors	NM_004066	genbank	human	reviewed	54_36p	silent	SNP	0.397	A
MED16	10025	genome.wustl.edu	37	19	871095	871095	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr19:871095C>G	ENST00000589119.1	-	12	2256	c.2257G>C	c.(2257-2259)Ggc>Cgc	p.G753R	MED16_ENST00000606828.1_5'Flank|MED16_ENST00000269814.4_Missense_Mutation_p.L688F|MED16_ENST00000395808.3_Missense_Mutation_p.G753R|MED16_ENST00000325464.1_Missense_Mutation_p.G753R|MED16_ENST00000312090.6_Missense_Mutation_p.G772R			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	753					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGCCCGGCCAAACTGCAGA	0.682																																																0			19											12.0	14.0	13.0					19																	871095		1889	3654	5543	822095	SO:0001583	missense	10025			AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.2257G>C	19.37:g.871095C>G	ENSP00000464810:p.Gly753Arg	Somatic		Capture	Illumina GAIIx	4	822095	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40	p.G753R	ENST00000589119.1	37	c.2257	CCDS12047.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	11.54|11.54	1.670615|1.670615	0.29693|0.29693	.|.	.|.	ENSG00000175221|ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808|ENST00000269814	T;T;T|.	0.49432|.	0.78;0.78;0.78|.	4.13|4.13	1.88|1.88	0.25563|0.25563	.|.	0.072510|.	0.56097|.	U|.	0.000040|.	T|T	0.38054|0.38054	0.1026|0.1026	L|L	0.56769|0.56769	1.78|1.78	0.26802|0.26802	N|N	0.96918|0.96918	B;B|P	0.15930|0.39883	0.005;0.015|0.693	B;B|B	0.20577|0.39840	0.011;0.03|0.311	T|T	0.16394|0.16394	-1.0404|-1.0404	10|8	0.62326|0.33940	D|T	0.03|0.23	-39.2741|-39.2741	8.6497|8.6497	0.34027|0.34027	0.0:0.7616:0.1502:0.0882|0.0:0.7616:0.1502:0.0882	.|.	772;753|688	Q9Y2X0-3;Q9Y2X0|Q9Y2X0-4	.;MED16_HUMAN|.	R|F	753;772;753|688	ENSP00000325612:G753R;ENSP00000308528:G772R;ENSP00000379153:G753R|.	ENSP00000308528:G772R|ENSP00000269814:L688F	G|L	-|-	1|3	0|2	MED16|MED16	822095|822095	1.000000|1.000000	0.71417|0.71417	0.556000|0.556000	0.28293|0.28293	0.017000|0.017000	0.09413|0.09413	5.242000|5.242000	0.65389|0.65389	0.702000|0.702000	0.31825|0.31825	0.543000|0.543000	0.68304|0.68304	GGC|TTG	-	NULL		0.682	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MED16	protein_coding	OTTHUMT00000457902.3	C	NM_005481		822095	-1	no_errors	NM_005481	genbank	human	validated	54_36p	missense	SNP	0.999	G
TMEM259	91304	genome.wustl.edu	37	19	1021622	1021622	+	5'Flank	SNP	A	A	G	rs572960308	byFrequency	TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr19:1021622A>G	ENST00000356663.3	-	0	0				RNU6-2_ENST00000384627.1_RNA|TMEM259_ENST00000333175.5_5'Flank	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											agcgttccatatttttGCTGT	0.507													A|||	8	0.00159744	0.003	0.0014	5008	,	,		20749	0.001		0.0	False		,,,				2504	0.002															0			19																																								972622	SO:0001631	upstream_gene_variant	26826			BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3			19.37:g.1021622A>G	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	972622	O60392|Q8NF79|Q96H30	RNA	SNP	-	NULL	ENST00000356663.3	37	NULL	CCDS32862.1	19																																																																																			-	-		0.507	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNU6-2	protein_coding	OTTHUMT00000458236.1	A	NM_033420		972622	+1	no_errors	ENST00000384627	ensembl	human	known	54_36p	rna	SNP	0.907	G
WDR37	22884	genome.wustl.edu	37	10	1170258	1170258	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr10:1170258A>G	ENST00000358220.1	+	12	1348	c.1204A>G	c.(1204-1206)Att>Gtt	p.I402V	WDR37_ENST00000263150.4_Missense_Mutation_p.I402V|WDR37_ENST00000482165.1_3'UTR			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	402										breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		GAGATCCCCCATTGCAACTAT	0.458																																																0			10											136.0	122.0	127.0					10																	1170258		2203	4300	6503	1160258	SO:0001583	missense	22884			AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.1204A>G	10.37:g.1170258A>G	ENSP00000350954:p.Ile402Val	Somatic		Capture	Illumina GAIIx	4	1160258	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.I402V	ENST00000358220.1	37	c.1204	CCDS7057.1	10	.	.	.	.	.	.	.	.	.	.	A	15.75	2.926673	0.52759	.	.	ENSG00000047056	ENST00000358220;ENST00000263150	T;T	0.01287	5.05;5.05	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.01254	0.0041	N	0.12961	0.28	0.80722	D	1	B;B	0.31485	0.075;0.325	B;B	0.25405	0.028;0.06	T	0.72714	-0.4210	10	0.25751	T	0.34	.	15.8515	0.78934	1.0:0.0:0.0:0.0	.	403;402	A8K976;Q9Y2I8	.;WDR37_HUMAN	V	402	ENSP00000350954:I402V;ENSP00000263150:I402V	ENSP00000263150:I402V	I	+	1	0	WDR37	1160258	1.000000	0.71417	0.931000	0.37212	0.809000	0.45718	9.154000	0.94694	2.152000	0.67230	0.482000	0.46254	ATT	-	superfamily_WD40_like		0.458	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR37	protein_coding	OTTHUMT00000046418.1	A	NM_014023		1160258	+1	no_errors	NM_014023	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SLC6A3	6531	genome.wustl.edu	37	5	1441484	1441484	+	Silent	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr5:1441484G>A	ENST00000270349.9	-	3	535	c.408C>T	c.(406-408)ccC>ccT	p.P136P	SLC6A3_ENST00000453492.2_Silent_p.P136P	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	136					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	CTTTCAGTATGGGGCAGATCT	0.582																																																0			5											77.0	71.0	73.0					5																	1441484		2203	4300	6503	1494484	SO:0001819	synonymous_variant	6531				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.408C>T	5.37:g.1441484G>A		Somatic		Capture	Illumina GAIIx	4	1494484	A2RUN4|Q14996	Silent	SNP	HMMPfam_SNF,PatternScan_NA_NEUROTRAN_SYMP_1,PatternScan_NA_NEUROTRAN_SYMP_2	p.P136	ENST00000270349.9	37	c.408	CCDS3863.1	5																																																																																			-	HMMPfam_SNF		0.582	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A3	protein_coding	OTTHUMT00000253650.3	G	NM_001044		1494484	-1	no_errors	NM_001044	genbank	human	validated	54_36p	silent	SNP	0.974	A
PAM16	51025	genome.wustl.edu	37	16	4390365	4390365	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr16:4390365G>C	ENST00000318059.3	-	5	470	c.333C>G	c.(331-333)atC>atG	p.I111M	PAM16_ENST00000576217.1_Missense_Mutation_p.I111M|PAM16_ENST00000573553.1_Missense_Mutation_p.I131M|RP11-295D4.1_ENST00000574705.1_RNA|PAM16_ENST00000577031.1_Intron|PAM16_ENST00000571941.1_Missense_Mutation_p.I131M|CORO7-PAM16_ENST00000572274.1_5'Flank|PAM16_ENST00000575848.1_Missense_Mutation_p.I123M|CORO7-PAM16_ENST00000572467.1_Missense_Mutation_p.I1034M	NM_016069.9	NP_057153.8	Q9Y3D7	TIM16_HUMAN	presequence translocase-associated motor 16 homolog (S. cerevisiae)	111					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial matrix (GO:0030150)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane presequence translocase complex (GO:0005744)				lung(3)	3						CCTGGGCCTGGATTTTGAGTT	0.602																																																0			16											86.0	84.0	85.0					16																	4390365		2197	4299	6496	4330366	SO:0001583	missense	51025			AK026514	CCDS10512.1	16p13.3	2010-10-12	2010-10-12		ENSG00000217930	ENSG00000217930			29679	protein-coding gene	gene with protein product	"""mitochondria associated protein involved in granulocyte macrophage colony stimulating factor signal transduction"""	614336				10810093, 11750097	Standard	NM_016069		Approved	Magmas, Tim16, TIMM16		Q9Y3D7	OTTHUMG00000129466	ENST00000318059.3:c.333C>G	16.37:g.4390365G>C	ENSP00000315693:p.Ile111Met	Somatic		Capture	Illumina GAIIx	4	4330366	Q6I9Z3|Q9H5X3	Missense_Mutation	SNP	HMMPfam_Pam16	p.I111M	ENST00000318059.3	37	c.333	CCDS10512.1	16	.	.	.	.	.	.	.	.	.	.	G	16.12	3.032442	0.54790	.	.	ENSG00000217930	ENST00000318059	T	0.50548	0.74	6.17	5.2	0.72013	.	.	.	.	.	T	0.45034	0.1322	L	0.50333	1.59	0.27512	N	0.951674	B	0.28933	0.228	B	0.30251	0.113	T	0.35822	-0.9773	9	0.31617	T	0.26	-16.5284	14.5529	0.68081	0.0:0.0:0.849:0.151	.	111	Q9Y3D7	TIM16_HUMAN	M	111	ENSP00000315693:I111M	ENSP00000315693:I111M	I	-	3	3	PAM16	4330366	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.134000	0.50538	1.564000	0.49628	0.655000	0.94253	ATC	-	HMMPfam_Pam16		0.602	PAM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	Magmas	protein_coding	OTTHUMT00000251629.2	G	NM_016069		4330366	-1	no_errors	NM_016069	genbank	human	provisional	54_36p	missense	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7577579	7577579	+	Nonsense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr17:7577579G>C	ENST00000269305.4	-	7	891	c.702C>G	c.(700-702)taC>taG	p.Y234*	TP53_ENST00000445888.2_Nonsense_Mutation_p.Y234*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Y234*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Y234*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Y234*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Y234*|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	234	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> K (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> N (in sporadic cancers; somatic mutation).|Y -> Q (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(5)|p.Y234*(4)|p.Y234del(3)|p.N235fs*5(2)|p.N235fs*6(1)|p.I232_Y236delIHYNY(1)|p.Y234fs*2(1)|p.Y234Y(1)|p.T230_Y234delTTIHY(1)|p.H233fs*6(1)|p.V225fs*23(1)|p.Y234_N235insX(1)|p.Y234fs*4(1)|p.H233_C242del10(1)|p.D228fs*12(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACATGTAGTTGTAGTGGATGG	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	33	Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Unknown(5)|Substitution - Nonsense(4)|Insertion - Frameshift(3)|Insertion - In frame(1)|Substitution - coding silent(1)	biliary_tract(6)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|bone(4)|central_nervous_system(3)|oesophagus(2)|ovary(2)|upper_aerodigestive_tract(1)|cervix(1)|vulva(1)|stomach(1)|large_intestine(1)|lung(1)|skin(1)|liver(1)	17											120.0	95.0	104.0					17																	7577579		2203	4300	6503	7518304	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.702C>G	17.37:g.7577579G>C	ENSP00000269305:p.Tyr234*	Somatic		Capture	Illumina GAIIx	4	7518304	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.Y234*	ENST00000269305.4	37	c.702	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584528	0.65992	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	4.62	3.63	0.41609	.	0.211900	0.41823	D	0.000804	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1131	11.0852	0.48082	0.0925:0.0:0.9075:0.0	.	.	.	.	X	234;234;234;234;234;234;223;141;102;141	.	ENSP00000269305:Y234X	Y	-	3	2	TP53	7518304	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.037000	0.30241	1.281000	0.44480	0.462000	0.41574	TAC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7518304	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	C
MTRR	4552	genome.wustl.edu	37	5	7891483	7891483	+	Splice_Site	SNP	A	A	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr5:7891483A>G	ENST00000264668.2	+	10	1438		c.e10-1		MTRR_ENST00000440940.2_Splice_Site	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase						cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	ATTTTTTTCTAGAACATCTTC	0.264																																																0			5											79.0	80.0	80.0					5																	7891483		2203	4298	6501	7944483	SO:0001630	splice_region_variant	4552			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1409-1A>G	5.37:g.7891483A>G		Somatic		Capture	Illumina GAIIx	4	7944483	O60471|Q32MA9|Q7Z4M8	Splice_Site	SNP	-	e10-2	ENST00000264668.2	37	c.1409-2	CCDS3874.1	5	.	.	.	.	.	.	.	.	.	.	A	16.41	3.115254	0.56505	.	.	ENSG00000124275	ENST00000264668;ENST00000440940	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.601	0.62020	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MTRR	7944483	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.096000	0.76960	1.961000	0.56991	0.460000	0.39030	.	-	-		0.264	MTRR-001	KNOWN	basic|CCDS	protein_coding	MTRR	protein_coding	OTTHUMT00000206931.1	A		Intron	7944483	+1	no_errors	NM_024010	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	G
MRVI1	10335	genome.wustl.edu	37	11	10615085	10615085	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr11:10615085G>C	ENST00000436272.1	-	16	2126	c.2048C>G	c.(2047-2049)cCt>cGt	p.P683R	MRVI1_ENST00000527509.2_Missense_Mutation_p.P619R|MRVI1_ENST00000545852.1_Missense_Mutation_p.P395R|MRVI1_ENST00000423302.2_Missense_Mutation_p.P710R|MRVI1_ENST00000552103.1_Missense_Mutation_p.P619R|MRVI1_ENST00000531107.1_Missense_Mutation_p.P702R|MRVI1_ENST00000421747.1_Missense_Mutation_p.P701R|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000424001.1_Missense_Mutation_p.P395R|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000541483.1_Missense_Mutation_p.P504R|MRVI1-AS1_ENST00000525578.1_RNA|MRVI1_ENST00000547195.1_Missense_Mutation_p.P619R|MRVI1_ENST00000558540.1_Missense_Mutation_p.P395R|MRVI1_ENST00000534266.2_Missense_Mutation_p.P395R|MRVI1-AS1_ENST00000529829.1_RNA			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	683					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		AGTTTGGCCAGGCAGATTCAG	0.512																																																0			11											110.0	112.0	112.0					11																	10615085		2201	4294	6495	10571661	SO:0001583	missense	10335			AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.2048C>G	11.37:g.10615085G>C	ENSP00000412229:p.Pro683Arg	Somatic		Capture	Illumina GAIIx	4	10571661	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	HMMPfam_MRVI1	p.P701R	ENST00000436272.1	37	c.2102		11	.	.	.	.	.	.	.	.	.	.	G	28.3	4.911985	0.92178	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.26223	2.89;2.89;2.31;2.31;1.75;1.75;2.71;2.37;2.89;2.31	5.74	5.74	0.90152	.	0.185232	0.48286	D	0.000194	T	0.46073	0.1374	L	0.56769	1.78	0.80722	D	1	D;P;P;P	0.63880	0.993;0.782;0.782;0.741	P;P;P;P	0.58454	0.839;0.607;0.607;0.472	T	0.25363	-1.0134	10	0.54805	T	0.06	-5.8269	19.9357	0.97140	0.0:0.0:1.0:0.0	.	504;683;702;701	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	R	701;684;683;619;619;395;395;710;504;702;619	ENSP00000414598:P701R;ENSP00000412229:P683R;ENSP00000448278:P619R;ENSP00000446764:P619R;ENSP00000441971:P395R;ENSP00000401205:P395R;ENSP00000412130:P710R;ENSP00000437784:P504R;ENSP00000432436:P702R;ENSP00000432067:P619R	ENSP00000307885:P684R	P	-	2	0	MRVI1	10571661	1.000000	0.71417	0.544000	0.28141	0.939000	0.58152	7.091000	0.76923	2.715000	0.92844	0.655000	0.94253	CCT	-	HMMPfam_MRVI1		0.512	MRVI1-203	KNOWN	basic	protein_coding	MRVI1	protein_coding		G	NM_001098579		10571661	-1	no_errors	NM_001098579	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MYOCD	93649	genome.wustl.edu	37	17	12666711	12666711	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr17:12666711T>G	ENST00000343344.4	+	13	2567	c.2567T>G	c.(2566-2568)aTc>aGc	p.I856S	MYOCD_ENST00000425538.1_Missense_Mutation_p.I904S|RP11-1090M7.1_ENST00000584772.1_RNA			Q8IZQ8	MYCD_HUMAN	myocardin	856					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GCACATGAGATCTTGCCAGGC	0.502																																																0			17											85.0	71.0	76.0					17																	12666711		2203	4300	6503	12607436	SO:0001583	missense	93649			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2567T>G	17.37:g.12666711T>G	ENSP00000341835:p.Ile856Ser	Somatic		Capture	Illumina GAIIx	4	12607436	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	HMMSmart_SM00707,superfamily_SAP domain,HMMPfam_SAP,HMMSmart_SM00513	p.I856S	ENST00000343344.4	37	c.2567	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	T	14.43	2.534361	0.45073	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000443061	T;T	0.56444	0.46;0.47	6.08	6.08	0.98989	.	0.248184	0.41823	D	0.000807	T	0.62636	0.2444	M	0.65498	2.005	0.80722	D	1	P;P;B	0.51791	0.917;0.948;0.418	B;P;B	0.50231	0.282;0.635;0.167	T	0.67078	-0.5761	10	0.87932	D	0	-26.1798	15.6264	0.76863	0.0:0.0:0.0:1.0	.	580;904;856	E9PEP9;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	S	580;904;856;566	ENSP00000341835:I856S;ENSP00000400148:I566S	ENSP00000341835:I856S	I	+	2	0	MYOCD	12607436	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	3.271000	0.51608	2.333000	0.79357	0.533000	0.62120	ATC	-	NULL		0.502	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	protein_coding	OTTHUMT00000129950.1	T	NM_153604		12607436	+1	no_errors	NM_153604	genbank	human	provisional	54_36p	missense	SNP	0.992	G
CEP76	79959	genome.wustl.edu	37	18	12686335	12686335	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr18:12686335G>C	ENST00000262127.2	-	8	1273	c.1048C>G	c.(1048-1050)Cga>Gga	p.R350G	PSMG2_ENST00000589405.1_3'UTR|PSMG2_ENST00000585331.2_Intron|CEP76_ENST00000423709.2_Missense_Mutation_p.R275G	NM_024899.2	NP_079175.2	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	350					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						ACAGGGGCTCGTTCATAACCA	0.433																																																0			18											111.0	100.0	103.0					18																	12686335		2203	4300	6503	12676335	SO:0001583	missense	79959			BC026307	CCDS11861.1, CCDS62390.1	18p11.21	2014-02-20	2005-12-01	2005-12-01	ENSG00000101624	ENSG00000101624			25727	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 9"""	C18orf9		14654843	Standard	NM_024899		Approved	HsT1705, FLJ12542	uc002kri.4	Q8TAP6	OTTHUMG00000131701	ENST00000262127.2:c.1048C>G	18.37:g.12686335G>C	ENSP00000262127:p.Arg350Gly	Somatic		Capture	Illumina GAIIx	4	12676335	B0YJB2|B4DXG5|B4DZW1|Q658N5|Q9H9U7	Missense_Mutation	SNP	PatternScan_WD_REPEATS_1	p.R350G	ENST00000262127.2	37	c.1048	CCDS11861.1	18	.	.	.	.	.	.	.	.	.	.	G	15.32	2.799034	0.50208	.	.	ENSG00000101624	ENST00000262127;ENST00000423709	T;T	0.80123	-1.34;-1.32	5.74	0.954	0.19595	.	0.089737	0.85682	D	0.000000	T	0.75087	0.3802	L	0.59436	1.845	0.52501	D	0.999958	P;P;P	0.48589	0.912;0.785;0.6	B;B;B	0.41723	0.365;0.193;0.193	T	0.70615	-0.4823	10	0.21540	T	0.41	-12.9701	14.7869	0.69810	0.0:0.0:0.4508:0.5492	.	275;350;172	Q8TAP6-2;Q8TAP6;Q8TAP6-3	.;CEP76_HUMAN;.	G	350;275	ENSP00000262127:R350G;ENSP00000403074:R275G	ENSP00000262127:R350G	R	-	1	2	CEP76	12676335	1.000000	0.71417	0.913000	0.36048	0.971000	0.66376	1.584000	0.36589	-0.050000	0.13356	0.591000	0.81541	CGA	-	NULL		0.433	CEP76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP76	protein_coding	OTTHUMT00000254611.1	G	NM_024899		12676335	-1	no_errors	NM_024899	genbank	human	provisional	54_36p	missense	SNP	1.000	C
DNAH5	1767	genome.wustl.edu	37	5	13781064	13781064	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr5:13781064G>C	ENST00000265104.4	-	53	8929	c.8825C>G	c.(8824-8826)tCt>tGt	p.S2942C		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2942	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AATGACACGAGAGATCTGTAA	0.403									Kartagener syndrome																																							0			5											70.0	66.0	67.0					5																	13781064		2203	4300	6503	13834064	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8825C>G	5.37:g.13781064G>C	ENSP00000265104:p.Ser2942Cys	Somatic		Capture	Illumina GAIIx	4	13834064	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	HMMPfam_DHC_N1,superfamily_Spectrin,HMMPfam_DHC_N2,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.S2942C	ENST00000265104.4	37	c.8825	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126839	0.77549	.	.	ENSG00000039139	ENST00000265104	T	0.39406	1.08	5.56	5.56	0.83823	Dynein heavy chain, P-loop containing D4 domain (1);	0.000000	0.85682	D	0.000000	T	0.64789	0.2630	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66440	-0.5923	10	0.87932	D	0	.	19.5216	0.95187	0.0:0.0:1.0:0.0	.	2942	Q8TE73	DYH5_HUMAN	C	2942	ENSP00000265104:S2942C	ENSP00000265104:S2942C	S	-	2	0	DNAH5	13834064	1.000000	0.71417	0.982000	0.44146	0.527000	0.34593	9.691000	0.98679	2.605000	0.88082	0.655000	0.94253	TCT	-	superfamily_SSF52540		0.403	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	protein_coding	OTTHUMT00000207057.2	G	NM_001369		13834064	-1	no_errors	NM_001369	genbank	human	validated	54_36p	missense	SNP	1.000	C
LIPI	149998	genome.wustl.edu	37	21	15517068	15517068	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr21:15517068A>G	ENST00000536861.1	-	9	1170	c.1171T>C	c.(1171-1173)Tat>Cat	p.Y391H	AP001347.6_ENST00000432621.1_RNA|LIPI_ENST00000344577.2_Missense_Mutation_p.Y412H|AP001347.6_ENST00000428809.1_RNA			Q6XZB0	LIPI_HUMAN	lipase, member I	391					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		AAGTCATTATAAAATTGAGCA	0.313																																																0			21											53.0	57.0	55.0					21																	15517068		2202	4296	6498	14438939	SO:0001583	missense	149998			BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.1171T>C	21.37:g.15517068A>G	ENSP00000440381:p.Tyr391His	Somatic		Capture	Illumina GAIIx	4	14438939	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	HMMPfam_Lipase,superfamily_SSF53474	p.Y412H	ENST00000536861.1	37	c.1234		21	.	.	.	.	.	.	.	.	.	.	A	3.205	-0.162817	0.06502	.	.	ENSG00000188992	ENST00000344577;ENST00000536861	D;D	0.87571	-2.27;-2.25	5.34	1.57	0.23409	.	0.859781	0.10214	N	0.701745	T	0.73799	0.3633	N	0.19112	0.55	0.09310	N	0.999997	B	0.16603	0.018	B	0.18561	0.022	T	0.55927	-0.8063	10	0.15499	T	0.54	.	4.6369	0.12528	0.6515:0.1706:0.1778:0.0	.	412	Q6XZB0-2	.	H	412;391	ENSP00000343331:Y412H;ENSP00000440381:Y391H	ENSP00000343331:Y412H	Y	-	1	0	LIPI	14438939	0.720000	0.27996	0.296000	0.24974	0.426000	0.31534	1.106000	0.31098	0.081000	0.16988	-0.297000	0.09499	TAT	-	NULL		0.313	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	LIPI	protein_coding		A	NM_198996		14438939	-1	no_errors	NM_198996	genbank	human	validated	54_36p	missense	SNP	0.620	G
EAF1	85403	genome.wustl.edu	37	3	15477870	15477870	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr3:15477870T>G	ENST00000396842.2	+	5	973	c.548T>G	c.(547-549)aTt>aGt	p.I183S	EAF1-AS1_ENST00000594820.1_RNA|EAF1-AS1_ENST00000609310.1_RNA|EAF1_ENST00000432764.2_Missense_Mutation_p.I82S|EAF1-AS1_ENST00000494875.3_RNA|EAF1-AS1_ENST00000597949.1_RNA|EAF1-AS1_ENST00000595627.1_RNA|EAF1-AS1_ENST00000596371.1_RNA|EAF1-AS1_ENST00000595975.1_RNA|EAF1-AS1_ENST00000608780.1_RNA|EAF1-AS1_ENST00000593876.1_RNA	NM_033083.6	NP_149074.3	Q96JC9	EAF1_HUMAN	ELL associated factor 1	183	Necessary for transactivation activity.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ELL-EAF complex (GO:0032783)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	7						GAAGTTGACATTATTGAACAA	0.473																																																0			3											46.0	47.0	47.0					3																	15477870		2203	4300	6503	15452874	SO:0001583	missense	85403			AF272973	CCDS2626.1	3p25.1	2011-06-10			ENSG00000144597	ENSG00000144597			20907	protein-coding gene	gene with protein product		608315				11418481	Standard	NM_033083		Approved		uc003bzu.3	Q96JC9	OTTHUMG00000162544	ENST00000396842.2:c.548T>G	3.37:g.15477870T>G	ENSP00000380054:p.Ile183Ser	Somatic		Capture	Illumina GAIIx	4	15452874	B4E3F5|Q8IW10	Missense_Mutation	SNP	HMMPfam_EAF	p.I183S	ENST00000396842.2	37	c.548	CCDS2626.1	3	.	.	.	.	.	.	.	.	.	.	T	23.1	4.368948	0.82463	.	.	ENSG00000144597	ENST00000396842;ENST00000432764	.	.	.	5.65	5.65	0.86999	.	0.301064	0.40818	N	0.001011	T	0.53562	0.1804	L	0.56769	1.78	0.50813	D	0.999897	P;B	0.41450	0.75;0.063	B;B	0.36335	0.222;0.026	T	0.59300	-0.7480	9	0.52906	T	0.07	-6.2183	14.8502	0.70292	0.0:0.0:0.0:1.0	.	82;183	B4E3F5;Q96JC9	.;EAF1_HUMAN	S	183;82	.	ENSP00000380054:I183S	I	+	2	0	EAF1	15452874	1.000000	0.71417	0.939000	0.37840	0.896000	0.52359	7.698000	0.84413	2.150000	0.67090	0.397000	0.26171	ATT	-	NULL		0.473	EAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EAF1	protein_coding	OTTHUMT00000252100.4	T	NM_033083		15452874	+1	no_errors	NM_033083	genbank	human	validated	54_36p	missense	SNP	0.997	G
AD000091.2	0	genome.wustl.edu	37	19	15726547	15726547	+	lincRNA	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr19:15726547C>T	ENST00000589196.2	-	0	0				CYP4F8_ENST00000441682.2_RNA																							GGACCTATGCCTTCTATCACA	0.672																																																0			19											48.0	54.0	52.0					19																	15726547		2203	4300	6503	15587547			11283																															19.37:g.15726547C>T		Somatic		Capture	Illumina GAIIx	4	15587547		Silent	SNP	superfamily_Cytochrome P450,HMMPfam_p450,PatternScan_CYTOCHROME_P450	p.A40	ENST00000589196.2	37	c.120		19	.	.	.	.	.	.	.	.	.	.	c	5.835	0.338206	0.11069	.	.	ENSG00000186526	ENST00000325723	.	.	.	2.32	-0.211	0.13172	.	.	.	.	.	T	0.26448	0.0646	.	.	.	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.28106	-1.0054	6	0.87932	D	0	.	2.0797	0.03632	0.3198:0.4528:0.0:0.2274	.	2	B4DU85	.	L	2	.	ENSP00000314398:P2L	P	+	2	0	CYP4F8	15587547	0.000000	0.05858	0.005000	0.12908	0.012000	0.07955	-0.965000	0.03829	-0.007000	0.14345	0.313000	0.20887	CCT	-	NULL		0.672	AD000091.2-001	KNOWN	basic	lincRNA	CYP4F8	lincRNA	OTTHUMT00000460896.2	C			15587547	+1	no_errors	ENST00000325723	ensembl	human	known	54_36p	silent	SNP	0.087	T
ABCC6	368	genome.wustl.edu	37	16	16244575	16244575	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr16:16244575C>A	ENST00000205557.7	-	30	4292	c.4263G>T	c.(4261-4263)caG>caT	p.Q1421H		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1421	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	GGATGAGGATCTGGGTCTTCC	0.617																																																0			16											46.0	40.0	42.0					16																	16244575		2197	4300	6497	16152076	SO:0001583	missense	368			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.4263G>T	16.37:g.16244575C>A	ENSP00000205557:p.Gln1421His	Somatic		Capture	Illumina GAIIx	4	16152076	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.Q1421H	ENST00000205557.7	37	c.4263	CCDS10568.1	16	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265963	0.59540	.	.	ENSG00000091262	ENST00000205557;ENST00000205558	D	0.94184	-3.37	4.36	3.38	0.38709	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.172710	0.26096	U	0.026371	D	0.91036	0.7180	N	0.17872	0.535	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.64410	0.925;0.925	D	0.89619	0.3847	10	0.87932	D	0	.	4.6619	0.12646	0.0:0.5783:0.194:0.2278	.	1421;1421	O95255;A8Y988	MRP6_HUMAN;.	H	1421;359	ENSP00000205557:Q1421H	ENSP00000205557:Q1421H	Q	-	3	2	ABCC6	16152076	0.992000	0.36948	1.000000	0.80357	0.972000	0.66771	0.376000	0.20535	2.154000	0.67381	0.549000	0.68633	CAG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran		0.617	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC6	protein_coding	OTTHUMT00000252232.2	C			16152076	-1	no_errors	NM_001171	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CLCNKA	1187	genome.wustl.edu	37	1	16354393	16354393	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:16354393G>T	ENST00000331433.4	+	9	878	c.859G>T	c.(859-861)Gcg>Tcg	p.A287S	CLCNKA_ENST00000420078.1_Missense_Mutation_p.A287S|CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000375692.1_Missense_Mutation_p.A287S|CLCNKA_ENST00000439316.2_Missense_Mutation_p.A244S			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	287			A -> V (in dbSNP:rs34188929).		excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	CTTTTTTGTGGCGCTGGGGTG	0.612																																																0			1											63.0	57.0	59.0					1																	16354393		2202	4276	6478	16226980	SO:0001583	missense	1187				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.859G>T	1.37:g.16354393G>T	ENSP00000332771:p.Ala287Ser	Somatic		Capture	Illumina GAIIx	4	16226980	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Missense_Mutation	SNP	superfamily_Cl-channel_core,HMMPfam_Voltage_CLC,superfamily_SSF54631,HMMPfam_CBS,HMMSmart_CBS	p.A287S	ENST00000331433.4	37	c.859	CCDS167.1	1	.	.	.	.	.	.	.	.	.	.	G	8.121	0.780840	0.16120	.	.	ENSG00000186510	ENST00000375692;ENST00000420078;ENST00000439316;ENST00000331433	D;D;D;D	0.94457	-3.43;-3.43;-3.43;-3.43	3.3	-2.09	0.07232	Chloride channel, core (2);	0.863417	0.10401	N	0.679201	D	0.90971	0.7161	L	0.44542	1.39	0.09310	N	1	B;B;B	0.26602	0.154;0.154;0.154	B;B;B	0.40410	0.244;0.328;0.328	D	0.83652	0.0156	10	0.72032	D	0.01	.	0.8946	0.01261	0.1631:0.3207:0.1937:0.3224	.	244;287;287	E7EPH6;Q5T5Q4;P51800	.;.;CLCKA_HUMAN	S	287;287;244;287	ENSP00000364844:A287S;ENSP00000410353:A287S;ENSP00000414445:A244S;ENSP00000332771:A287S	ENSP00000332771:A287S	A	+	1	0	CLCNKA	16226980	0.000000	0.05858	0.137000	0.22149	0.114000	0.19823	-0.376000	0.07465	-0.136000	0.11475	0.313000	0.20887	GCG	-	superfamily_Cl-channel_core,HMMPfam_Voltage_CLC		0.612	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	protein_coding	OTTHUMT00000026326.1	G			16226980	+1	no_errors	NM_004070	genbank	human	reviewed	54_36p	missense	SNP	0.274	T
TRPV2	51393	genome.wustl.edu	37	17	16326074	16326074	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr17:16326074G>A	ENST00000338560.7	+	4	895	c.496G>A	c.(496-498)Gct>Act	p.A166T	TRPV2_ENST00000577397.1_5'UTR	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	166	Required for interaction with SLC50A1. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		AGGCCACAGCGCTCTGCACAT	0.587																																																0			17											65.0	54.0	58.0					17																	16326074		2203	4299	6502	16266799	SO:0001583	missense	51393			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.496G>A	17.37:g.16326074G>A	ENSP00000342222:p.Ala166Thr	Somatic		Capture	Illumina GAIIx	4	16266799	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	superfamily_ANK,HMMPfam_Ank,HMMSmart_ANK,HMMPfam_Ion_trans	p.A166T	ENST00000338560.7	37	c.496	CCDS32576.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.255643|5.255643	0.95336|0.95336	.|.	.|.	ENSG00000187688|ENSG00000187688	ENST00000338560|ENST00000455666	T|.	0.74209|.	-0.82|.	5.94|5.94	5.94|5.94	0.96194|0.96194	Ankyrin repeat-containing domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76478|0.76478	0.3993|0.3993	M|M	0.70108|0.70108	2.13|2.13	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.73754|0.73754	-0.3883|-0.3883	10|5	0.72032|.	D|.	0.01|.	-18.4928|-18.4928	19.3475|19.3475	0.94370|0.94370	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	166|.	Q9Y5S1|.	TRPV2_HUMAN|.	T|H	166|123	ENSP00000342222:A166T|.	ENSP00000342222:A166T|.	A|R	+|+	1|2	0|0	TRPV2|TRPV2	16266799|16266799	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.677000|0.677000	0.39632|0.39632	7.339000|7.339000	0.79282|0.79282	2.816000|2.816000	0.96949|0.96949	0.563000|0.563000	0.77884|0.77884	GCT|CGC	-	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank		0.587	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV2	protein_coding	OTTHUMT00000130464.2	G	NM_016113		16266799	+1	no_errors	NM_016113	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TMEM38A	79041	genome.wustl.edu	37	19	16799107	16799107	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr19:16799107T>A	ENST00000187762.2	+	6	916	c.825T>A	c.(823-825)caT>caA	p.H275Q		NM_024074.1	NP_076979.1	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	275						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)	15						GAGCTCAGCATTCGGCCATGC	0.647																																																0			19											62.0	64.0	63.0					19																	16799107		2203	4300	6503	16660107	SO:0001583	missense	79041			AK025981	CCDS12349.1	19p13.11	2013-05-23				ENSG00000072954			28462	protein-coding gene	gene with protein product		611235				17611541	Standard	NM_024074		Approved	MGC3169, TRIC-A	uc002nes.3	Q9H6F2		ENST00000187762.2:c.825T>A	19.37:g.16799107T>A	ENSP00000187762:p.His275Gln	Somatic		Capture	Illumina GAIIx	4	16660107	A8K9P9	Missense_Mutation	SNP	HMMPfam_DUF714	p.H275Q	ENST00000187762.2	37	c.825	CCDS12349.1	19	.	.	.	.	.	.	.	.	.	.	t	0.052	-1.247763	0.01469	.	.	ENSG00000072954	ENST00000187762	.	.	.	4.17	0.58	0.17402	.	0.669254	0.14953	N	0.288815	T	0.22666	0.0547	N	0.25647	0.755	0.09310	N	0.999999	B	0.21309	0.054	B	0.18263	0.021	T	0.22034	-1.0228	9	0.13108	T	0.6	-3.8583	5.2858	0.15700	0.0:0.3557:0.1479:0.4965	.	275	Q9H6F2	TM38A_HUMAN	Q	275	.	ENSP00000187762:H275Q	H	+	3	2	TMEM38A	16660107	0.027000	0.19231	0.081000	0.20488	0.301000	0.27625	-0.195000	0.09546	0.180000	0.19960	0.459000	0.35465	CAT	-	NULL		0.647	TMEM38A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM38A	protein_coding	OTTHUMT00000462841.1	T	NM_024074		16660107	+1	no_errors	NM_024074	genbank	human	provisional	54_36p	missense	SNP	0.150	A
VIM	7431	genome.wustl.edu	37	10	17276768	17276768	+	Missense_Mutation	SNP	G	G	A	rs371431143		TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr10:17276768G>A	ENST00000224237.5	+	5	1104	c.959G>A	c.(958-960)cGg>cAg	p.R320Q	VIM_ENST00000544301.1_Missense_Mutation_p.R320Q|RP11-124N14.3_ENST00000456355.1_RNA			P08670	VIME_HUMAN	vimentin	320	Coil 2.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ACTGAGTACCGGAGACAGGTG	0.522																																																0			10						G	GLN/ARG	0,4406		0,0,2203	87.0	80.0	82.0		959	5.1	1.0	10		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	VIM	NM_003380.3	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	320/467	17276768	1,13005	2203	4300	6503	17316774	SO:0001583	missense	7431			M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.959G>A	10.37:g.17276768G>A	ENSP00000224237:p.Arg320Gln	Somatic		Capture	Illumina GAIIx	4	17316774	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	HMMPfam_Filament_head,HMMPfam_Filament,PatternScan_IF	p.R320Q	ENST00000224237.5	37	c.959	CCDS7120.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.867489	0.97043	0.0	1.16E-4	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533;ENST00000421459	D;D;D	0.91740	-2.9;-2.9;-2.9	6.05	5.12	0.69794	Filament (1);	0.000000	0.44097	D	0.000499	D	0.96592	0.8888	M	0.88640	2.97	0.80722	D	1	D;D;D;D	0.89917	0.989;1.0;1.0;0.998	P;D;D;D	0.81914	0.733;0.991;0.995;0.949	D	0.96645	0.9477	10	0.62326	D	0.03	.	17.4719	0.87648	0.0:0.1236:0.8764:0.0	.	307;307;320;320	F5H288;B3KRK8;B0YJC4;P08670	.;.;.;VIME_HUMAN	Q	320;320;307;146	ENSP00000446007:R320Q;ENSP00000224237:R320Q;ENSP00000391842:R146Q	ENSP00000224237:R320Q	R	+	2	0	VIM	17316774	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.859000	0.99545	2.881000	0.98747	0.637000	0.83480	CGG	-	HMMPfam_Filament		0.522	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIM	protein_coding	OTTHUMT00000047015.1	G	NM_003380		17316774	+1	no_errors	NM_003380	genbank	human	validated	54_36p	missense	SNP	1.000	A
MAP3K15	389840	genome.wustl.edu	37	X	19390893	19390893	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chrX:19390893C>A	ENST00000338883.4	-	22	2985	c.2986G>T	c.(2986-2988)Gag>Tag	p.E996*	MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000359173.3_Nonsense_Mutation_p.E431*|MAP3K15_ENST00000469203.2_Nonsense_Mutation_p.E828*	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	996							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					TCCCTGTCCTCCGGGGACGAG	0.607																																																0			X											77.0	68.0	71.0					X																	19390893		2203	4300	6503	19300814	SO:0001587	stop_gained	389840			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2986G>T	X.37:g.19390893C>A	ENSP00000345629:p.Glu996*	Somatic		Capture	Illumina GAIIx	4	19300814	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Nonsense_Mutation	SNP	HMMSmart_S_TKc,HMMPfam_Pkinase,superfamily_Kinase_like,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,superfamily_SAM_homology	p.E471*	ENST00000338883.4	37	c.1411		X	.	.	.	.	.	.	.	.	.	.	c	38	6.982055	0.97979	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	.	.	.	5.58	4.72	0.59763	.	0.095273	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	13.4683	0.61268	0.0:0.9227:0.0:0.0773	.	.	.	.	X	996;431;828	.	ENSP00000345629:E996X	E	-	1	0	MAP3K15	19300814	1.000000	0.71417	0.042000	0.18584	0.057000	0.15508	5.607000	0.67648	1.114000	0.41781	0.525000	0.51046	GAG	-	NULL		0.607	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	protein_coding		C	NM_001001671		19300814	-1	no_errors	NM_001001671	genbank	human	validated	54_36p	nonsense	SNP	0.996	A
APOB	338	genome.wustl.edu	37	2	21225627	21225627	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:21225627C>G	ENST00000233242.1	-	29	12794	c.12667G>C	c.(12667-12669)Gag>Cag	p.E4223Q	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4223					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCCCTACCTCCCTTATGAAC	0.428																																																0			2											78.0	81.0	80.0					2																	21225627		2203	4300	6503	21079132	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.12667G>C	2.37:g.21225627C>G	ENSP00000233242:p.Glu4223Gln	Somatic		Capture	Illumina GAIIx	4	21079132	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	superfamily_Lipovitellin-phosvitin complex beta-sheet shell regions,HMMPfam_Vitellogenin_N,HMMSmart_SM00638,superfamily_Lipovitellin-phosvitin complex superhelical domain,HMMPfam_DUF1943,HMMPfam_DUF1081	p.E4223Q	ENST00000233242.1	37	c.12667	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092247	0.36952	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00730	5.77	5.84	1.76	0.24704	.	0.312951	0.27245	N	0.020254	T	0.00875	0.0029	L	0.49126	1.545	0.18873	N	0.999989	B	0.26195	0.144	B	0.18263	0.021	T	0.47341	-0.9125	10	0.46703	T	0.11	.	5.8614	0.18749	0.0:0.4366:0.1437:0.4197	.	4223	P04114	APOB_HUMAN	Q	4223	ENSP00000233242:E4223Q	ENSP00000233242:E4223Q	E	-	1	0	APOB	21079132	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.132000	0.15891	0.391000	0.25143	0.655000	0.94253	GAG	-	NULL		0.428	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	C			21079132	-1	no_errors	NM_000384	genbank	human	reviewed	54_36p	missense	SNP	0.071	G
KIAA0100	9703	genome.wustl.edu	37	17	26962549	26962549	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr17:26962549G>C	ENST00000528896.2	-	16	2130	c.2056C>G	c.(2056-2058)Cta>Gta	p.L686V	RP11-192H23.7_ENST00000583787.1_RNA|KIAA0100_ENST00000389003.3_Missense_Mutation_p.L543V|RP11-192H23.7_ENST00000577814.1_RNA|KIAA0100_ENST00000544884.1_Missense_Mutation_p.L543V	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	686						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CGGCACTGTAGAGTGGCCAGG	0.527																																																0			17											77.0	74.0	75.0					17																	26962549		2203	4300	6503	23986676	SO:0001583	missense	9703			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2056C>G	17.37:g.26962549G>C	ENSP00000436773:p.Leu686Val	Somatic		Capture	Illumina GAIIx	4	23986676	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	HMMPfam_Mqo,HMMPfam_Fmp27_GFWDK,HMMPfam_Apt1	p.L686V	ENST00000528896.2	37	c.2056	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	G	9.427	1.084599	0.20309	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.23754	1.91;1.89	5.71	1.03	0.20045	.	0.308684	0.32687	N	0.005780	T	0.13713	0.0332	L	0.43152	1.355	0.09310	N	1	P	0.37466	0.596	B	0.26770	0.073	T	0.18429	-1.0337	10	0.26408	T	0.33	.	5.0962	0.14735	0.3894:0.0:0.4817:0.1289	.	686	Q14667	K0100_HUMAN	V	686;686;686;543	ENSP00000436773:L686V;ENSP00000446443:L543V	ENSP00000005905:L686V	L	-	1	2	KIAA0100	23986676	0.006000	0.16342	0.024000	0.17045	0.355000	0.29361	-0.015000	0.12634	-0.020000	0.14032	0.563000	0.77884	CTA	-	NULL		0.527	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	protein_coding	OTTHUMT00000390571.3	G	NM_014680		23986676	-1	no_errors	NM_014680	genbank	human	validated	54_36p	missense	SNP	0.138	C
FKBP1B	2281	genome.wustl.edu	37	2	24285961	24285961	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:24285961A>G	ENST00000380986.4	+	4	362	c.226A>G	c.(226-228)Acc>Gcc	p.T76A	FKBP1B_ENST00000452109.1_Missense_Mutation_p.T47A|FKBP1B_ENST00000380991.4_3'UTR	NM_004116.3|NM_054033.2	NP_004107.1|NP_473374.1	P68106	FKB1B_HUMAN	FK506 binding protein 1B, 12.6 kDa	76	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				'de novo' protein folding (GO:0006458)|calcium ion transmembrane transport (GO:0070588)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|chaperone-mediated protein folding (GO:0061077)|cytosolic calcium ion homeostasis (GO:0051480)|insulin secretion (GO:0030073)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neuronal action potential propagation (GO:0019227)|positive regulation of axon regeneration (GO:0048680)|positive regulation of sequestering of calcium ion (GO:0051284)|protein maturation by protein folding (GO:0022417)|protein peptidyl-prolyl isomerization (GO:0000413)|protein refolding (GO:0042026)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to redox state (GO:0051775)|response to vitamin E (GO:0033197)|smooth muscle contraction (GO:0006939)|T cell proliferation (GO:0042098)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	calcium channel inhibitor activity (GO:0019855)|cyclic nucleotide binding (GO:0030551)|FK506 binding (GO:0005528)|ion channel binding (GO:0044325)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|receptor binding (GO:0005102)			lung(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCGAAGCTGACCTGCACCCC	0.552																																																0			2											75.0	64.0	67.0					2																	24285961		2203	4300	6503	24139465	SO:0001583	missense	2281			D38037	CCDS1706.1, CCDS33153.1	2p23.3	2013-03-20	2002-08-29		ENSG00000119782	ENSG00000119782			3712	protein-coding gene	gene with protein product	"""calstabin 2"""	600620	"""FK506-binding protein 1B (12.6 kD)"""	FKBP1L		7513996	Standard	NM_004116		Approved	OTK4, FKBP12.6, PPIase, FKBP9	uc002rer.3	P68106	OTTHUMG00000151889	ENST00000380986.4:c.226A>G	2.37:g.24285961A>G	ENSP00000370373:p.Thr76Ala	Somatic		Capture	Illumina GAIIx	4	24139465	Q13664|Q16645|Q53TM2|Q9BQ40	Missense_Mutation	SNP	superfamily_FKBP-like,HMMPfam_FKBP_C	p.T76A	ENST00000380986.4	37	c.226	CCDS1706.1	2	.	.	.	.	.	.	.	.	.	.	A	27.4	4.830774	0.91036	.	.	ENSG00000119782	ENST00000380986;ENST00000452109	T;T	0.49720	0.77;0.77	5.29	5.29	0.74685	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	0.000000	0.85682	D	0.000000	T	0.63355	0.2504	M	0.77313	2.365	0.80722	D	1	P	0.48230	0.907	P	0.53313	0.723	T	0.69053	-0.5247	10	0.72032	D	0.01	-21.5631	15.5181	0.75840	1.0:0.0:0.0:0.0	.	76	P68106	FKB1B_HUMAN	A	76;47	ENSP00000370373:T76A;ENSP00000406593:T47A	ENSP00000370373:T76A	T	+	1	0	FKBP1B	24139465	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.332000	0.96446	2.124000	0.65301	0.460000	0.39030	ACC	-	superfamily_FKBP-like,HMMPfam_FKBP_C		0.552	FKBP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP1B	protein_coding	OTTHUMT00000207622.1	A	NM_004116		24139465	+1	no_errors	NM_004116	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TAOK1	57551	genome.wustl.edu	37	17	27794198	27794198	+	Silent	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr17:27794198C>T	ENST00000261716.3	+	3	687	c.168C>T	c.(166-168)atC>atT	p.I56I	TAOK1_ENST00000536202.1_Silent_p.I56I	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	56	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			TGGTGGCCATCAAGAAAATGT	0.328																																																0			17											121.0	120.0	121.0					17																	27794198		2203	4300	6503	24818324	SO:0001819	synonymous_variant	57551			AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.168C>T	17.37:g.27794198C>T		Somatic		Capture	Illumina GAIIx	4	24818324	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Silent	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.I56	ENST00000261716.3	37	c.168	CCDS32601.1	17																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP		0.328	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK1	protein_coding	OTTHUMT00000447790.1	C	NM_020791		24818324	+1	no_errors	NM_020791	genbank	human	validated	54_36p	silent	SNP	1.000	T
ATAD5	79915	genome.wustl.edu	37	17	29184107	29184107	+	Nonsense_Mutation	SNP	A	A	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr17:29184107A>T	ENST00000321990.4	+	8	3148	c.2770A>T	c.(2770-2772)Aaa>Taa	p.K924*	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	924					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TTCAAAGTTGAAAAGCGGTAA	0.333																																																0			17											106.0	105.0	105.0					17																	29184107		2203	4300	6503	26208233	SO:0001587	stop_gained	79915				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.2770A>T	17.37:g.29184107A>T	ENSP00000313171:p.Lys924*	Somatic		Capture	Illumina GAIIx	4	26208233	Q05DH0|Q69YR6|Q9H9I1	Nonsense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA	p.K924*	ENST00000321990.4	37	c.2770	CCDS11260.1	17	.	.	.	.	.	.	.	.	.	.	A	40	8.342169	0.98769	.	.	ENSG00000176208	ENST00000321990	.	.	.	5.36	3.1	0.35709	.	0.609988	0.16017	N	0.233482	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.9401	0.24488	0.7737:0.1499:0.0765:0.0	.	.	.	.	X	924	.	ENSP00000313171:K924X	K	+	1	0	ATAD5	26208233	0.002000	0.14202	0.006000	0.13384	0.008000	0.06430	1.668000	0.37481	0.316000	0.23135	-0.353000	0.07706	AAA	-	NULL		0.333	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	protein_coding	OTTHUMT00000256206.2	A	NM_024857		26208233	+1	no_errors	NM_024857	genbank	human	provisional	54_36p	nonsense	SNP	0.007	T
DHDDS	79947	genome.wustl.edu	37	1	26795504	26795504	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:26795504G>C	ENST00000236342.7	+	9	977	c.884G>C	c.(883-885)cGa>cCa	p.R295P	DHDDS_ENST00000526219.1_Missense_Mutation_p.R256P|DHDDS_ENST00000525682.2_Missense_Mutation_p.R261P|DHDDS_ENST00000360009.2_Missense_Mutation_p.R296P|RP3-476K8.3_ENST00000423060.1_RNA			Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase	295					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			breast(5)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	15		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		GCCCAGCTCCGAAGGACACGC	0.642																																																0			1											54.0	52.0	53.0					1																	26795504		2203	4300	6503	26668091	SO:0001583	missense	79947			AK023164	CCDS281.1, CCDS282.1, CCDS57984.1, CCDS57983.1	1p35.3	2014-01-28			ENSG00000117682	ENSG00000117682			20603	protein-coding gene	gene with protein product		608172				12591616	Standard	NM_024887		Approved	HDS, FLJ13102, DS, RP59	uc001bmk.3	Q86SQ9	OTTHUMG00000003554	ENST00000236342.7:c.884G>C	1.37:g.26795504G>C	ENSP00000236342:p.Arg295Pro	Somatic		Capture	Illumina GAIIx	4	26668091	B7Z4B9|B7ZB20|D3DPK7|D3DPK8|D3DPK9|E9KL43|Q5T0A4|Q8NE90|Q9BTG5|Q9BTK3|Q9H905	Missense_Mutation	SNP	superfamily_Undecaprenyl diphosphate synthase,HMMPfam_Prenyltransf,PatternScan_UPP_SYNTHETASE	p.R296P	ENST00000236342.7	37	c.887	CCDS282.1	1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.938395	0.73557	.	.	ENSG00000117682	ENST00000374187;ENST00000525682;ENST00000236342;ENST00000526219;ENST00000360009;ENST00000431933	T;T;T;T	0.46063	0.88;0.91;0.89;0.91	5.52	5.52	0.82312	.	0.059022	0.64402	D	0.000002	T	0.52549	0.1741	L	0.50333	1.59	0.80722	D	1	P;D;P;P	0.59767	0.875;0.986;0.797;0.92	B;P;B;P	0.55345	0.286;0.774;0.286;0.562	T	0.48603	-0.9021	10	0.44086	T	0.13	-25.2442	16.5975	0.84800	0.0:0.0:1.0:0.0	.	261;256;295;296	B7Z4B9;Q86SQ9-3;Q86SQ9;Q86SQ9-2	.;.;DHDDS_HUMAN;.	P	133;261;295;256;296;131	ENSP00000434984:R261P;ENSP00000236342:R295P;ENSP00000434219:R256P;ENSP00000353104:R296P	ENSP00000236342:R295P	R	+	2	0	DHDDS	26668091	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.277000	0.78572	2.598000	0.87819	0.462000	0.41574	CGA	-	NULL		0.642	DHDDS-011	KNOWN	basic|appris_candidate|CCDS	protein_coding	DHDDS	protein_coding	OTTHUMT00000392504.1	G	NM_024887		26668091	+1	no_errors	NM_024887	genbank	human	validated	54_36p	missense	SNP	1.000	C
GTF3C1	2975	genome.wustl.edu	37	16	27549656	27549656	+	Silent	SNP	G	G	A	rs367815308		TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr16:27549656G>A	ENST00000356183.4	-	3	468	c.453C>T	c.(451-453)atC>atT	p.I151I	GTF3C1_ENST00000561623.1_Silent_p.I151I	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	151					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GGGAGGCAACGATGATCAGTT	0.493																																																0			16						G		2,4392	4.2+/-10.8	0,2,2195	65.0	60.0	62.0		453	-7.6	0.8	16		62	0,8600		0,0,4300	no	coding-synonymous	GTF3C1	NM_001520.3		0,2,6495	AA,AG,GG		0.0,0.0455,0.0154		151/2110	27549656	2,12992	2197	4300	6497	27457157	SO:0001819	synonymous_variant	2975			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.453C>T	16.37:g.27549656G>A		Somatic		Capture	Illumina GAIIx	4	27457157	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Silent	SNP	HMMPfam_B-block_TFIIIC	p.I151	ENST00000356183.4	37	c.453	CCDS32414.1	16																																																																																			-	HMMPfam_B-block_TFIIIC		0.493	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	protein_coding	OTTHUMT00000433856.1	G	NM_001520		27457157	-1	no_errors	NM_001520	genbank	human	validated	54_36p	silent	SNP	0.626	A
FLT1	2321	genome.wustl.edu	37	13	28913358	28913358	+	Missense_Mutation	SNP	C	C	T	rs374468544		TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr13:28913358C>T	ENST00000282397.4	-	17	2686	c.2435G>A	c.(2434-2436)cGg>cAg	p.R812Q	FLT1_ENST00000540678.1_Missense_Mutation_p.R30Q	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	812					blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATAAGGGAGCCGCTCACACTG	0.408																																																0			13						C	GLN/ARG	0,4406		0,0,2203	83.0	82.0	83.0		2435	5.5	1.0	13		83	1,8599	1.2+/-3.3	0,1,4299	no	missense	FLT1	NM_002019.4	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	812/1339	28913358	1,13005	2203	4300	6503	27811358	SO:0001583	missense	2321			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.2435G>A	13.37:g.28913358C>T	ENSP00000282397:p.Arg812Gln	Somatic		Capture	Illumina GAIIx	4	27811358	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMSmart_SM00406,HMMPfam_I-set,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_RECEPTOR_TYR_KIN_III,PatternScan_PROTEIN_KINASE_TYR	p.R812Q	ENST00000282397.4	37	c.2435	CCDS9330.1	13	.	.	.	.	.	.	.	.	.	.	C	19.69	3.874572	0.72180	0.0	1.16E-4	ENSG00000102755	ENST00000282397;ENST00000540678	D;D	0.89123	-2.47;-2.47	5.52	5.52	0.82312	Protein kinase-like domain (1);	0.132945	0.45867	D	0.000340	D	0.91620	0.7352	L	0.58428	1.81	0.80722	D	1	D	0.89917	1.0	P	0.61070	0.883	D	0.87242	0.2267	10	0.07813	T	0.8	.	19.7926	0.96466	0.0:1.0:0.0:0.0	.	812	P17948	VGFR1_HUMAN	Q	812;30	ENSP00000282397:R812Q;ENSP00000443311:R30Q	ENSP00000282397:R812Q	R	-	2	0	FLT1	27811358	0.735000	0.28153	0.998000	0.56505	0.980000	0.70556	3.313000	0.51935	2.761000	0.94854	0.655000	0.94253	CGG	-	NULL		0.408	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	protein_coding	OTTHUMT00000044322.1	C			27811358	-1	no_errors	NM_002019	genbank	human	validated	54_36p	missense	SNP	0.989	T
NOL4	8715	genome.wustl.edu	37	18	31523052	31523052	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr18:31523052T>C	ENST00000261592.5	-	9	1816	c.1519A>G	c.(1519-1521)Agg>Ggg	p.R507G	NOL4_ENST00000589544.1_Intron|NOL4_ENST00000535384.1_Missense_Mutation_p.R222G|NOL4_ENST00000269185.4_Intron|NOL4_ENST00000538587.1_Missense_Mutation_p.R433G|NOL4_ENST00000535475.1_Missense_Mutation_p.R288G	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	507						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						AGACGCATCCTCTTGGCGGCA	0.433																																																0			18											105.0	95.0	98.0					18																	31523052		2203	4299	6502	29777050	SO:0001583	missense	8715			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1519A>G	18.37:g.31523052T>C	ENSP00000261592:p.Arg507Gly	Somatic		Capture	Illumina GAIIx	4	29777050	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	NULL	p.R507G	ENST00000261592.5	37	c.1519	CCDS11907.2	18	.	.	.	.	.	.	.	.	.	.	T	18.13	3.554596	0.65425	.	.	ENSG00000101746	ENST00000261592;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	.	.	.	5.87	3.36	0.38483	.	0.000000	0.85682	D	0.000000	T	0.76471	0.3992	M	0.71206	2.165	0.42947	D	0.994361	D;D;D;D;D;P	0.89917	0.989;1.0;1.0;0.997;1.0;0.51	D;D;D;D;D;B	0.87578	0.985;0.998;0.998;0.971;0.998;0.419	T	0.79070	-0.1954	9	0.62326	D	0.03	-18.6544	13.3487	0.60589	0.0:0.0:0.3698:0.6302	.	192;222;433;507;222;288	F8W825;B7Z3Z7;B4DSQ0;O94818;F5H1E3;B3KRF4	.;.;.;NOL4_HUMAN;.;.	G	507;192;222;288;433	.	ENSP00000261592:R507G	R	-	1	2	NOL4	29777050	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.415000	0.52700	1.025000	0.39708	0.528000	0.53228	AGG	-	NULL		0.433	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL4	protein_coding	OTTHUMT00000255386.1	T	NM_003787		29777050	-1	no_errors	NM_003787	genbank	human	validated	54_36p	missense	SNP	1.000	C
IER3	8870	genome.wustl.edu	37	6	30712169	30712169	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr6:30712169C>A	ENST00000259874.5	-	1	162	c.127G>T	c.(127-129)Gag>Tag	p.E43*	FLOT1_ENST00000376389.3_5'Flank|XXbac-BPG252P9.10_ENST00000607333.1_RNA|FLOT1_ENST00000456573.2_5'Flank|FLOT1_ENST00000470643.1_5'Flank|IER3_ENST00000376377.2_Nonsense_Mutation_p.E43*	NM_003897.3	NP_003888.2	P46695	IEX1_HUMAN	immediate early response 3	43					anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glycolytic process (GO:0045820)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|negative regulation of systemic arterial blood pressure (GO:0003085)|positive regulation of protein catabolic process (GO:0045732)|regulation of DNA repair (GO:0006282)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of response to DNA damage stimulus (GO:2001020)|response to protozoan (GO:0001562)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				NS(1)	1						GCTGCGGGCTCCGGGAGAGGG	0.721																																																0			6											6.0	9.0	8.0					6																	30712169		1213	2416	3629	30820148	SO:0001587	stop_gained	8870			AF083421	CCDS4689.1	6p21.3	2010-02-17			ENSG00000137331	ENSG00000137331			5392	protein-coding gene	gene with protein product		602996				8603392, 9703517	Standard	NM_003897		Approved	IEX-1, DIF-2, PRG1, IEX-1L	uc003nrn.3	P46695	OTTHUMG00000031265	ENST00000259874.5:c.127G>T	6.37:g.30712169C>A	ENSP00000259874:p.Glu43*	Somatic		Capture	Illumina GAIIx	4	30820148	Q5SU30|Q92691|Q93044	Nonsense_Mutation	SNP	NULL	p.E43*	ENST00000259874.5	37	c.127	CCDS4689.1	6	.	.	.	.	.	.	.	.	.	.	C	37	6.115470	0.97296	.	.	ENSG00000137331	ENST00000259874;ENST00000376377;ENST00000376382	.	.	.	5.04	5.04	0.67666	.	0.070048	0.56097	D	0.000035	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	13.9745	0.64262	0.0:1.0:0.0:0.0	.	.	.	.	X	43	.	ENSP00000259874:E43X	E	-	1	0	IER3	30820148	0.997000	0.39634	0.972000	0.41901	0.887000	0.51463	3.718000	0.54919	2.354000	0.79902	0.549000	0.68633	GAG	-	NULL		0.721	IER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IER3	protein_coding	OTTHUMT00000076578.2	C			30820148	-1	no_errors	NM_003897	genbank	human	reviewed	54_36p	nonsense	SNP	0.968	A
ADAMTS12	81792	genome.wustl.edu	37	5	33527447	33527447	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr5:33527447A>C	ENST00000504830.1	-	24	4966	c.4631T>G	c.(4630-4632)cTg>cGg	p.L1544R	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.L1459R	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1544	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						ACTGGCTGACAGTTTGTCCTT	0.428										HNSCC(64;0.19)																																						0			5											118.0	109.0	112.0					5																	33527447		2203	4300	6503	33563204	SO:0001583	missense	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4631T>G	5.37:g.33527447A>C	ENSP00000422554:p.Leu1544Arg	Somatic		Capture	Illumina GAIIx	4	33563204	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1"	p.L1544R	ENST00000504830.1	37	c.4631	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	A	20.9	4.069620	0.76301	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.61392	0.14;0.11	5.93	5.93	0.95920	PLAC (1);	0.127371	0.51477	D	0.000083	T	0.74092	0.3671	M	0.75777	2.31	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.91635	0.999;0.997	T	0.74106	-0.3772	10	0.38643	T	0.18	.	12.7684	0.57405	1.0:0.0:0.0:0.0	.	1459;1544	P58397-3;P58397	.;ATS12_HUMAN	R	1544;1459	ENSP00000422554:L1544R;ENSP00000344847:L1459R	ENSP00000344847:L1459R	L	-	2	0	ADAMTS12	33563204	0.964000	0.33143	0.401000	0.26359	0.975000	0.68041	5.028000	0.64115	2.263000	0.75096	0.533000	0.62120	CTG	-	NULL		0.428	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	protein_coding	OTTHUMT00000367164.2	A	NM_030955		33563204	-1	no_errors	NM_030955	genbank	human	reviewed	54_36p	missense	SNP	0.973	C
IFNAR1	3454	genome.wustl.edu	37	21	34725117	34725117	+	Silent	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr21:34725117G>C	ENST00000270139.3	+	9	1349	c.1197G>C	c.(1195-1197)ctG>ctC	p.L399L	IFNAR1_ENST00000442357.2_Silent_p.L399L|IFNAR1_ENST00000416947.2_Silent_p.L330L	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1	399	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	TGAAACCACTGACTGTATATT	0.333																																					Esophageal Squamous(73;817 1211 32990 35667 42746)											0			21											82.0	88.0	86.0					21																	34725117		2203	4300	6503	33646987	SO:0001819	synonymous_variant	3454				CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.1197G>C	21.37:g.34725117G>C		Somatic		Capture	Illumina GAIIx	4	33646987	B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Silent	SNP	superfamily_Fibronectin type III	p.L399	ENST00000270139.3	37	c.1197	CCDS13624.1	21																																																																																			-	superfamily_Fibronectin type III		0.333	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNAR1	protein_coding	OTTHUMT00000139823.4	G			33646987	+1	no_errors	NM_000629	genbank	human	reviewed	54_36p	silent	SNP	0.758	C
FAM47A	158724	genome.wustl.edu	37	X	34148343	34148343	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chrX:34148343A>G	ENST00000346193.3	-	1	2104	c.2053T>C	c.(2053-2055)Tct>Cct	p.S685P		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	685										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GCGGTATAAGAATTCGATGGC	0.443																																																0			X											84.0	82.0	82.0					X																	34148343		2202	4300	6502	34058264	SO:0001583	missense	158724			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.2053T>C	X.37:g.34148343A>G	ENSP00000345029:p.Ser685Pro	Somatic		Capture	Illumina GAIIx	4	34058264	A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.S685P	ENST00000346193.3	37	c.2053	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	A	5.648	0.304255	0.10678	.	.	ENSG00000185448	ENST00000346193	T	0.62364	0.03	1.49	0.542	0.17174	.	.	.	.	.	T	0.42268	0.1195	L	0.28458	0.855	0.09310	N	1	B	0.16396	0.017	B	0.12837	0.008	T	0.20907	-1.0261	9	0.23891	T	0.37	.	3.354	0.07163	0.3145:0.0:0.6855:0.0	.	685	Q5JRC9	FA47A_HUMAN	P	685	ENSP00000345029:S685P	ENSP00000345029:S685P	S	-	1	0	FAM47A	34058264	0.049000	0.20398	0.003000	0.11579	0.001000	0.01503	0.109000	0.15417	0.109000	0.17891	-0.488000	0.04728	TCT	-	NULL		0.443	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	protein_coding	OTTHUMT00000056205.1	A	NM_203408		34058264	-1	no_errors	NM_203408	genbank	human	predicted	54_36p	missense	SNP	0.006	G
GJB3	2707	genome.wustl.edu	37	1	35250947	35250947	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:35250947C>A	ENST00000373366.2	+	2	1199	c.584C>A	c.(583-585)tCc>tAc	p.S195Y	GJB3_ENST00000373362.3_Missense_Mutation_p.S195Y|RP1-34M23.5_ENST00000542839.1_RNA	NM_024009.2	NP_076872.1	O75712	CXB3_HUMAN	gap junction protein, beta 3, 31kDa	195					cell communication (GO:0007154)|in utero embryonic development (GO:0001701)|placenta development (GO:0001890)|sensory perception of sound (GO:0007605)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	connexon complex (GO:0005922)|cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|prostate(3)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GTGGGCGCCTCCGCCGTCTGC	0.602																																																0			1											87.0	80.0	82.0					1																	35250947		2203	4300	6503	35023534	SO:0001583	missense	2707			BC012918	CCDS384.1	1p34	2008-05-14	2007-01-16		ENSG00000188910	ENSG00000188910		"""Ion channels / Gap junction proteins (connexins)"""	4285	protein-coding gene	gene with protein product	"""connexin 31"""	603324	"""gap junction protein, beta 3, 31kD (connexin 31)"", ""gap junction protein, beta 3, 31kDa (connexin 31)"", ""erythrokeratodermia variabilis"""	DFNA2, EKV		9843210, 9704026	Standard	NM_024009		Approved	CX31	uc001bxy.3	O75712	OTTHUMG00000004051	ENST00000373366.2:c.584C>A	1.37:g.35250947C>A	ENSP00000362464:p.Ser195Tyr	Somatic		Capture	Illumina GAIIx	4	35023534	B2R790|Q2TAZ8	Missense_Mutation	SNP	HMMPfam_Connexin,HMMSmart_SM00037,PatternScan_CONNEXINS_1,HMMPfam_Connexin_CCC,PatternScan_CONNEXINS_2	p.S195Y	ENST00000373366.2	37	c.584	CCDS384.1	1	.	.	.	.	.	.	.	.	.	.	C	14.10	2.435551	0.43224	.	.	ENSG00000188910	ENST00000373366;ENST00000373362;ENST00000543647	D;D	0.96856	-4.15;-4.15	5.07	4.16	0.48862	Gap junction protein, cysteine-rich domain (1);	0.127905	0.56097	D	0.000039	D	0.98441	0.9481	M	0.93678	3.445	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.99129	1.0852	10	0.87932	D	0	.	13.1849	0.59675	0.0:0.9217:0.0:0.0783	.	195	O75712	CXB3_HUMAN	Y	195;195;179	ENSP00000362464:S195Y;ENSP00000362460:S195Y	ENSP00000362460:S195Y	S	+	2	0	GJB3	35023534	1.000000	0.71417	0.816000	0.32577	0.037000	0.13140	7.770000	0.85390	1.146000	0.42352	-0.265000	0.10407	TCC	-	HMMPfam_Connexin_CCC		0.602	GJB3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GJB3	protein_coding	OTTHUMT00000011559.1	C	NM_024009		35023534	+1	no_errors	NM_001005752	genbank	human	reviewed	54_36p	missense	SNP	0.886	A
SLC32A1	140679	genome.wustl.edu	37	20	37356582	37356582	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr20:37356582C>T	ENST00000217420.1	+	2	1141	c.878C>T	c.(877-879)gCc>gTc	p.A293V		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	293					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CGCGACTGGGCCTGGGAGAAG	0.547																																																0			20											77.0	59.0	65.0					20																	37356582		2203	4300	6503	36789996	SO:0001583	missense	140679			AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.878C>T	20.37:g.37356582C>T	ENSP00000217420:p.Ala293Val	Somatic		Capture	Illumina GAIIx	4	36789996	Q8N489	Missense_Mutation	SNP	HMMPfam_Aa_trans	p.A293V	ENST00000217420.1	37	c.878	CCDS13307.1	20	.	.	.	.	.	.	.	.	.	.	C	12.29	1.893141	0.33442	.	.	ENSG00000101438	ENST00000217420	T	0.02236	4.38	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.03695	0.0105	L	0.43152	1.355	0.80722	D	1	P	0.34757	0.467	B	0.38296	0.27	T	0.55780	-0.8087	10	0.41790	T	0.15	-17.2041	15.1458	0.72650	0.0:1.0:0.0:0.0	.	293	Q9H598	VIAAT_HUMAN	V	293	ENSP00000217420:A293V	ENSP00000217420:A293V	A	+	2	0	SLC32A1	36789996	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	7.756000	0.85195	2.255000	0.74692	0.462000	0.41574	GCC	-	HMMPfam_Aa_trans		0.547	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC32A1	protein_coding	OTTHUMT00000079206.1	C	NM_080552		36789996	+1	no_errors	NM_080552	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
VIT	5212	genome.wustl.edu	37	2	37035991	37035991	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:37035991C>T	ENST00000389975.3	+	14	2023	c.1721C>T	c.(1720-1722)aCg>aTg	p.T574M	VIT_ENST00000379242.3_Missense_Mutation_p.T589M|VIT_ENST00000404084.1_Missense_Mutation_p.T526M|VIT_ENST00000401530.1_Missense_Mutation_p.T553M|VIT_ENST00000497382.1_Missense_Mutation_p.T243M|VIT_ENST00000379241.3_Missense_Mutation_p.T552M	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	574	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				GGCACCAGCACGGGGGCTGCC	0.567																																																0			2											75.0	71.0	72.0					2																	37035991		2203	4300	6503	36889495	SO:0001583	missense	5212			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.1721C>T	2.37:g.37035991C>T	ENSP00000374625:p.Thr574Met	Somatic		Capture	Illumina GAIIx	4	36889495	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	superfamily_LCCL,HMMSmart_LCCL,HMMPfam_LCCL,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA	p.T589M	ENST00000389975.3	37	c.1766	CCDS54347.1	2	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081717	0.76528	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000497382;ENST00000404084;ENST00000379241;ENST00000401530	D;D;D;D;D;D	0.86627	-2.15;-2.15;-2.15;-2.15;-2.15;-2.15	5.51	5.51	0.81932	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.95522	0.8545	M	0.93241	3.395	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96214	0.9155	10	0.72032	D	0.01	-14.9356	19.4545	0.94882	0.0:1.0:0.0:0.0	.	553;552;574;589	E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4	.;.;VITRN_HUMAN;.	M	589;574;243;526;552;553	ENSP00000368544:T589M;ENSP00000374625:T574M;ENSP00000417874:T243M;ENSP00000384154:T526M;ENSP00000368543:T552M;ENSP00000385658:T553M	ENSP00000368543:T552M	T	+	2	0	VIT	36889495	1.000000	0.71417	0.971000	0.41717	0.509000	0.34042	7.786000	0.85741	2.590000	0.87494	0.650000	0.86243	ACG	-	superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA		0.567	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	VIT	protein_coding		C			36889495	+1	no_errors	NM_053276	genbank	human	provisional	54_36p	missense	SNP	1.000	T
NIPBL	25836	genome.wustl.edu	37	5	37061025	37061025	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr5:37061025C>T	ENST00000282516.8	+	45	8264	c.7765C>T	c.(7765-7767)Cat>Tat	p.H2589Y	NIPBL_ENST00000448238.2_Missense_Mutation_p.H2589Y	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2589					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AGTTCATTTTCATCCAAAACA	0.368																																																0			5											96.0	93.0	94.0					5																	37061025		2203	4300	6503	37096782	SO:0001583	missense	25836			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.7765C>T	5.37:g.37061025C>T	ENSP00000282516:p.His2589Tyr	Somatic		Capture	Illumina GAIIx	4	37096782	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM repeat	p.H2589Y	ENST00000282516.8	37	c.7765	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	C	13.54	2.267121	0.40095	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.92965	-3.14;-3.14	4.89	4.89	0.63831	.	0.056069	0.64402	D	0.000001	D	0.86657	0.5985	N	0.17082	0.46	0.43321	D	0.995341	B;B;B	0.10296	0.001;0.001;0.003	B;B;B	0.11329	0.003;0.003;0.006	T	0.82327	-0.0512	10	0.52906	T	0.07	-11.8179	18.4096	0.90546	0.0:1.0:0.0:0.0	.	2589;2589;2589	Q6IEH8;Q6KC79;Q6KC79-2	.;NIPBL_HUMAN;.	Y	2589	ENSP00000282516:H2589Y;ENSP00000406266:H2589Y	ENSP00000282516:H2589Y	H	+	1	0	NIPBL	37096782	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.521000	0.45563	2.400000	0.81607	0.591000	0.81541	CAT	-	NULL		0.368	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	protein_coding	OTTHUMT00000207582.1	C	NM_015384		37096782	+1	no_errors	NM_133433	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TTC3	7267	genome.wustl.edu	37	21	38460546	38460546	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr21:38460546G>A	ENST00000399017.2	+	4	2985	c.238G>A	c.(238-240)Gat>Aat	p.D80N	TTC3_ENST00000354749.2_Missense_Mutation_p.D80N|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000399010.1_Missense_Mutation_p.D80N|TTC3_ENST00000540756.1_Intron|TTC3_ENST00000355666.1_Missense_Mutation_p.D80N	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	80					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TGTCCTGCAAGATTATTGCGA	0.333																																					Ovarian(38;194 1649 35661)											0			21											83.0	74.0	77.0					21																	38460546		2203	4300	6503	37382416	SO:0001583	missense	7267			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.238G>A	21.37:g.38460546G>A	ENSP00000381981:p.Asp80Asn	Somatic		Capture	Illumina GAIIx	4	37382416	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	HMMPfam_TPR_1,HMMSmart_TPR,superfamily_SSF48452,superfamily_Spectrin,superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4	p.D80N	ENST00000399017.2	37	c.238	CCDS13651.1	21	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016253	0.54468	.	.	ENSG00000182670	ENST00000418766;ENST00000450533;ENST00000438055;ENST00000355666;ENST00000399010;ENST00000399017;ENST00000354749	T;T;T;T;T;T	0.51325	2.54;0.71;2.54;2.85;2.85;2.85	4.82	4.82	0.62117	.	0.233723	0.29300	N	0.012558	T	0.43809	0.1264	L	0.56769	1.78	0.80722	D	1	B	0.18741	0.03	B	0.21151	0.033	T	0.46978	-0.9152	10	0.87932	D	0	-8.7404	9.4973	0.38995	0.0982:0.0:0.9018:0.0	.	80	P53804	TTC3_HUMAN	N	80	ENSP00000403943:D80N;ENSP00000408456:D80N;ENSP00000391891:D80N;ENSP00000347889:D80N;ENSP00000381981:D80N;ENSP00000346791:D80N	ENSP00000346791:D80N	D	+	1	0	TTC3	37382416	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.748000	0.55142	2.359000	0.80004	0.557000	0.71058	GAT	-	NULL		0.333	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	protein_coding	OTTHUMT00000194776.1	G			37382416	+1	no_errors	NM_001001894	genbank	human	validated	54_36p	missense	SNP	1.000	A
WNK4	65266	genome.wustl.edu	37	17	40939863	40939863	+	Silent	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr17:40939863G>A	ENST00000246914.5	+	8	1830	c.1809G>A	c.(1807-1809)caG>caA	p.Q603Q	WNK4_ENST00000587705.1_Intron	NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	603					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CTGCCCTTCAGCCCCCTGGGG	0.642																																					Esophageal Squamous(6;201 374 4964 23855 42828)											0			17											37.0	40.0	39.0					17																	40939863		2157	4220	6377	38193389	SO:0001819	synonymous_variant	65266			AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.1809G>A	17.37:g.40939863G>A		Somatic		Capture	Illumina GAIIx	4	38193389	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Silent	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST	p.Q603	ENST00000246914.5	37	c.1809	CCDS11439.1	17																																																																																			-	superfamily_Protein kinase-like (PK-like)		0.642	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK4	protein_coding	OTTHUMT00000452389.1	G			38193389	+1	no_errors	NM_032387	genbank	human	validated	54_36p	silent	SNP	0.911	A
EXOG	9941	genome.wustl.edu	37	3	38542913	38542913	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr3:38542913C>G	ENST00000287675.5	+	3	477	c.381C>G	c.(379-381)ttC>ttG	p.F127L	EXOG_ENST00000422077.2_Missense_Mutation_p.F77L|EXOG_ENST00000358249.2_5'UTR	NM_005107.3	NP_005098.2	Q9Y2C4	EXOG_HUMAN	endo/exonuclease (5'-3'), endonuclease G-like	127					DNA catabolic process, endonucleolytic (GO:0000737)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			central_nervous_system(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	17						TCAGTGCCTTCAATGAAGATT	0.428																																																0			3											136.0	129.0	132.0					3																	38542913		2203	4300	6503	38517917	SO:0001583	missense	9941			AB020523	CCDS2680.1, CCDS46795.1	3p21.3	2010-05-07	2009-01-08	2009-01-08	ENSG00000157036	ENSG00000157036	3.1.30.-		3347	protein-coding gene	gene with protein product		604051	"""endonuclease G-like 1"", ""endonuclease G-like 2"""	ENDOGL1, ENDOGL2		10231028, 18187503	Standard	NM_005107		Approved	ENGL-a, ENGL, ENGL-b	uc003cih.2	Q9Y2C4	OTTHUMG00000131295	ENST00000287675.5:c.381C>G	3.37:g.38542913C>G	ENSP00000287675:p.Phe127Leu	Somatic		Capture	Illumina GAIIx	4	38517917	A8K242|B4DVG2|Q3SXM9|Q9Y2C8	Missense_Mutation	SNP	superfamily_His-Me finger endonucleases,HMMPfam_Endonuclease_NS,HMMSmart_SM00477	p.F127L	ENST00000287675.5	37	c.381	CCDS2680.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.99|15.99	2.994224|2.994224	0.54041|0.54041	.|.	.|.	ENSG00000157036|ENSG00000157036	ENST00000287675;ENST00000422077|ENST00000453767	T;T|.	0.63744|.	-0.06;-0.06|.	4.91|4.91	1.94|1.94	0.25998|0.25998	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);|.	1.328060|.	0.04638|.	N|.	0.404782|.	T|T	0.12263|0.12263	0.0298|0.0298	N|N	0.00483|0.00483	-1.445|-1.445	0.80722|0.80722	D|D	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.06405|.	0.001;0.002|.	T|T	0.06991|0.06991	-1.0796|-1.0796	10|5	0.08381|.	T|.	0.77|.	-0.0039|-0.0039	5.8903|5.8903	0.18909|0.18909	0.1321:0.4132:0.3829:0.0719|0.1321:0.4132:0.3829:0.0719	.|.	77;127|.	Q9Y2C4-4;Q9Y2C4|.	.;EXOG_HUMAN|.	L|E	127;77|90	ENSP00000287675:F127L;ENSP00000404305:F77L|.	ENSP00000287675:F127L|.	F|Q	+|+	3|1	2|0	EXOG|EXOG	38517917|38517917	0.444000|0.444000	0.25649|0.25649	0.968000|0.968000	0.41197|0.41197	0.939000|0.939000	0.58152|0.58152	0.709000|0.709000	0.25734|0.25734	0.645000|0.645000	0.30675|0.30675	0.467000|0.467000	0.42956|0.42956	TTC|CAA	-	superfamily_His-Me finger endonucleases,HMMPfam_Endonuclease_NS,HMMSmart_SM00477		0.428	EXOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOG	protein_coding	OTTHUMT00000254063.2	C	NM_005107		38517917	+1	no_errors	NM_005107	genbank	human	reviewed	54_36p	missense	SNP	0.888	G
CNTN1	1272	genome.wustl.edu	37	12	41323797	41323797	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr12:41323797A>G	ENST00000551295.2	+	7	813	c.696A>G	c.(694-696)atA>atG	p.I232M	CNTN1_ENST00000547702.1_Missense_Mutation_p.I232M|CNTN1_ENST00000547849.1_Missense_Mutation_p.I232M|CNTN1_ENST00000348761.2_Missense_Mutation_p.I221M|CNTN1_ENST00000360099.3_Missense_Mutation_p.I232M|CNTN1_ENST00000347616.1_Missense_Mutation_p.I232M	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	232					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TCATTCCAATACCTGAACGTA	0.373																																																0			12											149.0	142.0	144.0					12																	41323797		2203	4299	6502	39610064	SO:0001583	missense	1272			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.696A>G	12.37:g.41323797A>G	ENSP00000447006:p.Ile232Met	Somatic		Capture	Illumina GAIIx	4	39610064	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_V-set,PatternScan_N6_MTASE,HMMPfam_I-set,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.I232M	ENST00000551295.2	37	c.696	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	A	12.34	1.908125	0.33721	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.66815	-0.23;0.17;-0.23;0.17;-0.23;0.16	5.39	-0.364	0.12553	Immunoglobulin subtype (1);	0.354955	0.30168	N	0.010260	T	0.55369	0.1916	L	0.57536	1.79	0.20563	N	0.999883	P;B;B	0.42993	0.797;0.208;0.132	B;B;B	0.41174	0.349;0.139;0.066	T	0.48647	-0.9017	10	0.38643	T	0.18	.	5.1999	0.15258	0.5674:0.0:0.1272:0.3054	.	232;221;232	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	M	232;232;232;232;232;221	ENSP00000448004:I232M;ENSP00000447006:I232M;ENSP00000448653:I232M;ENSP00000325660:I232M;ENSP00000353213:I232M;ENSP00000261160:I221M	ENSP00000325660:I232M	I	+	3	3	CNTN1	39610064	0.097000	0.21791	0.809000	0.32408	0.994000	0.84299	0.329000	0.19698	0.065000	0.16485	0.533000	0.62120	ATA	-	HMMPfam_V-set,HMMSmart_SM00409		0.373	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	protein_coding	OTTHUMT00000403692.2	A	NM_001843		39610064	+1	no_errors	NM_001843	genbank	human	reviewed	54_36p	missense	SNP	0.975	G
PRICKLE1	144165	genome.wustl.edu	37	12	42853781	42853781	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr12:42853781C>A	ENST00000455697.1	-	8	2611	c.2326G>T	c.(2326-2328)Gga>Tga	p.G776*	PRICKLE1_ENST00000552240.1_Nonsense_Mutation_p.G776*|RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000445766.2_Nonsense_Mutation_p.G776*|PRICKLE1_ENST00000345127.3_Nonsense_Mutation_p.G776*|PRICKLE1_ENST00000548696.1_Nonsense_Mutation_p.G776*	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	776					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		AGAAAATATCCTTCTTCTTCC	0.512																																																0			12											122.0	129.0	127.0					12																	42853781		2203	4300	6503	41140048	SO:0001587	stop_gained	144165			AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.2326G>T	12.37:g.42853781C>A	ENSP00000401060:p.Gly776*	Somatic		Capture	Illumina GAIIx	4	41140048	Q14C83|Q71QF8|Q96N00	Nonsense_Mutation	SNP	HMMPfam_PET,HMMSmart_LIM,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM,superfamily_SSF57716	p.G776*	ENST00000455697.1	37	c.2326	CCDS8742.1	12	.	.	.	.	.	.	.	.	.	.	C	41	8.845733	0.98976	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-23.5429	19.6792	0.95956	0.0:1.0:0.0:0.0	.	.	.	.	X	776	.	ENSP00000345064:G776X	G	-	1	0	PRICKLE1	41140048	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.339000	0.79282	2.717000	0.92951	0.655000	0.94253	GGA	-	NULL		0.512	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRICKLE1	protein_coding	OTTHUMT00000404069.1	C			41140048	-1	no_errors	NM_153026	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
TCEB3B	51224	genome.wustl.edu	37	18	44559660	44559660	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr18:44559660T>C	ENST00000332567.4	-	1	2328	c.1976A>G	c.(1975-1977)gAg>gGg	p.E659G	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	659	Activation domain. {ECO:0000250}.				regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TGCAGACTTCTCTTGCCTCCT	0.567																																																0			18											113.0	115.0	114.0					18																	44559660		2203	4300	6503	42813658	SO:0001583	missense	51224			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.1976A>G	18.37:g.44559660T>C	ENSP00000331302:p.Glu659Gly	Somatic		Capture	Illumina GAIIx	4	42813658	Q9P2V9	Missense_Mutation	SNP	HMMPfam_TFIIS,HMMSmart_TFS2N,HMMPfam_Elongin_A	p.E659G	ENST00000332567.4	37	c.1976	CCDS11932.1	18	.	.	.	.	.	.	.	.	.	.	T	7.419	0.636368	0.14386	.	.	ENSG00000206181	ENST00000332567	T	0.10005	2.92	1.4	0.235	0.15431	.	0.344460	0.20558	N	0.089967	T	0.08891	0.0220	L	0.55990	1.75	0.09310	N	1	B	0.20671	0.047	B	0.16289	0.015	T	0.24870	-1.0148	10	0.66056	D	0.02	-12.6401	3.1376	0.06444	0.0:0.254:0.0:0.746	.	659	Q8IYF1	ELOA2_HUMAN	G	659	ENSP00000331302:E659G	ENSP00000331302:E659G	E	-	2	0	TCEB3B	42813658	0.004000	0.15560	0.002000	0.10522	0.006000	0.05464	1.109000	0.31135	0.057000	0.16193	0.496000	0.49642	GAG	-	NULL		0.567	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	protein_coding	OTTHUMT00000255900.1	T	NM_016427		42813658	-1	no_errors	NM_016427	genbank	human	reviewed	54_36p	missense	SNP	0.024	C
SLC22A7	10864	genome.wustl.edu	37	6	43270123	43270123	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr6:43270123C>G	ENST00000372585.5	+	8	1342	c.1247C>G	c.(1246-1248)gCg>gGg	p.A416G	SLC22A7_ENST00000372574.3_Missense_Mutation_p.A414G|SLC22A7_ENST00000372589.3_Missense_Mutation_p.A414G	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	416					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.A416V(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	ACGGCCCTGGCGTTCGGCACT	0.672																																																1	Substitution - Missense(1)	endometrium(1)	6											41.0	35.0	37.0					6																	43270123		2202	4300	6502	43378101	SO:0001583	missense	10864			AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.1247C>G	6.37:g.43270123C>G	ENSP00000361666:p.Ala416Gly	Somatic		Capture	Illumina GAIIx	4	43378101	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	HMMPfam_MFS_1,superfamily_MFS general substrate transporter	p.A416G	ENST00000372585.5	37	c.1247	CCDS4893.2	6	.	.	.	.	.	.	.	.	.	.	C	13.40	2.227390	0.39399	.	.	ENSG00000137204	ENST00000372589;ENST00000372585;ENST00000372574;ENST00000436107	T;T;T;T	0.75367	0.43;0.43;0.43;-0.93	5.27	4.35	0.52113	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.595751	0.17522	N	0.171230	T	0.59074	0.2167	L	0.49256	1.55	0.19300	N	0.999978	B;B;B	0.23540	0.087;0.071;0.071	B;B;B	0.34093	0.175;0.109;0.109	T	0.58736	-0.7584	10	0.87932	D	0	.	11.0316	0.47776	0.0:0.812:0.188:0.0	.	416;414;414	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	G	414;416;414;109	ENSP00000361670:A414G;ENSP00000361666:A416G;ENSP00000361655:A414G;ENSP00000393836:A109G	ENSP00000361655:A414G	A	+	2	0	SLC22A7	43378101	0.006000	0.16342	0.024000	0.17045	0.121000	0.20230	1.858000	0.39408	2.468000	0.83385	0.462000	0.41574	GCG	-	HMMPfam_MFS_1,superfamily_MFS general substrate transporter		0.672	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	SLC22A7	protein_coding	OTTHUMT00000040588.1	C			43378101	+1	no_errors	NM_153320	genbank	human	reviewed	54_36p	missense	SNP	0.003	G
TDGF1	6997	genome.wustl.edu	37	3	46622701	46622701	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr3:46622701G>T	ENST00000296145.5	+	6	1261	c.528G>T	c.(526-528)atG>atT	p.M176I	TDGF1_ENST00000542931.1_Missense_Mutation_p.M160I|LRRC2_ENST00000296144.3_5'Flank	NM_003212.3	NP_003203.1	P13385	TDGF1_HUMAN	teratocarcinoma-derived growth factor 1	176					activation of MAPK activity (GO:0000187)|anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle cell differentiation (GO:0055007)|cell differentiation (GO:0030154)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-6 (GO:0071354)|cellular response to tumor necrosis factor (GO:0071356)|embryo development (GO:0009790)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of signal transduction (GO:0009966)|vasculogenesis (GO:0001570)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	growth factor activity (GO:0008083)|receptor binding (GO:0005102)			cervix(2)|endometrium(1)|kidney(1)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		CCACTTTTATGCTAGTTGGCA	0.433																																																0			3											145.0	126.0	132.0					3																	46622701		2203	4300	6503	46597705	SO:0001583	missense	6997			M96955	CCDS2742.1, CCDS54575.1	3p21.31	2012-10-03			ENSG00000241186	ENSG00000241186			11701	protein-coding gene	gene with protein product		187395				1882841, 10393436	Standard	NM_003212		Approved	CRIPTO, CR, Cripto-1	uc021wxd.1	P13385	OTTHUMG00000133482	ENST00000296145.5:c.528G>T	3.37:g.46622701G>T	ENSP00000296145:p.Met176Ile	Somatic		Capture	Illumina GAIIx	4	46597705	Q8TCC1	Missense_Mutation	SNP	PatternScan_EGF_2,superfamily_SSF57196,HMMSmart_EGF,PatternScan_EGF_1,HMMPfam_CFC	p.M176I	ENST00000296145.5	37	c.528	CCDS2742.1	3	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028031	0.35797	.	.	ENSG00000241186	ENST00000542931;ENST00000296145	T;T	0.63744	-0.04;-0.06	4.13	1.31	0.21738	.	0.763982	0.12418	N	0.470686	T	0.40886	0.1135	N	0.24115	0.695	0.09310	N	1	B	0.18461	0.028	B	0.11329	0.006	T	0.20571	-1.0271	10	0.33940	T	0.23	.	2.9478	0.05852	0.0995:0.1783:0.5379:0.1843	.	176	P13385	TDGF1_HUMAN	I	160;176	ENSP00000446375:M160I;ENSP00000296145:M176I	ENSP00000296145:M176I	M	+	3	0	AC104304.1	46597705	0.034000	0.19679	0.018000	0.16275	0.508000	0.34012	0.220000	0.17660	0.279000	0.22186	0.655000	0.94253	ATG	-	NULL		0.433	TDGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDGF1	protein_coding	OTTHUMT00000257378.2	G	NM_003212		46597705	+1	no_errors	NM_003212	genbank	human	validated	54_36p	missense	SNP	0.023	T
LRP4	4038	genome.wustl.edu	37	11	46893150	46893150	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr11:46893150C>A	ENST00000378623.1	-	31	4860	c.4618G>T	c.(4618-4620)Gag>Tag	p.E1540*	LRP4-AS1_ENST00000531719.1_RNA|LRP4-AS1_ENST00000502049.2_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1540					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		TCAGCACTCTCGATCCGGTCC	0.562																																																0			11											108.0	90.0	96.0					11																	46893150		2201	4299	6500	46849726	SO:0001587	stop_gained	4038			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.4618G>T	11.37:g.46893150C>A	ENSP00000367888:p.Glu1540*	Somatic		Capture	Illumina GAIIx	4	46849726	B2RN39|Q4AC85|Q5KTZ5	Nonsense_Mutation	SNP	superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,HMMSmart_SM00181,superfamily_EGF/Laminin,HMMPfam_EGF,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b	p.E1540*	ENST00000378623.1	37	c.4618	CCDS31478.1	11	.	.	.	.	.	.	.	.	.	.	C	45	12.064099	0.99632	.	.	ENSG00000134569	ENST00000378623	.	.	.	5.81	5.81	0.92471	.	0.116771	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.0784	0.97758	0.0:1.0:0.0:0.0	.	.	.	.	X	1540	.	ENSP00000367888:E1540X	E	-	1	0	LRP4	46849726	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.759000	0.68785	2.736000	0.93811	0.655000	0.94253	GAG	-	superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b		0.562	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	protein_coding	OTTHUMT00000391133.1	C	NM_002334		46849726	-1	no_errors	NM_002334	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
ARHGEF1	9138	genome.wustl.edu	37	19	42400747	42400747	+	Intron	SNP	G	G	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr19:42400747G>T	ENST00000354532.3	+	13	1269				ARHGEF1_ENST00000347545.4_Intron|ARHGEF1_ENST00000337665.4_Intron|ARHGEF1_ENST00000378152.4_Intron|ARHGEF1_ENST00000599846.1_Intron	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1						cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		cttcctcattgcccccctttc	0.527																																																0			19																																								47092587	SO:0001627	intron_variant	9138			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.1121+192G>T	19.37:g.42400747G>T		Somatic		Capture	Illumina GAIIx	4	47092587	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	HMMPfam_RGS-like,superfamily_Regulator of G-protein signaling RGS	p.C474F	ENST00000354532.3	37	c.1421	CCDS12591.1	19	.	.	.	.	.	.	.	.	.	.	G	4.756	0.140668	0.09083	.	.	ENSG00000076928	ENST00000316079	.	.	.	1.84	0.764	0.18465	.	.	.	.	.	T	0.28665	0.0710	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27502	-1.0072	7	0.87932	D	0	.	5.0187	0.14350	0.0:0.0:0.5001:0.4999	.	498	Q8NF33	.	F	474	.	ENSP00000323044:C474F	C	+	2	0	ARHGEF1	47092587	0.025000	0.19082	0.000000	0.03702	0.130000	0.20726	0.788000	0.26872	0.255000	0.21593	0.289000	0.19496	TGC	-	NULL		0.527	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	protein_coding	OTTHUMT00000463360.1	G	NM_199002		47092587	+1	no_start_codon	ENST00000316079	ensembl	human	known	54_36p	missense	SNP	0.003	T
CDC14C	168448	genome.wustl.edu	37	7	48965328	48965328	+	IGR	SNP	G	G	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr7:48965328G>T								AC004899.1 (74107 upstream) : AC010971.1 (304404 downstream)																							GCAGGAGAATGGACAACACAG	0.488																																																0			7																																								48935874	SO:0001628	intergenic_variant	168448																															7.37:g.48965328G>T		Somatic		Capture	Illumina GAIIx	4	48935874		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.488					CDC14C			G			48935874	+1	pseudogene	NR_003595	genbank	human	provisional	54_36p	rna	SNP	0.995	T
TRIM49B	283116	genome.wustl.edu	37	11	49059128	49059128	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr11:49059128T>A	ENST00000332682.7	+	7	986	c.958T>A	c.(958-960)Tat>Aat	p.Y320N		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	320	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						AGATGTACCCTATTTCACTGC	0.428																																																0			11																																								49015704	SO:0001583	missense	283116				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.958T>A	11.37:g.49059128T>A	ENSP00000330216:p.Tyr320Asn	Somatic		Capture	Illumina GAIIx	4	49015704		Missense_Mutation	SNP	PatternScan_ZF_RING_1,superfamily_SSF57850,HMMPfam_zf-C3HC4,HMMSmart_RING,HMMPfam_zf-B_box,HMMSmart_BBOX,HMMPfam_SPRY	p.Y320N	ENST00000332682.7	37	c.958	CCDS55762.1	11	.	.	.	.	.	.	.	.	.	.	T	0.015	-1.547175	0.00926	.	.	ENSG00000182053	ENST00000332682	T	0.60171	0.21	0.407	-0.813	0.10850	.	.	.	.	.	T	0.19127	0.0459	N	0.00869	-1.13	0.09310	N	1	.	.	.	.	.	.	T	0.11036	-1.0604	6	0.21014	T	0.42	.	.	.	.	.	.	.	.	N	320	ENSP00000330216:Y320N	ENSP00000330216:Y320N	Y	+	1	0	AC084851.1	49015704	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.643000	0.00862	-1.244000	0.02516	-1.194000	0.01681	TAT	-	NULL		0.428	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC283116	protein_coding		T			49015704	+1	no_errors	XM_208043	genbank	human	model	54_36p	missense	SNP	0.009	A
LAMB2	3913	genome.wustl.edu	37	3	49159178	49159178	+	Missense_Mutation	SNP	G	G	A	rs141473691	byFrequency	TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr3:49159178G>A	ENST00000418109.1	-	31	5203	c.5039C>T	c.(5038-5040)gCa>gTa	p.A1680V	USP19_ENST00000453664.1_5'Flank|USP19_ENST00000434032.2_5'Flank|USP19_ENST00000398898.2_5'Flank|USP19_ENST00000398892.3_5'Flank|USP19_ENST00000398888.2_5'Flank|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000417901.1_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.A1680V	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1680	Domain I.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGTAGAGGCTGCCAGACTATT	0.612																																																0			3						G	VAL/ALA	0,4406		0,0,2203	75.0	77.0	76.0		5039	4.6	1.0	3	dbSNP_134	76	3,8597	3.0+/-9.4	0,3,4297	yes	missense	LAMB2	NM_002292.3	64	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	1680/1799	49159178	3,13003	2203	4300	6503	49134182	SO:0001583	missense	3913				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.5039C>T	3.37:g.49159178G>A	ENSP00000388325:p.Ala1680Val	Somatic		Capture	Illumina GAIIx	4	49134182	Q16321	Missense_Mutation	SNP	HMMSmart_LamNT,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,superfamily_SSF57196,PatternScan_EGF_1,PatternScan_EGF_LAM_1,PatternScan_EGF_2	p.A1680V	ENST00000418109.1	37	c.5039	CCDS2789.1	3	.	.	.	.	.	.	.	.	.	.	G	15.00	2.704453	0.48412	0.0	3.49E-4	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.35048	1.33;1.33	5.55	4.59	0.56863	.	0.174918	0.49305	D	0.000154	T	0.36441	0.0967	L	0.53249	1.67	0.52099	D	0.999946	B	0.30851	0.297	B	0.31390	0.129	T	0.15983	-1.0418	10	0.32370	T	0.25	.	17.0977	0.86639	0.0:0.0:0.8647:0.1353	.	1680	P55268	LAMB2_HUMAN	V	1680	ENSP00000388325:A1680V;ENSP00000307156:A1680V	ENSP00000307156:A1680V	A	-	2	0	LAMB2	49134182	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.362000	0.44169	2.620000	0.88729	0.655000	0.94253	GCA	-	NULL		0.612	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	protein_coding	OTTHUMT00000345939.1	G	NM_002292		49134182	-1	no_errors	NM_002292	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CCDC8	83987	genome.wustl.edu	37	19	46915441	46915441	+	Silent	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr19:46915441C>T	ENST00000307522.3	-	1	1400	c.627G>A	c.(625-627)agG>agA	p.R209R		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	209					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		AACCCTTCACCCTCCGCTTCA	0.692																																																0			19											17.0	17.0	17.0					19																	46915441		2201	4295	6496	51607281	SO:0001819	synonymous_variant	83987			BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.627G>A	19.37:g.46915441C>T		Somatic		Capture	Illumina GAIIx	4	51607281	Q8TB26	Silent	SNP	NULL	p.R209	ENST00000307522.3	37	c.627	CCDS12685.1	19																																																																																			-	NULL		0.692	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC8	protein_coding	OTTHUMT00000368598.1	C	NM_032040		51607281	-1	no_errors	NM_032040	genbank	human	validated	54_36p	silent	SNP	0.906	T
PELO	53918	genome.wustl.edu	37	5	52096887	52096887	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr5:52096887A>G	ENST00000274311.2	+	2	1644	c.659A>G	c.(658-660)tAc>tGc	p.Y220C	ITGA1_ENST00000282588.6_Intron|ITGA1_ENST00000504086.1_Intron|PELO_ENST00000506949.1_Intron	NM_015946.4	NP_057030.3	Q9BRX2	PELO_HUMAN	pelota homolog (Drosophila)	220					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA catabolic process, non-stop decay (GO:0070481)|RNA surveillance (GO:0071025)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	11		Lung NSC(810;4.94e-05)|Breast(144;0.0848)				TTCTGCGACTACCTGTTTCAA	0.473																																																0			5											65.0	66.0	66.0					5																	52096887		2203	4300	6503	52132644	SO:0001583	missense	53918				CCDS3956.1	5q11.2	2008-07-18	2001-11-28		ENSG00000152684	ENSG00000152684			8829	protein-coding gene	gene with protein product		605757	"""pelota (Drosophila) homolog"""			11060452	Standard	NM_015946		Approved		uc003jos.3	Q9BRX2	OTTHUMG00000096973	ENST00000274311.2:c.659A>G	5.37:g.52096887A>G	ENSP00000274311:p.Tyr220Cys	Somatic		Capture	Illumina GAIIx	4	52132644	Q9GZS6|Q9Y306	Missense_Mutation	SNP	HMMPfam_eRF1_1,HMMPfam_eRF1_2,superfamily_L30e-like,HMMPfam_eRF1_3	p.Y220C	ENST00000274311.2	37	c.659	CCDS3956.1	5	.	.	.	.	.	.	.	.	.	.	A	17.74	3.464579	0.63513	.	.	ENSG00000152684	ENST00000274311	T	0.52057	0.68	5.25	5.25	0.73442	eRF1 domain 2 (1);	0.077607	0.53938	U	0.000048	T	0.74160	0.3680	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80160	-0.1498	10	0.87932	D	0	-14.5789	10.2657	0.43453	0.8525:0.0:0.0:0.1475	.	220	Q9BRX2	PELO_HUMAN	C	220	ENSP00000274311:Y220C	ENSP00000274311:Y220C	Y	+	2	0	PELO	52132644	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.265000	0.72534	2.210000	0.71456	0.460000	0.39030	TAC	-	HMMPfam_eRF1_2		0.473	PELO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PELO	protein_coding	OTTHUMT00000214040.1	A	NM_015946		52132644	+1	no_errors	NM_015946	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
ALPK2	115701	genome.wustl.edu	37	18	56204618	56204618	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr18:56204618G>C	ENST00000361673.3	-	5	3014	c.2801C>G	c.(2800-2802)cCc>cGc	p.P934R	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	934						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TGAGTTGCTGGGGCTTGGCTG	0.512																																																0			18											43.0	47.0	46.0					18																	56204618		2203	4300	6503	54355598	SO:0001583	missense	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.2801C>G	18.37:g.56204618G>C	ENSP00000354991:p.Pro934Arg	Somatic		Capture	Illumina GAIIx	4	54355598	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00811,HMMPfam_Alpha_kinase	p.P934R	ENST00000361673.3	37	c.2801	CCDS11966.2	18	.	.	.	.	.	.	.	.	.	.	G	14.37	2.516054	0.44763	.	.	ENSG00000198796	ENST00000361673	T	0.48522	0.81	5.2	3.3	0.37823	.	1.026590	0.07734	N	0.945695	T	0.60287	0.2257	L	0.52573	1.65	0.09310	N	1	D;D	0.89917	1.0;0.999	D;D	0.79108	0.992;0.97	T	0.42413	-0.9453	10	0.72032	D	0.01	-6.0956	5.5441	0.17053	0.0997:0.0:0.7036:0.1967	.	934;934	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	R	934	ENSP00000354991:P934R	ENSP00000354991:P934R	P	-	2	0	ALPK2	54355598	0.001000	0.12720	0.207000	0.23584	0.009000	0.06853	-0.235000	0.09016	1.198000	0.43158	0.591000	0.81541	CCC	-	NULL		0.512	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	protein_coding	OTTHUMT00000256126.1	G	NM_052947		54355598	-1	no_errors	NM_052947	genbank	human	validated	54_36p	missense	SNP	0.001	C
ALAS2	212	genome.wustl.edu	37	X	55047546	55047546	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chrX:55047546C>A	ENST00000330807.5	-	5	714	c.577G>T	c.(577-579)Gtc>Ttc	p.V193F	ALAS2_ENST00000498636.1_5'Flank|ALAS2_ENST00000335854.4_Missense_Mutation_p.V156F|ALAS2_ENST00000396198.3_Missense_Mutation_p.V180F	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	193					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	CTACACCAGACGGACACATCC	0.532																																																0			X											121.0	89.0	100.0					X																	55047546		2203	4300	6503	55064271	SO:0001583	missense	212				CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.577G>T	X.37:g.55047546C>A	ENSP00000332369:p.Val193Phe	Somatic		Capture	Illumina GAIIx	4	55064271	A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	HMMPfam_Preseq_ALAS,superfamily_PLP-dependent transferases,HMMPfam_Aminotran_1_2,PatternScan_AA_TRANSFER_CLASS_2	p.V193F	ENST00000330807.5	37	c.577	CCDS14366.1	X	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434998	0.62955	.	.	ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854	D;D;D	0.95069	-3.6;-3.6;-3.6	4.92	4.05	0.47172	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.118259	0.56097	D	0.000032	D	0.98027	0.9350	H	0.95574	3.69	0.53005	D	0.999962	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.85130	0.997;0.997;0.99	D	0.98074	1.0400	10	0.87932	D	0	-17.6432	14.9044	0.70706	0.0:0.9176:0.0:0.0824	.	156;180;193	A8K6C4;Q5JZF5;P22557	.;.;HEM0_HUMAN	F	193;180;156	ENSP00000332369:V193F;ENSP00000379501:V180F;ENSP00000337131:V156F	ENSP00000332369:V193F	V	-	1	0	ALAS2	55064271	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	3.364000	0.52328	0.438000	0.26450	-1.225000	0.01585	GTC	-	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_1_2		0.532	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAS2	protein_coding	OTTHUMT00000056843.3	C	NM_000032		55064271	-1	no_errors	NM_000032	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
OR5AR1	219493	genome.wustl.edu	37	11	56431795	56431795	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr11:56431795C>G	ENST00000302969.2	+	1	658	c.634C>G	c.(634-636)Ctc>Gtc	p.L212V		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						CAGCACCATCCTCATCATCTT	0.493																																																0			11											180.0	152.0	162.0					11																	56431795		2201	4296	6497	56188371	SO:0001583	missense	219493			AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.634C>G	11.37:g.56431795C>G	ENSP00000302639:p.Leu212Val	Somatic		Capture	Illumina GAIIx	4	56188371	Q6IF61	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.L212V	ENST00000302969.2	37	c.634	CCDS31535.1	11	.	.	.	.	.	.	.	.	.	.	C	11.05	1.525069	0.27299	.	.	ENSG00000172459	ENST00000302969	T	0.38722	1.12	4.91	4.0	0.46444	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42964	D	0.000633	T	0.33876	0.0878	L	0.41079	1.255	0.30730	N	0.747303	P	0.42908	0.793	B	0.41332	0.354	T	0.34675	-0.9819	10	0.40728	T	0.16	.	9.7922	0.40713	0.0:0.7807:0.1404:0.0789	.	212	Q8NGP9	O5AR1_HUMAN	V	212	ENSP00000302639:L212V	ENSP00000302639:L212V	L	+	1	0	OR5AR1	56188371	0.000000	0.05858	0.998000	0.56505	0.958000	0.62258	-0.531000	0.06171	1.305000	0.44909	0.573000	0.79308	CTC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.493	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AR1	protein_coding	OTTHUMT00000334434.1	C	NM_001004730		56188371	+1	no_errors	NM_001004730	genbank	human	provisional	54_36p	missense	SNP	0.980	G
P2RX3	5024	genome.wustl.edu	37	11	57135539	57135539	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr11:57135539C>A	ENST00000263314.2	+	9	933	c.899C>A	c.(898-900)gCt>gAt	p.A300D		NM_002559.3	NP_002550.2	P56373	P2RX3_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 3	300					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of synaptic plasticity (GO:0048167)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to cold (GO:0009409)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)|transport (GO:0006810)|urinary bladder smooth muscle contraction (GO:0014832)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)			endometrium(4)|kidney(2)|large_intestine(4)|lung(15)|prostate(1)	26						CTCCTGAAGGCTTTTGGCATC	0.577																																																0			11											96.0	90.0	92.0					11																	57135539		2201	4296	6497	56892115	SO:0001583	missense	5024			Y07683	CCDS7953.1	11q12	2012-01-17			ENSG00000109991	ENSG00000109991		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8534	protein-coding gene	gene with protein product		600843				9221902	Standard	NM_002559		Approved	P2X3	uc001nju.3	P56373	OTTHUMG00000167025	ENST00000263314.2:c.899C>A	11.37:g.57135539C>A	ENSP00000263314:p.Ala300Asp	Somatic		Capture	Illumina GAIIx	4	56892115	Q6DK37|Q9UQB6	Missense_Mutation	SNP	HMMPfam_P2X_receptor,PatternScan_P2X_RECEPTOR	p.A300D	ENST00000263314.2	37	c.899	CCDS7953.1	11	.	.	.	.	.	.	.	.	.	.	C	26.2	4.717721	0.89205	.	.	ENSG00000109991	ENST00000439993;ENST00000263314	T	0.05996	3.36	6.08	5.14	0.70334	.	0.106801	0.64402	D	0.000005	T	0.31796	0.0808	M	0.90483	3.12	0.53688	D	0.999979	D	0.89917	1.0	D	0.97110	1.0	T	0.31806	-0.9930	10	0.87932	D	0	-17.8196	14.448	0.67364	0.0:0.8527:0.1473:0.0	.	300	P56373	P2RX3_HUMAN	D	300	ENSP00000263314:A300D	ENSP00000263314:A300D	A	+	2	0	P2RX3	56892115	1.000000	0.71417	0.928000	0.36995	0.988000	0.76386	4.607000	0.61133	1.525000	0.49052	0.655000	0.94253	GCT	-	HMMPfam_P2X_receptor		0.577	P2RX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX3	protein_coding	OTTHUMT00000392465.1	C	NM_002559		56892115	+1	no_errors	NM_002559	genbank	human	reviewed	54_36p	missense	SNP	0.994	A
ASL	435	genome.wustl.edu	37	7	65540936	65540936	+	5'UTR	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr7:65540936C>G	ENST00000395332.3	+	0	76				ASL_ENST00000304874.9_Intron|ASL_ENST00000395331.3_5'UTR|ASL_ENST00000380839.4_5'UTR	NM_001024943.1	NP_001020114.1	P04424	ARLY_HUMAN	argininosuccinate lyase						arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)			breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	GGGCTGCGCTCCCTCAAGCGC	0.736																																																0			7																																								65178371	SO:0001623	5_prime_UTR_variant	435				CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000395332.3:c.-133C>G	7.37:g.65540936C>G		Somatic		Capture	Illumina GAIIx	4	65178371	E7EMI0|E9PE48|Q6LDS5|Q96HS2	Silent	SNP	HMMPfam_Lyase_1,superfamily_L-aspartase-like,PatternScan_FUMARATE_LYASES	p.L36	ENST00000395332.3	37	c.108	CCDS5531.1	7																																																																																			-	NULL		0.736	ASL-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASL	protein_coding	OTTHUMT00000345103.1	C	NM_000048		65178371	+1	no_start_codon	ENST00000395332	ensembl	human	known	54_36p	silent	SNP	0.000	G
SLC12A4	6560	genome.wustl.edu	37	16	67979072	67979072	+	Silent	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr16:67979072G>A	ENST00000316341.3	-	23	3224	c.3084C>T	c.(3082-3084)gtC>gtT	p.V1028V	SLC12A4_ENST00000541864.2_Silent_p.V997V|LCAT_ENST00000264005.5_5'Flank|CTC-479C5.17_ENST00000590594.1_lincRNA|SLC12A4_ENST00000338335.3_3'UTR|SLC12A4_ENST00000422611.2_Silent_p.V1030V|SLC12A4_ENST00000576616.1_Silent_p.V1028V|SLC12A4_ENST00000537830.2_Silent_p.V1022V|SLC12A4_ENST00000572037.1_Silent_p.V980V	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	1028					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GCGTGACAATGACTTCATTGA	0.577																																																0			16											138.0	126.0	130.0					16																	67979072		2198	4300	6498	66536573	SO:0001819	synonymous_variant	6560				CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.3084C>T	16.37:g.67979072G>A		Somatic		Capture	Illumina GAIIx	4	66536573	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Silent	SNP	HMMPfam_AA_permease,HMMPfam_KCl_Cotrans_1	p.V1028	ENST00000316341.3	37	c.3084	CCDS10855.1	16																																																																																			-	NULL		0.577	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A4	protein_coding	OTTHUMT00000268864.4	G	NM_005072		66536573	-1	no_errors	NM_005072	genbank	human	validated	54_36p	silent	SNP	0.999	A
NUP107	57122	genome.wustl.edu	37	12	69135623	69135623	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr12:69135623C>G	ENST00000229179.4	+	27	2865	c.2533C>G	c.(2533-2535)Caa>Gaa	p.Q845E	NUP107_ENST00000378905.2_Missense_Mutation_p.Q606E|NUP107_ENST00000539906.1_Missense_Mutation_p.Q816E	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	845				Q -> R (in Ref. 4; AAH43343). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			AAGAACACATCAAATGGTCTT	0.368																																																0			12											209.0	191.0	197.0					12																	69135623		2203	4300	6503	67421890	SO:0001583	missense	57122			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.2533C>G	12.37:g.69135623C>G	ENSP00000229179:p.Gln845Glu	Somatic		Capture	Illumina GAIIx	4	67421890	B4DZ67|Q6PJE1	Missense_Mutation	SNP	HMMPfam_Nup84_Nup100	p.Q845E	ENST00000229179.4	37	c.2533	CCDS8985.1	12	.	.	.	.	.	.	.	.	.	.	C	16.41	3.115116	0.56505	.	.	ENSG00000111581	ENST00000229179;ENST00000378905;ENST00000539906	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.71358	0.3330	M	0.73319	2.225	0.33695	D	0.613782	P;B;P	0.48834	0.916;0.307;0.916	P;B;P	0.54460	0.753;0.163;0.645	T	0.77005	-0.2748	8	.	.	.	-10.778	19.7824	0.96422	0.0:1.0:0.0:0.0	.	816;606;845	B4DZ67;Q6PJE1;P57740	.;.;NU107_HUMAN	E	845;606;816	.	.	Q	+	1	0	NUP107	67421890	1.000000	0.71417	0.718000	0.30602	0.004000	0.04260	6.768000	0.74980	2.770000	0.95276	0.655000	0.94253	CAA	-	HMMPfam_Nup84_Nup100		0.368	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP107	protein_coding	OTTHUMT00000403195.1	C	NM_020401		67421890	+1	no_errors	NM_020401	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
MARVELD2	153562	genome.wustl.edu	37	5	68728873	68728873	+	Silent	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr5:68728873C>T	ENST00000325631.5	+	5	1530	c.1456C>T	c.(1456-1458)Ctg>Ttg	p.L486L	MARVELD2_ENST00000413223.2_Silent_p.L370L	NM_001038603.2|NM_001244734.1	NP_001033692.2|NP_001231663.1	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2	486					cell-cell junction organization (GO:0045216)|establishment of endothelial barrier (GO:0061028)|sensory perception of sound (GO:0007605)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(4)|skin(1)|urinary_tract(1)	15		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		GTTTGATGAGCTGGATGCAGT	0.468																																																0			5											136.0	127.0	130.0					5																	68728873		2203	4300	6503	68764629	SO:0001819	synonymous_variant	153562			AK055094	CCDS34175.1, CCDS58956.1	5q13.1	2007-05-01	2004-07-12	2004-07-14	ENSG00000152939	ENSG00000152939			26401	protein-coding gene	gene with protein product	"""tricellulin"""	610572	"""MARVEL (membrane-associating) domain containing 2"", ""deafness, autosomal recessive 49"""	MRVLDC2, DFNB49		17186462	Standard	NM_001038603		Approved	FLJ30532, TRIC	uc003jwq.3	Q8N4S9	OTTHUMG00000162512	ENST00000325631.5:c.1456C>T	5.37:g.68728873C>T		Somatic		Capture	Illumina GAIIx	4	68764629	A1BQX0|A1BQX1|A8KA97|Q96NM9	Silent	SNP	HMMPfam_MARVEL,HMMPfam_Occludin_ELL	p.L486	ENST00000325631.5	37	c.1456	CCDS34175.1	5																																																																																			-	HMMPfam_Occludin_ELL		0.468	MARVELD2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MARVELD2	protein_coding	OTTHUMT00000369583.1	C	NM_144724		68764629	+1	no_errors	NM_001038603	genbank	human	provisional	54_36p	silent	SNP	1.000	T
SLC8A3	6547	genome.wustl.edu	37	14	70634682	70634682	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr14:70634682A>G	ENST00000381269.2	-	2	1211	c.458T>C	c.(457-459)aTt>aCt	p.I153T	SLC8A3_ENST00000357887.3_Missense_Mutation_p.I153T|SLC8A3_ENST00000534137.1_Missense_Mutation_p.I153T|SLC8A3_ENST00000356921.2_Missense_Mutation_p.I153T|SLC8A3_ENST00000528359.1_Missense_Mutation_p.I153T	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	153					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		ACACACCTCAATTAAAGAGAG	0.493																																																0			14											91.0	85.0	87.0					14																	70634682		2203	4300	6503	69704435	SO:0001583	missense	6547			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.458T>C	14.37:g.70634682A>G	ENSP00000370669:p.Ile153Thr	Somatic		Capture	Illumina GAIIx	4	69704435	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	HMMPfam_Na_Ca_ex,HMMSmart_SM00237,HMMPfam_Calx-beta	p.I153T	ENST00000381269.2	37	c.458	CCDS35498.1	14	.	.	.	.	.	.	.	.	.	.	A	15.88	2.962635	0.53400	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	5.48	5.48	0.80851	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.84678	0.5525	H	0.95574	3.69	0.80722	D	1	D;D;D;D	0.60160	0.984;0.987;0.987;0.987	D;D;D;D	0.68765	0.932;0.96;0.912;0.912	D	0.89481	0.3750	10	0.87932	D	0	.	15.5805	0.76432	1.0:0.0:0.0:0.0	.	153;153;153;153	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	T	153	ENSP00000349392:I153T;ENSP00000370669:I153T;ENSP00000350560:I153T;ENSP00000436688:I153T;ENSP00000433531:I153T	ENSP00000349392:I153T	I	-	2	0	SLC8A3	69704435	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.332000	0.96446	2.081000	0.62600	0.528000	0.53228	ATT	-	HMMPfam_Na_Ca_ex		0.493	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	protein_coding	OTTHUMT00000390736.1	A			69704435	-1	no_errors	NM_183002	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
NUP85	79902	genome.wustl.edu	37	17	73228962	73228962	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr17:73228962G>C	ENST00000245544.4	+	15	1484	c.1413G>C	c.(1411-1413)aaG>aaC	p.K471N	NUP85_ENST00000579324.1_Missense_Mutation_p.K359N|NUP85_ENST00000579298.1_Missense_Mutation_p.K426N|NUP85_ENST00000540768.1_Missense_Mutation_p.K74N|NUP85_ENST00000447371.2_Missense_Mutation_p.K303N|NUP85_ENST00000541827.1_Missense_Mutation_p.K425N	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa	471					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			GCATTTGTAAGATCTTAGCCA	0.542																																																0			17											165.0	167.0	166.0					17																	73228962		2203	4300	6503	70740557	SO:0001583	missense	79902			AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.1413G>C	17.37:g.73228962G>C	ENSP00000245544:p.Lys471Asn	Somatic		Capture	Illumina GAIIx	4	70740557	B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Missense_Mutation	SNP	HMMPfam_Nucleopor_Nup85	p.K471N	ENST00000245544.4	37	c.1413	CCDS32730.1	17	.	.	.	.	.	.	.	.	.	.	G	11.20	1.569200	0.28003	.	.	ENSG00000125450	ENST00000245544;ENST00000541827;ENST00000447371;ENST00000540768	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.79347	0.4430	M	0.85859	2.78	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.79784	0.989;0.993	T	0.80395	-0.1400	9	0.46703	T	0.11	-31.8175	12.1321	0.53948	0.1245:0.0:0.8755:0.0	.	425;471	B4DMQ3;Q9BW27	.;NUP85_HUMAN	N	471;425;303;74	.	ENSP00000245544:K471N	K	+	3	2	NUP85	70740557	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.139000	0.42149	2.579000	0.87056	0.655000	0.94253	AAG	-	HMMPfam_Nucleopor_Nup85		0.542	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP85	protein_coding	OTTHUMT00000446619.1	G	NM_024844		70740557	+1	no_errors	NM_024844	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CABS1	85438	genome.wustl.edu	37	4	71201025	71201025	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr4:71201025C>G	ENST00000273936.5	+	1	343	c.269C>G	c.(268-270)aCt>aGt	p.T90S		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	90					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						AAGTCAACAACTCACCTACAG	0.368																																																0			4											60.0	60.0	60.0					4																	71201025		2203	4299	6502	71235614	SO:0001583	missense	85438			AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.269C>G	4.37:g.71201025C>G	ENSP00000273936:p.Thr90Ser	Somatic		Capture	Illumina GAIIx	4	71235614	B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	NULL	p.T90S	ENST00000273936.5	37	c.269	CCDS3539.1	4	.	.	.	.	.	.	.	.	.	.	C	6.864	0.528783	0.13127	.	.	ENSG00000145309	ENST00000273936	T	0.27720	1.65	4.42	4.42	0.53409	.	0.000000	0.38548	N	0.001642	T	0.40372	0.1114	L	0.32530	0.975	0.18873	N	0.999988	D	0.69078	0.997	P	0.62740	0.906	T	0.16129	-1.0413	10	0.87932	D	0	-25.5408	12.7151	0.57111	0.0:1.0:0.0:0.0	.	90	Q96KC9	CABS1_HUMAN	S	90	ENSP00000273936:T90S	ENSP00000273936:T90S	T	+	2	0	CABS1	71235614	0.003000	0.15002	0.530000	0.27963	0.083000	0.17756	0.919000	0.28692	2.461000	0.83175	0.561000	0.74099	ACT	-	NULL		0.368	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	C4orf35	protein_coding	OTTHUMT00000251561.3	C	NM_033122		71235614	+1	no_errors	NM_033122	genbank	human	validated	54_36p	missense	SNP	0.111	G
KCNQ5	56479	genome.wustl.edu	37	6	73787100	73787100	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr6:73787100T>A	ENST00000370398.1	+	4	781	c.672T>A	c.(670-672)aaT>aaA	p.N224K	KCNQ5_ENST00000370392.1_Missense_Mutation_p.N224K|KCNQ5_ENST00000342056.2_Missense_Mutation_p.N224K|KCNQ5_ENST00000403813.2_Missense_Mutation_p.N224K|KCNQ5_ENST00000402622.2_Missense_Mutation_p.N224K|KCNQ5_ENST00000355635.3_Missense_Mutation_p.N224K|KCNQ5_ENST00000355194.4_Missense_Mutation_p.N224K|KCNQ5_ENST00000414165.2_Missense_Mutation_p.N224K	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	224					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	CTCAGGGTAATATTTTTGCCA	0.468																																					GBM(142;1375 1859 14391 23261 44706)											0			6											106.0	98.0	101.0					6																	73787100		2203	4300	6503	73843821	SO:0001583	missense	56479			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.672T>A	6.37:g.73787100T>A	ENSP00000359425:p.Asn224Lys	Somatic		Capture	Illumina GAIIx	4	73843821	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_KCNQ_channel	p.N224K	ENST00000370398.1	37	c.672	CCDS4976.1	6	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189650	0.78789	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000370392;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D;D	0.98567	-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0	5.95	-3.49	0.04724	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97914	0.9314	M	0.70595	2.14	0.38526	D	0.948842	P;D;P;P;D;P	0.71674	0.866;0.995;0.954;0.944;0.998;0.84	P;D;D;P;D;D	0.74348	0.675;0.958;0.921;0.661;0.983;0.91	D	0.97235	0.9887	10	0.72032	D	0.01	.	14.0841	0.64944	0.0:0.5956:0.0:0.4044	.	224;224;224;224;224;224	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82;Q9NR82-4	.;.;.;.;KCNQ5_HUMAN;.	K	224	ENSP00000345055:N224K;ENSP00000347326:N224K;ENSP00000359425:N224K;ENSP00000359419:N224K;ENSP00000385501:N224K;ENSP00000347853:N224K;ENSP00000384453:N224K;ENSP00000409861:N224K	ENSP00000345055:N224K	N	+	3	2	KCNQ5	73843821	0.999000	0.42202	0.992000	0.48379	0.984000	0.73092	0.733000	0.26087	-0.342000	0.08363	-0.263000	0.10527	AAT	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.468	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	protein_coding	OTTHUMT00000041198.3	T	NM_019842		73843821	+1	no_errors	NM_019842	genbank	human	reviewed	54_36p	missense	SNP	0.983	A
OIT3	170392	genome.wustl.edu	37	10	74683987	74683987	+	Splice_Site	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr10:74683987G>A	ENST00000334011.5	+	7	1170	c.952G>A	c.(952-954)Gtg>Atg	p.V318M		NM_152635.1	NP_689848.1	Q8WWZ8	OIT3_HUMAN	oncoprotein induced transcript 3	318	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)	35	Prostate(51;0.0198)					CCTGGCTCAGGTGGTGAATGA	0.517																																					Colon(7;19 345 13446 17537)											0			10											73.0	75.0	74.0					10																	74683987		2203	4300	6503	74353993	SO:0001630	splice_region_variant	170392				CCDS7318.1	10q22.2-q22.3	2004-04-21			ENSG00000138315	ENSG00000138315			29953	protein-coding gene	gene with protein product		609330				12975309, 12939600	Standard	NM_152635		Approved	LZP, FLJ39116	uc001jte.1	Q8WWZ8	OTTHUMG00000018444	ENST00000334011.5:c.952-1G>A	10.37:g.74683987G>A		Somatic		Capture	Illumina GAIIx	4	74353993	A0AVP3|Q8N1M8	Missense_Mutation	SNP	superfamily_EGF/Laminin,HMMSmart_SM00181,PatternScan_EGF_CA,HMMSmart_SM00179,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,HMMPfam_Zona_pellucida,HMMSmart_SM00241	p.V318M	ENST00000334011.5	37	c.952	CCDS7318.1	10	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054902	0.75960	.	.	ENSG00000138315	ENST00000334011	D	0.82344	-1.6	5.72	5.72	0.89469	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.000000	0.51477	D	0.000082	D	0.89399	0.6704	M	0.70275	2.135	0.80722	D	1	D	0.63880	0.993	D	0.67900	0.954	D	0.88838	0.3310	9	.	.	.	-19.6253	14.0832	0.64939	0.0717:0.0:0.9283:0.0	.	318	Q8WWZ8	OIT3_HUMAN	M	318	ENSP00000333900:V318M	.	V	+	1	0	OIT3	74353993	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.494000	0.73661	2.695000	0.91970	0.655000	0.94253	GTG	-	HMMPfam_Zona_pellucida,HMMSmart_SM00241		0.517	OIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OIT3	protein_coding	OTTHUMT00000048596.1	G	NM_152635	Missense_Mutation	74353993	+1	no_errors	NM_152635	genbank	human	provisional	54_36p	missense	SNP	1.000	A
TTLL5	23093	genome.wustl.edu	37	14	76232700	76232700	+	Silent	SNP	T	T	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr14:76232700T>C	ENST00000298832.9	+	20	2209	c.2004T>C	c.(2002-2004)aaT>aaC	p.N668N	TTLL5_ENST00000554510.1_Silent_p.N177N|TTLL5_ENST00000556893.1_Silent_p.N219N|TTLL5_ENST00000557636.1_Silent_p.N682N|TTLL5_ENST00000555422.1_3'UTR	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	668					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		TTCAAGATAATGGCAATCTTA	0.343																																																0			14											46.0	50.0	49.0					14																	76232700		2203	4300	6503	75302453	SO:0001819	synonymous_variant	23093			AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.2004T>C	14.37:g.76232700T>C		Somatic		Capture	Illumina GAIIx	4	75302453	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Silent	SNP	HMMPfam_TTL,superfamily_Glutathione synthetase ATP-binding domain-like	p.N668	ENST00000298832.9	37	c.2004	CCDS32124.1	14																																																																																			-	NULL		0.343	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	protein_coding	OTTHUMT00000414453.1	T	NM_015072		75302453	+1	no_errors	NM_015072	genbank	human	validated	54_36p	silent	SNP	0.990	C
CSPG4P13	100302666	genome.wustl.edu	37	15	78189628	78189628	+	IGR	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr15:78189628C>T								LINGO1 (77758 upstream) : CSPG4P13 (4374 downstream)																							CACACCACGGCGAGCTCGAGC	0.637																																																0			15																																								75976683	SO:0001628	intergenic_variant	0																															15.37:g.78189628C>T		Somatic		Capture	Illumina GAIIx	4	75976683		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.637					LOC400403			C			75976683	+1	pseudogene	XR_038194	genbank	human	model	54_36p	rna	SNP	0.504	T
ADAMTS7	11173	genome.wustl.edu	37	15	79058799	79058799	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr15:79058799G>T	ENST00000388820.4	-	19	3664	c.3454C>A	c.(3454-3456)Cct>Act	p.P1152T	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1152					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TTGATCAAAGGGTTCCCAGGG	0.657																																																0			15											4.0	6.0	5.0					15																	79058799		1831	3770	5601	76845854	SO:0001583	missense	11173			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3454C>A	15.37:g.79058799G>T	ENSP00000373472:p.Pro1152Thr	Somatic		Capture	Illumina GAIIx	4	76845854	Q14F51|Q6P7J9	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1"	p.P1152T	ENST00000388820.4	37	c.3454	CCDS32303.1	15	.	.	.	.	.	.	.	.	.	.	g	6.952	0.545477	0.13312	.	.	ENSG00000136378	ENST00000388820	T	0.58797	0.31	4.21	-0.322	0.12713	.	0.903051	0.09539	N	0.788564	T	0.45418	0.1341	M	0.64997	1.995	0.09310	N	1	B	0.28713	0.22	B	0.24541	0.054	T	0.29150	-1.0021	10	0.15499	T	0.54	.	4.2921	0.10883	0.3173:0.2487:0.434:0.0	.	1152	Q9UKP4	ATS7_HUMAN	T	1152	ENSP00000373472:P1152T	ENSP00000373472:P1152T	P	-	1	0	ADAMTS7	76845854	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.106000	0.15354	0.033000	0.15463	-0.240000	0.12126	CCT	-	NULL		0.657	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	protein_coding	OTTHUMT00000421331.1	G	NM_014272		76845854	-1	no_errors	NM_014272	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
DOPEY1	23033	genome.wustl.edu	37	6	83848674	83848674	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr6:83848674G>A	ENST00000349129.2	+	21	5173	c.4913G>A	c.(4912-4914)gGc>gAc	p.G1638D	DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000369739.3_Missense_Mutation_p.G1629D|DOPEY1_ENST00000237163.5_Missense_Mutation_p.G1619D	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1638					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		ACATGTCAAGGCATGTTCCTC	0.433																																																0			6											127.0	101.0	110.0					6																	83848674		2203	4299	6502	83905393	SO:0001583	missense	23033			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.4913G>A	6.37:g.83848674G>A	ENSP00000195654:p.Gly1638Asp	Somatic		Capture	Illumina GAIIx	4	83905393	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	HMMPfam_Dopey_N	p.G1638D	ENST00000349129.2	37	c.4913	CCDS4996.1	6	.	.	.	.	.	.	.	.	.	.	G	19.89	3.911340	0.72983	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.46451	0.87;0.87	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.59321	0.2185	M	0.64404	1.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.55872	-0.8072	10	0.54805	T	0.06	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	1529;1629;1638	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	D	1638;1619;1619	ENSP00000195654:G1638D;ENSP00000237163:G1619D	ENSP00000237163:G1619D	G	+	2	0	DOPEY1	83905393	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.476000	0.97823	2.882000	0.98803	0.655000	0.94253	GGC	-	NULL		0.433	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	protein_coding	OTTHUMT00000043785.2	G	NM_015018		83905393	+1	no_errors	NM_015018	genbank	human	validated	54_36p	missense	SNP	1.000	A
AGPAT9	84803	genome.wustl.edu	37	4	84502751	84502751	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr4:84502751G>C	ENST00000395226.2	+	4	463	c.245G>C	c.(244-246)gGg>gCg	p.G82A	AGPAT9_ENST00000264409.4_Missense_Mutation_p.G82A	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9	82					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				ATGGAAAAAGGGCTCTCTGGT	0.438																																																0			4											167.0	169.0	168.0					4																	84502751		2203	4300	6503	84721775	SO:0001583	missense	84803			AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.245G>C	4.37:g.84502751G>C	ENSP00000378651:p.Gly82Ala	Somatic		Capture	Illumina GAIIx	4	84721775	Q68CJ4|Q6GPI6|Q96NA3	Missense_Mutation	SNP	HMMPfam_Acyltransferase,HMMSmart_PlsC	p.G82A	ENST00000395226.2	37	c.245	CCDS3606.1	4	.	.	.	.	.	.	.	.	.	.	G	9.377	1.072066	0.20147	.	.	ENSG00000138678	ENST00000395226;ENST00000264409	T;T	0.39997	1.05;1.05	5.66	4.81	0.61882	.	0.098399	0.64402	D	0.000002	T	0.29491	0.0735	L	0.50333	1.59	0.34189	D	0.671894	B	0.06786	0.001	B	0.04013	0.001	T	0.30736	-0.9968	10	0.12766	T	0.61	-18.6828	4.2114	0.10514	0.205:0.2022:0.5928:0.0	.	82	Q53EU6	GPAT3_HUMAN	A	82	ENSP00000378651:G82A;ENSP00000264409:G82A	ENSP00000264409:G82A	G	+	2	0	AGPAT9	84721775	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.495000	0.53280	2.693000	0.91896	0.644000	0.83932	GGG	-	NULL		0.438	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT9	protein_coding	OTTHUMT00000252821.3	G	NM_032717		84721775	+1	no_errors	NM_032717	genbank	human	validated	54_36p	missense	SNP	0.997	C
SYTL2	54843	genome.wustl.edu	37	11	85445291	85445291	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr11:85445291C>G	ENST00000528231.1	-	6	1355	c.1078G>C	c.(1078-1080)Gaa>Caa	p.E360Q	SYTL2_ENST00000389960.4_Missense_Mutation_p.E360Q|SYTL2_ENST00000524452.1_Missense_Mutation_p.E360Q|SYTL2_ENST00000527523.1_Missense_Mutation_p.E312Q|SYTL2_ENST00000316356.4_Missense_Mutation_p.E361Q	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	360					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)	p.E361K(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CTGTCAGATTCTAAAACACTA	0.443																																																1	Substitution - Missense(1)	skin(1)	11											113.0	109.0	111.0					11																	85445291		2203	4299	6502	85122939	SO:0001583	missense	54843			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1078G>C	11.37:g.85445291C>G	ENSP00000431701:p.Glu360Gln	Somatic		Capture	Illumina GAIIx	4	85122939	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	superfamily_FYVE/PHD zinc finger,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.E360Q	ENST00000528231.1	37	c.1078	CCDS53688.1	11	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416967	0.83449	.	.	ENSG00000137501	ENST00000389960;ENST00000316356;ENST00000528231;ENST00000527523;ENST00000524452	T;T;T;T;T	0.29655	1.65;1.68;1.67;1.56;1.65	6.17	5.26	0.73747	.	.	.	.	.	T	0.51669	0.1688	M	0.64997	1.995	0.80722	D	1	D;D;D;D;D	0.76494	0.997;0.997;0.969;0.999;0.997	D;D;P;D;D	0.68353	0.933;0.945;0.663;0.957;0.945	T	0.50625	-0.8806	8	.	.	.	.	15.4581	0.75330	0.0:0.9332:0.0:0.0668	.	312;360;360;361;218	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15	.;.;SYTL2_HUMAN;.;.	Q	360;361;360;312;360	ENSP00000374610:E360Q;ENSP00000318803:E361Q;ENSP00000431701:E360Q;ENSP00000434010:E312Q;ENSP00000435238:E360Q	.	E	-	1	0	SYTL2	85122939	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.706000	0.47135	1.626000	0.50381	0.655000	0.94253	GAA	-	NULL		0.443	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	protein_coding	OTTHUMT00000392192.1	C	NM_206927		85122939	-1	no_errors	NM_032943	genbank	human	reviewed	54_36p	missense	SNP	0.999	G
PICALM	8301	genome.wustl.edu	37	11	85779710	85779710	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr11:85779710T>C	ENST00000393346.3	-	1	261	c.113A>G	c.(112-114)aAg>aGg	p.K38R	PICALM_ENST00000532317.1_Missense_Mutation_p.K38R|PICALM_ENST00000528411.1_5'UTR|PICALM_ENST00000526033.1_Missense_Mutation_p.K38R|PICALM_ENST00000356360.5_Missense_Mutation_p.K38R|PICALM_ENST00000528398.1_Intron			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	38	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)			endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				GTGCTTTTTCTTGGGCCCCAT	0.647			T	"""MLLT10, MLL"""	"""TALL, AML, """																																		Dom	yes		11	11q14	8301	phosphatidylinositol binding clathrin assembly protein (CALM)		L	0			11											96.0	85.0	89.0					11																	85779710		2203	4299	6502	85457358	SO:0001583	missense	8301			BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.113A>G	11.37:g.85779710T>C	ENSP00000377015:p.Lys38Arg	Somatic		Capture	Illumina GAIIx	4	85457358	B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Missense_Mutation	SNP	superfamily_ENTH/VHS domain,HMMPfam_ANTH,HMMSmart_SM00273,superfamily_GAT-like domain	p.K38R	ENST00000393346.3	37	c.113	CCDS8272.1	11	.	.	.	.	.	.	.	.	.	.	T	22.0	4.224858	0.79576	.	.	ENSG00000073921	ENST00000532317;ENST00000526033;ENST00000447890;ENST00000393346;ENST00000356360;ENST00000531930;ENST00000528256	T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45	4.73	3.61	0.41365	ENTH/VHS (2);ANTH (1);Epsin-like, N-terminal (2);	0.126853	0.52532	D	0.000080	T	0.54711	0.1875	M	0.92026	3.265	0.80722	D	1	P;P;P	0.52316	0.952;0.934;0.556	P;P;B	0.55999	0.789;0.775;0.406	T	0.62732	-0.6792	9	.	.	.	-10.031	10.4785	0.44678	0.0:0.0771:0.0:0.9229	.	38;38;38	F8VPG7;Q13492;Q13492-3	.;PICAL_HUMAN;.	R	38;38;38;38;38;4;4	ENSP00000436958:K38R;ENSP00000433846:K38R;ENSP00000377015:K38R;ENSP00000348718:K38R;ENSP00000433303:K4R;ENSP00000431545:K4R	.	K	-	2	0	PICALM	85457358	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	7.319000	0.79040	0.955000	0.37878	-0.371000	0.07208	AAG	-	superfamily_ENTH/VHS domain,HMMPfam_ANTH,HMMSmart_SM00273		0.647	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PICALM	protein_coding	OTTHUMT00000392224.1	T	NM_007166		85457358	-1	no_errors	NM_007166	genbank	human	validated	54_36p	missense	SNP	1.000	C
ABCB4	5244	genome.wustl.edu	37	7	87032453	87032453	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr7:87032453T>C	ENST00000265723.4	-	27	3763	c.3652A>G	c.(3652-3654)Aag>Gag	p.K1218E	ABCB4_ENST00000358400.3_Missense_Mutation_p.K1164E|ABCB4_ENST00000359206.3_Missense_Mutation_p.K1211E|ABCB4_ENST00000545634.1_Missense_Mutation_p.K1211E|ABCB4_ENST00000453593.1_Missense_Mutation_p.K1164E	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	1218	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	ACACACACCTTTTCACTTTCA	0.423																																																0			7											145.0	131.0	136.0					7																	87032453		2203	4300	6503	86870389	SO:0001583	missense	5244			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.3652A>G	7.37:g.87032453T>C	ENSP00000265723:p.Lys1218Glu	Somatic		Capture	Illumina GAIIx	4	86870389	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.K1218E	ENST00000265723.4	37	c.3652	CCDS5606.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.3|24.3	4.516573|4.516573	0.85495|0.85495	.|.	.|.	ENSG00000005471|ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634|ENST00000440025	D;D;D;D;D|.	0.84223|.	-1.82;-1.82;-1.82;-1.82;-1.82|.	5.41|5.41	5.41|5.41	0.78517|0.78517	ATPase, AAA+ type, core (1);ABC transporter-like (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.45657|0.45657	0.1353|0.1353	N|N	0.11560|0.11560	0.145|0.145	0.80722|0.80722	D|D	1|1	P;D;D|.	0.63880|.	0.939;0.993;0.987|.	P;D;P|.	0.64506|.	0.547;0.926;0.844|.	T|T	0.43147|0.43147	-0.9409|-0.9409	10|6	0.87932|.	D|.	0|.	-18.0289|-18.0289	15.7384|15.7384	0.77866|0.77866	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1164;1211;1218|.	A4D1D5;P21439-2;P21439|.	.;.;MDR3_HUMAN|.	E|R	1211;1164;1218;1164;1211|22	ENSP00000352135:K1211E;ENSP00000351172:K1164E;ENSP00000265723:K1218E;ENSP00000392983:K1164E;ENSP00000437465:K1211E|.	ENSP00000265723:K1218E|.	K|K	-|-	1|2	0|0	ABCB4|ABCB4	86870389|86870389	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.866000|0.866000	0.49608|0.49608	6.199000|6.199000	0.72112|0.72112	2.174000|2.174000	0.68829|0.68829	0.459000|0.459000	0.35465|0.35465	AAG|AAA	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran		0.423	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	protein_coding	OTTHUMT00000336083.1	T	NM_000443		86870389	-1	no_errors	NM_018849	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ANKRD11	29123	genome.wustl.edu	37	16	89334918	89334918	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr16:89334918C>T	ENST00000301030.4	-	13	8420	c.7960G>A	c.(7960-7962)Gtc>Atc	p.V2654I	AC137932.1_ENST00000602042.1_3'UTR|RP11-46C24.5_ENST00000566427.1_lincRNA|ANKRD11_ENST00000378330.2_Missense_Mutation_p.V2654I	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2654					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TCGTCGTTGACGTCGACCATG	0.662																																																0			16											5.0	5.0	5.0					16																	89334918		2077	4109	6186	87862419	SO:0001583	missense	29123			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.7960G>A	16.37:g.89334918C>T	ENSP00000301030:p.Val2654Ile	Somatic		Capture	Illumina GAIIx	4	87862419	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.V2654I	ENST00000301030.4	37	c.7960	CCDS32513.1	16	.	.	.	.	.	.	.	.	.	.	C	13.45	2.239890	0.39598	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.60672	0.17;0.17	4.36	3.39	0.38822	.	0.000000	0.48767	D	0.000167	T	0.73877	0.3643	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.76642	-0.2884	10	0.59425	D	0.04	.	13.7849	0.63104	0.1548:0.8452:0.0:0.0	.	2654	Q6UB99	ANR11_HUMAN	I	2654	ENSP00000301030:V2654I;ENSP00000367581:V2654I	ENSP00000301030:V2654I	V	-	1	0	ANKRD11	87862419	1.000000	0.71417	0.594000	0.28785	0.001000	0.01503	7.617000	0.83032	0.939000	0.37446	-0.324000	0.08512	GTC	-	NULL		0.662	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	protein_coding	OTTHUMT00000430462.3	C	NM_013275		87862419	-1	no_errors	NM_013275	genbank	human	validated	54_36p	missense	SNP	1.000	T
ZNF276	92822	genome.wustl.edu	37	16	89789687	89789687	+	Silent	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr16:89789687C>T	ENST00000443381.2	+	4	673	c.576C>T	c.(574-576)agC>agT	p.S192S	VPS9D1_ENST00000389386.3_5'Flank|ZNF276_ENST00000568064.1_Splice_Site_p.A111V|ZNF276_ENST00000289816.5_Silent_p.S117S|ZNF276_ENST00000446326.2_5'UTR	NM_001113525.1	NP_001106997.1	Q8N554	ZN276_HUMAN	zinc finger protein 276	192					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)	14		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		TCACATCCAGCCCCCAGTGCC	0.652																																																0			16											58.0	56.0	57.0					16																	89789687		2197	4299	6496	88317188	SO:0001819	synonymous_variant	92822			AK026482	CCDS10986.1, CCDS45554.1	16q24.3	2014-02-17	2006-02-10	2006-02-10	ENSG00000158805	ENSG00000158805		"""Zinc fingers, C2H2-type"""	23330	protein-coding gene	gene with protein product	"""centromere protein Z"", ""zinc finger, AD-type"""	608460	"""zinc finger protein 276 homolog (mouse)"""	ZFP276		10936049, 20813266	Standard	NM_152287		Approved	MGC45417, ZNF477, CENPZ, CENP-Z, ZADT	uc002fos.4	Q8N554	OTTHUMG00000138050	ENST00000443381.2:c.576C>T	16.37:g.89789687C>T		Somatic		Capture	Illumina GAIIx	4	88317188	Q0VGA1|Q2TBE8|Q3B7H7	Silent	SNP	HMMPfam_zf-AD,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.S117	ENST00000443381.2	37	c.351	CCDS45554.1	16																																																																																			-	NULL		0.652	ZNF276-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF276	protein_coding	OTTHUMT00000422517.1	C	NM_152287		88317188	+1	no_errors	NM_152287	genbank	human	validated	54_36p	silent	SNP	1.000	T
F3	2152	genome.wustl.edu	37	1	94997915	94997915	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:94997915G>C	ENST00000334047.7	-	5	876	c.713C>G	c.(712-714)cCg>cGg	p.P238R	F3_ENST00000480356.1_5'Flank|F3_ENST00000370207.4_Intron	NM_001993.4	NP_001984.1	P13726	TF_HUMAN	coagulation factor III (thromboplastin, tissue factor)	238					activation of blood coagulation via clotting cascade (GO:0002543)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of plasma proteins involved in acute inflammatory response (GO:0002541)|blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)|protease binding (GO:0002020)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)	14		all_lung(203;0.00106)|Lung NSC(277;0.00475)		all cancers(265;0.0232)|Epithelial(280;0.121)	Coagulation factor VIIa(DB00036)	ACACTCTACCGGGCTGTCTGT	0.502																																					Melanoma(40;358 1339 15970 39161)											0			1											136.0	122.0	127.0					1																	94997915		2203	4300	6503	94770503	SO:0001583	missense	2152			BC011029	CCDS750.1, CCDS53345.1	1p22-p21	2012-10-02			ENSG00000117525	ENSG00000117525		"""CD molecules"""	3541	protein-coding gene	gene with protein product		134390					Standard	NM_001993		Approved	CD142	uc001dqr.3	P13726	OTTHUMG00000010716	ENST00000334047.7:c.713C>G	1.37:g.94997915G>C	ENSP00000334145:p.Pro238Arg	Somatic		Capture	Illumina GAIIx	4	94770503	D3DT47|Q6FHG2|Q86WH4	Missense_Mutation	SNP	HMMPfam_Tissue_fac,superfamily_FN_III-like,PatternScan_TISSUE_FACTOR	p.P238R	ENST00000334047.7	37	c.713	CCDS750.1	1	.	.	.	.	.	.	.	.	.	.	G	4.442	0.081785	0.08533	.	.	ENSG00000117525	ENST00000334047	T	0.30714	1.52	5.48	-6.37	0.01963	Fibronectin, type III (1);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	1.920830	0.01704	N	0.027376	T	0.04318	0.0119	N	0.19112	0.55	0.09310	N	0.999996	B	0.24426	0.103	B	0.15052	0.012	T	0.15867	-1.0422	10	0.19590	T	0.45	.	2.5101	0.04654	0.2737:0.2219:0.3938:0.1106	.	238	P13726	TF_HUMAN	R	238	ENSP00000334145:P238R	ENSP00000334145:P238R	P	-	2	0	F3	94770503	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.743000	0.01834	-0.604000	0.05760	-0.793000	0.03317	CCG	-	superfamily_FN_III-like		0.502	F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F3	protein_coding	OTTHUMT00000029593.1	G	NM_001993		94770503	-1	no_errors	NM_001993	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
MEPCE	56257	genome.wustl.edu	37	7	100028200	100028200	+	Silent	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr7:100028200C>T	ENST00000310512.2	+	1	947	c.559C>T	c.(559-561)Ctg>Ttg	p.L187L	ZCWPW1_ENST00000324725.6_5'Flank|MEPCE_ENST00000414441.1_Intron|ZCWPW1_ENST00000398027.2_5'Flank|ZCWPW1_ENST00000360951.4_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	187					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAACTTCCTCCTGGGGGGCAA	0.577																																																0			7											62.0	63.0	63.0					7																	100028200		2203	4299	6502	99866136	SO:0001819	synonymous_variant	56257			AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.559C>T	7.37:g.100028200C>T		Somatic		Capture	Illumina GAIIx	4	99866136	B3KP86|D6W5V7|Q9NPD4	Silent	SNP	superfamily_SSF53335,HMMPfam_Bin3	p.L187	ENST00000310512.2	37	c.559	CCDS5693.1	7																																																																																			-	NULL		0.577	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEPCE	protein_coding	OTTHUMT00000339135.1	C			99866136	+1	no_errors	NM_019606	genbank	human	provisional	54_36p	silent	SNP	1.000	T
ARMCX3	51566	genome.wustl.edu	37	X	100880002	100880002	+	Silent	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chrX:100880002C>T	ENST00000341189.4	+	5	899	c.33C>T	c.(31-33)acC>acT	p.T11T	ARMCX3-AS1_ENST00000454228.1_RNA|ARMCX3_ENST00000471229.2_Silent_p.T11T|RP4-545K15.5_ENST00000564612.1_RNA|ARMCX3_ENST00000537169.1_Silent_p.T11T	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	11					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						GCTGGGTGACCGCAGGCCTGG	0.552																																																0			X											74.0	72.0	72.0					X																	100880002		2203	4300	6503	100766658	SO:0001819	synonymous_variant	51566			AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.33C>T	X.37:g.100880002C>T		Somatic		Capture	Illumina GAIIx	4	100766658	Q53HC6|Q7LCF5|Q9NPE4	Silent	SNP	superfamily_ARM-type_fold,HMMPfam_DUF634	p.T11	ENST00000341189.4	37	c.33	CCDS14489.1	X																																																																																			-	NULL		0.552	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMCX3	protein_coding	OTTHUMT00000057568.2	C	NM_016607		100766658	+1	no_errors	NM_016607	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
GPR128	84873	genome.wustl.edu	37	3	100373784	100373784	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr3:100373784C>A	ENST00000273352.3	+	12	1753	c.1485C>A	c.(1483-1485)aaC>aaA	p.N495K	GPR128_ENST00000475887.1_Missense_Mutation_p.N200K|GPR128_ENST00000481506.1_3'UTR	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	495					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						CCAATAAGAACTTGCAGACAA	0.393																																					Pancreas(87;185 1975 7223 18722)											0			3											143.0	130.0	134.0					3																	100373784		2203	4300	6503	101856474	SO:0001583	missense	84873			AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.1485C>A	3.37:g.100373784C>A	ENSP00000273352:p.Asn495Lys	Somatic		Capture	Illumina GAIIx	4	101856474	Q14D94|Q86SQ2	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F2_2,HMMPfam_GPS,HMMSmart_GPS,HMMPfam_7tm_2	p.N495K	ENST00000273352.3	37	c.1485	CCDS2938.1	3	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.411169	0.00191	.	.	ENSG00000144820	ENST00000273352;ENST00000475887	T;T	0.40476	1.03;1.03	4.61	1.76	0.24704	GPCR, family 2-like (1);	0.492266	0.21899	N	0.067474	T	0.27594	0.0678	L	0.45137	1.4	0.09310	N	0.999999	B;B	0.25772	0.064;0.134	B;B	0.27170	0.031;0.077	T	0.30327	-0.9982	10	0.07030	T	0.85	.	6.7314	0.23385	0.1446:0.6797:0.0:0.1757	.	200;495	E9PHI0;Q96K78	.;GP128_HUMAN	K	495;200	ENSP00000273352:N495K;ENSP00000419788:N200K	ENSP00000273352:N495K	N	+	3	2	GPR128	101856474	0.008000	0.16893	0.064000	0.19789	0.101000	0.19017	0.619000	0.24388	-0.003000	0.14444	-0.797000	0.03246	AAC	-	HMMPfam_7tm_2		0.393	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR128	protein_coding	OTTHUMT00000353236.1	C			101856474	+1	no_errors	NM_032787	genbank	human	provisional	54_36p	missense	SNP	0.012	A
TECPR2	9895	genome.wustl.edu	37	14	102901427	102901427	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr14:102901427A>G	ENST00000359520.7	+	9	2499	c.2273A>G	c.(2272-2274)tAt>tGt	p.Y758C	TECPR2_ENST00000558678.1_Missense_Mutation_p.Y758C	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	758					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						GAGGACATCTATGCCCACGGG	0.612																																																0			14											65.0	63.0	64.0					14																	102901427		2203	4300	6503	101971180	SO:0001583	missense	9895			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.2273A>G	14.37:g.102901427A>G	ENSP00000352510:p.Tyr758Cys	Somatic		Capture	Illumina GAIIx	4	101971180	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	PatternScan_WD_REPEATS_1,HMMSmart_WD40,superfamily_WD40_like,HMMSmart_TECPR,HMMPfam_Hyd_WA	p.Y758C	ENST00000359520.7	37	c.2273	CCDS32162.1	14	.	.	.	.	.	.	.	.	.	.	A	23.7	4.448106	0.84101	.	.	ENSG00000196663	ENST00000359520	T	0.29655	1.56	5.31	5.31	0.75309	.	0.208401	0.40469	N	0.001092	T	0.43255	0.1239	L	0.29908	0.895	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.22906	-1.0203	9	.	.	.	.	15.3184	0.74102	1.0:0.0:0.0:0.0	.	758;758	A5PKY3;O15040	.;TCPR2_HUMAN	C	758	ENSP00000352510:Y758C	.	Y	+	2	0	TECPR2	101971180	1.000000	0.71417	0.988000	0.46212	0.984000	0.73092	7.808000	0.86044	2.026000	0.59711	0.454000	0.30748	TAT	-	NULL		0.612	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	protein_coding	OTTHUMT00000415056.2	A	NM_014844		101971180	+1	no_errors	NM_014844	genbank	human	validated	54_36p	missense	SNP	1.000	G
TRAF3	7187	genome.wustl.edu	37	14	103336579	103336579	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr14:103336579A>C	ENST00000560371.1	+	2	258	c.41A>C	c.(40-42)cAg>cCg	p.Q14P	TRAF3_ENST00000539721.1_Missense_Mutation_p.Q14P|TRAF3_ENST00000351691.5_Missense_Mutation_p.Q14P|TRAF3_ENST00000392745.2_Missense_Mutation_p.Q14P|TRAF3_ENST00000347662.4_Missense_Mutation_p.Q14P	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	14					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		GGCGCGCTGCAGACTAACCCG	0.502																																																0			14											60.0	60.0	60.0					14																	103336579		2203	4300	6503	102406332	SO:0001583	missense	7187			U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.41A>C	14.37:g.103336579A>C	ENSP00000454207:p.Gln14Pro	Somatic		Capture	Illumina GAIIx	4	102406332	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Missense_Mutation	SNP	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,superfamily_Traf_like,HMMPfam_zf-TRAF,HMMSmart_MATH,HMMPfam_MATH	p.Q14P	ENST00000560371.1	37	c.41	CCDS9975.1	14	.	.	.	.	.	.	.	.	.	.	A	9.094	1.002352	0.19121	.	.	ENSG00000131323	ENST00000392745;ENST00000347662;ENST00000351691;ENST00000539721	T;T;T;T	0.46063	2.23;2.21;2.21;0.88	5.2	4.05	0.47172	.	1.197230	0.06020	N	0.651164	T	0.33731	0.0873	N	0.24115	0.695	0.40904	D	0.984179	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.01604	-1.1314	10	0.32370	T	0.25	-18.7909	12.0919	0.53730	0.8488:0.1512:0.0:0.0	.	14;14;14	Q13114-2;A6NHG8;Q13114	.;.;TRAF3_HUMAN	P	14	ENSP00000376500:Q14P;ENSP00000328003:Q14P;ENSP00000332468:Q14P;ENSP00000445998:Q14P	ENSP00000328003:Q14P	Q	+	2	0	TRAF3	102406332	0.996000	0.38824	0.485000	0.27403	0.038000	0.13279	2.674000	0.46867	0.827000	0.34685	0.533000	0.62120	CAG	-	NULL		0.502	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF3	protein_coding	OTTHUMT00000415735.1	A	NM_145725		102406332	+1	no_errors	NM_003300	genbank	human	reviewed	54_36p	missense	SNP	0.492	C
TCEAL1	9338	genome.wustl.edu	37	X	102885158	102885158	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chrX:102885158G>A	ENST00000372625.3	+	3	478	c.314G>A	c.(313-315)aGg>aAg	p.R105K	TCEAL1_ENST00000372624.3_Missense_Mutation_p.R105K|TCEAL1_ENST00000372626.3_Missense_Mutation_p.R105K	NM_001006639.1|NM_004780.2	NP_001006640.1|NP_004771.2	Q15170	TCAL1_HUMAN	transcription elongation factor A (SII)-like 1	103					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			ovary(1)	1						TTTAAAGAAAGGTTGGCTCGT	0.483																																																0			X											80.0	75.0	77.0					X																	102885158		2203	4300	6503	102771814	SO:0001583	missense	9338			M99701	CCDS35358.1	Xq22.1	2014-03-21			ENSG00000172465	ENSG00000172465			11616	protein-coding gene	gene with protein product		300237				8206389, 7971997, 16221301	Standard	NM_004780		Approved	p21, pp21, SIIR, P21, WEX9	uc004eku.3	Q15170	OTTHUMG00000022699	ENST00000372625.3:c.314G>A	X.37:g.102885158G>A	ENSP00000361708:p.Arg105Lys	Somatic		Capture	Illumina GAIIx	4	102771814	Q9UJQ9	Missense_Mutation	SNP	HMMPfam_TFA	p.R105K	ENST00000372625.3	37	c.314	CCDS35358.1	X	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625800	0.87560	.	.	ENSG00000172465	ENST00000372626;ENST00000537029;ENST00000372625;ENST00000372624	T;T;T	0.10668	2.85;2.85;2.85	4.79	4.79	0.61399	.	0.000000	0.49916	D	0.000121	T	0.27454	0.0674	.	.	.	0.31597	N	0.653205	D	0.67145	0.996	D	0.75484	0.986	T	0.03673	-1.1014	9	0.31617	T	0.26	-7.5031	14.5691	0.68200	0.0:0.0:1.0:0.0	.	105	Q15170-2	.	K	105;102;105;105	ENSP00000361709:R105K;ENSP00000361708:R105K;ENSP00000361707:R105K	ENSP00000361707:R105K	R	+	2	0	TCEAL1	102771814	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	2.402000	0.44521	2.618000	0.88619	0.600000	0.82982	AGG	-	HMMPfam_TFA		0.483	TCEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL1	protein_coding	OTTHUMT00000058903.1	G	NM_004780		102771814	+1	no_errors	NM_001006639	genbank	human	reviewed	54_36p	missense	SNP	0.977	A
CNNM2	54805	genome.wustl.edu	37	10	104678273	104678273	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr10:104678273G>C	ENST00000369878.4	+	1	224	c.36G>C	c.(34-36)aaG>aaC	p.K12N	CNNM2_ENST00000369875.3_Missense_Mutation_p.K12N|CNNM2_ENST00000433628.2_Missense_Mutation_p.K12N	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	12					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CCAAAGTAAAGATGGCGGGCG	0.701																																																0			10											10.0	12.0	11.0					10																	104678273		2160	4237	6397	104668263	SO:0001583	missense	54805			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.36G>C	10.37:g.104678273G>C	ENSP00000358894:p.Lys12Asn	Somatic		Capture	Illumina GAIIx	4	104668263	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	HMMPfam_DUF21,HMMPfam_CBS	p.K12N	ENST00000369878.4	37	c.36	CCDS44474.1	10	.	.	.	.	.	.	.	.	.	.	G	15.03	2.712830	0.48517	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369875;ENST00000369878;ENST00000345419;ENST00000541201	T;T;T	0.75154	-0.73;-0.91;-0.73	4.88	3.97	0.46021	.	1.399140	0.04725	N	0.420097	T	0.68522	0.3010	N	0.14661	0.345	0.34688	D	0.725421	B;B;P	0.48016	0.275;0.18;0.904	B;B;P	0.45099	0.112;0.052;0.469	T	0.64871	-0.6305	10	0.87932	D	0	.	14.3096	0.66407	0.0:0.1497:0.8503:0.0	.	12;12;12	Q9H8M5-2;Q9H8M5;F5H1I3	.;CNNM2_HUMAN;.	N	12	ENSP00000392875:K12N;ENSP00000358891:K12N;ENSP00000358894:K12N	ENSP00000286899:K12N	K	+	3	2	CNNM2	104668263	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.258000	0.32944	1.275000	0.44379	0.555000	0.69702	AAG	-	NULL		0.701	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	protein_coding	OTTHUMT00000050113.3	G	NM_017649		104668263	+1	no_errors	NM_017649	genbank	human	validated	54_36p	missense	SNP	0.998	C
TACR3	6870	genome.wustl.edu	37	4	104579400	104579400	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr4:104579400A>G	ENST00000304883.2	-	2	849	c.709T>C	c.(709-711)Tgg>Cgg	p.W237R		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	237					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		CCTTCTGGCCATTGCACAAAG	0.388																																																0			4											128.0	120.0	123.0					4																	104579400		2203	4300	6503	104798849	SO:0001583	missense	6870			M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.709T>C	4.37:g.104579400A>G	ENSP00000303325:p.Trp237Arg	Somatic		Capture	Illumina GAIIx	4	104798849	Q0P510	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.W237R	ENST00000304883.2	37	c.709	CCDS3664.1	4	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563326	0.86335	.	.	ENSG00000169836	ENST00000304883	T	0.37058	1.22	6.07	6.07	0.98685	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	M	0.86805	2.84	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.72124	-0.4385	10	0.72032	D	0.01	.	15.8218	0.78654	1.0:0.0:0.0:0.0	.	237	P29371	NK3R_HUMAN	R	237	ENSP00000303325:W237R	ENSP00000303325:W237R	W	-	1	0	TACR3	104798849	1.000000	0.71417	0.994000	0.49952	0.976000	0.68499	8.256000	0.89848	2.326000	0.78906	0.533000	0.62120	TGG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.388	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACR3	protein_coding	OTTHUMT00000253804.1	A	NM_001059		104798849	-1	no_errors	NM_001059	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
MTA1	9112	genome.wustl.edu	37	14	105930753	105930753	+	Splice_Site	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr14:105930753C>T	ENST00000331320.7	+	14	1407	c.1193C>T	c.(1192-1194)aCc>aTc	p.T398I	MTA1_ENST00000435036.2_5'UTR|MTA1_ENST00000405646.1_Splice_Site_p.T381I|MTA1_ENST00000406191.1_Splice_Site_p.T398I	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	398					circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		TTGTCCGTAGCCACACAGTCT	0.537																																																0			14											121.0	112.0	115.0					14																	105930753		2203	4300	6503	105001798	SO:0001630	splice_region_variant	9112			U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.1193-1C>T	14.37:g.105930753C>T		Somatic		Capture	Illumina GAIIx	4	105001798	A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Missense_Mutation	SNP	HMMPfam_BAH,HMMSmart_SM00439,HMMPfam_ELM2,HMMSmart_SM00717,HMMPfam_Myb_DNA-binding,superfamily_Homeodomain-like,HMMSmart_SM00401,superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMPfam_GATA	p.T398I	ENST00000331320.7	37	c.1193	CCDS32169.1	14	.	.	.	.	.	.	.	.	.	.	C	17.98	3.520698	0.64747	.	.	ENSG00000182979	ENST00000414153;ENST00000331320;ENST00000406191;ENST00000405646;ENST00000434050	D;D;D;D	0.99735	-6.58;-6.58;-6.58;-6.58	4.62	4.62	0.57501	Zinc finger, GATA-type (2);	0.096735	0.64402	D	0.000001	D	0.98905	0.9629	L	0.43152	1.355	0.80722	D	1	B;B	0.27166	0.17;0.078	B;B	0.37198	0.243;0.142	D	0.99978	1.2357	9	.	.	.	.	16.0373	0.80640	0.0:1.0:0.0:0.0	.	190;398	Q59FW1;Q13330	.;MTA1_HUMAN	I	307;398;398;381;190	ENSP00000333633:T398I;ENSP00000385702:T398I;ENSP00000384180:T381I;ENSP00000394106:T190I	.	T	+	2	0	MTA1	105001798	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.937000	0.70162	2.125000	0.65367	0.462000	0.41574	ACC	-	HMMSmart_SM00401,superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMPfam_GATA		0.537	MTA1-001	KNOWN	basic|CCDS	protein_coding	MTA1	protein_coding	OTTHUMT00000317849.15	C		Missense_Mutation	105001798	+1	no_errors	NM_004689	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SH3PXD2A	9644	genome.wustl.edu	37	10	105361944	105361944	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr10:105361944C>G	ENST00000369774.4	-	15	3307	c.3031G>C	c.(3031-3033)Ggc>Cgc	p.G1011R	SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.G878R|SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.G846R|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.G983R|SH3PXD2A_ENST00000427662.2_Intron			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	1011					superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CGTCGGACGCCTCGGAGGCCA	0.672																																																0			10											44.0	49.0	47.0					10																	105361944		2203	4300	6503	105351934	SO:0001583	missense	9644			AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.3031G>C	10.37:g.105361944C>G	ENSP00000358789:p.Gly1011Arg	Somatic		Capture	Illumina GAIIx	4	105351934	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	HMMPfam_PX,HMMSmart_SM00312,superfamily_PX domain,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326	p.G983R	ENST00000369774.4	37	c.2947		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.481|9.481	1.098162|1.098162	0.20552|0.20552	.|.	.|.	ENSG00000107957|ENSG00000107957	ENST00000369774;ENST00000355946;ENST00000315994;ENST00000540321;ENST00000538130|ENST00000420222	T;T;T;T|T	0.58797|0.58358	0.38;0.38;0.53;0.31|0.34	5.27|5.27	4.37|4.37	0.52481|0.52481	.|.	0.500214|.	0.23045|.	N|.	0.052580|.	T|T	0.42675|0.42675	0.1213|0.1213	L|L	0.34521|0.34521	1.04|1.04	0.26374|0.26374	N|N	0.976842|0.976842	B;B;P;B|.	0.43826|.	0.257;0.257;0.818;0.145|.	B;B;B;B|.	0.36186|.	0.143;0.091;0.219;0.133|.	T|T	0.27020|0.27020	-1.0086|-1.0086	10|7	0.16896|0.14252	T|T	0.51|0.57	-5.4347|-5.4347	10.5962|10.5962	0.45338|0.45338	0.0:0.8333:0.0:0.1667|0.0:0.8333:0.0:0.1667	.|.	1011;860;856;983|.	Q5TCZ1;B7Z9L8;B7Z3B0;Q5TCZ1-3|.	SPD2A_HUMAN;.;.;.|.	R|T	1011;983;818;878;846|937	ENSP00000358789:G1011R;ENSP00000348215:G983R;ENSP00000443663:G878R;ENSP00000441514:G846R|ENSP00000395781:R937T	ENSP00000318135:G818R|ENSP00000395781:R937T	G|R	-|-	1|2	0|0	SH3PXD2A|SH3PXD2A	105351934|105351934	0.002000|0.002000	0.14202|0.14202	0.131000|0.131000	0.22000|0.22000	0.533000|0.533000	0.34776|0.34776	0.673000|0.673000	0.25203|0.25203	1.228000|1.228000	0.43614|0.43614	0.561000|0.561000	0.74099|0.74099	GGC|AGG	-	NULL		0.672	SH3PXD2A-001	KNOWN	basic	protein_coding	SH3PXD2A	protein_coding	OTTHUMT00000050178.1	C	NM_014631		105351934	-1	no_errors	NM_014631	genbank	human	validated	54_36p	missense	SNP	0.008	G
NPNT	255743	genome.wustl.edu	37	4	106888398	106888398	+	Missense_Mutation	SNP	C	C	G	rs371602917		TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr4:106888398C>G	ENST00000379987.2	+	11	1615	c.1399C>G	c.(1399-1401)Cgc>Ggc	p.R467G	NPNT_ENST00000514622.1_Missense_Mutation_p.R438G|NPNT_ENST00000506666.1_Missense_Mutation_p.R468G|NPNT_ENST00000305572.8_Missense_Mutation_p.R438G|NPNT_ENST00000427316.2_Missense_Mutation_p.R497G|NPNT_ENST00000453617.2_Missense_Mutation_p.R484G	NM_001033047.2	NP_001028219.1	Q6UXI9	NPNT_HUMAN	nephronectin	467	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to tumor necrosis factor (GO:0071356)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|pilomotor reflex (GO:0097195)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|ureteric bud development (GO:0001657)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integrin alpha8-beta1 complex (GO:0034678)|proteinaceous extracellular matrix (GO:0005578)|smooth muscle contractile fiber (GO:0030485)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)	p.R467C(1)		kidney(5)|large_intestine(2)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	21		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		AAAAGCTGCACGCTTGGTGCT	0.572																																																1	Substitution - Missense(1)	prostate(1)	4											41.0	43.0	42.0					4																	106888398		2203	4300	6503	107107847	SO:0001583	missense	255743				CCDS34046.1, CCDS54784.1, CCDS54785.1, CCDS54786.1, CCDS54787.1	4q25	2005-10-07							27405	protein-coding gene	gene with protein product		610306				15754038	Standard	NM_001033047		Approved	EGFL6L, POEM	uc011cfd.2	Q6UXI9		ENST00000379987.2:c.1399C>G	4.37:g.106888398C>G	ENSP00000369323:p.Arg467Gly	Somatic		Capture	Illumina GAIIx	4	107107847	A6NFT9|A8K1W4|B4DIT4|B4DYK3|B4E2H7|B4E3H2|D6RCA1|E9PCK8|E9PCQ1|E9PE64|E9PF04	Missense_Mutation	SNP	superfamily_Growth factor receptor domain,HMMSmart_SM00181,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,superfamily_EGF/Laminin,HMMSmart_SM00137,HMMPfam_MAM	p.R467G	ENST00000379987.2	37	c.1399	CCDS34046.1	4	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499977	0.64298	.	.	ENSG00000168743	ENST00000379987;ENST00000453617;ENST00000427316;ENST00000514622;ENST00000305572;ENST00000506666;ENST00000503451	T;T;T;T;T;T;T	0.02552	4.25;4.25;4.25;4.25;4.25;4.25;4.25	4.65	4.65	0.58169	Concanavalin A-like lectin/glucanase (1);MAM domain (2);	0.179037	0.50627	D	0.000103	T	0.20700	0.0498	M	0.89785	3.06	0.47123	D	0.99932	D;D;D;D;D;D	0.71674	0.992;0.997;0.998;0.998;0.99;0.998	P;D;D;D;P;D	0.79108	0.869;0.963;0.992;0.992;0.794;0.992	T	0.07328	-1.0778	10	0.87932	D	0	.	17.8945	0.88883	0.0:1.0:0.0:0.0	.	438;468;497;484;438;467	E9PF04;E9PE64;E9PCQ1;E9PCK8;Q6UXI9-2;Q6UXI9	.;.;.;.;.;NPNT_HUMAN	G	467;484;497;438;438;468;514	ENSP00000369323:R467G;ENSP00000402884:R484G;ENSP00000389252:R497G;ENSP00000422044:R438G;ENSP00000302557:R438G;ENSP00000422474:R468G;ENSP00000426146:R514G	ENSP00000302557:R438G	R	+	1	0	NPNT	107107847	1.000000	0.71417	0.929000	0.37066	0.273000	0.26683	5.309000	0.65774	2.294000	0.77228	0.650000	0.86243	CGC	-	HMMSmart_SM00137,HMMPfam_MAM		0.572	NPNT-001	KNOWN	basic|CCDS	protein_coding	NPNT	protein_coding	OTTHUMT00000364083.1	C	NM_198278		107107847	+1	no_errors	NM_001033047	genbank	human	validated	54_36p	missense	SNP	0.987	G
LAMB1	3912	genome.wustl.edu	37	7	107638875	107638875	+	Silent	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr7:107638875G>A	ENST00000222399.6	-	4	506	c.276C>T	c.(274-276)gaC>gaT	p.D92D	LAMB1_ENST00000393561.1_Silent_p.D116D|U3_ENST00000458938.1_RNA|LAMB1_ENST00000393560.1_Silent_p.D92D	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	92	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TGAGATGGCTGTCAGGATTCA	0.413																																																0			7											162.0	138.0	146.0					7																	107638875		2203	4300	6503	107426111	SO:0001819	synonymous_variant	3912			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.276C>T	7.37:g.107638875G>A		Somatic		Capture	Illumina GAIIx	4	107426111	Q14D91	Silent	SNP	HMMSmart_SM00136,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_LAM_1,HMMSmart_SM00181,PatternScan_EGF_2,superfamily_Prefoldin	p.D92	ENST00000222399.6	37	c.276	CCDS5750.1	7																																																																																			-	HMMSmart_SM00136,HMMPfam_Laminin_N		0.413	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	protein_coding	OTTHUMT00000314584.1	G	NM_002291		107426111	-1	no_errors	NM_002291	genbank	human	reviewed	54_36p	silent	SNP	0.995	A
EPS8L3	79574	genome.wustl.edu	37	1	110299781	110299781	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:110299781C>G	ENST00000361965.4	-	12	1082	c.976G>C	c.(976-978)Gcc>Ccc	p.A326P	EPS8L3_ENST00000361852.4_Missense_Mutation_p.A326P|EPS8L3_ENST00000494151.1_5'Flank|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000369805.3_Missense_Mutation_p.A327P	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	326						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		GGGCACCTGGCCAGGATCTAG	0.602																																																0			1											49.0	42.0	45.0					1																	110299781		2203	4300	6503	110101304	SO:0001583	missense	79574			AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.976G>C	1.37:g.110299781C>G	ENSP00000355255:p.Ala326Pro	Somatic		Capture	Illumina GAIIx	4	110101304	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	HMMPfam_PTB,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.A327P	ENST00000361965.4	37	c.979	CCDS814.1	1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327437	0.81690	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.37411	1.2;1.2;1.2	5.44	-6.22	0.02058	.	1.063900	0.07094	N	0.839258	T	0.17195	0.0413	L	0.50333	1.59	0.09310	N	1	B;B;B;D	0.53151	0.002;0.022;0.002;0.958	B;B;B;P	0.51229	0.005;0.003;0.004;0.663	T	0.15752	-1.0426	10	0.30078	T	0.28	0.7248	5.5358	0.17011	0.4935:0.1493:0.0:0.3572	.	326;326;326;327	A8K2J6;Q8TE67-2;Q8TE67;Q8TE67-3	.;.;ES8L3_HUMAN;.	P	326;327;326	ENSP00000354551:A326P;ENSP00000358820:A327P;ENSP00000355255:A326P	ENSP00000354551:A326P	A	-	1	0	EPS8L3	110101304	0.000000	0.05858	0.001000	0.08648	0.645000	0.38454	-1.965000	0.01511	-0.833000	0.04245	0.585000	0.79938	GCC	-	NULL		0.602	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EPS8L3	protein_coding	OTTHUMT00000032234.1	C	NM_024526		110101304	-1	no_errors	NM_139053	genbank	human	reviewed	54_36p	missense	SNP	0.001	G
DRAM2	128338	genome.wustl.edu	37	1	111661425	111661425	+	Splice_Site	SNP	A	A	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:111661425A>G	ENST00000286692.4	-	8	1311		c.e8+1		DRAM2_ENST00000484310.1_Splice_Site|DRAM2_ENST00000539140.1_Splice_Site			Q6UX65	DRAM2_HUMAN	DNA-damage regulated autophagy modulator 2						apoptotic process (GO:0006915)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|microtubule cytoskeleton (GO:0015630)				endometrium(1)|large_intestine(5)|lung(3)	9						GTGCCTTCTTACCTGAAAATC	0.403																																																0			1											61.0	56.0	58.0					1																	111661425		2200	4300	6500	111462948	SO:0001630	splice_region_variant	128338			AY336747	CCDS30801.1	1p13.3	2010-07-08	2009-06-12	2009-06-12	ENSG00000156171	ENSG00000156171			28769	protein-coding gene	gene with protein product		613360	"""transmembrane protein 77"""	TMEM77		12975309	Standard	NM_178454		Approved	MGC54289, PRO180, WWFQ154, RP5-1180E21.1	uc001ead.4	Q6UX65	OTTHUMG00000011911	ENST00000286692.4:c.693+1T>C	1.37:g.111661425A>G		Somatic		Capture	Illumina GAIIx	4	111462948	B3SUG9|Q4VWF6|Q86VD3|Q8NBQ4	Splice_Site	SNP	-	e6+2	ENST00000286692.4	37	c.693+2	CCDS30801.1	1	.	.	.	.	.	.	.	.	.	.	A	17.67	3.447641	0.63178	.	.	ENSG00000156171	ENST00000286692;ENST00000539140	.	.	.	5.63	4.48	0.54585	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0664	0.36467	0.8363:0.0:0.0:0.1637	.	.	.	.	.	-1	.	.	.	-	.	.	DRAM2	111462948	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.962000	0.76048	1.028000	0.39785	0.528000	0.53228	.	-	-		0.403	DRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM77	protein_coding	OTTHUMT00000032930.3	A	NM_178454	Intron	111462948	-1	no_errors	NM_178454	genbank	human	validated	54_36p	splice_site	SNP	1.000	G
PSD4	23550	genome.wustl.edu	37	2	113951510	113951510	+	Silent	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:113951510C>G	ENST00000245796.6	+	10	2361	c.2166C>G	c.(2164-2166)ccC>ccG	p.P722P	PSD4_ENST00000441564.3_Silent_p.P694P	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	722	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGAACTTCCCCAAGGAGCTGC	0.537																																																0			2											94.0	91.0	92.0					2																	113951510		2203	4300	6503	113667981	SO:0001819	synonymous_variant	23550			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.2166C>G	2.37:g.113951510C>G		Somatic		Capture	Illumina GAIIx	4	113667981	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Silent	SNP	HMMPfam_Sec7,superfamily_Sec7 domain,HMMSmart_SM00222,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.P722	ENST00000245796.6	37	c.2166	CCDS33276.1	2																																																																																			-	HMMPfam_Sec7,superfamily_Sec7 domain,HMMSmart_SM00222		0.537	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSD4	protein_coding	OTTHUMT00000330789.1	C	NM_012455		113667981	+1	no_errors	NM_012455	genbank	human	validated	54_36p	silent	SNP	1.000	G
KLHL13	90293	genome.wustl.edu	37	X	117035836	117035836	+	Silent	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chrX:117035836G>A	ENST00000262820.3	-	6	2349	c.1440C>T	c.(1438-1440)ggC>ggT	p.G480G	KLHL13_ENST00000541812.1_Silent_p.G464G|KLHL13_ENST00000469946.1_Silent_p.G429G|KLHL13_ENST00000539496.1_Silent_p.G483G|KLHL13_ENST00000545703.1_Silent_p.G438G|KLHL13_ENST00000371878.1_Silent_p.G429G|KLHL13_ENST00000371882.1_Silent_p.G429G|KLHL13_ENST00000540167.1_Silent_p.G464G|KLHL13_ENST00000371876.1_Silent_p.G429G	NM_033495.3	NP_277030.2	Q9P2N7	KLH13_HUMAN	kelch-like family member 13	480					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)				NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						TTCCAGCATGGCCATAGTGGG	0.333																																																0			X											151.0	131.0	138.0					X																	117035836		2203	4300	6503	116919864	SO:0001819	synonymous_variant	90293			AB037730	CCDS14571.1, CCDS55479.1, CCDS55480.1, CCDS55481.1	Xq23-q24	2013-01-30	2013-01-30	2004-02-18	ENSG00000003096	ENSG00000003096		"""Kelch-like"", ""BTB/POZ domain containing"""	22931	protein-coding gene	gene with protein product		300655	"""BTB and kelch domain containing 2, KIAA1309"", ""kelch-like 13 (Drosophila)"""	BKLHD2, KIAA1309		10718198	Standard	NM_033495		Approved	FLJ10262	uc011mtp.2	Q9P2N7	OTTHUMG00000022252	ENST00000262820.3:c.1440C>T	X.37:g.117035836G>A		Somatic		Capture	Illumina GAIIx	4	116919864	B3KV78|B3KWM7|B7Z3S9|B7Z5P2|B7Z802|D3DWH6|Q6P2E3|Q96QI7|Q9UDN9	Silent	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,HMMPfam_BACK,superfamily_Galactose oxidase central domain,HMMSmart_SM00612,HMMPfam_Kelch_1	p.G480	ENST00000262820.3	37	c.1440	CCDS14571.1	X																																																																																			-	superfamily_Galactose oxidase central domain,HMMSmart_SM00612,HMMPfam_Kelch_1		0.333	KLHL13-201	KNOWN	basic|CCDS	protein_coding	KLHL13	protein_coding		G	NM_033495		116919864	-1	no_errors	NM_033495	genbank	human	validated	54_36p	silent	SNP	1.000	A
PHLDB1	23187	genome.wustl.edu	37	11	118486873	118486873	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr11:118486873A>C	ENST00000361417.2	+	5	713	c.302A>C	c.(301-303)aAt>aCt	p.N101T	PHLDB1_ENST00000356063.5_Missense_Mutation_p.N101T	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	101	FHA.									breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCCTGTGGCAATGCCTGCACT	0.612																																																0			11											109.0	103.0	105.0					11																	118486873		2200	4295	6495	117992083	SO:0001583	missense	23187				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.302A>C	11.37:g.118486873A>C	ENSP00000354498:p.Asn101Thr	Somatic		Capture	Illumina GAIIx	4	117992083	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	superfamily_SMAD/FHA domain,HMMPfam_FHA,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.N101T	ENST00000361417.2	37	c.302	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	A	29.4	5.003244	0.93287	.	.	ENSG00000019144	ENST00000361417;ENST00000543207;ENST00000545313;ENST00000356063	T;T	0.57752	0.38;0.38	5.76	5.76	0.90799	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	0.098537	0.64402	D	0.000002	T	0.66327	0.2778	L	0.55017	1.72	0.80722	D	1	D;D;D	0.63880	0.978;0.991;0.993	P;D;D	0.74674	0.794;0.964;0.984	T	0.61554	-0.7039	10	0.23891	T	0.37	-21.5455	15.1972	0.73100	1.0:0.0:0.0:0.0	.	101;101;101	B4DIX4;Q86UU1-2;Q86UU1	.;.;PHLB1_HUMAN	T	101	ENSP00000354498:N101T;ENSP00000348359:N101T	ENSP00000348359:N101T	N	+	2	0	PHLDB1	117992083	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.684000	0.91242	2.324000	0.78689	0.533000	0.62120	AAT	-	superfamily_SMAD/FHA domain,HMMPfam_FHA		0.612	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	protein_coding	OTTHUMT00000389279.1	A	NM_015157		117992083	+1	no_errors	NM_015157	genbank	human	validated	54_36p	missense	SNP	1.000	C
TMEM136	219902	genome.wustl.edu	37	11	120198146	120198146	+	Intron	SNP	A	A	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr11:120198146A>C	ENST00000375095.2	+	2	240				TMEM136_ENST00000529187.1_Missense_Mutation_p.H21P|TMEM136_ENST00000314475.2_Missense_Mutation_p.H21P|TMEM136_ENST00000531346.1_Intron	NM_001198671.1|NM_001198672.1|NM_001198673.1|NM_001198674.1|NM_001198675.1	NP_001185600.1|NP_001185601.1|NP_001185602.1|NP_001185603.1|NP_001185604.1	Q6ZRR5	TM136_HUMAN	transmembrane protein 136							integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|ovary(1)	4		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		TCTTTTCATCACAGGATGGCA	0.428																																																0			11											166.0	154.0	158.0					11																	120198146		2203	4299	6502	119703356	SO:0001627	intron_variant	219902			BC015232	CCDS8432.1, CCDS55792.1, CCDS55793.1	11q23.3	2006-11-24				ENSG00000181264			28280	protein-coding gene	gene with protein product						12477932	Standard	NM_174926		Approved	MGC17839	uc001pxj.3	Q6ZRR5		ENST00000375095.2:c.-1-4A>C	11.37:g.120198146A>C		Somatic		Capture	Illumina GAIIx	4	119703356	B4DGQ4|B4E230|Q8IZ79	Missense_Mutation	SNP	HMMPfam_TRAM_LAG1_CLN8	p.H21P	ENST00000375095.2	37	c.62	CCDS55793.1	11	.	.	.	.	.	.	.	.	.	.	A	11.80	1.745457	0.30955	.	.	ENSG00000181264	ENST00000314475;ENST00000529187	.	.	.	5.61	-8.75	0.00834	.	.	.	.	.	T	0.21103	0.0508	.	.	.	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16778	-1.0391	7	0.33141	T	0.24	.	6.2452	0.20813	0.2334:0.2576:0.4297:0.0793	.	21;21	Q6ZRR5-3;Q6ZRR5-4	.;.	P	21	.	ENSP00000312672:H21P	H	+	2	0	TMEM136	119703356	0.934000	0.31675	0.003000	0.11579	0.975000	0.68041	1.772000	0.38552	-1.866000	0.01145	-0.331000	0.08364	CAC	-	NULL		0.428	TMEM136-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TMEM136	protein_coding	OTTHUMT00000388045.1	A	NM_174926		119703356	+1	no_errors	NM_174926	genbank	human	provisional	54_36p	missense	SNP	0.015	C
SEMA5B	54437	genome.wustl.edu	37	3	122632161	122632161	+	Silent	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr3:122632161C>T	ENST00000357599.3	-	17	2777	c.2391G>A	c.(2389-2391)cgG>cgA	p.R797R	SEMA5B_ENST00000451055.2_Silent_p.R851R|SEMA5B_ENST00000195173.4_Silent_p.R796R	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	797					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		TGAAGCGGAACCGCTGCTCCT	0.731																																																0			3											7.0	9.0	9.0					3																	122632161		2136	4199	6335	124114851	SO:0001819	synonymous_variant	54437			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2391G>A	3.37:g.122632161C>T		Somatic		Capture	Illumina GAIIx	4	124114851	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Silent	SNP	superfamily_Sema domain,HMMPfam_Sema,HMMSmart_SM00630,HMMPfam_PSI,HMMSmart_SM00423,superfamily_Plexin repeat,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1	p.R797	ENST00000357599.3	37	c.2391	CCDS35491.1	3																																																																																			-	NULL		0.731	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	protein_coding	OTTHUMT00000277165.1	C	NM_001031702		124114851	-1	no_errors	NM_001031702	genbank	human	validated	54_36p	silent	SNP	0.944	T
BIN1	274	genome.wustl.edu	37	2	127818189	127818189	+	Intron	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:127818189C>A	ENST00000316724.5	-	11	1269				BIN1_ENST00000351659.3_Intron|BIN1_ENST00000259238.4_Silent_p.L264L|BIN1_ENST00000393040.3_Intron|BIN1_ENST00000346226.3_Intron|BIN1_ENST00000409400.1_Intron|BIN1_ENST00000393041.3_Intron|BIN1_ENST00000348750.4_Intron|BIN1_ENST00000466111.1_Intron|BIN1_ENST00000357970.3_Intron|BIN1_ENST00000376113.2_Silent_p.L264L|BIN1_ENST00000352848.3_Silent_p.L264L	NM_139343.2	NP_647593.1	O00499	BIN1_HUMAN	bridging integrator 1						cell proliferation (GO:0008283)|endocytosis (GO:0006897)|lipid tube assembly (GO:0060988)|muscle cell differentiation (GO:0042692)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of endocytosis (GO:0045807)|positive regulation of GTPase activity (GO:0043547)|regulation of cell cycle arrest (GO:0071156)|regulation of neuron differentiation (GO:0045664)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon initial segment (GO:0043194)|axon terminus (GO:0043679)|cerebellar mossy fiber (GO:0044300)|cytoplasm (GO:0005737)|I band (GO:0031674)|lipid tube (GO:0060987)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)|T-tubule (GO:0030315)|varicosity (GO:0043196)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|tau protein binding (GO:0048156)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)	24	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		TCTTTCTGCGCAGCCGCGAAA	0.632																																																0			2											117.0	109.0	112.0					2																	127818189		2203	4300	6503	127534659	SO:0001627	intron_variant	274			U68485	CCDS2137.1, CCDS2138.1, CCDS2139.1, CCDS2140.1, CCDS2141.1, CCDS2142.1, CCDS2143.1, CCDS42743.1, CCDS42744.1, CCDS46403.1	2q14	2014-09-17			ENSG00000136717	ENSG00000136717			1052	protein-coding gene	gene with protein product	"""amphiphysin II"""	601248		AMPHL		8725406, 8782822, 17676042	Standard	NM_004305		Approved	SH3P9, AMPH2	uc002tns.2	O00499	OTTHUMG00000131465	ENST00000316724.5:c.858-1458G>T	2.37:g.127818189C>A		Somatic		Capture	Illumina GAIIx	4	127534659	O00297|O00545|O43867|O60552|O60553|O60554|O60555|O75514|O75515|O75516|O75517|O75518|Q659B7|Q92944|Q99688	Silent	SNP	HMMSmart_BAR,HMMPfam_BAR,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.L264	ENST00000316724.5	37	c.792	CCDS2138.1	2																																																																																			-	NULL		0.632	BIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIN1	protein_coding	OTTHUMT00000254298.2	C	NM_139343		127534659	-1	no_errors	NM_139346	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
MCM2	4171	genome.wustl.edu	37	3	127337955	127337955	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr3:127337955G>T	ENST00000265056.7	+	13	2343	c.2099G>T	c.(2098-2100)aGc>aTc	p.S700I	MCM2_ENST00000468414.1_3'UTR	NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	700					cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						GCCAATGGCAGCGCTGCTGAG	0.632																																																0			3											37.0	32.0	34.0					3																	127337955		2203	4300	6503	128820645	SO:0001583	missense	4171			X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.2099G>T	3.37:g.127337955G>T	ENSP00000265056:p.Ser700Ile	Somatic		Capture	Illumina GAIIx	4	128820645	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	superfamily_Nucleic_acid_OB,HMMSmart_MCM,HMMPfam_MCM,superfamily_SSF52540,PatternScan_MCM_1	p.S700I	ENST00000265056.7	37	c.2099	CCDS3043.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.846|3.846	-0.032893|-0.032893	0.07543|0.07543	.|.	.|.	ENSG00000073111|ENSG00000073111	ENST00000491422|ENST00000265056;ENST00000539922;ENST00000543142	.|T	.|0.02631	.|4.22	5.61|5.61	2.52|2.52	0.30459|0.30459	.|.	.|1.518360	.|0.03083	.|N	.|0.158813	T|T	0.05777|0.05777	0.0151|0.0151	M|M	0.65320|0.65320	2|2	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.32526	.|0.374;0.017;0.032	.|B;B;B	.|0.33042	.|0.157;0.032;0.048	T|T	0.44967|0.44967	-0.9293|-0.9293	5|10	.|0.37606	.|T	.|0.19	-11.2213|-11.2213	7.8119|7.8119	0.29237|0.29237	0.5314:0.0:0.4686:0.0|0.5314:0.0:0.4686:0.0	.|.	.|750;570;700	.|F5H1E9;B4DSV5;P49736	.|.;.;MCM2_HUMAN	S|I	632|700;604;750	.|ENSP00000265056:S700I	.|ENSP00000265056:S700I	A|S	+|+	1|2	0|0	MCM2|MCM2	128820645|128820645	0.011000|0.011000	0.17503|0.17503	0.000000|0.000000	0.03702|0.03702	0.020000|0.020000	0.10135|0.10135	1.834000|1.834000	0.39171|0.39171	0.189000|0.189000	0.20188|0.20188	0.591000|0.591000	0.81541|0.81541	GCG|AGC	-	HMMSmart_MCM,HMMPfam_MCM,superfamily_SSF52540		0.632	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM2	protein_coding	OTTHUMT00000356612.1	G			128820645	+1	no_errors	NM_004526	genbank	human	reviewed	54_36p	missense	SNP	0.002	T
Unknown	0	genome.wustl.edu	37	10	131571489	131571489	+	IGR	SNP	C	C	T	rs186907985	byFrequency	TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr10:131571489C>T								RP11-109A6.3 (3790 upstream) : EBF3 (62057 downstream)																							CTGGAGGGCCCGTGAGGATCC	0.577													C|||	2	0.000399361	0.0	0.0	5008	,	,		18448	0.0		0.002	False		,,,				2504	0.0															0			10																																								131461479	SO:0001628	intergenic_variant	0																															10.37:g.131571489C>T		Somatic		Capture	Illumina GAIIx	4	131461479		Silent	SNP	NULL	p.P409		37	c.1227		10																																																																																			-	NULL	0	0.577					LOC100129103			C			131461479	+1	no_errors	XM_001714423	genbank	human	model	54_36p	silent	SNP	0.013	T
TAAR1	134864	genome.wustl.edu	37	6	132966668	132966668	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr6:132966668T>C	ENST00000275216.1	-	1	474	c.475A>G	c.(475-477)Atc>Gtc	p.I159V		NM_138327.1	NP_612200.1	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	159					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.I159L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)	18	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)|Dextroamphetamine(DB01576)|Methamphetamine(DB01577)|Propylhexedrine(DB06714)	TCCAGAAAGATCATTCCAAAT	0.393																																																1	Substitution - Missense(1)	lung(1)	6											63.0	65.0	65.0					6																	132966668		2203	4299	6502	133008361	SO:0001583	missense	134864			AY180374	CCDS5158.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146399	ENSG00000146399		"""GPCR / Class A : Trace amine associated receptors"""	17734	protein-coding gene	gene with protein product		609333	"""trace amine receptor 1"""	TRAR1		11459929, 15718104	Standard	NM_138327		Approved	TAR1, TA1	uc003qdm.1	Q96RJ0	OTTHUMG00000015583	ENST00000275216.1:c.475A>G	6.37:g.132966668T>C	ENSP00000275216:p.Ile159Val	Somatic		Capture	Illumina GAIIx	4	133008361	Q2M1W5|Q3MIH8|Q5VUQ1	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.I159V	ENST00000275216.1	37	c.475	CCDS5158.1	6	.	.	.	.	.	.	.	.	.	.	T	1.195	-0.634168	0.03584	.	.	ENSG00000146399	ENST00000275216	T	0.37235	1.21	5.93	3.57	0.40892	GPCR, rhodopsin-like superfamily (1);	0.172233	0.49916	D	0.000137	T	0.06917	0.0176	L	0.28014	0.82	0.31030	N	0.717489	P	0.40302	0.712	B	0.37508	0.252	T	0.16748	-1.0392	10	0.02654	T	1	-17.2472	8.1935	0.31383	0.0:0.2127:0.0:0.7873	.	159	Q96RJ0	TAAR1_HUMAN	V	159	ENSP00000275216:I159V	ENSP00000275216:I159V	I	-	1	0	TAAR1	133008361	0.995000	0.38212	1.000000	0.80357	0.866000	0.49608	0.518000	0.22847	1.066000	0.40716	0.454000	0.30748	ATC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.393	TAAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAAR1	protein_coding	OTTHUMT00000042259.1	T	NM_138327		133008361	-1	no_errors	NM_138327	genbank	human	provisional	54_36p	missense	SNP	0.999	C
C3orf36	80111	genome.wustl.edu	37	3	133647616	133647616	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr3:133647616T>A	ENST00000408895.2	-	1	1040	c.32A>T	c.(31-33)gAg>gTg	p.E11V		NM_025041.2	NP_079317.2	Q3SXR2	CC036_HUMAN	chromosome 3 open reading frame 36	11										breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6						TAAGCCAGCCTCAAGACCCTC	0.627																																																0			3											43.0	45.0	44.0					3																	133647616		2182	4280	6462	135130306	SO:0001583	missense	80111			AK025826	CCDS3083.1	3q22.1	2011-09-30			ENSG00000221972	ENSG00000221972			26170	protein-coding gene	gene with protein product						12477932	Standard	NM_025041		Approved	FLJ22173	uc003epz.1	Q3SXR2		ENST00000408895.2:c.32A>T	3.37:g.133647616T>A	ENSP00000386219:p.Glu11Val	Somatic		Capture	Illumina GAIIx	4	135130306	Q3SXR3|Q9H6K8	Missense_Mutation	SNP	NULL	p.E11V	ENST00000408895.2	37	c.32	CCDS3083.1	3	.	.	.	.	.	.	.	.	.	.	T	8.864	0.947546	0.18356	.	.	ENSG00000221972	ENST00000408895	.	.	.	2.21	-0.622	0.11560	.	.	.	.	.	T	0.19406	0.0466	N	0.08118	0	0.09310	N	1	P	0.45768	0.866	P	0.49276	0.605	T	0.14699	-1.0463	8	0.87932	D	0	.	4.926	0.13894	0.0:0.5197:0.0:0.4803	.	11	Q3SXR2	CC036_HUMAN	V	11	.	ENSP00000386219:E11V	E	-	2	0	C3orf36	135130306	0.001000	0.12720	0.001000	0.08648	0.025000	0.11179	-0.041000	0.12084	-0.147000	0.11254	-0.736000	0.03550	GAG	-	NULL		0.627	C3orf36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf36	protein_coding		T	NM_025041		135130306	-1	no_errors	NM_025041	genbank	human	validated	54_36p	missense	SNP	0.005	A
LCT	3938	genome.wustl.edu	37	2	136558238	136558238	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:136558238C>A	ENST00000264162.2	-	12	4815	c.4805G>T	c.(4804-4806)tGg>tTg	p.W1602L		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1602	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GGGTTCAGCCCAGTCACTGCT	0.522																																																0			2											113.0	107.0	109.0					2																	136558238		2203	4300	6503	136274708	SO:0001583	missense	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4805G>T	2.37:g.136558238C>A	ENSP00000264162:p.Trp1602Leu	Somatic		Capture	Illumina GAIIx	4	136274708	Q4ZG58	Missense_Mutation	SNP	superfamily_Glyco_hydro_cat,HMMPfam_Glyco_hydro_1,PatternScan_GLYCOSYL_HYDROL_F1_2,PatternScan_GLYCOSYL_HYDROL_F1_1	p.W1602L	ENST00000264162.2	37	c.4805	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.349804	0.95830	.	.	ENSG00000115850	ENST00000264162	T	0.31510	1.49	5.73	5.73	0.89815	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.64438	0.2598	M	0.89414	3.03	0.80722	D	1	D	0.61080	0.989	D	0.71184	0.972	T	0.70249	-0.4924	10	0.87932	D	0	-11.6774	19.9019	0.96988	0.0:1.0:0.0:0.0	.	1602	P09848	LPH_HUMAN	L	1602	ENSP00000264162:W1602L	ENSP00000264162:W1602L	W	-	2	0	LCT	136274708	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.706000	0.92434	0.563000	0.77884	TGG	-	HMMPfam_Glyco_hydro_1,superfamily_Glyco_hydro_cat		0.522	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	protein_coding	OTTHUMT00000254657.1	C	NM_002299		136274708	-1	no_errors	NM_002299	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PERP	64065	genome.wustl.edu	37	6	138428387	138428387	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr6:138428387C>T	ENST00000421351.3	-	1	261	c.91G>A	c.(91-93)Gcc>Acc	p.A31T		NM_022121.4	NP_071404.2	Q96FX8	PERP_HUMAN	PERP, TP53 apoptosis effector	31					activation of cysteine-type endopeptidase activity (GO:0097202)|amelogenesis (GO:0097186)|desmosome organization (GO:0002934)|heterotypic cell-cell adhesion (GO:0034113)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of proteolysis (GO:0045862)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(1)|lung(1)|prostate(1)	5	Breast(32;0.0799)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000878)|OV - Ovarian serous cystadenocarcinoma(155;0.000997)		CCGCGGCCGGCCAGCGCGATG	0.692																																																0			6											30.0	37.0	35.0					6																	138428387		2146	4199	6345	138470080	SO:0001583	missense	64065			AF317550	CCDS5188.1	6q24	2014-04-29			ENSG00000112378	ENSG00000112378			17637	protein-coding gene	gene with protein product	"""keratinocyte associated protein 1"""	609301				11062687	Standard	NM_022121		Approved	PIGPC1, dJ496H19.1, KCP1, THW, KRTCAP1	uc003qht.2	Q96FX8	OTTHUMG00000015668	ENST00000421351.3:c.91G>A	6.37:g.138428387C>T	ENSP00000397157:p.Ala31Thr	Somatic		Capture	Illumina GAIIx	4	138470080	B2RB73|E1P590|Q8IWS3|Q8N1J6|Q8NC16|Q9H1C5|Q9H230	Missense_Mutation	SNP	NULL	p.A31T	ENST00000421351.3	37	c.91	CCDS5188.1	6	.	.	.	.	.	.	.	.	.	.	c	13.58	2.281022	0.40394	.	.	ENSG00000112378	ENST00000421351	D	0.89050	-2.46	4.29	-4.67	0.03319	.	0.340480	0.29995	N	0.010679	T	0.69620	0.3131	L	0.52573	1.65	0.50632	D	0.99988	B	0.06786	0.001	B	0.12837	0.008	T	0.52117	-0.8618	10	0.49607	T	0.09	-10.0537	4.6517	0.12598	0.4619:0.2966:0.0:0.2415	.	31	Q96FX8	PERP_HUMAN	T	31	ENSP00000397157:A31T	ENSP00000397157:A31T	A	-	1	0	PERP	138470080	0.358000	0.24947	0.974000	0.42286	0.469000	0.32828	-0.788000	0.04614	-0.532000	0.06332	-0.265000	0.10407	GCC	-	NULL		0.692	PERP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PERP	protein_coding	OTTHUMT00000042423.2	C	NM_022121		138470080	-1	no_errors	NM_022121	genbank	human	validated	54_36p	missense	SNP	0.991	T
PCYOX1L	78991	genome.wustl.edu	37	5	148748176	148748176	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr5:148748176G>T	ENST00000274569.4	+	6	1506	c.1444G>T	c.(1444-1446)Gat>Tat	p.D482Y	PCYOX1L_ENST00000514349.1_Missense_Mutation_p.D392Y	NM_024028.3	NP_076933.3	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like	482					prenylcysteine catabolic process (GO:0030328)	extracellular region (GO:0005576)|membrane (GO:0016020)	prenylcysteine oxidase activity (GO:0001735)			breast(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGACAAGATTGATCAAAAAGA	0.552																																					Ovarian(62;1136 1477 27277 27495)											0			5											100.0	101.0	101.0					5																	148748176		2203	4300	6503	148728369	SO:0001583	missense	78991				CCDS4296.1	5q33.1	2008-02-05			ENSG00000145882	ENSG00000145882			28477	protein-coding gene	gene with protein product						12477932	Standard	NM_024028		Approved	MGC3265	uc003lqk.2	Q8NBM8	OTTHUMG00000130052	ENST00000274569.4:c.1444G>T	5.37:g.148748176G>T	ENSP00000274569:p.Asp482Tyr	Somatic		Capture	Illumina GAIIx	4	148728369	Q7Z4S2|Q8NCY5|Q8NF69|Q9BTE8|Q9BWS3	Missense_Mutation	SNP	superfamily_FAD/NAD(P)-binding domain,HMMPfam_DAO,HMMPfam_Prenylcys_lyase	p.D482Y	ENST00000274569.4	37	c.1444	CCDS4296.1	5	.	.	.	.	.	.	.	.	.	.	G	23.8	4.459010	0.84317	.	.	ENSG00000145882	ENST00000274569;ENST00000514349	T;T	0.27720	1.65;1.65	5.51	5.51	0.81932	Prenylcysteine lyase (1);	0.000000	0.85682	D	0.000000	T	0.60077	0.2241	M	0.78456	2.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.998	T	0.63756	-0.6565	10	0.87932	D	0	-42.2597	19.427	0.94746	0.0:0.0:1.0:0.0	.	364;392;482	B3KXF9;E7EVZ5;Q8NBM8	.;.;PCYXL_HUMAN	Y	482;392	ENSP00000274569:D482Y;ENSP00000428512:D392Y	ENSP00000274569:D482Y	D	+	1	0	PCYOX1L	148728369	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.835000	0.99442	2.577000	0.86979	0.561000	0.74099	GAT	-	HMMPfam_Prenylcys_lyase		0.552	PCYOX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYOX1L	protein_coding	OTTHUMT00000252331.2	G	NM_024028		148728369	+1	no_errors	NM_024028	genbank	human	provisional	54_36p	missense	SNP	1.000	T
HRNR	388697	genome.wustl.edu	37	1	152191033	152191033	+	Nonsense_Mutation	SNP	A	A	T	rs148722408	byFrequency	TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:152191033A>T	ENST00000368801.2	-	3	3147	c.3072T>A	c.(3070-3072)taT>taA	p.Y1024*	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1024					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.Y1024Y(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TATATGGGCCATAGCTGGAAG	0.602																																																1	Substitution - coding silent(1)	prostate(1)	1											152.0	168.0	163.0					1																	152191033		2203	4300	6503	150457657	SO:0001587	stop_gained	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.3072T>A	1.37:g.152191033A>T	ENSP00000357791:p.Tyr1024*	Somatic		Capture	Illumina GAIIx	4	150457657	Q5DT20|Q5U1F4	Nonsense_Mutation	SNP	superfamily_SSF47473,HMMPfam_S_100,PatternScan_S100_CABP,PatternScan_EF_HAND_1,HMMPfam_SVS_QK	p.Y1024*	ENST00000368801.2	37	c.3072	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	A	36	5.728352	0.96856	.	.	ENSG00000197915	ENST00000368801	.	.	.	2.88	-5.32	0.02722	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.272	0.43489	0.795:0.0:0.205:0.0	.	.	.	.	X	1024	.	ENSP00000357791:Y1024X	Y	-	3	2	HRNR	150457657	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.358000	0.02604	-1.947000	0.01034	-2.376000	0.00234	TAT	-	HMMPfam_SVS_QK		0.602	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	protein_coding	OTTHUMT00000034016.1	A	XM_373868		150457657	-1	no_errors	NM_001009931	genbank	human	validated	54_36p	nonsense	SNP	0.107	T
S100A9	6280	genome.wustl.edu	37	1	153333314	153333314	+	Nonstop_Mutation	SNP	A	A	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:153333314A>C	ENST00000368738.3	+	3	388	c.345A>C	c.(343-345)taA>taC	p.*115Y		NM_002965.3	NP_002956.1	P06702	S10A9_HUMAN	S100 calcium binding protein A9	0					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagy (GO:0006914)|cell-cell signaling (GO:0007267)|chemokine production (GO:0032602)|chronic inflammatory response (GO:0002544)|cytokine production (GO:0001816)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|neutrophil aggregation (GO:0070488)|neutrophil chemotaxis (GO:0030593)|positive regulation of cell growth (GO:0030307)|positive regulation of inflammatory response (GO:0050729)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of cytoskeleton organization (GO:0051493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to zinc ion (GO:0010043)|sequestering of zinc ion (GO:0032119)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	antioxidant activity (GO:0016209)|arachidonic acid binding (GO:0050544)|calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|RAGE receptor binding (GO:0050786)|signal transducer activity (GO:0004871)|Toll-like receptor 4 binding (GO:0035662)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(2)	4	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCACCCCCTAAGACCACAGTG	0.657																																																0			1											25.0	22.0	23.0					1																	153333314		2202	4300	6502	151599938	SO:0001578	stop_lost	6280			BC047681	CCDS1036.1	1q21	2013-01-10	2006-09-11		ENSG00000163220	ENSG00000163220		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10499	protein-coding gene	gene with protein product		123886	"""S100 calcium-binding protein A9 (calgranulin B)"", ""S100 calcium binding protein A9 (calgranulin B)"""	CAGB, CFAG			Standard	NM_002965		Approved	P14, MIF, NIF, LIAG, MRP14, MAC387, 60B8AG, CGLB	uc001fbq.3	P06702	OTTHUMG00000013125	ENST00000368738.3:c.345A>C	1.37:g.153333314A>C	ENSP00000357727:p.*115Tyrext*24	Somatic		Capture	Illumina GAIIx	4	151599938	D3DV36|Q6FGA1|Q9NYM0|Q9UCJ1	Nonstop_Mutation	SNP	superfamily_SSF47473,HMMPfam_S_100,HMMPfam_efhand,PatternScan_S100_CABP,PatternScan_EF_HAND_1	p.*115Y	ENST00000368738.3	37	c.345	CCDS1036.1	1	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.643830	0.00792	.	.	ENSG00000163220	ENST00000368738	.	.	.	1.23	-2.47	0.06442	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.3379	0.04252	0.472:0.2772:0.0:0.2509	.	.	.	.	Y	115	.	.	X	+	3	2	S100A9	151599938	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.183000	0.01255	-1.605000	0.01593	-0.717000	0.03617	TAA	-	NULL		0.657	S100A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A9	protein_coding	OTTHUMT00000036793.1	A	NM_002965		151599938	+1	no_errors	NM_002965	genbank	human	reviewed	54_36p	nonstop	SNP	0.001	C
IRAK1	3654	genome.wustl.edu	37	X	153284523	153284523	+	Missense_Mutation	SNP	G	G	A	rs375736059		TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chrX:153284523G>A	ENST00000369980.3	-	4	610	c.443C>T	c.(442-444)cCa>cTa	p.P148L	MIR718_ENST00000390190.2_RNA|IRAK1_ENST00000393682.1_Missense_Mutation_p.P174L|IRAK1_ENST00000477274.1_5'Flank|IRAK1_ENST00000393687.2_Missense_Mutation_p.P148L|IRAK1_ENST00000369974.2_Missense_Mutation_p.P148L|IRAK1_ENST00000429936.2_Missense_Mutation_p.P174L	NM_001025242.1|NM_001569.3	NP_001020413.1|NP_001560.2	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	148	ProST region.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|interleukin-1 receptor complex (GO:0045323)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|NF-kappaB-inducing kinase activity (GO:0004704)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(15)|ovary(2)	25	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGGGAGCCTGGAAAAGCTTC	0.612																																																0			X						G	LEU/PRO,LEU/PRO,LEU/PRO	1,3832		0,0,1,1632,568	41.0	45.0	44.0		443,443,443	4.2	0.3	X		44	0,6728		0,0,0,2428,1872	no	missense,missense,missense	IRAK1	NM_001025242.1,NM_001025243.1,NM_001569.3	98,98,98	0,0,1,4060,2440	AA,AG,A,GG,G		0.0,0.0261,0.0095	probably-damaging,probably-damaging,probably-damaging	148/683,148/634,148/713	153284523	1,10560	2201	4300	6501	152937717	SO:0001583	missense	3654			L76191	CCDS14740.1, CCDS35443.1, CCDS35444.1	Xq28	2011-07-08			ENSG00000184216	ENSG00000184216			6112	protein-coding gene	gene with protein product		300283				9374458, 8599092	Standard	XM_005274668		Approved	IRAK, pelle	uc004fjs.1	P51617	OTTHUMG00000024228	ENST00000369980.3:c.443C>T	X.37:g.153284523G>A	ENSP00000358997:p.Pro148Leu	Somatic		Capture	Illumina GAIIx	4	152937717	D3DWW3|D3DWW4|Q7Z5V4|Q96C06|Q96RL2	Missense_Mutation	SNP	superfamily_DEATH domain,HMMPfam_Death,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.P148L	ENST00000369980.3	37	c.443	CCDS14740.1	X	.	.	.	.	.	.	.	.	.	.	.	21.6	4.172096	0.78452	2.61E-4	0.0	ENSG00000184216	ENST00000369980;ENST00000369974;ENST00000393682;ENST00000444230;ENST00000393687;ENST00000429936	T;T;T;T;T;T	0.75154	-0.91;-0.86;-0.82;1.76;-0.85;-0.86	4.17	4.17	0.49024	.	0.131699	0.34828	N	0.003660	D	0.83408	0.5248	M	0.72118	2.19	0.31001	N	0.720321	D;D;D;D	0.89917	0.997;1.0;0.997;0.998	P;D;P;D	0.91635	0.879;0.999;0.88;0.959	T	0.82918	-0.0219	10	0.62326	D	0.03	-8.2978	10.8649	0.46849	0.0:0.0:1.0:0.0	.	174;148;148;148	D3YTB5;P51617-4;P51617;P51617-2	.;.;IRAK1_HUMAN;.	L	148;148;174;144;148;174	ENSP00000358997:P148L;ENSP00000358991:P148L;ENSP00000377287:P174L;ENSP00000399974:P144L;ENSP00000377291:P148L;ENSP00000392662:P174L	ENSP00000358990:P174L	P	-	2	0	IRAK1	152937717	0.998000	0.40836	0.328000	0.25416	0.345000	0.29048	2.326000	0.43849	1.931000	0.55961	0.529000	0.55759	CCA	-	NULL		0.612	IRAK1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK1	protein_coding	OTTHUMT00000061143.3	G			152937717	-1	no_errors	NM_001569	genbank	human	reviewed	54_36p	missense	SNP	0.937	A
BCAN	63827	genome.wustl.edu	37	1	156618391	156618391	+	Silent	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:156618391G>A	ENST00000329117.5	+	6	1137	c.801G>A	c.(799-801)aaG>aaA	p.K267K	BCAN_ENST00000361588.5_Silent_p.K267K|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	267	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTCCAGAGAAGCTGACATTGG	0.602																																																0			1											78.0	77.0	77.0					1																	156618391		2203	4300	6503	154885015	SO:0001819	synonymous_variant	63827			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.801G>A	1.37:g.156618391G>A		Somatic		Capture	Illumina GAIIx	4	154885015	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Silent	SNP	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin,HMMSmart_SM00406,PatternScan_IG_MHC,superfamily_C-type lectin-like,HMMSmart_SM00445,HMMPfam_Xlink,PatternScan_LINK_1,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00034,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.K267	ENST00000329117.5	37	c.801	CCDS1149.1	1																																																																																			-	HMMSmart_SM00445,HMMPfam_Xlink,superfamily_C-type lectin-like		0.602	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAN	protein_coding	OTTHUMT00000081844.2	G	NM_021948		154885015	+1	no_errors	NM_021948	genbank	human	validated	54_36p	silent	SNP	0.877	A
NES	10763	genome.wustl.edu	37	1	156642460	156642460	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:156642460T>G	ENST00000368223.3	-	4	1652	c.1520A>C	c.(1519-1521)aAa>aCa	p.K507T		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	507	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCTGTTTCTTTCTCTACCAA	0.502																																																0			1											113.0	116.0	115.0					1																	156642460		2203	4300	6503	154909084	SO:0001583	missense	10763			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.1520A>C	1.37:g.156642460T>G	ENSP00000357206:p.Lys507Thr	Somatic		Capture	Illumina GAIIx	4	154909084	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	HMMPfam_Filament,PatternScan_IF	p.K507T	ENST00000368223.3	37	c.1520	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	T	13.94	2.387086	0.42308	.	.	ENSG00000132688	ENST00000368223;ENST00000255024	D	0.88586	-2.4	5.27	2.89	0.33648	.	0.778451	0.10515	N	0.665688	T	0.76004	0.3927	M	0.64997	1.995	0.24421	N	0.994611	B	0.21905	0.062	B	0.21708	0.036	T	0.69015	-0.5257	10	0.87932	D	0	.	4.3268	0.11045	0.0:0.1771:0.1727:0.6501	.	507	P48681	NEST_HUMAN	T	507	ENSP00000357206:K507T	ENSP00000255024:K507T	K	-	2	0	NES	154909084	0.043000	0.20138	0.141000	0.22245	0.411000	0.31082	0.757000	0.26433	0.309000	0.22966	0.377000	0.23210	AAA	-	NULL		0.502	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	protein_coding	OTTHUMT00000082844.2	T	NM_006617		154909084	-1	no_errors	NM_006617	genbank	human	reviewed	54_36p	missense	SNP	0.381	G
FCRL5	83416	genome.wustl.edu	37	1	157490854	157490854	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:157490854T>C	ENST00000361835.3	-	11	2625	c.2468A>G	c.(2467-2469)aAt>aGt	p.N823S	FCRL5_ENST00000461387.1_5'UTR|FCRL5_ENST00000356953.4_Missense_Mutation_p.N823S	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	823	Ig-like C2-type 8.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CCCGAGGCCATTGTCGGCCTC	0.562																																																0			1											57.0	66.0	63.0					1																	157490854		2203	4300	6503	155757478	SO:0001583	missense	83416			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2468A>G	1.37:g.157490854T>C	ENSP00000354691:p.Asn823Ser	Somatic		Capture	Illumina GAIIx	4	155757478	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig	p.N823S	ENST00000361835.3	37	c.2468	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	T	15.58	2.876199	0.51801	.	.	ENSG00000143297	ENST00000361835;ENST00000356953	T;T	0.16457	2.34;2.34	5.25	5.25	0.73442	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.27169	0.0666	H	0.95151	3.63	0.80722	D	1	B;P	0.41102	0.015;0.738	B;B	0.43445	0.033;0.42	T	0.35400	-0.9790	9	0.72032	D	0.01	.	11.4603	0.50206	0.0:0.0:0.0:1.0	.	823;823	A6NJE8;Q96RD9	.;FCRL5_HUMAN	S	823	ENSP00000354691:N823S;ENSP00000349434:N823S	ENSP00000349434:N823S	N	-	2	0	FCRL5	155757478	0.995000	0.38212	0.590000	0.28732	0.377000	0.30045	2.010000	0.40913	2.201000	0.70794	0.528000	0.53228	AAT	-	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408		0.562	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	protein_coding	OTTHUMT00000046263.1	T	NM_031281		155757478	-1	no_errors	NM_031281	genbank	human	validated	54_36p	missense	SNP	0.931	C
AIM2	9447	genome.wustl.edu	37	1	159032487	159032487	+	Missense_Mutation	SNP	T	T	G	rs531843702	byFrequency	TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:159032487T>G	ENST00000368130.4	-	6	1315	c.1027A>C	c.(1027-1029)Aca>Cca	p.T343P		NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	343					activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					CTTCTCTATGTTTTTTTTTTG	0.398																																																0			1											174.0	138.0	150.0					1																	159032487		2203	4300	6503	157299111	SO:0001583	missense	9447			AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.1027A>C	1.37:g.159032487T>G	ENSP00000357112:p.Thr343Pro	Somatic		Capture	Illumina GAIIx	4	157299111	A8K7M7|Q5T3V9|Q96FG9	Missense_Mutation	SNP	superfamily_DEATH_like,HMMPfam_PAAD_DAPIN,HMMPfam_HIN	p.T343P	ENST00000368130.4	37	c.1027	CCDS1181.1	1	.	.	.	.	.	.	.	.	.	.	T	7.267	0.606385	0.14002	.	.	ENSG00000163568	ENST00000368130	T	0.08984	3.03	1.77	1.77	0.24775	.	.	.	.	.	T	0.01320	0.0043	N	0.08118	0	0.09310	N	1	B	0.22003	0.063	B	0.09377	0.004	T	0.47005	-0.9150	9	0.72032	D	0.01	.	5.5806	0.17248	0.0:0.0:0.0:1.0	.	343	O14862	AIM2_HUMAN	P	343	ENSP00000357112:T343P	ENSP00000357112:T343P	T	-	1	0	AIM2	157299111	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.008000	0.12788	1.066000	0.40716	0.379000	0.24179	ACA	-	NULL		0.398	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM2	protein_coding	OTTHUMT00000090341.1	T	NM_004833		157299111	-1	no_errors	NM_004833	genbank	human	reviewed	54_36p	missense	SNP	0.001	G
UAP1	6675	genome.wustl.edu	37	1	162535876	162535876	+	Silent	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:162535876C>G	ENST00000367925.1	+	1	50	c.18C>G	c.(16-18)ctC>ctG	p.L6L	UAP1_ENST00000367924.1_Silent_p.L6L|UAP1_ENST00000367926.4_Silent_p.L6L|UAP1_ENST00000271469.3_Silent_p.L6L			Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1	6					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|UDP-N-acetylglucosamine diphosphorylase activity (GO:0003977)			breast(2)|cervix(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)|skin(2)|stomach(1)	22	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TTAATGACCTCAAACTCACGT	0.413																																																0			1											95.0	90.0	92.0					1																	162535876		2203	4300	6503	160802500	SO:0001819	synonymous_variant	6675			AB011004	CCDS1240.1	1q23.2	2014-07-31	2014-07-31		ENSG00000117143	ENSG00000117143	2.7.7.23		12457	protein-coding gene	gene with protein product		602862		SPAG2		9603950, 8025165	Standard	NM_003115		Approved	AGX1, AgX	uc001gce.4	Q16222	OTTHUMG00000034419	ENST00000367925.1:c.18C>G	1.37:g.162535876C>G		Somatic		Capture	Illumina GAIIx	4	160802500	B2R6R8|Q5VTA9|Q5VTB0|Q5VTB1|Q96GM2	Silent	SNP	superfamily_Nucleotide-diphospho-sugar transferases,HMMPfam_UDPGP	p.L6	ENST00000367925.1	37	c.18		1																																																																																			-	superfamily_Nucleotide-diphospho-sugar transferases		0.413	UAP1-002	KNOWN	basic	protein_coding	UAP1	protein_coding	OTTHUMT00000083203.1	C	NM_003115		160802500	+1	no_errors	NM_003115	genbank	human	validated	54_36p	silent	SNP	0.989	G
ILDR2	387597	genome.wustl.edu	37	1	166944486	166944486	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:166944486C>T	ENST00000271417.3	-	1	75	c.20G>A	c.(19-21)aGg>aAg	p.R7K	ILDR2_ENST00000528703.1_Missense_Mutation_p.R7K|ILDR2_ENST00000529387.1_Missense_Mutation_p.R7K|ILDR2_ENST00000469934.2_Missense_Mutation_p.R7K|ILDR2_ENST00000525740.1_Missense_Mutation_p.R7K|ILDR2_ENST00000529071.1_Missense_Mutation_p.R7K|ILDR2_ENST00000526687.1_Missense_Mutation_p.R7K	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	7					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						AGAAATCCACCTCAGCAAGAC	0.512																																																0			1											123.0	114.0	117.0					1																	166944486		2203	4300	6503	165211110	SO:0001583	missense	387597			AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.20G>A	1.37:g.166944486C>T	ENSP00000271417:p.Arg7Lys	Somatic		Capture	Illumina GAIIx	4	165211110		Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IG,HMMPfam_V-set,HMMPfam_LSR	p.R7K	ENST00000271417.3	37	c.20	CCDS1256.1	1	.	.	.	.	.	.	.	.	.	.	C	8.651	0.898355	0.17686	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000529387;ENST00000469934;ENST00000529071;ENST00000526687;ENST00000528703	T;T;T;T;T;T;T	0.76060	0.59;-0.99;-0.99;0.58;0.59;-0.99;0.01	3.04	-0.258	0.12975	.	3.324780	0.01045	U	0.004372	T	0.31104	0.0786	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.14671	-1.0464	10	0.41790	T	0.15	.	5.2114	0.15318	0.0:0.3817:0.4776:0.1407	.	7	Q71H61	ILDR2_HUMAN	K	7	ENSP00000271417:R7K;ENSP00000436120:R7K;ENSP00000431316:R7K;ENSP00000437008:R7K;ENSP00000436882:R7K;ENSP00000434273:R7K;ENSP00000432750:R7K	ENSP00000271417:R7K	R	-	2	0	ILDR2	165211110	0.139000	0.22563	0.001000	0.08648	0.663000	0.39108	0.666000	0.25097	-0.331000	0.08501	0.407000	0.27541	AGG	-	NULL		0.512	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILDR2	protein_coding	OTTHUMT00000082880.2	C	NM_199351		165211110	-1	no_errors	NM_199351	genbank	human	provisional	54_36p	missense	SNP	0.002	T
SI	6476	genome.wustl.edu	37	3	164725758	164725758	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr3:164725758T>C	ENST00000264382.3	-	36	4270	c.4208A>G	c.(4207-4209)aAt>aGt	p.N1403S		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1403	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AGTTGTTCCATTTACAAAACT	0.289										HNSCC(35;0.089)																																						0			3											142.0	145.0	144.0					3																	164725758		2202	4293	6495	166208452	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4208A>G	3.37:g.164725758T>C	ENSP00000264382:p.Asn1403Ser	Somatic		Capture	Illumina GAIIx	4	166208452	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	HMMSmart_SM00018,superfamily_Trefoil,HMMPfam_Trefoil,PatternScan_P_TREFOIL,HMMPfam_Glyco_hydro_31,superfamily_(Trans)glycosidases,PatternScan_GLYCOSYL_HYDROL_F31_1,PatternScan_GLYCOSYL_HYDROL_F31_2	p.N1403S	ENST00000264382.3	37	c.4208	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	T	13.06	2.124469	0.37533	.	.	ENSG00000090402	ENST00000264382	D	0.88664	-2.41	5.06	3.9	0.45041	Glycoside hydrolase, superfamily (1);	0.270733	0.35436	N	0.003201	D	0.83275	0.5219	L	0.43923	1.385	0.35035	D	0.759122	B	0.06786	0.001	B	0.09377	0.004	T	0.81553	-0.0880	10	0.46703	T	0.11	.	9.2666	0.37645	0.0:0.0828:0.0:0.9172	.	1403	P14410	SUIS_HUMAN	S	1403	ENSP00000264382:N1403S	ENSP00000264382:N1403S	N	-	2	0	SI	166208452	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	3.930000	0.56522	0.951000	0.37770	0.477000	0.44152	AAT	-	HMMPfam_Glyco_hydro_31,superfamily_(Trans)glycosidases		0.289	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	protein_coding	OTTHUMT00000350116.1	T	NM_001041		166208452	-1	no_errors	NM_001041	genbank	human	validated	54_36p	missense	SNP	0.964	C
TTC21B	79809	genome.wustl.edu	37	2	166737246	166737246	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:166737246C>T	ENST00000243344.7	-	27	3885	c.3748G>A	c.(3748-3750)Gct>Act	p.A1250T	TTC21B_ENST00000536175.1_Missense_Mutation_p.A188T	NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	1250					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						TTCAAGGCAGCATCTGTATAT	0.368																																																0			2											124.0	114.0	117.0					2																	166737246		2203	4300	6503	166445492	SO:0001583	missense	79809			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.3748G>A	2.37:g.166737246C>T	ENSP00000243344:p.Ala1250Thr	Somatic		Capture	Illumina GAIIx	4	166445492	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	superfamily_TPR-like,HMMPfam_TPR_1,HMMSmart_SM00028	p.A1250T	ENST00000243344.7	37	c.3748	CCDS33315.1	2	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045321	0.93685	.	.	ENSG00000123607	ENST00000536175;ENST00000243344	T;T	0.73152	-0.72;-0.72	5.72	5.72	0.89469	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.044953	0.85682	D	0.000000	D	0.88381	0.6421	H	0.95043	3.615	0.80722	D	1	D	0.67145	0.996	P	0.60236	0.871	D	0.91044	0.4873	10	0.87932	D	0	-18.4163	20.2441	0.98394	0.0:1.0:0.0:0.0	.	1250	Q7Z4L5	TT21B_HUMAN	T	188;1250	ENSP00000438692:A188T;ENSP00000243344:A1250T	ENSP00000243344:A1250T	A	-	1	0	TTC21B	166445492	1.000000	0.71417	1.000000	0.80357	0.543000	0.35085	7.583000	0.82559	2.865000	0.98341	0.655000	0.94253	GCT	-	superfamily_TPR-like		0.368	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC21B	protein_coding	OTTHUMT00000333770.1	C	NM_024753		166445492	-1	no_errors	NM_024753	genbank	human	validated	54_36p	missense	SNP	1.000	T
PRRC2C	23215	genome.wustl.edu	37	1	171486773	171486773	+	Silent	SNP	T	T	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:171486773T>C	ENST00000338920.4	+	6	801	c.564T>C	c.(562-564)ccT>ccC	p.P188P	PRRC2C_ENST00000367742.3_Silent_p.P190P|PRRC2C_ENST00000426496.2_Silent_p.P188P|PRRC2C_ENST00000476522.1_3'UTR|PRRC2C_ENST00000392078.3_Silent_p.P190P|RNU6-773P_ENST00000364256.1_RNA	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	188					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										CTGGCTCACCTTCGTCATCTG	0.423																																																0			1											97.0	95.0	96.0					1																	171486773		2203	4300	6503	169753397	SO:0001819	synonymous_variant	23215			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.564T>C	1.37:g.171486773T>C		Somatic		Capture	Illumina GAIIx	4	169753397	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Silent	SNP	HMMPfam_BAT2_N	p.P188	ENST00000338920.4	37	c.564	CCDS1296.2	1																																																																																			-	NULL		0.423	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	BAT2D1	protein_coding	OTTHUMT00000314826.4	T	NM_015172		169753397	+1	no_errors	ENST00000392080	ensembl	human	known	54_36p	silent	SNP	0.186	C
PDLIM7	9260	genome.wustl.edu	37	5	176916810	176916810	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr5:176916810G>C	ENST00000355841.2	-	8	662	c.596C>G	c.(595-597)cCa>cGa	p.P199R	PDLIM7_ENST00000359895.2_Missense_Mutation_p.P165R|PDLIM7_ENST00000393551.1_Intron|PDLIM7_ENST00000356618.4_Intron	NM_005451.3	NP_005442.2	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 (enigma)	199					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|receptor-mediated endocytosis (GO:0006898)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ruffle (GO:0001726)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	10	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCTGGGGCTGGGGCTTCTGT	0.677																																																0			5											37.0	32.0	34.0					5																	176916810		2197	4296	6493	176849416	SO:0001583	missense	9260			BC001093	CCDS4422.1, CCDS4423.1, CCDS4424.1	5q35.3	2008-02-05			ENSG00000196923	ENSG00000196923			22958	protein-coding gene	gene with protein product		605903				11874232	Standard	NM_005451		Approved	ENIGMA	uc003mhc.1	Q9NR12	OTTHUMG00000130853	ENST00000355841.2:c.596C>G	5.37:g.176916810G>C	ENSP00000348099:p.Pro199Arg	Somatic		Capture	Illumina GAIIx	4	176849416	Q14250|Q5XG82|Q6NVZ5|Q96C91|Q9BXB8|Q9BXB9	Missense_Mutation	SNP	HMMPfam_PDZ,superfamily_PDZ domain-like,HMMSmart_SM00228,superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00132,HMMPfam_LIM,PatternScan_LIM_DOMAIN_1	p.P199R	ENST00000355841.2	37	c.596	CCDS4422.1	5	.	.	.	.	.	.	.	.	.	.	g	15.04	2.715687	0.48622	.	.	ENSG00000196923	ENST00000359895;ENST00000355841	T;T	0.52754	0.72;0.65	5.04	5.04	0.67666	.	0.293949	0.27084	N	0.021013	T	0.44286	0.1286	L	0.55481	1.735	0.80722	D	1	B;B	0.30973	0.003;0.302	B;B	0.28139	0.002;0.086	T	0.38520	-0.9657	10	0.36615	T	0.2	.	15.577	0.76400	0.0:0.0:1.0:0.0	.	199;165	Q9NR12;Q9NR12-2	PDLI7_HUMAN;.	R	165;199	ENSP00000352964:P165R;ENSP00000348099:P199R	ENSP00000348099:P199R	P	-	2	0	PDLIM7	176849416	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.526000	0.60566	2.345000	0.79718	0.550000	0.68814	CCA	-	NULL		0.677	PDLIM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDLIM7	protein_coding	OTTHUMT00000253423.1	G	NM_005451		176849416	-1	no_errors	NM_005451	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
RMND5B	64777	genome.wustl.edu	37	5	177571007	177571007	+	Nonsense_Mutation	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr5:177571007C>T	ENST00000515098.1	+	8	943	c.592C>T	c.(592-594)Cga>Tga	p.R198*	RMND5B_ENST00000542098.1_Nonsense_Mutation_p.R185*|RMND5B_ENST00000313386.4_Nonsense_Mutation_p.R198*			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	198	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.									endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAAGCTGCACCGACTGCACTT	0.627																																																0			5											65.0	70.0	68.0					5																	177571007		2203	4300	6503	177503613	SO:0001587	stop_gained	64777			BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.592C>T	5.37:g.177571007C>T	ENSP00000420875:p.Arg198*	Somatic		Capture	Illumina GAIIx	4	177503613	Q1HE27|Q6UVY7|Q9H6F6	Nonsense_Mutation	SNP	HMMSmart_SM00667,HMMSmart_SM00668,HMMSmart_SM00757,superfamily_RING/U-box	p.R198*	ENST00000515098.1	37	c.592	CCDS4431.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.954282	0.97139	.	.	ENSG00000145916	ENST00000313386;ENST00000515098;ENST00000542098	.	.	.	4.3	4.3	0.51218	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-10.4243	9.5223	0.39143	0.2102:0.7898:0.0:0.0	.	.	.	.	X	198;198;185	.	ENSP00000320623:R198X	R	+	1	2	RMND5B	177503613	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	3.292000	0.51772	2.215000	0.71742	0.313000	0.20887	CGA	-	HMMSmart_SM00668		0.627	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RMND5B	protein_coding	OTTHUMT00000373542.1	C	NM_022762		177503613	+1	no_errors	NM_022762	genbank	human	provisional	54_36p	nonsense	SNP	1.000	T
HNRNPA3	220988	genome.wustl.edu	37	2	178083987	178083987	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:178083987C>G	ENST00000392524.2	+	10	1334	c.1097C>G	c.(1096-1098)tCt>tGt	p.S366C	HNRNPA3_ENST00000411529.2_Missense_Mutation_p.S344C|HNRNPA3_ENST00000435711.1_Missense_Mutation_p.S366C			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	366	Gly-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						GGTTATGGATCTGGTGGTGGA	0.303																																																0			2											68.0	72.0	71.0					2																	178083987		2203	4300	6503	177792233	SO:0001583	missense	220988			AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.1097C>G	2.37:g.178083987C>G	ENSP00000376309:p.Ser366Cys	Somatic		Capture	Illumina GAIIx	4	177792233	D3DPF4|Q53RW7|Q6URK5	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.S366C	ENST00000392524.2	37	c.1097	CCDS2273.1	2	.	.	.	.	.	.	.	.	.	.	c	12.50	1.956385	0.34565	.	.	ENSG00000170144	ENST00000392524;ENST00000411529;ENST00000416446;ENST00000420139;ENST00000435711;ENST00000432457	D;D;D;T	0.85773	-1.94;-2.03;-1.94;0.73	4.73	4.73	0.59995	.	0.000000	0.46758	D	0.000278	D	0.90490	0.7021	L	0.55481	1.735	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.984	D	0.91095	0.4910	10	0.56958	D	0.05	.	18.1088	0.89528	0.0:1.0:0.0:0.0	.	344;366	B4DDB6;P51991	.;ROA3_HUMAN	C	366;344;310;311;366;103	ENSP00000376309:S366C;ENSP00000408487:S344C;ENSP00000416340:S366C;ENSP00000400688:S103C	ENSP00000376309:S366C	S	+	2	0	HNRNPA3	177792233	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.205000	0.58466	2.353000	0.79882	0.580000	0.79431	TCT	-	NULL		0.303	HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPA3	protein_coding	OTTHUMT00000255729.3	C	NM_194247		177792233	+1	no_errors	NM_194247	genbank	human	validated	54_36p	missense	SNP	1.000	G
QSOX1	5768	genome.wustl.edu	37	1	180165665	180165665	+	Silent	SNP	C	C	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:180165665C>T	ENST00000367602.3	+	12	1811	c.1737C>T	c.(1735-1737)gaC>gaT	p.D579D	QSOX1_ENST00000367600.5_Silent_p.D579D			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	579					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CAACTCTGGACCCTGGGAAGC	0.642																																																0			1											84.0	88.0	87.0					1																	180165665		2203	4300	6503	178432288	SO:0001819	synonymous_variant	5768			U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.1737C>T	1.37:g.180165665C>T		Somatic		Capture	Illumina GAIIx	4	178432288	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Silent	SNP	superfamily_Thioredoxin-like,HMMPfam_Thioredoxin,superfamily_FAD-dependent thiol oxidase,HMMPfam_Evr1_Alr	p.D579	ENST00000367602.3	37	c.1737	CCDS1337.1	1																																																																																			-	NULL		0.642	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX1	protein_coding	OTTHUMT00000085289.1	C	NM_002826		178432288	+1	no_errors	NM_002826	genbank	human	reviewed	54_36p	silent	SNP	0.001	T
TUBB8P8	102723626	genome.wustl.edu	37	3	197847231	197847231	+	IGR	SNP	C	C	T	rs565444491	byFrequency	TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr3:197847231C>T								AC073135.3 (8794 upstream) : FAM157A (32889 downstream)																							CTGTGACCCCCGTCACGGCCG	0.567													-|||	6	0.00119808	0.0038	0.0	5008	,	,		15737	0.001		0.0	False		,,,				2504	0.0															0			3																																								199331628	SO:0001628	intergenic_variant	728247																															3.37:g.197847231C>T		Somatic		Capture	Illumina GAIIx	4	199331628		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.567					LOC728247			C			199331628	+1	pseudogene	XR_015241	genbank	human	model	54_36p	rna	SNP	1.000	T
IL10	3586	genome.wustl.edu	37	1	206945708	206945708	+	Nonsense_Mutation	SNP	G	G	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:206945708G>A	ENST00000423557.1	-	1	131	c.73C>T	c.(73-75)Cag>Tag	p.Q25*	IL10_ENST00000471071.1_5'Flank	NM_000572.2	NP_000563.1	P22301	IL10_HUMAN	interleukin 10	25					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|defense response to bacterium (GO:0042742)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|leukocyte chemotaxis (GO:0030595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of chronic inflammatory response to antigenic stimulus (GO:0002875)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interferon-alpha biosynthetic process (GO:0045355)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of myeloid dendritic cell activation (GO:0030886)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor biosynthetic process (GO:0032800)|regulation of gene expression (GO:0010468)|regulation of isotype switching (GO:0045191)|regulation of sensory perception of pain (GO:0051930)|response to activity (GO:0014823)|response to carbon monoxide (GO:0034465)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to inactivity (GO:0014854)|response to insulin (GO:0032868)|response to molecule of bacterial origin (GO:0002237)|type 2 immune response (GO:0042092)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-10 receptor binding (GO:0005141)			endometrium(1)|large_intestine(6)|lung(4)|prostate(1)	12	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			TTCTCAGACTGGGTGCCCTGG	0.557																																																0			1											110.0	89.0	96.0					1																	206945708		2203	4300	6503	205012331	SO:0001587	stop_gained	3586			M57627	CCDS1467.1	1q31-q32	2011-07-14			ENSG00000136634	ENSG00000136634		"""Interleukins and interleukin receptors"""	5962	protein-coding gene	gene with protein product	"""cytokine synthesis inhibitory factor"", ""T-cell growth inhibitory factor"""	124092				9162098	Standard	NM_000572		Approved	CSIF, TGIF, IL10A, IL-10	uc001hen.1	P22301	OTTHUMG00000036386	ENST00000423557.1:c.73C>T	1.37:g.206945708G>A	ENSP00000412237:p.Gln25*	Somatic		Capture	Illumina GAIIx	4	205012331		Nonsense_Mutation	SNP	HMMPfam_IL10,superfamily_4-helical cytokines,HMMSmart_SM00188,PatternScan_INTERLEUKIN_10	p.Q25*	ENST00000423557.1	37	c.73	CCDS1467.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.976282	0.74360	.	.	ENSG00000136634	ENST00000423557	.	.	.	5.13	4.22	0.49857	.	1.344010	0.04241	N	0.336953	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-0.0214	10.3465	0.43909	0.0931:0.0:0.9069:0.0	.	.	.	.	X	25	.	ENSP00000412237:Q25X	Q	-	1	0	IL10	205012331	0.010000	0.17322	0.010000	0.14722	0.498000	0.33706	1.727000	0.38095	1.484000	0.48361	0.655000	0.94253	CAG	-	HMMPfam_IL10		0.557	IL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL10	protein_coding	OTTHUMT00000088564.3	G	NM_000572		205012331	-1	no_errors	NM_000572	genbank	human	reviewed	54_36p	nonsense	SNP	0.064	A
FN1	2335	genome.wustl.edu	37	2	216288916	216288916	+	Missense_Mutation	SNP	G	G	A	rs201876289		TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:216288916G>A	ENST00000359671.1	-	8	1434	c.1169C>T	c.(1168-1170)tCg>tTg	p.S390L	FN1_ENST00000336916.4_Missense_Mutation_p.S390L|FN1_ENST00000346544.3_Missense_Mutation_p.S390L|FN1_ENST00000421182.1_Missense_Mutation_p.S390L|FN1_ENST00000345488.5_Missense_Mutation_p.S390L|FN1_ENST00000357867.4_Missense_Mutation_p.S390L|FN1_ENST00000446046.1_Missense_Mutation_p.S390L|FN1_ENST00000356005.4_Missense_Mutation_p.S390L|FN1_ENST00000354785.4_Missense_Mutation_p.S390L|FN1_ENST00000443816.1_Missense_Mutation_p.S390L|FN1_ENST00000323926.6_Missense_Mutation_p.S390L|FN1_ENST00000432072.2_Missense_Mutation_p.S390L|FN1_ENST00000357009.2_Missense_Mutation_p.S390L|FN1_ENST00000426059.1_Missense_Mutation_p.S390L			P02751	FINC_HUMAN	fibronectin 1	390	Collagen-binding.|Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CTCATAATTCGAAGTTGTGCT	0.512																																																0			2											181.0	146.0	158.0					2																	216288916		2203	4300	6503	215997161	SO:0001583	missense	2335				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.1169C>T	2.37:g.216288916G>A	ENSP00000352696:p.Ser390Leu	Somatic		Capture	Illumina GAIIx	4	215997161	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	superfamily_Fibronectin type I module,HMMPfam_fn1,PatternScan_FN1_1,HMMSmart_SM00058,PatternScan_EGF_1,superfamily_Kringle-like,HMMSmart_SM00059,HMMPfam_fn2,PatternScan_FN2_1,HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,PatternScan_ALDEHYDE_DEHYDR_GLU	p.S390L	ENST00000359671.1	37	c.1169		2	.	.	.	.	.	.	.	.	.	.	G	34	5.353524	0.95830	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.97	5.09	0.68999	.	0.093361	0.46758	D	0.000264	T	0.66577	0.2803	L	0.56769	1.78	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.988;0.988;0.991;1.0;0.999;0.988;0.988;0.999	D;D;D;B;B;P;D;P;B;B;D	0.91635	0.999;0.991;0.989;0.383;0.383;0.517;0.999;0.875;0.383;0.383;0.993	T	0.70539	-0.4844	10	0.87932	D	0	.	17.1998	0.86902	0.0:0.1261:0.8739:0.0	.	390;390;390;390;390;390;390;390;390;390;390	E9PG29;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.	L	390	ENSP00000394423:S390L;ENSP00000323534:S390L;ENSP00000338200:S390L;ENSP00000350534:S390L;ENSP00000346839:S390L;ENSP00000352696:S390L;ENSP00000265312:S390L;ENSP00000273049:S390L;ENSP00000349509:S390L;ENSP00000410422:S390L;ENSP00000415018:S390L;ENSP00000399538:S390L;ENSP00000348285:S390L;ENSP00000398907:S390L	ENSP00000265313:S390L	S	-	2	0	FN1	215997161	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	6.333000	0.72939	1.513000	0.48852	0.655000	0.94253	TCG	-	superfamily_Kringle-like,HMMSmart_SM00059,HMMPfam_fn2,PatternScan_FN2_1		0.512	FN1-204	KNOWN	basic	protein_coding	FN1	protein_coding		G	NM_212476		215997161	-1	no_errors	NM_212482	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SPATA17	128153	genome.wustl.edu	37	1	217955521	217955521	+	Silent	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:217955521C>A	ENST00000366933.4	+	8	784	c.729C>A	c.(727-729)ccC>ccA	p.P243P	RP11-415L24.1_ENST00000415765.1_RNA	NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	243						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		GTCAGGGGCCCTTCCGAGATA	0.448																																																0			1											66.0	70.0	69.0					1																	217955521		2203	4300	6503	216022144	SO:0001819	synonymous_variant	128153			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.729C>A	1.37:g.217955521C>A		Somatic		Capture	Illumina GAIIx	4	216022144	A5D6N2	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00015,HMMPfam_IQ	p.P243	ENST00000366933.4	37	c.729	CCDS1519.1	1																																																																																			-	NULL		0.448	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA17	protein_coding	OTTHUMT00000092433.2	C	NM_138796		216022144	+1	no_errors	NM_138796	genbank	human	provisional	54_36p	silent	SNP	0.998	A
SLC11A1	6556	genome.wustl.edu	37	2	219259733	219259733	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:219259733A>T	ENST00000233202.6	+	15	1968	c.1628A>T	c.(1627-1629)gAc>gTc	p.D543V	SLC11A1_ENST00000539932.1_Missense_Mutation_p.D425V	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	543			D -> N (associated with susceptibility to infection with Mycobacterium ulcerans; dbSNP:rs17235409). {ECO:0000269|PubMed:7717395}.		activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTGAAGAGGACCAGAAAGGG	0.642																																																0			2											39.0	32.0	35.0					2																	219259733		2203	4300	6503	218967977	SO:0001583	missense	6556			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.1628A>T	2.37:g.219259733A>T	ENSP00000233202:p.Asp543Val	Somatic		Capture	Illumina GAIIx	4	218967977	C0H5Y3	Missense_Mutation	SNP	HMMPfam_Nramp	p.D543V	ENST00000233202.6	37	c.1628	CCDS2415.1	2	.	.	.	.	.	.	.	.	.	.	A	13.03	2.116512	0.37339	.	.	ENSG00000018280	ENST00000233202;ENST00000539932	T;T	0.22336	1.96;1.96	5.67	-3.15	0.05233	.	1.151050	0.06269	N	0.695294	T	0.11281	0.0275	N	0.22421	0.69	0.09310	N	1	B;B	0.20164	0.042;0.017	B;B	0.19946	0.027;0.027	T	0.36841	-0.9731	10	0.59425	D	0.04	0.034	0.2496	0.00203	0.3321:0.1438:0.2454:0.2787	.	425;543	C0H5Y3;P49279	.;NRAM1_HUMAN	V	543;425	ENSP00000233202:D543V;ENSP00000443435:D425V	ENSP00000233202:D543V	D	+	2	0	SLC11A1	218967977	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.233000	0.17911	-0.418000	0.07450	-0.379000	0.06801	GAC	-	NULL		0.642	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC11A1	protein_coding	OTTHUMT00000195076.2	A	NM_000578		218967977	+1	no_errors	NM_000578	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
TP53BP2	7159	genome.wustl.edu	37	1	223990521	223990521	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:223990521T>C	ENST00000343537.7	-	8	1199	c.908A>G	c.(907-909)gAa>gGa	p.E303G	TP53BP2_ENST00000391878.2_Missense_Mutation_p.E174G|TP53BP2_ENST00000391879.2_5'Flank|TP53BP2_ENST00000498843.1_5'Flank	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	297					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GACTGCCACTTCTGAATTACG	0.433																																																0			1											183.0	173.0	176.0					1																	223990521		2203	4300	6503	222057144	SO:0001583	missense	7159			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.908A>G	1.37:g.223990521T>C	ENSP00000341957:p.Glu303Gly	Somatic		Capture	Illumina GAIIx	4	222057144	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank,HMMPfam_SH3_1,HMMSmart_SH3	p.E303G	ENST00000343537.7	37	c.908	CCDS44319.1	1	.	.	.	.	.	.	.	.	.	.	T	33	5.272966	0.95429	.	.	ENSG00000143514	ENST00000391878;ENST00000343537	T;T	0.33654	1.4;1.4	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.63931	0.2553	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.993	T	0.70040	-0.4981	10	0.87932	D	0	.	15.7073	0.77594	0.0:0.0:0.0:1.0	.	303;297	B4DG66;Q13625	.;ASPP2_HUMAN	G	174;303	ENSP00000375750:E174G;ENSP00000341957:E303G	ENSP00000341957:E303G	E	-	2	0	TP53BP2	222057144	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.974000	0.88039	2.098000	0.63641	0.533000	0.62120	GAA	-	NULL		0.433	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53BP2	protein_coding	OTTHUMT00000090985.3	T	NM_001031685, NM_005426		222057144	-1	no_errors	NM_001031685	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MFF	56947	genome.wustl.edu	37	2	228217244	228217244	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:228217244G>C	ENST00000353339.3	+	9	1208	c.767G>C	c.(766-768)gGt>gCt	p.G256A	MFF_ENST00000337110.7_Intron|MFF_ENST00000476924.1_Intron|MFF_ENST00000409565.1_Intron|MFF_ENST00000392059.1_Missense_Mutation_p.G256A|MFF_ENST00000354503.6_Intron|MFF_ENST00000304593.9_Missense_Mutation_p.G205A|MFF_ENST00000409616.1_Missense_Mutation_p.G152A|MFF_ENST00000524634.1_Intron|MFF_ENST00000349901.7_Missense_Mutation_p.G152A	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	256					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)			breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						GTGTTGCGTGGTGGGTCTGCT	0.423																																																0			2											111.0	101.0	104.0					2																	228217244		2203	4300	6503	227925488	SO:0001583	missense	56947			AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.767G>C	2.37:g.228217244G>C	ENSP00000302037:p.Gly256Ala	Somatic		Capture	Illumina GAIIx	4	227925488	Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Missense_Mutation	SNP	HMMPfam_DUF800	p.G256A	ENST00000353339.3	37	c.767	CCDS2465.1	2	.	.	.	.	.	.	.	.	.	.	G	29.4	5.003780	0.93287	.	.	ENSG00000168958	ENST00000304593;ENST00000353339;ENST00000409616;ENST00000349901;ENST00000392059	T;T	0.35048	1.33;1.33	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.55369	0.1916	L	0.56769	1.78	0.58432	D	0.999999	B;D;D	0.89917	0.044;1.0;0.996	B;D;P	0.87578	0.026;0.998;0.905	T	0.40270	-0.9572	10	0.06365	T	0.9	-15.7951	20.8598	0.99761	0.0:0.0:1.0:0.0	.	152;205;256	Q9GZY8-5;Q9GZY8-2;Q9GZY8	.;.;MFF_HUMAN	A	205;256;152;152;256	ENSP00000302037:G256A;ENSP00000375912:G256A	ENSP00000304898:G205A	G	+	2	0	MFF	227925488	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.473000	0.73572	2.937000	0.99478	0.650000	0.86243	GGT	-	HMMPfam_DUF800		0.423	MFF-001	KNOWN	basic|CCDS	protein_coding	MFF	protein_coding	OTTHUMT00000256887.2	G	NM_020194		227925488	+1	no_errors	NM_020194	genbank	human	provisional	54_36p	missense	SNP	1.000	C
PGBD5	79605	genome.wustl.edu	37	1	230472976	230472976	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:230472976T>A	ENST00000525115.1	-	4	769	c.746A>T	c.(745-747)aAg>aTg	p.K249M	PGBD5_ENST00000391860.1_Missense_Mutation_p.K203M|PGBD5_ENST00000530424.1_5'Flank|PGBD5_ENST00000321327.2_Missense_Mutation_p.K348M			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	249						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GAGCTGGGGCTTATTCTTCAG	0.572																																																0			1											64.0	56.0	58.0					1																	230472976		2203	4300	6503	228539599	SO:0001583	missense	79605			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.746A>T	1.37:g.230472976T>A	ENSP00000431404:p.Lys249Met	Somatic		Capture	Illumina GAIIx	4	228539599	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	NULL	p.K348M	ENST00000525115.1	37	c.1043		1	.	.	.	.	.	.	.	.	.	.	t	20.1	3.934375	0.73442	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.18502	2.21;2.21;2.21	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.27629	0.0679	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04128	-1.0975	10	0.31617	T	0.26	-34.1128	15.0639	0.71977	0.0:0.0:0.0:1.0	.	249	Q8N414	PGBD5_HUMAN	M	203;348;249	ENSP00000375733:K203M;ENSP00000322530:K348M;ENSP00000431404:K249M	ENSP00000322530:K348M	K	-	2	0	PGBD5	228539599	1.000000	0.71417	1.000000	0.80357	0.554000	0.35429	7.767000	0.85331	1.950000	0.56595	0.477000	0.44152	AAG	-	NULL		0.572	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	PGBD5	protein_coding	OTTHUMT00000382617.1	T	NM_024554		228539599	-1	no_errors	NM_024554	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DGKD	8527	genome.wustl.edu	37	2	234366988	234366988	+	Missense_Mutation	SNP	G	G	C	rs200902302		TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:234366988G>C	ENST00000264057.2	+	22	2651	c.2639G>C	c.(2638-2640)aGc>aCc	p.S880T	DGKD_ENST00000409813.3_Missense_Mutation_p.S836T	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	880					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GTGTTCGGCAGCATGCAGATG	0.597																																																0			2											142.0	101.0	115.0					2																	234366988		2203	4300	6503	234031727	SO:0001583	missense	8527			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2639G>C	2.37:g.234366988G>C	ENSP00000264057:p.Ser880Thr	Somatic		Capture	Illumina GAIIx	4	234031727	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,HMMPfam_DAGK_cat,HMMSmart_SM00046,HMMPfam_DAGK_acc,HMMSmart_SM00045,superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_2	p.S880T	ENST00000264057.2	37	c.2639	CCDS2504.1	2	.	.	.	.	.	.	.	.	.	.	G	25.3	4.623349	0.87460	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.29655	1.56;1.56	3.51	3.51	0.40186	Diacylglycerol kinase, accessory domain (2);	0.052045	0.85682	N	0.000000	T	0.41236	0.1150	L	0.35854	1.095	0.43145	D	0.994907	P;P	0.50272	0.724;0.933	B;P	0.58391	0.263;0.838	T	0.37776	-0.9691	10	0.49607	T	0.09	.	16.3329	0.83049	0.0:0.0:1.0:0.0	.	836;880	Q16760-2;Q16760	.;DGKD_HUMAN	T	880;836	ENSP00000264057:S880T;ENSP00000386455:S836T	ENSP00000264057:S880T	S	+	2	0	DGKD	234031727	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.623000	0.98386	2.276000	0.75962	0.555000	0.69702	AGC	-	HMMPfam_DAGK_acc,HMMSmart_SM00045		0.597	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	protein_coding	OTTHUMT00000257072.2	G	NM_003648		234031727	+1	no_errors	NM_152879	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
GPC1	2817	genome.wustl.edu	37	2	241402904	241402904	+	Silent	SNP	G	G	C	rs375213101		TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr2:241402904G>C	ENST00000264039.2	+	4	1106	c.858G>C	c.(856-858)ctG>ctC	p.L286L		NM_002081.2	NP_002072.2	P35052	GPC1_HUMAN	glypican 1	286					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|myelin assembly (GO:0032288)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|phototransduction, visible light (GO:0007603)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|retinoid metabolic process (GO:0001523)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|laminin binding (GO:0043236)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	9		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)		AGGCCGACCTGGACGCCGAGT	0.682																																																0			2											56.0	58.0	58.0					2																	241402904		2201	4300	6501	241051577	SO:0001819	synonymous_variant	2817			AK095397	CCDS2534.1	2q35-q37	2008-02-05			ENSG00000063660	ENSG00000063660		"""Proteoglycans / Cell Surface : Glypicans"""	4449	protein-coding gene	gene with protein product	"""glypican proteoglycan 1"""	600395				7774946	Standard	NM_002081		Approved	glypican	uc002vyw.4	P35052	OTTHUMG00000133349	ENST00000264039.2:c.858G>C	2.37:g.241402904G>C		Somatic		Capture	Illumina GAIIx	4	241051577	B3KTD1|Q53QM4	Silent	SNP	HMMPfam_Glypican,PatternScan_GLYPICAN	p.L286	ENST00000264039.2	37	c.858	CCDS2534.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.660|9.660	1.143794|1.143794	0.21205|0.21205	.|.	.|.	ENSG00000063660|ENSG00000063660	ENST00000420138;ENST00000455111|ENST00000425056	.|.	.|.	.|.	3.87|3.87	2.02|2.02	0.26589|0.26589	.|.	.|.	.|.	.|.	.|.	T|T	0.54647|0.54647	0.1871|0.1871	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.44772|0.44772	-0.9306|-0.9306	4|4	.|.	.|.	.|.	-18.8866|-18.8866	6.8826|6.8826	0.24181|0.24181	0.1059:0.1925:0.7016:0.0|0.1059:0.1925:0.7016:0.0	.|.	.|.	.|.	.|.	R|S	326;31|282	.|.	.|.	G|W	+|+	1|2	0|0	GPC1|GPC1	241051577|241051577	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.862000|0.862000	0.49288|0.49288	0.352000|0.352000	0.20113|0.20113	0.402000|0.402000	0.25451|0.25451	0.478000|0.478000	0.44815|0.44815	GGA|TGG	-	HMMPfam_Glypican		0.682	GPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC1	protein_coding	OTTHUMT00000257179.3	G	NM_002081		241051577	+1	no_errors	NM_002081	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
HNRNPU	3192	genome.wustl.edu	37	1	245018790	245018790	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2649-01A-01D-1526-09	TCGA-23-2649-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	ec4811e0-474e-424b-80a2-6ff67942d858	f9d52994-6177-4fed-9b86-d69514e13741	g.chr1:245018790C>A	ENST00000283179.9	-	12	2451	c.2288G>T	c.(2287-2289)gGt>gTt	p.G763V	HNRNPU_ENST00000444376.2_Missense_Mutation_p.G744V|HNRNPU-AS1_ENST00000475997.1_RNA|HNRNPU-AS1_ENST00000489705.1_RNA			Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)	763	Gly-rich.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasmic ribonucleoprotein granule (GO:0036464)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			TGAGTAACTACCACGGCCAGG	0.502																																					NSCLC(33;911 1010 3329 23631 49995)											0			1											163.0	162.0	162.0					1																	245018790		2203	4300	6503	243085413	SO:0001583	missense	3192			X65488	CCDS31081.1, CCDS41479.1	1q44	2011-10-24		2007-08-16	ENSG00000153187	ENSG00000153187			5048	protein-coding gene	gene with protein product		602869		HNRPU		7509195, 8068679	Standard	NM_031844		Approved	SAF-A, hnRNPU	uc001iaz.1	Q00839	OTTHUMG00000040396	ENST00000283179.9:c.2288G>T	1.37:g.245018790C>A	ENSP00000283179:p.Gly763Val	Somatic		Capture	Illumina GAIIx	4	243085413	O75507|Q8N174|Q96HY9|Q9BQ09	Missense_Mutation	SNP	superfamily_SAP domain,HMMPfam_SAP,HMMSmart_SM00513,HMMSmart_SM00449,HMMPfam_SPRY,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.G763V	ENST00000283179.9	37	c.2288	CCDS41479.1	1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.258810	0.80246	.	.	ENSG00000153187	ENST00000444376;ENST00000283179;ENST00000427948	T;T	0.52295	0.68;0.67	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.62183	0.2407	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.994;0.994	T	0.63506	-0.6622	10	0.62326	D	0.03	-10.0637	19.4189	0.94712	0.0:1.0:0.0:0.0	.	744;763;487	Q00839-2;Q00839;Q5RI19	.;HNRPU_HUMAN;.	V	744;763;688	ENSP00000393151:G744V;ENSP00000283179:G763V	ENSP00000283179:G763V	G	-	2	0	HNRNPU	243085413	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	5.944000	0.70219	2.584000	0.87258	0.591000	0.81541	GGT	-	NULL		0.502	HNRNPU-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPU	protein_coding	OTTHUMT00000097163.3	C	NM_031844		243085413	-1	no_errors	NM_031844	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
