#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TXNIP	10628	genome.wustl.edu	37	1	145440070	145440070	+	Silent	SNP	T	T	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr1:145440070T>A	ENST00000369317.4	+	4	838	c.504T>A	c.(502-504)gtT>gtA	p.V168V	TXNIP_ENST00000475171.1_Intron	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	168					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)	p.V168V(1)		breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AAAAGAAAGTTTCCTGCATGT	0.403																																																1	Substitution - coding silent(1)	ovary(1)	1											173.0	195.0	188.0					1																	145440070		2203	4300	6503	144151427	SO:0001819	synonymous_variant	10628			S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.504T>A	1.37:g.145440070T>A		Somatic		Capture	Illumina GAIIx	4	144151427	B4E3D3|Q16226|Q6PML0|Q9BXG9	Silent	SNP	-	p.V168	ENST00000369317.4	37	c.504	CCDS913.1	1																																																																																			-	NULL		0.403	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNIP	protein_coding	OTTHUMT00000038547.1	T	NM_006472		144151427	1	no_errors	NM_006472	genbank	human	validated	54_36p	silent	SNP	1	A
HORMAD1	84072	genome.wustl.edu	37	1	150679068	150679068	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr1:150679068C>G	ENST00000361824.2	-	10	870	c.765G>C	c.(763-765)agG>agC	p.R255S	HORMAD1_ENST00000322343.7_Missense_Mutation_p.R248S|HORMAD1_ENST00000368995.4_Missense_Mutation_p.R175S|HORMAD1_ENST00000368993.2_Missense_Mutation_p.R255S	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	255					blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)		p.R255S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			CATCTTTGTCCCTCAGGATTT	0.313																																																1	Substitution - Missense(1)	ovary(1)	1											164.0	158.0	160.0					1																	150679068		2203	4300	6503	148945692	SO:0001583	missense	84072			AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.765G>C	1.37:g.150679068C>G	ENSP00000355167:p.Arg255Ser	Somatic		Capture	Illumina GAIIx	4	148945692	A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Missense_Mutation	SNP	-	p.R255S	ENST00000361824.2	37	c.765	CCDS967.1	1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.812452	0.00600	.	.	ENSG00000143452	ENST00000368995;ENST00000368993;ENST00000368992;ENST00000540570;ENST00000322343;ENST00000361824;ENST00000368987	T;T;T;T	0.42513	0.97;1.5;1.54;1.5	5.72	0.73	0.18271	.	0.450862	0.23114	N	0.051780	T	0.06735	0.0172	N	0.14661	0.345	0.09310	N	0.999997	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.42241	-0.9463	10	0.08837	T	0.75	-0.7431	8.891	0.35434	0.0:0.6434:0.0:0.3566	.	175;248;255	Q86X24-4;Q86X24-2;Q86X24	.;.;HORM1_HUMAN	S	175;255;184;175;248;255;184	ENSP00000357991:R175S;ENSP00000357989:R255S;ENSP00000326489:R248S;ENSP00000355167:R255S	ENSP00000326489:R248S	R	-	3	2	HORMAD1	148945692	0.331000	0.24713	0.273000	0.24645	0.031000	0.12232	0.470000	0.22084	0.090000	0.17273	-1.443000	0.01068	AGG	-	NULL		0.313	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HORMAD1	protein_coding	OTTHUMT00000084722.1	C	NM_032132		148945692	-1	no_errors	NM_032132	genbank	human	provisional	54_36p	missense	SNP	0.94	G
FLG	2312	genome.wustl.edu	37	1	152286915	152286915	+	Silent	SNP	C	C	T			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr1:152286915C>T	ENST00000368799.1	-	3	482	c.447G>A	c.(445-447)ggG>ggA	p.G149G	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	149					establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G149G(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGCCTTTTCCCCCCTGTTT	0.348									Ichthyosis																																							1	Substitution - coding silent(1)	ovary(1)	1											159.0	171.0	167.0					1																	152286915		2203	4300	6503	150553539	SO:0001819	synonymous_variant	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.447G>A	1.37:g.152286915C>T		Somatic		Capture	Illumina GAIIx	4	150553539	Q01720|Q5T583|Q9UC71	Silent	SNP	-	p.G149	ENST00000368799.1	37	c.447	CCDS30860.1	1																																																																																			-	NULL		0.348	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	C	NM_002016		150553539	-1	no_errors	NM_002016	genbank	human	provisional	54_36p	silent	SNP		T
MECR	51102	genome.wustl.edu	37	1	29528552	29528552	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr1:29528552T>A	ENST00000263702.6	-	6	684	c.659A>T	c.(658-660)gAt>gTt	p.D220V	MECR_ENST00000489248.1_5'Flank|MECR_ENST00000373791.3_Missense_Mutation_p.D144V			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	220					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)	p.D220V(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		CTTCTGGATATCAGGTCTGGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											155.0	158.0	157.0					1																	29528552		2203	4300	6503	29401139	SO:0001583	missense	51102				CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.659A>T	1.37:g.29528552T>A	ENSP00000263702:p.Asp220Val	Somatic		Capture	Illumina GAIIx	4	29401139	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	superfamily_GroES-like;HMMPfam_ADH_zinc_N;HMMPfam_ADH_N;superfamily_NAD(P)-binding Rossmann-fold domains	p.D220V	ENST00000263702.6	37	c.659	CCDS30659.1	1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.514349	0.64522	.	.	ENSG00000116353	ENST00000373791;ENST00000263702;ENST00000373792;ENST00000453185	T;T	0.04234	3.67;3.67	5.75	5.75	0.90469	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.202986	0.49916	D	0.000127	T	0.09730	0.0239	M	0.78049	2.395	0.80722	D	1	P	0.37548	0.599	B	0.36922	0.236	T	0.01363	-1.1374	10	0.54805	T	0.06	-1.115	12.4474	0.55659	0.0:0.0:0.0:1.0	.	220	Q9BV79	MECR_HUMAN	V	144;220;132;59	ENSP00000362896:D144V;ENSP00000263702:D220V	ENSP00000263702:D220V	D	-	2	0	MECR	29401139	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.772000	0.75001	2.185000	0.69588	0.459000	0.35465	GAT	-	HMMPfam_ADH_zinc_N		0.512	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MECR	protein_coding	OTTHUMT00000130740.1	T	NM_016011		29401139	-1	no_errors	NM_016011	genbank	human	validated	54_36p	missense	SNP	0.97	A
RGS18	64407	genome.wustl.edu	37	1	192150457	192150457	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr1:192150457G>C	ENST00000367460.3	+	4	500	c.319G>C	c.(319-321)Gaa>Caa	p.E107Q		NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	107	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.E107Q(1)		kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCTTAAAACTGAATTCAGTGA	0.289																																																1	Substitution - Missense(1)	ovary(1)	1											36.0	40.0	39.0					1																	192150457		2174	4284	6458	190417080	SO:0001583	missense	64407			AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.319G>C	1.37:g.192150457G>C	ENSP00000356430:p.Glu107Gln	Somatic		Capture	Illumina GAIIx	4	190417080	B2RD23	Missense_Mutation	SNP	-	p.E107Q	ENST00000367460.3	37	c.319	CCDS1374.1	1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.705662	0.89018	.	.	ENSG00000150681	ENST00000367460	T	0.02258	4.37	5.51	5.51	0.81932	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.17916	0.0430	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00585	-1.1658	10	0.66056	D	0.02	.	17.9822	0.89145	0.0:0.0:1.0:0.0	.	107	Q9NS28	RGS18_HUMAN	Q	107	ENSP00000356430:E107Q	ENSP00000356430:E107Q	E	+	1	0	RGS18	190417080	1.000000	0.71417	0.994000	0.49952	0.950000	0.60333	9.447000	0.97595	2.601000	0.87937	0.460000	0.39030	GAA	-	NULL		0.289	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS18	protein_coding	OTTHUMT00000086382.1	G	NM_130782		190417080	1	no_errors	NM_130782	genbank	human	reviewed	54_36p	missense	SNP	1	C
MYO3A	53904	genome.wustl.edu	37	10	26463053	26463053	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr10:26463053C>A	ENST00000265944.5	+	30	4026	c.3860C>A	c.(3859-3861)cCt>cAt	p.P1287H	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1287			P -> T (in dbSNP:rs35575696). {ECO:0000269|PubMed:17344846}.		ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.P1287H(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						ACTTTGGAACCTACACTTAGC	0.418																																																1	Substitution - Missense(1)	ovary(1)	10											61.0	65.0	63.0					10																	26463053		2203	4300	6503	26503059	SO:0001583	missense	53904			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3860C>A	10.37:g.26463053C>A	ENSP00000265944:p.Pro1287His	Somatic		Capture	Illumina GAIIx	4	26503059	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like);superfamily_P-loop containing nucleoside triphosphate hydrolases;IQ;HMMPfam_IQ;Pkinase;Myosin_head;HMMPfam_Myosin_head	p.P1287H	ENST00000265944.5	37	c.3860	CCDS7148.1	10	.	.	.	.	.	.	.	.	.	.	C	5.954	0.360016	0.11296	.	.	ENSG00000095777	ENST00000265944	T	0.77229	-1.08	5.63	4.72	0.59763	.	0.821445	0.11667	N	0.541242	T	0.68016	0.2955	L	0.29908	0.895	0.48901	D	0.999725	P	0.41748	0.761	B	0.38500	0.275	T	0.64145	-0.6476	10	0.45353	T	0.12	.	11.4708	0.50268	0.1414:0.7225:0.136:0.0	.	1287	Q8NEV4	MYO3A_HUMAN	H	1287	ENSP00000265944:P1287H	ENSP00000265944:P1287H	P	+	2	0	MYO3A	26503059	0.020000	0.18652	0.021000	0.16686	0.152000	0.21847	0.668000	0.25127	1.355000	0.45865	0.563000	0.77884	CCT	-	NULL		0.418	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	protein_coding	OTTHUMT00000047259.1	C	NM_017433		26503059	1	no_errors	NM_017433	genbank	human	reviewed	54_36p	missense	SNP	0.13	A
PARG	8505	genome.wustl.edu	37	10	51069692	51069692	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr10:51069692G>A	ENST00000402038.3	-	8	691	c.692C>T	c.(691-693)aCa>aTa	p.T231I		NM_003631.2	NP_003622.2	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	716	A-domain.				carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)	p.T716I(1)		endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		ATGCAATCGTGTCAAGGGTTT	0.358																																																1	Substitution - Missense(1)	ovary(1)	10											34.0	42.0	39.0					10																	51069692		692	1581	2273	50739698	SO:0001583	missense	8505			AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000402038.3:c.692C>T	10.37:g.51069692G>A	ENSP00000384408:p.Thr231Ile	Somatic		Capture	Illumina GAIIx	4	50739698	A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	Missense_Mutation	SNP	-	p.T716I	ENST00000402038.3	37	c.2147		10	.	.	.	.	.	.	.	.	.	.	G	15.07	2.725143	0.48833	.	.	ENSG00000227345	ENST00000402038	.	.	.	4.75	4.75	0.60458	.	0.083859	0.46758	U	0.000274	T	0.67636	0.2914	L	0.43152	1.355	.	.	.	D;D;D;D;D;D	0.63046	0.973;0.992;0.988;0.96;0.96;0.992	P;D;P;P;P;D	0.64595	0.807;0.927;0.78;0.78;0.844;0.927	T	0.68014	-0.5521	8	0.36615	T	0.2	-3.7512	17.3468	0.87311	0.0:0.0:1.0:0.0	.	634;716;267;231;256;716	Q86W56-2;Q86W56;A5YBK3;Q5SQP4;B4DX76;Q0MQR4	.;PARG_HUMAN;.;.;.;.	I	231	.	ENSP00000384408:T231I	T	-	2	0	PARG	50739698	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.591000	0.61019	2.170000	0.68504	0.462000	0.41574	ACA	-	NULL		0.358	PARG-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	PARG	protein_coding	OTTHUMT00000048011.2	G	NM_003631		50739698	-1	no_errors	ENST00000402038	ensembl	human	known	54_36p	missense	SNP	0.75	A
ANK3	288	genome.wustl.edu	37	10	61967903	61967903	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr10:61967903T>C	ENST00000280772.2	-	10	1276	c.1085A>G	c.(1084-1086)gAt>gGt	p.D362G	ANK3_ENST00000503366.1_Missense_Mutation_p.D345G|ANK3_ENST00000373827.2_Missense_Mutation_p.D356G	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	362					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.D362G(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						ATTGGTGACATCATCCACGGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	10											201.0	158.0	173.0					10																	61967903		2203	4300	6503	61637909	SO:0001583	missense	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.1085A>G	10.37:g.61967903T>C	ENSP00000280772:p.Asp362Gly	Somatic		Capture	Illumina GAIIx	4	61637909	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	HMMPfam_Death;HMMPfam_ZU5;HMMPfam_Ank;superfamily_Ankyrin repeat;superfamily_DEATH domain	p.D362G	ENST00000280772.2	37	c.1085	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	T	24.0	4.476912	0.84640	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000395293;ENST00000395304	T;T;T	0.15718	2.4;2.4;2.4	4.78	4.78	0.61160	Ankyrin repeat-containing domain (4);	0.000000	0.44285	D	0.000468	T	0.32194	0.0821	L	0.37697	1.125	0.80722	D	1	P;D;D;D	0.89917	0.954;0.992;0.993;1.0	P;P;D;D	0.91635	0.814;0.905;0.973;0.999	T	0.06144	-1.0843	10	0.87932	D	0	.	14.4831	0.67597	0.0:0.0:0.0:1.0	.	345;23;356;362	E9PE32;E7EMJ1;Q5CZH9;Q12955	.;.;.;ANK3_HUMAN	G	362;356;345;324;23;23	ENSP00000280772:D362G;ENSP00000362933:D356G;ENSP00000425236:D345G	ENSP00000280772:D362G	D	-	2	0	ANK3	61637909	1.000000	0.71417	0.476000	0.27291	0.966000	0.64601	7.825000	0.86693	2.014000	0.59158	0.460000	0.39030	GAT	-	HMMPfam_Ank		0.488	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	protein_coding	OTTHUMT00000048201.4	T	NM_020987		61637909	-1	no_errors	NM_020987	genbank	human	reviewed	54_36p	missense	SNP	1	C
DNA2	1763	genome.wustl.edu	37	10	70182344	70182344	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr10:70182344T>A	ENST00000358410.3	-	16	2470	c.2420A>T	c.(2419-2421)gAa>gTa	p.E807V	DNA2_ENST00000399179.2_Intron|DNA2_ENST00000399180.2_Missense_Mutation_p.E893V	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	807	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						GAATAAGCTTTCACTCATGCC	0.363																																																0			10											214.0	201.0	205.0					10																	70182344		1875	4105	5980	69852350	SO:0001583	missense	1763			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2420A>T	10.37:g.70182344T>A	ENSP00000351185:p.Glu807Val	Somatic		Capture	Illumina GAIIx	4	69852350	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	-	p.E893V	ENST00000358410.3	37	c.2678		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.25|12.25	1.882360|1.882360	0.33255|0.33255	.|.	.|.	ENSG00000138346|ENSG00000138346	ENST00000399180;ENST00000358410|ENST00000440722	T;T|.	0.80566|.	-1.39;-1.39|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.58764|.	0.2145|.	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|.	0.55444|.	-0.8140|.	10|.	0.25106|.	T|.	0.35|.	.|.	15.6974|15.6974	0.77512|0.77512	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	807|.	P51530|.	DNA2L_HUMAN|.	V|C	893;807|128	ENSP00000382133:E893V;ENSP00000351185:E807V|.	ENSP00000351185:E807V|.	E|X	-|-	2|3	0|0	DNA2|DNA2	69852350|69852350	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.714000|7.714000	0.84703|0.84703	2.108000|2.108000	0.64289|0.64289	0.528000|0.528000	0.53228|0.53228	GAA|TGA	-	NULL		0.363	DNA2-001	KNOWN	basic|appris_principal	protein_coding	DNA2	protein_coding	OTTHUMT00000048334.2	T			69852350	-1	no_errors	NM_001080449	genbank	human	provisional	54_36p	missense	SNP	1	A
KIF18A	81930	genome.wustl.edu	37	11	28058014	28058014	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr11:28058014T>A	ENST00000263181.6	-	14	2436	c.2146A>T	c.(2146-2148)Aat>Tat	p.N716Y		NM_031217.3	NP_112494.3	Q8NI77	KI18A_HUMAN	kinesin family member 18A	716					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|protein transport (GO:0015031)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore microtubule (GO:0005828)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|ruffle (GO:0001726)	actin binding (GO:0003779)|ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|plus-end-directed microtubule motor activity (GO:0008574)|tubulin-dependent ATPase activity (GO:0070463)|ubiquitin binding (GO:0043130)	p.N716Y(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	36						GTAGACGGATTTTGAAAAGCT	0.358																																																1	Substitution - Missense(1)	ovary(1)	11											115.0	117.0	116.0					11																	28058014		2202	4298	6500	28014590	SO:0001583	missense	81930			AL136819	CCDS7867.1	11p14.1	2014-06-12			ENSG00000121621	ENSG00000121621		"""Kinesins"""	29441	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 99"""	611271				11230166	Standard	NM_031217		Approved	DKFZP434G2226, PPP1R99	uc001msc.2	Q8NI77	OTTHUMG00000166195	ENST00000263181.6:c.2146A>T	11.37:g.28058014T>A	ENSP00000263181:p.Asn716Tyr	Somatic		Capture	Illumina GAIIx	4	28014590	Q4VPE3|Q86VS5|Q9H0F3	Missense_Mutation	SNP	-	p.N716Y	ENST00000263181.6	37	c.2146	CCDS7867.1	11	.	.	.	.	.	.	.	.	.	.	T	14.06	2.421798	0.43020	.	.	ENSG00000121621	ENST00000263181	T	0.72725	-0.68	5.87	2.2	0.27929	.	0.282420	0.34932	N	0.003561	T	0.55049	0.1896	L	0.47716	1.5	0.09310	N	1	P	0.38863	0.65	B	0.31751	0.135	T	0.51293	-0.8724	10	0.62326	D	0.03	.	5.372	0.16144	0.2712:0.0737:0.0:0.6551	.	716	Q8NI77	KI18A_HUMAN	Y	716	ENSP00000263181:N716Y	ENSP00000263181:N716Y	N	-	1	0	KIF18A	28014590	0.090000	0.21635	0.001000	0.08648	0.335000	0.28730	1.756000	0.38390	0.180000	0.19960	0.533000	0.62120	AAT	-	NULL		0.358	KIF18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF18A	protein_coding	OTTHUMT00000388328.3	T	NM_031217		28014590	-1	no_errors	NM_031217	genbank	human	validated	54_36p	missense	SNP		A
FAM111A	63901	genome.wustl.edu	37	11	58920334	58920334	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr11:58920334G>C	ENST00000528737.1	+	5	4011	c.1193G>C	c.(1192-1194)aGt>aCt	p.S398T	FAM111A_ENST00000361723.3_Missense_Mutation_p.S398T|FAM111A_ENST00000533703.1_Missense_Mutation_p.S398T|FAM111A_ENST00000531147.1_Missense_Mutation_p.S398T|FAM111A_ENST00000420244.1_Missense_Mutation_p.S398T			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	398	Interaction with SV40 large T antigen.				defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.S398T(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				ATAGAGCCAAGTAAGTGGGCA	0.393																																																1	Substitution - Missense(1)	ovary(1)	11											163.0	162.0	163.0					11																	58920334		2201	4295	6496	58676910	SO:0001583	missense	63901			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.1193G>C	11.37:g.58920334G>C	ENSP00000434435:p.Ser398Thr	Somatic		Capture	Illumina GAIIx	4	58676910	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	superfamily_Trypsin-like serine proteases	p.S398T	ENST00000528737.1	37	c.1193	CCDS7973.1	11	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893414	0.33442	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.73	1.09	0.20402	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.719821	0.13532	N	0.380877	T	0.30355	0.0762	L	0.46157	1.445	0.09310	N	1	B	0.27013	0.166	B	0.28553	0.091	T	0.19257	-1.0311	10	0.27785	T	0.31	-7.6407	4.1103	0.10055	0.2483:0.3737:0.378:0.0	.	398	Q96PZ2	F111A_HUMAN	T	398	ENSP00000434435:S398T;ENSP00000406683:S398T;ENSP00000355264:S398T;ENSP00000433154:S398T;ENSP00000431631:S398T	ENSP00000355264:S398T	S	+	2	0	FAM111A	58676910	0.000000	0.05858	0.001000	0.08648	0.274000	0.26718	-0.045000	0.12003	0.409000	0.25649	0.655000	0.94253	AGT	-	NULL		0.393	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM111A	protein_coding	OTTHUMT00000393975.1	G	NM_022074		58676910	1	no_errors	NM_022074	genbank	human	validated	54_36p	missense	SNP		C
OOSP2	219990	genome.wustl.edu	37	11	59811021	59811021	+	Silent	SNP	G	G	A	rs199849874		TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr11:59811021G>A	ENST00000278855.2	+	2	329	c.144G>A	c.(142-144)gcG>gcA	p.A48A	PLAC1L_ENST00000532905.1_Silent_p.A17A	NM_173801.3	NP_776162.2	Q86WS3	OOSP2_HUMAN		48						extracellular region (GO:0005576)		p.A48A(1)		breast(1)|lung(9)|ovary(2)|prostate(2)|skin(1)	15						ATATATTTGCGGATGAATTAC	0.403																																																1	Substitution - coding silent(1)	ovary(1)	11						G		0,4402		0,0,2201	121.0	119.0	120.0		144	-1.8	0.1	11		120	1,8589	1.2+/-3.3	0,1,4294	yes	coding-synonymous	PLAC1L	NM_173801.3		0,1,6495	AA,AG,GG		0.0116,0.0,0.0077		48/159	59811021	1,12991	2201	4295	6496	59567597	SO:0001819	synonymous_variant	219990																														ENST00000278855.2:c.144G>A	11.37:g.59811021G>A		Somatic		Capture	Illumina GAIIx	4	59567597	E9PJA4|Q8N9U6	Silent	SNP	-	p.A48	ENST00000278855.2	37	c.144	CCDS7979.1	11																																																																																			-	NULL		0.403	PLAC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAC1L	protein_coding	OTTHUMT00000394411.1	G			59567597	1	no_errors	NM_173801	genbank	human	provisional	54_36p	silent	SNP	0.52	A
OR8A1	390275	genome.wustl.edu	37	11	124440425	124440425	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr11:124440425C>T	ENST00000284287.3	+	1	533	c.461C>T	c.(460-462)tCt>tTt	p.S154F		NM_001005194.1	NP_001005194.1	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A, member 1	154					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S154F(1)		haematopoietic_and_lymphoid_tissue(1)|lung(16)|ovary(2)|prostate(1)|skin(2)	22		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		ATCATTATGTCTCATCACACC	0.483																																																1	Substitution - Missense(1)	ovary(1)	11											160.0	135.0	144.0					11																	124440425		2201	4299	6500	123945635	SO:0001583	missense	390275			BK004495	CCDS31712.1	11q24.2	2012-08-09			ENSG00000196119	ENSG00000196119		"""GPCR / Class A : Olfactory receptors"""	8469	protein-coding gene	gene with protein product							Standard	NM_001005194		Approved	OST025	uc010san.2	Q8NGG7	OTTHUMG00000165923	ENST00000284287.3:c.461C>T	11.37:g.124440425C>T	ENSP00000284287:p.Ser154Phe	Somatic		Capture	Illumina GAIIx	4	123945635	Q6IEW7|Q96RC6	Missense_Mutation	SNP	-	p.S154F	ENST00000284287.3	37	c.461	CCDS31712.1	11	.	.	.	.	.	.	.	.	.	.	C	14.15	2.449247	0.43531	.	.	ENSG00000196119	ENST00000284287	T	0.42131	0.98	5.03	4.11	0.48088	GPCR, rhodopsin-like superfamily (1);	0.309751	0.23364	N	0.048991	T	0.58779	0.2146	H	0.94582	3.555	0.09310	N	0.999995	B	0.21905	0.062	B	0.30316	0.114	T	0.60031	-0.7342	10	0.87932	D	0	.	13.7302	0.62783	0.0:0.5327:0.4672:0.0	.	154	Q8NGG7	OR8A1_HUMAN	F	154	ENSP00000284287:S154F	ENSP00000284287:S154F	S	+	2	0	OR8A1	123945635	0.003000	0.15002	0.881000	0.34555	0.639000	0.38242	0.534000	0.23098	1.316000	0.45131	0.650000	0.86243	TCT	-	NULL		0.483	OR8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8A1	protein_coding	OTTHUMT00000387062.1	C	NM_001005194		123945635	1	no_errors	NM_001005194	genbank	human	provisional	54_36p	missense	SNP	0.08	T
CACNA1C	775	genome.wustl.edu	37	12	2613667	2613667	+	Silent	SNP	C	C	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr12:2613667C>A	ENST00000399617.1	+	8	1179	c.1179C>A	c.(1177-1179)tcC>tcA	p.S393S	CACNA1C_ENST00000399649.1_Intron|CACNA1C_ENST00000347598.4_Intron|CACNA1C_ENST00000344100.3_Intron|CACNA1C_ENST00000399637.1_Intron|CACNA1C_ENST00000399641.1_Silent_p.S393S|CACNA1C_ENST00000491104.1_3'UTR|CACNA1C_ENST00000399629.1_Intron|CACNA1C_ENST00000399655.1_Intron|CACNA1C_ENST00000335762.5_Intron|CACNA1C_ENST00000399606.1_Intron|CACNA1C_ENST00000399638.1_Intron|CACNA1C_ENST00000399621.1_Intron|CACNA1C_ENST00000399597.1_Intron|CACNA1C_ENST00000399595.1_Intron|CACNA1C_ENST00000399603.1_Silent_p.S393S|CACNA1C_ENST00000327702.7_Intron|CACNA1C_ENST00000399634.1_Silent_p.S393S|CACNA1C_ENST00000406454.3_Silent_p.S393S|CACNA1C_ENST00000402845.3_Intron|CACNA1C_ENST00000399601.1_Intron|CACNA1C_ENST00000399644.1_Intron|CACNA1C_ENST00000399591.1_Intron|CACNA1C_ENST00000480911.1_Intron	NM_001167624.1	NP_001161096.1	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	393					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TCTTTGGATCCTTTTTCGTTC	0.488																																																0			12											308.0	256.0	272.0					12																	2613667		1568	3582	5150	2483928	SO:0001819	synonymous_variant	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000399617.1:c.1179C>A	12.37:g.2613667C>A		Somatic		Capture	Illumina GAIIx	4	2483928	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	-	p.S393	ENST00000399617.1	37	c.1179	CCDS53733.1	12																																																																																			-	NULL		0.488	CACNA1C-013	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	CACNA1C	protein_coding	OTTHUMT00000317031.1	C	NM_000719		2483928	1	no_errors	ENST00000399634	ensembl	human	known	54_36p	silent	SNP	1	A
RIC8B	55188	genome.wustl.edu	37	12	107208754	107208754	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr12:107208754T>G	ENST00000392839.2	+	3	519	c.413T>G	c.(412-414)cTt>cGt	p.L138R	RIC8B_ENST00000355478.2_Missense_Mutation_p.L98R|RIC8B_ENST00000549643.1_Intron|RIC8B_ENST00000392837.4_Missense_Mutation_p.L138R	NM_018157.2	NP_060627.2	Q9NVN3	RIC8B_HUMAN	RIC8 guanine nucleotide exchange factor B	138					regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	G-protein alpha-subunit binding (GO:0001965)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.L138R(1)		kidney(2)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	19						AGCCTGGAACTTAATCTTGCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	12											95.0	94.0	94.0					12																	107208754		2203	4300	6503	105732884	SO:0001583	missense	55188			AK128102	CCDS9109.2	12q23.3	2013-08-05	2013-08-05		ENSG00000111785	ENSG00000111785			25555	protein-coding gene	gene with protein product		609147	"""resistance to inhibitors of cholinesterase 8 homolog B (C. elegans)"""				Standard	XM_005268998		Approved	FLJ10620, hSyn, RIC8	uc001tlx.3	Q9NVN3	OTTHUMG00000144188	ENST00000392839.2:c.413T>G	12.37:g.107208754T>G	ENSP00000376583:p.Leu138Arg	Somatic		Capture	Illumina GAIIx	4	105732884	A2RTZ0|Q4G103|Q6ZRN4|Q86WD3	Missense_Mutation	SNP	-	p.L138R	ENST00000392839.2	37	c.413	CCDS9109.2	12	.	.	.	.	.	.	.	.	.	.	T	20.7	4.039203	0.75617	.	.	ENSG00000111785	ENST00000392837;ENST00000392839;ENST00000355478	T;T;T	0.50813	0.73;0.73;0.73	5.76	5.76	0.90799	Armadillo-type fold (1);	0.061109	0.64402	D	0.000002	T	0.63094	0.2482	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.77004	0.974;0.985;0.989	T	0.58211	-0.7676	10	0.24483	T	0.36	-3.9372	16.0796	0.80995	0.0:0.0:0.0:1.0	.	98;138;138	Q9NVN3-3;Q9NVN3;B7WPL0	.;RIC8B_HUMAN;.	R	138;138;98	ENSP00000376582:L138R;ENSP00000376583:L138R;ENSP00000347662:L98R	ENSP00000347662:L98R	L	+	2	0	RIC8B	105732884	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.471000	0.80985	2.206000	0.71126	0.533000	0.62120	CTT	-	NULL		0.423	RIC8B-006	KNOWN	basic|exp_conf|CCDS	protein_coding	RIC8B	protein_coding	OTTHUMT00000291398.2	T	NM_018157		105732884	1	no_errors	NM_018157	genbank	human	validated	54_36p	missense	SNP	1	G
NALCN	259232	genome.wustl.edu	37	13	101944593	101944593	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr13:101944593G>T	ENST00000251127.6	-	8	1005	c.924C>A	c.(922-924)ttC>ttA	p.F308L	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_Missense_Mutation_p.F308L	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	308					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.F308L(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GCCAGGCGAGGAAGAAAATGA	0.468																																																1	Substitution - Missense(1)	ovary(1)	13											76.0	61.0	66.0					13																	101944593		2203	4300	6503	100742594	SO:0001583	missense	259232			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.924C>A	13.37:g.101944593G>T	ENSP00000251127:p.Phe308Leu	Somatic		Capture	Illumina GAIIx	Phase_III	100742594	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	HMMPfam_Ion_trans;superfamily_Voltage-gated potassium channels	p.F308L	ENST00000251127.6	37	c.924	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998521	0.74818	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.97941	-4.62;-4.62	6.16	5.15	0.70609	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96710	0.8926	L	0.33293	1	0.80722	D	1	D;P;P	0.55172	0.97;0.807;0.737	P;P;P	0.58013	0.831;0.498;0.649	D	0.94425	0.7644	10	0.21540	T	0.41	.	14.1163	0.65156	0.1091:0.0:0.8909:0.0	.	308;308;308	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	L	308	ENSP00000251127:F308L;ENSP00000365367:F308L	ENSP00000251127:F308L	F	-	3	2	NALCN	100742594	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.424000	0.44714	2.937000	0.99478	0.650000	0.86243	TTC	-	HMMPfam_Ion_trans		0.468	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	protein_coding	OTTHUMT00000045663.2	G	NM_052867		100742594	-1	no_errors	NM_052867	genbank	human	validated	54_36p	missense	SNP	1	T
Unknown	0	genome.wustl.edu	37	15	22440380	22440380	+	IGR	SNP	G	G	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr15:22440380G>A								RP11-2F9.4 (4203 upstream) : IGHV1OR15-1 (8001 downstream)																							GCTGATTTTGGCATTCTTTTT	0.458																																																0			15																																								19941744	SO:0001628	intergenic_variant	388076																															15.37:g.22440380G>A		Somatic		Capture	Illumina GAIIx	4	19941744		Missense_Mutation	SNP	-	p.A156V		37	c.467		15																																																																																			-	NULL	0	0.458					LOC388076			G			19941744	-1	pseudogene	XM_931016	genbank	human	model	54_36p	missense	SNP	1	A
PARN	5073	genome.wustl.edu	37	16	14649545	14649545	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr16:14649545C>G	ENST00000437198.2	-	19	1425	c.1284G>C	c.(1282-1284)atG>atC	p.M428I	PARN_ENST00000420015.2_Missense_Mutation_p.M382I|PARN_ENST00000539279.1_Missense_Mutation_p.M253I|PARN_ENST00000341484.7_Missense_Mutation_p.M367I	NM_001134477.2|NM_002582.3	NP_001127949.1|NP_002573.1	O95453	PARN_HUMAN	poly(A)-specific ribonuclease	428					female gamete generation (GO:0007292)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA metabolic process (GO:0016070)|RNA modification (GO:0009451)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|nuclease activity (GO:0004518)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(A)-specific ribonuclease activity (GO:0004535)|protein kinase binding (GO:0019901)	p.M428I(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|urinary_tract(1)	21						AGGGGATATCCATGACCCTCA	0.348																																																1	Substitution - Missense(1)	ovary(1)	16											63.0	56.0	58.0					16																	14649545		1811	4069	5880	14557046	SO:0001583	missense	5073			AJ005698	CCDS45419.1, CCDS45420.1, CCDS58425.1	16p13	2014-08-08	2011-07-07		ENSG00000140694	ENSG00000140694	3.1.13.4		8609	protein-coding gene	gene with protein product	"""deadenylation nuclease"""	604212	"""poly(A)-specific ribonuclease (deadenylation nuclease)"""			10640832	Standard	NM_002582		Approved	DAN	uc010uzd.2	O95453	OTTHUMG00000173199	ENST00000437198.2:c.1284G>C	16.37:g.14649545C>G	ENSP00000387911:p.Met428Ile	Somatic		Capture	Illumina GAIIx	4	14557046	B2RCB3|B4DDG8|B4DWR4|B4E1H6	Missense_Mutation	SNP	-	p.M428I	ENST00000437198.2	37	c.1284	CCDS45419.1	16	.	.	.	.	.	.	.	.	.	.	C	12.29	1.893252	0.33442	.	.	ENSG00000140694	ENST00000437198;ENST00000341484;ENST00000420015;ENST00000539279	.	.	.	5.76	5.76	0.90799	.	0.074477	0.85682	D	0.000000	T	0.36138	0.0956	N	0.03115	-0.41	0.44409	D	0.997324	B;B;B	0.12013	0.005;0.001;0.0	B;B;B	0.09377	0.004;0.002;0.001	T	0.18618	-1.0331	9	0.24483	T	0.36	-14.7373	17.4573	0.87610	0.0:1.0:0.0:0.0	.	253;382;428	B4DSB0;B4DWR4;O95453	.;.;PARN_HUMAN	I	428;367;382;253	.	ENSP00000345456:M367I	M	-	3	0	PARN	14557046	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.495000	0.35627	2.714000	0.92807	0.591000	0.81541	ATG	-	NULL		0.348	PARN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARN	protein_coding	OTTHUMT00000422383.1	C	NM_002582		14557046	-1	no_errors	NM_002582	genbank	human	reviewed	54_36p	missense	SNP	1	G
N4BP1	9683	genome.wustl.edu	37	16	48595211	48595211	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr16:48595211T>C	ENST00000262384.3	-	2	1579	c.1343A>G	c.(1342-1344)aAa>aGa	p.K448R	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	448					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)		p.K448R(1)		breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				AGCTTCCACTTTGAATGGTAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	16											109.0	101.0	104.0					16																	48595211		1854	4098	5952	47152712	SO:0001583	missense	9683			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.1343A>G	16.37:g.48595211T>C	ENSP00000262384:p.Lys448Arg	Somatic		Capture	Illumina GAIIx	4	47152712	A7MD49|Q2YDX1	Missense_Mutation	SNP	-	p.K448R	ENST00000262384.3	37	c.1343	CCDS45479.1	16	.	.	.	.	.	.	.	.	.	.	T	6.118	0.389929	0.11581	.	.	ENSG00000102921	ENST00000262384	T	0.47528	0.84	5.71	-1.13	0.09775	.	0.634648	0.16817	N	0.198316	T	0.24084	0.0583	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18116	-1.0347	10	0.19590	T	0.45	-13.5351	12.9746	0.58531	0.0:0.3782:0.0:0.6218	.	448	O75113	N4BP1_HUMAN	R	448	ENSP00000262384:K448R	ENSP00000262384:K448R	K	-	2	0	N4BP1	47152712	0.001000	0.12720	0.902000	0.35471	0.875000	0.50365	-0.440000	0.06888	-0.128000	0.11641	-0.605000	0.04089	AAA	-	NULL		0.373	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP1	protein_coding	OTTHUMT00000429920.1	T	NM_014664		47152712	-1	no_errors	NM_153029	genbank	human	validated	54_36p	missense	SNP	1	C
TP53	7157	genome.wustl.edu	37	17	7577599	7577600	+	Frame_Shift_Ins	INS	-	-	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr17:7577599_7577600insA	ENST00000269305.4	-	7	870_871	c.681_682insT	c.(679-684)tctgacfs	p.D228fs	TP53_ENST00000445888.2_Frame_Shift_Ins_p.D228fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.D228fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.D228fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.D228fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.D228fs|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	228	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		D -> A (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> G (in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).|D -> N (in sporadic cancers; somatic mutation).|D -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.D228N(6)|p.?(5)|p.S227S(3)|p.D228Y(2)|p.?fs(2)|p.V225_S227delVGS(2)|p.S227fs*1(1)|p.G226_D228delGSD(1)|p.D228fs*1(1)|p.V225fs*23(1)|p.D228fs*12(1)|p.D228fs*11(1)|p.S227_I232delSDCTTI(1)|p.D228H(1)|p.D228fs*19(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGTACAGTCAGAGCCAACCT	0.525		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	37	Substitution - Missense(9)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Deletion - In frame(4)|Insertion - Frameshift(3)|Substitution - coding silent(3)	biliary_tract(5)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(4)|breast(4)|bone(4)|oesophagus(2)|lung(2)|ovary(2)|liver(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|pancreas(1)	17																																								7518325	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.682dupT	17.37:g.7577600_7577600dupA	ENSP00000269305:p.Asp228fs	Somatic		Capture	Illumina GAIIx	4	7518324	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.D227fs	ENST00000269305.4	37	c.682_681	CCDS11118.1	17																																																																																			-	HMMPfam_P53		0.525	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	-	NM_000546		7518325	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.998:0.801	A
KRT23	25984	genome.wustl.edu	37	17	39081622	39081622	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr17:39081622C>A	ENST00000209718.3	-	7	1550	c.1126G>T	c.(1126-1128)Gag>Tag	p.E376*	KRT23_ENST00000436344.3_Nonsense_Mutation_p.E239*|AC004231.2_ENST00000418393.1_RNA	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	376	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.E376*(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				CTCTCTCCCTCCAGGAGCCGT	0.552																																																1	Substitution - Nonsense(1)	ovary(1)	17											165.0	127.0	140.0					17																	39081622		2203	4300	6503	36335148	SO:0001587	stop_gained	25984			AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.1126G>T	17.37:g.39081622C>A	ENSP00000209718:p.Glu376*	Somatic		Capture	Illumina GAIIx	4	36335148	A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Nonsense_Mutation	SNP	HMMPfam_Filament	p.E376*	ENST00000209718.3	37	c.1126	CCDS11380.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.607467	0.98387	.	.	ENSG00000108244	ENST00000209718;ENST00000436344	.	.	.	5.49	5.49	0.81192	.	0.114249	0.38778	N	0.001577	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.3809	0.94532	0.0:1.0:0.0:0.0	.	.	.	.	X	376;239	.	ENSP00000209718:E376X	E	-	1	0	KRT23	36335148	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.485000	0.81204	2.581000	0.87130	0.655000	0.94253	GAG	-	HMMPfam_Filament		0.552	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT23	protein_coding	OTTHUMT00000257223.1	C			36335148	-1	no_errors	NM_015515	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
CYP2B7P	1556	genome.wustl.edu	37	19	41447223	41447223	+	RNA	SNP	T	T	C			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr19:41447223T>C	ENST00000599198.1	+	0	722					NR_001278.1													p.F223S(1)		NS(1)|endometrium(6)|kidney(1)|lung(2)|ovary(1)|skin(1)	12						TTCTCTGGCTTCTTGAAATAC	0.527																																																1	Substitution - Missense(1)	ovary(1)	19																																								46139063			1556																															19.37:g.41447223T>C		Somatic		Capture	Illumina GAIIx	4	46139063		Missense_Mutation	SNP	-	p.F223S	ENST00000599198.1	37	c.668		19	.	.	.	.	.	.	.	.	.	.	T	17.75	3.465778	0.63513	.	.	ENSG00000256612	ENST00000541697	.	.	.	3.23	3.23	0.37069	.	0.427671	0.22995	N	0.053144	T	0.62441	0.2428	.	.	.	.	.	.	P	0.49635	0.926	P	0.56514	0.8	T	0.74411	-0.3674	7	0.87932	D	0	.	9.8301	0.40937	0.0:0.0:0.0:1.0	.	223	B6A7R5	.	S	223	.	ENSP00000441190:F223S	F	+	2	0	AC008537.4	46139063	0.120000	0.22244	0.017000	0.16124	0.260000	0.26232	2.261000	0.43276	1.482000	0.48325	0.409000	0.27619	TTC	-	NULL		0.527	CYP2B7P1-006	KNOWN	basic	processed_transcript	CYP2B7P1	pseudogene	OTTHUMT00000465180.1	T			46139063	1	no_errors	ENST00000330446	ensembl	human	known	54_36p	missense	SNP	0.29	C
CATSPERD	257062	genome.wustl.edu	37	19	5771046	5771046	+	Missense_Mutation	SNP	G	G	A	rs374184519		TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr19:5771046G>A	ENST00000381624.3	+	19	1787	c.1726G>A	c.(1726-1728)Gtc>Atc	p.V576I	CATSPERD_ENST00000381614.2_Missense_Mutation_p.V234I|CATSPERD_ENST00000309164.7_3'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	576					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)		p.V576I(1)									TCCTCTCCTCGTCTACTATGA	0.627																																																1	Substitution - Missense(1)	ovary(1)	19						G	ILE/VAL	0,3828		0,0,1914	68.0	67.0	67.0		1726	2.1	1.0	19		67	2,8258		0,2,4128	no	missense	TMEM146	NM_152784.3	29	0,2,6042	AA,AG,GG		0.0242,0.0,0.0165	probably-damaging	576/799	5771046	2,12086	1914	4130	6044	5722046	SO:0001583	missense	257062			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.1726G>A	19.37:g.5771046G>A	ENSP00000371037:p.Val576Ile	Somatic		Capture	Illumina GAIIx	4	5722046	Q6ZRP1	Missense_Mutation	SNP	-	p.V576I	ENST00000381624.3	37	c.1726	CCDS12149.2	19	.	.	.	.	.	.	.	.	.	.	G	10.39	1.336965	0.24253	0.0	2.42E-4	ENSG00000174898	ENST00000394548;ENST00000381624;ENST00000381614;ENST00000309164;ENST00000381613	T;T	0.26810	1.71;1.71	3.13	2.09	0.27110	.	0.708561	0.11607	N	0.547158	T	0.39172	0.1068	M	0.61703	1.905	0.22081	N	0.999375	D;D	0.71674	0.992;0.998	P;P	0.60068	0.695;0.868	T	0.12604	-1.0541	10	0.66056	D	0.02	-22.218	5.9475	0.19227	0.1443:0.0:0.8557:0.0	.	502;576	B7WNK5;Q86XM0	.;TM146_HUMAN	I	502;576;234;247;245	ENSP00000371037:V576I;ENSP00000371027:V234I	ENSP00000310546:V247I	V	+	1	0	TMEM146	5722046	0.801000	0.28930	0.970000	0.41538	0.141000	0.21300	0.925000	0.28791	0.883000	0.36040	0.563000	0.77884	GTC	-	NULL		0.627	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TMEM146	protein_coding	OTTHUMT00000286953.2	G	NM_152784		5722046	1	no_errors	NM_152784	genbank	human	validated	54_36p	missense	SNP	0.39	A
MED25	81857	genome.wustl.edu	37	19	50333062	50333062	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr19:50333062T>C	ENST00000312865.6	+	6	598	c.545T>C	c.(544-546)aTt>aCt	p.I182T	MED25_ENST00000538643.1_Intron	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	182	Interaction with the Mediator complex.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)	p.I182T(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		CACTTCTCCATTGTGTCTCCC	0.652																																					GBM(51;894 1657 37868)											1	Substitution - Missense(1)	ovary(1)	19											13.0	12.0	12.0					19																	50333062		2200	4297	6497	55024874	SO:0001583	missense	81857			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.545T>C	19.37:g.50333062T>C	ENSP00000326767:p.Ile182Thr	Somatic		Capture	Illumina GAIIx	4	55024874	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Missense_Mutation	SNP	superfamily_vWA-like	p.I182T	ENST00000312865.6	37	c.545	CCDS33075.1	19	.	.	.	.	.	.	.	.	.	.	T	16.12	3.034219	0.54896	.	.	ENSG00000104973	ENST00000355584;ENST00000377077;ENST00000312881;ENST00000312865;ENST00000456294;ENST00000542221;ENST00000544580	D	0.82433	-1.61	5.65	5.65	0.86999	.	0.194934	0.45361	D	0.000362	T	0.81616	0.4860	L	0.60455	1.87	0.80722	D	1	B	0.31752	0.338	B	0.33121	0.158	T	0.82242	-0.0554	10	0.87932	D	0	.	14.9931	0.71406	0.0:0.0:0.0:1.0	.	182	Q71SY5	MED25_HUMAN	T	182	ENSP00000326767:I182T	ENSP00000326767:I182T	I	+	2	0	MED25	55024874	1.000000	0.71417	0.977000	0.42913	0.651000	0.38670	4.902000	0.63266	2.371000	0.80710	0.533000	0.62120	ATT	-	NULL		0.652	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED25	protein_coding	OTTHUMT00000465316.1	T	NM_030973		55024874	1	no_errors	NM_030973	genbank	human	validated	54_36p	missense	SNP	1	C
PEG3	5178	genome.wustl.edu	37	19	57325380	57325380	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr19:57325380C>A	ENST00000326441.9	-	10	4793	c.4430G>T	c.(4429-4431)gGa>gTa	p.G1477V	PEG3_ENST00000593695.1_Missense_Mutation_p.G1351V|PEG3_ENST00000598410.1_Missense_Mutation_p.G1353V|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.G1477V|ZIM2_ENST00000601070.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1477	Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G1477V(1)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GTCGGCATCTCCCTCTGGCTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	19											140.0	126.0	131.0					19																	57325380		2203	4300	6503	62017192	SO:0001583	missense	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4430G>T	19.37:g.57325380C>A	ENSP00000326581:p.Gly1477Val	Somatic		Capture	Illumina GAIIx	4	62017192	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	HMMPfam_SCAN;HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.G1477V	ENST00000326441.9	37	c.4430	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	C	13.26	2.182719	0.38511	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.03831	3.79;3.79	2.97	1.7	0.24286	.	.	.	.	.	T	0.05502	0.0145	L	0.27053	0.805	.	.	.	D;D;D	0.60160	0.983;0.982;0.987	P;P;P	0.52672	0.637;0.648;0.706	T	0.35871	-0.9771	8	0.18710	T	0.47	-15.2477	5.9165	0.19057	0.0:0.8299:0.0:0.1701	.	1353;1477;1412	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	V	1477	ENSP00000326581:G1477V;ENSP00000403051:G1477V	ENSP00000326581:G1477V	G	-	2	0	ZIM2	62017192	0.000000	0.05858	0.369000	0.25952	0.793000	0.44817	0.046000	0.14035	0.693000	0.31634	0.472000	0.43445	GGA	-	NULL		0.507	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	protein_coding	OTTHUMT00000416099.2	C			62017192	-1	no_errors	NM_006210	genbank	human	provisional	54_36p	missense	SNP	0.8	A
KCNS3	3790	genome.wustl.edu	37	2	18113665	18113665	+	Missense_Mutation	SNP	G	G	A	rs150320186		TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr2:18113665G>A	ENST00000403915.1	+	3	1841	c.1390G>A	c.(1390-1392)Gat>Aat	p.D464N	KCNS3_ENST00000304101.4_Missense_Mutation_p.D464N|KCNS3_ENST00000465292.1_Intron	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	464					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)	p.D464N(3)		endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TGTGGTGAGCGATCCTGACTC	0.453																																																3	Substitution - Missense(3)	ovary(1)|large_intestine(1)|kidney(1)	2						G	ASN/ASP	0,4406		0,0,2203	123.0	112.0	116.0		1390	5.2	0.4	2	dbSNP_134	116	2,8598	2.2+/-6.3	0,2,4298	no	missense	KCNS3	NM_002252.3	23	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	464/492	18113665	2,13004	2203	4300	6503	17977146	SO:0001583	missense	3790			AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.1390G>A	2.37:g.18113665G>A	ENSP00000385968:p.Asp464Asn	Somatic		Capture	Illumina GAIIx	4	17977146	D6W520|O43651|Q4ZFY1|Q96B56	Missense_Mutation	SNP	-	p.D464N	ENST00000403915.1	37	c.1390	CCDS1692.1	2	.	.	.	.	.	.	.	.	.	.	G	4.513	0.095252	0.08681	0.0	2.33E-4	ENSG00000170745	ENST00000403915;ENST00000304101	D;D	0.97138	-4.26;-4.26	6.07	5.19	0.71726	.	0.658090	0.16144	N	0.227590	D	0.93602	0.7957	N	0.22421	0.69	0.43803	D	0.996355	B	0.10296	0.003	B	0.04013	0.001	D	0.89831	0.3996	10	0.38643	T	0.18	.	15.2363	0.73432	0.0669:0.0:0.9331:0.0	.	464	Q9BQ31	KCNS3_HUMAN	N	464	ENSP00000385968:D464N;ENSP00000305824:D464N	ENSP00000305824:D464N	D	+	1	0	KCNS3	17977146	0.870000	0.30015	0.420000	0.26596	0.987000	0.75469	2.980000	0.49321	1.578000	0.49821	0.655000	0.94253	GAT	-	NULL		0.453	KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNS3	protein_coding	OTTHUMT00000323808.1	G	NM_002252		17977146	1	no_errors	NM_002252	genbank	human	reviewed	54_36p	missense	SNP	0.32	A
CCDC141	285025	genome.wustl.edu	37	2	179720257	179720257	+	Silent	SNP	C	C	T			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr2:179720257C>T	ENST00000420890.2	-	19	2994	c.2877G>A	c.(2875-2877)agG>agA	p.R959R	CCDC141_ENST00000295723.5_Silent_p.R384R	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	959								p.R384R(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TTTCCATTTTCCTTTTCAAAG	0.274																																																1	Substitution - coding silent(1)	ovary(1)	2											41.0	44.0	43.0					2																	179720257		2200	4297	6497	179428502	SO:0001819	synonymous_variant	285025			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2877G>A	2.37:g.179720257C>T		Somatic		Capture	Illumina GAIIx	4	179428502	H7C0P1|J3KNW6|Q8N8H3	Silent	SNP	-	p.R384	ENST00000420890.2	37	c.1152		2																																																																																			-	NULL		0.274	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	protein_coding		C	NM_173648		179428502	-1	no_errors	NM_173648	genbank	human	provisional	54_36p	silent	SNP	1	T
WDR5B	54554	genome.wustl.edu	37	3	122133816	122133816	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr3:122133816T>C	ENST00000330689.4	-	1	1066	c.560A>G	c.(559-561)tAt>tGt	p.Y187C	RP11-299J3.8_ENST00000609469.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000608465.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA	NM_019069.3	NP_061942.2	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	187								p.Y187C(1)		kidney(2)|large_intestine(4)|lung(2)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.0704)		GAGGCCATCATAGCTACCTGA	0.423																																																1	Substitution - Missense(1)	ovary(1)	3											85.0	85.0	85.0					3																	122133816		2203	4300	6503	123616506	SO:0001583	missense	54554			AK002149	CCDS3012.1	3q21.1	2013-01-09			ENSG00000196981	ENSG00000196981		"""WD repeat domain containing"""	17826	protein-coding gene	gene with protein product						10369878	Standard	NM_019069		Approved	FLJ11287	uc003efa.1	Q86VZ2	OTTHUMG00000159489	ENST00000330689.4:c.560A>G	3.37:g.122133816T>C	ENSP00000330381:p.Tyr187Cys	Somatic		Capture	Illumina GAIIx	4	123616506	B2RCM9|Q9NUL4	Missense_Mutation	SNP	-	p.Y187C	ENST00000330689.4	37	c.560	CCDS3012.1	3	.	.	.	.	.	.	.	.	.	.	T	19.32	3.805846	0.70682	.	.	ENSG00000196981	ENST00000330689	T	0.41758	0.99	4.64	4.64	0.57946	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.50565	0.1623	L	0.31845	0.965	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.47446	-0.9117	10	0.41790	T	0.15	.	12.3576	0.55184	0.0:0.0:0.0:1.0	.	187	Q86VZ2	WDR5B_HUMAN	C	187	ENSP00000330381:Y187C	ENSP00000330381:Y187C	Y	-	2	0	WDR5B	123616506	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.679000	0.74513	2.082000	0.62665	0.379000	0.24179	TAT	-	NULL		0.423	WDR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR5B	protein_coding	OTTHUMT00000355753.1	T	NM_019069		123616506	-1	no_errors	NM_019069	genbank	human	reviewed	54_36p	missense	SNP	1	C
DTX3L	151636	genome.wustl.edu	37	3	122287985	122287985	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr3:122287985T>A	ENST00000296161.4	+	3	1238	c.1049T>A	c.(1048-1050)aTt>aAt	p.I350N	DTX3L_ENST00000383661.3_Intron	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	350					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I350N(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		CAAGATGACATTTCAGCTGCC	0.383																																																1	Substitution - Missense(1)	ovary(1)	3											85.0	96.0	92.0					3																	122287985		2200	4300	6500	123770675	SO:0001583	missense	151636				CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.1049T>A	3.37:g.122287985T>A	ENSP00000296161:p.Ile350Asn	Somatic		Capture	Illumina GAIIx	4	123770675	B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;superfamily_RING/U-box	p.I350N	ENST00000296161.4	37	c.1049	CCDS3015.1	3	.	.	.	.	.	.	.	.	.	.	T	22.2	4.261288	0.80246	.	.	ENSG00000163840	ENST00000296161	T	0.47869	0.83	5.65	5.65	0.86999	.	0.108665	0.41396	D	0.000889	T	0.63850	0.2546	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.65573	0.936	T	0.66901	-0.5806	10	0.87932	D	0	-12.8112	13.3611	0.60657	0.0:0.0:0.0:1.0	.	350	Q8TDB6	DTX3L_HUMAN	N	350	ENSP00000296161:I350N	ENSP00000296161:I350N	I	+	2	0	DTX3L	123770675	0.999000	0.42202	0.830000	0.32933	0.961000	0.63080	5.331000	0.65905	2.371000	0.80710	0.533000	0.62120	ATT	-	NULL		0.383	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX3L	protein_coding	OTTHUMT00000355966.1	T	NM_138287		123770675	1	no_errors	NM_138287	genbank	human	validated	54_36p	missense	SNP	0.98	A
TRAK1	22906	genome.wustl.edu	37	3	42235383	42235383	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr3:42235383C>G	ENST00000327628.5	+	9	1368	c.968C>G	c.(967-969)aCa>aGa	p.T323R	TRAK1_ENST00000396175.1_Missense_Mutation_p.T265R|TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000341421.3_Missense_Mutation_p.T265R|TRAK1_ENST00000449246.1_Missense_Mutation_p.T249R	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	323	HAP1 N-terminal.				endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.T265R(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						CGGCAGCTCACAGCCGAGGTG	0.532																																					GBM(44;195 884 22595 31865 41850)											1	Substitution - Missense(1)	ovary(1)	3											92.0	93.0	92.0					3																	42235383		2203	4300	6503	42210387	SO:0001583	missense	22906				CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.968C>G	3.37:g.42235383C>G	ENSP00000328998:p.Thr323Arg	Somatic		Capture	Illumina GAIIx	4	42210387	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Missense_Mutation	SNP	-	p.T323R	ENST00000327628.5	37	c.968	CCDS43072.1	3	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725542	0.89298	.	.	ENSG00000182606	ENST00000327628;ENST00000543338;ENST00000449246;ENST00000396175;ENST00000341421	T;T;T;T	0.19938	2.11;2.11;2.11;2.11	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.42607	0.1210	L	0.45698	1.435	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.993;0.997	T	0.05818	-1.0862	10	0.49607	T	0.09	.	19.0018	0.92837	0.0:1.0:0.0:0.0	.	249;265;323;265;249;323	B7Z218;C9JC32;B7Z347;Q9UPV9-2;E9PDS2;Q9UPV9	.;.;.;.;.;TRAK1_HUMAN	R	323;323;249;265;265	ENSP00000328998:T323R;ENSP00000410717:T249R;ENSP00000379478:T265R;ENSP00000340702:T265R	ENSP00000328998:T323R	T	+	2	0	TRAK1	42210387	1.000000	0.71417	0.998000	0.56505	0.913000	0.54294	7.757000	0.85209	2.732000	0.93576	0.637000	0.83480	ACA	-	NULL		0.532	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TRAK1	protein_coding	OTTHUMT00000343413.1	C	NM_014965		42210387	1	no_errors	NM_001042646	genbank	human	validated	54_36p	missense	SNP	1	G
CLDN18	51208	genome.wustl.edu	37	3	137742517	137742517	+	Silent	SNP	C	C	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr3:137742517C>A	ENST00000183605.5	+	2	464	c.238C>A	c.(238-240)Cga>Aga	p.R80R	CLDN18_ENST00000343735.4_Silent_p.R80R	NM_016369.3	NP_057453.1	P56856	CLD18_HUMAN	claudin 18	80					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.R80R(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						GCAGGCAGTGCGAGCCCTGAT	0.522																																																1	Substitution - coding silent(1)	ovary(1)	3											123.0	98.0	106.0					3																	137742517		2203	4300	6503	139225207	SO:0001819	synonymous_variant	51208			AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	ENST00000183605.5:c.238C>A	3.37:g.137742517C>A		Somatic		Capture	Illumina GAIIx	4	139225207	A5PL21|Q96PH4	Silent	SNP	-	p.R80	ENST00000183605.5	37	c.238	CCDS3095.1	3																																																																																			-	NULL		0.522	CLDN18-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLDN18	protein_coding	OTTHUMT00000357199.2	C	NM_001002026		139225207	1	no_errors	NM_001002026	genbank	human	validated	54_36p	silent	SNP	1	A
KIT	3815	genome.wustl.edu	37	4	55602954	55602954	+	Silent	SNP	G	G	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr4:55602954G>A	ENST00000288135.5	+	19	2761	c.2664G>A	c.(2662-2664)cgG>cgA	p.R888R		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	888	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R888R(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AAGGCTTCCGGATGCTCAGCC	0.433		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	1	Substitution - coding silent(1)	ovary(1)	4											84.0	81.0	82.0					4																	55602954		2203	4300	6503	55297711	SO:0001819	synonymous_variant	3815	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2664G>A	4.37:g.55602954G>A		Somatic		Capture	Illumina GAIIx	4	55297711	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Silent	SNP	Pkinase_Tyr;HMMPfam_Pkinase_Tyr;Protein kinase-like (PK-like);superfamily_Protein kinase-like (PK-like);ig;HMMPfam_ig;Immunoglobulin;superfamily_Immunoglobulin	p.R888	ENST00000288135.5	37	c.2664	CCDS3496.1	4																																																																																			-	HMMPfam_Pkinase_Tyr		0.433	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	protein_coding	OTTHUMT00000250618.1	G			55297711	1	no_errors	NM_000222	genbank	human	reviewed	54_36p	silent	SNP	0.96	A
PCDHA3	56145	genome.wustl.edu	37	5	140182138	140182138	+	Silent	SNP	G	G	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr5:140182138G>A	ENST00000522353.2	+	1	1356	c.1356G>A	c.(1354-1356)gcG>gcA	p.A452A	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Silent_p.A452A	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	452	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A452A(1)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGACAATGCGCCGGCATTCT	0.672																																																1	Substitution - coding silent(1)	ovary(1)	5											98.0	98.0	98.0					5																	140182138		2203	4300	6503	140162322	SO:0001819	synonymous_variant	56145			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1356G>A	5.37:g.140182138G>A		Somatic		Capture	Illumina GAIIx	4	140162322	O75286	Silent	SNP	-	p.A452	ENST00000522353.2	37	c.1356	CCDS54915.1	5																																																																																			-	NULL		0.672	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA3	protein_coding	OTTHUMT00000372848.2	G	NM_018906		140162322	1	no_errors	NM_018906	genbank	human	reviewed	54_36p	silent	SNP	0.85	A
SH3PXD2B	285590	genome.wustl.edu	37	5	171777565	171777565	+	Missense_Mutation	SNP	C	C	A	rs201224113		TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr5:171777565C>A	ENST00000311601.5	-	10	984	c.814G>T	c.(814-816)Gcc>Tcc	p.A272S	SH3PXD2B_ENST00000519643.1_Missense_Mutation_p.A272S	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	272	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)	p.A272S(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGGTAGGAGGCGGGGGCCCAG	0.627																																																1	Substitution - Missense(1)	ovary(1)	5											18.0	20.0	19.0					5																	171777565		2203	4299	6502	171710170	SO:0001583	missense	285590			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.814G>T	5.37:g.171777565C>A	ENSP00000309714:p.Ala272Ser	Somatic		Capture	Illumina GAIIx	4	171710170	B6F0V2|Q9P2Q1	Missense_Mutation	SNP	-	p.A272S	ENST00000311601.5	37	c.814	CCDS34291.1	5	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792881	0.50102	.	.	ENSG00000174705	ENST00000519643;ENST00000311601	T;T	0.40476	1.03;1.03	4.96	4.96	0.65561	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.48572	0.1507	L	0.28740	0.885	0.80722	D	1	D	0.55800	0.973	P	0.60068	0.868	T	0.40590	-0.9555	10	0.35671	T	0.21	-18.591	15.7132	0.77646	0.0:1.0:0.0:0.0	.	272	A1X283	SPD2B_HUMAN	S	272	ENSP00000430890:A272S;ENSP00000309714:A272S	ENSP00000309714:A272S	A	-	1	0	SH3PXD2B	171710170	1.000000	0.71417	0.995000	0.50966	0.859000	0.49053	7.454000	0.80714	2.264000	0.75181	0.561000	0.74099	GCC	-	NULL		0.627	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3PXD2B	protein_coding	OTTHUMT00000372449.1	C	NM_017963		171710170	-1	no_errors	NM_001017995	genbank	human	validated	54_36p	missense	SNP	1	A
TMEM174	134288	genome.wustl.edu	37	5	72469177	72469177	+	Missense_Mutation	SNP	C	C	A	rs145426839		TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr5:72469177C>A	ENST00000296776.5	+	1	156	c.107C>A	c.(106-108)gCg>gAg	p.A36E	TMEM174_ENST00000511737.1_3'UTR	NM_153217.2	NP_694949.1	Q8WUU8	TM174_HUMAN	transmembrane protein 174	36						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.A36E(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		GATGACAAGGCGGGGGCCACC	0.562																																																1	Substitution - Missense(1)	ovary(1)	5											159.0	149.0	153.0					5																	72469177		2203	4300	6503	72504933	SO:0001583	missense	134288			BC019346	CCDS4018.1	5q13.2	2008-02-05			ENSG00000164325	ENSG00000164325			28187	protein-coding gene	gene with protein product		614909				12477932	Standard	NM_153217		Approved	MGC13034, FLJ31268	uc010izc.3	Q8WUU8	OTTHUMG00000131268	ENST00000296776.5:c.107C>A	5.37:g.72469177C>A	ENSP00000296776:p.Ala36Glu	Somatic		Capture	Illumina GAIIx	4	72504933	B2RDA0|Q96N81	Missense_Mutation	SNP	-	p.A36E	ENST00000296776.5	37	c.107	CCDS4018.1	5	.	.	.	.	.	.	.	.	.	.	C	29.2	4.981773	0.93044	.	.	ENSG00000164325	ENST00000296776	.	.	.	5.91	5.91	0.95273	.	0.110266	0.64402	D	0.000008	T	0.67144	0.2862	N	0.24115	0.695	0.53688	D	0.999978	D	0.89917	1.0	D	0.77557	0.99	T	0.70019	-0.4987	9	0.87932	D	0	-3.204	20.3053	0.98627	0.0:1.0:0.0:0.0	.	36	Q8WUU8	TM174_HUMAN	E	36	.	ENSP00000296776:A36E	A	+	2	0	TMEM174	72504933	1.000000	0.71417	0.973000	0.42090	0.885000	0.51271	6.487000	0.73633	2.808000	0.96608	0.655000	0.94253	GCG	-	NULL		0.562	TMEM174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM174	protein_coding	OTTHUMT00000254036.1	C	NM_153217		72504933	1	no_errors	NM_153217	genbank	human	validated	54_36p	missense	SNP	1	A
BOD1	91272	genome.wustl.edu	37	5	173036352	173036352	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr5:173036352C>T	ENST00000311086.4	-	3	671	c.448G>A	c.(448-450)Gaa>Aaa	p.E150K	BOD1_ENST00000285908.5_Intron|BOD1_ENST00000480951.1_Intron|BOD1_ENST00000471339.1_5'Flank	NM_138369.2	NP_612378.1	Q96IK1	BOD1_HUMAN	biorientation of chromosomes in cell division 1	150					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|kinetochore (GO:0000776)		p.E150K(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(2)	7						ATTGCTCGTTCTATTTGTGGC	0.527																																																1	Substitution - Missense(1)	ovary(1)	5											146.0	130.0	136.0					5																	173036352		2203	4300	6503	172968958	SO:0001583	missense	91272			AY303777	CCDS4389.1, CCDS54951.1	5q35.2	2013-10-11	2009-03-04	2009-03-04	ENSG00000145919	ENSG00000145919			25114	protein-coding gene	gene with protein product	"""biorientation defective 1"""		"""family with sequence similarity 44, member B"""	FAM44B		17938248	Standard	NM_138369		Approved		uc003mcq.2	Q96IK1	OTTHUMG00000130540	ENST00000311086.4:c.448G>A	5.37:g.173036352C>T	ENSP00000309644:p.Glu150Lys	Somatic		Capture	Illumina GAIIx	4	172968958	B4DXH8|Q9BTW1	Missense_Mutation	SNP	-	p.E150K	ENST00000311086.4	37	c.448	CCDS4389.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.869627|5.869627	0.97049|0.97049	.|.	.|.	ENSG00000145919|ENSG00000145919	ENST00000311086|ENST00000477985	.|.	.|.	.|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77538|0.77538	0.4145|0.4145	M|M	0.74647|0.74647	2.275|2.275	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.87578|.	0.998|.	T|T	0.76075|0.76075	-0.3092|-0.3092	9|5	0.87932|.	D|.	0|.	-39.1734|-39.1734	19.7198|19.7198	0.96137|0.96137	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	150|.	Q96IK1|.	BOD1_HUMAN|.	K|K	150|82	.|.	ENSP00000309644:E150K|.	E|R	-|-	1|2	0|0	BOD1|BOD1	172968958|172968958	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.474000|7.474000	0.81024|0.81024	2.668000|2.668000	0.90789|0.90789	0.655000|0.655000	0.94253|0.94253	GAA|AGA	-	NULL		0.527	BOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1	protein_coding	OTTHUMT00000252963.1	C	NM_138369		172968958	-1	no_errors	NM_138369	genbank	human	provisional	54_36p	missense	SNP	1	T
DUSP22	56940	genome.wustl.edu	37	6	348818	348818	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr6:348818C>T	ENST00000344450.5	+	7	928	c.485C>T	c.(484-486)gCa>gTa	p.A162V	DUSP22_ENST00000605035.1_3'UTR|DUSP22_ENST00000605315.1_Missense_Mutation_p.A59V|DUSP22_ENST00000419235.2_Missense_Mutation_p.A162V|DUSP22_ENST00000603453.1_Missense_Mutation_p.A59V|DUSP22_ENST00000604971.1_Missense_Mutation_p.A59V	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	162					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.A162V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		TTGCAGGATGCAGAAGAAGCC	0.557																																																1	Substitution - Missense(1)	ovary(1)	6											133.0	121.0	125.0					6																	348818		2203	4300	6503	293818	SO:0001583	missense	56940			AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.485C>T	6.37:g.348818C>T	ENSP00000345281:p.Ala162Val	Somatic		Capture	Illumina GAIIx	4	293818	B4DK56|Q59GW2|Q5VWR2|Q96AR1	Missense_Mutation	SNP	HMMPfam_DSPc;superfamily_(Phosphotyrosine protein) phosphatases II	p.A162V	ENST00000344450.5	37	c.485	CCDS4468.1	6	.	.	.	.	.	.	.	.	.	.	C	13.66	2.304108	0.40795	.	.	ENSG00000112679	ENST00000344450	T	0.04406	3.63	4.8	3.94	0.45596	.	0.457704	0.22127	N	0.064244	T	0.01189	0.0039	L	0.36672	1.1	0.27341	N	0.956495	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.06405	0.002;0.001;0.002	T	0.47129	-0.9141	10	0.27785	T	0.31	.	4.1756	0.10349	0.3106:0.5081:0.0:0.1813	.	162;119;162	Q9NRW4-2;B3KSA8;Q9NRW4	.;.;DUS22_HUMAN	V	162	ENSP00000345281:A162V	ENSP00000345281:A162V	A	+	2	0	DUSP22	293818	0.579000	0.26725	0.979000	0.43373	0.976000	0.68499	1.021000	0.30040	1.141000	0.42275	0.655000	0.94253	GCA	-	NULL		0.557	DUSP22-001	KNOWN	basic|CCDS	protein_coding	DUSP22	protein_coding	OTTHUMT00000039621.1	C	NM_020185		293818	1	no_errors	NM_020185	genbank	human	provisional	54_36p	missense	SNP	0.95	T
COL19A1	1310	genome.wustl.edu	37	6	70733536	70733536	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr6:70733536A>T	ENST00000322773.4	+	12	1146	c.1044A>T	c.(1042-1044)aaA>aaT	p.K348N		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	348	Collagen-like 1.|Triple-helical region 1 (COL1).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.K348N(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						AAGGAGAAAAAGGAGATCCAG	0.323																																																1	Substitution - Missense(1)	ovary(1)	6											86.0	85.0	86.0					6																	70733536		2203	4300	6503	70790257	SO:0001583	missense	1310				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.1044A>T	6.37:g.70733536A>T	ENSP00000316030:p.Lys348Asn	Somatic		Capture	Illumina GAIIx	4	70790257	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	HMMPfam_Collagen;superfamily_Concanavalin A-like lectins/glucanases	p.K348N	ENST00000322773.4	37	c.1044	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	A	11.94	1.789901	0.31685	.	.	ENSG00000082293	ENST00000322773	D	0.96587	-4.06	5.5	3.09	0.35607	.	0.133462	0.52532	D	0.000080	D	0.95140	0.8425	M	0.69463	2.115	0.80722	D	1	D	0.58268	0.982	P	0.59825	0.864	D	0.92898	0.6337	10	0.23302	T	0.38	.	9.4425	0.38677	0.8532:0.0:0.1468:0.0	.	348	Q14993	COJA1_HUMAN	N	348	ENSP00000316030:K348N	ENSP00000316030:K348N	K	+	3	2	COL19A1	70790257	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.250000	0.43178	0.930000	0.37217	0.533000	0.62120	AAA	-	HMMPfam_Collagen		0.323	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	protein_coding	OTTHUMT00000041127.1	A			70790257	1	no_errors	NM_001858	genbank	human	reviewed	54_36p	missense	SNP	1	T
TRDN	10345	genome.wustl.edu	37	6	123869664	123869664	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr6:123869664A>T	ENST00000398178.3	-	3	347	c.326T>A	c.(325-327)tTg>tAg	p.L109*	TRDN_ENST00000542443.1_Nonsense_Mutation_p.L109*|TRDN_ENST00000546248.1_Nonsense_Mutation_p.L109*|TRDN_ENST00000334268.4_Nonsense_Mutation_p.L109*	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	109					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)	p.L109*(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		GTCAGATAACAAAGAAAAGAA	0.393																																																1	Substitution - Nonsense(1)	ovary(1)	6											52.0	53.0	53.0					6																	123869664		1846	4092	5938	123911363	SO:0001587	stop_gained	10345			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.326T>A	6.37:g.123869664A>T	ENSP00000381240:p.Leu109*	Somatic		Capture	Illumina GAIIx	4	123911363	A5D6W5|F5H2W7|Q6NSB8	Nonsense_Mutation	SNP	-	p.L109*	ENST00000398178.3	37	c.326	CCDS55053.1	6	.	.	.	.	.	.	.	.	.	.	A	32	5.144860	0.94603	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000333613;ENST00000542443;ENST00000265491	.	.	.	5.29	5.29	0.74685	.	0.096709	0.43919	D	0.000511	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.9386	13.7886	0.63126	1.0:0.0:0.0:0.0	.	.	.	.	X	109;109;109;109;109;109;14;109;14	.	ENSP00000265491:L14X	L	-	2	0	TRDN	123911363	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	5.656000	0.67988	1.983000	0.57843	0.533000	0.62120	TTG	-	NULL		0.393	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	protein_coding		A			123911363	-1	no_errors	NM_006073	genbank	human	validated	54_36p	nonsense	SNP	1	T
Unknown	0	genome.wustl.edu	37	7	66041945	66041945	+	IGR	SNP	G	G	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr7:66041945G>A								GS1-124K5.11 (34409 upstream) : KCTD7 (51922 downstream)																							ACAAGAAAGTGCTGTTGAAAA	0.408																																																0			7																																								65679380	SO:0001628	intergenic_variant	493754																															7.37:g.66041945G>A		Somatic		Capture	Illumina GAIIx	4	65679380		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.408					LOC493754			G			65679380	-1	pseudogene	NR_002933	genbank	human	provisional	54_36p	rna	SNP	0.01	A
MUSK	4593	genome.wustl.edu	37	9	113530182	113530182	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr9:113530182G>A	ENST00000374448.4	+	9	1137	c.1003G>A	c.(1003-1005)Gtt>Att	p.V335I	MUSK_ENST00000416899.2_Missense_Mutation_p.V335I|MUSK_ENST00000189978.5_Missense_Mutation_p.V335I	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	335	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V335I(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						AGATGCTCTTGTTTTTCTCAA	0.512																																																1	Substitution - Missense(1)	ovary(1)	9											104.0	106.0	105.0					9																	113530182		1930	4136	6066	112570003	SO:0001583	missense	4593			AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.1003G>A	9.37:g.113530182G>A	ENSP00000363571:p.Val335Ile	Somatic		Capture	Illumina GAIIx	4	112570003	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	HMMPfam_Fz;HMMPfam_Pkinase_Tyr;superfamily_Protein kinase-like (PK-like);HMMPfam_I-set;superfamily_Immunoglobulin;superfamily_Frizzled cysteine-rich domain	p.V335I	ENST00000374448.4	37	c.1003	CCDS48005.1	9	.	.	.	.	.	.	.	.	.	.	G	27.5	4.840046	0.91117	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000416899	T	0.76316	-1.01	5.08	5.08	0.68730	Frizzled domain (3);	0.000000	0.85682	D	0.000000	D	0.87783	0.6264	M	0.74647	2.275	0.80722	D	1	D	0.67145	0.996	D	0.87578	0.998	D	0.87761	0.2598	10	0.48119	T	0.1	.	17.8228	0.88655	0.0:0.0:1.0:0.0	.	335	O15146	MUSK_HUMAN	I	341;335;335;341	ENSP00000363571:V335I	ENSP00000189978:V341I	V	+	1	0	MUSK	112570003	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.443000	0.80521	2.545000	0.85829	0.591000	0.81541	GTT	-	HMMPfam_Fz		0.512	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUSK	protein_coding		G			112570003	1	no_errors	NM_005592	genbank	human	validated	54_36p	missense	SNP	1	A
KLHL9	55958	genome.wustl.edu	37	9	21333117	21333117	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr9:21333117G>A	ENST00000359039.4	-	1	2262	c.1742C>T	c.(1741-1743)cCa>cTa	p.P581L	KLHL9_ENST00000537938.1_Missense_Mutation_p.P513L			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	581					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)		p.P581L(1)		endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		AAGTGACTCTGGAAGATCAAA	0.413																																																1	Substitution - Missense(1)	ovary(1)	9											120.0	120.0	120.0					9																	21333117		2203	4300	6503	21323117	SO:0001583	missense	55958			AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.1742C>T	9.37:g.21333117G>A	ENSP00000351933:p.Pro581Leu	Somatic		Capture	Illumina GAIIx	4	21323117	Q8TCQ2	Missense_Mutation	SNP	HMMPfam_Kelch_1;superfamily_Galactose oxidase central domain;HMMPfam_BACK;HMMPfam_BTB;superfamily_POZ domain	p.P581L	ENST00000359039.4	37	c.1742	CCDS6503.1	9	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417943	0.42918	.	.	ENSG00000198642	ENST00000359039;ENST00000537938	T;T	0.70164	-0.46;-0.46	4.66	4.66	0.58398	Galactose oxidase, beta-propeller (1);	0.203853	0.42172	D	0.000750	T	0.71333	0.3327	M	0.62266	1.93	0.80722	D	1	B	0.33857	0.429	P	0.47134	0.539	T	0.64437	-0.6408	10	0.12103	T	0.63	.	15.4657	0.75397	0.0:0.0:1.0:0.0	.	581	Q9P2J3	KLHL9_HUMAN	L	581;513	ENSP00000351933:P581L;ENSP00000437733:P513L	ENSP00000351933:P581L	P	-	2	0	KLHL9	21323117	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.701000	0.84566	2.590000	0.87494	0.655000	0.94253	CCA	-	HMMPfam_Kelch_1		0.413	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL9	protein_coding	OTTHUMT00000051898.2	G	NM_018847		21323117	-1	no_errors	NM_018847	genbank	human	validated	54_36p	missense	SNP	1	A
CNTNAP3	79937	genome.wustl.edu	37	9	39086820	39086820	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr9:39086820C>G	ENST00000297668.6	-	20	3320	c.3247G>C	c.(3247-3249)Gat>Cat	p.D1083H	CNTNAP3_ENST00000358144.2_Missense_Mutation_p.D995H|CNTNAP3_ENST00000377656.2_Missense_Mutation_p.D1002H	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	1083	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D1083H(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TGATGTCTATCTAGCTTGTAC	0.328																																																1	Substitution - Missense(1)	ovary(1)	9											4.0	4.0	4.0					9																	39086820		1728	3625	5353	39076820	SO:0001583	missense	79937			AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.3247G>C	9.37:g.39086820C>G	ENSP00000297668:p.Asp1083His	Somatic		Capture	Illumina GAIIx	4	39076820	B1AMA0|Q9C0E9	Missense_Mutation	SNP	HMMPfam_F5_F8_type_C;HMMPfam_EGF;superfamily_Galactose-binding domain-like;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_Fibrinogen C-terminal domain-like	p.D1083H	ENST00000297668.6	37	c.3247	CCDS6616.1	9	.	.	.	.	.	.	.	.	.	.	C	6.597	0.478434	0.12521	.	.	ENSG00000106714	ENST00000297668;ENST00000377656;ENST00000358144	T;T;T	0.79653	-1.29;-1.29;-1.29	2.73	1.82	0.25136	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.73164	0.3552	L	0.45581	1.43	0.80722	D	1	B;B;B	0.29988	0.264;0.192;0.089	B;B;B	0.32289	0.071;0.143;0.125	T	0.69457	-0.5140	9	0.66056	D	0.02	.	8.5714	0.33572	0.0:0.8769:0.0:0.1231	.	1083;1002;1083	Q9BZ76-2;A6NC89;Q9BZ76	.;.;CNTP3_HUMAN	H	1083;1002;995	ENSP00000297668:D1083H;ENSP00000366884:D1002H;ENSP00000350863:D995H	ENSP00000297668:D1083H	D	-	1	0	CNTNAP3	39076820	1.000000	0.71417	0.304000	0.25085	0.724000	0.41520	1.167000	0.31847	0.486000	0.27676	0.306000	0.20318	GAT	-	HMMPfam_Laminin_G_2		0.328	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3	protein_coding	OTTHUMT00000052511.1	C	NM_033655		39076820	-1	no_errors	NM_033655	genbank	human	reviewed	54_36p	missense	SNP	0.88	G
GDA	9615	genome.wustl.edu	37	9	74860096	74860096	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr9:74860096G>A	ENST00000358399.3	+	12	1261	c.1168G>A	c.(1168-1170)Gaa>Aaa	p.E390K	GDA_ENST00000238018.4_Missense_Mutation_p.E390K|GDA_ENST00000545168.1_Missense_Mutation_p.E316K|GDA_ENST00000376986.1_Missense_Mutation_p.E312K|GDA_ENST00000376989.3_Missense_Mutation_p.E329K	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	390					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)	p.E390K(1)		central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		TGGAAACTTTGAAGTGGGCAA	0.448																																																1	Substitution - Missense(1)	ovary(1)	9											208.0	203.0	205.0					9																	74860096		2203	4300	6503	74049916	SO:0001583	missense	9615			AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.1168G>A	9.37:g.74860096G>A	ENSP00000351170:p.Glu390Lys	Somatic		Capture	Illumina GAIIx	4	74049916	B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Missense_Mutation	SNP	HMMPfam_Amidohydro_1;superfamily_Composite domain of metallo-dependent hydrolases;superfamily_Metallo-dependent hydrolases	p.E390K	ENST00000358399.3	37	c.1168	CCDS6641.1	9	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041844	0.55003	.	.	ENSG00000119125	ENST00000545168;ENST00000238018;ENST00000376989;ENST00000376986;ENST00000358399;ENST00000436438	D;D;D;D;D;D	0.91894	-2.93;-2.93;-2.93;-2.93;-2.93;-2.93	5.3	5.3	0.74995	Amidohydrolase 1 (1);	0.046040	0.85682	D	0.000000	D	0.91858	0.7423	L	0.60455	1.87	0.80722	D	1	P;P;P	0.38250	0.616;0.571;0.624	B;B;B	0.44224	0.444;0.154;0.174	D	0.90314	0.4339	10	0.31617	T	0.26	-13.9582	16.2414	0.82409	0.0:0.0:1.0:0.0	.	312;390;390	Q5SZC6;Q9Y2T3-3;Q9Y2T3	.;.;GUAD_HUMAN	K	316;390;329;312;390;98	ENSP00000437972:E316K;ENSP00000238018:E390K;ENSP00000366188:E329K;ENSP00000366185:E312K;ENSP00000351170:E390K;ENSP00000400857:E98K	ENSP00000238018:E390K	E	+	1	0	GDA	74049916	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.831000	0.69330	2.633000	0.89246	0.650000	0.86243	GAA	-	HMMPfam_Amidohydro_1		0.448	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDA	protein_coding	OTTHUMT00000052633.1	G			74049916	1	no_errors	NM_004293	genbank	human	validated	54_36p	missense	SNP	1	A
SETX	23064	genome.wustl.edu	37	9	135202589	135202589	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chr9:135202589C>A	ENST00000224140.5	-	10	4578	c.4396G>T	c.(4396-4398)Ggt>Tgt	p.G1466C	SETX_ENST00000393220.1_Missense_Mutation_p.G1466C|SETX_ENST00000372169.2_Missense_Mutation_p.G1466C	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1466					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.G1466C(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TCACCTCCACCCAGAGGGTCT	0.433																																																1	Substitution - Missense(1)	ovary(1)	9											150.0	141.0	144.0					9																	135202589		2203	4300	6503	134192410	SO:0001583	missense	23064			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.4396G>T	9.37:g.135202589C>A	ENSP00000224140:p.Gly1466Cys	Somatic		Capture	Illumina GAIIx	4	134192410	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases	p.G1466C	ENST00000224140.5	37	c.4396	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	C	9.888	1.203379	0.22121	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.87412	-2.16;-2.25;-1.86	5.31	3.47	0.39725	.	0.968070	0.08482	N	0.939300	D	0.90442	0.7007	L	0.56769	1.78	0.09310	N	1	D;D;D	0.65815	0.995;0.983;0.995	P;P;P	0.58873	0.789;0.62;0.847	T	0.79070	-0.1954	10	0.59425	D	0.04	.	10.3324	0.43831	0.0:0.8427:0.0:0.1573	.	1466;1466;1466	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	C	1466	ENSP00000224140:G1466C;ENSP00000361242:G1466C;ENSP00000376913:G1466C	ENSP00000224140:G1466C	G	-	1	0	SETX	134192410	0.000000	0.05858	0.009000	0.14445	0.005000	0.04900	0.697000	0.25556	1.250000	0.43966	-0.136000	0.14681	GGT	-	NULL		0.433	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	protein_coding	OTTHUMT00000054774.3	C	NM_015046		134192410	-1	no_errors	NM_015046	genbank	human	reviewed	54_36p	missense	SNP		A
PTCHD1	139411	genome.wustl.edu	37	X	23411676	23411676	+	Missense_Mutation	SNP	G	G	A	rs150912089		TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chrX:23411676G>A	ENST00000379361.4	+	3	2901	c.2041G>A	c.(2041-2043)Gtc>Atc	p.V681I		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	681					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)	p.V576I(1)		NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						GAAGTTCATCGTCTTCAATCC	0.483																																																1	Substitution - Missense(1)	ovary(1)	X						G	ILE/VAL	0,3835		0,0,1632,571	91.0	82.0	85.0		2041	5.3	1.0	X	dbSNP_134	85	1,6727		0,1,2427,1872	no	missense	PTCHD1	NM_173495.2	29	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	benign	681/889	23411676	1,10562	2203	4300	6503	23321597	SO:0001583	missense	139411			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.2041G>A	X.37:g.23411676G>A	ENSP00000368666:p.Val681Ile	Somatic		Capture	Illumina GAIIx	4	23321597	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	-	p.V681I	ENST00000379361.4	37	c.2041	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	G	11.70	1.718231	0.30503	0.0	1.49E-4	ENSG00000165186	ENST00000379361	D	0.87029	-2.2	5.34	5.34	0.76211	.	0.059808	0.64402	D	0.000002	T	0.78629	0.4313	N	0.13003	0.285	0.36781	D	0.884332	B	0.24258	0.1	B	0.24394	0.053	T	0.76329	-0.2999	10	0.22706	T	0.39	.	18.121	0.89571	0.0:0.0:1.0:0.0	.	681	Q96NR3	PTHD1_HUMAN	I	681	ENSP00000368666:V681I	ENSP00000368666:V681I	V	+	1	0	PTCHD1	23321597	1.000000	0.71417	0.970000	0.41538	0.997000	0.91878	6.939000	0.75911	2.216000	0.71823	0.529000	0.55759	GTC	-	NULL		0.483	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	protein_coding	OTTHUMT00000056047.2	G	NM_173495		23321597	1	no_errors	NM_173495	genbank	human	validated	54_36p	missense	SNP	1	A
ARHGEF9	23229	genome.wustl.edu	37	X	62917093	62917093	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1418-01A-01W-0549-09	TCGA-24-1418-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	6093bcb5-4889-4cb9-9b01-e4e4278e72aa	99170dcd-ecd1-4735-8bea-5ef023669cf2	g.chrX:62917093A>T	ENST00000253401.6	-	4	1273	c.473T>A	c.(472-474)tTt>tAt	p.F158Y	ARHGEF9_ENST00000374870.4_Missense_Mutation_p.F56Y|ARHGEF9_ENST00000374872.1_Missense_Mutation_p.F137Y|ARHGEF9_ENST00000495564.1_5'UTR|ARHGEF9_ENST00000437457.2_Missense_Mutation_p.F105Y|ARHGEF9_ENST00000374878.1_Missense_Mutation_p.F156Y	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	158	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.F156Y(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						GCCCATCTGAAATCTGTAGAT	0.463																																																1	Substitution - Missense(1)	ovary(1)	X											121.0	93.0	103.0					X																	62917093		2203	4300	6503	62833818	SO:0001583	missense	23229			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.473T>A	X.37:g.62917093A>T	ENSP00000253401:p.Phe158Tyr	Somatic		Capture	Illumina GAIIx	4	62833818	A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Missense_Mutation	SNP	HMMPfam_RhoGEF;HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_PH;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like	p.F158Y	ENST00000253401.6	37	c.473	CCDS35315.1	X	.	.	.	.	.	.	.	.	.	.	A	27.2	4.812673	0.90707	.	.	ENSG00000131089	ENST00000253401;ENST00000374878;ENST00000437457;ENST00000374870;ENST00000374872	T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16	5.59	5.59	0.84812	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.81079	0.4748	M	0.86651	2.83	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.995;0.987;0.995;0.987	D	0.84442	0.0583	10	0.72032	D	0.01	.	13.4906	0.61393	1.0:0.0:0.0:0.0	.	105;156;158;158	B4DHC7;B1AMR4;O43307;A8K1S8	.;.;ARHG9_HUMAN;.	Y	158;156;105;56;137	ENSP00000253401:F158Y;ENSP00000364012:F156Y;ENSP00000399994:F105Y;ENSP00000364004:F56Y;ENSP00000364006:F137Y	ENSP00000253401:F158Y	F	-	2	0	ARHGEF9	62833818	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.806000	0.75195	1.865000	0.54081	0.417000	0.27973	TTT	-	HMMPfam_RhoGEF		0.463	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF9	protein_coding	OTTHUMT00000056937.1	A			62833818	-1	no_errors	NM_015185	genbank	human	validated	54_36p	missense	SNP	1	T
