#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PADI2	11240	genome.wustl.edu	37	1	17401419	17401419	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr1:17401419G>A	ENST00000375486.4	-	13	1544	c.1481C>T	c.(1480-1482)aCc>aTc	p.T494I	PADI2_ENST00000466151.1_5'UTR|PADI2_ENST00000444885.2_Missense_Mutation_p.T378I	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	494					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)	p.T494I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	GCAGGCCGAGGTGCTGGCCAT	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											63.0	53.0	57.0					1																	17401419		2203	4300	6503	17274006	SO:0001583	missense	11240			AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.1481C>T	1.37:g.17401419G>A	ENSP00000364635:p.Thr494Ile	Somatic		Capture	Illumina GAIIx	4	17274006	Q96DA7|Q9UPN2	Missense_Mutation	SNP	-	p.T494I	ENST00000375486.4	37	c.1481	CCDS177.1	1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.396407	0.83011	.	.	ENSG00000117115	ENST00000375486;ENST00000444885	T;T	0.22134	1.97;1.97	4.65	4.65	0.58169	Protein-arginine deiminase, C-terminal (1);	0.051785	0.85682	D	0.000000	T	0.26484	0.0647	L	0.38175	1.15	0.42050	D	0.99111	B;P	0.43938	0.392;0.822	B;P	0.47673	0.18;0.554	T	0.03315	-1.1049	10	0.87932	D	0	-33.5973	16.6194	0.84926	0.0:0.0:1.0:0.0	.	378;494	B4DIU3;Q9Y2J8	.;PADI2_HUMAN	I	494;378	ENSP00000364635:T494I;ENSP00000405894:T378I	ENSP00000364635:T494I	T	-	2	0	PADI2	17274006	1.000000	0.71417	0.992000	0.48379	0.918000	0.54935	7.827000	0.86722	2.570000	0.86706	0.561000	0.74099	ACC	-	NULL		0.592	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI2	protein_coding	OTTHUMT00000006624.1	G			17274006	-1	no_errors	NM_007365	genbank	human	reviewed	54_36p	missense	SNP	1	A
LRIG2	9860	genome.wustl.edu	37	1	113657287	113657287	+	Silent	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr1:113657287G>A	ENST00000361127.5	+	15	2517	c.2319G>A	c.(2317-2319)ggG>ggA	p.G773G	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	773	Ig-like C2-type 3.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G773G(1)		breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		ACACCCTTGGGACAGAACGTG	0.463																																																1	Substitution - coding silent(1)	ovary(1)	1											185.0	162.0	170.0					1																	113657287		2203	4300	6503	113458810	SO:0001819	synonymous_variant	9860			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.2319G>A	1.37:g.113657287G>A		Somatic		Capture	Illumina GAIIx	4	113458810	Q9NSN2	Silent	SNP	-	p.G773	ENST00000361127.5	37	c.2319	CCDS30808.1	1																																																																																			-	NULL		0.463	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	protein_coding	OTTHUMT00000033549.2	G	NM_014813		113458810	1	no_errors	NM_014813	genbank	human	provisional	54_36p	silent	SNP	0.98	A
WNT4	54361	genome.wustl.edu	37	1	22453784	22453784	+	Intron	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr1:22453784G>A	ENST00000290167.6	-	2	357				WNT4_ENST00000542383.1_Intron	NM_030761.4	NP_110388.2	P56705	WNT4_HUMAN	wingless-type MMTV integration site family, member 4						adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|embryonic epithelial tube formation (GO:0001838)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization to plasma membrane (GO:0090002)|female gonad development (GO:0008585)|female sex determination (GO:0030237)|immature T cell proliferation in thymus (GO:0033080)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|mammary gland epithelium development (GO:0061180)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric nephron morphogenesis (GO:0072273)|metanephric tubule formation (GO:0072174)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of gene expression (GO:0010629)|negative regulation of male gonad development (GO:2000019)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of testicular blood vessel morphogenesis (GO:0061369)|negative regulation of testosterone biosynthetic process (GO:2000225)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of wound healing (GO:0061045)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via MAPK cascade (GO:0038030)|oocyte development (GO:0048599)|paramesonephric duct development (GO:0061205)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cortisol biosynthetic process (GO:2000066)|positive regulation of dermatome development (GO:0061184)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of meiosis (GO:0045836)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|protein palmitoylation (GO:0018345)|regulation of cell-cell adhesion (GO:0022407)|renal vesicle formation (GO:0072033)|renal vesicle induction (GO:0072034)|smooth muscle cell differentiation (GO:0051145)|somatotropin secreting cell differentiation (GO:0060126)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	8		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		ATGCTGAGCCGGTGTGGGTGC	0.587																																																0			1											17.0	16.0	16.0					1																	22453784		876	1991	2867	22326371	SO:0001627	intron_variant	54361			AL031281	CCDS223.1	1p36.23-p35.1	2013-02-28			ENSG00000162552	ENSG00000162552		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12783	protein-coding gene	gene with protein product		603490				8168088	Standard	NM_030761		Approved	WNT-4	uc001bfs.4	P56705	OTTHUMG00000002894	ENST00000290167.6:c.313+2324C>T	1.37:g.22453784G>A		Somatic		Capture	Illumina GAIIx	4	22326371	B4DJF9|Q5TZQ0|Q96T81|Q9BXF5|Q9H1J8|Q9UJM2	Silent	SNP	-	p.T168	ENST00000290167.6	37	c.504	CCDS223.1	1	.	.	.	.	.	.	.	.	.	.	G	2.288	-0.363097	0.05103	.	.	ENSG00000162552	ENST00000415567	.	.	.	3.74	-1.62	0.08372	.	.	.	.	.	T	0.21718	0.0523	.	.	.	0.19300	N	0.999974	.	.	.	.	.	.	T	0.28004	-1.0057	4	.	.	.	.	4.0145	0.09637	0.4961:0.1856:0.3183:0.0	.	.	.	.	W	143	.	.	R	-	1	2	WNT4	22326371	0.000000	0.05858	0.003000	0.11579	0.002000	0.02628	-0.718000	0.04980	-0.276000	0.09206	-1.079000	0.02226	CGG	-	NULL		0.587	WNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT4	protein_coding	OTTHUMT00000008088.2	G			22326371	-1	no_errors	ENST00000374655	ensembl	human	known	54_36p	silent	SNP		A
COL16A1	1307	genome.wustl.edu	37	1	32163510	32163510	+	Silent	SNP	G	G	C			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr1:32163510G>C	ENST00000373672.3	-	6	1170	c.654C>G	c.(652-654)gtC>gtG	p.V218V	COL16A1_ENST00000373668.3_Silent_p.V218V|COL16A1_ENST00000271069.6_Silent_p.V218V	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	218	Laminin G-like.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.V218V(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CACTCACCGAGACAGGCTTGC	0.597																																					Colon(143;498 1786 21362 25193 36625)											1	Substitution - coding silent(1)	ovary(1)	1											53.0	56.0	55.0					1																	32163510		1973	4116	6089	31936097	SO:0001819	synonymous_variant	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.654C>G	1.37:g.32163510G>C		Somatic		Capture	Illumina GAIIx	4	31936097	Q16593|Q59F89|Q71RG9	Silent	SNP	-	p.V218	ENST00000373672.3	37	c.654	CCDS41297.1	1																																																																																			-	NULL		0.597	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	protein_coding	OTTHUMT00000011057.2	G	NM_001856		31936097	-1	no_errors	NM_001856	genbank	human	reviewed	54_36p	silent	SNP	0.13	C
RGS21	431704	genome.wustl.edu	37	1	192316515	192316515	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr1:192316515C>A	ENST00000417209.2	+	3	258	c.84C>A	c.(82-84)aaC>aaA	p.N28K		NM_001039152.3	NP_001034241.1	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	28	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.N28K(1)		NS(1)|endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	15						TTTTAGCCAACCAAGGTAAGA	0.303																																																1	Substitution - Missense(1)	ovary(1)	1											121.0	114.0	116.0					1																	192316515		1820	4079	5899	190583138	SO:0001583	missense	431704			AY643711	CCDS41448.1	1q31.2	2013-09-24	2007-08-14		ENSG00000253148	ENSG00000253148		"""Regulators of G-protein signaling"""	26839	protein-coding gene	gene with protein product		612407	"""regulator of G-protein signalling 21"""			15066150	Standard	NM_001039152		Approved		uc001gsh.3	Q2M5E4	OTTHUMG00000035594	ENST00000417209.2:c.84C>A	1.37:g.192316515C>A	ENSP00000428343:p.Asn28Lys	Somatic		Capture	Illumina GAIIx	4	190583138		Missense_Mutation	SNP	-	p.N28K	ENST00000417209.2	37	c.84	CCDS41448.1	1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.742325	0.30865	.	.	ENSG00000253148	ENST00000417209	T	0.32753	1.44	6.08	-4.77	0.03219	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.36234	U	0.002715	T	0.20861	0.0502	L	0.48877	1.53	0.27291	N	0.957833	P	0.52316	0.952	B	0.37267	0.245	T	0.16897	-1.0387	10	0.45353	T	0.12	.	15.2697	0.73689	0.0:0.2703:0.0:0.7297	.	28	Q2M5E4	RGS21_HUMAN	K	28	ENSP00000428343:N28K	ENSP00000428343:N28K	N	+	3	2	RGS21	190583138	0.259000	0.24043	0.529000	0.27951	0.432000	0.31715	-0.597000	0.05713	-1.438000	0.01965	-0.218000	0.12543	AAC	-	NULL		0.303	RGS21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS21	protein_coding	OTTHUMT00000086387.2	C			190583138	1	no_errors	NM_001039152	genbank	human	provisional	54_36p	missense	SNP	0.96	A
MBL2	4153	genome.wustl.edu	37	10	54531252	54531252	+	Silent	SNP	G	G	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr10:54531252G>T	ENST00000373968.3	-	1	208	c.144C>A	c.(142-144)ggC>ggA	p.G48G		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	48	Collagen-like.				acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)	p.G48G(1)		breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						GCCCATCTTTGCCTGGGAAGC	0.542																																																1	Substitution - coding silent(1)	ovary(1)	10											127.0	114.0	119.0					10																	54531252		2203	4300	6503	54201258	SO:0001819	synonymous_variant	4153			AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.144C>A	10.37:g.54531252G>T		Somatic		Capture	Illumina GAIIx	4	54201258	Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	Silent	SNP	HMMPfam_Lectin_C;HMMPfam_Collagen;superfamily_C-type lectin-like	p.G48	ENST00000373968.3	37	c.144	CCDS7247.1	10																																																																																			-	NULL		0.542	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBL2	protein_coding	OTTHUMT00000048115.1	G	NM_000242		54201258	-1	no_errors	NM_000242	genbank	human	reviewed	54_36p	silent	SNP	1	T
DOCK1	1793	genome.wustl.edu	37	10	129172467	129172467	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr10:129172467G>A	ENST00000280333.6	+	35	3710	c.3601G>A	c.(3601-3603)Gtc>Atc	p.V1201I		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1201					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.V1201I(2)		NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		GAGCTGCACCGTCAATGTGCT	0.443																																																2	Substitution - Missense(2)	ovary(1)|central_nervous_system(1)	10											56.0	56.0	56.0					10																	129172467		1964	4167	6131	129062457	SO:0001583	missense	1793			D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.3601G>A	10.37:g.129172467G>A	ENSP00000280333:p.Val1201Ile	Somatic		Capture	Illumina GAIIx	4	129062457	A9Z1Z5	Missense_Mutation	SNP	-	p.V1267I	ENST00000280333.6	37	c.3799		10	.	.	.	.	.	.	.	.	.	.	G	28.1	4.894732	0.91962	.	.	ENSG00000150760	ENST00000280333	T	0.38240	1.15	5.52	5.52	0.82312	.	0.071608	0.56097	D	0.000037	T	0.60932	0.2307	M	0.87097	2.86	0.80722	D	1	D;D;D	0.69078	0.994;0.995;0.997	P;P;P	0.54544	0.755;0.559;0.693	T	0.67654	-0.5615	10	0.72032	D	0.01	.	19.2287	0.93829	0.0:0.0:1.0:0.0	.	1201;1267;1201	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	I	1201	ENSP00000280333:V1201I	ENSP00000280333:V1201I	V	+	1	0	DOCK1	129062457	1.000000	0.71417	0.961000	0.40146	0.795000	0.44927	9.575000	0.98187	2.878000	0.98634	0.650000	0.86243	GTC	-	NULL		0.443	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	DOCK1	protein_coding	OTTHUMT00000050979.2	G	NM_001380		129062457	1	no_errors	ENST00000398025	ensembl	human	known	54_36p	missense	SNP	1	A
SLC17A6	57084	genome.wustl.edu	37	11	22398211	22398211	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr11:22398211A>G	ENST00000263160.3	+	11	1843	c.1406A>G	c.(1405-1407)aAg>aGg	p.K469R		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	469					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.K469R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						GCAATGACAAAGAATAAGGTA	0.348																																																1	Substitution - Missense(1)	ovary(1)	11											177.0	154.0	162.0					11																	22398211		2203	4300	6503	22354787	SO:0001583	missense	57084			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1406A>G	11.37:g.22398211A>G	ENSP00000263160:p.Lys469Arg	Somatic		Capture	Illumina GAIIx	4	22354787	A6NKS2	Missense_Mutation	SNP	HMMPfam_MFS_1;superfamily_MFS general substrate transporter	p.K469R	ENST00000263160.3	37	c.1406	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	A	17.60	3.430702	0.62844	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.54675	0.56	5.91	5.91	0.95273	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.48892	0.1525	L	0.49256	1.55	0.80722	D	1	B	0.11235	0.004	B	0.15484	0.013	T	0.38779	-0.9645	10	0.25106	T	0.35	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	469	Q9P2U8	VGLU2_HUMAN	R	469;357	ENSP00000263160:K469R	ENSP00000263160:K469R	K	+	2	0	SLC17A6	22354787	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.339000	0.96797	2.254000	0.74563	0.533000	0.62120	AAG	-	HMMPfam_MFS_1		0.348	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	protein_coding	OTTHUMT00000387671.1	A	NM_020346		22354787	1	no_errors	NM_020346	genbank	human	validated	54_36p	missense	SNP	1	G
TUB	7275	genome.wustl.edu	37	11	8122521	8122521	+	Missense_Mutation	SNP	T	T	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr11:8122521T>A	ENST00000299506.2	+	11	1513	c.1364T>A	c.(1363-1365)tTc>tAc	p.F455Y	TUB_ENST00000305253.4_Missense_Mutation_p.F510Y|TUB_ENST00000534099.1_Missense_Mutation_p.F461Y	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	455					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)	p.F510Y(1)		breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		GTGAAGAACTTCCAGATCATC	0.517																																																1	Substitution - Missense(1)	ovary(1)	11											183.0	155.0	164.0					11																	8122521		2201	4296	6497	8079097	SO:0001583	missense	7275			U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.1364T>A	11.37:g.8122521T>A	ENSP00000299506:p.Phe455Tyr	Somatic		Capture	Illumina GAIIx	4	8079097	D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	HMMPfam_Tub;superfamily_Transcriptional factor tubby C-terminal domain	p.F510Y	ENST00000299506.2	37	c.1529	CCDS7787.1	11	.	.	.	.	.	.	.	.	.	.	T	33	5.219874	0.95139	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.91792	-2.91;-2.91;-2.91	5.43	5.43	0.79202	Tubby, C-terminal (4);Tubby, C-terminal, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97284	0.9112	H	0.95679	3.705	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98507	1.0617	10	0.87932	D	0	-8.8011	15.7477	0.77958	0.0:0.0:0.0:1.0	.	461;455;510	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	Y	461;510;455	ENSP00000434400:F461Y;ENSP00000305426:F510Y;ENSP00000299506:F455Y	ENSP00000299506:F455Y	F	+	2	0	TUB	8079097	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.187000	0.69744	0.533000	0.62120	TTC	-	HMMPfam_Tub		0.517	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TUB	protein_coding	OTTHUMT00000385823.1	T	NM_003320		8079097	1	no_errors	NM_003320	genbank	human	reviewed	54_36p	missense	SNP	1	A
TP53I11	9537	genome.wustl.edu	37	11	44956477	44956477	+	Missense_Mutation	SNP	A	A	C			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr11:44956477A>C	ENST00000533940.1	-	10	1132	c.528T>G	c.(526-528)atT>atG	p.I176M	TP53I11_ENST00000308212.5_Missense_Mutation_p.I176M|TP53I11_ENST00000525680.1_Missense_Mutation_p.I176M|TP53I11_ENST00000531130.2_5'Flank|TP53I11_ENST00000395648.3_Missense_Mutation_p.I176M	NM_001258320.1	NP_001245249.1	O14683	P5I11_HUMAN	tumor protein p53 inducible protein 11	176					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)		p.I176M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(1)	5						AATAGTAGTAAATGCTGATGA	0.632																																																1	Substitution - Missense(1)	ovary(1)	11											101.0	99.0	100.0					11																	44956477		2203	4299	6502	44913053	SO:0001583	missense	9537			AF010315	CCDS7911.1	11p11.2	2005-09-22				ENSG00000175274			16842	protein-coding gene	gene with protein product						9305847	Standard	NM_006034		Approved	PIG11	uc001myk.3	O14683		ENST00000533940.1:c.528T>G	11.37:g.44956477A>C	ENSP00000436152:p.Ile176Met	Somatic		Capture	Illumina GAIIx	4	44913053	Q3ZCS0	Missense_Mutation	SNP	-	p.I176M	ENST00000533940.1	37	c.528	CCDS7911.1	11	.	.	.	.	.	.	.	.	.	.	A	11.40	1.626136	0.28978	.	.	ENSG00000175274	ENST00000395648;ENST00000308212;ENST00000308220;ENST00000533940;ENST00000525680	.	.	.	5.1	1.43	0.22495	.	.	.	.	.	T	0.27419	0.0673	N	0.12182	0.205	0.38723	D	0.953483	B;B	0.06786	0.001;0.001	B;B	0.13407	0.009;0.004	T	0.06250	-1.0837	8	0.21014	T	0.42	.	4.3094	0.10964	0.5664:0.1662:0.2674:0.0	.	123;176	Q8N8U5;O14683	.;P5I11_HUMAN	M	176;176;123;176;176	.	ENSP00000309532:I176M	I	-	3	3	TP53I11	44913053	0.989000	0.36119	0.978000	0.43139	0.872000	0.50106	0.329000	0.19698	0.003000	0.14656	0.454000	0.30748	ATT	-	NULL		0.632	TP53I11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TP53I11	protein_coding	OTTHUMT00000389909.1	A	NM_006034		44913053	-1	no_errors	NM_001076787	genbank	human	validated	54_36p	missense	SNP	1	C
KCNA5	3741	genome.wustl.edu	37	12	5153871	5153871	+	Silent	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr12:5153871G>A	ENST00000252321.3	+	1	787	c.558G>A	c.(556-558)cgG>cgA	p.R186R		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	186					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)	p.R186R(2)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GCCGCCTGCGGAGGCCGGTCA	0.637																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	12											36.0	40.0	39.0					12																	5153871		2203	4300	6503	5024132	SO:0001819	synonymous_variant	3741			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.558G>A	12.37:g.5153871G>A		Somatic		Capture	Illumina GAIIx	4	5024132	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Silent	SNP	HMMPfam_K_tetra;HMMPfam_Ion_trans;superfamily_POZ domain;superfamily_Voltage-gated potassium channels	p.R186	ENST00000252321.3	37	c.558	CCDS8536.1	12																																																																																			-	HMMPfam_K_tetra		0.637	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	protein_coding	OTTHUMT00000398925.2	G	NM_002234		5024132	1	no_errors	NM_002234	genbank	human	reviewed	54_36p	silent	SNP	0.98	A
POSTN	10631	genome.wustl.edu	37	13	38138662	38138663	+	Frame_Shift_Ins	INS	-	-	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr13:38138662_38138663insT	ENST00000379747.4	-	22	2583_2584	c.2466_2467insA	c.(2464-2469)aaagttfs	p.V823fs	POSTN_ENST00000379749.4_Frame_Shift_Ins_p.V795fs|POSTN_ENST00000379742.4_Frame_Shift_Ins_p.V766fs|POSTN_ENST00000541179.1_Frame_Shift_Ins_p.V768fs|POSTN_ENST00000541481.1_Frame_Shift_Ins_p.V736fs|POSTN_ENST00000379743.4_Frame_Shift_Ins_p.V796fs	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	823					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)	p.V823fs*5(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TTACCTTGAACTTTTTTGTTGG	0.332																																																1	Insertion - Frameshift(1)	ovary(1)	13																																								37036663	SO:0001589	frameshift_variant	10631			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.2467dupA	13.37:g.38138668_38138668dupT	ENSP00000369071:p.Val823fs	Somatic		Capture	Illumina GAIIx	Phase_III	37036662	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Frame_Shift_Ins	INS	HMMPfam_Fasciclin,HMMPfam_EMI,superfamily_FAS1 domain	p.V822fs	ENST00000379747.4	37	c.2467_2466	CCDS9364.1	13																																																																																			-	NULL		0.332	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POSTN	protein_coding	OTTHUMT00000044566.2	-	NM_006475		37036663	-1	no_errors	NM_006475	genbank	human	validated	54_36p	frame_shift_ins	INS	0.975:0.976	T
MYO16	23026	genome.wustl.edu	37	13	109318424	109318424	+	Silent	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr13:109318424G>A	ENST00000357550.2	+	1	194	c.153G>A	c.(151-153)gcG>gcA	p.A51A	MYO16_ENST00000251041.5_Silent_p.A51A|MYO16_ENST00000356711.2_Silent_p.A51A	NM_001198950.1	NP_001185879.1			myosin XVI									p.A51A(2)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TGAAGCATGCGAAGAATCCGA	0.478																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	13											76.0	67.0	70.0					13																	109318424		2203	4300	6503	108116425	SO:0001819	synonymous_variant	23026				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.153G>A	13.37:g.109318424G>A		Somatic		Capture	Illumina GAIIx	4	108116425		Silent	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Ank;superfamily_Ankyrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.A51	ENST00000357550.2	37	c.153	CCDS32008.1	13																																																																																			-	NULL		0.478	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	protein_coding	OTTHUMT00000045746.1	G	NM_015011		108116425	1	no_errors	NM_015011	genbank	human	validated	54_36p	silent	SNP	0.01	A
PSMB5	5693	genome.wustl.edu	37	14	23504059	23504059	+	Missense_Mutation	SNP	A	A	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr14:23504059A>T	ENST00000361611.6	-	1	295	c.32T>A	c.(31-33)cTa>cAa	p.L11Q	PSMB5_ENST00000425762.2_Intron|PSMB5_ENST00000460922.2_Missense_Mutation_p.L11Q|PSMB5_ENST00000493471.2_Missense_Mutation_p.L11Q|AL132780.1_ENST00000385031.1_RNA	NM_002797.3	NP_002788.1	P28074	PSB5_HUMAN	proteasome (prosome, macropain) subunit, beta type, 5	11					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to oxidative stress (GO:0006979)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)	p.L11Q(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)|Carfilzomib(DB08889)	GTTCACCGGTAGCGGTCTCTC	0.597																																																1	Substitution - Missense(1)	ovary(1)	14											43.0	41.0	42.0					14																	23504059		2203	4300	6503	22573899	SO:0001583	missense	5693			D29011	CCDS9584.1, CCDS45083.1, CCDS45084.1	14q11.2	2008-08-29			ENSG00000100804	ENSG00000100804		"""Proteasome (prosome, macropain) subunits"""	9542	protein-coding gene	gene with protein product		600306				8066462, 8811196	Standard	NM_001130725		Approved	X, MB1	uc001wii.3	P28074	OTTHUMG00000028713	ENST00000361611.6:c.32T>A	14.37:g.23504059A>T	ENSP00000355325:p.Leu11Gln	Somatic		Capture	Illumina GAIIx	4	22573899	B2R4N9|B4DUM9|D3DS43|E9PAV2|Q16242|Q6PEW2|Q7Z3B5|Q86T01|Q9TNN9	Missense_Mutation	SNP	-	p.L11Q	ENST00000361611.6	37	c.32	CCDS9584.1	14	.	.	.	.	.	.	.	.	.	.	A	15.34	2.805368	0.50315	.	.	ENSG00000100804	ENST00000361611;ENST00000493471;ENST00000460922	T;T;T	0.55413	0.52;0.52;0.52	5.22	5.22	0.72569	.	0.626565	0.15106	N	0.280242	T	0.48114	0.1482	N	0.24115	0.695	0.80722	D	1	P;B	0.48503	0.911;0.151	P;B	0.49332	0.607;0.149	T	0.33394	-0.9870	10	0.27785	T	0.31	-1.7546	14.0914	0.64993	1.0:0.0:0.0:0.0	.	11;11	P28074-2;P28074	.;PSB5_HUMAN	Q	11	ENSP00000355325:L11Q;ENSP00000452424:L11Q;ENSP00000451286:L11Q	ENSP00000334973:L11Q	L	-	2	0	PSMB5	22573899	0.995000	0.38212	0.898000	0.35279	0.845000	0.48019	5.589000	0.67523	1.967000	0.57214	0.454000	0.30748	CTA	-	NULL		0.597	PSMB5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB5	protein_coding	OTTHUMT00000071695.4	A	NM_002797		22573899	-1	no_errors	NM_002797	genbank	human	reviewed	54_36p	missense	SNP	0.98	T
DLGAP5	9787	genome.wustl.edu	37	14	55642645	55642645	+	Missense_Mutation	SNP	A	A	C			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr14:55642645A>C	ENST00000247191.2	-	9	1357	c.1141T>G	c.(1141-1143)Tgt>Ggt	p.C381G	DLGAP5_ENST00000395425.2_Missense_Mutation_p.C381G	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	381					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)	p.C381G(1)		biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						CCCAAAGGACATGGCAATTTA	0.284																																																1	Substitution - Missense(1)	ovary(1)	14											167.0	155.0	159.0					14																	55642645		2203	4298	6501	54712398	SO:0001583	missense	9787			D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.1141T>G	14.37:g.55642645A>C	ENSP00000247191:p.Cys381Gly	Somatic		Capture	Illumina GAIIx	4	54712398	A8MTM6|B4DRM8|Q86T11|Q8NG58	Missense_Mutation	SNP	-	p.C381G	ENST00000247191.2	37	c.1141	CCDS9723.1	14	.	.	.	.	.	.	.	.	.	.	A	3.462	-0.109767	0.06924	.	.	ENSG00000126787	ENST00000395425;ENST00000247191	T;T	0.16073	2.37;2.37	4.69	1.12	0.20585	.	0.940554	0.08988	N	0.864844	T	0.15176	0.0366	L	0.57536	1.79	0.09310	N	1	P;P	0.39044	0.656;0.528	B;B	0.36378	0.207;0.223	T	0.25641	-1.0126	10	0.20046	T	0.44	.	6.4174	0.21723	0.7107:0.0:0.2893:0.0	.	381;381	A8MTM6;Q15398	.;DLGP5_HUMAN	G	381	ENSP00000378815:C381G;ENSP00000247191:C381G	ENSP00000247191:C381G	C	-	1	0	DLGAP5	54712398	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.218000	0.09240	0.189000	0.20188	-0.256000	0.11100	TGT	-	NULL		0.284	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP5	protein_coding	OTTHUMT00000276908.2	A	NM_014750		54712398	-1	no_errors	NM_014750	genbank	human	provisional	54_36p	missense	SNP	0.01	C
DUOXA2	405753	genome.wustl.edu	37	15	45410236	45410236	+	3'UTR	SNP	C	C	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr15:45410236C>T	ENST00000323030.5	+	0	1377				DUOXA1_ENST00000430224.2_Silent_p.A296A|DUOXA1_ENST00000267803.4_Silent_p.A341A|DUOXA1_ENST00000558996.1_3'UTR|DUOXA1_ENST00000559014.1_Silent_p.A341A	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2						hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.A341A(1)					all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		CTCGGACATCCGCAGGCACCA	0.547											OREG0023102	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	15											17.0	20.0	19.0					15																	45410236		2173	4226	6399	43197528	SO:0001624	3_prime_UTR_variant	90527			BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.*129C>T	15.37:g.45410236C>T		Somatic	931	Capture	Illumina GAIIx	4	43197528	B2RPI9|H0YNQ6	Silent	SNP	-	p.A341	ENST00000323030.5	37	c.1023	CCDS10118.2	15																																																																																			-	NULL		0.547	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUOXA1	protein_coding	OTTHUMT00000254142.1	C	NM_207581		43197528	-1	no_errors	NM_144565	genbank	human	provisional	54_36p	silent	SNP		T
GLCE	26035	genome.wustl.edu	37	15	69561147	69561147	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr15:69561147C>T	ENST00000261858.2	+	5	1646	c.1418C>T	c.(1417-1419)gCa>gTa	p.A473V	GLCE_ENST00000559420.2_Missense_Mutation_p.A409V	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	473					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)	p.A473V(1)		NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						GCTTTAAGGGCAACAGCCCCT	0.418																																																1	Substitution - Missense(1)	ovary(1)	15											58.0	64.0	62.0					15																	69561147		2200	4298	6498	67348201	SO:0001583	missense	26035			AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.1418C>T	15.37:g.69561147C>T	ENSP00000261858:p.Ala473Val	Somatic		Capture	Illumina GAIIx	4	67348201	Q6GUQ2	Missense_Mutation	SNP	HMMPfam_C5-epim_C	p.A473V	ENST00000261858.2	37	c.1418	CCDS32277.1	15	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580314	0.86645	.	.	ENSG00000138604	ENST00000261858	T	0.50548	0.74	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.67720	0.2923	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.69347	-0.5169	10	0.56958	D	0.05	-15.3981	17.5279	0.87805	0.0:1.0:0.0:0.0	.	473	O94923	GLCE_HUMAN	V	473	ENSP00000261858:A473V	ENSP00000261858:A473V	A	+	2	0	GLCE	67348201	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.687000	0.84139	2.479000	0.83701	0.557000	0.71058	GCA	-	HMMPfam_C5-epim_C		0.418	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GLCE	protein_coding		C	NM_015554		67348201	1	no_errors	NM_015554	genbank	human	validated	54_36p	missense	SNP	1	T
SCAMP5	192683	genome.wustl.edu	37	15	75308997	75308997	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr15:75308997G>A	ENST00000361900.6	+	5	407	c.200G>A	c.(199-201)gGa>gAa	p.G67E	SCAMP5_ENST00000425597.3_Missense_Mutation_p.G67E|SCAMP5_ENST00000562212.1_Missense_Mutation_p.G67E|SCAMP5_ENST00000565923.1_3'UTR|SCAMP5_ENST00000545456.1_Intron|SCAMP5_ENST00000568081.1_5'Flank	NM_001178111.1	NP_001171582.1	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	67					exocytosis (GO:0006887)|negative regulation of endocytosis (GO:0045806)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of cytokine secretion (GO:0050715)|protein transport (GO:0015031)|response to endoplasmic reticulum stress (GO:0034976)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)|trans-Golgi network membrane (GO:0032588)		p.G67E(1)		large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	5						GGAGGCGGGGGAGCCACCAAC	0.592																																																1	Substitution - Missense(1)	ovary(1)	15											120.0	126.0	124.0					15																	75308997		2153	4256	6409	73096050	SO:0001583	missense	192683			AL833230	CCDS45306.1	15q24.2	2014-05-20			ENSG00000198794	ENSG00000198794		"""Secretory carrier membrane proteins"""	30386	protein-coding gene	gene with protein product		613766				12477932	Standard	NM_001178111		Approved	MGC24969	uc002azk.2	Q8TAC9	OTTHUMG00000172704	ENST00000361900.6:c.200G>A	15.37:g.75308997G>A	ENSP00000355387:p.Gly67Glu	Somatic		Capture	Illumina GAIIx	4	73096050	B3KPJ7|B7Z762|D3DW71|Q8N3M4	Missense_Mutation	SNP	HMMPfam_SCAMP	p.G67E	ENST00000361900.6	37	c.200	CCDS45306.1	15	.	.	.	.	.	.	.	.	.	.	G	19.13	3.768773	0.69878	.	.	ENSG00000198794	ENST00000361900;ENST00000425597	T;T	0.15952	2.38;2.38	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.28699	0.0711	L	0.46885	1.475	0.80722	D	1	D;B	0.63046	0.992;0.434	P;P	0.59825	0.864;0.507	T	0.02519	-1.1147	10	0.10111	T	0.7	-9.244	17.294	0.87164	0.0:0.0:1.0:0.0	.	67;67	Q8TAC9-2;Q8TAC9	.;SCAM5_HUMAN	E	67	ENSP00000355387:G67E;ENSP00000406547:G67E	ENSP00000355387:G67E	G	+	2	0	SCAMP5	73096050	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.614000	0.74197	2.391000	0.81399	0.561000	0.74099	GGA	-	HMMPfam_SCAMP		0.592	SCAMP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAMP5	protein_coding	OTTHUMT00000420015.2	G	NM_138967		73096050	1	no_errors	NM_138967	genbank	human	validated	54_36p	missense	SNP	1	A
ZKSCAN2	342357	genome.wustl.edu	37	16	25266695	25266695	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr16:25266695G>C	ENST00000328086.7	-	2	1221	c.418C>G	c.(418-420)Cgg>Ggg	p.R140G		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	140					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R140G(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		TGCTTCTCCCGGTGCACGGGA	0.567																																																1	Substitution - Missense(1)	ovary(1)	16											38.0	35.0	36.0					16																	25266695		2197	4300	6497	25174196	SO:0001583	missense	342357			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.418C>G	16.37:g.25266695G>C	ENSP00000331626:p.Arg140Gly	Somatic		Capture	Illumina GAIIx	4	25174196	A1L3B4|Q6ZN77	Missense_Mutation	SNP	-	p.R140G	ENST00000328086.7	37	c.418	CCDS32410.1	16	.	.	.	.	.	.	.	.	.	.	G	0.106	-1.145088	0.01714	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	T	0.13089	2.62	4.77	1.17	0.20885	Transcription regulator SCAN (1);	1.266630	0.05322	N	0.526708	T	0.06096	0.0158	N	0.08118	0	0.09310	N	1	B;B	0.12630	0.0;0.006	B;B	0.10450	0.005;0.003	T	0.39440	-0.9614	10	0.16896	T	0.51	0.4572	1.2547	0.01989	0.5265:0.1765:0.1017:0.1954	.	140;140	Q63HK3-2;Q63HK3	.;ZKSC2_HUMAN	G	140	ENSP00000331626:R140G	ENSP00000331626:R140G	R	-	1	2	ZKSCAN2	25174196	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.753000	0.26376	0.063000	0.16370	-0.410000	0.06199	CGG	-	NULL		0.567	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN2	protein_coding	OTTHUMT00000435739.1	G	NM_001012981		25174196	-1	no_errors	NM_001012981	genbank	human	validated	54_36p	missense	SNP		C
TP53	7157	genome.wustl.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	17	GRCh37	CM010465|CM900211	TP53	M	rs121912651						151.0	112.0	125.0					17																	7577539		2203	4300	6503	7518264	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp	Somatic		Capture	Illumina GAIIx	4	7518264	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R248W	ENST00000269305.4	37	c.742	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	-	HMMPfam_P53		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7518264	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	A
BCAS3	54828	genome.wustl.edu	37	17	58804589	58804589	+	Intron	SNP	C	C	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr17:58804589C>T	ENST00000390652.5	+	5	352				BCAS3_ENST00000408905.3_Intron|BCAS3_ENST00000588462.1_Intron|BCAS3_ENST00000407086.3_Intron|BCAS3_ENST00000589222.1_Intron	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3									p.Q85Q(1)		NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GCTTACATCTCTGAATGACCA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	17																																								56159371	SO:0001627	intron_variant	729621			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.321+17903C>T	17.37:g.58804589C>T		Somatic		Capture	Illumina GAIIx	4	56159371		Silent	SNP	-	p.Q85	ENST00000390652.5	37	c.255	CCDS45749.1	17																																																																																			-	NULL		0.418	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC729621	protein_coding	OTTHUMT00000449578.1	C	NM_017679		56159371	-1	pseudogene	XM_001133900	genbank	human	model	54_36p	silent	SNP	1	T
CCDC40	55036	genome.wustl.edu	37	17	78061473	78061473	+	Silent	SNP	C	C	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr17:78061473C>T	ENST00000397545.4	+	15	2544	c.2517C>T	c.(2515-2517)gaC>gaT	p.D839D	CCDC40_ENST00000374877.3_Silent_p.D839D	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	839					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.D839D(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			TGGACAACGACCTGAAGAAGC	0.522																																																1	Substitution - coding silent(1)	ovary(1)	17											77.0	89.0	85.0					17																	78061473		2079	4218	6297	75676068	SO:0001819	synonymous_variant	55036			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2517C>T	17.37:g.78061473C>T		Somatic		Capture	Illumina GAIIx	4	75676068	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Silent	SNP	-	p.D839	ENST00000397545.4	37	c.2517	CCDS42395.1	17																																																																																			-	NULL		0.522	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	protein_coding	OTTHUMT00000256005.2	C	XM_371082		75676068	1	no_errors	NM_017950	genbank	human	validated	54_36p	silent	SNP	1	T
PDE11A	50940	genome.wustl.edu	37	2	178936480	178936480	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr2:178936480C>T	ENST00000286063.6	-	1	1002	c.685G>A	c.(685-687)Gtc>Atc	p.V229I	PDE11A_ENST00000358450.4_Intron	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	229	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)	p.V229I(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	ATAAGGCAGACAAAGATGAGA	0.473									Primary Pigmented Nodular Adrenocortical Disease, Familial																																							1	Substitution - Missense(1)	ovary(1)	2											98.0	84.0	89.0					2																	178936480		2203	4300	6503	178644726	SO:0001583	missense	50940	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.685G>A	2.37:g.178936480C>T	ENSP00000286063:p.Val229Ile	Somatic		Capture	Illumina GAIIx	4	178644726	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	HMMPfam_PDEase_I;HMMPfam_GAF;superfamily_HD-domain/PDEase-like;superfamily_GAF domain-like	p.V229I	ENST00000286063.6	37	c.685	CCDS33334.1	2	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745490	0.89663	.	.	ENSG00000128655	ENST00000286063	T	0.69306	-0.39	5.52	5.52	0.82312	GAF (2);	0.170306	0.53938	D	0.000060	T	0.75708	0.3886	L	0.49571	1.57	0.80722	D	1	D	0.59357	0.985	P	0.60345	0.873	T	0.73216	-0.4053	10	0.36615	T	0.2	.	18.4131	0.90559	0.0:1.0:0.0:0.0	.	229	Q9HCR9	PDE11_HUMAN	I	229	ENSP00000286063:V229I	ENSP00000286063:V229I	V	-	1	0	PDE11A	178644726	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.730000	0.68546	2.590000	0.87494	0.655000	0.94253	GTC	-	HMMPfam_GAF		0.473	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE11A	protein_coding	OTTHUMT00000334313.2	C			178644726	-1	no_errors	NM_016953	genbank	human	reviewed	54_36p	missense	SNP	1	T
SPAG16	79582	genome.wustl.edu	37	2	214228856	214228856	+	Silent	SNP	T	T	C			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr2:214228856T>C	ENST00000331683.5	+	8	914	c.819T>C	c.(817-819)ggT>ggC	p.G273G	SPAG16_ENST00000414961.2_3'UTR|SPAG16_ENST00000272898.7_Silent_p.G273G|SPAG16_ENST00000413312.1_Silent_p.G242G|SPAG16_ENST00000447990.1_Silent_p.G273G|SPAG16_ENST00000374309.3_Silent_p.G179G	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	273					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.G273G(1)		endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GTTACCATGGTCCTCAAATTA	0.284																																																1	Substitution - coding silent(1)	ovary(1)	2											30.0	30.0	30.0					2																	214228856		2200	4274	6474	213937101	SO:0001819	synonymous_variant	79582			AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.819T>C	2.37:g.214228856T>C		Somatic		Capture	Illumina GAIIx	4	213937101	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Silent	SNP	-	p.G273	ENST00000331683.5	37	c.819	CCDS2396.1	2																																																																																			-	NULL		0.284	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG16	protein_coding	OTTHUMT00000256601.2	T	NM_024532		213937101	1	no_errors	NM_024532	genbank	human	validated	54_36p	silent	SNP	0.1	C
CDH22	64405	genome.wustl.edu	37	20	44815563	44815563	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr20:44815563C>T	ENST00000372262.3	-	8	1847	c.1447G>A	c.(1447-1449)Gca>Aca	p.A483T	CDH22_ENST00000537909.1_Missense_Mutation_p.A483T	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	483	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A483T(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CTTAGGGATGCCCGGGATAGC	0.547																																																1	Substitution - Missense(1)	ovary(1)	20											227.0	206.0	213.0					20																	44815563		2203	4300	6503	44248970	SO:0001583	missense	64405			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1447G>A	20.37:g.44815563C>T	ENSP00000361336:p.Ala483Thr	Somatic		Capture	Illumina GAIIx	4	44248970	B9EGK7|O43205	Missense_Mutation	SNP	HMMPfam_Cadherin;superfamily_Cadherin-like;superfamily_MFS general substrate transporter;HMMPfam_Cadherin_C	p.A483T	ENST00000372262.3	37	c.1447	CCDS13395.1	20	.	.	.	.	.	.	.	.	.	.	C	15.49	2.848521	0.51164	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.50548	0.74;0.74	4.12	4.12	0.48240	Cadherin (5);Cadherin-like (1);	0.505774	0.21808	N	0.068810	T	0.33030	0.0849	N	0.16201	0.385	0.31082	N	0.711841	B	0.06786	0.001	B	0.04013	0.001	T	0.38023	-0.9680	10	0.54805	T	0.06	.	15.5603	0.76240	0.0:1.0:0.0:0.0	.	483	Q9UJ99	CAD22_HUMAN	T	483	ENSP00000361336:A483T;ENSP00000437790:A483T	ENSP00000361336:A483T	A	-	1	0	CDH22	44248970	0.981000	0.34729	0.991000	0.47740	0.903000	0.53119	2.074000	0.41529	2.151000	0.67156	0.442000	0.29010	GCA	-	HMMPfam_Cadherin		0.547	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH22	protein_coding	OTTHUMT00000080491.1	C	NM_021248		44248970	-1	no_errors	NM_021248	genbank	human	reviewed	54_36p	missense	SNP	0.24	T
SLC35C2	51006	genome.wustl.edu	37	20	44984490	44984490	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr20:44984490G>A	ENST00000372227.1	-	5	899	c.359C>T	c.(358-360)gCt>gTt	p.A120V	SLC35C2_ENST00000317734.8_Missense_Mutation_p.A120V|SLC35C2_ENST00000243896.2_Missense_Mutation_p.A120V|SLC35C2_ENST00000543605.1_Missense_Mutation_p.A149V|SLC35C2_ENST00000493599.1_5'Flank|SLC35C2_ENST00000372230.5_Missense_Mutation_p.A120V|SLC35C2_ENST00000372229.1_Intron	NM_001281458.1|NM_001281460.1	NP_001268387.1|NP_001268389.1	Q9NQQ7	S35C2_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C2	120					negative regulation of gene expression (GO:0010629)|positive regulation of Notch signaling pathway (GO:0045747)|protein O-linked fucosylation (GO:0036066)|transport (GO:0006810)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.A120V(1)		cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	16		Myeloproliferative disorder(115;0.0122)				GAAGAGGACAGCTGAGGATTT	0.527																																																1	Substitution - Missense(1)	ovary(1)	20											151.0	142.0	145.0					20																	44984490		2203	4300	6503	44417897	SO:0001583	missense	51006				CCDS13396.1, CCDS13397.1, CCDS63292.1	20q13.12	2013-07-17	2013-07-17	2003-10-10	ENSG00000080189	ENSG00000080189		"""Solute carriers"""	17117	protein-coding gene	gene with protein product			"""ovarian cancer overexpressed 1"", ""solute carrier family 35, member C2"""	C20orf5, OVCOV1		10810093, 11549316	Standard	NM_173179		Approved	CGI-15, bA394O2.1	uc002xrq.3	Q9NQQ7	OTTHUMG00000033050	ENST00000372227.1:c.359C>T	20.37:g.44984490G>A	ENSP00000361301:p.Ala120Val	Somatic		Capture	Illumina GAIIx	4	44417897	B7Z6V6|E1P5T0|Q53GK3|Q5JW05|Q96CJ8|Q9Y304	Missense_Mutation	SNP	-	p.A120V	ENST00000372227.1	37	c.359	CCDS13396.1	20	.	.	.	.	.	.	.	.	.	.	G	32	5.182466	0.94885	.	.	ENSG00000080189	ENST00000317734;ENST00000243896;ENST00000372227;ENST00000372230;ENST00000543605	D;D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9;-2.9	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.93887	0.8044	M	0.64170	1.965	0.80722	D	1	P;D;P;D	0.61080	0.915;0.989;0.767;0.976	P;P;P;P	0.54856	0.596;0.762;0.661;0.761	D	0.94048	0.7315	10	0.59425	D	0.04	-10.2452	17.7923	0.88558	0.0:0.0:1.0:0.0	.	149;6;120;120	F5H4T9;B7Z6R4;Q9NQQ7-2;Q9NQQ7	.;.;.;S35C2_HUMAN	V	120;120;120;120;149	ENSP00000318960:A120V;ENSP00000243896:A120V;ENSP00000361301:A120V;ENSP00000361304:A120V;ENSP00000439974:A149V	ENSP00000243896:A120V	A	-	2	0	SLC35C2	44417897	1.000000	0.71417	0.363000	0.25875	0.992000	0.81027	8.688000	0.91260	2.746000	0.94184	0.655000	0.94253	GCT	-	NULL		0.527	SLC35C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35C2	protein_coding	OTTHUMT00000080363.1	G	NM_015945		44417897	-1	no_errors	NM_015945	genbank	human	reviewed	54_36p	missense	SNP	1	A
CBLN4	140689	genome.wustl.edu	37	20	54579014	54579014	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr20:54579014C>T	ENST00000064571.2	-	1	1514	c.214G>A	c.(214-216)Gcc>Acc	p.A72T		NM_080617.5	NP_542184.1	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	72	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein secretion (GO:0009306)	cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)		p.A72T(1)		endometrium(2)|large_intestine(1)|lung(10)|ovary(3)|pancreas(1)	17			Colorectal(105;0.202)			GCCGAGAAGGCGACCTTGGAG	0.637																																																1	Substitution - Missense(1)	ovary(1)	20											118.0	123.0	122.0					20																	54579014		2203	4300	6503	54012421	SO:0001583	missense	140689			AY358527	CCDS13448.1	20q13	2004-08-19	2004-08-19	2004-08-19	ENSG00000054803	ENSG00000054803			16231	protein-coding gene	gene with protein product		615029	"""cerebellin precursor-like 1"""	CBLNL1			Standard	NM_080617		Approved	dJ885A10.1	uc002xxa.4	Q9NTU7	OTTHUMG00000032782	ENST00000064571.2:c.214G>A	20.37:g.54579014C>T	ENSP00000064571:p.Ala72Thr	Somatic		Capture	Illumina GAIIx	4	54012421	A8K0S5	Missense_Mutation	SNP	-	p.A72T	ENST00000064571.2	37	c.214	CCDS13448.1	20	.	.	.	.	.	.	.	.	.	.	C	35	5.465298	0.96257	.	.	ENSG00000054803	ENST00000064571	D	0.84873	-1.91	5.4	4.46	0.54185	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.045100	0.85682	N	0.000000	D	0.93923	0.8055	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.95268	0.8375	10	0.87932	D	0	-21.7691	14.2838	0.66232	0.0:0.9284:0.0:0.0716	.	72	Q9NTU7	CBLN4_HUMAN	T	72	ENSP00000064571:A72T	ENSP00000064571:A72T	A	-	1	0	CBLN4	54012421	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.343000	0.79319	1.409000	0.46915	0.655000	0.94253	GCC	-	NULL		0.637	CBLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN4	protein_coding	OTTHUMT00000079783.2	C	NM_080617		54012421	-1	no_errors	NM_080617	genbank	human	reviewed	54_36p	missense	SNP	1	T
POTEH	23784	genome.wustl.edu	37	22	16287661	16287661	+	Silent	SNP	G	G	A	rs201321237	byFrequency	TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr22:16287661G>A	ENST00000343518.6	-	1	276	c.225C>T	c.(223-225)agC>agT	p.S75S		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	75								p.S75S(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TGCTCTTGCCGCTCCCCCTGC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	22						G		9,4157		0,9,2074	83.0	97.0	92.0		225		0.1	22		92	39,7707		1,37,3835	no	coding-synonymous	POTEH	NM_001136213.1		1,46,5909	AA,AG,GG		0.5035,0.216,0.403		75/546	16287661	48,11864	2083	3873	5956	14667661	SO:0001819	synonymous_variant	23784			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.225C>T	22.37:g.16287661G>A		Somatic		Capture	Illumina GAIIx	4	14667661	A2CEK4|A6NCI1|A9Z1W0	Silent	SNP	-	p.S75	ENST00000343518.6	37	c.225	CCDS46658.1	22																																																																																			-	NULL		0.582	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH	protein_coding	OTTHUMT00000276918.4	G	NM_001136213		14667661	-1	no_errors	ENST00000354997	ensembl	human	known	54_36p	silent	SNP	0	A
CES5AP1	649264	genome.wustl.edu	37	22	23712642	23712642	+	RNA	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr22:23712642G>A	ENST00000415114.1	-	0	613									carboxylesterase 5A pseudogene 1																		GGCCATGGGAGACAGAATCTG	0.498																																																0			22																																								22042642			649264					22q11.23	2010-10-19			ENSG00000215478	ENSG00000215478			38516	pseudogene	pseudogene							Standard	NR_037839		Approved		uc021wms.1		OTTHUMG00000150651		22.37:g.23712642G>A		Somatic		Capture	Illumina GAIIx	4	22042642		Missense_Mutation	SNP	-	p.S112F	ENST00000415114.1	37	c.335		22																																																																																			-	NULL		0.498	CES5AP1-002	KNOWN	basic	processed_transcript	LOC649264	pseudogene	OTTHUMT00000319403.1	G			22042642	-1	no_errors	XM_001131286	genbank	human	model	54_36p	missense	SNP	1	A
LOC388882	388882	genome.wustl.edu	37	22	23802596	23802596	+	lincRNA	SNP	C	C	T	rs531630933		TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr22:23802596C>T	ENST00000320372.9	-	0	3156				AP000344.4_ENST00000454268.1_RNA																							TCTCGCACACCGTGGGCGAGC	0.657													.|||	1	0.000199681	0.0008	0.0	5008	,	,		18979	0.0		0.0	False		,,,				2504	0.0															0			22																																								22132596			645904																															22.37:g.23802596C>T		Somatic		Capture	Illumina GAIIx	4	22132596		Silent	SNP	-	p.T44	ENST00000320372.9	37	c.132		22																																																																																			-	NULL		0.657	AP000345.1-001	KNOWN	basic	lincRNA	LOC645904	lincRNA	OTTHUMT00000319544.1	C			22132596	1	no_errors	XM_928876	genbank	human	model	54_36p	silent	SNP	0.22	T
L3MBTL2	83746	genome.wustl.edu	37	22	41605747	41605747	+	Silent	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr22:41605747G>A	ENST00000216237.5	+	2	230	c.72G>A	c.(70-72)ttG>ttA	p.L24L	L3MBTL2_ENST00000489136.1_3'UTR|RP4-756G23.5_ENST00000441316.1_RNA|RP4-756G23.5_ENST00000451176.1_RNA	NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	24					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.L24L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATGACGACTTGGAGCTGTTTG	0.468																																																1	Substitution - coding silent(1)	ovary(1)	22											184.0	185.0	185.0					22																	41605747		2203	4300	6503	39935693	SO:0001819	synonymous_variant	83746			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.72G>A	22.37:g.41605747G>A		Somatic		Capture	Illumina GAIIx	Phase_III	39935693	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Silent	SNP	HMMPfam_MBT,superfamily_Tudor/PWWP/MBT	p.L24	ENST00000216237.5	37	c.72	CCDS14011.1	22																																																																																			-	NULL		0.468	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL2	protein_coding	OTTHUMT00000320613.1	G	NM_031488		39935693	1	no_errors	NM_031488	genbank	human	validated	54_36p	silent	SNP	1	A
L3MBTL2	83746	genome.wustl.edu	37	22	41605761	41605761	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr22:41605761G>A	ENST00000216237.5	+	2	244	c.86G>A	c.(85-87)gGc>gAc	p.G29D	L3MBTL2_ENST00000489136.1_3'UTR|RP4-756G23.5_ENST00000441316.1_RNA|RP4-756G23.5_ENST00000451176.1_RNA	NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	29					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.G29D(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTGTTTGGTGGCTATGATAGT	0.483																																																1	Substitution - Missense(1)	ovary(1)	22											180.0	179.0	179.0					22																	41605761		2203	4300	6503	39935707	SO:0001583	missense	83746			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.86G>A	22.37:g.41605761G>A	ENSP00000216237:p.Gly29Asp	Somatic		Capture	Illumina GAIIx	Phase_III	39935707	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	HMMPfam_MBT,superfamily_Tudor/PWWP/MBT	p.G29D	ENST00000216237.5	37	c.86	CCDS14011.1	22	.	.	.	.	.	.	.	.	.	.	G	25.1	4.601921	0.87055	.	.	ENSG00000100395	ENST00000216237;ENST00000449635	T	0.20463	2.07	5.37	4.35	0.52113	.	0.058631	0.64402	D	0.000003	T	0.16854	0.0405	L	0.29908	0.895	0.43693	D	0.996146	B	0.14012	0.009	B	0.12837	0.008	T	0.03493	-1.1031	10	0.38643	T	0.18	.	14.4551	0.67411	0.0724:0.0:0.9276:0.0	.	29	Q969R5	LMBL2_HUMAN	D	29;21	ENSP00000216237:G29D	ENSP00000216237:G29D	G	+	2	0	L3MBTL2	39935707	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.100000	0.64560	2.528000	0.85240	0.655000	0.94253	GGC	-	NULL		0.483	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL2	protein_coding	OTTHUMT00000320613.1	G	NM_031488		39935707	1	no_errors	NM_031488	genbank	human	validated	54_36p	missense	SNP	1	A
FRG1B	284802	genome.wustl.edu	37	20	29612385	29612385	+	Intron	SNP	A	A	C	rs112006061		TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr20:29612385A>C	ENST00000278882.3	+	1	257				FRG1B_ENST00000468180.2_Intron|FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCATCTCTCCAGGCCTCTGCC	0.537																																																0			20																																								28226046	SO:0001627	intron_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-124+272A>C	20.37:g.29612385A>C		Somatic		Capture	Illumina GAIIx	4	28226046	C4AME5	Missense_Mutation	SNP	-	p.Q52P	ENST00000278882.3	37	c.155		20																																																																																			-	NULL		0.537	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ENSG00000215548	protein_coding	OTTHUMT00000078494.2	A	NR_003579		28226046	1	no_stop_codon	ENST00000358464	ensembl	human	known	54_36p	missense	SNP	0.091	C
SIDT1	54847	genome.wustl.edu	37	3	113286443	113286443	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr3:113286443C>T	ENST00000264852.4	+	3	1127	c.401C>T	c.(400-402)gCa>gTa	p.A134V	SIDT1_ENST00000393830.3_Missense_Mutation_p.A134V	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	134					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)	p.A134V(1)		breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						CCCTCAGAAGCAACCAATGAG	0.468																																																1	Substitution - Missense(1)	ovary(1)	3											148.0	137.0	141.0					3																	113286443		2203	4300	6503	114769133	SO:0001583	missense	54847			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.401C>T	3.37:g.113286443C>T	ENSP00000264852:p.Ala134Val	Somatic		Capture	Illumina GAIIx	4	114769133	Q17RR4	Missense_Mutation	SNP	-	p.A134V	ENST00000264852.4	37	c.401	CCDS2974.1	3	.	.	.	.	.	.	.	.	.	.	C	10.99	1.508447	0.27036	.	.	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.14266	2.52;2.52	6.17	5.3	0.74995	.	0.209857	0.33631	N	0.004716	T	0.06280	0.0162	N	0.02539	-0.55	0.34313	D	0.685651	B	0.32526	0.374	B	0.31390	0.129	T	0.36261	-0.9755	10	0.19147	T	0.46	-4.5525	15.6272	0.76870	0.0:0.9346:0.0:0.0653	.	134	Q9NXL6	SIDT1_HUMAN	V	134	ENSP00000264852:A134V;ENSP00000377416:A134V	ENSP00000264852:A134V	A	+	2	0	SIDT1	114769133	0.994000	0.37717	1.000000	0.80357	0.365000	0.29674	3.117000	0.50407	1.632000	0.50472	-0.140000	0.14226	GCA	-	NULL		0.468	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	protein_coding	OTTHUMT00000317564.1	C	NM_017699		114769133	1	no_errors	NM_017699	genbank	human	validated	54_36p	missense	SNP	0.99	T
STXBP5L	9515	genome.wustl.edu	37	3	120973862	120973862	+	Missense_Mutation	SNP	A	A	G			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr3:120973862A>G	ENST00000273666.6	+	16	1833	c.1562A>G	c.(1561-1563)tAc>tGc	p.Y521C	STXBP5L_ENST00000492541.1_Missense_Mutation_p.Y521C|STXBP5L_ENST00000471454.1_Missense_Mutation_p.Y521C|STXBP5L_ENST00000472879.1_Missense_Mutation_p.Y521C|STXBP5L_ENST00000497029.1_Missense_Mutation_p.Y521C	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	521					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Y521C(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		CAGATGATTTACTGGTGTCCA	0.348																																																1	Substitution - Missense(1)	ovary(1)	3											82.0	77.0	79.0					3																	120973862		1854	4116	5970	122456552	SO:0001583	missense	9515			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1562A>G	3.37:g.120973862A>G	ENSP00000273666:p.Tyr521Cys	Somatic		Capture	Illumina GAIIx	4	122456552	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	-	p.Y521C	ENST00000273666.6	37	c.1562	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	A	14.56	2.573049	0.45902	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44	5.45	2.89	0.33648	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);	0.111689	0.64402	D	0.000007	T	0.32010	0.0815	L	0.34521	1.04	0.39632	D	0.970196	D;D	0.65815	0.995;0.995	P;P	0.52514	0.701;0.701	T	0.07009	-1.0795	10	0.38643	T	0.18	0.0043	12.1147	0.53858	0.5874:0.4126:0.0:0.0	.	521;521	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	C	521	ENSP00000273666:Y521C;ENSP00000420019:Y521C;ENSP00000419627:Y521C;ENSP00000420287:Y521C;ENSP00000420666:Y521C;ENSP00000420167:Y521C	ENSP00000273666:Y521C	Y	+	2	0	STXBP5L	122456552	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.565000	0.36386	0.885000	0.36088	-0.313000	0.08912	TAC	-	NULL		0.348	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	protein_coding	OTTHUMT00000355256.3	A			122456552	1	no_errors	NM_014980	genbank	human	validated	54_36p	missense	SNP	1	G
BOD1L1	259282	genome.wustl.edu	37	4	13612616	13612616	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr4:13612616G>A	ENST00000040738.5	-	6	1568	c.1433C>T	c.(1432-1434)tCa>tTa	p.S478L		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	478	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S478L(1)									ATAGTATTTTGAGTAAAGATA	0.348																																																1	Substitution - Missense(1)	ovary(1)	4											229.0	206.0	214.0					4																	13612616		2203	4300	6503	13221714	SO:0001583	missense	259282			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.1433C>T	4.37:g.13612616G>A	ENSP00000040738:p.Ser478Leu	Somatic		Capture	Illumina GAIIx	4	13221714	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	-	p.S478L	ENST00000040738.5	37	c.1433	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	G	30	5.056004	0.93793	.	.	ENSG00000038219	ENST00000040738	T	0.20069	2.1	5.58	5.58	0.84498	.	0.000000	0.42964	D	0.000633	T	0.48241	0.1489	M	0.68952	2.095	0.53005	D	0.999966	D	0.89917	1.0	D	0.85130	0.997	T	0.37197	-0.9716	10	0.59425	D	0.04	-4.0371	19.9215	0.97087	0.0:0.0:1.0:0.0	.	478	Q8NFC6	BOD1L_HUMAN	L	478	ENSP00000040738:S478L	ENSP00000040738:S478L	S	-	2	0	BOD1L	13221714	1.000000	0.71417	0.975000	0.42487	0.809000	0.45718	9.379000	0.97198	2.787000	0.95880	0.591000	0.81541	TCA	-	NULL		0.348	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L	protein_coding	OTTHUMT00000207321.1	G	NM_148894		13221714	-1	no_errors	NM_148894	genbank	human	validated	54_36p	missense	SNP	1	A
SLIT2	9353	genome.wustl.edu	37	4	20493434	20493434	+	Missense_Mutation	SNP	G	G	A	rs148733702	byFrequency	TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr4:20493434G>A	ENST00000504154.1	+	9	1078	c.826G>A	c.(826-828)Gcc>Acc	p.A276T	SLIT2_ENST00000503823.1_Missense_Mutation_p.A276T|SLIT2_ENST00000503837.1_Missense_Mutation_p.A280T|SLIT2_ENST00000273739.5_Missense_Mutation_p.A280T	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	276	LRRNT 2.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.A276T(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CTGCCCTGCCGCCTGTACCTG	0.418																																																1	Substitution - Missense(1)	ovary(1)	4						G	THR/ALA	0,4406		0,0,2203	143.0	141.0	142.0		826	4.8	0.8	4	dbSNP_134	142	5,8595	4.3+/-15.6	0,5,4295	yes	missense	SLIT2	NM_004787.1	58	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	benign	276/1530	20493434	5,13001	2203	4300	6503	20102532	SO:0001583	missense	9353			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.826G>A	4.37:g.20493434G>A	ENSP00000422591:p.Ala276Thr	Somatic		Capture	Illumina GAIIx	4	20102532	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	superfamily_L domain-like;superfamily_EGF/Laminin;HMMPfam_LRRNT;HMMPfam_LRRCT;HMMPfam_LRR_1;HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2	p.A276T	ENST00000504154.1	37	c.826	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409728	0.42715	0.0	5.81E-4	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.96396	-4.0;-4.0;-4.0;-4.0	5.63	4.79	0.61399	Leucine-rich repeat-containing N-terminal (2);	0.194104	0.56097	N	0.000036	D	0.92805	0.7712	L	0.47078	1.49	0.49130	D	0.999753	B;P	0.40638	0.095;0.725	B;B	0.33254	0.009;0.16	D	0.91435	0.5169	10	0.21540	T	0.41	.	15.2381	0.73447	0.068:0.0:0.932:0.0	.	276;276	O94813-3;O94813	.;SLIT2_HUMAN	T	276;276;280;280;280	ENSP00000427548:A276T;ENSP00000422591:A276T;ENSP00000273739:A280T;ENSP00000422261:A280T	ENSP00000273739:A280T	A	+	1	0	SLIT2	20102532	0.742000	0.28228	0.820000	0.32676	0.987000	0.75469	2.164000	0.42387	1.514000	0.48869	0.655000	0.94253	GCC	-	HMMPfam_LRRNT		0.418	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	protein_coding	OTTHUMT00000250396.2	G			20102532	1	no_errors	NM_004787	genbank	human	provisional	54_36p	missense	SNP	0.92	A
FGB	2244	genome.wustl.edu	37	4	155491741	155491741	+	Missense_Mutation	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr4:155491741G>A	ENST00000302068.4	+	8	1478	c.1415G>A	c.(1414-1416)gGg>gAg	p.G472E	FGB_ENST00000509493.1_Missense_Mutation_p.G253E|FGB_ENST00000502545.1_3'UTR	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	472	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)	p.G472E(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	AATTGGAAGGGGTCATGGTAC	0.473																																					NSCLC(106;1133 1613 21870 46110 52656)											1	Substitution - Missense(1)	ovary(1)	4											201.0	179.0	186.0					4																	155491741		2203	4300	6503	155711191	SO:0001583	missense	2244				CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.1415G>A	4.37:g.155491741G>A	ENSP00000306099:p.Gly472Glu	Somatic		Capture	Illumina GAIIx	4	155711191	A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	-	p.G472E	ENST00000302068.4	37	c.1415	CCDS3786.1	4	.	.	.	.	.	.	.	.	.	.	G	24.7	4.557456	0.86231	.	.	ENSG00000171564	ENST00000302068;ENST00000537843;ENST00000509493	D;D	0.82526	-1.62;-1.62	5.48	5.48	0.80851	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.046082	0.85682	D	0.000000	D	0.91546	0.7330	M	0.87328	2.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.92252	0.5809	10	0.72032	D	0.01	.	12.9905	0.58616	0.0739:0.0:0.9261:0.0	.	455;472	B4E1D3;P02675	.;FIBB_HUMAN	E	472;455;253	ENSP00000306099:G472E;ENSP00000426757:G253E	ENSP00000306099:G472E	G	+	2	0	FGB	155711191	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.968000	0.87980	2.749000	0.94314	0.655000	0.94253	GGG	-	NULL		0.473	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGB	protein_coding	OTTHUMT00000317595.1	G	NM_005141		155711191	1	no_errors	NM_005141	genbank	human	reviewed	54_36p	missense	SNP	1	A
FBN2	2201	genome.wustl.edu	37	5	127681245	127681245	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr5:127681245C>A	ENST00000508053.1	-	30	3995	c.3021G>T	c.(3019-3021)tgG>tgT	p.W1007C	FBN2_ENST00000262464.4_Missense_Mutation_p.W1007C|FBN2_ENST00000508989.1_Missense_Mutation_p.W974C			P35556	FBN2_HUMAN	fibrillin 2	1007	TB 5.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.W1007C(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CATCTTCATCCCACTTCAAGT	0.527																																																1	Substitution - Missense(1)	ovary(1)	5											95.0	89.0	91.0					5																	127681245		2203	4300	6503	127709144	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3021G>T	5.37:g.127681245C>A	ENSP00000424571:p.Trp1007Cys	Somatic		Capture	Illumina GAIIx	4	127709144	B4DU01|Q59ES6	Missense_Mutation	SNP	HMMPfam_EGF_CA;superfamily_Cadherin-like;superfamily_EGF/Laminin;superfamily_TB module/8-cys domain;HMMPfam_TB;HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;superfamily_Growth factor receptor domain	p.W1007C	ENST00000508053.1	37	c.3021	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306145	0.60305	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.90676	-2.71;-2.71;-2.71	4.08	4.08	0.47627	Matrix fibril-associated (2);TGF-beta binding (1);	0.195833	0.35585	N	0.003118	D	0.94551	0.8245	M	0.78223	2.4	0.80722	D	1	D;D	0.76494	0.999;0.997	D;P	0.70487	0.969;0.808	D	0.92845	0.6292	10	0.25106	T	0.35	.	17.5943	0.88006	0.0:1.0:0.0:0.0	.	974;1007	D6RJI3;P35556	.;FBN2_HUMAN	C	1007;1007;974	ENSP00000262464:W1007C;ENSP00000424571:W1007C;ENSP00000425596:W974C	ENSP00000262464:W1007C	W	-	3	0	FBN2	127709144	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	1.818000	0.39012	2.567000	0.86603	0.563000	0.77884	TGG	-	NULL		0.527	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	protein_coding	OTTHUMT00000371618.2	C	NM_001999		127709144	-1	no_errors	NM_001999	genbank	human	reviewed	54_36p	missense	SNP	1	A
ADAMTS12	81792	genome.wustl.edu	37	5	33615972	33615972	+	Silent	SNP	C	C	G			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr5:33615972C>G	ENST00000504830.1	-	15	2684	c.2349G>C	c.(2347-2349)ctG>ctC	p.L783L	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Silent_p.L698L	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	783	Spacer 1.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L783L(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CTGTGGCCATCAGCTTTTCCA	0.458										HNSCC(64;0.19)																																						1	Substitution - coding silent(1)	ovary(1)	5											148.0	129.0	135.0					5																	33615972		2203	4300	6503	33651729	SO:0001819	synonymous_variant	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2349G>C	5.37:g.33615972C>G		Somatic		Capture	Illumina GAIIx	4	33651729	A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	"HMMPfam_TSP_1;HMMPfam_Reprolysin;HMMPfam_Pep_M12B_propep;HMMPfam_ADAM_spacer1;superfamily_Metalloproteases (""zincins"") catalytic domain;superfamily_TSP-1 type 1 repeat"	p.L783	ENST00000504830.1	37	c.2349	CCDS34140.1	5																																																																																			-	HMMPfam_ADAM_spacer1		0.458	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	protein_coding	OTTHUMT00000367164.2	C	NM_030955		33651729	-1	no_errors	NM_030955	genbank	human	reviewed	54_36p	silent	SNP	1	G
PPP2R2B	5521	genome.wustl.edu	37	5	145969658	145969658	+	Missense_Mutation	SNP	A	A	C			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr5:145969658A>C	ENST00000394413.3	-	9	1754	c.1184T>G	c.(1183-1185)gTg>gGg	p.V395G	PPP2R2B_ENST00000394414.1_Missense_Mutation_p.V461G|PPP2R2B_ENST00000508545.2_Missense_Mutation_p.V384G|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000394409.3_Missense_Mutation_p.V453G|PPP2R2B_ENST00000394411.4_Missense_Mutation_p.V395G|PPP2R2B_ENST00000453001.1_Missense_Mutation_p.V395G|PPP2R2B_ENST00000356826.3_Missense_Mutation_p.V395G|PPP2R2B_ENST00000394410.2_Missense_Mutation_p.V384G|PPP2R2B_ENST00000336640.6_Missense_Mutation_p.V398G|CTB-99A3.1_ENST00000512730.1_RNA|PPP2R2B_ENST00000504198.1_Missense_Mutation_p.V401G			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	395					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.V398G(2)|p.V453G(1)|p.V395G(1)|p.V384G(1)		endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTTGCCCCCCACACACACTTT	0.488																																																5	Substitution - Missense(5)	endometrium(4)|ovary(1)	5											136.0	142.0	140.0					5																	145969658		2203	4300	6503	145949851	SO:0001583	missense	5521			M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.1184T>G	5.37:g.145969658A>C	ENSP00000377935:p.Val395Gly	Somatic		Capture	Illumina GAIIx	4	145949851	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Missense_Mutation	SNP	HMMPfam_WD40;superfamily_WD40 repeat-like	p.V398G	ENST00000394413.3	37	c.1193	CCDS4284.1	5	.	.	.	.	.	.	.	.	.	.	A	13.91	2.379009	0.42207	.	.	ENSG00000156475	ENST00000394413;ENST00000508545;ENST00000394414;ENST00000394411;ENST00000356826;ENST00000453001;ENST00000394410;ENST00000336640;ENST00000504198;ENST00000394409	T;T;T;T;T;T;T;T;T;T	0.73897	-0.79;-0.79;1.51;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;1.51	5.82	5.82	0.92795	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.64114	0.2569	L	0.31664	0.95	0.80722	D	1	B;B;B;B;B;B	0.06786	0.001;0.001;0.0;0.001;0.0;0.0	B;B;B;B;B;B	0.10450	0.005;0.003;0.003;0.005;0.001;0.002	T	0.58792	-0.7574	10	0.19147	T	0.46	-8.1571	16.1814	0.81903	1.0:0.0:0.0:0.0	.	453;401;384;461;398;395	Q00005-4;Q00005-3;G3V149;Q00005-5;Q00005-2;Q00005	.;.;.;.;.;2ABB_HUMAN	G	395;384;461;395;395;395;384;398;401;453	ENSP00000377935:V395G;ENSP00000431320:V384G;ENSP00000377936:V461G;ENSP00000377933:V395G;ENSP00000349283:V395G;ENSP00000398779:V395G;ENSP00000377932:V384G;ENSP00000336591:V398G;ENSP00000421396:V401G;ENSP00000377931:V453G	ENSP00000336591:V398G	V	-	2	0	AC011357.1	145949851	0.995000	0.38212	1.000000	0.80357	0.983000	0.72400	3.460000	0.53028	2.234000	0.73211	0.533000	0.62120	GTG	-	NULL		0.488	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2B	protein_coding	OTTHUMT00000251893.2	A	NM_181678		145949851	-1	no_errors	NM_181676	genbank	human	reviewed	54_36p	missense	SNP	1	C
LYPLA2P1	653639	genome.wustl.edu	37	6	33333963	33333963	+	IGR	SNP	C	C	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr6:33333963C>T								DAXX (43172 upstream) : KIFC1 (25349 downstream)																							TCCCGCTCAGCTCCAGACACG	0.592																																																0			6																																								33441941	SO:0001628	intergenic_variant	653639																															6.37:g.33333963C>T		Somatic		Capture	Illumina GAIIx	4	33441941		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.592					LYPLA2P1			C			33441941	-1	pseudogene	NR_001444	genbank	human	provisional	54_36p	rna	SNP	0.97	T
CLDN15	24146	genome.wustl.edu	37	7	100877639	100877639	+	Missense_Mutation	SNP	C	C	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr7:100877639C>T	ENST00000401528.1	-	3	1427	c.302G>A	c.(301-303)cGc>cAc	p.R101H	CLDN15_ENST00000308344.5_Missense_Mutation_p.R101H|CLDN15_ENST00000433422.1_5'UTR	NM_001185080.1	NP_001172009.1	P56746	CLD15_HUMAN	claudin 15	101					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|ion transport (GO:0006811)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.R101H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	10	Lung NSC(181;0.168)|all_lung(186;0.215)					GTTGGTGCAGCGCAGGCCCGC	0.652																																																1	Substitution - Missense(1)	ovary(1)	7											53.0	59.0	57.0					7																	100877639		2203	4300	6503	100664359	SO:0001583	missense	24146			AJ245738	CCDS5717.1	7q22	2008-07-18			ENSG00000106404	ENSG00000106404		"""Claudins"""	2036	protein-coding gene	gene with protein product		615778					Standard	NM_014343		Approved		uc003uyg.2	P56746	OTTHUMG00000150512	ENST00000401528.1:c.302G>A	7.37:g.100877639C>T	ENSP00000385300:p.Arg101His	Somatic		Capture	Illumina GAIIx	4	100664359	B3KPB5	Missense_Mutation	SNP	-	p.R101H	ENST00000401528.1	37	c.302	CCDS5717.1	7	.	.	.	.	.	.	.	.	.	.	C	20.9	4.071706	0.76301	.	.	ENSG00000106404	ENST00000308344;ENST00000401528;ENST00000412417	D;D;D	0.88741	-2.42;-2.42;-2.42	5.11	5.11	0.69529	.	0.125473	0.56097	D	0.000026	D	0.93025	0.7780	M	0.78637	2.42	0.34308	D	0.685095	D	0.64830	0.994	D	0.66847	0.947	D	0.95530	0.8602	10	0.87932	D	0	.	9.6297	0.39772	0.0:0.9052:0.0:0.0948	.	101	P56746	CLD15_HUMAN	H	101;101;78	ENSP00000308870:R101H;ENSP00000385300:R101H;ENSP00000390230:R78H	ENSP00000308870:R101H	R	-	2	0	CLDN15	100664359	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	4.348000	0.59379	2.379000	0.81126	0.462000	0.41574	CGC	-	NULL		0.652	CLDN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN15	protein_coding	OTTHUMT00000318698.1	C	NM_014343		100664359	-1	no_errors	NM_014343	genbank	human	provisional	54_36p	missense	SNP	1	T
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	C	C	G			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chrUnknown:0C>G								None (None upstream) : None (None downstream)																								0.0																																																0			7																																								101997426	SO:0001628	intergenic_variant	548644																															Unknown.37:g.0C>G		Somatic		Capture	Illumina GAIIx	4	101997426		Missense_Mutation	SNP	-	p.M34I		37	c.102		7																																																																																			-	NULL	0	0					POLR2J3			C			101997426	-1	no_errors	NM_001097615	genbank	human	reviewed	54_36p	missense	SNP	1	G
BLVRA	644	genome.wustl.edu	37	7	43846616	43846616	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr7:43846616C>T	ENST00000402924.1	+	9	836	c.673C>T	c.(673-675)Cga>Tga	p.R225*	BLVRA_ENST00000265523.4_Nonsense_Mutation_p.R225*	NM_001253823.1	NP_001240752.1	P53004	BIEA_HUMAN	biliverdin reductase A	225					heme catabolic process (GO:0042167)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	biliverdin reductase activity (GO:0004074)|zinc ion binding (GO:0008270)	p.R225*(1)		endometrium(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(2)	12						TGGTCTAAAACGAAACAGATA	0.368																																																1	Substitution - Nonsense(1)	ovary(1)	7											67.0	67.0	67.0					7																	43846616		2203	4300	6503	43813141	SO:0001587	stop_gained	644			BC008456	CCDS5472.1	7p13	2012-10-02			ENSG00000106605	ENSG00000106605	1.3.1.24		1062	protein-coding gene	gene with protein product		109750		BLVR			Standard	NM_001253823		Approved		uc003tir.3	P53004	OTTHUMG00000128953	ENST00000402924.1:c.673C>T	7.37:g.43846616C>T	ENSP00000385757:p.Arg225*	Somatic		Capture	Illumina GAIIx	Phase_III	43813141	A8K747|O95019|Q86UX0|Q96QL4|Q9BRW8	Nonsense_Mutation	SNP	HMMPfam_GFO_IDH_MocA,HMMPfam_Biliv-reduc_cat,superfamily_NAD(P)-binding Rossmann-fold domains,superfamily_Glyceraldehyde-3-phosphate dehydrogenase-like C-terminal domain	p.R225*	ENST00000402924.1	37	c.673	CCDS5472.1	7	.	.	.	.	.	.	.	.	.	.	C	18.56	3.651395	0.67472	.	.	ENSG00000106605	ENST00000265523;ENST00000402924	.	.	.	4.25	2.28	0.28536	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	10.5007	0.44804	0.352:0.648:0.0:0.0	.	.	.	.	X	225	.	ENSP00000265523:R225X	R	+	1	2	BLVRA	43813141	1.000000	0.71417	0.107000	0.21349	0.935000	0.57460	3.026000	0.49689	0.287000	0.22375	0.462000	0.41574	CGA	-	HMMPfam_Biliv-reduc_cat		0.368	BLVRA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BLVRA	protein_coding	OTTHUMT00000339006.1	C	NM_000712		43813141	1	no_errors	NM_000712	genbank	human	validated	54_36p	nonsense	SNP	0.755	T
AUTS2	26053	genome.wustl.edu	37	7	70229813	70229813	+	Silent	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr7:70229813G>A	ENST00000342771.4	+	8	1611	c.1290G>A	c.(1288-1290)ccG>ccA	p.P430P	AUTS2_ENST00000406775.2_Silent_p.P430P	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	430								p.P430P(1)		breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		ctgcctccccgttccccctct	0.607																																																1	Substitution - coding silent(1)	ovary(1)	7											54.0	49.0	51.0					7																	70229813		2189	4253	6442	69867749	SO:0001819	synonymous_variant	26053			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1290G>A	7.37:g.70229813G>A		Somatic		Capture	Illumina GAIIx	4	69867749	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	-	p.P430	ENST00000342771.4	37	c.1290	CCDS5539.1	7																																																																																			-	NULL		0.607	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	protein_coding	OTTHUMT00000251971.2	G			69867749	1	no_errors	NM_015570	genbank	human	validated	54_36p	silent	SNP	0.09	A
DNAJB6	10049	genome.wustl.edu	37	7	157177652	157177652	+	Silent	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr7:157177652G>A	ENST00000262177.4	+	7	775	c.570G>A	c.(568-570)tcG>tcA	p.S190S	DNAJB6_ENST00000443280.1_Intron|DNAJB6_ENST00000429029.2_Silent_p.S190S|DNAJB6_ENST00000452797.2_Silent_p.S141S	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6	190	Interaction with KRT18.|Ser-rich.				intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)	p.S190S(1)		central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		ACTTCAAATCGATATCAACTT	0.403																																					Esophageal Squamous(46;195 967 1350 20350 43814)											1	Substitution - coding silent(1)	ovary(1)	7											111.0	107.0	108.0					7																	157177652		2203	4300	6503	156870413	SO:0001819	synonymous_variant	10049			AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.570G>A	7.37:g.157177652G>A		Somatic		Capture	Illumina GAIIx	4	156870413	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Silent	SNP	-	p.S190	ENST00000262177.4	37	c.570	CCDS5946.1	7																																																																																			-	NULL		0.403	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	DNAJB6	protein_coding	OTTHUMT00000348119.2	G			156870413	1	no_errors	NM_058246	genbank	human	reviewed	54_36p	silent	SNP	0.66	A
SYBU	55638	genome.wustl.edu	37	8	110587148	110587148	+	Missense_Mutation	SNP	C	C	T	rs74885615		TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr8:110587148C>T	ENST00000422135.1	-	8	2494	c.1979G>A	c.(1978-1980)cGt>cAt	p.R660H	SYBU_ENST00000419099.1_Missense_Mutation_p.R659H|SYBU_ENST00000528647.1_Missense_Mutation_p.R659H|SYBU_ENST00000533895.1_Missense_Mutation_p.R659H|SYBU_ENST00000408889.3_Missense_Mutation_p.R541H|SYBU_ENST00000533065.1_Missense_Mutation_p.R541H|SYBU_ENST00000529690.1_Missense_Mutation_p.R530H|SYBU_ENST00000433638.1_Missense_Mutation_p.R660H|SYBU_ENST00000424158.2_Missense_Mutation_p.R665H|SYBU_ENST00000408908.2_Missense_Mutation_p.R660H|SYBU_ENST00000446070.2_Missense_Mutation_p.R659H|SYBU_ENST00000533171.1_Missense_Mutation_p.R660H|SYBU_ENST00000276646.9_Missense_Mutation_p.R660H|SYBU_ENST00000528331.1_Missense_Mutation_p.R541H|SYBU_ENST00000399066.3_Missense_Mutation_p.R657H|SYBU_ENST00000527707.1_5'Flank|SYBU_ENST00000532779.1_Missense_Mutation_p.R592H|SYBU_ENST00000529175.1_Missense_Mutation_p.R454H|SYBU_ENST00000440310.1_Missense_Mutation_p.R660H	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	660					regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.R657H(1)		NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						GGTTTTGATACGGAAGGCGGT	0.527													T|||	1	0.000199681	0.0	0.0	5008	,	,		19819	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	8						T	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4078		0,0,2039	80.0	84.0	83.0		1976,1979,1979,1622,1976,1979,1622,1979,1976,1979,1976,1979,1622,1970,1976	4.5	0.0	8	dbSNP_131	83	1,8355		0,1,4177	yes	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	SYBU	NM_001099743.1,NM_001099744.1,NM_001099745.1,NM_001099746.1,NM_001099747.1,NM_001099748.1,NM_001099749.1,NM_001099750.1,NM_001099751.1,NM_001099752.1,NM_001099753.1,NM_001099754.1,NM_001099755.1,NM_001099756.1,NM_017786.5	29,29,29,29,29,29,29,29,29,29,29,29,29,29,29	0,1,6216	TT,TC,CC		0.012,0.0,0.0080	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	659/663,660/664,660/664,541/545,659/663,660/664,541/545,660/664,659/663,660/664,659/663,660/664,541/545,657/661,659/663	110587148	1,12433	2039	4178	6217	110656324	SO:0001583	missense	55638			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.1979G>A	8.37:g.110587148C>T	ENSP00000407118:p.Arg660His	Somatic		Capture	Illumina GAIIx	4	110656324	A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	-	p.R660H	ENST00000422135.1	37	c.1979	CCDS47912.1	8	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	T	0.016	-1.531508	0.00951	0.0	1.2E-4	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000532779;ENST00000399066;ENST00000446070;ENST00000528331;ENST00000529175;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000408889;ENST00000533065;ENST00000529690;ENST00000533171	.	.	.	5.7	4.53	0.55603	.	0.458427	0.26048	N	0.026660	T	0.06416	0.0165	N	0.00237	-1.79	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.0;0.001;0.0;0.0	B;B;B;B;B	0.06405	0.0;0.0;0.002;0.0;0.0	T	0.35919	-0.9769	9	0.07325	T	0.83	-5.3549	6.9948	0.24777	0.0:0.0754:0.1488:0.7759	.	530;592;659;660;657	B7Z4D2;Q9NX95-2;Q9NX95-3;Q9NX95;Q9NX95-4	.;.;.;SYBU_HUMAN;.	H	659;665;592;657;659;541;454;660;659;660;659;660;660;660;541;541;530;660	.	ENSP00000276646:R660H	R	-	2	0	SYBU	110656324	0.000000	0.05858	0.045000	0.18777	0.244000	0.25665	-0.464000	0.06688	0.422000	0.26005	-0.254000	0.11334	CGT	-	NULL		0.527	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLSYN	protein_coding	OTTHUMT00000385501.1	C	NM_017786		110656324	-1	no_errors	NM_001099744	genbank	human	validated	54_36p	missense	SNP	0.75	T
FAM83A	84985	genome.wustl.edu	37	8	124195554	124195554	+	Missense_Mutation	SNP	G	G	A	rs376602872		TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr8:124195554G>A	ENST00000518448.1	+	2	2472	c.458G>A	c.(457-459)cGc>cAc	p.R153H	U3_ENST00000408534.1_RNA|FAM83A_ENST00000318462.6_Missense_Mutation_p.R153H|FAM83A_ENST00000546351.1_Missense_Mutation_p.R153H|RP11-539E17.5_ENST00000522383.1_RNA|FAM83A_ENST00000276699.6_Missense_Mutation_p.R153H|FAM83A_ENST00000522648.1_Missense_Mutation_p.R153H|FAM83A_ENST00000536633.1_Missense_Mutation_p.R153H			Q86UY5	FA83A_HUMAN	family with sequence similarity 83, member A	153								p.R153H(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(2)|skin(1)	17	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			CTCGTCCGCCGCTGCATCACC	0.607																																																1	Substitution - Missense(1)	ovary(1)	8						G	HIS/ARG,HIS/ARG	0,4394		0,0,2197	54.0	56.0	55.0		458,458	5.5	1.0	8		55	1,8587		0,1,4293	no	missense,missense	FAM83A	NM_032899.4,NM_207006.1	29,29	0,1,6490	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	153/435,153/368	124195554	1,12981	2197	4294	6491	124264735	SO:0001583	missense	84985			BC052300	CCDS6339.1, CCDS6340.1, CCDS75784.1	8q24.13	2014-03-13			ENSG00000147689	ENSG00000147689			28210	protein-coding gene	gene with protein product						22886303	Standard	XM_005251087		Approved	MGC14128, BJ-TSA-9	uc003ypx.3	Q86UY5	OTTHUMG00000165083	ENST00000518448.1:c.458G>A	8.37:g.124195554G>A	ENSP00000428876:p.Arg153His	Somatic		Capture	Illumina GAIIx	4	124264735	Q71HL2|Q8N7I1|Q96I47	Missense_Mutation	SNP	HMMPfam_DUF1669;superfamily_Phospholipase D/nuclease	p.R153H	ENST00000518448.1	37	c.458	CCDS6340.1	8	.	.	.	.	.	.	.	.	.	.	G	25.0	4.589895	0.86851	0.0	1.16E-4	ENSG00000147689	ENST00000518448;ENST00000546351;ENST00000536633;ENST00000318462;ENST00000522648;ENST00000276699	T;T;T;T;T;T	0.14391	2.51;2.86;2.51;2.51;2.86;2.51	5.46	5.46	0.80206	.	0.116123	0.64402	D	0.000011	T	0.40791	0.1131	M	0.76574	2.34	0.41628	D	0.989009	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.977;0.955;0.989	T	0.25676	-1.0125	10	0.66056	D	0.02	-33.6774	19.2957	0.94120	0.0:0.0:1.0:0.0	.	153;153;153	Q86UY5-2;Q86UY5-3;Q86UY5	.;.;FA83A_HUMAN	H	153	ENSP00000428876:R153H;ENSP00000440565:R153H;ENSP00000445218:R153H;ENSP00000323034:R153H;ENSP00000427979:R153H;ENSP00000276699:R153H	ENSP00000276699:R153H	R	+	2	0	FAM83A	124264735	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.362000	0.52314	2.548000	0.85928	0.561000	0.74099	CGC	-	HMMPfam_DUF1669		0.607	FAM83A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83A	protein_coding	OTTHUMT00000381737.1	G	NM_032899		124264735	1	no_errors	NM_032899	genbank	human	validated	54_36p	missense	SNP	1	A
MYOM2	9172	genome.wustl.edu	37	8	2057292	2057292	+	Silent	SNP	T	T	C			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr8:2057292T>C	ENST00000262113.4	+	25	3291	c.3150T>C	c.(3148-3150)atT>atC	p.I1050I	MYOM2_ENST00000523438.1_Silent_p.I475I	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1050					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.I1050I(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		ACCGATTTATTATTAACGACA	0.473																																																1	Substitution - coding silent(1)	ovary(1)	8											87.0	84.0	85.0					8																	2057292		2203	4300	6503	2044699	SO:0001819	synonymous_variant	9172				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.3150T>C	8.37:g.2057292T>C		Somatic		Capture	Illumina GAIIx	4	2044699	Q7Z3Y2	Silent	SNP	HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_I-set;superfamily_Immunoglobulin	p.I1050	ENST00000262113.4	37	c.3150	CCDS5957.1	8																																																																																			-	NULL		0.473	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	protein_coding	OTTHUMT00000251249.1	T	NM_003970		2044699	1	no_errors	NM_003970	genbank	human	validated	54_36p	silent	SNP	0.88	C
ZNF16	7564	genome.wustl.edu	37	8	146157787	146157787	+	Missense_Mutation	SNP	G	G	T			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr8:146157787G>T	ENST00000276816.4	-	4	572	c.386C>A	c.(385-387)tCc>tAc	p.S129Y	ZNF16_ENST00000394909.2_Missense_Mutation_p.S129Y	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	129	Necessary for transcription activation.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S129Y(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		CTGGGAGAGGGACTGTGGCAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	8											74.0	79.0	77.0					8																	146157787		2203	4300	6503	146128591	SO:0001583	missense	7564			X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.386C>A	8.37:g.146157787G>T	ENSP00000276816:p.Ser129Tyr	Somatic		Capture	Illumina GAIIx	4	146128591	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	-	p.S129Y	ENST00000276816.4	37	c.386	CCDS6437.1	8	.	.	.	.	.	.	.	.	.	.	G	11.09	1.537239	0.27475	.	.	ENSG00000170631	ENST00000276816;ENST00000394909;ENST00000532351	T;T;T	0.09630	2.96;2.96;4.58	4.17	3.28	0.37604	.	.	.	.	.	T	0.09512	0.0234	N	0.08118	0	0.09310	N	1	D	0.55385	0.971	P	0.51355	0.667	T	0.22138	-1.0225	9	0.59425	D	0.04	.	9.6158	0.39690	0.0:0.2137:0.7863:0.0	.	129	P17020	ZNF16_HUMAN	Y	129	ENSP00000276816:S129Y;ENSP00000378369:S129Y;ENSP00000434321:S129Y	ENSP00000276816:S129Y	S	-	2	0	ZNF16	146128591	0.000000	0.05858	0.003000	0.11579	0.021000	0.10359	0.027000	0.13621	0.928000	0.37168	0.563000	0.77884	TCC	-	NULL		0.562	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF16	protein_coding	OTTHUMT00000382978.1	G	NM_006958		146128591	-1	no_errors	NM_001029976	genbank	human	reviewed	54_36p	missense	SNP		T
IARS	3376	genome.wustl.edu	37	9	95013039	95013039	+	Missense_Mutation	SNP	G	G	C			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr9:95013039G>C	ENST00000375643.3	-	23	2651	c.2385C>G	c.(2383-2385)gaC>gaG	p.D795E	IARS_ENST00000375629.3_5'UTR|IARS_ENST00000443024.2_Missense_Mutation_p.D795E|IARS_ENST00000447699.2_Missense_Mutation_p.D685E	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	795					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)	p.D795E(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	GTGTGTCCTTGTCCTGAACAG	0.478																																																1	Substitution - Missense(1)	ovary(1)	9											157.0	119.0	132.0					9																	95013039		2203	4300	6503	94052860	SO:0001583	missense	3376			AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.2385C>G	9.37:g.95013039G>C	ENSP00000364794:p.Asp795Glu	Somatic		Capture	Illumina GAIIx	4	94052860	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	HMMPfam_tRNA-synt_1;superfamily_ValRS/IleRS/LeuRS editing domain;superfamily_Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases;HMMPfam_Anticodon_1;superfamily_Nucleotidylyl transferase	p.D795E	ENST00000375643.3	37	c.2385	CCDS6694.1	9	.	.	.	.	.	.	.	.	.	.	G	4.790	0.146866	0.09134	.	.	ENSG00000196305	ENST00000375643;ENST00000451588;ENST00000443024;ENST00000543028;ENST00000447699;ENST00000375660;ENST00000421189;ENST00000436450;ENST00000449893	T;T;T	0.13778	2.56;2.56;2.56	5.52	0.0994	0.14502	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (1);Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.131761	0.64402	N	0.000002	T	0.03305	0.0096	N	0.02985	-0.445	0.80722	D	1	B;B;B	0.11235	0.004;0.0;0.0	B;B;B	0.14023	0.01;0.004;0.004	T	0.43032	-0.9416	10	0.02654	T	1	-14.3119	3.3713	0.07222	0.2362:0.4479:0.2119:0.104	.	305;795;640	F5H1M4;P41252;Q6P0M4	.;SYIC_HUMAN;.	E	795;27;795;19;685;795;19;27;27	ENSP00000364794:D795E;ENSP00000406448:D795E;ENSP00000415020:D685E	ENSP00000364794:D795E	D	-	3	2	IARS	94052860	0.722000	0.28017	0.998000	0.56505	0.991000	0.79684	-0.091000	0.11146	0.023000	0.15187	0.655000	0.94253	GAC	-	HMMPfam_Anticodon_1		0.478	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS	protein_coding	OTTHUMT00000053059.2	G	NM_002161		94052860	-1	no_errors	NM_002161	genbank	human	reviewed	54_36p	missense	SNP	1	C
DNM1	1759	genome.wustl.edu	37	9	131008774	131008774	+	Silent	SNP	G	G	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr9:131008774G>A	ENST00000372923.3	+	16	1865	c.1773G>A	c.(1771-1773)acG>acA	p.T591T	MIR199B_ENST00000384849.1_RNA|MIR3154_ENST00000577829.1_RNA|DNM1_ENST00000475805.1_Silent_p.T591T|DNM1_ENST00000341179.7_Silent_p.T591T|DNM1_ENST00000393594.3_Silent_p.T591T|DNM1_ENST00000486160.1_Silent_p.T591T|DNM1_ENST00000493925.1_3'UTR	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	591	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.T591T(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						TCTTTAACACGGAGCAGAGGT	0.552																																					GBM(113;146 1575 2722 28670 29921)											1	Substitution - coding silent(1)	ovary(1)	9											138.0	97.0	111.0					9																	131008774		2203	4300	6503	130048595	SO:0001819	synonymous_variant	1759			L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1773G>A	9.37:g.131008774G>A		Somatic		Capture	Illumina GAIIx	4	130048595	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Silent	SNP	HMMPfam_Dynamin_M;HMMPfam_Dynamin_N;HMMPfam_PH;HMMPfam_GED;superfamily_PH domain-like;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.T591	ENST00000372923.3	37	c.1773	CCDS6895.1	9																																																																																			-	HMMPfam_PH		0.552	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNM1	protein_coding	OTTHUMT00000054367.1	G	NM_004408		130048595	1	no_errors	NM_004408	genbank	human	reviewed	54_36p	silent	SNP	0.84	A
SMC1A	8243	genome.wustl.edu	37	X	53432592	53432592	+	Missense_Mutation	SNP	C	C	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chrX:53432592C>A	ENST00000322213.4	-	11	1871	c.1744G>T	c.(1744-1746)Gat>Tat	p.D582Y	SMC1A_ENST00000375340.6_Missense_Mutation_p.D348Y	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	582	Flexible hinge.				DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.D582Y(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						AGTTTCTCATCTGTAGGCTTC	0.532																																																1	Substitution - Missense(1)	ovary(1)	X											52.0	42.0	45.0					X																	53432592		2203	4300	6503	53449317	SO:0001583	missense	8243			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.1744G>T	X.37:g.53432592C>A	ENSP00000323421:p.Asp582Tyr	Somatic		Capture	Illumina GAIIx	4	53449317	O14995|Q16351|Q2M228	Missense_Mutation	SNP	HMMPfam_SMC_N;HMMPfam_SMC_hinge;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Smc hinge domain	p.D582Y	ENST00000322213.4	37	c.1744	CCDS14352.1	X	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079655	0.76528	.	.	ENSG00000072501	ENST00000322213;ENST00000375340	D;D	0.86497	-2.13;-2.13	5.15	5.15	0.70609	SMCs flexible hinge (3);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.91341	0.7269	L	0.46157	1.445	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.996	D;P;P	0.87578	0.998;0.905;0.878	D	0.92118	0.5701	10	0.72032	D	0.01	.	16.9916	0.86355	0.0:1.0:0.0:0.0	.	348;560;582	B7Z709;Q6MZR8;Q14683	.;.;SMC1A_HUMAN	Y	582;348	ENSP00000323421:D582Y;ENSP00000364489:D348Y	ENSP00000323421:D582Y	D	-	1	0	SMC1A	53449317	0.991000	0.36638	1.000000	0.80357	0.991000	0.79684	2.565000	0.45939	2.476000	0.83614	0.600000	0.82982	GAT	-	HMMPfam_SMC_N:HMMPfam_SMC_hinge		0.532	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	protein_coding	OTTHUMT00000056756.2	C	NM_006306		53449317	-1	no_errors	NM_006306	genbank	human	reviewed	54_36p	missense	SNP	1	A
ARMCX7P	653354	genome.wustl.edu	37	X	100852697	100852697	+	RNA	SNP	T	T	A			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chrX:100852697T>A	ENST00000602449.1	+	0	0																		p.L70*(1)									CCGGATAACTTAAATGCGAGT	0.498																																																1	Substitution - Nonsense(1)	ovary(1)	X																																								100739353			653354																															X.37:g.100852697T>A		Somatic		Capture	Illumina GAIIx	4	100739353		Nonsense_Mutation	SNP	-	p.L84*	ENST00000602449.1	37	c.251		X																																																																																			-	NULL		0.498	RP4-545K15.3-002	KNOWN	basic	processed_transcript	LOC653354	pseudogene	OTTHUMT00000467919.1	T			100739353	1	no_errors	XM_001717888	genbank	human	model	54_36p	nonsense	SNP	0.01	A
L3MBTL2	83746	genome.wustl.edu	37	22	41605732	41605733	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-24-0982-01A-01W-0488-09	TCGA-24-0982-10C-01W-0488-09	GG	GG	GG	AA	GG	GG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7667c0e6-e44a-448f-b118-6e2171a99b6c	41f442b7-c8ce-437d-abac-3130c8b51cb3	g.chr22:41605732_41605733GG>AA	ENST00000216237.5	+	2	215_216	c.57_58GG>AA	c.(55-60)gaGGaa>gaAAaa	p.E20K	L3MBTL2_ENST00000489136.1_3'UTR|RP4-756G23.5_ENST00000441316.1_RNA|RP4-756G23.5_ENST00000451176.1_RNA	NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	20	Poly-Glu.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGGAGGAAGAGGAAGATGACGA	0.485																																																0			22																																								39935679	SO:0001583	missense	83746			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	Exception_encountered	22.37:g.41605732_41605733delinsAA	ENSP00000216237:p.Glu20Lys	Somatic		Capture	Illumina GAIIx	Phase_III	39935678	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	DNP	superfamily_Tudor/PWWP/MBT,HMMSmart_SM00561,HMMPfam_MBT	p.E20K	ENST00000216237.5	37	c.57_58	CCDS14011.1	22																																																																																			-	NULL		0.485	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL2	protein_coding	OTTHUMT00000320613.1	GG	NM_031488		39935679	1	no_errors	NM_031488	genbank	human	validated	54_36p	missense	DNP	1.000:1.000	AA
