#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
STRIP1	85369	genome.wustl.edu	37	1	110587643	110587643	+	Silent	SNP	G	G	A	rs143183603	byFrequency	TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr1:110587643G>A	ENST00000369795.3	+	12	1381	c.1359G>A	c.(1357-1359)acG>acA	p.T453T	STRIP1_ENST00000369796.1_Silent_p.T358T	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1	453					cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.T453T(1)									CCAGTGACACGAACACAGTGG	0.512													G|||	4	0.000798722	0.003	0.0	5008	,	,		15888	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1						G		8,4398	14.3+/-33.2	0,8,2195	114.0	113.0	113.0		1359	-10.2	0.4	1	dbSNP_134	113	0,8600		0,0,4300	no	coding-synonymous	FAM40A	NM_033088.2		0,8,6495	AA,AG,GG		0.0,0.1816,0.0615		453/838	110587643	8,12998	2203	4300	6503	110389166	SO:0001819	synonymous_variant	85369			AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.1359G>A	1.37:g.110587643G>A		Somatic		Capture	Illumina GAIIx	4	110389166	Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	Silent	SNP	-	p.T453	ENST00000369795.3	37	c.1359	CCDS30798.1	1																																																																																			-	NULL		0.512	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM40A	protein_coding	OTTHUMT00000032213.1	G	NM_033088		110389166	1	no_errors	NM_033088	genbank	human	validated	54_36p	silent	SNP	0.79	A
NUP210L	91181	genome.wustl.edu	37	1	154018594	154018594	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr1:154018594C>A	ENST00000368559.3	-	27	3718	c.3647G>T	c.(3646-3648)tGg>tTg	p.W1216L	NUP210L_ENST00000271854.3_Missense_Mutation_p.W1216L|NUP210L_ENST00000368553.1_Missense_Mutation_p.W149L	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1216					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.W1216L(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GCTCATAGACCAGTGGAATGT	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											100.0	90.0	93.0					1																	154018594		1879	4119	5998	152285218	SO:0001583	missense	91181			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.3647G>T	1.37:g.154018594C>A	ENSP00000357547:p.Trp1216Leu	Somatic		Capture	Illumina GAIIx	4	152285218	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	-	p.W1216L	ENST00000368559.3	37	c.3647	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825076	0.90955	.	.	ENSG00000143552	ENST00000368559;ENST00000368553;ENST00000271854	T;D;T	0.86432	-0.58;-2.12;-0.55	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000010	D	0.92011	0.7469	M	0.72353	2.195	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	D	0.92674	0.6152	10	0.87932	D	0	-27.7325	17.1477	0.86770	0.0:1.0:0.0:0.0	.	1216;1216	E7EP56;Q5VU65	.;P210L_HUMAN	L	1216;149;1216	ENSP00000357547:W1216L;ENSP00000357541:W149L;ENSP00000271854:W1216L	ENSP00000271854:W1216L	W	-	2	0	NUP210L	152285218	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.538000	0.73852	2.582000	0.87167	0.650000	0.86243	TGG	-	NULL		0.418	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	protein_coding	OTTHUMT00000087270.3	C	NM_207308		152285218	-1	no_errors	NM_207308	genbank	human	validated	54_36p	missense	SNP	1	A
UAP1	6675	genome.wustl.edu	37	1	162569083	162569083	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr1:162569083A>G	ENST00000367925.1	+	10	1531	c.1499A>G	c.(1498-1500)gAt>gGt	p.D500G	UAP1_ENST00000271469.3_Missense_Mutation_p.D500G|UAP1_ENST00000367924.1_Missense_Mutation_p.D499G|UAP1_ENST00000367926.4_Missense_Mutation_p.D483G			Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1	500					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|UDP-N-acetylglucosamine diphosphorylase activity (GO:0003977)	p.D483G(1)		breast(2)|cervix(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)|skin(2)|stomach(1)	22	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TATGTGGCAGATAAAGAATTC	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											99.0	93.0	95.0					1																	162569083		2203	4300	6503	160835707	SO:0001583	missense	6675			AB011004	CCDS1240.1	1q23.2	2014-07-31	2014-07-31		ENSG00000117143	ENSG00000117143	2.7.7.23		12457	protein-coding gene	gene with protein product		602862		SPAG2		9603950, 8025165	Standard	NM_003115		Approved	AGX1, AgX	uc001gce.4	Q16222	OTTHUMG00000034419	ENST00000367925.1:c.1499A>G	1.37:g.162569083A>G	ENSP00000356902:p.Asp500Gly	Somatic		Capture	Illumina GAIIx	4	160835707	B2R6R8|Q5VTA9|Q5VTB0|Q5VTB1|Q96GM2	Missense_Mutation	SNP	HMMPfam_UDPGP;superfamily_Nucleotide-diphospho-sugar transferases	p.D483G	ENST00000367925.1	37	c.1448		1	.	.	.	.	.	.	.	.	.	.	A	2.904	-0.226904	0.06022	.	.	ENSG00000117143	ENST00000367926;ENST00000271469;ENST00000367925;ENST00000367924	T;T;T;T	0.15372	2.43;2.43;2.43;2.43	5.55	2.06	0.26882	.	0.206543	0.51477	D	0.000092	T	0.00906	0.0030	N	0.00408	-1.53	0.31486	N	0.666553	B	0.02656	0.0	B	0.04013	0.001	T	0.49331	-0.8951	9	0.02654	T	1	-15.8219	8.9991	0.36069	0.7879:0.0:0.2121:0.0	.	483	Q16222-2	.	G	483;500;500;499	ENSP00000356903:D483G;ENSP00000271469:D500G;ENSP00000356902:D500G;ENSP00000356901:D499G	ENSP00000271469:D500G	D	+	2	0	UAP1	160835707	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.953000	0.49105	0.934000	0.37316	0.533000	0.62120	GAT	-	NULL		0.363	UAP1-002	KNOWN	basic	protein_coding	UAP1	protein_coding	OTTHUMT00000083203.1	A	NM_003115		160835707	1	no_errors	NM_003115	genbank	human	validated	54_36p	missense	SNP	1	G
SERPINC1	462	genome.wustl.edu	37	1	173873145	173873145	+	Missense_Mutation	SNP	G	G	A	rs121909550		TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr1:173873145G>A	ENST00000367698.3	-	7	1395	c.1277C>T	c.(1276-1278)tCg>tTg	p.S426L		NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1	426		Reactive bond.	S -> L (in AT3D; type-II; Denver/Milano- 2; deprived of inhibitory activity). {ECO:0000269|PubMed:15164384, ECO:0000269|PubMed:3805013, ECO:0000269|PubMed:9031473}.		blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S426L(1)		NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	GGGGTTTAGCGAACGGCCAGC	0.468																																																1	Substitution - Missense(1)	ovary(1)	1	GRCh37	CM890019	SERPINC1	M	rs121909550						80.0	77.0	78.0					1																	173873145		2203	4300	6503	172139768	SO:0001583	missense	462			X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.1277C>T	1.37:g.173873145G>A	ENSP00000356671:p.Ser426Leu	Somatic		Capture	Illumina GAIIx	4	172139768	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Missense_Mutation	SNP	-	p.S426L	ENST00000367698.3	37	c.1277	CCDS1313.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.130691	0.94473	.	.	ENSG00000117601	ENST00000367698;ENST00000351522	D	0.84223	-1.82	5.74	5.74	0.90152	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.92044	0.7479	M	0.85777	2.775	0.80722	A	1	D	0.89917	1.0	D	0.79784	0.993	D	0.89643	0.3864	9	0.30854	T	0.27	.	19.5507	0.95319	0.0:0.0:1.0:0.0	.	426	P01008	ANT3_HUMAN	L	426;221	ENSP00000356671:S426L	ENSP00000307953:S221L	S	-	2	0	SERPINC1	172139768	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	9.021000	0.93673	2.712000	0.92718	0.650000	0.86243	TCG	-	NULL		0.468	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINC1	protein_coding	OTTHUMT00000090734.1	G	NM_000488		172139768	-1	no_errors	NM_000488	genbank	human	validated	54_36p	missense	SNP	1	A
PAPPA2	60676	genome.wustl.edu	37	1	176668566	176668566	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr1:176668566A>G	ENST00000367662.3	+	8	4241	c.3077A>G	c.(3076-3078)gAt>gGt	p.D1026G		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1026					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D1026G(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TACACCTTTGATGAGAGGATA	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											129.0	135.0	133.0					1																	176668566		2093	4228	6321	174935189	SO:0001583	missense	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3077A>G	1.37:g.176668566A>G	ENSP00000356634:p.Asp1026Gly	Somatic		Capture	Illumina GAIIx	4	174935189	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	-	p.D1026G	ENST00000367662.3	37	c.3077	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	A	18.82	3.705356	0.68615	.	.	ENSG00000116183	ENST00000367662	T	0.40756	1.02	5.38	5.38	0.77491	Fibronectin, type III (2);	0.000000	0.85682	D	0.000000	T	0.47303	0.1438	M	0.76002	2.32	0.80722	D	1	B	0.28419	0.211	B	0.29267	0.1	T	0.51880	-0.8649	10	0.87932	D	0	-20.553	15.2247	0.73342	1.0:0.0:0.0:0.0	.	1026	Q9BXP8	PAPP2_HUMAN	G	1026	ENSP00000356634:D1026G	ENSP00000356634:D1026G	D	+	2	0	PAPPA2	174935189	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.413000	0.90235	2.254000	0.74563	0.533000	0.62120	GAT	-	NULL		0.557	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	protein_coding	OTTHUMT00000084763.1	A			174935189	1	no_errors	NM_020318	genbank	human	validated	54_36p	missense	SNP	1	G
MIER1	57708	genome.wustl.edu	37	1	67411870	67411870	+	Silent	SNP	A	A	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr1:67411870A>G	ENST00000355356.3	+	3	221	c.72A>G	c.(70-72)ccA>ccG	p.P24P	MIER1_ENST00000355977.6_Intron|MIER1_ENST00000371012.2_Silent_p.P41P|MIER1_ENST00000357692.2_Silent_p.P41P|MIER1_ENST00000401042.3_Silent_p.P24P|MIER1_ENST00000371016.1_Silent_p.P41P|MIER1_ENST00000479067.1_3'UTR|MIER1_ENST00000371018.3_Silent_p.P41P|MIER1_ENST00000401041.1_Silent_p.P77P|MIER1_ENST00000371014.1_Silent_p.P77P	NM_001077701.2|NM_001077704.2	NP_001071169.1|NP_001071172.1	Q8N108	MIER1_HUMAN	mesoderm induction early response 1, transcriptional regulator	24					positive regulation of chromatin silencing (GO:0031937)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.P24P(2)|p.P77P(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(3)	15						AATTTGATCCATCAGCTGACA	0.348																																																3	Substitution - coding silent(3)	lung(2)|ovary(1)	1											119.0	108.0	111.0					1																	67411870		1854	4092	5946	67184458	SO:0001819	synonymous_variant	57708				CCDS41347.1, CCDS41348.1, CCDS53325.1, CCDS53326.1, CCDS53327.1, CCDS53328.1, CCDS53329.1, CCDS53330.1, CCDS60163.1	1p31.2	2013-07-23	2013-07-23		ENSG00000198160	ENSG00000198160			29657	protein-coding gene	gene with protein product			"""mesoderm induction early response 1 homolog (Xenopus laevis)"""			12242014, 12482978	Standard	NM_020948		Approved	hMI-ER1, MI-ER1, KIAA1610	uc001dde.2	Q8N108	OTTHUMG00000009194	ENST00000355356.3:c.72A>G	1.37:g.67411870A>G		Somatic		Capture	Illumina GAIIx	4	67184458	C9JFD4|Q08AE0|Q32NC4|Q5T104|Q5TAD1|Q5TAD2|Q5TAD4|Q5TAD5|Q6AHY8|Q86TB4|Q8N156|Q8N161|Q8NC37|Q8NES4|Q8NES5|Q8NES6|Q8WWG2|Q9HCG2	Missense_Mutation	SNP	-	p.H48R	ENST00000355356.3	37	c.143	CCDS41348.1	1																																																																																			-	NULL		0.348	MIER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MIER1	protein_coding	OTTHUMT00000025491.2	A	NM_020948		67184458	1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_020948	genbank	human	validated	54_36p	missense	SNP	1	G
NLRP3	114548	genome.wustl.edu	37	1	247607359	247607359	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr1:247607359C>G	ENST00000336119.3	+	7	3501	c.2755C>G	c.(2755-2757)Ctg>Gtg	p.L919V	NLRP3_ENST00000366497.2_Missense_Mutation_p.L862V|NLRP3_ENST00000391828.3_Missense_Mutation_p.L919V|NLRP3_ENST00000348069.2_Missense_Mutation_p.L805V|NLRP3_ENST00000366496.2_Missense_Mutation_p.L862V|NLRP3_ENST00000391827.2_Missense_Mutation_p.L862V	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	919					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.L919V(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GCACCTTTACCTGCGAGGCAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											187.0	152.0	164.0					1																	247607359		2203	4300	6503	245673982	SO:0001583	missense	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2755C>G	1.37:g.247607359C>G	ENSP00000337383:p.Leu919Val	Somatic		Capture	Illumina GAIIx	4	245673982	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	-	p.L919V	ENST00000336119.3	37	c.2755	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.139016	0.56936	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81;-0.81;-0.81	4.06	3.15	0.36227	.	0.000000	0.37136	N	0.002230	D	0.83977	0.5371	M	0.83118	2.625	0.30016	N	0.814763	D;P;D;D;P	0.89917	0.999;0.929;1.0;0.968;0.939	D;P;D;P;P	0.83275	0.989;0.554;0.996;0.873;0.633	T	0.79130	-0.1930	10	0.51188	T	0.08	.	7.7001	0.28617	0.0:0.8873:0.0:0.1127	.	899;862;805;862;919	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	V	919;862;919;805;862;862	ENSP00000375704:L919V;ENSP00000355453:L862V;ENSP00000337383:L919V;ENSP00000294752:L805V;ENSP00000355452:L862V;ENSP00000375703:L862V	ENSP00000337383:L919V	L	+	1	2	NLRP3	245673982	0.959000	0.32827	0.980000	0.43619	0.857000	0.48899	0.770000	0.26618	1.298000	0.44778	0.549000	0.68633	CTG	-	NULL		0.507	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	protein_coding	OTTHUMT00000097740.1	C	NM_004895		245673982	1	no_errors	NM_001079821	genbank	human	reviewed	54_36p	missense	SNP	0.33	G
SVIL	6840	genome.wustl.edu	37	10	29773706	29773706	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr10:29773706T>A	ENST00000355867.4	-	27	5586	c.4834A>T	c.(4834-4836)Aca>Tca	p.T1612S	SVIL_ENST00000375400.3_Missense_Mutation_p.T1186S|SVIL_ENST00000375398.2_Missense_Mutation_p.T1612S|PTCHD3P1_ENST00000413405.1_RNA|PTCHD3P1_ENST00000414457.1_RNA|PTCHD3P1_ENST00000423223.1_RNA|SVIL_ENST00000535393.1_Missense_Mutation_p.T526S|SVIL_ENST00000538146.1_Missense_Mutation_p.T404S|PTCHD3P1_ENST00000446807.1_RNA	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1612	Interaction with NEB.				cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.T1612S(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TGTGCTAATGTGACTTCTTTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	10											150.0	132.0	138.0					10																	29773706		2203	4300	6503	29813712	SO:0001583	missense	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.4834A>T	10.37:g.29773706T>A	ENSP00000348128:p.Thr1612Ser	Somatic		Capture	Illumina GAIIx	4	29813712	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	HMMPfam_VHP;superfamily_VHP Villin headpiece domain;HMMPfam_Gelsolin;superfamily_Actin depolymerizing proteins	p.T1612S	ENST00000355867.4	37	c.4834	CCDS7164.1	10	.	.	.	.	.	.	.	.	.	.	T	19.69	3.873994	0.72180	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393;ENST00000535994;ENST00000538146	T;T;T;T;T	0.13657	2.57;2.57;2.57;2.57;2.57	4.02	4.02	0.46733	.	0.000000	0.85682	D	0.000000	T	0.11879	0.0289	L	0.33245	0.995	0.58432	D	0.999993	B;B;B;B	0.31548	0.328;0.067;0.033;0.04	B;B;B;B	0.32928	0.155;0.084;0.078;0.035	T	0.13388	-1.0511	10	0.33940	T	0.23	-16.2657	13.4302	0.61051	0.0:0.0:0.0:1.0	.	526;404;1186;1612	F5H2Q5;F5GXV0;O95425-2;O95425	.;.;.;SVIL_HUMAN	S	1186;1612;1612;526;566;404	ENSP00000364549:T1186S;ENSP00000364547:T1612S;ENSP00000348128:T1612S;ENSP00000445472:T526S;ENSP00000440343:T404S	ENSP00000348128:T1612S	T	-	1	0	SVIL	29813712	1.000000	0.71417	0.989000	0.46669	0.969000	0.65631	7.774000	0.85478	1.817000	0.53016	0.459000	0.35465	ACA	-	NULL		0.408	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	protein_coding	OTTHUMT00000047395.1	T			29813712	-1	no_errors	NM_021738	genbank	human	reviewed	54_36p	missense	SNP	1	A
DUPD1	338599	genome.wustl.edu	37	10	76818085	76818085	+	Missense_Mutation	SNP	T	T	C	rs146031273	byFrequency	TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr10:76818085T>C	ENST00000338487.5	-	1	187	c.188A>G	c.(187-189)tAc>tGc	p.Y63C		NM_001003892.1	NP_001003892.1	Q68J44	DUPD1_HUMAN	dual specificity phosphatase and pro isomerase domain containing 1	63	Tyrosine-protein phosphatase.				protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.Y63C(1)		breast(1)|endometrium(2)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					ATCGCCAATGTAGAGCTTGGG	0.647													T|||	2	0.000399361	0.0015	0.0	5008	,	,		17288	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	10						T	CYS/TYR	7,4399	12.9+/-30.5	0,7,2196	103.0	85.0	91.0		188	5.4	1.0	10	dbSNP_134	91	0,8600		0,0,4300	yes	missense	DUPD1	NM_001003892.1	194	0,7,6496	CC,CT,TT		0.0,0.1589,0.0538	probably-damaging	63/221	76818085	7,12999	2203	4300	6503	76488091	SO:0001583	missense	338599				CCDS31223.1	10q22.3	2011-06-09			ENSG00000188716	ENSG00000188716		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	23481	protein-coding gene	gene with protein product							Standard	NM_001003892		Approved	DUSP27	uc001jwq.1	Q68J44	OTTHUMG00000018512	ENST00000338487.5:c.188A>G	10.37:g.76818085T>C	ENSP00000340609:p.Tyr63Cys	Somatic		Capture	Illumina GAIIx	4	76488091	B2RP93	Missense_Mutation	SNP	HMMPfam_DSPc;superfamily_(Phosphotyrosine protein) phosphatases II	p.Y63C	ENST00000338487.5	37	c.188	CCDS31223.1	10	.	.	.	.	.	.	.	.	.	.	T	16.61	3.170184	0.57584	0.001589	0.0	ENSG00000188716	ENST00000338487	D	0.91068	-2.78	5.37	5.37	0.77165	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.062767	0.64402	D	0.000003	D	0.96476	0.8850	H	0.95260	3.645	0.53688	D	0.999976	D	0.89917	1.0	D	0.75020	0.985	D	0.97376	0.9979	10	0.87932	D	0	-23.0761	12.8964	0.58101	0.0:0.0:0.0:1.0	.	63	Q68J44	DUPD1_HUMAN	C	63	ENSP00000340609:Y63C	ENSP00000340609:Y63C	Y	-	2	0	DUPD1	76488091	1.000000	0.71417	0.992000	0.48379	0.437000	0.31866	5.212000	0.65225	2.037000	0.60232	0.460000	0.39030	TAC	-	HMMPfam_DSPc		0.647	DUPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUPD1	protein_coding	OTTHUMT00000048777.2	T	XM_291741		76488091	-1	no_errors	NM_001003892	genbank	human	provisional	54_36p	missense	SNP	1	C
KRTAP5-3	387266	genome.wustl.edu	37	11	1629081	1629081	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr11:1629081C>A	ENST00000399685.1	-	1	612	c.535G>T	c.(535-537)Ggc>Tgc	p.G179C		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	179	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G179C(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		gacccacagcctgaggagcag	0.627																																																1	Substitution - Missense(1)	ovary(1)	11											117.0	126.0	123.0					11																	1629081		2193	4284	6477	1585657	SO:0001583	missense	387266			AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.535G>T	11.37:g.1629081C>A	ENSP00000382592:p.Gly179Cys	Somatic		Capture	Illumina GAIIx	4	1585657	Q6PL44|Q701N3	Missense_Mutation	SNP	HMMPfam_Keratin_B2	p.G179C	ENST00000399685.1	37	c.535	CCDS41591.1	11	.	.	.	.	.	.	.	.	.	.	T	2.856	-0.237294	0.05944	.	.	ENSG00000196224	ENST00000399685	T	0.00892	5.57	2.0	-4.0	0.04057	.	.	.	.	.	T	0.00815	0.0027	L	0.38838	1.175	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.45454	-0.9260	9	0.45353	T	0.12	.	3.7154	0.08435	0.4047:0.4303:0.0:0.165	.	179	Q6L8H2	KRA53_HUMAN	C	179	ENSP00000382592:G179C	ENSP00000382592:G179C	G	-	1	0	KRTAP5-3	1585657	0.000000	0.05858	0.003000	0.11579	0.441000	0.31987	-0.018000	0.12568	-0.152000	0.11156	0.280000	0.19369	GGC	-	HMMPfam_Keratin_B2		0.627	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-3	protein_coding	OTTHUMT00000127924.1	C			1585657	-1	no_errors	NM_001012708	genbank	human	validated	54_36p	missense	SNP	0.18	A
TRIM51	84767	genome.wustl.edu	37	11	55653305	55653305	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr11:55653305A>T	ENST00000449290.2	+	2	493	c.401A>T	c.(400-402)gAg>gTg	p.E134V	TRIM51_ENST00000244891.3_5'Flank	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	134						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.E134V(1)									TGGGCTGCTGAGGAACGCCGG	0.473																																																1	Substitution - Missense(1)	ovary(1)	11											11.0	11.0	11.0					11																	55653305		692	1590	2282	55409881	SO:0001583	missense	84767			BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.401A>T	11.37:g.55653305A>T	ENSP00000395086:p.Glu134Val	Somatic		Capture	Illumina GAIIx	4	55409881	A6NMG2	Missense_Mutation	SNP	HMMPfam_zf-B_box,HMMPfam_zf-C3HC4,HMMPfam_SPRY,superfamily_SSF57850	p.E141V	ENST00000449290.2	37	c.422		11	.	.	.	.	.	.	.	.	.	.	.	12.54	1.969783	0.34754	.	.	ENSG00000124900	ENST00000449290	T	0.59083	0.29	0.803	0.803	0.18691	.	.	.	.	.	T	0.73513	0.3596	M	0.91818	3.245	0.53688	D	0.999974	D	0.76494	0.999	D	0.71184	0.972	T	0.71144	-0.4678	9	0.72032	D	0.01	.	2.8746	0.05627	0.6803:0.0:0.3197:0.0	.	134	Q9BSJ1	SPRY5_HUMAN	V	134	ENSP00000395086:E134V	ENSP00000395086:E134V	E	+	2	0	SPRYD5	55409881	0.078000	0.21339	0.066000	0.19879	0.183000	0.23260	2.277000	0.43417	0.624000	0.30286	0.128000	0.15822	GAG	-	NULL		0.473	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	SPRYD5	protein_coding	OTTHUMT00000391522.1	A	NM_032681		55409881	1	no_start_codon	ENST00000327733	ensembl	human	known	54_36p	missense	SNP	0.947	T
CLMP	79827	genome.wustl.edu	37	11	122953914	122953914	+	Splice_Site	SNP	G	G	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr11:122953914G>A	ENST00000448775.2	-	5	898	c.558C>T	c.(556-558)gaC>gaT	p.D186D	CLMP_ENST00000530371.1_5'UTR	NM_024769.2	NP_079045.1	Q9H6B4	CLMP_HUMAN	CXADR-like membrane protein	186	Ig-like C2-type 2.				digestive tract development (GO:0048565)	cell surface (GO:0009986)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.D186D(1)		endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	14						GGTGGTTGTAGTCTGCACAAG	0.438																																																1	Substitution - coding silent(1)	ovary(1)	11											130.0	119.0	123.0					11																	122953914		2202	4299	6501	122459124	SO:0001630	splice_region_variant	79827			BC009371	CCDS8441.1	11q24	2013-01-29			ENSG00000166250	ENSG00000166250		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24039	protein-coding gene	gene with protein product	"""adipocyte-specific adhesion molecule"", ""coxsackie- and adenovirus receptor-like membrane protein"", ""adipocyte adhesion molecule"""	611693				12851705, 14573622	Standard	NM_024769		Approved	ASAM, FLJ22415, ACAM	uc001pyt.3	Q9H6B4		ENST00000448775.2:c.557-1C>T	11.37:g.122953914G>A		Somatic		Capture	Illumina GAIIx	4	122459124		Silent	SNP	-	p.D186	ENST00000448775.2	37	c.558	CCDS8441.1	11																																																																																			-	NULL		0.438	CLMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAM	protein_coding	OTTHUMT00000387542.1	G	NM_024769	Silent	122459124	-1	no_errors	NM_024769	genbank	human	validated	54_36p	silent	SNP	1	A
TAS2R50	259296	genome.wustl.edu	37	12	11139452	11139452	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr12:11139452G>C	ENST00000506868.1	-	1	59	c.8C>G	c.(7-9)aCt>aGt	p.T3S	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176890.2	NP_795371.2	P59544	T2R50_HUMAN	taste receptor, type 2, member 50	3					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.T3S(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)	17						GTATAGAAAAGTTATCATATC	0.308																																																1	Substitution - Missense(1)	ovary(1)	12											23.0	28.0	26.0					12																	11139452		2147	4249	6396	11030719	SO:0001583	missense	259296			AF494235	CCDS8638.1	12p13.2	2012-08-22			ENSG00000212126	ENSG00000212126		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18882	protein-coding gene	gene with protein product		609627				12379855, 12584440, 16175505	Standard	NM_176890		Approved	T2R51	uc001qzl.2	P59544	OTTHUMG00000162719	ENST00000506868.1:c.8C>G	12.37:g.11139452G>C	ENSP00000424040:p.Thr3Ser	Somatic		Capture	Illumina GAIIx	4	11030719	P59545|Q2M255|Q645Y0	Missense_Mutation	SNP	HMMPfam_TAS2R;superfamily_Family A G protein-coupled receptor-like	p.T3S	ENST00000506868.1	37	c.8	CCDS8638.1	12	.	.	.	.	.	.	.	.	.	.	G	0	-2.708338	0.00096	.	.	ENSG00000212126	ENST00000506868	T	0.00655	5.95	2.19	-4.39	0.03611	.	2.100360	0.03225	N	0.178163	T	0.00524	0.0017	N	0.11313	0.125	0.09310	N	1	B	0.02656	0.0	B	0.17098	0.017	T	0.46871	-0.9160	10	0.05959	T	0.93	.	6.5454	0.22402	0.0:0.1735:0.4826:0.344	.	3	P59544	T2R50_HUMAN	S	3	ENSP00000424040:T3S	ENSP00000424040:T3S	T	-	2	0	TAS2R50	11030719	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-2.690000	0.00831	-2.020000	0.00940	0.313000	0.20887	ACT	-	HMMPfam_TAS2R		0.308	TAS2R50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R50	protein_coding	OTTHUMT00000370192.2	G	NM_176890		11030719	-1	no_errors	NM_176890	genbank	human	validated	54_36p	missense	SNP		C
SLCO1A2	6579	genome.wustl.edu	37	12	21472312	21472312	+	Intron	SNP	C	C	T			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr12:21472312C>T	ENST00000307378.6	-	4	781				SLCO1A2_ENST00000473830.1_Intron|SLCO1A2_ENST00000390670.3_Silent_p.S16S|SLCO1A2_ENST00000458504.1_Intron|SLCO1A2_ENST00000537524.1_Intron|SLCO1A2_ENST00000452078.1_Intron	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2						bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	ttaccttggccgactccactc	0.393																																																0			12											143.0	140.0	141.0					12																	21472312		1872	4101	5973	21363579	SO:0001627	intron_variant	6579				CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.61-455G>A	12.37:g.21472312C>T		Somatic		Capture	Illumina GAIIx	4	21363579	Q9UGP7|Q9UL38	Silent	SNP	-	p.S16	ENST00000307378.6	37	c.48	CCDS8686.1	12																																																																																			-	NULL		0.393	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1A2	protein_coding	OTTHUMT00000343648.3	C	NM_021094		21363579	-1	no_errors	ENST00000390670	ensembl	human	known	54_36p	silent	SNP		T
Unknown	0	genome.wustl.edu	37	12	53125256	53125256	+	IGR	SNP	G	G	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr12:53125256G>A								KRT77 (28009 upstream) : KRT76 (36682 downstream)																							TGGGATGATCGTCATTGGTCT	0.502																																																0			12																																								51411523	SO:0001628	intergenic_variant	400036																															12.37:g.53125256G>A		Somatic		Capture	Illumina GAIIx	4	51411523		RNA	SNP	-	NULL		37	NULL		12																																																																																			-	-	0	0.502					LOC400036			G			51411523	1	pseudogene	XR_042304	genbank	human	model	54_36p	rna	SNP	1	A
OS9	10956	genome.wustl.edu	37	12	58113916	58113916	+	Silent	SNP	C	C	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr12:58113916C>A	ENST00000315970.7	+	13	1676	c.1635C>A	c.(1633-1635)gtC>gtA	p.V545V	RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000551035.1_Intron|OS9_ENST00000257966.8_Intron|OS9_ENST00000413095.2_Intron|OS9_ENST00000552285.1_Intron|OS9_ENST00000439210.2_Intron|OS9_ENST00000389146.6_Silent_p.V530V|OS9_ENST00000435406.2_Intron|OS9_ENST00000389142.5_Intron	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	545					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)	p.V545V(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GGGTCCGGGTCACCAAGCTCC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	12											85.0	85.0	85.0					12																	58113916		2203	4300	6503	56400183	SO:0001819	synonymous_variant	10956			AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.1635C>A	12.37:g.58113916C>A		Somatic		Capture	Illumina GAIIx	4	56400183	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Silent	SNP	superfamily_Mannose 6-phosphate receptor domain;HMMPfam_PRKCSH	p.V545	ENST00000315970.7	37	c.1635	CCDS31843.1	12																																																																																			-	NULL		0.582	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OS9	protein_coding	OTTHUMT00000408344.1	C	NM_006812		56400183	1	no_errors	NM_006812	genbank	human	reviewed	54_36p	silent	SNP	1	A
MLXIP	22877	genome.wustl.edu	37	12	122614147	122614147	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr12:122614147A>G	ENST00000319080.7	+	5	841	c.709A>G	c.(709-711)Aag>Gag	p.K237E	MLXIP_ENST00000538698.1_5'Flank					MLX interacting protein									p.K237E(1)		NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		ACAGCAGCACAAGGATGAGGA	0.607																																					Esophageal Squamous(105;787 1493 16200 18566 52466)											1	Substitution - Missense(1)	ovary(1)	12											42.0	45.0	44.0					12																	122614147		2014	4162	6176	121180101	SO:0001583	missense	22877			AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.709A>G	12.37:g.122614147A>G	ENSP00000312834:p.Lys237Glu	Somatic		Capture	Illumina GAIIx	4	121180101		Missense_Mutation	SNP	HMMPfam_HLH;superfamily_HLH helix-loop-helix DNA-binding domain	p.K237E	ENST00000319080.7	37	c.709		12	.	.	.	.	.	.	.	.	.	.	A	26.1	4.701801	0.88924	.	.	ENSG00000175727	ENST00000319080	T	0.15256	2.44	5.0	5.0	0.66597	.	0.253842	0.38058	N	0.001832	T	0.13586	0.0329	.	.	.	0.80722	D	1	P	0.37061	0.58	B	0.31495	0.131	T	0.06734	-1.0810	9	0.32370	T	0.25	-24.2339	14.3721	0.66846	1.0:0.0:0.0:0.0	.	237	Q9HAP2	MLXIP_HUMAN	E	237	ENSP00000312834:K237E	ENSP00000312834:K237E	K	+	1	0	MLXIP	121180101	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.659000	0.83766	1.881000	0.54492	0.459000	0.35465	AAG	-	NULL		0.607	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	MLXIP	protein_coding	OTTHUMT00000401718.2	A	NM_014938		121180101	1	no_errors	ENST00000319080	ensembl	human	known	54_36p	missense	SNP	1	G
DCLK1	9201	genome.wustl.edu	37	13	36424904	36424904	+	Intron	SNP	G	G	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr13:36424904G>A	ENST00000360631.3	-	6	1247				DCLK1_ENST00000379893.1_Intron|DCLK1_ENST00000255448.4_Intron|DCLK1_ENST00000460982.1_5'UTR|DCLK1_ENST00000379892.4_Missense_Mutation_p.R349C			O15075	DCLK1_HUMAN	doublecortin-like kinase 1						axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GAGAGGGGGCGGTACAGGTCC	0.483																																																0			13											107.0	103.0	105.0					13																	36424904		876	1991	2867	35322904	SO:0001627	intron_variant	9201			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1035+3731C>T	13.37:g.36424904G>A		Somatic		Capture	Illumina GAIIx	4	35322904	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	-	p.R349C	ENST00000360631.3	37	c.1045		13	.	.	.	.	.	.	.	.	.	.	G	13.90	2.373611	0.42105	.	.	ENSG00000133083	ENST00000379892	T	0.22945	1.93	5.42	4.58	0.56647	.	.	.	.	.	T	0.32466	0.0830	.	.	.	0.24707	N	0.993223	.	.	.	.	.	.	T	0.12066	-1.0562	6	0.37606	T	0.19	.	14.1511	0.65384	0.0723:0.0:0.9277:0.0	.	.	.	.	C	349	ENSP00000369222:R349C	ENSP00000369222:R349C	R	-	1	0	DCLK1	35322904	1.000000	0.71417	0.984000	0.44739	0.998000	0.95712	5.345000	0.65987	1.302000	0.44855	0.655000	0.94253	CGC	-	NULL		0.483	DCLK1-010	KNOWN	basic	protein_coding	DCAMKL1	protein_coding	OTTHUMT00000044487.1	G	NM_004734		35322904	-1	no_errors	ENST00000379892	ensembl	human	known	54_36p	missense	SNP	1	A
SPRY2	10253	genome.wustl.edu	37	13	80911657	80911657	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr13:80911657C>T	ENST00000377102.1	-	2	1161	c.184G>A	c.(184-186)Gtc>Atc	p.V62I	SPRY2_ENST00000540649.1_Missense_Mutation_p.V62I|SPRY2_ENST00000377104.3_Missense_Mutation_p.V62I			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	62					bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)	p.V62I(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		GGTCTTGGGACGACAGTAGGC	0.602																																																1	Substitution - Missense(1)	ovary(1)	13											96.0	95.0	95.0					13																	80911657		2203	4300	6503	79809658	SO:0001583	missense	10253			AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.184G>A	13.37:g.80911657C>T	ENSP00000366306:p.Val62Ile	Somatic		Capture	Illumina GAIIx	4	79809658	B2R9J9|Q5T6Z7	Missense_Mutation	SNP	HMMPfam_Sprouty	p.V62I	ENST00000377102.1	37	c.184	CCDS9463.1	13	.	.	.	.	.	.	.	.	.	.	C	11.33	1.605563	0.28623	.	.	ENSG00000136158	ENST00000377104;ENST00000377102;ENST00000541655;ENST00000540649	T;T;T	0.56275	0.47;0.47;0.47	5.48	4.63	0.57726	.	0.259797	0.36303	N	0.002662	T	0.42040	0.1185	L	0.29908	0.895	0.28439	N	0.916893	B	0.15141	0.012	B	0.08055	0.003	T	0.22765	-1.0207	10	0.27785	T	0.31	.	16.2993	0.82801	0.0:0.8675:0.1325:0.0	.	62	O43597	SPY2_HUMAN	I	62	ENSP00000366308:V62I;ENSP00000366306:V62I;ENSP00000439027:V62I	ENSP00000366306:V62I	V	-	1	0	SPRY2	79809658	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	1.462000	0.35266	1.302000	0.44855	0.655000	0.94253	GTC	-	HMMPfam_Sprouty		0.602	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPRY2	protein_coding	OTTHUMT00000045387.1	C			79809658	-1	no_errors	NM_005842	genbank	human	reviewed	54_36p	missense	SNP	1	T
MOK	5891	genome.wustl.edu	37	14	102698968	102698968	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr14:102698968T>G	ENST00000361847.2	-	9	1001	c.770A>C	c.(769-771)cAa>cCa	p.Q257P	MOK_ENST00000561150.1_5'UTR|MOK_ENST00000522867.1_5'UTR|MOK_ENST00000524214.1_Missense_Mutation_p.Q227P|MOK_ENST00000524370.1_5'UTR|MOK_ENST00000523231.1_5'UTR|MOK_ENST00000193029.6_Missense_Mutation_p.Q23P|MOK_ENST00000517966.1_5'UTR|MOK_ENST00000522534.1_5'UTR|MOK_ENST00000519058.1_5'UTR|MOK_ENST00000522874.1_Missense_Mutation_p.Q256P|MOK_ENST00000520266.1_Intron	NM_014226.1	NP_055041.1	Q9UQ07	MOK_HUMAN	MOK protein kinase	257	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q257P(1)									GGAGAGGCATTGTGGGGACAA	0.473																																																1	Substitution - Missense(1)	ovary(1)	14											162.0	162.0	162.0					14																	102698968		2203	4300	6503	101768721	SO:0001583	missense	5891			AB022694	CCDS9971.1, CCDS61552.1	14q32	2014-04-23	2011-09-06	2011-09-06	ENSG00000080823	ENSG00000080823			9833	protein-coding gene	gene with protein product		605762	"""renal tumor antigen"""	RAGE		8781117, 10421840	Standard	NM_014226		Approved	RAGE1, STK30	uc001ylm.4	Q9UQ07	OTTHUMG00000164896	ENST00000361847.2:c.770A>C	14.37:g.102698968T>G	ENSP00000355304:p.Gln257Pro	Somatic		Capture	Illumina GAIIx	4	101768721	B2R6Z4|B7Z7P6|E7ER76|E7ERR8|Q92790|Q93067	Missense_Mutation	SNP	-	p.Q257P	ENST00000361847.2	37	c.770	CCDS9971.1	14	.	.	.	.	.	.	.	.	.	.	.	12.34	1.908451	0.33721	.	.	ENSG00000080823	ENST00000193029;ENST00000522874;ENST00000361847;ENST00000524214	T;T;T;T	0.65549	0.94;-0.16;-0.16;-0.16	5.5	5.5	0.81552	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.419894	0.26553	N	0.023735	T	0.55226	0.1907	L	0.39397	1.21	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.11329	0.006;0.006	T	0.48980	-0.8986	10	0.41790	T	0.15	.	15.5969	0.76590	0.0:0.0:0.0:1.0	.	227;257	E7ERR8;Q9UQ07	.;MOK_HUMAN	P	23;256;257;227	ENSP00000193029:Q23P;ENSP00000429469:Q256P;ENSP00000355304:Q257P;ENSP00000428942:Q227P	ENSP00000193029:Q23P	Q	-	2	0	RAGE	101768721	0.997000	0.39634	0.640000	0.29408	0.988000	0.76386	4.638000	0.61353	2.093000	0.63338	0.379000	0.24179	CAA	-	NULL		0.473	MOK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAGE	protein_coding	OTTHUMT00000380848.3	T			101768721	-1	no_errors	NM_014226	genbank	human	provisional	54_36p	missense	SNP	0.03	G
BAG5	9529	genome.wustl.edu	37	14	104026926	104026926	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr14:104026926C>A	ENST00000445922.2	-	2	822	c.576G>T	c.(574-576)gaG>gaT	p.E192D	APOPT1_ENST00000247618.4_5'Flank|BAG5_ENST00000337322.4_Missense_Mutation_p.E233D|RP11-894P9.2_ENST00000556332.1_RNA|APOPT1_ENST00000556253.2_5'Flank|RP11-73M18.2_ENST00000472726.2_5'Flank|APOPT1_ENST00000409074.2_5'Flank|BAG5_ENST00000299204.4_Missense_Mutation_p.E192D	NM_004873.3	NP_004864.1	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5	192	BAG 3. {ECO:0000255|PROSITE- ProRule:PRU00369}.				negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein refolding (GO:0061084)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron death (GO:0070997)|protein folding (GO:0006457)|regulation of inclusion body assembly (GO:0090083)	inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chaperone binding (GO:0051087)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.E192D(1)		endometrium(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	24		Melanoma(154;0.155)	Epithelial(46;0.144)			CCTTGTTCACCTCACACATCA	0.522																																					NSCLC(171;1832 2055 18950 31566 41632)											1	Substitution - Missense(1)	ovary(1)	14											147.0	136.0	140.0					14																	104026926		2203	4300	6503	103096679	SO:0001583	missense	9529			AF095195	CCDS9982.1, CCDS41995.1	14q32	2008-08-01				ENSG00000166170			941	protein-coding gene	gene with protein product		603885				9873016, 15603737	Standard	NM_001015048		Approved		uc001ynh.2	Q9UL15		ENST00000445922.2:c.576G>T	14.37:g.104026926C>A	ENSP00000391713:p.Glu192Asp	Somatic		Capture	Illumina GAIIx	4	103096679	O94950|Q86W59	Missense_Mutation	SNP	HMMPfam_BAG;superfamily_BAG domain	p.E233D	ENST00000445922.2	37	c.699	CCDS9982.1	14	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014330	0.35511	.	.	ENSG00000166170	ENST00000299204;ENST00000445922;ENST00000337322;ENST00000557666	D;D;D;T	0.88586	-2.4;-2.4;-2.4;-1.47	5.76	-4.36	0.03645	BAG domain (3);	0.462359	0.24303	N	0.039706	T	0.70168	0.3193	N	0.12182	0.205	0.35561	D	0.804696	B;B	0.06786	0.0;0.001	B;B	0.08055	0.002;0.003	T	0.43294	-0.9400	10	0.35671	T	0.21	-22.686	3.126	0.06407	0.0846:0.2842:0.2657:0.3655	.	192;233	Q9UL15;Q9UL15-2	BAG5_HUMAN;.	D	192;192;233;192	ENSP00000299204:E192D;ENSP00000391713:E192D;ENSP00000338814:E233D;ENSP00000450497:E192D	ENSP00000299204:E192D	E	-	3	2	BAG5	103096679	0.002000	0.14202	0.904000	0.35570	0.994000	0.84299	-1.544000	0.02192	-0.687000	0.05162	-0.150000	0.13652	GAG	-	HMMPfam_BAG		0.522	BAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG5	protein_coding	OTTHUMT00000414990.1	C			103096679	-1	no_errors	NM_001015049	genbank	human	reviewed	54_36p	missense	SNP	0.98	A
GLCE	26035	genome.wustl.edu	37	15	69560791	69560791	+	Silent	SNP	G	G	T			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr15:69560791G>T	ENST00000261858.2	+	5	1290	c.1062G>T	c.(1060-1062)ctG>ctT	p.L354L	GLCE_ENST00000559420.2_Silent_p.L290L|GLCE_ENST00000559500.1_3'UTR	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	354					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)	p.L354L(1)		NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						CCAGGGACCTGGTCACTGACC	0.423																																																1	Substitution - coding silent(1)	ovary(1)	15											56.0	57.0	56.0					15																	69560791		2200	4298	6498	67347845	SO:0001819	synonymous_variant	26035			AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.1062G>T	15.37:g.69560791G>T		Somatic		Capture	Illumina GAIIx	4	67347845	Q6GUQ2	Silent	SNP	HMMPfam_C5-epim_C	p.L354	ENST00000261858.2	37	c.1062	CCDS32277.1	15																																																																																			-	NULL		0.423	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GLCE	protein_coding		G	NM_015554		67347845	1	no_errors	NM_015554	genbank	human	validated	54_36p	silent	SNP	1	T
THSD4	79875	genome.wustl.edu	37	15	72050325	72050325	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr15:72050325T>G	ENST00000355327.3	+	15	2634	c.2500T>G	c.(2500-2502)Tgt>Ggt	p.C834G	THSD4_ENST00000567838.1_3'UTR|THSD4_ENST00000261862.6_Missense_Mutation_p.C834G|THSD4_ENST00000357769.4_Missense_Mutation_p.C474G			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	834	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)	p.C834G(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CCTGGAGGGCTGTGGGAACAA	0.657																																																1	Substitution - Missense(1)	ovary(1)	15											35.0	41.0	39.0					15																	72050325		2120	4232	6352	69837379	SO:0001583	missense	79875			AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.2500T>G	15.37:g.72050325T>G	ENSP00000347484:p.Cys834Gly	Somatic		Capture	Illumina GAIIx	4	69837379	B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	-	p.C834G	ENST00000355327.3	37	c.2500	CCDS10238.2	15	.	.	.	.	.	.	.	.	.	.	T	18.22	3.575884	0.65878	.	.	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769	T;T;T	0.72835	-0.69;-0.69;-0.69	5.18	5.18	0.71444	.	.	.	.	.	D	0.87947	0.6306	H	0.95539	3.685	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.996	D	0.90289	0.4321	9	0.51188	T	0.08	.	13.0184	0.58771	0.0:0.0:0.0:1.0	.	474;834	B4DR13;Q6ZMP0	.;THSD4_HUMAN	G	834;834;474	ENSP00000347484:C834G;ENSP00000261862:C834G;ENSP00000350413:C474G	ENSP00000261862:C834G	C	+	1	0	THSD4	69837379	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.749000	0.85096	2.177000	0.69029	0.533000	0.62120	TGT	-	NULL		0.657	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	THSD4	protein_coding	OTTHUMT00000257253.2	T	NM_024817		69837379	1	no_errors	NM_024817	genbank	human	provisional	54_36p	missense	SNP	1	G
PRDM7	11105	genome.wustl.edu	37	16	90128464	90128464	+	Silent	SNP	C	C	T			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr16:90128464C>T	ENST00000449207.2	-	7	766	c.747G>A	c.(745-747)ggG>ggA	p.G249G	PRDM7_ENST00000325921.6_Silent_p.G43G|PRDM7_ENST00000407825.1_Silent_p.G43G	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	249	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)	p.G43G(1)		lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		TGCCTGATGGCCCAATTCTCA	0.587																																																1	Substitution - coding silent(1)	ovary(1)	16											72.0	66.0	68.0					16																	90128464		2198	4300	6498	88655965	SO:0001819	synonymous_variant	11105			AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.747G>A	16.37:g.90128464C>T		Somatic		Capture	Illumina GAIIx	4	88655965	A4Q9G8|Q08EM4|Q9NQW4	Silent	SNP	-	p.G249	ENST00000449207.2	37	c.747	CCDS45557.1	16																																																																																			-	NULL		0.587	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM7	protein_coding	OTTHUMT00000420560.1	C			88655965	-1	no_errors	NM_001098173	genbank	human	reviewed	54_36p	silent	SNP	0.43	T
TP53	7157	genome.wustl.edu	37	17	7576852	7576852	+	Splice_Site	SNP	C	C	G	rs11575997		TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C					Verified	Unknown	Somatic	Phase_I	WXS	Sanger_PCR_WGA		dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr17:7576852C>G	ENST00000269305.4	-	9	1183		c.e9+1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(24)|p.0?(8)|p.I332fs*49(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGACTTAGTACCTGAAGGGTG	0.458		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	33	Unknown(24)|Whole gene deletion(8)|Insertion - Frameshift(1)	ovary(8)|lung(4)|breast(4)|bone(4)|stomach(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|NS(2)|pancreas(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|skin(1)	17	GRCh37	CD002536	TP53	D	rs11575997						115.0	108.0	111.0					17																	7576852		2203	4300	6503	7517577	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.993+1G>C	17.37:g.7576852C>G		Somatic		PCR	ABI 3730xl	Phase_III	7517577	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e8+1	ENST00000269305.4	37	c.993+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	13.44	2.238216	0.39598	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000419024	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6932	0.56988	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517577	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	2.315000	0.43752	2.462000	0.83206	0.561000	0.74099	.	-	-		0.458	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Intron	7517577	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	0.99	G
PIK3C3	5289	genome.wustl.edu	37	18	39600610	39600610	+	Silent	SNP	C	C	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr18:39600610C>A	ENST00000262039.4	+	13	1511	c.1425C>A	c.(1423-1425)ctC>ctA	p.L475L	PIK3C3_ENST00000398870.3_Silent_p.L412L	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	475	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.L475L(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						AGCAAGATCTCTGTACCTTCT	0.289										TSP Lung(28;0.18)																											NSCLC(37;552 1060 2683 16430 37914)											1	Substitution - coding silent(1)	ovary(1)	18											44.0	45.0	45.0					18																	39600610		2203	4286	6489	37854608	SO:0001819	synonymous_variant	5289			Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.1425C>A	18.37:g.39600610C>A		Somatic		Capture	Illumina GAIIx	4	37854608	Q15134	Silent	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB);superfamily_Protein kinase-like (PK-like);superfamily_ARM repeat;PI3_PI4_kinase;HMMPfam_PI3_PI4_kinase;PI3Ka;HMMPfam_PI3Ka;PI3K_C2;HMMPfam_PI3K_C2	p.L475	ENST00000262039.4	37	c.1425	CCDS11920.1	18																																																																																			-	HMMPfam_PI3Ka		0.289	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C3	protein_coding	OTTHUMT00000255804.1	C	NM_002647		37854608	1	no_errors	NM_002647	genbank	human	validated	54_36p	silent	SNP	1	A
ANO8	57719	genome.wustl.edu	37	19	17435902	17435902	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr19:17435902C>G	ENST00000159087.4	-	17	3113	c.2955G>C	c.(2953-2955)caG>caC	p.Q985H		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	985					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.Q985H(1)		autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						GGAATTTGCCCTGCAGTGGGA	0.667																																																1	Substitution - Missense(1)	ovary(1)	19											84.0	89.0	87.0					19																	17435902		2203	4300	6503	17296902	SO:0001583	missense	57719			AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.2955G>C	19.37:g.17435902C>G	ENSP00000159087:p.Gln985His	Somatic		Capture	Illumina GAIIx	4	17296902	A6NIJ0	Missense_Mutation	SNP	-	p.Q985H	ENST00000159087.4	37	c.2955	CCDS32949.1	19	.	.	.	.	.	.	.	.	.	.	C	15.02	2.707965	0.48412	.	.	ENSG00000074855	ENST00000159087	T	0.75050	-0.9	4.19	3.13	0.36017	.	0.064498	0.64402	D	0.000007	T	0.78419	0.4280	L	0.54323	1.7	0.34552	D	0.711429	D	0.65815	0.995	D	0.77557	0.99	T	0.78937	-0.2007	10	0.24483	T	0.36	.	7.1496	0.25604	0.0:0.7821:0.0:0.2178	.	985	Q9HCE9	ANO8_HUMAN	H	985	ENSP00000159087:Q985H	ENSP00000159087:Q985H	Q	-	3	2	ANO8	17296902	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.611000	0.46334	1.877000	0.54381	0.478000	0.44815	CAG	-	NULL		0.667	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO8	protein_coding	OTTHUMT00000462943.1	C	XM_050644		17296902	-1	no_errors	NM_020959	genbank	human	provisional	54_36p	missense	SNP	1	G
ZBTB32	27033	genome.wustl.edu	37	19	36207502	36207502	+	Missense_Mutation	SNP	C	C	A	rs267605434		TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr19:36207502C>A	ENST00000392197.2	+	7	1630	c.1312C>A	c.(1312-1314)Ccc>Acc	p.P438T	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000341701.1_5'Flank|KMT2B_ENST00000222270.7_5'Flank|ZBTB32_ENST00000262630.3_Missense_Mutation_p.P438T|KMT2B_ENST00000420124.1_5'Flank			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	438					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.P438T(1)		large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGCCGGCTGTCCCAGCCTGGC	0.692											OREG0025433	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	19											55.0	53.0	53.0					19																	36207502		2203	4298	6501	40899342	SO:0001583	missense	27033			AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.1312C>A	19.37:g.36207502C>A	ENSP00000376035:p.Pro438Thr	Somatic	861	Capture	Illumina GAIIx	4	40899342	Q8WVP2	Missense_Mutation	SNP	-	p.P438T	ENST00000392197.2	37	c.1312	CCDS12471.1	19	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955454	0.73902	.	.	ENSG00000011590	ENST00000262630;ENST00000392197	T;T	0.17054	2.3;2.3	4.75	1.49	0.22878	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.302644	0.24238	N	0.040290	T	0.10551	0.0258	N	0.04959	-0.14	0.30200	N	0.798714	P	0.46859	0.885	P	0.51324	0.666	T	0.17198	-1.0377	10	0.14252	T	0.57	-5.6783	8.1848	0.31333	0.0:0.7411:0.0:0.2589	.	438	Q9Y2Y4	ZBT32_HUMAN	T	438	ENSP00000262630:P438T;ENSP00000376035:P438T	ENSP00000262630:P438T	P	+	1	0	ZBTB32	40899342	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	0.733000	0.26087	0.231000	0.21079	0.462000	0.41574	CCC	-	NULL		0.692	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB32	protein_coding	OTTHUMT00000109491.3	C	NM_014383		40899342	1	no_errors	NM_014383	genbank	human	provisional	54_36p	missense	SNP	1	A
SIGLEC12	89858	genome.wustl.edu	37	19	52001388	52001388	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr19:52001388A>G	ENST00000291707.3	-	5	1344	c.1289T>C	c.(1288-1290)gTg>gCg	p.V430A	SIGLEC12_ENST00000598614.1_Missense_Mutation_p.V312A	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	430	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.V430A(1)		NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CAGCTCCAGCACCCCAAGGTT	0.617																																																1	Substitution - Missense(1)	ovary(1)	19											51.0	49.0	50.0					19																	52001388		2203	4300	6503	56693200	SO:0001583	missense	89858			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.1289T>C	19.37:g.52001388A>G	ENSP00000291707:p.Val430Ala	Somatic		Capture	Illumina GAIIx	4	56693200	Q8IYH7	Missense_Mutation	SNP	HMMPfam_V-set;HMMPfam_ig;HMMPfam_C2-set_2;superfamily_Immunoglobulin	p.V430A	ENST00000291707.3	37	c.1289	CCDS12833.1	19	.	.	.	.	.	.	.	.	.	.	.	12.02	1.811706	0.32053	.	.	ENSG00000254521	ENST00000291707	T	0.15952	2.38	1.39	0.203	0.15195	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.243882	0.20820	U	0.085088	T	0.33118	0.0852	M	0.82056	2.57	0.09310	N	1	D;P	0.60160	0.987;0.917	D;P	0.67231	0.95;0.81	T	0.10753	-1.0616	10	0.66056	D	0.02	.	3.3268	0.07070	0.6319:0.0:0.0:0.3681	.	430;312	Q96PQ1;Q96PQ1-2	SIG12_HUMAN;.	A	430	ENSP00000291707:V430A	ENSP00000291707:V430A	V	-	2	0	SIGLEC12	56693200	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-0.109000	0.10840	0.003000	0.14656	0.324000	0.21423	GTG	-	HMMPfam_ig		0.617	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC12	protein_coding	OTTHUMT00000384641.2	A	NM_053003		56693200	-1	no_errors	NM_053003	genbank	human	reviewed	54_36p	missense	SNP		G
ZNF615	284370	genome.wustl.edu	37	19	52497554	52497554	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr19:52497554G>A	ENST00000602063.1	-	6	1124	c.775C>T	c.(775-777)Cat>Tat	p.H259Y	ZNF615_ENST00000598071.1_Missense_Mutation_p.H270Y|ZNF615_ENST00000391795.3_Missense_Mutation_p.H264Y|ZNF615_ENST00000594083.1_Missense_Mutation_p.H270Y|ZNF615_ENST00000376716.5_Missense_Mutation_p.H259Y			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	259					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H259Y(1)|p.H270Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CATTCATAATGTTTCAGTTCT	0.398																																																2	Substitution - Missense(2)	ovary(2)	19											160.0	148.0	152.0					19																	52497554		2203	4300	6503	57189366	SO:0001583	missense	284370			AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.775C>T	19.37:g.52497554G>A	ENSP00000473089:p.His259Tyr	Somatic		Capture	Illumina GAIIx	4	57189366	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Missense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.H259Y	ENST00000602063.1	37	c.775	CCDS12846.1	19	.	.	.	.	.	.	.	.	.	.	G	5.602	0.295863	0.10622	.	.	ENSG00000197619	ENST00000376716;ENST00000354939;ENST00000391795;ENST00000391793	T;T	0.07444	3.19;3.19	3.32	1.14	0.20703	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05593	0.0147	N	0.16368	0.405	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.36768	-0.9734	9	0.62326	D	0.03	.	8.0487	0.30564	0.2119:0.0:0.7881:0.0	.	264;266;270;259	B4DH87;Q8N8J6-3;Q8N8J6-2;Q8N8J6	.;.;.;ZN615_HUMAN	Y	259;269;264;269	ENSP00000365906:H259Y;ENSP00000375672:H264Y	ENSP00000347019:H269Y	H	-	1	0	ZNF615	57189366	0.000000	0.05858	0.001000	0.08648	0.559000	0.35586	0.654000	0.24918	0.241000	0.21283	0.555000	0.69702	CAT	-	NULL		0.398	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZNF615	protein_coding	OTTHUMT00000462391.1	G	NM_198480		57189366	-1	no_errors	NM_198480	genbank	human	provisional	54_36p	missense	SNP	0.95	A
LILRB4	11006	genome.wustl.edu	37	19	55179203	55179203	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr19:55179203A>T	ENST00000391736.1	+	13	1474	c.1159A>T	c.(1159-1161)Aag>Tag	p.K387*	LILRB4_ENST00000391733.3_Nonsense_Mutation_p.K388*|LILRB4_ENST00000430952.2_Nonsense_Mutation_p.K386*|LILRB4_ENST00000391734.3_Intron|LILRB4_ENST00000270452.2_Nonsense_Mutation_p.K387*	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	387					immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.K387*(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		CCTGGACACAAAGGACAGACA	0.592																																																1	Substitution - Nonsense(1)	ovary(1)	19											74.0	71.0	72.0					19																	55179203		2198	4298	6496	59871015	SO:0001587	stop_gained	11006			U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.1159A>T	19.37:g.55179203A>T	ENSP00000375616:p.Lys387*	Somatic		Capture	Illumina GAIIx	4	59871015	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Nonsense_Mutation	SNP	HMMPfam_ig;superfamily_Immunoglobulin	p.K387*	ENST00000391736.1	37	c.1159	CCDS12902.1	19	.	.	.	.	.	.	.	.	.	.	A	10.57	1.388554	0.25118	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391733;ENST00000434286	.	.	.	2.18	-3.18	0.05186	.	.	.	.	.	.	.	.	.	.	.	0.53688	D	0.999973	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.2792	0.10824	0.3082:0.2213:0.4705:0.0	.	.	.	.	X	387;387;386;388;386	.	ENSP00000270452:K387X	K	+	1	0	LILRB4	59871015	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.414000	0.07114	-0.801000	0.04427	-0.466000	0.05196	AAG	-	NULL		0.592	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB4	protein_coding	OTTHUMT00000141127.3	A			59871015	1	no_errors	NM_006847	genbank	human	reviewed	54_36p	nonsense	SNP		T
ABCB11	8647	genome.wustl.edu	37	2	169801416	169801416	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr2:169801416A>G	ENST00000263817.6	-	20	2523	c.2399T>C	c.(2398-2400)cTa>cCa	p.L800P		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	800	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)	p.L800P(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TACAAAAAGTAGGCACACACC	0.308																																																1	Substitution - Missense(1)	ovary(1)	2											32.0	29.0	30.0					2																	169801416		1816	4082	5898	169509662	SO:0001583	missense	8647			AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.2399T>C	2.37:g.169801416A>G	ENSP00000263817:p.Leu800Pro	Somatic		Capture	Illumina GAIIx	Phase_III	169509662	Q53TL2|Q9UNB2	Missense_Mutation	SNP	HMMPfam_ABC_membrane;HMMPfam_ABC_tran;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain	p.L800P	ENST00000263817.6	37	c.2399	CCDS46444.1	2	.	.	.	.	.	.	.	.	.	.	A	22.8	4.335552	0.81801	.	.	ENSG00000073734	ENST00000263817	D	0.91686	-2.89	5.76	5.76	0.90799	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.953382	0.08815	N	0.889703	D	0.96445	0.8840	M	0.80422	2.495	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.71656	0.974;0.939	D	0.93500	0.6843	10	0.87932	D	0	.	16.0586	0.80822	1.0:0.0:0.0:0.0	.	242;800	B4DZQ8;O95342	.;ABCBB_HUMAN	P	800	ENSP00000263817:L800P	ENSP00000263817:L800P	L	-	2	0	ABCB11	169509662	1.000000	0.71417	0.985000	0.45067	0.974000	0.67602	8.936000	0.92931	2.187000	0.69744	0.528000	0.53228	CTA	-	HMMPfam_ABC_membrane		0.308	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB11	protein_coding	OTTHUMT00000333616.2	A	NM_003742		169509662	-1	no_errors	NM_003742	genbank	human	reviewed	54_36p	missense	SNP	0.99	G
Unknown	0	genome.wustl.edu	37	2	188690794	188690794	+	IGR	SNP	A	A	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr2:188690794A>G								AC068718.2 (83393 upstream) : AC068718.1 (401752 downstream)																							CAAAAATGTGAAGGGTGAGAG	0.433																																																0			2																																								188399039	SO:0001628	intergenic_variant	344328																															2.37:g.188690794A>G		Somatic		Capture	Illumina GAIIx	4	188399039		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.433					LOC344328			A			188399039	1	pseudogene	XR_017370	genbank	human	model	54_36p	rna	SNP	1	G
KIAA1755	85449	genome.wustl.edu	37	20	36855561	36855561	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr20:36855561C>T	ENST00000279024.4	-	7	2318	c.2047G>A	c.(2047-2049)Gtc>Atc	p.V683I		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	683								p.V683I(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				CTCACCTGGACGTCAGGTAAT	0.587																																																1	Substitution - Missense(1)	ovary(1)	20											37.0	36.0	37.0					20																	36855561		2203	4300	6503	36288975	SO:0001583	missense	85449			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.2047G>A	20.37:g.36855561C>T	ENSP00000279024:p.Val683Ile	Somatic		Capture	Illumina GAIIx	4	36288975	Q9C0A8	Missense_Mutation	SNP	-	p.V683I	ENST00000279024.4	37	c.2047	CCDS33467.1	20	.	.	.	.	.	.	.	.	.	.	C	0.090	-1.169350	0.01660	.	.	ENSG00000149633	ENST00000279024;ENST00000373398;ENST00000435901	T;T	0.63580	-0.05;1.97	4.16	-8.31	0.01001	.	1.135940	0.06757	N	0.781048	T	0.21674	0.0522	N	0.00677	-1.265	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42515	-0.9447	10	0.02654	T	1	.	11.4064	0.49900	0.0:0.6579:0.1957:0.1464	.	683	Q5JYT7	K1755_HUMAN	I	683;230;21	ENSP00000279024:V683I;ENSP00000393503:V21I	ENSP00000279024:V683I	V	-	1	0	KIAA1755	36288975	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	-1.394000	0.02518	-2.017000	0.00944	-0.956000	0.02647	GTC	-	NULL		0.587	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	protein_coding	OTTHUMT00000079144.3	C	NM_001029864		36288975	-1	no_errors	NM_001029864	genbank	human	predicted	54_36p	missense	SNP	0.01	T
PATZ1	23598	genome.wustl.edu	37	22	31731753	31731753	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr22:31731753G>A	ENST00000266269.5	-	3	2061	c.1432C>T	c.(1432-1434)Cgg>Tgg	p.R478W	RP3-400N23.6_ENST00000451161.1_RNA|PATZ1_ENST00000405309.3_Missense_Mutation_p.R478W|PATZ1_ENST00000351933.4_Missense_Mutation_p.R478W|RP3-400N23.6_ENST00000440456.1_RNA	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	478					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R478W(1)	EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						TATGCTGCCCGCAAGTACTTC	0.567																																																1	Substitution - Missense(1)	ovary(1)	22											113.0	102.0	105.0					22																	31731753		2203	4300	6503	30061753	SO:0001583	missense	23598			AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.1432C>T	22.37:g.31731753G>A	ENSP00000266269:p.Arg478Trp	Somatic		Capture	Illumina GAIIx	4	30061753	Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Missense_Mutation	SNP	HMMPfam_AT_hook,HMMPfam_zf-C2H2,HMMPfam_BTB,superfamily_POZ domain,superfamily_C2H2 and C2HC zinc fingers	p.R478W	ENST00000266269.5	37	c.1432	CCDS13894.1	22	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356868	0.82243	.	.	ENSG00000100105	ENST00000266269;ENST00000405309;ENST00000351933	T;T;T	0.12039	4.65;2.72;2.72	5.33	3.21	0.36854	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.31482	0.0798	L	0.55990	1.75	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.994;0.996;0.994	T	0.01753	-1.1281	10	0.59425	D	0.04	-17.0252	13.92	0.63926	0.0:0.0:0.6078:0.3921	.	478;478;478	Q9HBE1-3;Q9HBE1;Q9HBE1-2	.;PATZ1_HUMAN;.	W	478	ENSP00000266269:R478W;ENSP00000384173:R478W;ENSP00000337520:R478W	ENSP00000266269:R478W	R	-	1	2	PATZ1	30061753	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.254000	0.32897	0.611000	0.30052	0.563000	0.77884	CGG	-	NULL		0.567	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATZ1	protein_coding	OTTHUMT00000321932.1	G	NM_032052		30061753	-1	no_errors	NM_014323	genbank	human	reviewed	54_36p	missense	SNP	1	A
LAMB2	3913	genome.wustl.edu	37	3	49159423	49159423	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr3:49159423C>G	ENST00000418109.1	-	30	5041	c.4877G>C	c.(4876-4878)cGg>cCg	p.R1626P	USP19_ENST00000434032.2_5'Flank|USP19_ENST00000398892.3_5'Flank|USP19_ENST00000398898.2_5'Flank|USP19_ENST00000398888.2_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.R1626P|LAMB2_ENST00000464891.1_5'Flank|USP19_ENST00000453664.1_5'Flank|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000417901.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1626	Domain I.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.R1626P(1)		NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CACTGCCCCCCGGATGGCACC	0.602																																																1	Substitution - Missense(1)	ovary(1)	3											102.0	97.0	99.0					3																	49159423		2203	4300	6503	49134427	SO:0001583	missense	3913				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.4877G>C	3.37:g.49159423C>G	ENSP00000388325:p.Arg1626Pro	Somatic		Capture	Illumina GAIIx	4	49134427	Q16321	Missense_Mutation	SNP	HMMPfam_Laminin_EGF;HMMPfam_Laminin_N;superfamily_Galactose-binding domain-like;superfamily_Spectrin repeat;superfamily_EGF/Laminin	p.R1626P	ENST00000418109.1	37	c.4877	CCDS2789.1	3	.	.	.	.	.	.	.	.	.	.	C	12.07	1.826649	0.32329	.	.	ENSG00000172037	ENST00000418109;ENST00000305544;ENST00000395387	T;T	0.35236	1.32;1.32	5.55	-2.35	0.06684	.	0.943055	0.08994	N	0.864045	T	0.30854	0.0778	L	0.50333	1.59	0.09310	N	1	P	0.38617	0.64	B	0.35510	0.204	T	0.20806	-1.0264	10	0.49607	T	0.09	.	12.3465	0.55124	0.0:0.4809:0.0:0.5191	.	1626	P55268	LAMB2_HUMAN	P	1626;1626;350	ENSP00000388325:R1626P;ENSP00000307156:R1626P	ENSP00000307156:R1626P	R	-	2	0	LAMB2	49134427	0.000000	0.05858	0.884000	0.34674	0.972000	0.66771	-0.391000	0.07323	-0.681000	0.05204	-0.140000	0.14226	CGG	-	NULL		0.602	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	protein_coding	OTTHUMT00000345939.1	C	NM_002292		49134427	-1	no_errors	NM_002292	genbank	human	reviewed	54_36p	missense	SNP		G
PLD1	5337	genome.wustl.edu	37	3	171338240	171338240	+	Silent	SNP	T	T	C			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr3:171338240T>C	ENST00000351298.4	-	24	2790	c.2664A>G	c.(2662-2664)ctA>ctG	p.L888L	PLD1_ENST00000356327.5_Silent_p.L850L|PLD1_ENST00000342215.6_3'UTR|PLD1_ENST00000340989.4_Silent_p.L888L	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	888	Catalytic.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)	p.L888L(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GCTCAGTTACTAGGTTTCCTT	0.318																																					NSCLC(149;2174 3517 34058)											1	Substitution - coding silent(1)	ovary(1)	3											132.0	127.0	128.0					3																	171338240		2203	4300	6503	172820934	SO:0001819	synonymous_variant	5337			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.2664A>G	3.37:g.171338240T>C		Somatic		Capture	Illumina GAIIx	4	172820934		Silent	SNP	HMMPfam_PX;HMMPfam_PLDc;HMMPfam_PH;superfamily_PH domain-like;superfamily_Phospholipase D/nuclease;superfamily_PX domain	p.L888	ENST00000351298.4	37	c.2664	CCDS3216.1	3	.	.	.	.	.	.	.	.	.	.	T	0.547	-0.850908	0.02651	.	.	ENSG00000075651	ENST00000446289	.	.	.	5.5	-11.0	0.00169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.0791	5.1435	0.14971	0.3023:0.4405:0.0755:0.1817	.	.	.	.	W	151	.	.	X	-	2	0	PLD1	172820934	0.000000	0.05858	0.665000	0.29768	0.096000	0.18686	-4.276000	0.00261	-1.928000	0.01059	-0.669000	0.03829	TAG	-	NULL		0.318	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	protein_coding	OTTHUMT00000346730.2	T	NM_002662		172820934	-1	no_errors	NM_002662	genbank	human	validated	54_36p	silent	SNP	0.86	C
GPR78	27201	genome.wustl.edu	37	4	8582892	8582892	+	Silent	SNP	C	C	T			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr4:8582892C>T	ENST00000382487.4	+	1	600	c.183C>T	c.(181-183)ccC>ccT	p.P61P	GPR78_ENST00000509216.1_Intron	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	61					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P61P(1)		central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						TGGACATGCCCTTCACGCTGC	0.672																																																1	Substitution - coding silent(1)	ovary(1)	4											28.0	32.0	31.0					4																	8582892		2203	4300	6503	8633792	SO:0001819	synonymous_variant	27201			AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.183C>T	4.37:g.8582892C>T		Somatic		Capture	Illumina GAIIx	4	8633792	Q8NGV3	Silent	SNP	7tm_1;HMMPfam_7tm_1;Family A G protein-coupled receptor-like;superfamily_Family A G protein-coupled receptor-like	p.P61	ENST00000382487.4	37	c.183	CCDS3403.1	4																																																																																			-	HMMPfam_7tm_1		0.672	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR78	protein_coding	OTTHUMT00000359201.1	C			8633792	1	no_errors	NM_080819	genbank	human	validated	54_36p	silent	SNP	0.99	T
SLIT2	9353	genome.wustl.edu	37	4	20619224	20619224	+	Silent	SNP	G	G	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	A	G	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr4:20619224G>A	ENST00000504154.1	+	36	4551	c.4299G>A	c.(4297-4299)caG>caA	p.Q1433Q	SLIT2_ENST00000503823.1_Silent_p.Q1425Q|SLIT2_ENST00000503837.1_Silent_p.Q1429Q|SLIT2_ENST00000273739.5_Silent_p.Q1446Q	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1433					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.Q1433Q(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GTCTGGGGCAGCCCTACTGTG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	4											85.0	74.0	78.0					4																	20619224		2203	4300	6503	20228322	SO:0001819	synonymous_variant	9353			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.4299G>A	4.37:g.20619224G>A		Somatic		Capture	Illumina GAIIx	Phase_III	20228322	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	superfamily_L domain-like;superfamily_EGF/Laminin;HMMPfam_LRRNT;HMMPfam_LRRCT;HMMPfam_LRR_1;HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2	p.Q1433	ENST00000504154.1	37	c.4299	CCDS3426.1	4																																																																																			-	HMMPfam_EGF		0.567	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	protein_coding	OTTHUMT00000250396.2	G			20228322	1	no_errors	NM_004787	genbank	human	provisional	54_36p	silent	SNP	1	A
C5orf22	55322	genome.wustl.edu	37	5	31538630	31538630	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr5:31538630C>G	ENST00000325366.9	+	4	768	c.641C>G	c.(640-642)aCt>aGt	p.T214S	C5orf22_ENST00000355907.3_5'UTR	NM_018356.2	NP_060826.2	Q49AR2	CE022_HUMAN	chromosome 5 open reading frame 22	214								p.T214S(1)		kidney(3)|large_intestine(2)|lung(10)|ovary(2)|skin(1)	18						AGTGACCAGACTTGCCTAGAA	0.458																																																1	Substitution - Missense(1)	ovary(1)	5											69.0	65.0	66.0					5																	31538630		2203	4300	6503	31574387	SO:0001583	missense	55322			AK002055	CCDS3895.1	5p13.3	2012-02-22			ENSG00000082213	ENSG00000082213			25639	protein-coding gene	gene with protein product							Standard	NM_018356		Approved	FLJ11193	uc003jhj.4	Q49AR2	OTTHUMG00000131067	ENST00000325366.9:c.641C>G	5.37:g.31538630C>G	ENSP00000326879:p.Thr214Ser	Somatic		Capture	Illumina GAIIx	4	31574387	Q8ND28|Q8WU61|Q9NUR1	Missense_Mutation	SNP	-	p.T214S	ENST00000325366.9	37	c.641	CCDS3895.1	5	.	.	.	.	.	.	.	.	.	.	C	1.381	-0.583344	0.03827	.	.	ENSG00000082213	ENST00000325366	T	0.29655	1.56	5.37	4.49	0.54785	.	0.732493	0.14077	N	0.342983	T	0.27349	0.0671	L	0.47716	1.5	0.23215	N	0.998109	B	0.10296	0.003	B	0.15052	0.012	T	0.16070	-1.0415	10	0.49607	T	0.09	-3.2283	8.5178	0.33257	0.1403:0.7459:0.0:0.1138	.	214	Q49AR2	CE022_HUMAN	S	214	ENSP00000326879:T214S	ENSP00000326879:T214S	T	+	2	0	C5orf22	31574387	0.014000	0.17966	0.002000	0.10522	0.085000	0.17905	1.111000	0.31159	1.471000	0.48121	0.655000	0.94253	ACT	-	NULL		0.458	C5orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf22	protein_coding	OTTHUMT00000253726.2	C	NM_018356		31574387	1	no_errors	NM_018356	genbank	human	validated	54_36p	missense	SNP	0.08	G
TRIM23	373	genome.wustl.edu	37	5	64909990	64909990	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr5:64909990G>A	ENST00000231524.9	-	3	672	c.301C>T	c.(301-303)Cga>Tga	p.R101*	TRIM23_ENST00000274327.7_Nonsense_Mutation_p.R101*|TRIM23_ENST00000381018.3_Nonsense_Mutation_p.R101*	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	101					GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R101*(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		TTCTGCAGTCGTTCCAAAAGC	0.363																																																1	Substitution - Nonsense(1)	ovary(1)	5											117.0	123.0	121.0					5																	64909990		2203	4300	6503	64945746	SO:0001587	stop_gained	373			L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.301C>T	5.37:g.64909990G>A	ENSP00000231524:p.Arg101*	Somatic		Capture	Illumina GAIIx	4	64945746	Q9BZY4|Q9BZY5	Nonsense_Mutation	SNP	superfamily_RING/U-box;HMMPfam_zf-B_box;HMMPfam_zf-C3HC4;HMMPfam_Arf;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_C2H2 and C2HC zinc fingers	p.R101*	ENST00000231524.9	37	c.301	CCDS3987.1	5	.	.	.	.	.	.	.	.	.	.	G	25.2	4.618182	0.87359	.	.	ENSG00000113595	ENST00000231524;ENST00000381018;ENST00000274327	.	.	.	5.25	3.45	0.39498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9968	0.41905	0.0721:0.0:0.7895:0.1384	.	.	.	.	X	101	.	ENSP00000231524:R101X	R	-	1	2	TRIM23	64945746	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	4.087000	0.57671	0.589000	0.29677	0.585000	0.79938	CGA	-	NULL		0.363	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM23	protein_coding	OTTHUMT00000215058.2	G	NM_001656		64945746	-1	no_errors	NM_001656	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
GPLD1	2822	genome.wustl.edu	37	6	24462991	24462991	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr6:24462991A>G	ENST00000230036.1	-	11	964	c.854T>C	c.(853-855)aTt>aCt	p.I285T		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	285					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)	p.I285T(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						GCCACATGCAATGAACAGAGG	0.448																																																1	Substitution - Missense(1)	ovary(1)	6											138.0	137.0	138.0					6																	24462991		2203	4300	6503	24570970	SO:0001583	missense	2822			L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.854T>C	6.37:g.24462991A>G	ENSP00000230036:p.Ile285Thr	Somatic		Capture	Illumina GAIIx	4	24570970	Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Missense_Mutation	SNP	HMMPfam_FG-GAP;superfamily_Integrin alpha N-terminal domain	p.I285T	ENST00000230036.1	37	c.854	CCDS4553.1	6	.	.	.	.	.	.	.	.	.	.	A	11.71	1.718550	0.30503	.	.	ENSG00000112293	ENST00000230036	T	0.67345	-0.26	5.92	5.92	0.95590	.	0.073640	0.53938	D	0.000055	T	0.68970	0.3059	M	0.78637	2.42	0.80722	D	1	D	0.61080	0.989	P	0.52159	0.691	T	0.73729	-0.3891	10	0.51188	T	0.08	-24.4559	13.8758	0.63651	1.0:0.0:0.0:0.0	.	285	P80108	PHLD_HUMAN	T	285	ENSP00000230036:I285T	ENSP00000230036:I285T	I	-	2	0	GPLD1	24570970	0.999000	0.42202	0.925000	0.36789	0.065000	0.16274	5.425000	0.66470	2.255000	0.74692	0.533000	0.62120	ATT	-	NULL		0.448	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPLD1	protein_coding	OTTHUMT00000043315.1	A	NM_001503		24570970	-1	no_errors	NM_001503	genbank	human	reviewed	54_36p	missense	SNP	0.91	G
CDC5L	988	genome.wustl.edu	37	6	44394441	44394441	+	Frame_Shift_Del	DEL	T	T	-			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr6:44394441delT	ENST00000371477.3	+	13	2172	c.1873delT	c.(1873-1875)tccfs	p.S625fs		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	625	Interaction with DAPK3. {ECO:0000250|UniProtKB:O08837}.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)	p.S625fs*5(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGAAAAGTTCTCCAAAGAAGA	0.343																																																1	Deletion - Frameshift(1)	ovary(1)	6											80.0	80.0	80.0					6																	44394441		2203	4299	6502	44502419	SO:0001589	frameshift_variant	988			D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.1873delT	6.37:g.44394441delT	ENSP00000360532:p.Ser625fs	Somatic		Capture	Illumina GAIIx	Phase_III	44502419	Q76N46|Q99974	Frame_Shift_Del	DEL	superfamily_Homeodomain-like,HMMPfam_Myb_DNA-binding	p.S625fs	ENST00000371477.3	37	c.1873	CCDS4912.1	6																																																																																			(deletion:cds_exon[44502197,44502439])	NULL		0.343	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC5L	protein_coding	OTTHUMT00000040743.1	T			44502419	1	no_errors	NM_001253	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1	-
ABCB4	5244	genome.wustl.edu	37	7	87035712	87035712	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr7:87035712A>C	ENST00000265723.4	-	26	3510	c.3399T>G	c.(3397-3399)atT>atG	p.I1133M	ABCB4_ENST00000545634.1_Missense_Mutation_p.I1126M|ABCB4_ENST00000453593.1_Missense_Mutation_p.I1079M|ABCB4_ENST00000359206.3_Missense_Mutation_p.I1126M|ABCB4_ENST00000358400.3_Missense_Mutation_p.I1079M	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	1133	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.I1126M(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	TATTCTCGGCAATGCTGCAGT	0.478																																																1	Substitution - Missense(1)	ovary(1)	7											155.0	149.0	151.0					7																	87035712		2203	4300	6503	86873648	SO:0001583	missense	5244			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.3399T>G	7.37:g.87035712A>C	ENSP00000265723:p.Ile1133Met	Somatic		Capture	Illumina GAIIx	4	86873648	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	HMMPfam_ABC_membrane;HMMPfam_ABC_tran;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain	p.I1133M	ENST00000265723.4	37	c.3399	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	A	17.67	3.447194	0.63178	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09;-3.09	5.81	2.19	0.27852	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.060013	0.64402	D	0.000003	D	0.95893	0.8663	M	0.89785	3.06	0.48762	D	0.999708	D;D;D	0.89917	1.0;0.996;0.997	D;D;D	0.87578	0.998;0.978;0.987	D	0.94837	0.8001	10	0.87932	D	0	-16.7092	9.2334	0.37450	0.7205:0.0:0.2795:0.0	.	1079;1126;1133	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	M	1126;1079;1133;1079;1126	ENSP00000352135:I1126M;ENSP00000351172:I1079M;ENSP00000265723:I1133M;ENSP00000392983:I1079M;ENSP00000437465:I1126M	ENSP00000265723:I1133M	I	-	3	3	ABCB4	86873648	0.424000	0.25490	0.996000	0.52242	0.982000	0.71751	-0.132000	0.10467	0.479000	0.27511	0.455000	0.32223	ATT	-	HMMPfam_ABC_tran		0.478	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	protein_coding	OTTHUMT00000336083.1	A	NM_000443		86873648	-1	no_errors	NM_018849	genbank	human	reviewed	54_36p	missense	SNP	1	C
CSMD1	64478	genome.wustl.edu	37	8	2964060	2964060	+	Silent	SNP	T	T	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr8:2964060T>A	ENST00000520002.1	-	47	7497	c.6942A>T	c.(6940-6942)ccA>ccT	p.P2314P	CSMD1_ENST00000602723.1_Silent_p.P2314P|CSMD1_ENST00000400186.3_Silent_p.P2314P|CSMD1_ENST00000602557.1_Silent_p.P2314P|CSMD1_ENST00000542608.1_Silent_p.P2313P|CSMD1_ENST00000537824.1_Silent_p.P2313P			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2314	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.P2042P(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTTCACATGTTGGGAGAGAAC	0.423																																																1	Substitution - coding silent(1)	ovary(1)	8											56.0	54.0	55.0					8																	2964060		1898	4135	6033	2951467	SO:0001819	synonymous_variant	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6942A>T	8.37:g.2964060T>A		Somatic		Capture	Illumina GAIIx	4	2951467	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	-	p.N2315Y	ENST00000520002.1	37	c.6943		8	.	.	.	.	.	.	.	.	.	.	T	0.216	-1.032674	0.02029	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.31	-10.6	0.00265	.	.	.	.	.	T	0.49592	0.1566	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63256	-0.6678	4	.	.	.	.	11.3641	0.49662	0.0:0.2481:0.5518:0.2001	.	.	.	.	Y	1794	.	.	N	-	1	0	CSMD1	2951467	0.000000	0.05858	0.006000	0.13384	0.004000	0.04260	-0.949000	0.03893	-2.443000	0.00548	-1.272000	0.01410	AAC	-	NULL		0.423	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	T	NM_033225		2951467	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_033225	genbank	human	validated	54_36p	missense	SNP	0.07	A
SGCZ	137868	genome.wustl.edu	37	8	13948087	13948087	+	Silent	SNP	A	A	T			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr8:13948087A>T	ENST00000382080.1	-	8	1519	c.804T>A	c.(802-804)tcT>tcA	p.S268S	SGCZ_ENST00000421524.2_Silent_p.S221S	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	255					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)		p.S268S(1)		NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		TGGGTGAAGAAGATGAGAAGG	0.408																																																1	Substitution - coding silent(1)	ovary(1)	8											124.0	116.0	119.0					8																	13948087		2203	4300	6503	13992458	SO:0001819	synonymous_variant	137868			AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.804T>A	8.37:g.13948087A>T		Somatic		Capture	Illumina GAIIx	4	13992458	Q6REU0	Silent	SNP	-	p.S268	ENST00000382080.1	37	c.804	CCDS5992.2	8																																																																																			-	NULL		0.408	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SGCZ	protein_coding	OTTHUMT00000207636.2	A	NM_139167		13992458	-1	no_errors	NM_139167	genbank	human	reviewed	54_36p	silent	SNP	0.59	T
CPA6	57094	genome.wustl.edu	37	8	68340286	68340286	+	Silent	SNP	C	C	T			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr8:68340286C>T	ENST00000297770.4	-	10	1337	c.1122G>A	c.(1120-1122)acG>acA	p.T374T	CPA6_ENST00000297769.4_Intron	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	374						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.T374T(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			ACTTACACAACGTTGTGGAGG	0.433																																																1	Substitution - coding silent(1)	ovary(1)	8											113.0	105.0	108.0					8																	68340286		2203	4300	6503	68502840	SO:0001819	synonymous_variant	57094			AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.1122G>A	8.37:g.68340286C>T		Somatic		Capture	Illumina GAIIx	4	68502840	Q8NEX8|Q8TDE8|Q9NRI9	Silent	SNP	-	p.T374	ENST00000297770.4	37	c.1122	CCDS6200.1	8																																																																																			-	NULL		0.433	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA6	protein_coding	OTTHUMT00000379296.2	C	NM_020361		68502840	-1	no_errors	NM_020361	genbank	human	validated	54_36p	silent	SNP	0.04	T
ASAP1	50807	genome.wustl.edu	37	8	131124344	131124344	+	Silent	SNP	C	C	G	rs116410358	byFrequency	TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr8:131124344C>G	ENST00000518721.1	-	24	2624	c.2397G>C	c.(2395-2397)ggG>ggC	p.G799G	ASAP1_ENST00000357668.1_Silent_p.G799G	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	799	Pro-rich.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.G799G(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						CCATACCTTTCCCGGCGTTCC	0.547																																																1	Substitution - coding silent(1)	ovary(1)	8											124.0	122.0	123.0					8																	131124344		2203	4300	6503	131193526	SO:0001819	synonymous_variant	50807			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.2397G>C	8.37:g.131124344C>G		Somatic		Capture	Illumina GAIIx	4	131193526	B2RNV3	Silent	SNP	HMMPfam_ArfGap;superfamily_Pyk2-associated protein beta ARF-GAP domain;HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_PH;HMMPfam_Ank;superfamily_Ankyrin repeat;superfamily_PH domain-like	p.G799	ENST00000518721.1	37	c.2397	CCDS6362.1	8	.	.	.	.	.	.	.	.	.	.	C	10.35	1.326433	0.24080	.	.	ENSG00000153317	ENST00000524124;ENST00000519483	.	.	.	6.03	2.06	0.26882	.	.	.	.	.	T	0.66287	0.2774	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62558	-0.6829	4	.	.	.	.	12.6892	0.56964	0.0:0.3019:0.626:0.0721	.	.	.	.	Q	620;213	.	.	E	-	1	0	ASAP1	131193526	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.078000	0.30754	0.369000	0.24510	0.655000	0.94253	GAA	-	NULL		0.547	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	protein_coding	OTTHUMT00000380170.1	C	NM_018482		131193526	-1	no_errors	NM_018482	genbank	human	validated	54_36p	silent	SNP	1	G
OR13D1	286365	genome.wustl.edu	37	9	107457623	107457623	+	Silent	SNP	G	G	A			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chr9:107457623G>A	ENST00000318763.5	+	1	964	c.921G>A	c.(919-921)ggG>ggA	p.G307G		NM_001004484.1	NP_001004484.1	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D, member 1	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G307G(1)		large_intestine(4)|lung(10)|ovary(1)|prostate(2)|skin(2)	19						AGATTATTGGGCTGTCTTATG	0.418																																																1	Substitution - coding silent(1)	ovary(1)	9											119.0	120.0	120.0					9																	107457623		2203	4300	6503	106497444	SO:0001819	synonymous_variant	286365				CCDS35094.1	9q31.1	2013-09-24			ENSG00000179055	ENSG00000179055		"""GPCR / Class A : Olfactory receptors"""	14695	protein-coding gene	gene with protein product							Standard	NM_001004484		Approved		uc011lvs.2	Q8NGV5	OTTHUMG00000020412	ENST00000318763.5:c.921G>A	9.37:g.107457623G>A		Somatic		Capture	Illumina GAIIx	4	106497444	B9EIS1|Q6IFL1	Silent	SNP	-	p.G307	ENST00000318763.5	37	c.921	CCDS35094.1	9																																																																																			-	NULL		0.418	OR13D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13D1	protein_coding	OTTHUMT00000053483.1	G			106497444	1	no_errors	NM_001004484	genbank	human	provisional	54_36p	silent	SNP		A
ZNF185	7739	genome.wustl.edu	37	X	152138985	152138985	+	Splice_Site	SNP	A	A	G			TCGA-24-1436-01A-01W-0549-09	TCGA-24-1436-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	adeff0f5-d2a3-41c5-a509-298f702266bb	e75949ca-4478-406a-a598-a45d1f0cbefc	g.chrX:152138985A>G	ENST00000370268.4	+	22	2008		c.e22-1		ZNF185_ENST00000539731.1_Splice_Site|ZNF185_ENST00000324823.6_Splice_Site|ZNF185_ENST00000454925.1_Splice_Site|ZNF185_ENST00000318529.8_Splice_Site|ZNF185_ENST00000535861.1_Splice_Site|ZNF185_ENST00000318504.7_Splice_Site|ZNF185_ENST00000449285.2_Splice_Site|ZNF185_ENST00000370270.2_Splice_Site			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)							actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.?(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					TTTTCTTTTCAGTGTGGGATT	0.493																																																1	Unknown(1)	ovary(1)	X											112.0	105.0	108.0					X																	152138985		2015	4139	6154	151889641	SO:0001630	splice_region_variant	7739			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.1972-1A>G	X.37:g.152138985A>G		Somatic		Capture	Illumina GAIIx	4	151889641	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Splice_Site	SNP	-	e22-2	ENST00000370268.4	37	c.1972-2	CCDS48184.1	X	.	.	.	.	.	.	.	.	.	.	A	14.97	2.693857	0.48202	.	.	ENSG00000147394	ENST00000535861;ENST00000539731;ENST00000449285;ENST00000318504;ENST00000535156;ENST00000324823;ENST00000370268;ENST00000318529;ENST00000370270;ENST00000426821;ENST00000454925	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9908	0.53173	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF185	151889641	1.000000	0.71417	0.988000	0.46212	0.554000	0.35429	5.764000	0.68826	1.805000	0.52779	0.486000	0.48141	.	-	-		0.493	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	protein_coding	OTTHUMT00000377480.1	A	NM_007150	Intron	151889641	1	no_errors	NM_007150	genbank	human	validated	54_36p	splice_site	SNP	1	G
