#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AKNAD1	254268	genome.wustl.edu	37	1	109391611	109391613	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	AAG	AAG	AAG	-	AAG	AAG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:109391611_109391613delAAG	ENST00000370001.3	-	4	1371_1373	c.1103_1105delCTT	c.(1102-1107)tcttac>tac	p.S368del	AKNAD1_ENST00000369994.1_In_Frame_Del_p.S368del|AKNAD1_ENST00000369995.3_In_Frame_Del_p.S368del|AKNAD1_ENST00000357393.4_In_Frame_Del_p.S75del	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	368						cytoplasm (GO:0005737)		p.S368del(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						TGAAATATGTAAGAAGAACTTGA	0.365																																																1	Deletion - In frame(1)	ovary(1)	1																																								109193136	SO:0001651	inframe_deletion	254268			AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.1103_1105delCTT	1.37:g.109391614_109391616delAAG	ENSP00000359018:p.Ser368del	Somatic		Capture	Illumina GAIIx	4	109193134	B9EK62|Q5T1N0|Q8N990|Q8NCN9	In_Frame_Del	DEL	-	p.S368in_frame_del	ENST00000370001.3	37	c.1105_1103	CCDS791.2	1																																																																																			(deletion:cds_exon[109193057;109193205])	NULL		0.365	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf62	protein_coding	OTTHUMT00000030923.2	AAG	NM_152763		109193136	-1	no_errors	NM_152763	genbank	human	validated	54_36p	in_frame_del	DEL	0.633:0.633:0.697	-
KIAA1324	57535	genome.wustl.edu	37	1	109745807	109745807	+	3'UTR	SNP	T	T	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:109745807T>C	ENST00000369939.3	+	0	3398				KIAA1324_ENST00000369938.1_3'UTR	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324						cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)	p.?(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		CCCTCCTTTCTGCTTGCCTCA	0.433																																																1	Unknown(1)	ovary(1)	1																																								109547330	SO:0001624	3_prime_UTR_variant	57535			AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.*173T>C	1.37:g.109745807T>C		Somatic		Capture	Illumina GAIIx	4	109547330	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Missense_Mutation	SNP	-	p.C925R	ENST00000369939.3	37	c.2773	CCDS794.1	1																																																																																			-	NULL		0.433	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1324	protein_coding	OTTHUMT00000032389.2	T	NM_020775		109547330	1	no_stop_codon	ENST00000369939	ensembl	human	known	54_36p	missense	SNP	0.97	C
PPIAL4G	644591	genome.wustl.edu	37	1	143767441	143767441	+	Silent	SNP	C	C	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:143767441C>T	ENST00000419275.1	-	1	440	c.408G>A	c.(406-408)gtG>gtA	p.V136V		NM_001123068.1	NP_001116540.1	A2BFH1	PAL4G_HUMAN	peptidylprolyl isomerase A (cyclophilin A)-like 4G	136	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	cytoplasm (GO:0005737)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.V136V(1)		breast(1)|endometrium(2)|kidney(1)|lung(8)|ovary(1)|skin(1)	14						CCACAATATTCACACGTTCTT	0.468																																																1	Substitution - coding silent(1)	ovary(1)	1											132.0	109.0	116.0					1																	143767441		1270	3063	4333	142558964	SO:0001819	synonymous_variant	644591				CCDS41375.1, CCDS41375.2	1q21.1	2010-06-03			ENSG00000236334	ENSG00000236334			33996	protein-coding gene	gene with protein product							Standard	NM_001123068		Approved		uc001ejt.3	A2BFH1	OTTHUMG00000013629	ENST00000419275.1:c.408G>A	1.37:g.143767441C>T		Somatic		Capture	Illumina GAIIx	4	142558964	A1L431	Silent	SNP	-	p.V136	ENST00000419275.1	37	c.408	CCDS41375.1	1																																																																																			-	NULL		0.468	PPIAL4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIAL4G	protein_coding	OTTHUMT00000037969.1	C	NM_001123068		142558964	-1	no_errors	ENST00000369380	ensembl	human	known	54_36p	silent	SNP	1	T
ITGA10	8515	genome.wustl.edu	37	1	145535772	145535772	+	Missense_Mutation	SNP	G	G	C	rs201790812	byFrequency	TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:145535772G>C	ENST00000369304.3	+	16	2135	c.1960G>C	c.(1960-1962)Gtg>Ctg	p.V654L	ITGA10_ENST00000538811.1_Missense_Mutation_p.V523L|ITGA10_ENST00000539363.1_Missense_Mutation_p.V511L	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	654					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)	p.V654L(1)		NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ATCACTGGAGGTGACCCCACA	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											121.0	114.0	116.0					1																	145535772		2203	4300	6503	144247129	SO:0001583	missense	8515			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1960G>C	1.37:g.145535772G>C	ENSP00000358310:p.Val654Leu	Somatic		Capture	Illumina GAIIx	4	144247129	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	HMMPfam_Integrin_alpha2;superfamily_vWA-like;superfamily_Integrin domains;superfamily_Integrin alpha N-terminal domain;HMMPfam_VWA;HMMPfam_FG-GAP	p.V654L	ENST00000369304.3	37	c.1960	CCDS918.1	1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.713105	0.48517	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.55413	0.52;0.52;0.52	5.12	3.23	0.37069	Integrin alpha-2 (1);	0.166320	0.41294	D	0.000905	T	0.20414	0.0491	N	0.19112	0.55	0.26339	N	0.977395	B;B;B;B	0.23891	0.037;0.002;0.093;0.026	B;B;B;B	0.32465	0.087;0.007;0.146;0.142	T	0.17806	-1.0357	10	0.72032	D	0.01	.	8.1464	0.31115	0.0833:0.0:0.759:0.1578	.	620;523;511;654	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	L	654;620;511;523	ENSP00000358310:V654L;ENSP00000439894:V511L;ENSP00000440011:V523L	ENSP00000358310:V654L	V	+	1	0	ITGA10	144247129	0.988000	0.35896	0.239000	0.24122	0.928000	0.56348	2.096000	0.41738	0.852000	0.35287	0.655000	0.94253	GTG	-	HMMPfam_Integrin_alpha2		0.577	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	protein_coding	OTTHUMT00000038537.2	G	NM_003637		144247129	1	no_errors	NM_003637	genbank	human	reviewed	54_36p	missense	SNP	0	C
DCAF8	50717	genome.wustl.edu	37	1	160236616	160236616	+	Intron	SNP	G	G	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:160236616G>C	ENST00000556710.1	-	6	687				DCAF8_ENST00000608310.1_Intron			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8						protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						GCCTCTGTGAGAGGCTGATGG	0.527																																																0			1																																								158503240	SO:0001627	intron_variant	388707			AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000556710.1:c.436+11304C>G	1.37:g.160236616G>C		Somatic		Capture	Illumina GAIIx	4	158503240	D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	RNA	SNP	-	NULL	ENST00000556710.1	37	NULL		1																																																																																			-	-		0.527	DCAF8-001	PUTATIVE	basic|appris_principal|readthrough_transcript	protein_coding	LOC388707	protein_coding	OTTHUMT00000415203.1	G	NM_015726		158503240	-1	pseudogene	XR_017679	genbank	human	model	54_36p	rna	SNP	1	C
ASPM	259266	genome.wustl.edu	37	1	197072049	197072049	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:197072049C>T	ENST00000367409.4	-	18	6588	c.6332G>A	c.(6331-6333)aGa>aAa	p.R2111K	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2111	IQ 16. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.R2111K(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TTGAATATGTCTTCTAACTCT	0.328																																																1	Substitution - Missense(1)	ovary(1)	1											111.0	117.0	115.0					1																	197072049		2203	4297	6500	195338672	SO:0001583	missense	259266			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.6332G>A	1.37:g.197072049C>T	ENSP00000356379:p.Arg2111Lys	Somatic		Capture	Illumina GAIIx	4	195338672	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	IQ;HMMPfam_IQ;CH;HMMPfam_CH;Calponin-homology domain CH-domain;superfamily_Calponin-homology domain CH-domain;ARM repeat;superfamily_ARM repeat;P-loop containing nucleoside triphosphate hydrolases;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R2111K	ENST00000367409.4	37	c.6332	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	c	11.51	1.659926	0.29515	.	.	ENSG00000066279	ENST00000367409	T	0.71461	-0.57	5.59	2.72	0.32119	.	0.134493	0.51477	N	0.000099	T	0.65533	0.2700	L	0.49256	1.55	0.09310	N	1	B	0.32526	0.374	B	0.40329	0.326	T	0.54715	-0.8252	10	0.31617	T	0.26	.	8.4244	0.32720	0.0:0.6248:0.0:0.3752	.	2111	Q8IZT6	ASPM_HUMAN	K	2111	ENSP00000356379:R2111K	ENSP00000356379:R2111K	R	-	2	0	ASPM	195338672	0.000000	0.05858	0.191000	0.23289	0.401000	0.30781	0.260000	0.18424	0.317000	0.23160	-0.153000	0.13522	AGA	-	HMMPfam_IQ		0.328	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	protein_coding	OTTHUMT00000088256.1	C	NM_018136		195338672	-1	no_errors	NM_018136	genbank	human	validated	54_36p	missense	SNP	0.47	T
CRB1	23418	genome.wustl.edu	37	1	197297783	197297783	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:197297783G>C	ENST00000367400.3	+	2	437	c.302G>C	c.(301-303)gGg>gCg	p.G101A	CRB1_ENST00000538660.1_Missense_Mutation_p.G101A|CRB1_ENST00000367399.2_Missense_Mutation_p.G101A|CRB1_ENST00000535699.1_Missense_Mutation_p.G32A	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	101	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G101A(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TGTCCTCCTGGGTACAGTGGG	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											92.0	82.0	86.0					1																	197297783		2203	4300	6503	195564406	SO:0001583	missense	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.302G>C	1.37:g.197297783G>C	ENSP00000356370:p.Gly101Ala	Somatic		Capture	Illumina GAIIx	4	195564406	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_EGF/Laminin	p.G101A	ENST00000367400.3	37	c.302	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882507	0.33255	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399	D;D;D;D	0.98207	-4.79;-4.79;-4.79;-4.79	5.43	5.43	0.79202	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.99055	0.9676	M	0.84846	2.72	0.80722	D	1	D;D;B;D;D	0.89917	1.0;1.0;0.082;1.0;1.0	D;D;B;D;D	0.97110	0.999;1.0;0.049;0.999;0.999	D	0.99659	1.0993	9	0.66056	D	0.02	.	19.6052	0.95577	0.0:0.0:1.0:0.0	.	101;32;101;101;126	B7Z5T2;F5H0L2;P82279-3;P82279;Q59H36	.;.;.;CRUM1_HUMAN;.	A	32;101;101;101	ENSP00000438786:G32A;ENSP00000438091:G101A;ENSP00000356370:G101A;ENSP00000356369:G101A	ENSP00000356369:G101A	G	+	2	0	CRB1	195564406	1.000000	0.71417	0.589000	0.28718	0.104000	0.19210	4.927000	0.63440	2.698000	0.92095	0.591000	0.81541	GGG	-	HMMPfam_EGF		0.493	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	protein_coding	OTTHUMT00000086565.2	G	NM_201253		195564406	1	no_errors	NM_201253	genbank	human	reviewed	54_36p	missense	SNP	0.85	C
HHAT	55733	genome.wustl.edu	37	1	210591516	210591516	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:210591516G>A	ENST00000367010.1	+	7	930	c.703G>A	c.(703-705)Gac>Aac	p.D235N	HHAT_ENST00000545154.1_Missense_Mutation_p.D236N|HHAT_ENST00000537898.1_Missense_Mutation_p.D170N|HHAT_ENST00000261458.3_Missense_Mutation_p.D235N|HHAT_ENST00000391905.3_Missense_Mutation_p.D235N|HHAT_ENST00000541565.1_Missense_Mutation_p.D98N|HHAT_ENST00000308852.6_Missense_Mutation_p.D190N|HHAT_ENST00000545781.1_Missense_Mutation_p.D172N|HHAT_ENST00000413764.2_Missense_Mutation_p.D235N	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	235					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)	p.D235N(1)		breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		GCAGGAGCATGACTCCCTGAA	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											141.0	133.0	136.0					1																	210591516		2203	4300	6503	208658139	SO:0001583	missense	55733			AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.703G>A	1.37:g.210591516G>A	ENSP00000355977:p.Asp235Asn	Somatic		Capture	Illumina GAIIx	4	208658139	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	-	p.D235N	ENST00000367010.1	37	c.703	CCDS1495.1	1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443893	0.25987	.	.	ENSG00000054392	ENST00000413764;ENST00000541565;ENST00000545154;ENST00000537898;ENST00000391905;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010;ENST00000426968	T;T;T;T;T;T;T;T;T;T	0.73152	-0.69;-0.72;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69	5.1	-10.2	0.00374	.	1.176120	0.05735	N	0.600299	T	0.28101	0.0693	N	0.01048	-1.04	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.09377	0.003;0.001;0.001;0.001;0.004	T	0.19418	-1.0306	10	0.13470	T	0.59	-0.6034	2.3551	0.04293	0.3453:0.1271:0.3751:0.1525	.	190;236;98;170;235	B7Z2U8;F5H444;B7Z4D5;B7Z5I1;Q5VTY9	.;.;.;.;HHAT_HUMAN	N	235;98;236;170;235;172;235;190;235;107	ENSP00000416845:D235N;ENSP00000444995:D98N;ENSP00000438468:D236N;ENSP00000442625:D170N;ENSP00000375773:D235N;ENSP00000439229:D172N;ENSP00000261458:D235N;ENSP00000308628:D190N;ENSP00000355977:D235N;ENSP00000413399:D107N	ENSP00000261458:D235N	D	+	1	0	HHAT	208658139	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.443000	0.02405	-2.501000	0.00510	0.455000	0.32223	GAC	-	NULL		0.522	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HHAT	protein_coding	OTTHUMT00000088662.1	G	NM_018194		208658139	1	no_errors	NM_018194	genbank	human	validated	54_36p	missense	SNP	0	A
KCNH1	3756	genome.wustl.edu	37	1	210856770	210856770	+	Silent	SNP	G	G	A	rs143091808	byFrequency	TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:210856770G>A	ENST00000271751.4	-	11	2850	c.2823C>T	c.(2821-2823)aaC>aaT	p.N941N	KCNH1_ENST00000367007.4_Silent_p.N914N			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	941	CAD (involved in subunit assembly). {ECO:0000250}.				myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.N941N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TCATTTTGGCGTTTAAGGCCT	0.488													G|||	4	0.000798722	0.003	0.0	5008	,	,		21003	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1						G	,	6,4400	12.9+/-30.5	0,6,2197	95.0	80.0	85.0		2742,2823	-3.7	0.0	1	dbSNP_134	85	10,8590	7.7+/-29.5	0,10,4290	no	coding-synonymous,coding-synonymous	KCNH1	NM_002238.3,NM_172362.2	,	0,16,6487	AA,AG,GG		0.1163,0.1362,0.123	,	914/963,941/990	210856770	16,12990	2203	4300	6503	208923393	SO:0001819	synonymous_variant	3756			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2823C>T	1.37:g.210856770G>A		Somatic		Capture	Illumina GAIIx	4	208923393	B1AQ26|O76035|Q14CL3	Silent	SNP	-	p.N941	ENST00000271751.4	37	c.2823	CCDS1496.1	1																																																																																			-	NULL		0.488	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	protein_coding	OTTHUMT00000088332.1	G	NM_002238		208923393	-1	no_errors	NM_172362	genbank	human	reviewed	54_36p	silent	SNP	0.16	A
MAP10	54627	genome.wustl.edu	37	1	232942303	232942303	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:232942303C>G	ENST00000418460.1	+	1	1661	c.1534C>G	c.(1534-1536)Cca>Gca	p.P512A		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	370					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)	p.P512A(1)									TGTAAATCCTCCACATATTCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											71.0	68.0	69.0					1																	232942303		1911	4135	6046	231008926	SO:0001583	missense	54627			AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.1534C>G	1.37:g.232942303C>G	ENSP00000403208:p.Pro512Ala	Somatic		Capture	Illumina GAIIx	4	231008926	A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Missense_Mutation	SNP	-	p.P512A	ENST00000418460.1	37	c.1534	CCDS44334.1	1	.	.	.	.	.	.	.	.	.	.	C	7.059	0.566070	0.13560	.	.	ENSG00000212916	ENST00000418460	.	.	.	4.69	1.83	0.25207	.	1.515630	0.04332	N	0.352523	T	0.26231	0.0640	L	0.40543	1.245	0.09310	N	0.999999	P	0.41450	0.75	B	0.36766	0.232	T	0.15780	-1.0425	9	0.15499	T	0.54	-7.2159	4.7313	0.12966	0.0:0.6123:0.1937:0.1939	.	370	Q9P2G4	K1383_HUMAN	A	512	.	ENSP00000403208:P512A	P	+	1	0	KIAA1383	231008926	0.000000	0.05858	0.008000	0.14137	0.183000	0.23260	0.182000	0.16900	0.457000	0.26962	0.655000	0.94253	CCA	-	NULL		0.383	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1383	protein_coding	OTTHUMT00000092317.3	C	NM_019090		231008926	1	no_errors	NM_019090	genbank	human	validated	54_36p	missense	SNP	0.01	G
CYP4A11	1579	genome.wustl.edu	37	1	47398661	47398661	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:47398661G>T	ENST00000310638.4	-	10	1312	c.1281C>A	c.(1279-1281)aaC>aaA	p.N427K	CYP4A11_ENST00000462347.1_Missense_Mutation_p.N329K|CYP4A11_ENST00000496519.1_5'Flank|CYP4A11_ENST00000371905.1_Missense_Mutation_p.N427K|CYP4A11_ENST00000371904.4_Missense_Mutation_p.N428K	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	427					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)	p.N427K(1)		endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	ATACCTCTGGGTTGGGCCACA	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											293.0	280.0	284.0					1																	47398661		2203	4300	6503	47171248	SO:0001583	missense	1579			L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.1281C>A	1.37:g.47398661G>T	ENSP00000311095:p.Asn427Lys	Somatic		Capture	Illumina GAIIx	4	47171248	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	HMMPfam_p450;superfamily_Cytochrome P450	p.N427K	ENST00000310638.4	37	c.1281	CCDS543.1	1	.	.	.	.	.	.	.	.	.	.	N	14.16	2.452507	0.43531	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905	T;T;T	0.70282	-0.47;-0.47;-0.47	5.35	2.48	0.30137	.	0.193659	0.53938	N	0.000049	T	0.62344	0.2420	L	0.39147	1.195	0.80722	D	1	B	0.23540	0.087	B	0.33690	0.168	T	0.57625	-0.7779	10	0.59425	D	0.04	.	8.2998	0.32008	0.383:0.0:0.617:0.0	.	427	Q02928	CP4AB_HUMAN	K	427;428;427	ENSP00000311095:N427K;ENSP00000360971:N428K;ENSP00000360972:N427K	ENSP00000311095:N427K	N	-	3	2	CYP4A11	47171248	0.983000	0.35010	0.998000	0.56505	0.970000	0.65996	0.082000	0.14847	0.347000	0.23924	0.650000	0.86243	AAC	-	HMMPfam_p450		0.527	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP4A11	protein_coding	OTTHUMT00000022022.1	G	NM_000778		47171248	-1	no_errors	NM_000778	genbank	human	reviewed	54_36p	missense	SNP	1	T
RYR2	6262	genome.wustl.edu	37	1	237993891	237993891	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr1:237993891A>T	ENST00000366574.2	+	103	15034	c.14717A>T	c.(14716-14718)gAa>gTa	p.E4906V	RYR2_ENST00000542537.1_Missense_Mutation_p.E4890V|RYR2_ENST00000360064.6_Missense_Mutation_p.E4912V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4906					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.E4904V(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CATGGCTTTGAAACCCACACT	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											199.0	187.0	191.0					1																	237993891		1971	4170	6141	236060514	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14717A>T	1.37:g.237993891A>T	ENSP00000355533:p.Glu4906Val	Somatic		Capture	Illumina GAIIx	4	236060514	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	HMMPfam_RYDR_ITPR;HMMPfam_efhand;HMMPfam_RyR;HMMPfam_MIR;HMMPfam_SPRY;HMMPfam_Ion_trans;HMMPfam_RR_TM4-6;HMMPfam_RIH_assoc;HMMPfam_Ins145_P3_rec;superfamily_EF-hand;superfamily_MIR domain (Pfam 02815)	p.E4906V	ENST00000366574.2	37	c.14717	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.887645	0.91814	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97256	-4.31;-4.28;-4.31	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000005	D	0.98692	0.9561	M	0.90870	3.155	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.99780	1.1027	10	0.87932	D	0	-16.5253	15.3997	0.74830	1.0:0.0:0.0:0.0	.	4906	Q92736	RYR2_HUMAN	V	4906;4912;4890	ENSP00000355533:E4906V;ENSP00000353174:E4912V;ENSP00000443798:E4890V	ENSP00000353174:E4912V	E	+	2	0	RYR2	236060514	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.284000	0.95882	2.030000	0.59900	0.459000	0.35465	GAA	-	NULL		0.458	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	A	NM_001035		236060514	1	no_errors	NM_001035	genbank	human	reviewed	54_36p	missense	SNP	1	T
TRIM8	81603	genome.wustl.edu	37	10	104417026	104417026	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr10:104417026G>C	ENST00000302424.7	+	6	1693	c.1571G>C	c.(1570-1572)tGg>tCg	p.W524S		NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	524					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.W524S(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GTCAGAGACTGGCTTGACGCC	0.662																																																1	Substitution - Missense(1)	ovary(1)	10											34.0	33.0	34.0					10																	104417026		2203	4300	6503	104407016	SO:0001583	missense	81603			AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.1571G>C	10.37:g.104417026G>C	ENSP00000302120:p.Trp524Ser	Somatic		Capture	Illumina GAIIx	4	104407016	A6NI31|Q9C028	Missense_Mutation	SNP	-	p.W524S	ENST00000302424.7	37	c.1571	CCDS31274.1	10	.	.	.	.	.	.	.	.	.	.	G	18.63	3.664583	0.67700	.	.	ENSG00000171206	ENST00000302424;ENST00000369896	T	0.79454	-1.27	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.82440	0.5037	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.85027	0.0915	10	0.87932	D	0	.	18.8291	0.92130	0.0:0.0:1.0:0.0	.	524	Q9BZR9	TRIM8_HUMAN	S	524;523	ENSP00000302120:W524S	ENSP00000302120:W524S	W	+	2	0	TRIM8	104407016	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.277000	0.95755	2.456000	0.83038	0.491000	0.48974	TGG	-	NULL		0.662	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM8	protein_coding	OTTHUMT00000050084.3	G	NM_030912		104407016	1	no_errors	NM_030912	genbank	human	validated	54_36p	missense	SNP	1	C
EEF1G	1937	genome.wustl.edu	37	11	62341305	62341305	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr11:62341305C>A	ENST00000329251.4	-	1	140	c.10G>T	c.(10-12)Ggg>Tgg	p.G4W	MIR3654_ENST00000496634.2_3'UTR|EEF1G_ENST00000378019.3_Intron|EEF1G_ENST00000532986.1_Intron	NM_001404.4	NP_001395.1	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1 gamma	4	GST N-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to virus (GO:0009615)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	translation elongation factor activity (GO:0003746)	p.G4W(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AAACTTACCCCAGCCGCCATG	0.627																																																1	Substitution - Missense(1)	ovary(1)	11											30.0	38.0	36.0					11																	62341305		1905	4100	6005	62097881	SO:0001583	missense	1937			X63526	CCDS44626.1	11q12.3	2008-02-05			ENSG00000254772	ENSG00000254772			3213	protein-coding gene	gene with protein product		130593				1598220, 1461723	Standard	NM_001404		Approved	EF1G	uc001ntm.1	P26641	OTTHUMG00000167567	ENST00000329251.4:c.10G>T	11.37:g.62341305C>A	ENSP00000331901:p.Gly4Trp	Somatic		Capture	Illumina GAIIx	4	62097881	B4DTG2|Q6PJ62|Q6PK31|Q96CU2|Q9P196	Missense_Mutation	SNP	-	p.G4W	ENST00000329251.4	37	c.10	CCDS44626.1	11	.	.	.	.	.	.	.	.	.	.	C	24.8	4.575772	0.86645	.	.	ENSG00000254772	ENST00000329251	T	0.07800	3.16	5.02	5.02	0.67125	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	.	.	.	.	T	0.27559	0.0677	M	0.92555	3.32	0.80722	D	1	P	0.36010	0.532	P	0.45538	0.484	T	0.08411	-1.0723	9	0.87932	D	0	.	14.1882	0.65620	0.0:1.0:0.0:0.0	.	4	P26641	EF1G_HUMAN	W	4	ENSP00000331901:G4W	ENSP00000331901:G4W	G	-	1	0	EEF1G	62097881	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.806000	0.55583	2.491000	0.84063	0.563000	0.77884	GGG	-	NULL		0.627	EEF1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1G	protein_coding	OTTHUMT00000395047.1	C	NM_001404		62097881	-1	no_errors	NM_001404	genbank	human	reviewed	54_36p	missense	SNP	1	A
PGM2L1	283209	genome.wustl.edu	37	11	74056676	74056676	+	Silent	SNP	G	G	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr11:74056676G>A	ENST00000298198.4	-	9	1367	c.1056C>T	c.(1054-1056)ttC>ttT	p.F352F		NM_173582.3	NP_775853.2	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	352					glucose metabolic process (GO:0006006)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	glucose-1,6-bisphosphate synthase activity (GO:0047933)|intramolecular transferase activity, phosphotransferases (GO:0016868)	p.F352F(1)		NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(11;3.32e-06)					CATTCCCTGTGAAAACTTTCC	0.368																																																1	Substitution - coding silent(1)	ovary(1)	11											96.0	88.0	91.0					11																	74056676		2200	4293	6493	73734324	SO:0001819	synonymous_variant	283209			AB019210	CCDS8231.1	11q13.3	2008-12-01			ENSG00000165434	ENSG00000165434			20898	protein-coding gene	gene with protein product	"""glucose-1,6-bisphosphate synthase"""	611610				17804405	Standard	NM_173582		Approved	FLJ32029, BM32A	uc001ovb.1	Q6PCE3	OTTHUMG00000168132	ENST00000298198.4:c.1056C>T	11.37:g.74056676G>A		Somatic		Capture	Illumina GAIIx	4	73734324	Q96MQ7|Q9UIK3	Silent	SNP	superfamily_Phosphoglucomutase C-terminal domain;HMMPfam_PGM_PMM_I;HMMPfam_PGM_PMM_II;superfamily_Phosphoglucomutase first 3 domains	p.F352	ENST00000298198.4	37	c.1056	CCDS8231.1	11																																																																																			-	NULL		0.368	PGM2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGM2L1	protein_coding	OTTHUMT00000398324.1	G	NM_173582		73734324	-1	no_errors	NM_173582	genbank	human	validated	54_36p	silent	SNP	1	A
MYO7A	4647	genome.wustl.edu	37	11	76900457	76900457	+	Missense_Mutation	SNP	G	G	T	rs397516301		TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr11:76900457G>T	ENST00000409709.3	+	28	3844	c.3572G>T	c.(3571-3573)gGc>gTc	p.G1191V	MYO7A_ENST00000458637.2_Missense_Mutation_p.G1191V|MYO7A_ENST00000409619.2_Missense_Mutation_p.G1180V	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1191	MyTH4 1. {ECO:0000255|PROSITE- ProRule:PRU00359}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)	p.G1191V(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TATGCCCGGGGCTGGATTCTC	0.617																																																1	Substitution - Missense(1)	ovary(1)	11											82.0	93.0	89.0					11																	76900457		2035	4162	6197	76578105	SO:0001583	missense	4647			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.3572G>T	11.37:g.76900457G>T	ENSP00000386331:p.Gly1191Val	Somatic		Capture	Illumina GAIIx	4	76578105	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	-	p.G1191V	ENST00000409709.3	37	c.3572	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	.	30	5.050997	0.93740	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169	D;D;D;D	0.94828	-3.53;-3.53;-3.53;-3.53	5.43	5.43	0.79202	MyTH4 domain (3);	0.000000	0.85682	D	0.000000	D	0.97942	0.9323	M	0.91561	3.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.98720	1.0708	10	0.87932	D	0	.	19.2615	0.93970	0.0:0.0:1.0:0.0	.	1180;1191;1191	B9A011;F8VUN5;Q13402	.;.;MYO7A_HUMAN	V	1191;1191;1180;402;1190;1160;1067;372	ENSP00000386331:G1191V;ENSP00000392185:G1191V;ENSP00000386635:G1180V;ENSP00000417017:G372V	ENSP00000345075:G1067V	G	+	2	0	MYO7A	76578105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.546000	0.85860	0.643000	0.83706	GGC	-	NULL		0.617	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	protein_coding	OTTHUMT00000328133.1	G	NM_000260		76578105	1	no_errors	NM_000260	genbank	human	reviewed	54_36p	missense	SNP	1	T
TAS2R9	50835	genome.wustl.edu	37	12	10962049	10962049	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr12:10962049G>T	ENST00000240691.2	-	1	718	c.626C>A	c.(625-627)aCc>aAc	p.T209N	TAS2R8_ENST00000240615.2_5'Flank	NM_023917.2	NP_076406.1	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	209					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	taste receptor activity (GO:0008527)	p.T209N(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AATCTGCTTGGTGTGTCTAAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											81.0	82.0	82.0					12																	10962049		2203	4300	6503	10853316	SO:0001583	missense	50835			AF227135	CCDS8633.1	12p13	2012-08-22			ENSG00000121381	ENSG00000121381		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14917	protein-coding gene	gene with protein product		604795				10761934, 10766242	Standard	NM_023917		Approved	T2R9, TRB6	uc001qyx.3	Q9NYW1	OTTHUMG00000168507	ENST00000240691.2:c.626C>A	12.37:g.10962049G>T	ENSP00000240691:p.Thr209Asn	Somatic		Capture	Illumina GAIIx	4	10853316	Q502V7|Q50KT0|Q50KT1|Q645W9	Missense_Mutation	SNP	HMMPfam_TAS2R;superfamily_Family A G protein-coupled receptor-like	p.T209N	ENST00000240691.2	37	c.626	CCDS8633.1	12	.	.	.	.	.	.	.	.	.	.	G	8.850	0.944293	0.18356	.	.	ENSG00000121381	ENST00000240691	T	0.00816	5.66	4.14	2.22	0.28083	GPCR, rhodopsin-like superfamily (1);	0.368719	0.20653	U	0.088162	T	0.02649	0.0080	M	0.71871	2.18	0.09310	N	1	D	0.60575	0.988	D	0.63381	0.914	T	0.43572	-0.9383	10	0.27082	T	0.32	.	3.546	0.07828	0.211:0.0:0.5885:0.2005	.	209	Q9NYW1	TA2R9_HUMAN	N	209	ENSP00000240691:T209N	ENSP00000240691:T209N	T	-	2	0	TAS2R9	10853316	0.000000	0.05858	0.249000	0.24280	0.008000	0.06430	-0.863000	0.04259	0.464000	0.27142	0.650000	0.86243	ACC	-	HMMPfam_TAS2R		0.478	TAS2R9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R9	protein_coding	OTTHUMT00000399933.1	G			10853316	-1	no_errors	NM_023917	genbank	human	reviewed	54_36p	missense	SNP	0.18	T
KCNJ8	3764	genome.wustl.edu	37	12	21919537	21919537	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr12:21919537A>G	ENST00000240662.2	-	3	740	c.395T>C	c.(394-396)cTc>cCc	p.L132P	RP11-59N23.1_ENST00000542489.1_RNA	NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	132					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)	p.L132P(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	AATGGAGAAGAGAAAAGCAGA	0.403																																																1	Substitution - Missense(1)	ovary(1)	12											58.0	54.0	55.0					12																	21919537		2203	4300	6503	21810804	SO:0001583	missense	3764			BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.395T>C	12.37:g.21919537A>G	ENSP00000240662:p.Leu132Pro	Somatic		Capture	Illumina GAIIx	4	21810804	O00657	Missense_Mutation	SNP	-	p.L132P	ENST00000240662.2	37	c.395	CCDS8692.1	12	.	.	.	.	.	.	.	.	.	.	A	20.5	3.998003	0.74818	.	.	ENSG00000121361	ENST00000240662;ENST00000539350	D	0.96232	-3.95	5.11	5.11	0.69529	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.059206	0.64402	D	0.000002	D	0.98620	0.9538	H	0.95816	3.725	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	D	0.99755	1.1019	10	0.87932	D	0	.	15.0766	0.72082	1.0:0.0:0.0:0.0	.	132	Q15842	IRK8_HUMAN	P	132	ENSP00000240662:L132P	ENSP00000240662:L132P	L	-	2	0	KCNJ8	21810804	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.123000	0.94387	2.154000	0.67381	0.460000	0.39030	CTC	-	NULL		0.403	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ8	protein_coding	OTTHUMT00000402226.1	A	NM_004982		21810804	-1	no_errors	NM_004982	genbank	human	reviewed	54_36p	missense	SNP	1	G
C12orf42	374470	genome.wustl.edu	37	12	103696127	103696127	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr12:103696127G>A	ENST00000378113.2	-	6	1067	c.842C>T	c.(841-843)gCg>gTg	p.A281V	C12orf42_ENST00000548048.1_Missense_Mutation_p.A214V|C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548883.1_Missense_Mutation_p.A281V	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	281								p.A281V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						CATCTCCGGCGCCATGGCAAC	0.662																																																1	Substitution - Missense(1)	ovary(1)	12											43.0	50.0	47.0					12																	103696127		2009	4204	6213	102220257	SO:0001583	missense	374470			AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.842C>T	12.37:g.103696127G>A	ENSP00000367353:p.Ala281Val	Somatic		Capture	Illumina GAIIx	4	102220257	Q49A64|Q4G0S2	Missense_Mutation	SNP	-	p.A281V	ENST00000378113.2	37	c.842	CCDS44963.1	12	.	.	.	.	.	.	.	.	.	.	G	20.6	4.022696	0.75275	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113	T;T;T	0.59224	0.28;0.28;0.28	5.14	4.04	0.47022	.	0.197895	0.25138	N	0.032859	T	0.60547	0.2277	L	0.29908	0.895	0.23585	N	0.997357	D	0.89917	1.0	P	0.62382	0.901	T	0.52734	-0.8536	10	0.52906	T	0.07	-5.4457	12.394	0.55374	0.1429:0.0:0.8571:0.0	.	281	Q96LP6	CL042_HUMAN	V	281;214;281	ENSP00000447908:A281V;ENSP00000449362:A214V;ENSP00000367353:A281V	ENSP00000367353:A281V	A	-	2	0	C12orf42	102220257	0.999000	0.42202	0.689000	0.30133	0.775000	0.43874	1.834000	0.39171	2.378000	0.81104	0.561000	0.74099	GCG	-	NULL		0.662	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf42	protein_coding	OTTHUMT00000406754.1	G	NM_198521		102220257	-1	no_errors	NM_001099336	genbank	human	validated	54_36p	missense	SNP	0.94	A
LRCH1	23143	genome.wustl.edu	37	13	47260084	47260084	+	Missense_Mutation	SNP	A	A	G	rs371417993		TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr13:47260084A>G	ENST00000389798.3	+	5	927	c.730A>G	c.(730-732)Aaa>Gaa	p.K244E	LRCH1_ENST00000389797.3_Missense_Mutation_p.K244E|LRCH1_ENST00000311191.6_Missense_Mutation_p.K244E	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	244								p.K244E(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		TTCCTGCAACAAAGTGCTCGT	0.363																																																1	Substitution - Missense(1)	ovary(1)	13						A	GLU/LYS,GLU/LYS,GLU/LYS	1,4405	2.1+/-5.4	0,1,2202	59.0	55.0	56.0		730,730,730	5.9	1.0	13		56	0,8600		0,0,4300	no	missense,missense,missense	LRCH1	NM_001164211.1,NM_001164213.1,NM_015116.2	56,56,56	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	244/764,244/697,244/729	47260084	1,13005	2203	4300	6503	46158085	SO:0001583	missense	23143			AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.730A>G	13.37:g.47260084A>G	ENSP00000374448:p.Lys244Glu	Somatic		Capture	Illumina GAIIx	4	46158085	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	-	p.K244E	ENST00000389798.3	37	c.730	CCDS31972.1	13	.	.	.	.	.	.	.	.	.	.	A	28.8	4.951047	0.92660	2.27E-4	0.0	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797	T;T;T	0.19105	2.17;2.17;2.17	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.45716	0.1356	M	0.68728	2.09	0.80722	D	1	D;D;D;P	0.89917	0.999;1.0;0.999;0.737	D;D;D;P	0.91635	0.993;0.999;0.997;0.545	T	0.32134	-0.9918	10	0.48119	T	0.1	-9.3079	15.5755	0.76380	1.0:0.0:0.0:0.0	.	244;244;244;244	Q17R43;Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;.;LRCH1_HUMAN	E	244	ENSP00000308493:K244E;ENSP00000374448:K244E;ENSP00000374447:K244E	ENSP00000308493:K244E	K	+	1	0	LRCH1	46158085	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.706000	0.91362	2.281000	0.76405	0.533000	0.62120	AAA	-	NULL		0.363	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRCH1	protein_coding	OTTHUMT00000044824.2	A	NM_015116		46158085	1	no_errors	NM_015116	genbank	human	provisional	54_36p	missense	SNP	1	G
RB1	5925	genome.wustl.edu	37	13	48955540	48955555	+	Frame_Shift_Del	DEL	ATGTGAACATCGAATC	ATGTGAACATCGAATC	-	rs121913304		TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	ATGTGAACATCGAATC	ATGTGAACATCGAATC	ATGTGAACATCGAATC	-	ATGTGAACATCGAATC	ATGTGAACATCGAATC	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr13:48955540_48955555delATGTGAACATCGAATC	ENST00000267163.4	+	17	1794_1809	c.1656_1671delATGTGAACATCGAATC	c.(1654-1671)cgatgtgaacatcgaatcfs	p.RCEHRI552fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	552	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.R556*(5)|p.C553fs*53(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ATTTAGAACGATGTGAACATCGAATCATGGAATCCC	0.329		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	29	Whole gene deletion(15)|Unknown(8)|Substitution - Nonsense(5)|Deletion - Frameshift(1)	bone(11)|breast(5)|eye(4)|central_nervous_system(4)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|ovary(1)	13	GRCh37	CD075538|CM942039|CM961230|CM961231	RB1	D|M	rs121913304																																			47853556	SO:0001589	frameshift_variant	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1656_1671delATGTGAACATCGAATC	13.37:g.48955540_48955555delATGTGAACATCGAATC	ENSP00000267163:p.Arg552fs	Somatic		Capture	Illumina GAIIx	4	47853541	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	RB_B;HMMPfam_RB_B;RB_A;HMMPfam_RB_A;Rb_C;HMMPfam_Rb_C	p.C553fs	ENST00000267163.4	37	c.1656_1671	CCDS31973.1	13																																																																																			(deletion:cds_exon[47853384;47853580])	HMMPfam_RB_A		0.329	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	ATGTGAACATCGAATC			47853556	1	no_errors	NM_000321	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:1.000	-
DNAH3	55567	genome.wustl.edu	37	16	20974702	20974702	+	Nonsense_Mutation	SNP	C	C	A	rs200676672		TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr16:20974702C>A	ENST00000261383.3	-	53	10503	c.10504G>T	c.(10504-10506)Gaa>Taa	p.E3502*	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3502	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.E3502*(1)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GTAGGGGCTTCGATATACAGC	0.498																																																1	Substitution - Nonsense(1)	ovary(1)	16											108.0	99.0	102.0					16																	20974702		2201	4300	6501	20882203	SO:0001587	stop_gained	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10504G>T	16.37:g.20974702C>A	ENSP00000261383:p.Glu3502*	Somatic		Capture	Illumina GAIIx	4	20882203	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Nonsense_Mutation	SNP	-	p.E3502*	ENST00000261383.3	37	c.10504	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	50	17.135547	0.99880	.	.	ENSG00000158486	ENST00000261383	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.3211	0.94240	0.0:1.0:0.0:0.0	.	.	.	.	X	3502	.	ENSP00000261383:E3502X	E	-	1	0	DNAH3	20882203	0.998000	0.40836	0.918000	0.36340	0.318000	0.28184	3.978000	0.56881	2.565000	0.86533	0.655000	0.94253	GAA	-	NULL		0.498	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	protein_coding	OTTHUMT00000207361.1	C	NM_017539		20882203	-1	no_errors	NM_017539	genbank	human	provisional	54_36p	nonsense	SNP	1	A
ADCY9	115	genome.wustl.edu	37	16	4015908	4015908	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr16:4015908T>A	ENST00000294016.3	-	11	4468	c.3930A>T	c.(3928-3930)agA>agT	p.R1310S		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	1310					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.R1310S(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CCTTCCACGGTCTCTTGGGGG	0.537																																																1	Substitution - Missense(1)	ovary(1)	16											101.0	98.0	99.0					16																	4015908		2197	4300	6497	3955909	SO:0001583	missense	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.3930A>T	16.37:g.4015908T>A	ENSP00000294016:p.Arg1310Ser	Somatic		Capture	Illumina GAIIx	4	3955909	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	HMMPfam_Guanylate_cyc;superfamily_p53-like transcription factors;superfamily_Adenylyl and guanylyl cyclase catalytic domain	p.R1310S	ENST00000294016.3	37	c.3930	CCDS32382.1	16	.	.	.	.	.	.	.	.	.	.	T	11.07	1.530460	0.27387	.	.	ENSG00000162104	ENST00000294016	D	0.83250	-1.7	5.66	-2.56	0.06268	.	0.250430	0.41500	D	0.000869	T	0.68796	0.3040	N	0.24115	0.695	0.23293	N	0.997964	B	0.17465	0.022	B	0.11329	0.006	T	0.59139	-0.7510	10	0.54805	T	0.06	.	12.2958	0.54844	0.0:0.7194:0.1284:0.1522	.	1310	O60503	ADCY9_HUMAN	S	1310	ENSP00000294016:R1310S	ENSP00000294016:R1310S	R	-	3	2	ADCY9	3955909	0.783000	0.28701	0.980000	0.43619	0.348000	0.29142	-0.199000	0.09491	-0.300000	0.08895	0.528000	0.53228	AGA	-	NULL		0.537	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	protein_coding	OTTHUMT00000438076.1	T			3955909	-1	no_errors	NM_001116	genbank	human	reviewed	54_36p	missense	SNP	0.07	A
SCNN1B	6338	genome.wustl.edu	37	16	23388515	23388515	+	Missense_Mutation	SNP	G	G	A	rs201330438		TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr16:23388515G>A	ENST00000343070.2	+	9	1476	c.1300G>A	c.(1300-1302)Gtg>Atg	p.V434M	SCNN1B_ENST00000568923.1_Missense_Mutation_p.V407M|SCNN1B_ENST00000307331.5_Missense_Mutation_p.V479M|SCNN1B_ENST00000568085.1_Missense_Mutation_p.V398M	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	434			V -> M. {ECO:0000269|PubMed:9674649}.		excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)	p.V434M(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	ACAGATGAGCGTGGCGCAGAG	0.607													g|||	1	0.000199681	0.0	0.0	5008	,	,		18330	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	16						G	MET/VAL	1,4393	2.1+/-5.4	0,1,2196	58.0	53.0	55.0		1300	-7.6	0.0	16		55	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SCNN1B	NM_000336.2	21	0,2,6495	AA,AG,GG		0.0116,0.0228,0.0154	benign	434/641	23388515	2,12992	2197	4300	6497	23296016	SO:0001583	missense	6338			X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.1300G>A	16.37:g.23388515G>A	ENSP00000345751:p.Val434Met	Somatic		Capture	Illumina GAIIx	4	23296016	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	HMMPfam_ASC	p.V434M	ENST00000343070.2	37	c.1300	CCDS10609.1	16	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	12.78	2.041362	0.35989	2.28E-4	1.16E-4	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.63913	-0.07;-0.07	4.73	-7.6	0.01303	.	1.463560	0.04347	N	0.355023	T	0.48978	0.1530	L	0.48362	1.52	0.09310	N	1	B	0.28584	0.216	B	0.28709	0.093	T	0.50030	-0.8875	10	0.62326	D	0.03	-15.2947	5.6158	0.17430	0.1796:0.5018:0.222:0.0966	.	434	P51168	SCNNB_HUMAN	M	434;479	ENSP00000345751:V434M;ENSP00000302874:V479M	ENSP00000302874:V479M	V	+	1	0	SCNN1B	23296016	0.000000	0.05858	0.000000	0.03702	0.220000	0.24768	-0.344000	0.07780	-0.982000	0.03515	-0.498000	0.04607	GTG	-	HMMPfam_ASC		0.607	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCNN1B	protein_coding	OTTHUMT00000254495.2	G			23296016	1	no_errors	NM_000336	genbank	human	validated	54_36p	missense	SNP	0	A
RPGRIP1L	23322	genome.wustl.edu	37	16	53692358	53692358	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr16:53692358C>G	ENST00000379925.3	-	12	1419	c.1369G>C	c.(1369-1371)Gat>Cat	p.D457H	RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.D457H|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.D457H|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.D457H	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	457					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)	p.D457H(1)		endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CTCAATTCATCAGCATTAATA	0.343																																																1	Substitution - Missense(1)	ovary(1)	16											100.0	93.0	95.0					16																	53692358		2197	4299	6496	52249859	SO:0001583	missense	23322				CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.1369G>C	16.37:g.53692358C>G	ENSP00000369257:p.Asp457His	Somatic		Capture	Illumina GAIIx	4	52249859	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	-	p.D457H	ENST00000379925.3	37	c.1369	CCDS32447.1	16	.	.	.	.	.	.	.	.	.	.	C	13.47	2.247205	0.39697	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;D	0.90324	-0.18;-2.65	5.71	3.52	0.40303	.	0.326939	0.35708	N	0.003037	D	0.82600	0.5072	N	0.08118	0	0.80722	D	1	B;B;B;P	0.44380	0.016;0.009;0.016;0.834	B;B;B;P	0.47102	0.014;0.014;0.014;0.537	T	0.81382	-0.0958	10	0.36615	T	0.2	-11.9901	10.5827	0.45265	0.1375:0.7828:0.0:0.0797	.	457;457;457;457	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	H	457	ENSP00000369257:D457H;ENSP00000262135:D457H	ENSP00000262135:D457H	D	-	1	0	RPGRIP1L	52249859	0.999000	0.42202	1.000000	0.80357	0.844000	0.47949	1.746000	0.38288	2.691000	0.91804	0.650000	0.86243	GAT	-	NULL		0.343	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	RPGRIP1L	protein_coding	OTTHUMT00000422187.1	C	NM_015272		52249859	-1	no_errors	NM_015272	genbank	human	reviewed	54_36p	missense	SNP	1	G
IRX3	79191	genome.wustl.edu	37	16	54319105	54319105	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr16:54319105C>G	ENST00000329734.3	-	2	1400	c.688G>C	c.(688-690)Gag>Cag	p.E230Q		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	230	Asp/Glu-rich (acidic).|Poly-Glu.				mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.E230Q(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						agctcctcctcctccAGCTCT	0.657																																					GBM(143;1830 1866 4487 4646 37383)											1	Substitution - Missense(1)	ovary(1)	16											54.0	34.0	41.0					16																	54319105		2197	4297	6494	52876606	SO:0001583	missense	79191			U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.688G>C	16.37:g.54319105C>G	ENSP00000331608:p.Glu230Gln	Somatic		Capture	Illumina GAIIx	4	52876606	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	HMMPfam_Homeobox;superfamily_Homeodomain-like	p.E230Q	ENST00000329734.3	37	c.688	CCDS10750.1	16	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767050	0.31320	.	.	ENSG00000177508	ENST00000329734	T	0.53423	0.62	4.31	4.31	0.51392	.	0.130459	0.49305	D	0.000146	T	0.52191	0.1719	L	0.36672	1.1	0.28338	N	0.921476	D	0.63880	0.993	D	0.70227	0.968	T	0.41448	-0.9508	10	0.33141	T	0.24	-11.7002	8.0142	0.30372	0.0:0.8902:0.0:0.1098	.	230	P78415	IRX3_HUMAN	Q	230	ENSP00000331608:E230Q	ENSP00000331608:E230Q	E	-	1	0	IRX3	52876606	0.980000	0.34600	1.000000	0.80357	0.207000	0.24258	2.417000	0.44653	2.225000	0.72522	0.462000	0.41574	GAG	-	NULL		0.657	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX3	protein_coding	OTTHUMT00000256910.2	C			52876606	-1	no_errors	NM_024336	genbank	human	provisional	54_36p	missense	SNP	1	G
SPECC1	92521	genome.wustl.edu	37	17	20107754	20107754	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr17:20107754C>T	ENST00000261503.5	+	4	443	c.392C>T	c.(391-393)tCa>tTa	p.S131L	SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395530.2_Missense_Mutation_p.S50L|SPECC1_ENST00000395522.2_Missense_Mutation_p.S50L|SPECC1_ENST00000395529.3_Missense_Mutation_p.S131L|SPECC1_ENST00000395527.4_Missense_Mutation_p.S131L|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000395525.3_Missense_Mutation_p.S50L|AC004702.2_ENST00000580225.1_lincRNA	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	131					cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.S131L(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		CCCAGGAAATCAGTGTCCAGT	0.517																																																1	Substitution - Missense(1)	ovary(1)	17											177.0	179.0	179.0					17																	20107754		2203	4300	6503	20048346	SO:0001583	missense	92521			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.392C>T	17.37:g.20107754C>T	ENSP00000261503:p.Ser131Leu	Somatic		Capture	Illumina GAIIx	4	20048346	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	HMMPfam_CH;superfamily_Spectrin repeat;superfamily_Calponin-homology domain CH-domain	p.S131L	ENST00000261503.5	37	c.392	CCDS32590.1	17	.	.	.	.	.	.	.	.	.	.	C	2.259	-0.369772	0.05069	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.64085	-0.08;2.9;2.93;2.93	4.73	0.335	0.15953	.	0.680494	0.15413	N	0.263650	T	0.36413	0.0966	N	0.21448	0.665	0.09310	N	1	B;B;B;B	0.11235	0.004;0.004;0.004;0.001	B;B;B;B	0.13407	0.009;0.009;0.009;0.003	T	0.27191	-1.0081	10	0.02654	T	1	-0.011	5.3885	0.16231	0.0:0.5802:0.1482:0.2716	.	50;50;131;131	Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;CYTSB_HUMAN	L	131;131;131;50;50;50	ENSP00000261503:S131L;ENSP00000378900:S131L;ENSP00000378893:S50L;ENSP00000378896:S50L	ENSP00000261503:S131L	S	+	2	0	SPECC1	20048346	0.006000	0.16342	0.000000	0.03702	0.650000	0.38633	1.783000	0.38664	0.012000	0.14892	0.591000	0.81541	TCA	-	NULL		0.517	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTSB	protein_coding	OTTHUMT00000441206.1	C	NM_152904		20048346	1	no_errors	NM_001033553	genbank	human	validated	54_36p	missense	SNP	0.02	T
NF1	4763	genome.wustl.edu	37	17	29486075	29486093	+	Frame_Shift_Del	DEL	GATTATATTGGATACACTG	GATTATATTGGATACACTG	-			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	GATTATATTGGATACACTG	GATTATATTGGATACACTG	GATTATATTGGATACACTG	-	GATTATATTGGATACACTG	GATTATATTGGATACACTG	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr17:29486075_29486093delGATTATATTGGATACACTG	ENST00000358273.4	+	3	635_653	c.252_270delGATTATATTGGATACACTG	c.(250-270)ttgattatattggatacactgfs	p.LIILDTL84fs	NF1_ENST00000431387.4_Frame_Shift_Del_p.LIILDTL84fs|NF1_ENST00000356175.3_Frame_Shift_Del_p.LIILDTL84fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	84					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.I85fs*12(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTC	0.338			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(4)|Deletion - Frameshift(1)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)|ovary(1)	17	GRCh37	CD020576|CM073225	NF1	D|M																																				26510219	SO:0001589	frameshift_variant	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.252_270delGATTATATTGGATACACTG	17.37:g.29486075_29486093delGATTATATTGGATACACTG	ENSP00000351015:p.Leu84fs	Somatic		Capture	Illumina GAIIx	4	26510201	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	-	p.I85fs	ENST00000358273.4	37	c.252_270	CCDS42292.1	17																																																																																			(deletion:cds_exon[26510154;26510237])	NULL		0.338	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	GATTATATTGGATACACTG	NM_000267		26510219	1	no_errors	NM_001042492	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:0.998:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
P2RX1	5023	genome.wustl.edu	37	17	3801133	3801133	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr17:3801133A>C	ENST00000225538.3	-	12	1449	c.1175T>G	c.(1174-1176)cTg>cGg	p.L392R		NM_002558.2	NP_002549.1	P51575	P2RX1_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 1	392					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ceramide biosynthetic process (GO:0046513)|insemination (GO:0007320)|ion transport (GO:0006811)|neuronal action potential (GO:0019228)|platelet activation (GO:0030168)|positive regulation of ion transport (GO:0043270)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of vascular smooth muscle contraction (GO:0003056)|response to ATP (GO:0033198)|serotonin secretion by platelet (GO:0002554)|signal transduction (GO:0007165)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|vasoconstriction (GO:0042310)	external side of cell outer membrane (GO:0031240)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)	p.L392R(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	13				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		GTTCTCCTGCAGGCCCAGGGT	0.642																																																1	Substitution - Missense(1)	ovary(1)	17											88.0	78.0	81.0					17																	3801133		2203	4300	6503	3747882	SO:0001583	missense	5023			X83688	CCDS11040.1	17p13.3	2012-01-17				ENSG00000108405		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8533	protein-coding gene	gene with protein product		600845				8834001	Standard	NM_002558		Approved	P2X1	uc002fww.3	P51575		ENST00000225538.3:c.1175T>G	17.37:g.3801133A>C	ENSP00000225538:p.Leu392Arg	Somatic		Capture	Illumina GAIIx	4	3747882	Q9UK84	Missense_Mutation	SNP	-	p.L392R	ENST00000225538.3	37	c.1175	CCDS11040.1	17	.	.	.	.	.	.	.	.	.	.	A	15.71	2.912580	0.52439	.	.	ENSG00000108405	ENST00000225538	T	0.05139	3.49	4.08	4.08	0.47627	.	0.120788	0.33401	N	0.004942	T	0.13030	0.0316	L	0.36672	1.1	0.36655	D	0.877605	D	0.69078	0.997	D	0.63488	0.915	T	0.04347	-1.0958	10	0.66056	D	0.02	-24.5607	9.739	0.40406	1.0:0.0:0.0:0.0	.	392	P51575	P2RX1_HUMAN	R	392	ENSP00000225538:L392R	ENSP00000225538:L392R	L	-	2	0	P2RX1	3747882	1.000000	0.71417	1.000000	0.80357	0.341000	0.28922	4.254000	0.58798	2.076000	0.62316	0.397000	0.26171	CTG	-	NULL		0.642	P2RX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX1	protein_coding	OTTHUMT00000438391.1	A	NM_002558		3747882	-1	no_errors	NM_002558	genbank	human	reviewed	54_36p	missense	SNP	1	C
ACACA	31	genome.wustl.edu	37	17	35454849	35454849	+	Silent	SNP	T	T	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr17:35454849T>C	ENST00000394406.2	-	53	6715	c.6525A>G	c.(6523-6525)ctA>ctG	p.L2175L	ACACA_ENST00000361253.5_Silent_p.L301L|ACACA_ENST00000335166.5_Silent_p.L2097L|ACACA_ENST00000360679.3_Silent_p.L2117L|ACACA_ENST00000353139.5_Silent_p.L2212L	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	2175	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.L2117L(1)		NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AAATGGGAATTAGGAATTCCT	0.507																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)											1	Substitution - coding silent(1)	ovary(1)	17											168.0	147.0	154.0					17																	35454849		2203	4300	6503	32528962	SO:0001819	synonymous_variant	31			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.6525A>G	17.37:g.35454849T>C		Somatic		Capture	Illumina GAIIx	4	32528962	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Silent	SNP	HMMPfam_Carboxyl_trans;HMMPfam_Biotin_lipoyl;HMMPfam_CPSase_L_D2;HMMPfam_CPSase_L_chain;HMMPfam_Biotin_carb_C;superfamily_Single hybrid motif;superfamily_Rudiment single hybrid motif;HMMPfam_ACC_central;superfamily_ClpP/crotonase;superfamily_PreATP-grasp domain;superfamily_Glutathione synthetase ATP-binding domain-like	p.L2212	ENST00000394406.2	37	c.6636	CCDS11317.1	17																																																																																			-	HMMPfam_Carboxyl_trans		0.507	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	protein_coding	OTTHUMT00000256696.1	T	NM_198836		32528962	-1	no_errors	NM_198834	genbank	human	reviewed	54_36p	silent	SNP	0.92	C
EPX	8288	genome.wustl.edu	37	17	56280666	56280666	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr17:56280666C>T	ENST00000225371.5	+	11	2043	c.1933C>T	c.(1933-1935)Cga>Tga	p.R645*		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	645				RDGDRFWWQKRGVFTK -> ETETGSGGRTRCFHQ (in Ref. 3; AA sequence). {ECO:0000305}.	defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.R645*(1)|p.R645R(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	CAGAAGAGCCCGAGACGGAGA	0.507																																																2	Substitution - Nonsense(1)|Substitution - coding silent(1)	ovary(1)|endometrium(1)	17											45.0	49.0	48.0					17																	56280666		2203	4300	6503	53635665	SO:0001587	stop_gained	8288			M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.1933C>T	17.37:g.56280666C>T	ENSP00000225371:p.Arg645*	Somatic		Capture	Illumina GAIIx	4	53635665	Q4TVP3	Nonsense_Mutation	SNP	HMMPfam_An_peroxidase;superfamily_Heme-dependent peroxidases	p.R645*	ENST00000225371.5	37	c.1933	CCDS11602.1	17	.	.	.	.	.	.	.	.	.	.	C	38	6.773164	0.97829	.	.	ENSG00000121053	ENST00000225371	.	.	.	5.7	2.25	0.28309	.	0.162323	0.53938	D	0.000047	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.2542	9.5962	0.39576	0.2611:0.6626:0.0:0.0762	.	.	.	.	X	645	.	ENSP00000225371:R645X	R	+	1	2	EPX	53635665	0.773000	0.28580	0.494000	0.27515	0.976000	0.68499	1.577000	0.36515	0.737000	0.32582	0.655000	0.94253	CGA	-	HMMPfam_An_peroxidase		0.507	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPX	protein_coding	OTTHUMT00000443367.1	C	NM_000502		53635665	1	no_errors	NM_000502	genbank	human	validated	54_36p	nonsense	SNP	0.76	T
TP53	7157	genome.wustl.edu	37	17	7577117	7577117	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr17:7577117A>T	ENST00000269305.4	-	8	1010	c.821T>A	c.(820-822)gTt>gAt	p.V274D	TP53_ENST00000359597.4_Missense_Mutation_p.V274D|TP53_ENST00000455263.2_Missense_Mutation_p.V274D|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.V274D|TP53_ENST00000445888.2_Missense_Mutation_p.V274D|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	274	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V274A(19)|p.V274D(9)|p.V274G(8)|p.0?(8)|p.?(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V274_P278del(1)|p.F270_D281del12(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACAGGCACAAACACGCACCTC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	52	Substitution - Missense(36)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(2)|Deletion - Frameshift(1)	breast(8)|upper_aerodigestive_tract(6)|liver(6)|haematopoietic_and_lymphoid_tissue(5)|lung(4)|ovary(4)|bone(4)|large_intestine(3)|central_nervous_system(2)|urinary_tract(2)|prostate(2)|stomach(1)|soft_tissue(1)|endometrium(1)|skin(1)|oesophagus(1)|pancreas(1)	17											70.0	60.0	64.0					17																	7577117		2203	4300	6503	7517842	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.821T>A	17.37:g.7577117A>T	ENSP00000269305:p.Val274Asp	Somatic		Capture	Illumina GAIIx	4	7517842	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.V274D	ENST00000269305.4	37	c.821	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	23.2	4.391827	0.83011	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99836	-7.05;-7.05;-7.05;-7.05;-7.05;-7.05	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.312804	0.33382	N	0.004980	D	0.99802	0.9915	M	0.87456	2.885	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.87578	0.997;0.992;0.998;0.996	D	0.96852	0.9626	10	0.87932	D	0	-10.2267	12.5624	0.56288	1.0:0.0:0.0:0.0	.	274;274;274;274	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	D	274;274;274;274;274;263;142	ENSP00000352610:V274D;ENSP00000269305:V274D;ENSP00000398846:V274D;ENSP00000391127:V274D;ENSP00000391478:V274D;ENSP00000425104:V142D	ENSP00000269305:V274D	V	-	2	0	TP53	7517842	0.970000	0.33590	0.681000	0.30009	0.775000	0.43874	9.060000	0.93907	2.067000	0.61834	0.379000	0.24179	GTT	-	HMMPfam_P53		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546		7517842	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
DDX5	1655	genome.wustl.edu	37	17	62496288	62496288	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr17:62496288C>G	ENST00000225792.5	-	13	1999	c.1598G>C	c.(1597-1599)gGt>gCt	p.G533A	DDX5_ENST00000580026.1_5'UTR|MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000578804.1_Missense_Mutation_p.G533A|MIR3064_ENST00000581130.1_RNA|DDX5_ENST00000450599.2_Missense_Mutation_p.G454A	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	533	Transactivation domain.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)	p.G533A(1)		breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			ACTGTAAACACCATTCTGAGT	0.413			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	1	Substitution - Missense(1)	ovary(1)	17											139.0	143.0	142.0					17																	62496288		2203	4300	6503	59926750	SO:0001583	missense	1655			AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1598G>C	17.37:g.62496288C>G	ENSP00000225792:p.Gly533Ala	Somatic		Capture	Illumina GAIIx	4	59926750	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	HMMPfam_Helicase_C;HMMPfam_DEAD;HMMPfam_P68HR;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.G533A	ENST00000225792.5	37	c.1598	CCDS11659.1	17	.	.	.	.	.	.	.	.	.	.	C	10.81	1.454269	0.26161	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.86	5.86	0.93980	.	0.262657	0.45126	D	0.000386	T	0.52141	0.1716	L	0.27053	0.805	0.80722	D	1	B;B;B	0.19583	0.037;0.037;0.037	B;B;B	0.14023	0.01;0.004;0.004	T	0.41610	-0.9499	9	0.22109	T	0.4	-6.9894	20.2509	0.98409	0.0:1.0:0.0:0.0	.	454;533;533	B4DLW8;B5BUE6;P17844	.;.;DDX5_HUMAN	A	533;463;522	.	ENSP00000225792:G522A	G	-	2	0	DDX5	59926750	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.486000	0.66856	2.788000	0.95919	0.586000	0.80456	GGT	-	NULL		0.413	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	protein_coding	OTTHUMT00000444030.1	C	NM_004396		59926750	-1	no_errors	NM_004396	genbank	human	validated	54_36p	missense	SNP	1	G
COL5A3	50509	genome.wustl.edu	37	19	10071135	10071135	+	Silent	SNP	C	C	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr19:10071135C>T	ENST00000264828.3	-	67	5275	c.5190G>A	c.(5188-5190)acG>acA	p.T1730T		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1730	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.T1730T(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			ACTTTTGGTTCGTCTGGCCAA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	19											64.0	69.0	67.0					19																	10071135		2203	4300	6503	9932135	SO:0001819	synonymous_variant	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.5190G>A	19.37:g.10071135C>T		Somatic		Capture	Illumina GAIIx	4	9932135	Q9NZQ6	Silent	SNP	HMMPfam_COLFI;HMMPfam_Collagen;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_Fibrinogen C-terminal domain-like	p.T1730	ENST00000264828.3	37	c.5190	CCDS12222.1	19																																																																																			-	HMMPfam_COLFI		0.577	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	protein_coding	OTTHUMT00000315788.1	C	NM_015719		9932135	-1	no_errors	NM_015719	genbank	human	reviewed	54_36p	silent	SNP	0.13	T
ZNF606	80095	genome.wustl.edu	37	19	58489968	58489968	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr19:58489968G>A	ENST00000341164.4	-	7	2700	c.2080C>T	c.(2080-2082)Cac>Tac	p.H694Y	ZNF606_ENST00000536132.1_Missense_Mutation_p.H604Y	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	694					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H694N(2)|p.H694Y(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		GCAATGAGGTGAGAACTACAG	0.418																																																3	Substitution - Missense(3)	NS(2)|ovary(1)	19											96.0	95.0	95.0					19																	58489968		2203	4300	6503	63181780	SO:0001583	missense	80095			AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.2080C>T	19.37:g.58489968G>A	ENSP00000343617:p.His694Tyr	Somatic		Capture	Illumina GAIIx	4	63181780	A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers;HMMPfam_KRAB	p.H694Y	ENST00000341164.4	37	c.2080	CCDS12968.1	19	.	.	.	.	.	.	.	.	.	.	G	0.619	-0.821997	0.02755	.	.	ENSG00000166704	ENST00000341164;ENST00000536132	T;T	0.13089	2.62;2.62	4.43	3.3	0.37823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000220	T	0.10594	0.0259	N	0.03177	-0.4	0.26869	N	0.967791	D	0.64830	0.994	P	0.55545	0.778	T	0.28870	-1.0030	10	0.20519	T	0.43	.	13.2335	0.59957	0.0:0.0:0.8405:0.1595	.	694	Q8WXB4	ZN606_HUMAN	Y	694;604	ENSP00000343617:H694Y;ENSP00000445624:H604Y	ENSP00000343617:H694Y	H	-	1	0	ZNF606	63181780	0.000000	0.05858	1.000000	0.80357	0.993000	0.82548	-0.573000	0.05874	2.427000	0.82271	0.561000	0.74099	CAC	-	HMMPfam_zf-C2H2		0.418	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF606	protein_coding	OTTHUMT00000405961.1	G	NM_025027		63181780	-1	no_errors	NM_025027	genbank	human	validated	54_36p	missense	SNP	0.08	A
DPP10	57628	genome.wustl.edu	37	2	116534805	116534805	+	Missense_Mutation	SNP	G	G	A	rs150929011		TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr2:116534805G>A	ENST00000410059.1	+	14	1723	c.1243G>A	c.(1243-1245)Gtg>Atg	p.V415M	DPP10_ENST00000310323.8_Missense_Mutation_p.V408M|DPP10_ENST00000393147.2_Missense_Mutation_p.V419M|DPP10_ENST00000409163.1_Missense_Mutation_p.V365M	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	415						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.V408M(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GCAAATTACCGTGCGGCATCT	0.378																																																1	Substitution - Missense(1)	ovary(1)	2						G	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	3,4403	6.2+/-15.9	0,3,2200	108.0	105.0	106.0		1222,1255,1093,1231,1243	4.1	0.9	2	dbSNP_134	106	0,8598		0,0,4299	no	missense,missense,missense,missense,missense	DPP10	NM_001004360.3,NM_001178034.1,NM_001178036.1,NM_001178037.1,NM_020868.3	21,21,21,21,21	0,3,6499	AA,AG,GG		0.0,0.0681,0.0231	benign,benign,benign,benign,benign	408/790,419/801,365/747,411/793,415/797	116534805	3,13001	2203	4299	6502	116251275	SO:0001583	missense	57628			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1243G>A	2.37:g.116534805G>A	ENSP00000386565:p.Val415Met	Somatic		Capture	Illumina GAIIx	4	116251275	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	-	p.V415M	ENST00000410059.1	37	c.1243	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	G	14.30	2.493314	0.44352	6.81E-4	0.0	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	4.97	4.1	0.47936	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.202355	0.42548	N	0.000696	T	0.20536	0.0494	L	0.29908	0.895	0.44946	D	0.997961	B;P;B;P	0.38677	0.385;0.524;0.439;0.642	B;B;B;B	0.36378	0.063;0.086;0.104;0.223	T	0.04115	-1.0976	10	0.62326	D	0.03	-14.5709	7.6174	0.28167	0.1874:0.0:0.8126:0.0	.	408;419;411;415	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	M	415;365;419;408;365	ENSP00000386565:V415M;ENSP00000387038:V365M;ENSP00000376855:V419M;ENSP00000309066:V408M	ENSP00000309066:V408M	V	+	1	0	DPP10	116251275	1.000000	0.71417	0.893000	0.35052	0.992000	0.81027	3.538000	0.53597	1.452000	0.47756	0.655000	0.94253	GTG	-	NULL		0.378	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	protein_coding	OTTHUMT00000330580.4	G	NM_020868		116251275	1	no_errors	NM_020868	genbank	human	reviewed	54_36p	missense	SNP	0.98	A
POTEI	653269	genome.wustl.edu	37	2	131221058	131221058	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr2:131221058C>T	ENST00000451531.2	-	15	2989	c.2559G>A	c.(2557-2559)atG>atA	p.M853I		NM_001277406.1	NP_001264335.1	P0CG38	POTEI_HUMAN	POTE ankyrin domain family, member I	853	Actin-like.				retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(11)	11						CACCAGAGTCCATCACGATGC	0.602																																																0			2																																								130937528	SO:0001583	missense	653269				CCDS59431.1	2q21.1	2013-01-10			ENSG00000196834	ENSG00000196834		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37093	protein-coding gene	gene with protein product						16364570	Standard	NM_001277406		Approved	POTE2beta	uc031rpa.1	P0CG38	OTTHUMG00000153925	ENST00000451531.2:c.2559G>A	2.37:g.131221058C>T	ENSP00000392718:p.Met853Ile	Somatic		Capture	Illumina GAIIx	4	130937528		Missense_Mutation	SNP	-	p.M853I	ENST00000451531.2	37	c.2559	CCDS59431.1	2	.	.	.	.	.	.	.	.	.	.	.	14.34	2.506890	0.44558	.	.	ENSG00000196834	ENST00000451531	T	0.05081	3.5	.	.	.	.	.	.	.	.	T	0.05227	0.0139	N	0.20807	0.61	0.25717	N	0.985418	.	.	.	.	.	.	T	0.41088	-0.9528	6	0.72032	D	0.01	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	.	.	.	I	853	ENSP00000392718:M853I	ENSP00000392718:M853I	M	-	3	0	POTEI	130937528	1.000000	0.71417	0.045000	0.18777	0.045000	0.14185	5.236000	0.65354	0.119000	0.18210	0.121000	0.15741	ATG	-	NULL		0.602	POTEI-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LOC653269	protein_coding	OTTHUMT00000333222.2	C	XM_928585		130937528	-1	no_errors	XM_928585	genbank	human	model	54_36p	missense	SNP	1	T
POTEKP	440915	genome.wustl.edu	37	2	132381544	132381544	+	IGR	SNP	A	A	G			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr2:132381544A>G								RNU6-617P (21075 upstream) : LINC01087 (13053 downstream)																							AATTTCTTCTAATGATGAACA	0.358																																																0			2																																								132098014	SO:0001628	intergenic_variant	440915																															2.37:g.132381544A>G		Somatic		Capture	Illumina GAIIx	4	132098014		Splice_Site	SNP	-	e11-2		37	c.1494-2		2																																																																																			-	-	0	0.358					ACTBL3			A			132098014	1	no_stop_codon	ENST00000397487	ensembl	human	known	54_36p	splice_site	SNP	0	G
RAB3GAP1	22930	genome.wustl.edu	37	2	135926294	135926294	+	Silent	SNP	C	C	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr2:135926294C>T	ENST00000264158.8	+	24	2932	c.2889C>T	c.(2887-2889)ctC>ctT	p.L963L	ZRANB3_ENST00000412849.1_Intron|RAB3GAP1_ENST00000487003.1_3'UTR|RAB3GAP1_ENST00000539493.1_Silent_p.L919L|RAB3GAP1_ENST00000442034.1_Silent_p.L970L	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	963					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.L963L(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		ACAGTGTTCTCACCAAAGAGG	0.527																																																1	Substitution - coding silent(1)	ovary(1)	2											111.0	110.0	110.0					2																	135926294		2203	4300	6503	135642764	SO:0001819	synonymous_variant	22930			D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.2889C>T	2.37:g.135926294C>T		Somatic		Capture	Illumina GAIIx	4	135642764	A6H8Z3|C9J837|Q659F5|Q8TBB4	Silent	SNP	-	p.L963	ENST00000264158.8	37	c.2889	CCDS33294.1	2																																																																																			-	NULL		0.527	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP1	protein_coding	OTTHUMT00000337514.2	C	NM_012233		135642764	1	no_errors	NM_012233	genbank	human	validated	54_36p	silent	SNP	1	T
TTN	7273	genome.wustl.edu	37	2	179398820	179398820	+	Silent	SNP	G	G	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr2:179398820G>C	ENST00000591111.1	-	308	97823	c.97599C>G	c.(97597-97599)gtC>gtG	p.V32533V	TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN_ENST00000589042.1_Silent_p.V34174V|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Silent_p.V25234V|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN_ENST00000342992.6_Silent_p.V31606V|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN_ENST00000460472.2_Silent_p.V25109V|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342175.6_Silent_p.V25301V|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000589434.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32533	Ig-like 143.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V25109V(1)|p.V31604V(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAGCTGTCGGACGCCAAAGT	0.408																																																2	Substitution - coding silent(2)	ovary(2)	2											115.0	113.0	113.0					2																	179398820		1952	4146	6098	179107066	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.97599C>G	2.37:g.179398820G>C		Somatic		Capture	Illumina GAIIx	4	179107066	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	-	p.S31606C	ENST00000591111.1	37	c.94817		2																																																																																			-	NULL		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179107066	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	missense	SNP	0.98	C
SP100	6672	genome.wustl.edu	37	2	231311566	231311568	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	GAA	GAA	GAA	-	GAA	GAA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr2:231311566_231311568delGAA	ENST00000264052.5	+	5	827_829	c.472_474delGAA	c.(472-474)gaadel	p.E161del	SP100_ENST00000340126.4_In_Frame_Del_p.E161del|SP100_ENST00000409341.1_In_Frame_Del_p.E161del|SP100_ENST00000409112.1_In_Frame_Del_p.E161del|SP100_ENST00000341950.4_In_Frame_Del_p.E161del|SP100_ENST00000409897.1_In_Frame_Del_p.E126del|SP100_ENST00000409824.1_In_Frame_Del_p.E136del|SP100_ENST00000427101.2_In_Frame_Del_p.E136del	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	161	Poly-Glu.				cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.E158del(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CCAAGAAAGTGAAGAAGAAGAGA	0.424																																																1	Deletion - In frame(1)	ovary(1)	2																																								231019812	SO:0001651	inframe_deletion	6672			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.472_474delGAA	2.37:g.231311572_231311574delGAA	ENSP00000264052:p.Glu161del	Somatic		Capture	Illumina GAIIx	4	231019810	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	In_Frame_Del	DEL	-	p.E161in_frame_del	ENST00000264052.5	37	c.472_474	CCDS2477.1	2																																																																																			(deletion:cds_exon[231019778;231019861])	NULL		0.424	SP100-001	KNOWN	basic|CCDS	protein_coding	SP100	protein_coding	OTTHUMT00000256914.2	GAA	NM_003113		231019812	1	no_errors	NM_001080391	genbank	human	validated	54_36p	in_frame_del	DEL	0.001:0.000:0.000	-
WDR43	23160	genome.wustl.edu	37	2	29164333	29164333	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr2:29164333G>C	ENST00000407426.3	+	15	1683	c.1627G>C	c.(1627-1629)Gac>Cac	p.D543H		NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	543						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.D586H(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					CTAGTTGCCTGACCTGGTACC	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											73.0	70.0	71.0					2																	29164333		1934	4128	6062	29017837	SO:0001583	missense	23160			D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.1627G>C	2.37:g.29164333G>C	ENSP00000384302:p.Asp543His	Somatic		Capture	Illumina GAIIx	4	29017837	Q15395|Q92577	Missense_Mutation	SNP	-	p.D543H	ENST00000407426.3	37	c.1627	CCDS46251.1	2	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424056	0.83667	.	.	ENSG00000163811	ENST00000407426	T	0.67523	-0.27	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.84624	0.5513	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86186	0.1609	10	0.72032	D	0.01	-20.4027	19.7843	0.96430	0.0:0.0:1.0:0.0	.	543	Q15061	WDR43_HUMAN	H	543	ENSP00000384302:D543H	ENSP00000384302:D543H	D	+	1	0	WDR43	29017837	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.481000	0.81124	2.753000	0.94483	0.555000	0.69702	GAC	-	NULL		0.413	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR43	protein_coding	OTTHUMT00000324865.1	G	XM_087089		29017837	1	no_errors	NM_015131	genbank	human	validated	54_36p	missense	SNP	1	C
EIF2AK2	5610	genome.wustl.edu	37	2	37374945	37374945	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr2:37374945G>C	ENST00000233057.4	-	3	327	c.5C>G	c.(4-6)gCt>gGt	p.A2G	EIF2AK2_ENST00000395127.2_Missense_Mutation_p.A2G|EIF2AK2_ENST00000405334.1_Missense_Mutation_p.A2G	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	2					activation of MAPKK activity (GO:0000186)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|evasion or tolerance by virus of host immune response (GO:0030683)|innate immune response (GO:0045087)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production (GO:0001819)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of hematopoietic progenitor cell differentiation (GO:1901532)|regulation of hematopoietic stem cell differentiation (GO:1902036)|regulation of hematopoietic stem cell proliferation (GO:1902033)|regulation of NLRP3 inflammasome complex assembly (GO:1900225)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine kinase activity (GO:0004674)	p.A2G(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)				AAGATCACCAGCCATTTCTTC	0.403																																																1	Substitution - Missense(1)	ovary(1)	2											97.0	100.0	99.0					2																	37374945		2203	4300	6503	37228449	SO:0001583	missense	5610			BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332			9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR		1351683	Standard	NM_001135651		Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.5C>G	2.37:g.37374945G>C	ENSP00000233057:p.Ala2Gly	Somatic		Capture	Illumina GAIIx	4	37228449	A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	Missense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_dsrm;superfamily_Protein kinase-like (PK-like);superfamily_dsRNA-binding domain-like	p.A2G	ENST00000233057.4	37	c.5	CCDS1786.1	2	.	.	.	.	.	.	.	.	.	.	G	13.16	2.154921	0.38021	.	.	ENSG00000055332	ENST00000233057;ENST00000395127;ENST00000405334;ENST00000379156;ENST00000411537;ENST00000390013	T;T;T	0.80033	-1.12;-1.12;-1.33	5.32	3.46	0.39613	.	0.377447	0.22605	N	0.057911	D	0.87573	0.6211	M	0.72894	2.215	0.31195	N	0.700479	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.982	D	0.86390	0.1735	10	0.87932	D	0	-1.7891	11.0115	0.47665	0.0:0.0:0.6616:0.3384	.	2;2;2;2	Q8IW76;B7ZKK7;P19525;E9PC80	.;.;E2AK2_HUMAN;.	G	2	ENSP00000233057:A2G;ENSP00000378559:A2G;ENSP00000385014:A2G	ENSP00000233057:A2G	A	-	2	0	EIF2AK2	37228449	0.964000	0.33143	0.664000	0.29753	0.056000	0.15407	1.681000	0.37618	0.684000	0.31448	0.650000	0.86243	GCT	-	NULL		0.403	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2AK2	protein_coding	OTTHUMT00000218571.2	G	NM_002759		37228449	-1	no_errors	NM_002759	genbank	human	validated	54_36p	missense	SNP	0.87	C
TPRKB	51002	genome.wustl.edu	37	2	73961607	73961607	+	Silent	SNP	T	T	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr2:73961607T>C	ENST00000272424.5	-	2	196	c.90A>G	c.(88-90)agA>agG	p.R30R	TPRKB_ENST00000409716.2_Silent_p.R30R|TPRKB_ENST00000318190.7_Silent_p.R30R	NM_016058.2	NP_057142.1	Q9Y3C4	TPRKB_HUMAN	TP53RK binding protein	30					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)	p.R30R(1)		lung(2)|ovary(1)|skin(1)	4						TGGCCTTTCTTCTCAAGTCTC	0.418																																																1	Substitution - coding silent(1)	ovary(1)	2											138.0	133.0	135.0					2																	73961607		2203	4300	6503	73815115	SO:0001819	synonymous_variant	51002			AY157986	CCDS1927.1	2p24.3-p24.1	2008-02-05			ENSG00000144034	ENSG00000144034			24259	protein-coding gene	gene with protein product		608680				10810093, 12659830	Standard	NM_016058		Approved	CGI-121	uc002sjn.2	Q9Y3C4	OTTHUMG00000129815	ENST00000272424.5:c.90A>G	2.37:g.73961607T>C		Somatic		Capture	Illumina GAIIx	4	73815115	D6W5H6|Q8IWR6|Q8IWR7|Q9H3K4	Silent	SNP	-	p.R30	ENST00000272424.5	37	c.90	CCDS1927.1	2																																																																																			-	NULL		0.418	TPRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPRKB	protein_coding	OTTHUMT00000252046.2	T	NM_016058		73815115	-1	no_errors	NM_016058	genbank	human	validated	54_36p	silent	SNP	0.99	C
TRABD2A	129293	genome.wustl.edu	37	2	85097742	85097742	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr2:85097742G>T	ENST00000409520.2	-	2	318	c.276C>A	c.(274-276)gaC>gaA	p.D92E	TRABD2A_ENST00000335459.5_Missense_Mutation_p.D92E|TRABD2A_ENST00000409133.1_Missense_Mutation_p.D92E	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	92					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)	p.D92E(1)									TGGTATAGGGGTCTGTGAGAT	0.557																																																1	Substitution - Missense(1)	ovary(1)	2											40.0	43.0	42.0					2																	85097742		2014	4167	6181	84951253	SO:0001583	missense	129293			BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.276C>A	2.37:g.85097742G>T	ENSP00000387075:p.Asp92Glu	Somatic		Capture	Illumina GAIIx	4	84951253	B4DKK8|I6UMB9	Missense_Mutation	SNP	-	p.D92E	ENST00000409520.2	37	c.276		2	.	.	.	.	.	.	.	.	.	.	G	16.00	2.997863	0.54147	.	.	ENSG00000186854	ENST00000335459;ENST00000409520;ENST00000409133	T;T;T	0.26223	1.75;1.75;1.75	3.11	3.11	0.35812	.	0.000000	0.64402	D	0.000002	T	0.40297	0.1111	.	.	.	0.46609	D	0.999127	P;P;P	0.51057	0.833;0.615;0.941	B;P;P	0.55965	0.301;0.458;0.788	T	0.33879	-0.9851	9	0.52906	T	0.07	.	11.6748	0.51424	0.0:0.0:1.0:0.0	.	92;92;92	Q86V40;C9IYB5;Q86V40-2	CB089_HUMAN;.;.	E	92	ENSP00000335004:D92E;ENSP00000387075:D92E;ENSP00000387183:D92E	ENSP00000335004:D92E	D	-	3	2	C2orf89	84951253	1.000000	0.71417	0.791000	0.31998	0.195000	0.23768	2.825000	0.48096	1.589000	0.49982	0.455000	0.32223	GAC	-	NULL		0.557	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	LOC129293	protein_coding		G	NM_001080824		84951253	-1	no_errors	NM_001080824	genbank	human	predicted	54_36p	missense	SNP	1	T
ZNF341	84905	genome.wustl.edu	37	20	32354838	32354838	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr20:32354838G>C	ENST00000375200.1	+	9	1769	c.1404G>C	c.(1402-1404)aaG>aaC	p.K468N	ZNF341_ENST00000342427.2_Missense_Mutation_p.K461N	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	468					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K461N(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						CCCAGCATAAGAATGAGCAGG	0.547																																																1	Substitution - Missense(1)	ovary(1)	20											150.0	142.0	144.0					20																	32354838		2203	4300	6503	31818499	SO:0001583	missense	84905			AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.1404G>C	20.37:g.32354838G>C	ENSP00000364346:p.Lys468Asn	Somatic		Capture	Illumina GAIIx	4	31818499	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	-	p.K461N	ENST00000375200.1	37	c.1383		20	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162851	0.57368	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.60299	0.2;0.2	4.98	2.98	0.34508	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.54822	0.1882	N	0.10945	0.07	0.50171	D	0.99985	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	T	0.58222	-0.7674	10	0.66056	D	0.02	-22.6076	9.4285	0.38595	0.2409:0.0:0.7591:0.0	.	409;468;461	Q504V9;Q9BYN7;Q9BYN7-2	.;ZN341_HUMAN;.	N	461;468	ENSP00000344308:K461N;ENSP00000364346:K468N	ENSP00000344308:K461N	K	+	3	2	ZNF341	31818499	1.000000	0.71417	0.996000	0.52242	0.927000	0.56198	1.933000	0.40153	0.579000	0.29504	-0.448000	0.05591	AAG	-	NULL		0.547	ZNF341-201	KNOWN	basic	protein_coding	ZNF341	protein_coding		G			31818499	1	no_errors	NM_032819	genbank	human	validated	54_36p	missense	SNP	1	C
LPIN3	64900	genome.wustl.edu	37	20	39978941	39978941	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr20:39978941G>T	ENST00000373257.3	+	7	1097	c.1006G>T	c.(1006-1008)Gac>Tac	p.D336Y		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	336					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)	p.D336Y(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				GAGCTCTGGGGACATGGGCCT	0.627																																																1	Substitution - Missense(1)	ovary(1)	20											36.0	39.0	38.0					20																	39978941		2203	4300	6503	39412355	SO:0001583	missense	64900			AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.1006G>T	20.37:g.39978941G>T	ENSP00000362354:p.Asp336Tyr	Somatic		Capture	Illumina GAIIx	4	39412355	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Missense_Mutation	SNP	-	p.D336Y	ENST00000373257.3	37	c.1006	CCDS33469.1	20	.	.	.	.	.	.	.	.	.	.	G	11.54	1.670518	0.29693	.	.	ENSG00000132793	ENST00000373257	T	0.80824	-1.42	4.9	2.93	0.34026	.	1.137520	0.06344	N	0.708539	T	0.78672	0.4320	L	0.44542	1.39	0.09310	N	1	P;P	0.52842	0.674;0.956	B;P	0.50231	0.381;0.635	T	0.63659	-0.6587	9	.	.	.	-1.8838	3.9743	0.09467	0.091:0.1729:0.5767:0.1594	.	337;336	Q9BQK8-2;Q9BQK8	.;LPIN3_HUMAN	Y	336	ENSP00000362354:D336Y	.	D	+	1	0	LPIN3	39412355	0.063000	0.20901	0.001000	0.08648	0.007000	0.05969	0.880000	0.28159	0.725000	0.32318	0.561000	0.74099	GAC	-	NULL		0.627	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LPIN3	protein_coding	OTTHUMT00000080393.1	G	NM_022896		39412355	1	no_errors	NM_022896	genbank	human	validated	54_36p	missense	SNP	0.02	T
DIDO1	11083	genome.wustl.edu	37	20	61538627	61538627	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr20:61538627C>T	ENST00000266070.4	-	5	1571	c.1246G>A	c.(1246-1248)Gac>Aac	p.D416N	DIDO1_ENST00000354665.4_Missense_Mutation_p.D416N|DIDO1_ENST00000370366.1_Missense_Mutation_p.D416N|DIDO1_ENST00000395335.2_Missense_Mutation_p.D416N|DIDO1_ENST00000395343.1_Missense_Mutation_p.D416N|DIDO1_ENST00000370368.1_Missense_Mutation_p.D416N|DIDO1_ENST00000370371.4_Missense_Mutation_p.D416N|DIDO1_ENST00000266071.5_Missense_Mutation_p.D416N|DIDO1_ENST00000395340.1_Missense_Mutation_p.D416N	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	416					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.D416N(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					AGGATACAGTCATTACTGCAG	0.502																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)											1	Substitution - Missense(1)	ovary(1)	20											196.0	193.0	194.0					20																	61538627		2203	4300	6503	61009072	SO:0001583	missense	11083			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1246G>A	20.37:g.61538627C>T	ENSP00000266070:p.Asp416Asn	Somatic		Capture	Illumina GAIIx	4	61009072	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	-	p.D416N	ENST00000266070.4	37	c.1246	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	C	34	5.317788	0.95682	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335;ENST00000370371;ENST00000370368;ENST00000354665;ENST00000370366;ENST00000266071	T;T;T;T;T;T;T;T;T	0.25250	2.71;2.71;2.37;2.37;1.81;1.81;1.81;1.83;1.83	4.96	4.96	0.65561	.	0.000000	0.44902	D	0.000402	T	0.53367	0.1792	M	0.80183	2.485	0.80722	D	1	D;D;D;D	0.65815	0.995;0.995;0.992;0.981	P;D;P;P	0.64687	0.888;0.928;0.891;0.494	T	0.58769	-0.7578	10	0.59425	D	0.04	-32.892	18.5732	0.91144	0.0:1.0:0.0:0.0	.	416;416;416;416	Q9BTC0-2;Q9BTC0-3;Q9BTC0-1;Q9BTC0	.;.;.;DIDO1_HUMAN	N	416	ENSP00000266070:D416N;ENSP00000378752:D416N;ENSP00000378749:D416N;ENSP00000378744:D416N;ENSP00000359397:D416N;ENSP00000359394:D416N;ENSP00000346692:D416N;ENSP00000359391:D416N;ENSP00000266071:D416N	ENSP00000266070:D416N	D	-	1	0	DIDO1	61009072	1.000000	0.71417	0.741000	0.31004	0.602000	0.36980	7.666000	0.83877	2.472000	0.83506	0.561000	0.74099	GAC	-	NULL		0.502	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	protein_coding	OTTHUMT00000080091.2	C	NM_080796		61009072	-1	no_errors	NM_033081	genbank	human	reviewed	54_36p	missense	SNP	1	T
ZNRF3	84133	genome.wustl.edu	37	22	29445294	29445294	+	Silent	SNP	C	C	G			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr22:29445294C>G	ENST00000544604.2	+	8	1300	c.1125C>G	c.(1123-1125)acC>acG	p.T375T	ZNRF3_ENST00000406323.3_Silent_p.T275T|ZNRF3_ENST00000332811.4_Silent_p.T275T|ZNRF3_ENST00000402174.1_Silent_p.T275T	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	375					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T275T(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						TGCACAGGACCAACGCCATCC	0.642																																																1	Substitution - coding silent(1)	ovary(1)	22											66.0	75.0	72.0					22																	29445294		2188	4275	6463	27775294	SO:0001819	synonymous_variant	84133			AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.1125C>G	22.37:g.29445294C>G		Somatic		Capture	Illumina GAIIx	4	27775294	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Silent	SNP	-	p.T275	ENST00000544604.2	37	c.825	CCDS56225.1	22																																																																																			-	NULL		0.642	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNRF3	protein_coding	OTTHUMT00000320943.2	C	XM_290972		27775294	1	no_errors	NM_032173	genbank	human	validated	54_36p	silent	SNP	0.99	G
ATP2B2	491	genome.wustl.edu	37	3	10370704	10370704	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr3:10370704C>A	ENST00000352432.4	-	22	3595	c.3526G>T	c.(3526-3528)Gaa>Taa	p.E1176*	MIR378B_ENST00000578876.1_RNA|ATP2B2_ENST00000343816.4_Nonsense_Mutation_p.E1162*|ATP2B2_ENST00000397077.1_Nonsense_Mutation_p.E1131*|ATP2B2_ENST00000467702.2_5'UTR|ATP2B2_ENST00000383800.4_Nonsense_Mutation_p.E1131*|ATP2B2_ENST00000360273.2_Nonsense_Mutation_p.E1176*			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	1176					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.E1131*(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						TGGGAATCTTCGATCCGGAAT	0.527																																					Ovarian(125;1619 1709 15675 19819 38835)											1	Substitution - Nonsense(1)	ovary(1)	3											93.0	84.0	87.0					3																	10370704		2203	4300	6503	10345704	SO:0001587	stop_gained	491			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.3526G>T	3.37:g.10370704C>A	ENSP00000324172:p.Glu1176*	Somatic		Capture	Illumina GAIIx	4	10345704	O00766|Q12994|Q16818	Nonsense_Mutation	SNP	HMMPfam_Cation_ATPase_N;HMMPfam_Hydrolase;HMMPfam_Cation_ATPase_C;HMMPfam_E1-E2_ATPase;superfamily_HAD-like;superfamily_Calcium ATPase transduction domain A;superfamily_Metal cation-transporting ATPase ATP-binding domain N;superfamily_Calcium ATPase transmembrane domain M	p.E1176*	ENST00000352432.4	37	c.3526	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	C	45	11.325114	0.99547	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000429937;ENST00000452124	.	.	.	5.55	4.67	0.58626	.	0.114019	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-15.3774	14.4887	0.67634	0.0:0.9292:0.0:0.0708	.	.	.	.	X	1176;1131;1131;1176;1162;1111;365;1032	.	ENSP00000344677:E1162X	E	-	1	0	ATP2B2	10345704	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.806000	0.86020	1.334000	0.45468	0.650000	0.86243	GAA	-	NULL		0.527	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	protein_coding	OTTHUMT00000250576.2	C	NM_001683		10345704	-1	no_errors	NM_001001331	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
QDPR	5860	genome.wustl.edu	37	4	17506060	17506060	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr4:17506060C>A	ENST00000281243.5	-	3	416	c.237G>T	c.(235-237)aaG>aaT	p.K79N	QDPR_ENST00000508623.1_Missense_Mutation_p.K79N|QDPR_ENST00000513615.1_Missense_Mutation_p.K79N|QDPR_ENST00000428702.2_Missense_Mutation_p.K48N	NM_000320.2	NP_000311.2	P09417	DHPR_HUMAN	quinoid dihydropteridine reductase	79					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|dihydrobiopterin metabolic process (GO:0051066)|L-phenylalanine catabolic process (GO:0006559)|liver development (GO:0001889)|response to aluminum ion (GO:0010044)|response to glucagon (GO:0033762)|response to lead ion (GO:0010288)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	6,7-dihydropteridine reductase activity (GO:0004155)|electron carrier activity (GO:0009055)|NADH binding (GO:0070404)|NADPH binding (GO:0070402)	p.K79N(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	13						TTGCATCCACCTTCTCTTCAC	0.468																																																1	Substitution - Missense(1)	ovary(1)	4											147.0	136.0	139.0					4																	17506060		2203	4300	6503	17115158	SO:0001583	missense	5860			AB053170	CCDS3421.1	4p15.31	2014-04-01			ENSG00000151552	ENSG00000151552	1.5.1.34	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	9752	protein-coding gene	gene with protein product	"""6,7-dihydropteridine reductase"", ""short chain dehydrogenase/reductase family 33C, member 1"""	612676				19027726	Standard	NM_000320		Approved	DHPR, PKU2, SDR33C1	uc003gpd.3	P09417	OTTHUMG00000128537	ENST00000281243.5:c.237G>T	4.37:g.17506060C>A	ENSP00000281243:p.Lys79Asn	Somatic		Capture	Illumina GAIIx	4	17115158	A8K158|B3KW71|Q53F52|Q9H3M5	Missense_Mutation	SNP	HMMPfam_adh_short;superfamily_NAD(P)-binding Rossmann-fold domains	p.K79N	ENST00000281243.5	37	c.237	CCDS3421.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.83|17.83	3.486075|3.486075	0.63962|0.63962	.|.	.|.	ENSG00000151552|ENSG00000151552	ENST00000513615;ENST00000281243;ENST00000428702;ENST00000508623|ENST00000505710	D;D;D;D|.	0.94931|.	-3.56;-2.3;-3.56;-3.56|.	5.5|5.5	3.45|3.45	0.39498|0.39498	NAD(P)-binding domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80747|0.80747	0.4682|0.4682	M|M	0.92738|0.92738	3.34|3.34	0.58432|0.58432	D|D	0.999998|0.999998	D;D|.	0.65815|.	0.995;0.984|.	D;P|.	0.69654|.	0.965;0.866|.	D|D	0.84994|0.84994	0.0896|0.0896	10|5	0.66056|.	D|.	0.02|.	-10.3311|-10.3311	12.2095|12.2095	0.54371|0.54371	0.0:0.8351:0.0:0.1649|0.0:0.8351:0.0:0.1649	.|.	48;79|.	B3KW71;P09417|.	.;DHPR_HUMAN|.	N|M	79;79;48;79|55	ENSP00000422759:K79N;ENSP00000281243:K79N;ENSP00000390944:K48N;ENSP00000426377:K79N|.	ENSP00000281243:K79N|.	K|R	-|-	3|2	2|0	QDPR|QDPR	17115158|17115158	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.746000|0.746000	0.42486|0.42486	1.052000|1.052000	0.30429|0.30429	1.322000|1.322000	0.45245|0.45245	0.563000|0.563000	0.77884|0.77884	AAG|AGG	-	HMMPfam_adh_short		0.468	QDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QDPR	protein_coding	OTTHUMT00000250372.1	C	NM_000320		17115158	-1	no_errors	NM_000320	genbank	human	reviewed	54_36p	missense	SNP	1	A
LYAR	55646	genome.wustl.edu	37	4	4285450	4285450	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr4:4285450T>C	ENST00000343470.4	-	3	260	c.20A>G	c.(19-21)aAt>aGt	p.N7S	LYAR_ENST00000452476.1_Missense_Mutation_p.N7S	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	7						nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.N7S(1)		endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACATGCATTGCATGTAAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	4											83.0	76.0	78.0					4																	4285450		2203	4300	6503	4336351	SO:0001583	missense	55646			AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.20A>G	4.37:g.4285450T>C	ENSP00000345917:p.Asn7Ser	Somatic		Capture	Illumina GAIIx	4	4336351	D3DVS4|Q6FI78|Q9NYS1	Missense_Mutation	SNP	-	p.N7S	ENST00000343470.4	37	c.20	CCDS3374.1	4	.	.	.	.	.	.	.	.	.	.	T	17.76	3.469166	0.63625	.	.	ENSG00000145220	ENST00000343470;ENST00000452476;ENST00000513174	T;T	0.34667	1.35;1.35	5.37	5.37	0.77165	.	0.082117	0.85682	D	0.000000	T	0.48642	0.1511	L	0.52905	1.665	0.80722	D	1	P	0.50443	0.935	P	0.55011	0.766	T	0.45585	-0.9251	10	0.48119	T	0.1	-36.9748	14.3451	0.66654	0.0:0.0:0.0:1.0	.	7	Q9NX58	LYAR_HUMAN	S	7	ENSP00000345917:N7S;ENSP00000397367:N7S	ENSP00000345917:N7S	N	-	2	0	LYAR	4336351	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	5.555000	0.67301	2.036000	0.60181	0.482000	0.46254	AAT	-	NULL		0.333	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYAR	protein_coding	OTTHUMT00000246800.2	T	NM_017816		4336351	-1	no_errors	NM_017816	genbank	human	validated	54_36p	missense	SNP	1	C
KLKB1	3818	genome.wustl.edu	37	4	187155191	187155191	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr4:187155191C>A	ENST00000264690.6	+	4	494	c.307C>A	c.(307-309)Caa>Aaa	p.Q103K	KLKB1_ENST00000513864.1_Missense_Mutation_p.Q103K	NM_000892.3	NP_000883.2	P03952	KLKB1_HUMAN	kallikrein B, plasma (Fletcher factor) 1	103	Apple 1. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)|proteolysis (GO:0006508)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.Q103K(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	40		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		TTCCTTGAAGCAATGTGGTCA	0.373																																																1	Substitution - Missense(1)	ovary(1)	4											152.0	142.0	146.0					4																	187155191		2203	4300	6503	187392185	SO:0001583	missense	3818			M13143	CCDS34120.1	4q35	2008-02-05			ENSG00000164344	ENSG00000164344		"""Kallikreins"""	6371	protein-coding gene	gene with protein product		229000		KLK3		9535413, 3521732	Standard	XM_005262987		Approved		uc003iyy.3	P03952	OTTHUMG00000150347	ENST00000264690.6:c.307C>A	4.37:g.187155191C>A	ENSP00000264690:p.Gln103Lys	Somatic		Capture	Illumina GAIIx	4	187392185	A6NH96|B2R8H9|Q17RE8|Q17RE9|Q4W5C3	Missense_Mutation	SNP	-	p.Q103K	ENST00000264690.6	37	c.307	CCDS34120.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.26|18.26	3.583679|3.583679	0.65992|0.65992	.|.	.|.	ENSG00000164344|ENSG00000164344	ENST00000428196;ENST00000264690;ENST00000446598;ENST00000414291;ENST00000513864;ENST00000418715|ENST00000511608	D;D;D;D;D|.	0.89050|.	-2.46;-2.46;-2.46;-2.46;-2.46|.	4.73|4.73	4.73|4.73	0.59995|0.59995	Apple domain (2);PAN-1 domain (1);Apple-like (1);|.	0.444000|.	0.21632|.	N|.	0.071470|.	T|T	0.66056|0.66056	0.2751|0.2751	M|M	0.75777|0.75777	2.31|2.31	0.29384|0.29384	N|N	0.863074|0.863074	B;B|.	0.23735|.	0.029;0.09|.	B;B|.	0.26094|.	0.066;0.055|.	T|T	0.63651|0.63651	-0.6589|-0.6589	10|5	0.59425|.	D|.	0.04|.	.|.	15.0883|15.0883	0.72174|0.72174	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	65;103|.	E7EQA8;P03952|.	.;KLKB1_HUMAN|.	K|R	103;103;65;65;103;65|150	ENSP00000412366:Q103K;ENSP00000264690:Q103K;ENSP00000415563:Q65K;ENSP00000392231:Q65K;ENSP00000424469:Q103K|.	ENSP00000264690:Q103K|.	Q|S	+|+	1|3	0|2	KLKB1|KLKB1	187392185|187392185	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.724000|0.724000	0.41520|0.41520	2.980000|2.980000	0.49321|0.49321	2.626000|2.626000	0.88956|0.88956	0.650000|0.650000	0.86243|0.86243	CAA|AGC	-	NULL		0.373	KLKB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLKB1	protein_coding	OTTHUMT00000317732.1	C	NM_000892		187392185	1	no_errors	NM_000892	genbank	human	reviewed	54_36p	missense	SNP	1	A
PCDHB12	56124	genome.wustl.edu	37	5	140588530	140588530	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr5:140588530C>G	ENST00000239450.2	+	1	240	c.51C>G	c.(49-51)ttC>ttG	p.F17L	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	17					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.F17L(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCTGCTTTTCTTTGTTTTGC	0.483																																																1	Substitution - Missense(1)	ovary(1)	5											107.0	109.0	108.0					5																	140588530		2203	4300	6503	140568714	SO:0001583	missense	56124			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.51C>G	5.37:g.140588530C>G	ENSP00000239450:p.Phe17Leu	Somatic		Capture	Illumina GAIIx	4	140568714	B4DDU1	Missense_Mutation	SNP	-	p.F17L	ENST00000239450.2	37	c.51	CCDS4254.1	5	.	.	.	.	.	.	.	.	.	.	C	2.761	-0.257825	0.05791	.	.	ENSG00000120328	ENST00000239450	T	0.42131	0.98	4.15	2.3	0.28687	.	.	.	.	.	T	0.12646	0.0307	N	0.01277	-0.915	0.54753	D	0.999987	B	0.02656	0.0	B	0.04013	0.001	T	0.26503	-1.0101	9	0.02654	T	1	.	9.1429	0.36914	0.0:0.8156:0.0:0.1844	.	17	Q9Y5F1	PCDBC_HUMAN	L	17	ENSP00000239450:F17L	ENSP00000239450:F17L	F	+	3	2	PCDHB12	140568714	0.000000	0.05858	1.000000	0.80357	0.972000	0.66771	-0.025000	0.12413	0.857000	0.35407	0.561000	0.74099	TTC	-	NULL		0.483	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	protein_coding	OTTHUMT00000251815.2	C	NM_018932		140568714	1	no_errors	NM_018932	genbank	human	reviewed	54_36p	missense	SNP	0	G
KIF4B	285643	genome.wustl.edu	37	5	154395557	154395557	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr5:154395557G>T	ENST00000435029.4	+	1	2298	c.2138G>T	c.(2137-2139)cGa>cTa	p.R713L		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	713	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.G748V(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCCAACAAGCGACTCAAGGAT	0.483																																																2	Substitution - Missense(2)	ovary(2)	5											88.0	89.0	88.0					5																	154395557		2203	4300	6503	154375750	SO:0001583	missense	285643			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2138G>T	5.37:g.154395557G>T	ENSP00000387875:p.Arg713Leu	Somatic		Capture	Illumina GAIIx	4	154375750		Missense_Mutation	SNP	-	p.R713L	ENST00000435029.4	37	c.2138	CCDS47324.1	5	.	.	.	.	.	.	.	.	.	.	g	16.99	3.273454	0.59649	.	.	ENSG00000226650	ENST00000435029	T	0.18174	2.23	2.54	2.54	0.30619	.	.	.	.	.	T	0.42337	0.1198	M	0.85859	2.78	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	T	0.41963	-0.9479	9	0.51188	T	0.08	.	10.7682	0.46305	0.0:0.0:1.0:0.0	.	713	Q2VIQ3	KIF4B_HUMAN	L	713	ENSP00000387875:R713L	ENSP00000387875:R713L	R	+	2	0	KIF4B	154375750	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	4.386000	0.59620	1.138000	0.42230	0.563000	0.77884	CGA	-	NULL		0.483	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	protein_coding	OTTHUMT00000377478.1	G			154375750	1	no_errors	NM_001099293	genbank	human	provisional	54_36p	missense	SNP	1	T
ADAMTS16	170690	genome.wustl.edu	37	5	5186221	5186221	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr5:5186221T>C	ENST00000274181.7	+	5	958	c.820T>C	c.(820-822)Tgc>Cgc	p.C274R	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.C274R	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	274					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C274R(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTATAAGTCTTGCTTACGGCA	0.493																																																2	Substitution - Missense(2)	ovary(2)	5											163.0	159.0	160.0					5																	5186221		1936	4157	6093	5239221	SO:0001583	missense	170690			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.820T>C	5.37:g.5186221T>C	ENSP00000274181:p.Cys274Arg	Somatic		Capture	Illumina GAIIx	4	5239221	C6G490|Q8IVE2	Missense_Mutation	SNP	-	p.C274R	ENST00000274181.7	37	c.820	CCDS43299.1	5	.	.	.	.	.	.	.	.	.	.	T	0.051	-1.250076	0.01469	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	T;T	0.59906	0.29;0.23	5.51	-11.0	0.00169	.	0.920339	0.09304	N	0.820468	T	0.28962	0.0719	N	0.22421	0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.09618	-1.0666	10	0.14656	T	0.56	.	6.2214	0.20683	0.2053:0.0989:0.5852:0.1105	.	274;274;274	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	R	274	ENSP00000274181:C274R;ENSP00000421631:C274R	ENSP00000274181:C274R	C	+	1	0	ADAMTS16	5239221	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-1.605000	0.02074	-1.479000	0.01867	-0.313000	0.08912	TGC	-	NULL		0.493	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	protein_coding	OTTHUMT00000365657.1	T	NM_139056		5239221	1	no_errors	NM_139056	genbank	human	reviewed	54_36p	missense	SNP	0	C
RPL37	6167	genome.wustl.edu	37	5	40835298	40835298	+	5'UTR	SNP	C	C	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr5:40835298C>T	ENST00000274242.5	-	0	139				RPL37_ENST00000504562.1_5'Flank|SNORD72_ENST00000390994.1_RNA|RPL37_ENST00000508493.1_5'UTR|RPL37_ENST00000509877.1_5'UTR	NM_000997.4	NP_000988.1	P61927	RL37_HUMAN	ribosomal protein L37						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)	p.?(1)		lung(3)|ovary(1)	4		Breast(839;0.238)				CTCGCTTCTGCGGCCGAGACC	0.582																																					Colon(188;1411 2035 4978 19588 31462)											1	Unknown(1)	ovary(1)	5											160.0	133.0	142.0					5																	40835298		2203	4300	6503	40871055	SO:0001623	5_prime_UTR_variant	6167			L11567	CCDS3934.1	5p13.1	2013-09-23			ENSG00000145592	ENSG00000145592		"""L ribosomal proteins"""	10347	protein-coding gene	gene with protein product	"""60S ribosomal protein L37a"""	604181				7545944, 9582194	Standard	NM_000997		Approved	L37	uc003jme.1	P61927	OTTHUMG00000094774	ENST00000274242.5:c.-11G>A	5.37:g.40835298C>T		Somatic		Capture	Illumina GAIIx	4	40871055	B2R4H2|P02403|Q6IBB4|Q99883	Silent	SNP	-	p.P5	ENST00000274242.5	37	c.15	CCDS3934.1	5																																																																																			-	NULL		0.582	RPL37-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPL37	protein_coding	OTTHUMT00000211583.2	C	NM_000997		40871055	-1	no_start_codon	ENST00000315577	ensembl	human	known	54_36p	silent	SNP	0.05	T
TENM2	57451	genome.wustl.edu	37	5	167671470	167671470	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr5:167671470C>G	ENST00000518659.1	+	26	5605	c.5566C>G	c.(5566-5568)Cgg>Ggg	p.R1856G	TENM2_ENST00000520394.1_Missense_Mutation_p.R1617G|TENM2_ENST00000545108.1_Missense_Mutation_p.R1855G|TENM2_ENST00000519204.1_Missense_Mutation_p.R1735G|TENM2_ENST00000403607.2_Missense_Mutation_p.R1680G	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1856					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R1689G(1)									TCGAAATATTCGGACTGAAAA	0.517																																																1	Substitution - Missense(1)	ovary(1)	5											65.0	61.0	62.0					5																	167671470		1901	4127	6028	167604048	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.5566C>G	5.37:g.167671470C>G	ENSP00000429430:p.Arg1856Gly	Somatic		Capture	Illumina GAIIx	4	167604048	Q9ULU2	Missense_Mutation	SNP	-	p.R1855G	ENST00000518659.1	37	c.5563		5	.	.	.	.	.	.	.	.	.	.	C	19.59	3.855876	0.71834	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90133	-2.15;-2.14;-2.26;-2.59;-2.62	4.9	4.9	0.64082	.	0.162744	0.56097	D	0.000026	D	0.93344	0.7878	M	0.80183	2.485	0.45930	D	0.998762	P;P;P	0.42010	0.768;0.658;0.712	P;B;B	0.48425	0.577;0.373;0.237	D	0.93601	0.6930	10	0.48119	T	0.1	.	18.1051	0.89517	0.0:1.0:0.0:0.0	.	1855;1856;1617	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	G	1856;1855;1735;1617;1680	ENSP00000429430:R1856G;ENSP00000438635:R1855G;ENSP00000428964:R1735G;ENSP00000427874:R1617G;ENSP00000384905:R1680G	ENSP00000384905:R1680G	R	+	1	2	ODZ2	167604048	1.000000	0.71417	0.970000	0.41538	0.994000	0.84299	6.032000	0.70918	2.275000	0.75901	0.561000	0.74099	CGG	-	NULL		0.517	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	protein_coding	OTTHUMT00000376096.1	C	NM_001122679		167604048	1	no_errors	ENST00000388903	ensembl	human	known	54_36p	missense	SNP	1	G
OR2J2	26707	genome.wustl.edu	37	6	29142330	29142331	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	GG	GG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr6:29142330_29142331GG>TT	ENST00000377167.2	+	1	1020_1021	c.918_919GG>TT	c.(916-921)ttGGgg>ttTTgg	p.306_307LG>FW		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L306_G307>FW(1)		endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						AGAGACTATTGGGGTGGGAGTG	0.446																																																1	Complex - compound substitution(1)	ovary(1)	6																																								29250310	SO:0001583	missense	26707				CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	Exception_encountered	6.37:g.29142330_29142331delinsTT	ENSP00000366372:p.L306_G307delinsFW	Somatic		Capture	Illumina GAIIx	4	29250309	A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	DNP	-	p.LG306FW	ENST00000377167.2	37	c.918_919	CCDS43434.1	6																																																																																			-	NULL		0.446	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2J2	protein_coding	OTTHUMT00000076131.2	GG			29250310	1	no_errors	NM_030905	genbank	human	validated	54_36p	missense	DNP	0.007:0.005	TT
XXbac-BPG308J9.3	0	genome.wustl.edu	37	6	29231528	29231528	+	lincRNA	SNP	C	C	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr6:29231528C>A	ENST00000441381.1	+	0	79																		p.C110Y(1)|p.C110F(1)									CAGAAGCATACATTCAACCGT	0.458																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	6											207.0	196.0	199.0					6																	29231528		1992	4194	6186	29339507			81696																															6.37:g.29231528C>A		Somatic		Capture	Illumina GAIIx	4	29339507		Missense_Mutation	SNP	-	p.C110F	ENST00000441381.1	37	c.329		6																																																																																			-	NULL		0.458	XXbac-BPG308J9.3-001	KNOWN	basic	lincRNA	uc003nmb.1	lincRNA	OTTHUMT00000192829.1	C			29339507	-1	no_errors	ENST00000377164	ensembl	human	known	54_36p	missense	SNP	0.3	A
DAAM2	23500	genome.wustl.edu	37	6	39835375	39835386	+	In_Frame_Del	DEL	TCCACACCTCAC	TCCACACCTCAC	-	rs34365214|rs375543916		TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	TCCACACCTCAC	TCCACACCTCAC	TCCACACCTCAC	-	TCCACACCTCAC	TCCACACCTCAC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr6:39835375_39835386delTCCACACCTCAC	ENST00000398904.2	+	6	700_711	c.518_529delTCCACACCTCAC	c.(517-531)atccacacctcactc>atc	p.HTSL174del	DAAM2_ENST00000538976.1_In_Frame_Del_p.HTSL174del|DAAM2_ENST00000274867.4_In_Frame_Del_p.HTSL174del			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	174	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)			p.H174_L177del(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GAGAGCCGCATCCACACCTCACTCATTGGCTG	0.557																																																1	Deletion - In frame(1)	ovary(1)	6																																								39943364	SO:0001651	inframe_deletion	23500			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.518_529delTCCACACCTCAC	6.37:g.39835375_39835386delTCCACACCTCAC	ENSP00000381876:p.His174_Leu177del	Somatic		Capture	Illumina GAIIx	4	39943353	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	In_Frame_Del	DEL	HMMPfam_Drf_FH3;HMMPfam_Drf_GBD;HMMPfam_FH2;superfamily_Formin homology 2 domain (FH2 domain);superfamily_ARM repeat	p.HTSL174in_frame_del	ENST00000398904.2	37	c.518_529	CCDS56426.1	6																																																																																			(deletion:cds_exon[39943264;39943597])	HMMPfam_Drf_GBD		0.557	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	DAAM2	protein_coding	OTTHUMT00000280648.1	TCCACACCTCAC			39943364	1	no_errors	NM_015345	genbank	human	validated	54_36p	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.958:0.999:1.000:0.997:0.998	-
LRFN2	57497	genome.wustl.edu	37	6	40359689	40359689	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr6:40359689G>A	ENST00000338305.6	-	3	2905	c.2363C>T	c.(2362-2364)aCg>aTg	p.T788M		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	788						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.T788M(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					CACCTAGACCGTGCTCTCCAT	0.592																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	6											45.0	47.0	46.0					6																	40359689		2203	4300	6503	40467667	SO:0001583	missense	57497			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.2363C>T	6.37:g.40359689G>A	ENSP00000345985:p.Thr788Met	Somatic		Capture	Illumina GAIIx	4	40467667	A5PKU3|Q5SYP9	Missense_Mutation	SNP	HMMPfam_LRR_1;HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_I-set;superfamily_Immunoglobulin;superfamily_L domain-like	p.T788M	ENST00000338305.6	37	c.2363	CCDS34443.1	6	.	.	.	.	.	.	.	.	.	.	G	20.2	3.950136	0.73787	.	.	ENSG00000156564	ENST00000338305	T	0.68025	-0.3	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.69780	0.3149	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.74244	-0.3728	10	0.87932	D	0	.	17.664	0.88199	0.0:0.0:1.0:0.0	.	788	Q9ULH4	LRFN2_HUMAN	M	788	ENSP00000345985:T788M	ENSP00000345985:T788M	T	-	2	0	LRFN2	40467667	1.000000	0.71417	0.974000	0.42286	0.889000	0.51656	7.873000	0.87193	2.523000	0.85059	0.555000	0.69702	ACG	-	NULL		0.592	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN2	protein_coding	OTTHUMT00000040488.1	G	XM_166372		40467667	-1	no_errors	NM_020737	genbank	human	provisional	54_36p	missense	SNP	1	A
PEX3	8504	genome.wustl.edu	37	6	143792585	143792585	+	Splice_Site	SNP	T	T	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr6:143792585T>A	ENST00000367591.4	+	6	585	c.522T>A	c.(520-522)gaT>gaA	p.D174E		NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	174					peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)	p.D174E(1)		endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		TACTTGGAGATGGTAAGATTC	0.299																																																1	Substitution - Missense(1)	ovary(1)	6											96.0	97.0	97.0					6																	143792585		2203	4297	6500	143834278	SO:0001630	splice_region_variant	8504			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.523+1T>A	6.37:g.143792585T>A		Somatic		Capture	Illumina GAIIx	4	143834278	Q6FGP5	Missense_Mutation	SNP	-	p.D174E	ENST00000367591.4	37	c.522	CCDS5199.1	6	.	.	.	.	.	.	.	.	.	.	T	12.64	1.998910	0.35226	.	.	ENSG00000034693	ENST00000344281;ENST00000367592;ENST00000367591	T;T	0.39229	1.09;1.09	5.32	2.84	0.33178	.	0.043317	0.85682	D	0.000000	T	0.10423	0.0255	N	0.21583	0.68	0.53688	D	0.999971	B;B	0.25048	0.0;0.117	B;B	0.29524	0.004;0.103	T	0.09271	-1.0682	10	0.06757	T	0.87	-17.9749	9.6308	0.39778	0.0:0.2067:0.0:0.7933	.	174;174	B4DV31;P56589	.;PEX3_HUMAN	E	130;130;174	ENSP00000356564:D130E;ENSP00000356563:D174E	ENSP00000344195:D130E	D	+	3	2	PEX3	143834278	0.999000	0.42202	1.000000	0.80357	0.985000	0.73830	0.446000	0.21694	0.906000	0.36621	0.482000	0.46254	GAT	-	NULL		0.299	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX3	protein_coding	OTTHUMT00000042525.1	T		Missense_Mutation	143834278	1	no_errors	NM_003630	genbank	human	reviewed	54_36p	missense	SNP	1	A
C7orf26	79034	genome.wustl.edu	37	7	6639732	6639732	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr7:6639732C>G	ENST00000344417.5	+	4	1120	c.853C>G	c.(853-855)Ctc>Gtc	p.L285V	C7orf26_ENST00000359073.5_Intron|C7orf26_ENST00000472693.1_3'UTR	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	285								p.L285V(1)		endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		AGACTCCCACCTCTTGTACTC	0.552																																																1	Substitution - Missense(1)	ovary(1)	7											66.0	52.0	57.0					7																	6639732		2203	4300	6503	6606257	SO:0001583	missense	79034			BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.853C>G	7.37:g.6639732C>G	ENSP00000340220:p.Leu285Val	Somatic		Capture	Illumina GAIIx	4	6606257	Q9BQ43	Missense_Mutation	SNP	-	p.L285V	ENST00000344417.5	37	c.853	CCDS5353.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.711|9.711	1.156969|1.156969	0.21454|0.21454	.|.	.|.	ENSG00000146576|ENSG00000146576	ENST00000344417|ENST00000445375	T|.	0.44083|.	0.93|.	5.08|5.08	-0.141|-0.141	0.13452|0.13452	.|.	0.494474|.	0.22207|.	N|.	0.063153|.	T|T	0.25382|0.25382	0.0617|0.0617	L|L	0.39898|0.39898	1.24|1.24	0.26968|0.26968	N|N	0.965645|0.965645	B|.	0.12013|.	0.005|.	B|.	0.14023|.	0.01|.	T|T	0.26710|0.26710	-1.0095|-1.0095	10|5	0.30078|.	T|.	0.28|.	-20.8845|-20.8845	0.9996|0.9996	0.01474|0.01474	0.1614:0.4117:0.1571:0.2698|0.1614:0.4117:0.1571:0.2698	.|.	285|.	Q96N11|.	CG026_HUMAN|.	V|R	285|22	ENSP00000340220:L285V|.	ENSP00000340220:L285V|.	L|P	+|+	1|2	0|0	C7orf26|C7orf26	6606257|6606257	0.018000|0.018000	0.18449|0.18449	0.737000|0.737000	0.30932|0.30932	0.955000|0.955000	0.61496|0.61496	-0.080000|-0.080000	0.11339|0.11339	0.057000|0.057000	0.16193|0.16193	0.555000|0.555000	0.69702|0.69702	CTC|CCT	-	NULL		0.552	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf26	protein_coding	OTTHUMT00000246844.2	C	NM_024067		6606257	1	no_errors	NM_024067	genbank	human	predicted	54_36p	missense	SNP	0.02	G
CCZ1B	221960	genome.wustl.edu	37	7	6864116	6864116	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr7:6864116A>C	ENST00000316731.8	-	3	854	c.282T>G	c.(280-282)aaT>aaG	p.N94K	CCZ1B_ENST00000538180.1_Intron	NM_198097.3	NP_932765.1	P86790	CCZ1B_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog B (S. cerevisiae)	94						lysosome (GO:0005764)|membrane (GO:0016020)		p.N94K(1)									CTTCTGGTTCATTGAAGAACT	0.348																																																1	Substitution - Missense(1)	ovary(1)	7											49.0	54.0	52.0					7																	6864116		2163	4288	6451	6830641	SO:0001583	missense	221960			BC010130	CCDS5354.1	7p22.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000146574	ENSG00000146574			21717	protein-coding gene	gene with protein product	"""similar to CGI-43 protein"""		"""chromosome 7 open reading frame 28B"""	C7orf28B		12477932	Standard	NM_198097		Approved	DKFZP586I1023, H_NH0577018.2, MGC19819	uc003sqx.2	P86790	OTTHUMG00000152441	ENST00000316731.8:c.282T>G	7.37:g.6864116A>C	ENSP00000314544:p.Asn94Lys	Somatic		Capture	Illumina GAIIx	4	6830641	A2RU45|O95766|Q9UG65|Q9Y359	Missense_Mutation	SNP	-	p.N94K	ENST00000316731.8	37	c.282	CCDS5354.1	7	.	.	.	.	.	.	.	.	.	.	.	4.847	0.157435	0.09236	.	.	ENSG00000146574	ENST00000316731	.	.	.	2.63	-0.00182	0.14032	.	0.291230	0.36740	N	0.002427	T	0.38612	0.1047	.	.	.	0.80722	D	1	B	0.10296	0.003	B	0.18263	0.021	T	0.05599	-1.0875	8	0.28530	T	0.3	-18.5222	5.7089	0.17923	0.7249:0.0:0.2751:0.0	.	94	P86791	CCZ1_HUMAN	K	94	.	ENSP00000314544:N94K	N	-	3	2	C7orf28B	6830641	1.000000	0.71417	0.998000	0.56505	0.277000	0.26821	2.001000	0.40825	-0.098000	0.12285	0.163000	0.16589	AAT	-	NULL		0.348	CCZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf28B	protein_coding	OTTHUMT00000246858.1	A	NM_198097		6830641	-1	no_errors	NM_198097	genbank	human	predicted	54_36p	missense	SNP	1	C
ANLN	54443	genome.wustl.edu	37	7	36483373	36483373	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr7:36483373G>C	ENST00000265748.2	+	22	3201	c.2980G>C	c.(2980-2982)Gaa>Caa	p.E994Q	ANLN_ENST00000396068.2_Missense_Mutation_p.E957Q	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	994	Localization to the cleavage furrow.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.E994Q(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						GACCATATTTGAAGATGTTAG	0.383																																																1	Substitution - Missense(1)	ovary(1)	7											143.0	124.0	130.0					7																	36483373		2203	4300	6503	36449898	SO:0001583	missense	54443			AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.2980G>C	7.37:g.36483373G>C	ENSP00000265748:p.Glu994Gln	Somatic		Capture	Illumina GAIIx	4	36449898	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	HMMPfam_PH;superfamily_PH domain-like	p.E994Q	ENST00000265748.2	37	c.2980	CCDS5447.1	7	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	28.4|28.4|28.4	4.916763|4.916763|4.916763	0.92249|0.92249|0.92249	.|.|.	.|.|.	ENSG00000011426|ENSG00000011426|ENSG00000011426	ENST00000265748;ENST00000396068|ENST00000457743|ENST00000428612	T;T|.|.	0.76578|.|.	-1.03;-1.03|.|.	5.43|5.43|5.43	5.43|5.43|5.43	0.79202|0.79202|0.79202	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.57695|0.57695|.	0.2071|0.2071|.	L|L|L	0.28649|0.28649|0.28649	0.875|0.875|0.875	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D;D|.|.	0.89917|.|.	1.0;1.0;1.0;1.0|.|.	D;D;D;D|.|.	0.91635|.|.	0.999;0.998;0.997;0.998|.|.	T|T|.	0.52335|0.52335|.	-0.8589|-0.8589|.	10|5|.	0.87932|.|.	D|.|.	0|.|.	-25.9669|-25.9669|-25.9669	18.2422|18.2422|18.2422	0.89971|0.89971|0.89971	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	871;956;957;994|.|.	B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6|.|.	.;.;.;ANLN_HUMAN|.|.	Q|F|S	994;957|215|158	ENSP00000265748:E994Q;ENSP00000379380:E957Q|.|.	ENSP00000265748:E994Q|.|.	E|L|X	+|+|+	1|3|2	0|2|2	ANLN|ANLN|ANLN	36449898|36449898|36449898	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	9.715000|9.715000|9.715000	0.98748|0.98748|0.98748	2.538000|2.538000|2.538000	0.85594|0.85594|0.85594	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAA|TTG|TGA	-	HMMPfam_PH		0.383	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANLN	protein_coding	OTTHUMT00000218582.3	G	NM_018685		36449898	1	no_errors	NM_018685	genbank	human	validated	54_36p	missense	SNP	1	C
ZNF862	643641	genome.wustl.edu	37	7	149545320	149545320	+	Silent	SNP	G	G	T			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr7:149545320G>T	ENST00000223210.4	+	4	983	c.738G>T	c.(736-738)ggG>ggT	p.G246G		NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	246					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.G246G(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						ACCCCCCAGGGCCTCTGGGAG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	7											20.0	22.0	21.0					7																	149545320		1842	4095	5937	149176253	SO:0001819	synonymous_variant	643641			AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.738G>T	7.37:g.149545320G>T		Somatic		Capture	Illumina GAIIx	4	149176253	A0AUL8	Silent	SNP	-	p.G246	ENST00000223210.4	37	c.738	CCDS47741.1	7																																																																																			-	NULL		0.587	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF862	protein_coding	OTTHUMT00000350165.1	G	NM_001099220		149176253	1	no_errors	NM_001099220	genbank	human	provisional	54_36p	silent	SNP	1	T
Unknown	0	genome.wustl.edu	37	9	90939772	90939772	+	IGR	SNP	C	C	T	rs372674806		TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chr9:90939772C>T								U6 (326522 upstream) : U3 (49411 downstream)																							CAGCCTCTCACGGAGGCATCT	0.547																																																0			9																																								90129592	SO:0001628	intergenic_variant	401537																															9.37:g.90939772C>T		Somatic		Capture	Illumina GAIIx	4	90129592		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.547					LOC401537			C			90129592	1	pseudogene	XR_017028	genbank	human	model	54_36p	rna	SNP	1	T
TKTL1	8277	genome.wustl.edu	37	X	153543601	153543601	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1463-01A-01W-0549-09	TCGA-24-1463-10A-01W-0549-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f	5a9ad498-1cf3-4777-8e89-3d27d0c2b64c	g.chrX:153543601G>A	ENST00000369915.3	+	7	1132	c.943G>A	c.(943-945)Gac>Aac	p.D315N	TKTL1_ENST00000369912.2_Missense_Mutation_p.D259N|TKTL1_ENST00000217905.7_Missense_Mutation_p.D55N	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	315					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)	p.D315N(1)		NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCTGGATGGTGACACCAGGTA	0.493																																																1	Substitution - Missense(1)	ovary(1)	X											195.0	152.0	166.0					X																	153543601		2203	4300	6503	153196795	SO:0001583	missense	8277			X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.943G>A	X.37:g.153543601G>A	ENSP00000358931:p.Asp315Asn	Somatic		Capture	Illumina GAIIx	4	153196795	A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	HMMPfam_Transketolase_N;HMMPfam_Transket_pyr;HMMPfam_Transketolase_C;superfamily_TK C-terminal domain-like;superfamily_Thiamin diphosphate-binding fold (THDP-binding)	p.D315N	ENST00000369915.3	37	c.943	CCDS35448.1	X	.	.	.	.	.	.	.	.	.	.	G	17.71	3.456995	0.63401	.	.	ENSG00000007350	ENST00000369915;ENST00000441970;ENST00000217905;ENST00000369912	D;D;D	0.96716	-4.1;-4.1;-4.1	4.1	4.1	0.47936	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.98704	0.9565	H	0.96720	3.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.99544	1.0964	10	0.87932	D	0	-35.208	14.3768	0.66884	0.0:0.0:1.0:0.0	.	55;309;315	B7Z7M4;B7Z7I0;P51854	.;.;TKTL1_HUMAN	N	315;259;55;259	ENSP00000358931:D315N;ENSP00000217905:D55N;ENSP00000358928:D259N	ENSP00000217905:D55N	D	+	1	0	TKTL1	153196795	1.000000	0.71417	0.998000	0.56505	0.076000	0.17211	9.232000	0.95325	1.882000	0.54519	0.292000	0.19580	GAC	-	HMMPfam_Transket_pyr		0.493	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TKTL1	protein_coding	OTTHUMT00000058923.1	G	NM_012253		153196795	1	no_errors	NM_012253	genbank	human	validated	54_36p	missense	SNP	1	A
