#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ANKRD35	148741	genome.wustl.edu	37	1	145561130	145561130	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr1:145561130C>G	ENST00000355594.4	+	10	905	c.818C>G	c.(817-819)cCt>cGt	p.P273R	ANKRD35_ENST00000544626.1_3'UTR	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	273								p.P273R(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGTTCTCCTCCTAAGAGCTCA	0.547																																					Melanoma(9;127 754 22988 51047)											1	Substitution - Missense(1)	ovary(1)	1											38.0	45.0	42.0					1																	145561130		2203	4300	6503	144272487	SO:0001583	missense	148741			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.818C>G	1.37:g.145561130C>G	ENSP00000347802:p.Pro273Arg	Somatic		Capture	Illumina GAIIx	4	144272487	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	-	p.P273R	ENST00000355594.4	37	c.818	CCDS919.1	1	.	.	.	.	.	.	.	.	.	.	C	0.410	-0.913983	0.02415	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.68479	-0.33	5.77	4.86	0.63082	.	0.119641	0.38381	N	0.001719	T	0.46737	0.1408	L	0.29908	0.895	0.39258	D	0.964157	P	0.41366	0.747	B	0.43508	0.422	T	0.55373	-0.8151	10	0.52906	T	0.07	-6.0623	13.2862	0.60245	0.0:0.8414:0.1586:0.0	.	273	Q8N283	ANR35_HUMAN	R	182;273	ENSP00000347802:P273R	ENSP00000347802:P273R	P	+	2	0	ANKRD35	144272487	0.079000	0.21365	0.186000	0.23195	0.084000	0.17831	0.432000	0.21461	1.575000	0.49775	-0.150000	0.13652	CCT	-	NULL		0.547	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD35	protein_coding	OTTHUMT00000038515.1	C	NM_144698		144272487	1	no_errors	NM_144698	genbank	human	validated	54_36p	missense	SNP	0.45	G
CAP1	10487	genome.wustl.edu	37	1	40530176	40530176	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr1:40530176A>G	ENST00000372797.3	+	6	1030	c.469A>G	c.(469-471)Atg>Gtg	p.M157V	CAP1_ENST00000372802.1_Missense_Mutation_p.M156V|CAP1_ENST00000372792.2_Missense_Mutation_p.M157V|CAP1_ENST00000340450.3_Missense_Mutation_p.M156V|CAP1_ENST00000372805.3_Missense_Mutation_p.M157V|CAP1_ENST00000372798.1_Missense_Mutation_p.M156V	NM_001105530.1|NM_006367.3	NP_001099000|NP_006358	Q13114	TRAF3_HUMAN	CAP, adenylate cyclase-associated protein 1 (yeast)	308					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.M157V(1)		endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12	Lung NSC(20;5.03e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;4.63e-18)|Epithelial(16;1.27e-16)|all cancers(16;2.3e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGTGAAAGAAATGAATGATGC	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											111.0	106.0	108.0					1																	40530176		1864	4101	5965	40302763	SO:0001583	missense	10487			L12168	CCDS41309.1	1p34.3	2010-07-13			ENSG00000131236	ENSG00000131236			20040	protein-coding gene	gene with protein product						1406678, 8761950	Standard	NM_006367		Approved	CAP	uc001cey.4	Q01518	OTTHUMG00000004493	ENST00000372797.3:c.469A>G	1.37:g.40530176A>G	ENSP00000361883:p.Met157Val	Somatic		Capture	Illumina GAIIx	4	40302763	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Missense_Mutation	SNP	-	p.M157V	ENST00000372797.3	37	c.469	CCDS41309.1	1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.972690	0.74246	.	.	ENSG00000131236	ENST00000372797;ENST00000372802;ENST00000449311;ENST00000421589;ENST00000414281;ENST00000420216;ENST00000372792;ENST00000538246;ENST00000372798;ENST00000340450;ENST00000372805;ENST00000435719;ENST00000427843;ENST00000424977;ENST00000417287	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48;2.48	5.15	4.0	0.46444	Adenylate cyclase-associated CAP, N-terminal (2);	0.035871	0.85682	D	0.000000	T	0.37571	0.1008	M	0.83223	2.63	0.80722	D	1	D;D	0.76494	0.999;0.994	D;D	0.72075	0.976;0.966	T	0.19257	-1.0311	10	0.87932	D	0	-13.4392	10.5559	0.45117	0.8553:0.0:0.0:0.1447	.	104;157	E7ENY9;Q01518	.;CAP1_HUMAN	V	157;156;157;157;157;157;157;134;156;156;157;156;157;157;157	ENSP00000361883:M157V;ENSP00000361888:M156V;ENSP00000398475:M157V;ENSP00000403198:M157V;ENSP00000408561:M157V;ENSP00000410586:M157V;ENSP00000361878:M157V;ENSP00000361884:M156V;ENSP00000344832:M156V;ENSP00000361891:M157V;ENSP00000412859:M156V;ENSP00000413656:M157V;ENSP00000413383:M157V;ENSP00000400943:M157V	ENSP00000344832:M156V	M	+	1	0	CAP1	40302763	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.312000	0.59154	0.786000	0.33708	-0.341000	0.08007	ATG	-	NULL		0.418	CAP1-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	CAP1	protein_coding	OTTHUMT00000013109.1	A	NM_006367		40302763	1	no_errors	NM_001105530	genbank	human	reviewed	54_36p	missense	SNP	1	G
GBP7	388646	genome.wustl.edu	37	1	89637595	89637595	+	Silent	SNP	T	T	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr1:89637595T>A	ENST00000294671.2	-	2	162	c.24A>T	c.(22-24)ccA>ccT	p.P8P		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	8	GTPase domain (Globular). {ECO:0000250}.					membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.P8P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		ACACTGGGCCTGGCATGTGGA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	1											124.0	122.0	122.0					1																	89637595		2203	4300	6503	89410183	SO:0001819	synonymous_variant	388646			AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.24A>T	1.37:g.89637595T>A		Somatic		Capture	Illumina GAIIx	4	89410183		Silent	SNP	-	p.P8	ENST00000294671.2	37	c.24	CCDS720.1	1																																																																																			-	NULL		0.478	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP7	protein_coding	OTTHUMT00000029401.1	T	NM_207398		89410183	-1	no_errors	NM_207398	genbank	human	validated	54_36p	silent	SNP		A
SLC45A3	85414	genome.wustl.edu	37	1	205631993	205631993	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr1:205631993G>A	ENST00000367145.3	-	3	1221	c.926C>T	c.(925-927)cCg>cTg	p.P309L	SLC45A3_ENST00000460934.1_5'Flank	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	309					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.P309L(1)	SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			CTCGGTGCCCGGCTCAGCTCT	0.637			T	"""ETV1, ETV5, ELK4, ERG"""	prostate																																		Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	1	Substitution - Missense(1)	ovary(1)	1											39.0	42.0	41.0					1																	205631993		2203	4300	6503	203898616	SO:0001583	missense	85414			AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.926C>T	1.37:g.205631993G>A	ENSP00000356113:p.Pro309Leu	Somatic		Capture	Illumina GAIIx	4	203898616	A8K2U9	Missense_Mutation	SNP	HMMPfam_MFS_1;superfamily_MFS general substrate transporter	p.P309L	ENST00000367145.3	37	c.926	CCDS1458.1	1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109833	0.37242	.	.	ENSG00000158715	ENST00000367145	D	0.89939	-2.59	5.13	4.21	0.49690	Major facilitator superfamily domain, general substrate transporter (1);	0.050463	0.85682	N	0.000000	D	0.91707	0.7378	L	0.61218	1.895	0.54753	D	0.999987	D;D	0.71674	0.998;0.998	P;P	0.57204	0.815;0.815	D	0.89958	0.4084	10	0.38643	T	0.18	-4.63	16.3775	0.83410	0.0716:0.0:0.9284:0.0	.	309;309	A8K2U9;Q96JT2	.;S45A3_HUMAN	L	309	ENSP00000356113:P309L	ENSP00000356113:P309L	P	-	2	0	SLC45A3	203898616	1.000000	0.71417	0.996000	0.52242	0.128000	0.20619	5.398000	0.66308	0.572000	0.29383	-0.797000	0.03246	CCG	-	NULL		0.637	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A3	protein_coding	OTTHUMT00000090619.1	G	NM_033102		203898616	-1	no_errors	NM_033102	genbank	human	validated	54_36p	missense	SNP	1	A
CCDC88B	283234	genome.wustl.edu	37	11	64120233	64120233	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr11:64120233C>T	ENST00000356786.5	+	20	3418	c.3374C>T	c.(3373-3375)gCc>gTc	p.A1125V	CCDC88B_ENST00000301897.4_5'UTR|CCDC88B_ENST00000359902.2_Missense_Mutation_p.A277V|CCDC88B_ENST00000463837.1_3'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	1125						membrane (GO:0016020)		p.A1125V(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CAGCTGCAGGCCCAGCGGGCC	0.672																																																1	Substitution - Missense(1)	ovary(1)	11											27.0	31.0	30.0					11																	64120233		2199	4287	6486	63876809	SO:0001583	missense	283234			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.3374C>T	11.37:g.64120233C>T	ENSP00000349238:p.Ala1125Val	Somatic		Capture	Illumina GAIIx	4	63876809	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases	p.A1125V	ENST00000356786.5	37	c.3374	CCDS8072.2	11	.	.	.	.	.	.	.	.	.	.	c	17.58	3.425410	0.62733	.	.	ENSG00000168071	ENST00000356786;ENST00000359902	T;T	0.48201	1.82;0.82	3.95	3.95	0.45737	.	.	.	.	.	T	0.57695	0.2071	L	0.51422	1.61	0.80722	D	1	D;D;D	0.67145	0.996;0.991;0.996	D;P;D	0.63381	0.914;0.86;0.914	T	0.59380	-0.7465	9	0.56958	D	0.05	.	11.6616	0.51349	0.0:1.0:0.0:0.0	.	1125;261;1125	B2RTU8;A6NC98-5;A6NC98	.;.;CC88B_HUMAN	V	1125;277	ENSP00000349238:A1125V;ENSP00000352974:A277V	ENSP00000349238:A1125V	A	+	2	0	CCDC88B	63876809	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	2.909000	0.48758	2.196000	0.70406	0.462000	0.41574	GCC	-	NULL		0.672	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88B	protein_coding	OTTHUMT00000104845.1	C	NM_032251		63876809	1	no_errors	NM_032251	genbank	human	validated	54_36p	missense	SNP	0.96	T
ATM	472	genome.wustl.edu	37	11	108202174	108202174	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr11:108202174G>A	ENST00000452508.2	+	52	7708	c.7519G>A	c.(7519-7521)Gac>Aac	p.D2507N	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.D2507N			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2507	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ATGGTAGAGAGACGGAATGAA	0.348			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	1	Unknown(1)	ovary(1)	11	GRCh37	CD004352	ATM	D							58.0	57.0	57.0					11																	108202174		2201	4298	6499	107707384	SO:0001583	missense	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.7519G>A	11.37:g.108202174G>A	ENSP00000388058:p.Asp2507Asn	Somatic		Capture	Illumina GAIIx	4	107707384	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like);superfamily_ARM repeat;PI3_PI4_kinase;HMMPfam_PI3_PI4_kinase;FAT;HMMPfam_FAT;FATC;HMMPfam_FATC	p.D2507N	ENST00000452508.2	37	c.7519	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	9.201	1.028408	0.19512	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.81499	-1.5;-1.5	5.43	0.194	0.15143	PIK-related kinase (1);Armadillo-type fold (1);	0.649988	0.17397	N	0.175692	T	0.54255	0.1847	N	0.17474	0.49	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.40117	-0.9580	10	0.02654	T	1	.	2.4914	0.04611	0.2822:0.13:0.4697:0.1181	.	2507	Q13315	ATM_HUMAN	N	2507	ENSP00000278616:D2507N;ENSP00000388058:D2507N	ENSP00000278616:D2507N	D	+	1	0	ATM	107707384	0.885000	0.30320	0.336000	0.25522	0.966000	0.64601	2.410000	0.44592	-0.005000	0.14395	0.467000	0.42956	GAC	-	NULL		0.348	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	protein_coding	OTTHUMT00000389938.1	G	NM_000051		107707384	1	no_errors	NM_000051	genbank	human	reviewed	54_36p	missense	SNP	0.1	A
KRT73	319101	genome.wustl.edu	37	12	53007473	53007473	+	Splice_Site	SNP	T	T	G			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr12:53007473T>G	ENST00000305748.3	-	5	1017	c.983A>C	c.(982-984)aAg>aCg	p.K328T	RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	328	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.K328T(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		CGGCCTCACCTTGGTCTGGTA	0.602																																																1	Substitution - Missense(1)	ovary(1)	12											83.0	75.0	78.0					12																	53007473		2203	4300	6503	51293740	SO:0001630	splice_region_variant	319101			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.984+1A>C	12.37:g.53007473T>G		Somatic		Capture	Illumina GAIIx	4	51293740	Q32MB2	Missense_Mutation	SNP	HMMPfam_Filament;superfamily_Prefoldin	p.K328T	ENST00000305748.3	37	c.983	CCDS8834.1	12	.	.	.	.	.	.	.	.	.	.	T	22.6	4.317281	0.81469	.	.	ENSG00000186049	ENST00000305748;ENST00000552855	D;T	0.91740	-2.9;-1.39	4.91	4.91	0.64330	Filament (1);	0.000000	0.52532	D	0.000071	D	0.97399	0.9149	H	0.99299	4.505	0.44627	D	0.997601	D	0.71674	0.998	D	0.72075	0.976	D	0.97103	0.9799	10	0.87932	D	0	.	7.7853	0.29089	0.0:0.1288:0.0:0.8712	.	328	Q86Y46	K2C73_HUMAN	T	328;73	ENSP00000307014:K328T;ENSP00000449081:K73T	ENSP00000307014:K328T	K	-	2	0	KRT73	51293740	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.458000	0.53014	1.986000	0.57962	0.533000	0.62120	AAG	-	HMMPfam_Filament		0.602	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT73	protein_coding	OTTHUMT00000405700.1	T	NM_175068	Missense_Mutation	51293740	-1	no_errors	NM_175068	genbank	human	provisional	54_36p	missense	SNP	1	G
OR8G3P	387815	genome.wustl.edu	37	11	124086295	124086295	+	IGR	SNP	T	T	G			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr11:124086295T>G								OR10D3 (29343 upstream) : OR8G1 (34127 downstream)																							CTGTGTTTTATACTACTATTG	0.448																																																0			11																																								123591505	SO:0001628	intergenic_variant	0																															11.37:g.124086295T>G		Somatic		Capture	Illumina GAIIx	4	123591505		Nonsense_Mutation	SNP	HMMPfam_7tm_1;superfamily_SSF81321	p.Y291*		37	c.873		11																																																																																			-	NULL	0	0.448					ENSG00000196703			T			123591505	1	no_start_codon:no_stop_codon	ENST00000334412	ensembl	human	known	54_36p	nonsense	SNP		G
RPS6KL1	83694	genome.wustl.edu	37	14	75373786	75373786	+	Silent	SNP	T	T	C			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr14:75373786T>C	ENST00000555647.1	-	12	1868	c.1581A>G	c.(1579-1581)gaA>gaG	p.E527E	RPS6KL1_ENST00000354625.2_Silent_p.E496E|RPS6KL1_ENST00000358328.4_Silent_p.E527E|RPS6KL1_ENST00000557413.1_Silent_p.E527E			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	527	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E527E(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		TGACACCACCTTCTCCCATGC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	14											180.0	175.0	177.0					14																	75373786		2203	4300	6503	74443539	SO:0001819	synonymous_variant	83694			BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.1581A>G	14.37:g.75373786T>C		Somatic		Capture	Illumina GAIIx	4	74443539	A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Silent	SNP	HMMPfam_Pkinase;HMMPfam_MIT;superfamily_Protein kinase-like (PK-like)	p.E496	ENST00000555647.1	37	c.1488	CCDS9834.2	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.813|8.813	0.935615|0.935615	0.18206|0.18206	.|.	.|.	ENSG00000198208|ENSG00000198208	ENST00000555910|ENST00000553971	.|.	.|.	.|.	4.58|4.58	-5.99|-5.99	0.02213|0.02213	.|.	.|.	.|.	.|.	.|.	T|T	0.36248|0.36248	0.0960|0.0960	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.38607|0.38607	-0.9653|-0.9653	4|4	.|.	.|.	.|.	0.4027|0.4027	2.3699|2.3699	0.04328|0.04328	0.1277:0.1629:0.423:0.2864|0.1277:0.1629:0.423:0.2864	.|.	.|.	.|.	.|.	R|G	22|82	.|.	.|.	K|R	-|-	2|1	0|2	RPS6KL1|RPS6KL1	74443539|74443539	0.358000|0.358000	0.24947|0.24947	0.009000|0.009000	0.14445|0.14445	0.934000|0.934000	0.57294|0.57294	-0.377000|-0.377000	0.07456|0.07456	-0.972000|-0.972000	0.03559|0.03559	0.260000|0.260000	0.18958|0.18958	AAG|AGG	-	HMMPfam_Pkinase		0.617	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	RPS6KL1	protein_coding	OTTHUMT00000413732.1	T			74443539	-1	no_errors	NM_031464	genbank	human	validated	54_36p	silent	SNP	0.99	C
EFTUD1	79631	genome.wustl.edu	37	15	82551460	82551460	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr15:82551460T>C	ENST00000268206.7	-	3	296	c.128A>G	c.(127-129)aAt>aGt	p.N43S	EFTUD1_ENST00000359445.3_Intron	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	43	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)	p.N43S(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						GATGATTCCATTGCTAGATAT	0.338																																																1	Substitution - Missense(1)	ovary(1)	15											131.0	127.0	128.0					15																	82551460		1826	4081	5907	80338515	SO:0001583	missense	79631			AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.128A>G	15.37:g.82551460T>C	ENSP00000268206:p.Asn43Ser	Somatic		Capture	Illumina GAIIx	4	80338515	A6NKY5|B7Z6I0|Q9H8Z6	Missense_Mutation	SNP	-	p.N43S	ENST00000268206.7	37	c.128	CCDS42071.1	15	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490244	0.64074	.	.	ENSG00000140598	ENST00000268206	T	0.75821	-0.97	3.62	3.62	0.41486	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	0.000000	0.48286	U	0.000196	T	0.82042	0.4951	L	0.58302	1.8	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.83123	-0.0117	10	0.59425	D	0.04	-0.0361	12.0648	0.53581	0.0:0.0:0.0:1.0	.	43	Q7Z2Z2	ETUD1_HUMAN	S	43	ENSP00000268206:N43S	ENSP00000268206:N43S	N	-	2	0	EFTUD1	80338515	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.074000	0.76791	1.531000	0.49152	0.358000	0.22013	AAT	-	NULL		0.338	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD1	protein_coding	OTTHUMT00000419252.1	T	NM_024580		80338515	-1	no_errors	NM_024580	genbank	human	validated	54_36p	missense	SNP	1	C
CD19	930	genome.wustl.edu	37	16	28943743	28943743	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr16:28943743G>T	ENST00000324662.3	+	2	209	c.165G>T	c.(163-165)gaG>gaT	p.E55D	CD19_ENST00000567541.1_Missense_Mutation_p.E55D|CD19_ENST00000538922.1_Missense_Mutation_p.E55D			P15391	CD19_HUMAN	CD19 molecule	55	Ig-like C2-type 1.				B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)	p.E55D(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						GGTCTCGGGAGTCCCCGCTTA	0.587																																																1	Substitution - Missense(1)	ovary(1)	16											36.0	42.0	40.0					16																	28943743		2196	4300	6496	28851244	SO:0001583	missense	930				CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.165G>T	16.37:g.28943743G>T	ENSP00000313419:p.Glu55Asp	Somatic		Capture	Illumina GAIIx	4	28851244	A0N0P9|F5H635|Q96S68|Q9BRD6	Missense_Mutation	SNP	superfamily_Immunoglobulin	p.E55D	ENST00000324662.3	37	c.165	CCDS10644.1	16	.	.	.	.	.	.	.	.	.	.	G	8.353	0.831433	0.16820	.	.	ENSG00000177455	ENST00000538922;ENST00000380673;ENST00000324662	T;T	0.38560	1.13;1.13	5.29	-5.14	0.02875	Immunoglobulin subtype (1);Immunoglobulin-like (1);	1.015420	0.07882	N	0.969762	T	0.18002	0.0432	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.26052	-1.0114	10	0.13470	T	0.59	-1.2667	5.3881	0.16229	0.1455:0.3939:0.3642:0.0963	.	55;55	F5H635;P15391	.;CD19_HUMAN	D	55;40;55	ENSP00000437940:E55D;ENSP00000313419:E55D	ENSP00000313419:E55D	E	+	3	2	CD19	28851244	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.468000	0.06656	-1.149000	0.02843	-1.255000	0.01485	GAG	-	NULL		0.587	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD19	protein_coding	OTTHUMT00000214152.2	G			28851244	1	no_errors	NM_001770	genbank	human	reviewed	54_36p	missense	SNP		T
TP53	7157	genome.wustl.edu	37	17	7578431	7578432	+	Frame_Shift_Ins	INS	-	-	T			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr17:7578431_7578432insT	ENST00000269305.4	-	5	687_688	c.498_499insA	c.(496-501)tcacagfs	p.Q167fs	TP53_ENST00000413465.2_Frame_Shift_Ins_p.Q167fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.Q167fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.Q167fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.Q167fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.Q167fs|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	167	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|Q -> L (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|QH -> HD (in a sporadic cancer; somatic mutation).|QH -> YL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q167*(23)|p.0?(8)|p.Q167fs*14(6)|p.Q167fs*13(3)|p.S166S(2)|p.Q167fs*3(2)|p.K164fs*3(2)|p.V157_C176del20(1)|p.Q167_H168>YL(1)|p.Q167K(1)|p.Y163fs*1(1)|p.Q167fs*12(1)|p.P151_V173del23(1)|p.Q165_M169delQSQHM(1)|p.Q167del(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.Q74*(1)|p.Q167E(1)|p.Q35*(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCATGTGCTGTGACTGCTTGT	0.639		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	59	Substitution - Nonsense(25)|Deletion - Frameshift(10)|Whole gene deletion(8)|Insertion - Frameshift(6)|Deletion - In frame(5)|Substitution - Missense(2)|Substitution - coding silent(2)|Complex - compound substitution(1)	upper_aerodigestive_tract(10)|large_intestine(9)|lung(8)|breast(8)|oesophagus(8)|bone(4)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|stomach(2)|soft_tissue(1)|urinary_tract(1)|ovary(1)|liver(1)	17	GRCh37	CM942118	TP53	M																																				7519157	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.499dupA	17.37:g.7578432_7578432dupT	ENSP00000269305:p.Gln167fs	Somatic		Capture	Illumina GAIIx	4	7519156	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.Q166fs	ENST00000269305.4	37	c.499_498	CCDS11118.1	17																																																																																			-	HMMPfam_P53		0.639	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	-	NM_000546		7519157	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.998:0.836	T
PGS1	9489	genome.wustl.edu	37	17	76423180	76423180	+	IGR	SNP	C	C	T	rs201985449	byFrequency	TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr17:76423180C>T	ENST00000262764.6	+	0	2201				DNAH17_ENST00000585328.1_Missense_Mutation_p.V4195M|DNAH17_ENST00000389840.5_Missense_Mutation_p.V4223M|DNAH17_ENST00000586052.1_5'UTR	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)	p.V4195M(1)		cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			TCGTCCAGCACGGCCTTCACC	0.592													c|||	2	0.000399361	0.0	0.0	5008	,	,		17448	0.0		0.0	False		,,,				2504	0.002				Esophageal Squamous(45;182 1126 10685 43198)											1	Substitution - Missense(1)	ovary(1)	17											31.0	25.0	27.0					17																	76423180		2199	4286	6485	73934775	SO:0001628	intergenic_variant	8632				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8			17.37:g.76423180C>T		Somatic		Capture	Illumina GAIIx	4	73934775	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	-	p.V4195M	ENST00000262764.6	37	c.12583	CCDS42391.1	17	.	.	.	.	.	.	.	.	.	.	c	9.963	1.223398	0.22457	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.10099	2.91	4.99	4.03	0.46877	.	0.130940	0.34200	N	0.004162	T	0.08935	0.0221	L	0.28776	0.89	0.41139	D	0.985948	B	0.25007	0.116	B	0.28991	0.097	T	0.21793	-1.0235	10	0.33141	T	0.24	.	9.8872	0.41268	0.0:0.8435:0.0:0.1565	.	4195	E7EUM8	.	M	4195;4223	ENSP00000374490:V4223M	ENSP00000300671:V4195M	V	-	1	0	DNAH17	73934775	0.728000	0.28080	0.980000	0.43619	0.444000	0.32077	1.637000	0.37155	1.118000	0.41863	-0.119000	0.15052	GTG	-	NULL		0.592	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH17	protein_coding	OTTHUMT00000437301.1	C	NM_024419		73934775	-1	no_errors	ENST00000300671	ensembl	human	known	54_36p	missense	SNP	0.29	T
RNF213	57674	genome.wustl.edu	37	17	78363858	78363858	+	Missense_Mutation	SNP	C	C	T	rs191077627		TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr17:78363858C>T	ENST00000582970.1	+	67	15475	c.15332C>T	c.(15331-15333)cCg>cTg	p.P5111L	CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.P5160L|RNF213_ENST00000336301.6_Missense_Mutation_p.P3184L|CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000573394.1_RNA|RNF213_ENST00000427003.3_3'UTR	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	5111					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P3184L(1)|p.P5160Q(1)|p.P3184Q(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GATCTGAGCCCGGAAAATGCT	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		20599	0.001		0.0	False		,,,				2504	0.0															3	Substitution - Missense(3)	lung(2)|ovary(1)	17											99.0	103.0	102.0					17																	78363858		2203	4300	6503	75978453	SO:0001583	missense	57674			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.15332C>T	17.37:g.78363858C>T	ENSP00000464087:p.Pro5111Leu	Somatic		Capture	Illumina GAIIx	4	75978453	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Nickel-iron hydrogenase small subunit;superfamily_RING/U-box	p.P3184L	ENST00000582970.1	37	c.9551	CCDS58606.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	12.48	1.949476	0.34377	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301;ENST00000427003	T	0.22336	1.96	5.67	5.67	0.87782	.	0.409242	0.24957	N	0.034250	T	0.23926	0.0579	M	0.70595	2.14	0.32342	N	0.559596	P;P	0.51351	0.944;0.936	B;B	0.36504	0.191;0.226	T	0.47959	-0.9076	10	0.56958	D	0.05	.	14.5968	0.68413	0.1459:0.8541:0.0:0.0	.	5111;3184	D6RI12;Q63HN8	.;RN213_HUMAN	L	5111;5160;3184;461	ENSP00000338218:P3184L	ENSP00000338218:P3184L	P	+	2	0	RNF213	75978453	0.001000	0.12720	0.916000	0.36221	0.061000	0.15899	1.417000	0.34770	2.668000	0.90789	0.655000	0.94253	CCG	-	NULL		0.483	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	protein_coding	OTTHUMT00000443298.1	C	NM_020914		75978453	1	no_errors	NM_020914	genbank	human	validated	54_36p	missense	SNP	0.47	T
LRFN1	57622	genome.wustl.edu	37	19	39804613	39804613	+	Missense_Mutation	SNP	T	T	C			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr19:39804613T>C	ENST00000248668.4	-	1	1363	c.1364A>G	c.(1363-1365)cAg>cGg	p.Q455R	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	455	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.Q407R(1)		central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GTACTGAACCTGGTACATGCG	0.652																																																1	Substitution - Missense(1)	ovary(1)	19											63.0	70.0	68.0					19																	39804613		2073	4234	6307	44496453	SO:0001583	missense	57622			BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1364A>G	19.37:g.39804613T>C	ENSP00000248668:p.Gln455Arg	Somatic		Capture	Illumina GAIIx	4	44496453	Q8TBS9	Missense_Mutation	SNP	-	p.Q455R	ENST00000248668.4	37	c.1364	CCDS46071.1	19	.	.	.	.	.	.	.	.	.	.	T	19.46	3.832330	0.71258	.	.	ENSG00000128011	ENST00000248668	T	0.55588	0.51	4.53	4.53	0.55603	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.42420	D	0.000705	T	0.68924	0.3054	M	0.83223	2.63	0.58432	D	0.999998	P	0.42649	0.786	P	0.55222	0.771	T	0.73500	-0.3963	10	0.66056	D	0.02	.	11.8469	0.52389	0.0:0.0:0.0:1.0	.	455	Q9P244	LRFN1_HUMAN	R	455	ENSP00000248668:Q455R	ENSP00000248668:Q455R	Q	-	2	0	LRFN1	44496453	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.826000	0.86716	1.905000	0.55150	0.533000	0.62120	CAG	-	NULL		0.652	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN1	protein_coding	OTTHUMT00000463835.1	T	NM_020862		44496453	-1	no_errors	NM_020862	genbank	human	validated	54_36p	missense	SNP	1	C
ZNF426	79088	genome.wustl.edu	37	19	9641741	9641741	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr19:9641741A>G	ENST00000535489.1	-	5	664	c.328T>C	c.(328-330)Tgg>Cgg	p.W110R	ZNF426_ENST00000589289.1_Intron|ZNF426_ENST00000593003.1_Missense_Mutation_p.W72R|ZNF426_ENST00000253115.2_Missense_Mutation_p.W110R			Q9BUY5	ZN426_HUMAN	zinc finger protein 426	110	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.W110R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	20						CGCATTTCCCATCCTGAAATA	0.443																																																1	Substitution - Missense(1)	ovary(1)	19											96.0	90.0	92.0					19																	9641741		2203	4300	6503	9502741	SO:0001583	missense	79088			AK095759	CCDS12215.1, CCDS74279.1	19p13.2	2013-01-08				ENSG00000130818		"""Zinc fingers, C2H2-type"", ""-"""	20725	protein-coding gene	gene with protein product							Standard	NM_024106		Approved	MGC2663	uc002mlq.3	Q9BUY5		ENST00000535489.1:c.328T>C	19.37:g.9641741A>G	ENSP00000439017:p.Trp110Arg	Somatic		Capture	Illumina GAIIx	4	9502741	B3KTL2	Missense_Mutation	SNP	-	p.W110R	ENST00000535489.1	37	c.328	CCDS12215.1	19	.	.	.	.	.	.	.	.	.	.	A	9.959	1.222209	0.22457	.	.	ENSG00000130818	ENST00000545189;ENST00000253115;ENST00000535489	T;T	0.07021	3.23;3.23	1.53	1.53	0.23141	Krueppel-associated box (1);	.	.	.	.	T	0.07683	0.0193	N	0.08118	0	0.18873	N	0.999986	D;D	0.55605	0.972;0.972	P;P	0.59643	0.861;0.861	T	0.37407	-0.9707	9	0.21540	T	0.41	.	5.172	0.15114	1.0:0.0:0.0:0.0	.	97;110	Q59EH4;Q9BUY5	.;ZN426_HUMAN	R	97;110;110	ENSP00000253115:W110R;ENSP00000439017:W110R	ENSP00000253115:W110R	W	-	1	0	ZNF426	9502741	0.019000	0.18553	0.024000	0.17045	0.459000	0.32528	2.240000	0.43088	0.945000	0.37605	0.377000	0.23210	TGG	-	NULL		0.443	ZNF426-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF426	protein_coding	OTTHUMT00000449905.1	A	NM_024106		9502741	-1	no_errors	NM_024106	genbank	human	provisional	54_36p	missense	SNP	0.03	G
ZNF812	729648	genome.wustl.edu	37	19	9804486	9804486	+	Missense_Mutation	SNP	G	G	A	rs536402597		TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr19:9804486G>A	ENST00000457674.2	-	4	643	c.125C>T	c.(124-126)aCg>aTg	p.T42M	ZNF812_ENST00000536819.1_Intron	NM_001199814.1	NP_001186743.1	P0C7V5	ZN812_HUMAN	zinc finger protein 812	42	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T42M(1)		ovary(1)	1						ATCATCAAACGTCACTGAATC	0.463													g|||	1	0.000199681	0.0008	0.0	5008	,	,		15787	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19																																								9665486	SO:0001583	missense	729648				CCDS54215.1	19p13.2	2014-04-02			ENSG00000224689	ENSG00000224689		"""Zinc fingers, C2H2-type"", ""-"""	33242	protein-coding gene	gene with protein product							Standard	NM_001199814		Approved		uc021uop.1	P0C7V5	OTTHUMG00000167867	ENST00000457674.2:c.125C>T	19.37:g.9804486G>A	ENSP00000395629:p.Thr42Met	Somatic		Capture	Illumina GAIIx	4	9665486		Missense_Mutation	SNP	-	p.T42M	ENST00000457674.2	37	c.125	CCDS54215.1	19	.	.	.	.	.	.	.	.	.	.	g	11.20	1.567797	0.28003	.	.	ENSG00000224689	ENST00000457674	T	0.03065	4.06	1.58	-3.16	0.05217	.	.	.	.	.	T	0.06416	0.0165	M	0.67953	2.075	0.09310	N	1	.	.	.	.	.	.	T	0.18713	-1.0328	7	0.62326	D	0.03	.	4.1519	0.10242	0.4177:0.352:0.2303:0.0	.	.	.	.	M	42	ENSP00000395629:T42M	ENSP00000395629:T42M	T	-	2	0	ZNF812	9665486	0.003000	0.15002	0.000000	0.03702	0.336000	0.28762	-0.972000	0.03802	-1.254000	0.02485	-1.026000	0.02426	ACG	-	NULL		0.463	ZNF812-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF812	protein_coding	OTTHUMT00000396726.1	G			9665486	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	XM_001726949	genbank	human	model	54_36p	missense	SNP	0.04	A
AURKC	6795	genome.wustl.edu	37	19	57744900	57744900	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr19:57744900G>C	ENST00000302804.7	+	5	694	c.508G>C	c.(508-510)Gag>Cag	p.E170Q	AURKC_ENST00000415300.2_Missense_Mutation_p.E151Q|AURKC_ENST00000448930.1_Missense_Mutation_p.E136Q|AURKC_ENST00000599062.1_Missense_Mutation_p.E167Q|AURKC_ENST00000598785.1_Missense_Mutation_p.E136Q	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	170	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.E136Q(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		TATTAAGCCAGAGAACCTGCT	0.527																																																1	Substitution - Missense(1)	ovary(1)	19											120.0	113.0	115.0					19																	57744900		2203	4300	6503	62436712	SO:0001583	missense	6795				CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.508G>C	19.37:g.57744900G>C	ENSP00000302898:p.Glu170Gln	Somatic		Capture	Illumina GAIIx	4	62436712	O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.E170Q	ENST00000302804.7	37	c.508	CCDS33128.1	19	.	.	.	.	.	.	.	.	.	.	G	21.5	4.160809	0.78226	.	.	ENSG00000105146	ENST00000415300;ENST00000448930;ENST00000302804	T;T;T	0.10099	2.91;2.91;2.91	3.95	3.95	0.45737	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.30386	0.0763	M	0.68728	2.09	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.985;0.999	T	0.02829	-1.1105	10	0.87932	D	0	-28.9392	14.3221	0.66493	0.0:0.0:1.0:0.0	.	167;170;151	Q5Y191;Q9UQB9;Q9UQB9-3	.;AURKC_HUMAN;.	Q	151;136;170	ENSP00000407162:E151Q;ENSP00000406798:E136Q;ENSP00000302898:E170Q	ENSP00000302898:E170Q	E	+	1	0	AURKC	62436712	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	8.110000	0.89562	2.501000	0.84356	0.561000	0.74099	GAG	-	HMMPfam_Pkinase		0.527	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AURKC	protein_coding	OTTHUMT00000465089.1	G	NM_003160		62436712	1	no_errors	NM_001015878	genbank	human	reviewed	54_36p	missense	SNP	1	C
Unknown	0	genome.wustl.edu	37	2	162138424	162138425	+	IGR	INS	-	-	G	rs370453272|rs77778779		TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	-	-	-	G	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr2:162138424_162138425insG								AC009299.2 (27245 upstream) : PSMD14 (26123 downstream)																							cacccccagctctcggggagtc	0.545																																																0			2																																								161846671	SO:0001628	intergenic_variant	728220																															2.37:g.162138424_162138425insG		Somatic		Capture	Illumina GAIIx	Phase_III	161846670		Frame_Shift_Ins	INS	-	p.L13fs		37	c.39_40		2																																																																																			-	NULL	0	0.545					LOC728220			-			161846671	1	no_errors	XM_001126897	genbank	human	model	54_36p	frame_shift_ins	INS	0.974:0.963	G
USP34	9736	genome.wustl.edu	37	2	61475758	61475758	+	Silent	SNP	A	A	G			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr2:61475758A>G	ENST00000398571.2	-	49	6358	c.6282T>C	c.(6280-6282)aaT>aaC	p.N2094N		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2094	USP.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.N2094N(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TCGTGACCATATTAAATGTGT	0.333																																																1	Substitution - coding silent(1)	ovary(1)	2											106.0	103.0	104.0					2																	61475758		1850	4097	5947	61329262	SO:0001819	synonymous_variant	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.6282T>C	2.37:g.61475758A>G		Somatic		Capture	Illumina GAIIx	4	61329262	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	-	p.N2094	ENST00000398571.2	37	c.6282	CCDS42686.1	2																																																																																			-	NULL		0.333	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	protein_coding	OTTHUMT00000325650.4	A			61329262	-1	no_errors	NM_014709	genbank	human	validated	54_36p	silent	SNP	1	G
CLEC4F	165530	genome.wustl.edu	37	2	71043821	71043821	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr2:71043821G>C	ENST00000272367.2	-	4	768	c.692C>G	c.(691-693)gCc>gGc	p.A231G	CLEC4F_ENST00000426626.1_Missense_Mutation_p.A231G	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	231					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.A231G(1)		endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						TTCCAAACTGGCATTCAACAT	0.408																																					Colon(107;10 2157 6841 26035)											1	Substitution - Missense(1)	ovary(1)	2											79.0	77.0	78.0					2																	71043821		2203	4300	6503	70897329	SO:0001583	missense	165530			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.692C>G	2.37:g.71043821G>C	ENSP00000272367:p.Ala231Gly	Somatic		Capture	Illumina GAIIx	4	70897329	A4QPA5	Missense_Mutation	SNP	-	p.A231G	ENST00000272367.2	37	c.692	CCDS1910.1	2	.	.	.	.	.	.	.	.	.	.	G	3.764	-0.049016	0.07407	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.42900	0.96;0.96	3.51	0.409	0.16382	.	0.492559	0.15114	N	0.279793	T	0.41282	0.1152	L	0.41236	1.265	0.09310	N	1	D;D	0.67145	0.996;0.996	P;D	0.65443	0.906;0.935	T	0.28332	-1.0047	10	0.17369	T	0.5	.	1.7502	0.02970	0.1232:0.1969:0.4589:0.221	.	231;231	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	G	231	ENSP00000272367:A231G;ENSP00000390581:A231G	ENSP00000272367:A231G	A	-	2	0	CLEC4F	70897329	0.000000	0.05858	0.041000	0.18516	0.054000	0.15201	-0.384000	0.07389	0.069000	0.16605	0.313000	0.20887	GCC	-	NULL		0.408	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLEC4F	protein_coding	OTTHUMT00000251922.1	G	NM_173535		70897329	-1	no_errors	NM_173535	genbank	human	validated	54_36p	missense	SNP	0.01	C
TTN	7273	genome.wustl.edu	37	2	179395464	179395464	+	Missense_Mutation	SNP	T	T	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr2:179395464T>A	ENST00000591111.1	-	308	101179	c.100955A>T	c.(100954-100956)aAa>aTa	p.K33652I	TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K26353I|TTN_ENST00000460472.2_Missense_Mutation_p.K26228I|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K35293I|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K32725I|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K26420I|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33652	Ig-like 148.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K32723I(1)|p.K26228I(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTTCTGCTTTCAGGAACTG	0.463																																																2	Substitution - Missense(2)	ovary(2)	2											106.0	101.0	102.0					2																	179395464		1890	4108	5998	179103710	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100955A>T	2.37:g.179395464T>A	ENSP00000465570:p.Lys33652Ile	Somatic		Capture	Illumina GAIIx	4	179103710	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	-	p.K32725*	ENST00000591111.1	37	c.98173		2	.	.	.	.	.	.	.	.	.	.	T	15.61	2.885000	0.51908	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	4.99	4.99	0.66335	Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49949	0.1587	L	0.60455	1.87	0.36266	D	0.854834	D;D;D;D	0.61080	0.989;0.989;0.989;0.985	P;P;P;D	0.65323	0.892;0.892;0.892;0.934	T	0.62637	-0.6812	9	0.87932	D	0	.	14.7021	0.69162	0.0:0.0:0.0:1.0	.	26228;26353;26420;33652	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	32725;26228;26420;26353;26225	ENSP00000343764:K32725I;ENSP00000434586:K26228I;ENSP00000340554:K26420I;ENSP00000352154:K26353I	ENSP00000340554:K26420I	K	-	2	0	TTN	179103710	1.000000	0.71417	0.991000	0.47740	0.758000	0.43043	2.476000	0.45171	1.882000	0.54519	0.374000	0.22700	AAA	-	NULL		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378		179103710	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	nonsense	SNP	0.89	A
CHMP4B	128866	genome.wustl.edu	37	20	32436293	32436293	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr20:32436293C>A	ENST00000217402.2	+	2	376	c.211C>A	c.(211-213)Cgt>Agt	p.R71S		NM_176812.4	NP_789782.1	Q9H444	CHM4B_HUMAN	charged multivesicular body protein 4B	71					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of autophagic vacuole assembly (GO:1902902)|negative regulation of neuron death (GO:1901215)|positive regulation of viral release from host cell (GO:1902188)|posttranslational protein targeting to membrane (GO:0006620)|protein homooligomerization (GO:0051260)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|ESCRT III complex (GO:0000815)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)	p.R71S(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13						GGCACTGAAGCGTAAGAAGAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	20											65.0	54.0	58.0					20																	32436293		2203	4300	6503	31899954	SO:0001583	missense	128866			AL050349	CCDS13228.1	20q11.22	2011-09-21	2011-09-21	2005-04-04	ENSG00000101421	ENSG00000101421		"""Charged multivesicular body proteins"""	16171	protein-coding gene	gene with protein product		610897	"""chromosome 20 open reading frame 178"", ""chromatin modifying protein 4B"""	C20orf178		14678797	Standard	NM_176812		Approved	dJ553F4.4, Shax1, SNF7-2, VPS32B	uc002xaa.3	Q9H444	OTTHUMG00000032272	ENST00000217402.2:c.211C>A	20.37:g.32436293C>A	ENSP00000217402:p.Arg71Ser	Somatic		Capture	Illumina GAIIx	4	31899954	E1P5N4|Q53ZD6	Missense_Mutation	SNP	-	p.R71S	ENST00000217402.2	37	c.211	CCDS13228.1	20	.	.	.	.	.	.	.	.	.	.	C	32	5.114329	0.94339	.	.	ENSG00000101421	ENST00000217402	T	0.73047	-0.71	5.78	5.78	0.91487	.	0.047704	0.85682	D	0.000000	D	0.86091	0.5850	M	0.90595	3.13	0.80722	D	1	D	0.56746	0.977	P	0.58331	0.837	D	0.88313	0.2957	10	0.87932	D	0	-6.6585	19.996	0.97383	0.0:1.0:0.0:0.0	.	71	Q9H444	CHM4B_HUMAN	S	71	ENSP00000217402:R71S	ENSP00000217402:R71S	R	+	1	0	CHMP4B	31899954	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.047000	0.57383	2.731000	0.93534	0.591000	0.81541	CGT	-	NULL		0.562	CHMP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP4B	protein_coding	OTTHUMT00000078738.2	C			31899954	1	no_errors	NM_176812	genbank	human	validated	54_36p	missense	SNP	1	A
CCT8L2	150160	genome.wustl.edu	37	22	17072821	17072821	+	Missense_Mutation	SNP	G	G	A	rs376606608		TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr22:17072821G>A	ENST00000359963.3	-	1	879	c.620C>T	c.(619-621)gCg>gTg	p.A207V		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	207					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)	p.A207G(1)|p.A207V(1)|p.A207E(1)		breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CCCGGGCAGCGCGCACACCCC	0.617																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	22						G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	64.0	63.0	63.0		620	1.8	0.0	22		63	0,8600		0,0,4300	no	missense	CCT8L2	NM_014406.4	64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	207/558	17072821	1,13005	2203	4300	6503	15452821	SO:0001583	missense	150160			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.620C>T	22.37:g.17072821G>A	ENSP00000353048:p.Ala207Val	Somatic		Capture	Illumina GAIIx	4	15452821	A4QPH3|Q9UJS3	Missense_Mutation	SNP	HMMPfam_Cpn60_TCP1;superfamily_GroEL equatorial domain-like;superfamily_GroEL apical domain-like;superfamily_GroEL-intermediate domain like	p.A207V	ENST00000359963.3	37	c.620	CCDS13738.1	22	.	.	.	.	.	.	.	.	.	.	g	9.225	1.034437	0.19590	2.27E-4	0.0	ENSG00000198445	ENST00000359963	T	0.78816	-1.21	1.78	1.78	0.24846	.	1.965940	0.03364	N	0.197938	T	0.61949	0.2388	N	0.08118	0	0.09310	N	1	B	0.17852	0.024	B	0.18561	0.022	T	0.55328	-0.8158	10	0.66056	D	0.02	-1.6843	7.0003	0.24805	0.0:0.0:1.0:0.0	.	207	Q96SF2	TCPQM_HUMAN	V	207	ENSP00000353048:A207V	ENSP00000353048:A207V	A	-	2	0	CCT8L2	15452821	0.385000	0.25172	0.019000	0.16419	0.030000	0.12068	0.334000	0.19787	0.995000	0.38917	0.379000	0.24179	GCG	-	NULL		0.617	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8L2	protein_coding	OTTHUMT00000280580.1	G			15452821	-1	no_errors	NM_014406	genbank	human	validated	54_36p	missense	SNP		A
HDAC11	79885	genome.wustl.edu	37	3	13545660	13545660	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr3:13545660A>T	ENST00000295757.3	+	9	899	c.716A>T	c.(715-717)gAg>gTg	p.E239V	HDAC11_ENST00000405025.1_Nonsense_Mutation_p.R79*|HDAC11_ENST00000402259.1_Missense_Mutation_p.E73V|HDAC11_ENST00000404040.1_Missense_Mutation_p.E139V|HDAC11_ENST00000404548.1_Nonsense_Mutation_p.R107*|HDAC11_ENST00000522202.1_Missense_Mutation_p.E188V|HDAC11_ENST00000437379.2_Missense_Mutation_p.E211V|HDAC11_ENST00000446613.2_Missense_Mutation_p.E47V|HDAC11_ENST00000433119.1_Nonsense_Mutation_p.R197*|HDAC11_ENST00000402271.1_Missense_Mutation_p.E160V	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	239	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)	p.E239V(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						GATAAGGTGGAGAGGAACATC	0.582																																																1	Substitution - Missense(1)	ovary(1)	3											98.0	90.0	93.0					3																	13545660		2203	4300	6503	13520660	SO:0001583	missense	79885			AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.716A>T	3.37:g.13545660A>T	ENSP00000295757:p.Glu239Val	Somatic		Capture	Illumina GAIIx	4	13520660	B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Nonsense_Mutation	SNP	-	p.R225*	ENST00000295757.3	37	c.673	CCDS2615.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.52|12.52	1.961646|1.961646	0.34659|0.34659	.|.	.|.	ENSG00000163517|ENSG00000163517	ENST00000295757;ENST00000402259;ENST00000402271;ENST00000446613;ENST00000404040;ENST00000522202;ENST00000437379|ENST00000433119;ENST00000404548;ENST00000405025	T;T;T;T;T;T;T|.	0.71579|.	-0.58;-0.58;-0.58;-0.58;-0.58;-0.58;-0.58|.	5.65|5.65	0.258|0.258	0.15578|0.15578	Histone deacetylase domain (2);|.	0.281721|.	0.39146|.	N|.	0.001459|.	T|.	0.43722|.	0.1260|.	L|L	0.35487|0.35487	1.065|1.065	0.35006|0.35006	D|D	0.756478|0.756478	B;B|.	0.19200|.	0.002;0.034|.	B;B|.	0.23018|.	0.02;0.043|.	T|.	0.52689|.	-0.8542|.	10|.	0.87932|0.87932	D|D	0|0	-1.8835|-1.8835	4.9396|4.9396	0.13958|0.13958	0.6133:0.1455:0.2412:0.0|0.6133:0.1455:0.2412:0.0	.|.	188;239|.	B4DDK1;Q96DB2|.	.;HDA11_HUMAN|.	V|X	239;73;160;47;139;188;211|197;107;79	ENSP00000295757:E239V;ENSP00000384706:E73V;ENSP00000384123:E160V;ENSP00000401487:E47V;ENSP00000385475:E139V;ENSP00000429794:E188V;ENSP00000395188:E211V|.	ENSP00000295757:E239V|ENSP00000385528:R107X	E|R	+|+	2|1	0|2	HDAC11|HDAC11	13520660|13520660	0.899000|0.899000	0.30636|0.30636	0.983000|0.983000	0.44433|0.44433	0.003000|0.003000	0.03518|0.03518	1.950000|1.950000	0.40323|0.40323	0.096000|0.096000	0.17463|0.17463	-0.378000|-0.378000	0.06908|0.06908	GAG|AGA	-	NULL		0.582	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC11	protein_coding	OTTHUMT00000252028.5	A	NM_024827		13520660	1	no_errors	ENST00000383796	ensembl	human	known	54_36p	nonsense	SNP	1	T
FGD5	152273	genome.wustl.edu	37	3	14861824	14861824	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr3:14861824G>A	ENST00000285046.5	+	1	1356	c.1246G>A	c.(1246-1248)Gtg>Atg	p.V416M	FGD5_ENST00000543601.1_Missense_Mutation_p.V175M	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	416					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.V175M(1)		NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						TGTGGTGGTCGTGCTGGAGGA	0.682																																																1	Substitution - Missense(1)	ovary(1)	3											25.0	29.0	28.0					3																	14861824		2059	4177	6236	14836828	SO:0001583	missense	152273			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.1246G>A	3.37:g.14861824G>A	ENSP00000285046:p.Val416Met	Somatic		Capture	Illumina GAIIx	4	14836828	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	-	p.V175M	ENST00000285046.5	37	c.523	CCDS46767.1	3	.	.	.	.	.	.	.	.	.	.	G	8.491	0.862099	0.17178	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.78924	-1.22;-1.02	5.03	-10.1	0.00402	.	0.850128	0.10241	N	0.698480	T	0.44244	0.1284	N	0.11201	0.11	0.09310	N	1	B;B	0.31351	0.32;0.181	B;B	0.18561	0.022;0.006	T	0.37709	-0.9694	10	0.30854	T	0.27	-1.9286	2.8404	0.05527	0.2113:0.4016:0.2074:0.1796	.	175;416	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	M	416;175	ENSP00000285046:V416M;ENSP00000445949:V175M	ENSP00000285046:V416M	V	+	1	0	FGD5	14836828	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.928000	0.03980	-4.386000	0.00052	-1.031000	0.02408	GTG	-	NULL		0.682	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	protein_coding	OTTHUMT00000340628.1	G	NM_152536		14836828	1	no_errors	NM_152536	genbank	human	validated	54_36p	missense	SNP		A
MAP4	4134	genome.wustl.edu	37	3	48019417	48019417	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr3:48019417G>A	ENST00000360240.6	-	3	748	c.230C>T	c.(229-231)cCa>cTa	p.P77L	MAP4_ENST00000439356.1_Missense_Mutation_p.P77L|MAP4_ENST00000434267.1_Missense_Mutation_p.P77L|MAP4_ENST00000383737.4_Missense_Mutation_p.P77L|MAP4_ENST00000426837.2_Missense_Mutation_p.P94L|MAP4_ENST00000395734.3_Missense_Mutation_p.P77L	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	77					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.P77L(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TTTAGAAGATGGAGTATCTGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	3											202.0	181.0	188.0					3																	48019417		2203	4300	6503	47994421	SO:0001583	missense	4134				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.230C>T	3.37:g.48019417G>A	ENSP00000353375:p.Pro77Leu	Somatic		Capture	Illumina GAIIx	4	47994421	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	-	p.P77L	ENST00000360240.6	37	c.230	CCDS33750.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.61|17.61	3.431167|3.431167	0.62844|0.62844	.|.	.|.	ENSG00000047849|ENSG00000047849	ENST00000423088|ENST00000383737;ENST00000395734;ENST00000426837;ENST00000360240;ENST00000434267;ENST00000439356	.|T;T;T;T;T;T	.|0.45276	.|0.97;0.97;0.9;0.97;1.38;1.38	4.81|4.81	4.81|4.81	0.61882|0.61882	.|.	.|.	.|.	.|.	.|.	T|T	0.57446|0.57446	0.2054|0.2054	M|M	0.62723|0.62723	1.935|1.935	0.33518|0.33518	D|D	0.59196|0.59196	.|P;D;D	.|0.63046	.|0.675;0.992;0.961	.|B;P;P	.|0.59948	.|0.295;0.866;0.617	T|T	0.69079|0.69079	-0.5240|-0.5240	5|9	.|0.87932	.|D	.|0	-0.0368|-0.0368	13.5529|13.5529	0.61743|0.61743	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|77;77;77	.|Q86V26;P27816-6;P27816	.|.;.;MAP4_HUMAN	Y|L	84|77;77;94;77;77;77	.|ENSP00000373243:P77L;ENSP00000379083:P77L;ENSP00000407602:P94L;ENSP00000353375:P77L;ENSP00000402767:P77L;ENSP00000397414:P77L	.|ENSP00000353375:P77L	H|P	-|-	1|2	0|0	MAP4|MAP4	47994421|47994421	0.947000|0.947000	0.32204|0.32204	0.977000|0.977000	0.42913|0.42913	0.888000|0.888000	0.51559|0.51559	3.770000|3.770000	0.55310|0.55310	2.651000|2.651000	0.90000|0.90000	0.557000|0.557000	0.71058|0.71058	CAT|CCA	-	NULL		0.403	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	protein_coding	OTTHUMT00000346085.1	G	NM_002375		47994421	-1	no_errors	NM_002375	genbank	human	reviewed	54_36p	missense	SNP	1	A
PHLDB2	90102	genome.wustl.edu	37	3	111672808	111672808	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr3:111672808G>A	ENST00000431670.2	+	12	3215	c.2804G>A	c.(2803-2805)tGt>tAt	p.C935Y	PHLDB2_ENST00000393923.3_Missense_Mutation_p.C919Y|PHLDB2_ENST00000495180.1_Missense_Mutation_p.C426Y|PHLDB2_ENST00000481953.1_Missense_Mutation_p.C892Y|PHLDB2_ENST00000412622.1_Missense_Mutation_p.C892Y|PHLDB2_ENST00000393925.3_Missense_Mutation_p.C935Y	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	935						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.C892Y(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						AGTAACAGCTGTGGAAGTGTG	0.542																																																1	Substitution - Missense(1)	ovary(1)	3											92.0	77.0	82.0					3																	111672808		2203	4300	6503	113155498	SO:0001583	missense	90102				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.2804G>A	3.37:g.111672808G>A	ENSP00000405405:p.Cys935Tyr	Somatic		Capture	Illumina GAIIx	4	113155498	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	-	p.C892Y	ENST00000431670.2	37	c.2675	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	G	24.4	4.529950	0.85706	.	.	ENSG00000144824	ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.41065	1.37;1.22;1.38;1.35;1.22;1.38;1.01	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.63640	0.2528	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	0.982;0.999;1.0;1.0	P;D;D;D	0.87578	0.682;0.99;0.998;0.997	T	0.63892	-0.6534	10	0.56958	D	0.05	.	16.5746	0.84633	0.0:0.0:1.0:0.0	.	426;935;892;919	E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;PHLB2_HUMAN;.;.	Y	919;935;892;892;935;892;426	ENSP00000377500:C919Y;ENSP00000405405:C935Y;ENSP00000405292:C892Y;ENSP00000418296:C892Y;ENSP00000377502:C935Y;ENSP00000418319:C892Y;ENSP00000420303:C426Y	ENSP00000377500:C919Y	C	+	2	0	PHLDB2	113155498	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.796000	0.85898	2.721000	0.93114	0.655000	0.94253	TGT	-	NULL		0.542	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	protein_coding	OTTHUMT00000354337.1	G	NM_145753		113155498	1	no_errors	NM_145753	genbank	human	validated	54_36p	missense	SNP	1	A
FAIM2	23017	genome.wustl.edu	37	12	50272394	50272394	+	Intron	SNP	T	T	C	rs370826453		TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	T	T	C	T	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr12:50272394T>C	ENST00000320634.3	-	12	896				FAIM2_ENST00000550890.1_Intron	NM_012306.3	NP_036438.2	Q9BWQ8	LFG2_HUMAN	Fas apoptotic inhibitory molecule 2						apoptotic process (GO:0006915)|cerebellar granular layer development (GO:0021681)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum development (GO:0021549)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of neuron apoptotic process (GO:0043523)|response to ischemia (GO:0002931)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|postsynaptic membrane (GO:0045211)				endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|skin(2)	14						tgtgcatgtgtatgtgtgcat	0.388																																																0			12																																								48558661	SO:0001627	intron_variant	0			AB023167	CCDS8791.1	12q13	2010-03-18				ENSG00000135472			17067	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 2"""	604306				10231032, 10535980	Standard	NM_012306		Approved	KIAA0950, LFG, NMP35, LIFEGUARD, TMBIM2, LFG2	uc001rvj.2	Q9BWQ8	OTTHUMG00000169808	ENST00000320634.3:c.802-7958A>G	12.37:g.50272394T>C		Somatic		Capture	Illumina GAIIx	Phase_III	48558661	A8K1W6|B3KR08|Q9UJY9|Q9Y2F7	Missense_Mutation	SNP	-	p.Y114C	ENST00000320634.3	37	c.341	CCDS8791.1	12																																																																																			-	NULL		0.388	FAIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000202582	protein_coding	OTTHUMT00000405984.1	T	NM_012306		48558661	-1	no_errors	ENST00000380242	ensembl	human	known	54_36p	missense	SNP		C
PCDHA11	56138	genome.wustl.edu	37	5	140249861	140249861	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr5:140249861C>G	ENST00000398640.2	+	1	1173	c.1173C>G	c.(1171-1173)caC>caG	p.H391Q	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	391	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACGCCCCACGTTCCCTTCA	0.592																																																0			5											124.0	112.0	116.0					5																	140249861		2203	4300	6503	140230045	SO:0001583	missense	56138			AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1173C>G	5.37:g.140249861C>G	ENSP00000381636:p.His391Gln	Somatic		Capture	Illumina GAIIx	4	140230045	B2RN58|O75279	Missense_Mutation	SNP	-	p.H391Q	ENST00000398640.2	37	c.1173	CCDS47284.1	5	.	.	.	.	.	.	.	.	.	.	C	0.050	-1.253219	0.01457	.	.	ENSG00000249158	ENST00000398640	T	0.50001	0.76	5.7	-9.79	0.00494	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.24509	0.0594	L	0.28504	0.86	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.20384	0.029;0.006	T	0.23119	-1.0197	9	0.41790	T	0.15	.	0.6599	0.00841	0.2322:0.26:0.1528:0.3549	.	391;391	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	Q	391	ENSP00000381636:H391Q	ENSP00000381636:H391Q	H	+	3	2	PCDHA11	140230045	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-7.260000	0.00040	-1.647000	0.01511	-0.257000	0.10917	CAC	-	NULL		0.592	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA11	protein_coding	OTTHUMT00000372885.2	C	NM_018902		140230045	1	no_errors	NM_018902	genbank	human	reviewed	54_36p	missense	SNP		G
NSD1	64324	genome.wustl.edu	37	5	176687050	176687050	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr5:176687050C>A	ENST00000439151.2	+	14	5072	c.5027C>A	c.(5026-5028)gCt>gAt	p.A1676D	NSD1_ENST00000347982.4_Missense_Mutation_p.A1407D|NSD1_ENST00000354179.4_Missense_Mutation_p.A1407D|NSD1_ENST00000361032.4_Missense_Mutation_p.A1573D	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1676					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A1676D(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TTTTGCCTGGCTGCTGGGTCA	0.483			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																													Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	1	Substitution - Missense(1)	ovary(1)	5											125.0	115.0	118.0					5																	176687050		2203	4300	6503	176619656	SO:0001583	missense	64324	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.5027C>A	5.37:g.176687050C>A	ENSP00000395929:p.Ala1676Asp	Somatic		Capture	Illumina GAIIx	4	176619656	Q96PD8|Q96RN7	Missense_Mutation	SNP	HMMPfam_PWWP;HMMPfam_SET;HMMPfam_PHD;superfamily_FYVE/PHD zinc finger;superfamily_Tudor/PWWP/MBT;superfamily_SET domain	p.A1676D	ENST00000439151.2	37	c.5027	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.316698	0.95682	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.96168	-3.93;-3.93;-3.93;-3.93	5.51	5.51	0.81932	Zinc finger, PHD-type (1);	0.000000	0.64402	D	0.000005	D	0.97651	0.9230	M	0.75085	2.285	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.996;0.996;0.986	D	0.97938	1.0324	10	0.72032	D	0.01	.	19.783	0.96424	0.0:1.0:0.0:0.0	.	1407;1573;1676	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	D	1407;1676;1407;1573	ENSP00000346111:A1407D;ENSP00000395929:A1676D;ENSP00000343209:A1407D;ENSP00000354310:A1573D	ENSP00000343209:A1407D	A	+	2	0	NSD1	176619656	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.752000	0.94435	0.467000	0.42956	GCT	-	NULL		0.483	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	protein_coding	OTTHUMT00000253412.2	C	NM_172349		176619656	1	no_errors	NM_022455	genbank	human	reviewed	54_36p	missense	SNP	1	A
ZNF454	285676	genome.wustl.edu	37	5	178391968	178391968	+	Missense_Mutation	SNP	C	C	G			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr5:178391968C>G	ENST00000320129.3	+	5	866	c.563C>G	c.(562-564)tCt>tGt	p.S188C	ZNF454_ENST00000519564.1_Missense_Mutation_p.S188C	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S188C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		AAAGTCTTCTCTAAGAGTTCA	0.343																																																1	Substitution - Missense(1)	ovary(1)	5											49.0	51.0	50.0					5																	178391968		2203	4300	6503	178324574	SO:0001583	missense	285676			AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.563C>G	5.37:g.178391968C>G	ENSP00000326249:p.Ser188Cys	Somatic		Capture	Illumina GAIIx	4	178324574	Q2M1P2|Q2M323	Missense_Mutation	SNP	-	p.S188C	ENST00000320129.3	37	c.563	CCDS4441.1	5	.	.	.	.	.	.	.	.	.	.	C	8.941	0.965922	0.18659	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.36878	1.23;1.23	4.61	2.69	0.31865	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.736837	0.11296	N	0.578702	T	0.25121	0.0610	L	0.41124	1.26	0.20873	N	0.999839	P	0.35456	0.502	B	0.32762	0.152	T	0.27806	-1.0063	10	0.72032	D	0.01	-8.6688	2.9809	0.05953	0.1805:0.5452:0.1749:0.0993	.	188	Q8N9F8	ZN454_HUMAN	C	188	ENSP00000326249:S188C;ENSP00000430354:S188C	ENSP00000326249:S188C	S	+	2	0	ZNF454	178324574	0.000000	0.05858	0.992000	0.48379	0.902000	0.53008	0.687000	0.25407	1.300000	0.44818	0.555000	0.69702	TCT	-	NULL		0.343	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF454	protein_coding	OTTHUMT00000253476.2	C	XM_209718		178324574	1	no_errors	NM_182594	genbank	human	provisional	54_36p	missense	SNP	0.01	G
XKR4	114786	genome.wustl.edu	37	8	56362682	56362682	+	Intron	SNP	G	G	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr8:56362682G>A	ENST00000327381.6	+	3	1106					NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4							integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			TTAGCGGGTCGGCTCAGCTCT	0.662																																																0			8																																								56525236	SO:0001627	intron_variant	100133234			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1007-73158G>A	8.37:g.56362682G>A		Somatic		Capture	Illumina GAIIx	4	56525236	Q96PZ8	RNA	SNP	-	NULL	ENST00000327381.6	37	NULL	CCDS34893.1	8																																																																																			-	-		0.662	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100133234	protein_coding	OTTHUMT00000378129.2	G	NM_052898		56525236	-1	pseudogene	XR_038021	genbank	human	model	54_36p	rna	SNP	1	A
PSMC1P11	442153	genome.wustl.edu	37	6	4703251	4703251	+	IGR	SNP	G	G	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr6:4703251G>A								snoU13 (59163 upstream) : CDYL (3141 downstream)																							TGCCAATACTGGGAGGTTGGA	0.493																																																0			6																																								4648250	SO:0001628	intergenic_variant	442153																															6.37:g.4703251G>A		Somatic		Capture	Illumina GAIIx	4	4648250		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.493					LOC442153			G			4648250	1	pseudogene	XR_016425	genbank	human	model	54_36p	rna	SNP	1	A
GPX6	257202	genome.wustl.edu	37	6	28472134	28472134	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr6:28472134G>C	ENST00000361902.1	-	5	650	c.601C>G	c.(601-603)Cag>Gag	p.Q201E	GPX6_ENST00000474923.1_Silent_p.T167T|GPX6_ENST00000483058.1_5'Flank	NM_182701.1	NP_874360.1	P59796	GPX6_HUMAN	glutathione peroxidase 6 (olfactory)	201					response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)	p.Q201E(1)		NS(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Glutathione(DB00143)	ACTGGAGCCTGGTGGAACCAA	0.512																																																1	Substitution - Missense(1)	ovary(1)	6											142.0	134.0	136.0					6																	28472134		2022	4216	6238	28580113	SO:0001583	missense	257202				CCDS43432.1	6p22.1	2012-03-01			ENSG00000198704	ENSG00000198704	1.11.1.9		4558	protein-coding gene	gene with protein product		607913	"""glutathione peroxidase pseudogene 3"""	GPXP3			Standard	NM_182701		Approved		uc021yrx.1	P59796	OTTHUMG00000044828	ENST00000361902.1:c.601C>G	6.37:g.28472134G>C	ENSP00000354581:p.Gln201Glu	Somatic		Capture	Illumina GAIIx	Phase_III	28580113	Q4PJ17	Missense_Mutation	SNP	HMMPfam_GSHPx,superfamily_Thioredoxin-like	p.Q201E	ENST00000361902.1	37	c.601	CCDS43432.1	6	.	.	.	.	.	.	.	.	.	.	G	10.09	1.255435	0.22965	.	.	ENSG00000198704	ENST00000361902	T	0.03663	3.85	4.4	-4.43	0.03568	Thioredoxin-like fold (2);	1.096880	0.06846	N	0.796470	T	0.00967	0.0032	L	0.28608	0.87	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43523	-0.9386	10	0.25751	T	0.34	.	12.1185	0.53878	0.0:0.1012:0.237:0.6618	.	201	P59796	GPX6_HUMAN	E	201	ENSP00000354581:Q201E	ENSP00000354581:Q201E	Q	-	1	0	GPX6	28580113	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.784000	0.04633	-0.953000	0.03645	-0.169000	0.13324	CAG	-	NULL		0.512	GPX6-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	GPX6	protein_coding	OTTHUMT00000104340.1	G			28580113	-1	pseudogene	NM_182701	genbank	human	reviewed	54_36p	missense	SNP	0.001	C
BCAP29	55973	genome.wustl.edu	37	7	107221265	107221265	+	Silent	SNP	A	A	T			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr7:107221265A>T	ENST00000005259.4	+	2	387	c.48A>T	c.(46-48)atA>atT	p.I16I	BCAP29_ENST00000379117.2_Silent_p.I16I|BCAP29_ENST00000465919.1_Intron|BCAP29_ENST00000379119.2_Silent_p.I16I|BCAP29_ENST00000445771.2_Silent_p.I16I|BCAP29_ENST00000494086.1_Intron|RP4-593H12.1_ENST00000610269.1_RNA	NM_018844.3	NP_061332.2	Q9UHQ4	BAP29_HUMAN	B-cell receptor-associated protein 29	16					apoptotic process (GO:0006915)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|osteoblast differentiation (GO:0001649)|protein localization to endoplasmic reticulum exit site (GO:0070973)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.I16I(1)		cervix(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	14						ATGCCGAAATAGGACTCATTT	0.358																																																1	Substitution - coding silent(1)	ovary(1)	7											103.0	92.0	96.0					7																	107221265		2203	4300	6503	107008501	SO:0001819	synonymous_variant	55973				CCDS34730.1, CCDS34731.1	7q22.3	2012-09-20			ENSG00000075790	ENSG00000075790			24131	protein-coding gene	gene with protein product						12477932	Standard	NM_018844		Approved	BAP29, DKFZp686M2086	uc011kma.1	Q9UHQ4	OTTHUMG00000154770	ENST00000005259.4:c.48A>T	7.37:g.107221265A>T		Somatic		Capture	Illumina GAIIx	4	107008501	G5E9L4|O95003	Silent	SNP	-	p.I16	ENST00000005259.4	37	c.48	CCDS34731.1	7																																																																																			-	NULL		0.358	BCAP29-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BCAP29	protein_coding	OTTHUMT00000337011.2	A	NM_018844		107008501	1	no_errors	NM_001008405	genbank	human	validated	54_36p	silent	SNP	1	T
OR2A5	393046	genome.wustl.edu	37	7	143747797	143747797	+	Silent	SNP	C	C	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr7:143747797C>A	ENST00000408906.2	+	1	337	c.303C>A	c.(301-303)acC>acA	p.T101T		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T101T(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					CAATGCAGACCTTTTTATACA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	7											151.0	149.0	150.0					7																	143747797		2106	4252	6358	143378730	SO:0001819	synonymous_variant	393046			U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.303C>A	7.37:g.143747797C>A		Somatic		Capture	Illumina GAIIx	4	143378730	B9EGX2|O43885|O43888	Silent	SNP	-	p.T101	ENST00000408906.2	37	c.303	CCDS43668.1	7																																																																																			-	NULL		0.428	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A5	protein_coding	OTTHUMT00000349986.1	C			143378730	1	no_errors	NM_012365	genbank	human	provisional	54_36p	silent	SNP	0.57	A
SPATA31C2	645961	genome.wustl.edu	37	9	90745589	90745589	+	IGR	SNP	C	C	T			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chr9:90745589C>T								U6 (132339 upstream) : U3 (243594 downstream)																							AGATTGGGCTCCTAAGCTCCT	0.592																																																0			9											2.0	3.0	3.0					9																	90745589		594	1418	2012	89935409	SO:0001628	intergenic_variant	645961																															9.37:g.90745589C>T		Somatic		Capture	Illumina GAIIx	4	89935409		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.592					LOC645961			C			89935409	-1	no_errors	XR_040572	genbank	human	model	54_36p	rna	SNP		T
COL4A6	1288	genome.wustl.edu	37	X	107462959	107462959	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chrX:107462959A>T	ENST00000372216.4	-	5	396	c.296T>A	c.(295-297)gTt>gAt	p.V99D	COL4A6_ENST00000545689.1_Missense_Mutation_p.V98D|COL4A6_ENST00000394872.2_Intron|COL4A6_ENST00000538570.1_Missense_Mutation_p.V98D|COL4A6_ENST00000334504.7_Missense_Mutation_p.V98D	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	99	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.V98D(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						AAAGCCAGGAACTCCCATGGG	0.428									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)											1	Substitution - Missense(1)	ovary(1)	X											180.0	157.0	165.0					X																	107462959		2203	4300	6503	107349615	SO:0001583	missense	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.296T>A	X.37:g.107462959A>T	ENSP00000361290:p.Val99Asp	Somatic		Capture	Illumina GAIIx	4	107349615	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	HMMPfam_C4;HMMPfam_Collagen;superfamily_C-type lectin-like	p.V99D	ENST00000372216.4	37	c.296	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	A	11.64	1.699454	0.30142	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19	4.93	3.76	0.43208	.	.	.	.	.	D	0.93044	0.7786	L	0.41415	1.275	0.52099	D	0.999942	D;D;D;D	0.61697	0.971;0.99;0.977;0.971	P;P;P;P	0.62298	0.839;0.839;0.9;0.839	D	0.91378	0.5125	9	0.54805	T	0.06	.	7.8336	0.29358	0.8989:0.0:0.1011:0.0	.	98;98;99;98	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	D	99;98;98;98;98	ENSP00000361290:V99D;ENSP00000334733:V98D;ENSP00000443707:V98D;ENSP00000445236:V98D	ENSP00000334733:V98D	V	-	2	0	COL4A6	107349615	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.546000	0.60705	0.772000	0.33382	0.417000	0.27973	GTT	-	HMMPfam_Collagen		0.428	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	protein_coding	OTTHUMT00000057875.2	A			107349615	-1	no_errors	NM_001847	genbank	human	reviewed	54_36p	missense	SNP	1	T
PRRG1	5638	genome.wustl.edu	37	X	37285167	37285167	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chrX:37285167A>G	ENST00000542554.1	+	4	357	c.85A>G	c.(85-87)Aga>Gga	p.R29G	TM4SF2_ENST00000465127.1_Missense_Mutation_p.R29G|PRRG1_ENST00000491253.1_Intron|PRRG1_ENST00000543642.1_Missense_Mutation_p.R29G|PRRG1_ENST00000463135.1_Missense_Mutation_p.R29G|PRRG1_ENST00000449135.2_Missense_Mutation_p.R29G|PRRG1_ENST00000378628.4_Missense_Mutation_p.R29G	NM_001173489.1	NP_001166960.1	O14668	TMG1_HUMAN	proline rich Gla (G-carboxyglutamic acid) 1	29	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R29G(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	15						TGAAGAAATAAGACAGGGCAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	X											56.0	54.0	54.0					X																	37285167		2202	4299	6501	37170088	SO:0001583	missense	5638			AF009242	CCDS14239.1, CCDS55397.1	Xp21.1	2010-08-13	2004-05-27		ENSG00000130962	ENSG00000130962			9469	protein-coding gene	gene with protein product		604428	"""proline-rich Gla (G-carboxyglutamic acid) polypeptide 1"""			9256434	Standard	NM_000950		Approved	PRGP1	uc004ddo.3	O14668	OTTHUMG00000021360	ENST00000542554.1:c.85A>G	X.37:g.37285167A>G	ENSP00000444278:p.Arg29Gly	Somatic		Capture	Illumina GAIIx	4	37170088	B2R7A3|C9JXL7|D3DWA9|Q5JT66	Missense_Mutation	SNP	-	p.R29G	ENST00000542554.1	37	c.85	CCDS14239.1	X	.	.	.	.	.	.	.	.	.	.	A	15.50	2.851868	0.51270	.	.	ENSG00000130962;ENSG00000130962;ENSG00000130962;ENSG00000130962;ENSG00000130962;ENSG00000130962;ENSG00000130962;ENSG00000250349	ENST00000378628;ENST00000466533;ENST00000542554;ENST00000543642;ENST00000484460;ENST00000449135;ENST00000463135;ENST00000465127	D;D;D;D;D;D;D;D	0.99167	-5.51;-5.51;-5.51;-5.51;-5.51;-5.51;-5.51;-5.51	5.18	5.18	0.71444	Gamma-carboxyglutamic acid-rich (GLA) domain (5);Coagulation factor, subgroup, Gla domain (1);	0.317193	0.36409	N	0.002611	D	0.98261	0.9424	M	0.72118	2.19	0.28709	N	0.903655	B	0.32862	0.387	B	0.40256	0.324	D	0.97641	1.0148	10	0.72032	D	0.01	-13.8288	11.9146	0.52757	1.0:0.0:0.0:0.0	.	29	O14668	TMG1_HUMAN	G	29	ENSP00000367894:R29G;ENSP00000418384:R29G;ENSP00000444278:R29G;ENSP00000443271:R29G;ENSP00000420353:R29G;ENSP00000390332:R29G;ENSP00000419999:R29G;ENSP00000417050:R29G	ENSP00000367894:R29G	R	+	1	2	RP5-972B16.2;PRRG1	37170088	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.678000	0.61641	1.716000	0.51395	0.486000	0.48141	AGA	-	NULL		0.333	PRRG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG1	protein_coding	OTTHUMT00000056228.2	A	NM_000950		37170088	1	no_errors	NM_000950	genbank	human	validated	54_36p	missense	SNP	1	G
PCDH19	57526	genome.wustl.edu	37	X	99551803	99551803	+	Silent	SNP	G	G	A			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chrX:99551803G>A	ENST00000373034.4	-	6	4594	c.2919C>T	c.(2917-2919)ccC>ccT	p.P973P	PCDH19_ENST00000420881.2_Silent_p.P925P|PCDH19_ENST00000464981.1_5'Flank|PCDH19_ENST00000255531.7_Silent_p.P926P	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	973					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P973P(1)|p.P426P(1)		breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TGGGGTTCCGGGGCATCCAGC	0.493																																																2	Substitution - coding silent(2)	ovary(2)	X											62.0	60.0	61.0					X																	99551803		2062	4192	6254	99438459	SO:0001819	synonymous_variant	57526			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.2919C>T	X.37:g.99551803G>A		Somatic		Capture	Illumina GAIIx	4	99438459	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Silent	SNP	-	p.P926	ENST00000373034.4	37	c.2778	CCDS55462.1	X																																																																																			-	NULL		0.493	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	protein_coding	OTTHUMT00000057479.2	G	NM_020766		99438459	-1	no_errors	NM_001105243	genbank	human	validated	54_36p	silent	SNP	1	A
COL4A5	1287	genome.wustl.edu	37	X	107930810	107930810	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0980-01A-01W-0421-09	TCGA-24-0980-10A-01W-0421-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	87d32a92-a8d2-4656-a100-798328338486	f1db2b72-7ba5-42d7-804b-6119bda3e50c	g.chrX:107930810C>T	ENST00000361603.2	+	47	4640	c.4396C>T	c.(4396-4398)Cgc>Tgc	p.R1466C	COL4A5_ENST00000328300.6_Missense_Mutation_p.R1472C	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1466	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.R1466C(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TCTTATTACACGCCACAGCCA	0.522									Alport syndrome with Diffuse Leiomyomatosis																																							2	Substitution - Missense(2)	ovary(1)|endometrium(1)	X											141.0	126.0	131.0					X																	107930810		2203	4300	6503	107817466	SO:0001583	missense	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4396C>T	X.37:g.107930810C>T	ENSP00000354505:p.Arg1466Cys	Somatic		Capture	Illumina GAIIx	4	107817466	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	-	p.R1472C	ENST00000361603.2	37	c.4414	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	C	25.0	4.596920	0.87055	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.94650	-3.48;-3.48	5.58	5.58	0.84498	C-type lectin fold (1);	0.000000	0.85682	D	0.000000	D	0.98216	0.9410	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.99441	1.0938	10	0.87932	D	0	.	18.6316	0.91361	0.0:1.0:0.0:0.0	.	1469;1466	E7EVY4;P29400	.;CO4A5_HUMAN	C	1472;1466;1472	ENSP00000331902:R1472C;ENSP00000354505:R1466C	ENSP00000331902:R1472C	R	+	1	0	COL4A5	107817466	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.805000	0.62561	2.343000	0.79666	0.600000	0.82982	CGC	-	NULL		0.522	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	protein_coding	OTTHUMT00000057880.2	C			107817466	1	no_errors	NM_033380	genbank	human	reviewed	54_36p	missense	SNP	1	T
