#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
INTS3	65123	genome.wustl.edu	37	1	153742690	153742690	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:153742690G>C	ENST00000318967.2	+	24	2974	c.2406G>C	c.(2404-2406)tgG>tgC	p.W802C	INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000435409.2_Missense_Mutation_p.W802C|INTS3_ENST00000512605.1_Missense_Mutation_p.W596C|INTS3_ENST00000456435.1_Missense_Mutation_p.W596C	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	803					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)		p.W802C(1)		breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GCCTAGACTGGGAGACCTTTG	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											169.0	167.0	168.0					1																	153742690		2203	4300	6503	152009314	SO:0001583	missense	65123			BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.2406G>C	1.37:g.153742690G>C	ENSP00000318641:p.Trp802Cys	Somatic		Capture	Illumina GAIIx	4	152009314	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	-	p.W802C	ENST00000318967.2	37	c.2406	CCDS1052.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.056752	0.76074	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.73806	0.3634	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.999	D;D;D	0.85130	0.997;0.977;0.99	T	0.75866	-0.3166	9	0.87932	D	0	.	16.4886	0.84191	0.0:0.0:1.0:0.0	.	596;803;802	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	C	802;596;802;596	.	ENSP00000318641:W802C	W	+	3	0	INTS3	152009314	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.526000	0.90588	2.757000	0.94681	0.655000	0.94253	TGG	-	NULL		0.517	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS3	protein_coding	OTTHUMT00000090045.2	G	NM_023015		152009314	1	no_errors	NM_023015	genbank	human	validated	54_36p	missense	SNP	1	C
ACTL8	81569	genome.wustl.edu	37	1	18152772	18152772	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:18152772C>A	ENST00000375406.1	+	3	1075	c.859C>A	c.(859-861)Ctg>Atg	p.L287M		NM_030812.2	NP_110439.2	Q9H568	ACTL8_HUMAN	actin-like 8	287					epithelial cell differentiation (GO:0030855)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.L287M(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	28		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		CGAGATCTCCCTGCGCCCCCT	0.642											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											39.0	42.0	41.0					1																	18152772		2203	4300	6503	18025359	SO:0001583	missense	81569			AK057339	CCDS183.1	1p36.2-p35	2009-03-25			ENSG00000117148	ENSG00000117148			24018	protein-coding gene	gene with protein product	"""cancer/testis antigen 57"""						Standard	NM_030812		Approved	CT57	uc001bat.3	Q9H568	OTTHUMG00000002512	ENST00000375406.1:c.859C>A	1.37:g.18152772C>A	ENSP00000364555:p.Leu287Met	Somatic	723	Capture	Illumina GAIIx	4	18025359	Q13104|Q96M75	Missense_Mutation	SNP	-	p.L287M	ENST00000375406.1	37	c.859	CCDS183.1	1	.	.	.	.	.	.	.	.	.	.	C	7.931	0.740665	0.15642	.	.	ENSG00000117148	ENST00000375406	D	0.95885	-3.84	4.94	-9.89	0.00464	.	2.687210	0.01539	N	0.019156	D	0.91222	0.7234	L	0.42245	1.32	0.09310	N	1	B	0.18968	0.032	B	0.19666	0.026	T	0.79342	-0.1843	10	0.87932	D	0	-4.2969	6.379	0.21523	0.4903:0.1754:0.2764:0.0579	.	287	Q9H568	ACTL8_HUMAN	M	287	ENSP00000364555:L287M	ENSP00000364555:L287M	L	+	1	2	ACTL8	18025359	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.144000	0.00286	-4.389000	0.00052	-1.045000	0.02358	CTG	-	NULL		0.642	ACTL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL8	protein_coding	OTTHUMT00000007143.1	C	NM_030812		18025359	1	no_errors	NM_030812	genbank	human	provisional	54_36p	missense	SNP		A
NUP210L	91181	genome.wustl.edu	37	1	153995748	153995748	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:153995748A>T	ENST00000368559.3	-	31	4219	c.4148T>A	c.(4147-4149)gTg>gAg	p.V1383E	NUP210L_ENST00000271854.3_Missense_Mutation_p.V1383E|NUP210L_ENST00000368553.1_Missense_Mutation_p.V316E	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1383					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.V1383E(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TTGGCTGCTCACTCGCAGGTA	0.473																																																1	Substitution - Missense(1)	ovary(1)	1											99.0	101.0	100.0					1																	153995748		1982	4157	6139	152262372	SO:0001583	missense	91181			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.4148T>A	1.37:g.153995748A>T	ENSP00000357547:p.Val1383Glu	Somatic		Capture	Illumina GAIIx	4	152262372	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	-	p.V1383E	ENST00000368559.3	37	c.4148	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	A	17.57	3.422262	0.62622	.	.	ENSG00000143552	ENST00000368559;ENST00000368553;ENST00000271854	T;T;T	0.26223	3.3;1.75;3.05	5.18	5.18	0.71444	.	0.496846	0.21714	N	0.070221	T	0.10035	0.0246	N	0.24115	0.695	0.43007	D	0.994533	B;B	0.20671	0.047;0.047	B;B	0.21708	0.036;0.036	T	0.05225	-1.0898	10	0.52906	T	0.07	-4.1535	13.4177	0.60979	1.0:0.0:0.0:0.0	.	1383;1383	E7EP56;Q5VU65	.;P210L_HUMAN	E	1383;316;1383	ENSP00000357547:V1383E;ENSP00000357541:V316E;ENSP00000271854:V1383E	ENSP00000271854:V1383E	V	-	2	0	NUP210L	152262372	0.998000	0.40836	0.936000	0.37596	0.991000	0.79684	6.798000	0.75155	2.180000	0.69256	0.455000	0.32223	GTG	-	NULL		0.473	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	protein_coding	OTTHUMT00000087270.3	A	NM_207308		152262372	-1	no_errors	NM_207308	genbank	human	validated	54_36p	missense	SNP	0.99	T
BRINP3	339479	genome.wustl.edu	37	1	190203607	190203607	+	Splice_Site	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:190203607C>T	ENST00000367462.3	-	5	850	c.619G>A	c.(619-621)Gta>Ata	p.V207I	BRINP3_ENST00000534846.1_Splice_Site_p.V105I	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	207	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.V207I(1)									GTTTCTGTTACCTGGCAAACA	0.378																																																1	Substitution - Missense(1)	ovary(1)	1											110.0	93.0	99.0					1																	190203607		2203	4300	6503	188470230	SO:0001630	splice_region_variant	339479			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.619-1G>A	1.37:g.190203607C>T		Somatic		Capture	Illumina GAIIx	4	188470230	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	HMMPfam_MACPF	p.V207I	ENST00000367462.3	37	c.619	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684419	0.68157	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.23950	2.14;1.88	5.87	5.87	0.94306	Membrane attack complex component/perforin (MACPF) domain (1);	0.000000	0.85682	D	0.000000	T	0.47857	0.1468	L	0.58101	1.795	0.80722	D	1	D;D	0.61697	0.99;0.984	D;D	0.70935	0.971;0.935	T	0.14420	-1.0473	10	0.37606	T	0.19	.	17.6929	0.88273	0.0:1.0:0.0:0.0	.	105;207	B7Z260;Q76B58	.;FAM5C_HUMAN	I	207;105	ENSP00000356432:V207I;ENSP00000438022:V105I	ENSP00000356432:V207I	V	-	1	0	FAM5C	188470230	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.706000	0.84615	2.775000	0.95449	0.650000	0.86243	GTA	-	NULL		0.378	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	protein_coding	OTTHUMT00000086278.1	C	NM_199051	Missense_Mutation	188470230	-1	no_errors	NM_199051	genbank	human	provisional	54_36p	missense	SNP	1	T
SLC30A1	7779	genome.wustl.edu	37	1	211749372	211749372	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:211749372A>C	ENST00000367001.4	-	2	1011	c.882T>G	c.(880-882)ttT>ttG	p.F294L		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	294					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)	p.F294L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		TTATTTCTACAAATGCTTTGC	0.373																																																1	Substitution - Missense(1)	ovary(1)	1											117.0	123.0	121.0					1																	211749372		2203	4300	6503	209815995	SO:0001583	missense	7779			AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.882T>G	1.37:g.211749372A>C	ENSP00000355968:p.Phe294Leu	Somatic		Capture	Illumina GAIIx	4	209815995	Q0VAK9|Q9BZF6	Missense_Mutation	SNP	-	p.F294L	ENST00000367001.4	37	c.882	CCDS1499.1	1	.	.	.	.	.	.	.	.	.	.	A	7.597	0.672016	0.14776	.	.	ENSG00000170385	ENST00000367001	T	0.62105	0.05	5.44	5.44	0.79542	.	0.411034	0.28996	N	0.013463	T	0.47691	0.1459	L	0.38175	1.15	0.28598	N	0.909323	B	0.02656	0.0	B	0.06405	0.002	T	0.34477	-0.9827	10	0.10902	T	0.67	-1.9283	10.4965	0.44780	0.819:0.0:0.0:0.181	.	294	Q9Y6M5	ZNT1_HUMAN	L	294	ENSP00000355968:F294L	ENSP00000355968:F294L	F	-	3	2	SLC30A1	209815995	0.092000	0.21681	0.998000	0.56505	0.987000	0.75469	0.623000	0.24447	2.061000	0.61500	0.460000	0.39030	TTT	-	NULL		0.373	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A1	protein_coding	OTTHUMT00000104738.2	A			209815995	-1	no_errors	NM_021194	genbank	human	validated	54_36p	missense	SNP	0.97	C
ITPKB	3707	genome.wustl.edu	37	1	226923596	226923596	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:226923596G>A	ENST00000272117.3	-	1	1563	c.1564C>T	c.(1564-1566)Cgt>Tgt	p.R522C	ITPKB_ENST00000366784.1_Missense_Mutation_p.R522C|ITPKB_ENST00000429204.1_Missense_Mutation_p.R522C			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	522					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.R48C(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CCTGTGCCACGCGTCCAAGCC	0.627																																					Colon(84;110 1851 5306 33547)											1	Substitution - Missense(1)	ovary(1)	1											49.0	46.0	47.0					1																	226923596		2203	4300	6503	224990219	SO:0001583	missense	3707			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1564C>T	1.37:g.226923596G>A	ENSP00000272117:p.Arg522Cys	Somatic		Capture	Illumina GAIIx	4	224990219	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	HMMPfam_IPK;superfamily_SAICAR synthase-like	p.R522C	ENST00000272117.3	37	c.1564	CCDS1555.1	1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.936415	0.34189	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.22945	1.93;1.93;1.95	5.43	-6.94	0.01633	.	0.995923	0.08142	N	0.991498	T	0.13030	0.0316	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34378	-0.9831	10	0.54805	T	0.06	1.0444	11.7323	0.51744	0.3033:0.1225:0.5743:0.0	.	522	P27987	IP3KB_HUMAN	C	522	ENSP00000272117:R522C;ENSP00000411152:R522C;ENSP00000355748:R522C	ENSP00000272117:R522C	R	-	1	0	ITPKB	224990219	0.003000	0.15002	0.002000	0.10522	0.313000	0.28021	-0.346000	0.07760	-1.442000	0.01955	-1.626000	0.00786	CGT	-	NULL		0.627	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	protein_coding	OTTHUMT00000091632.1	G	NM_002221		224990219	-1	no_errors	NM_002221	genbank	human	reviewed	54_36p	missense	SNP		A
BAI2	576	genome.wustl.edu	37	1	32221992	32221992	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:32221992G>T	ENST00000373658.3	-	4	787	c.446C>A	c.(445-447)aCc>aAc	p.T149N	BAI2_ENST00000373655.2_Missense_Mutation_p.T149N|BAI2_ENST00000398547.1_Missense_Mutation_p.T137N|BAI2_ENST00000398556.3_Missense_Mutation_p.T152N|BAI2_ENST00000257070.4_Missense_Mutation_p.T149N|BAI2_ENST00000398542.1_Missense_Mutation_p.T137N|BAI2_ENST00000398538.1_Missense_Mutation_p.T137N|BAI2_ENST00000527361.1_Missense_Mutation_p.T149N|MIR4254_ENST00000581063.1_RNA	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	149					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T149N(1)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GTGCAGGAAGGTAAAGGGGCC	0.692																																																1	Substitution - Missense(1)	ovary(1)	1											21.0	23.0	22.0					1																	32221992		2201	4299	6500	31994579	SO:0001583	missense	576			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.446C>A	1.37:g.32221992G>T	ENSP00000362762:p.Thr149Asn	Somatic		Capture	Illumina GAIIx	4	31994579	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	-	p.T149N	ENST00000373658.3	37	c.446	CCDS346.2	1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.714252	0.48622	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T	0.47869	1.51;1.71;0.88;0.88;1.88;0.83;0.83;0.9;1.49;1.35	5.08	5.08	0.68730	.	0.000000	0.42172	D	0.000760	T	0.48768	0.1518	L	0.43152	1.355	0.80722	D	1	P;P;P;B;P;P	0.49090	0.9;0.919;0.865;0.118;0.865;0.788	B;P;P;B;P;B	0.46076	0.291;0.503;0.503;0.033;0.503;0.306	T	0.53989	-0.8360	10	0.72032	D	0.01	.	17.6069	0.88040	0.0:0.0:1.0:0.0	.	137;149;137;137;149;149	A2A3C3;O60241-4;O60241-3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	N	152;137;149;149;137;149;149;137;142;183	ENSP00000381564:T152N;ENSP00000381555:T137N;ENSP00000362762:T149N;ENSP00000362759:T149N;ENSP00000381550:T137N;ENSP00000257070:T149N;ENSP00000435397:T149N;ENSP00000381548:T137N;ENSP00000410921:T142N;ENSP00000437219:T183N	ENSP00000257070:T149N	T	-	2	0	BAI2	31994579	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	9.266000	0.95659	2.536000	0.85505	0.462000	0.41574	ACC	-	NULL		0.692	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	protein_coding	OTTHUMT00000381838.1	G	NM_001703		31994579	-1	no_errors	NM_001703	genbank	human	reviewed	54_36p	missense	SNP	1	T
MARCKSL1	65108	genome.wustl.edu	37	1	32800410	32800410	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:32800410G>A	ENST00000329421.7	-	2	721	c.376C>T	c.(376-378)Cag>Tag	p.Q126*		NM_023009.6	NP_075385.1	P49006	MRP_HUMAN	MARCKS-like 1	126					positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.Q126*(1)		breast(1)|large_intestine(3)|lung(1)|ovary(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CCCTGCTCCTGCTCTTCCTCT	0.612																																																1	Substitution - Nonsense(1)	ovary(1)	1											49.0	46.0	47.0					1																	32800410		2203	4300	6503	32572997	SO:0001587	stop_gained	65108			AF031640	CCDS361.1	1p35.1	2008-02-05	2004-11-17	2004-11-17	ENSG00000175130	ENSG00000175130			7142	protein-coding gene	gene with protein product		602940	"""MARCKS-like protein"""	MLP		9598313	Standard	NM_023009		Approved	F52, MacMARCKS, MLP1	uc001bvd.4	P49006	OTTHUMG00000007589	ENST00000329421.7:c.376C>T	1.37:g.32800410G>A	ENSP00000362638:p.Gln126*	Somatic		Capture	Illumina GAIIx	4	32572997	D3DPQ0|Q5TEE6|Q6NXS5	Nonsense_Mutation	SNP	HMMPfam_MARCKS	p.Q126*	ENST00000329421.7	37	c.376	CCDS361.1	1	.	.	.	.	.	.	.	.	.	.	G	37	5.996753	0.97184	.	.	ENSG00000175130	ENST00000329421	.	.	.	4.77	2.69	0.31865	.	0.414382	0.21644	N	0.071281	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-3.3247	12.3088	0.54918	0.0:0.4802:0.5198:0.0	.	.	.	.	X	126	.	ENSP00000362638:Q126X	Q	-	1	0	MARCKSL1	32572997	0.999000	0.42202	1.000000	0.80357	0.982000	0.71751	2.033000	0.41136	1.314000	0.45095	0.561000	0.74099	CAG	-	NULL		0.612	MARCKSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCKSL1	protein_coding	OTTHUMT00000020059.3	G	NM_023009		32572997	-1	no_errors	NM_023009	genbank	human	validated	54_36p	nonsense	SNP	1	A
AZIN2	113451	genome.wustl.edu	37	1	33560309	33560309	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:33560309G>C	ENST00000294517.6	+	8	1335	c.748G>C	c.(748-750)Gaa>Caa	p.E250Q	ADC_ENST00000373440.1_Intron|ADC_ENST00000373443.3_Missense_Mutation_p.E250Q|ADC_ENST00000373441.1_Missense_Mutation_p.E250Q|ADC_ENST00000484656.1_3'UTR|ADC_ENST00000398167.1_Missense_Mutation_p.E250Q|ADC_ENST00000358680.3_Intron	NM_052998.2	NP_443724.1	Q96A70	AZIN2_HUMAN		250					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of protein catabolic process (GO:0042177)|ornithine metabolic process (GO:0006591)|polyamine biosynthetic process (GO:0006596)|polyamine metabolic process (GO:0006595)|positive regulation of catalytic activity (GO:0043085)|positive regulation of polyamine transmembrane transport (GO:1902269)|putrescine transport (GO:0015847)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|trans-Golgi network membrane organization (GO:0098629)	axon (GO:0030424)|cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|granular vesicle (GO:1990005)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	catalytic activity (GO:0003824)|ornithine decarboxylase activator activity (GO:0042978)|putrescine transmembrane transporter activity (GO:0015489)	p.E250Q(1)		NS(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)			L-Arginine(DB00125)	AGTGAGATTTGAAGAGGTAAC	0.587											OREG0013339	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											65.0	67.0	67.0					1																	33560309		2203	4300	6503	33332896	SO:0001583	missense	113451																														ENST00000294517.6:c.748G>C	1.37:g.33560309G>C	ENSP00000294517:p.Glu250Gln	Somatic	841	Capture	Illumina GAIIx	4	33332896	B2RDU5|D3DPQ9|Q5TIF4|Q5TIF5|Q5TIF6|Q8TF56|Q96L54|Q96L55|Q96L56|Q96L57|Q96MD9	Missense_Mutation	SNP	HMMPfam_Orn_DAP_Arg_deC;HMMPfam_Orn_Arg_deC_N;superfamily_Alanine racemase C-terminal domain-like;superfamily_PLP-binding barrel	p.E250Q	ENST00000294517.6	37	c.748	CCDS375.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.288028	0.95517	.	.	ENSG00000142920	ENST00000294517;ENST00000341637;ENST00000373443;ENST00000398167;ENST00000373441	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.33	5.33	0.75918	Orn/DAP/Arg decarboxylase 2, N-terminal (1);Alanine racemase/group IV decarboxylase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.64692	0.2621	M	0.67625	2.065	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.998	D;D;D;P	0.83275	0.96;0.996;0.925;0.876	T	0.66630	-0.5875	10	0.72032	D	0.01	-5.4048	18.1576	0.89699	0.0:0.0:1.0:0.0	.	250;250;155;250	Q96A70-2;Q96A70-3;D3DPR0;Q96A70	.;.;.;ADC_HUMAN	Q	250;262;250;250;250	ENSP00000294517:E250Q;ENSP00000362542:E250Q;ENSP00000381233:E250Q;ENSP00000362540:E250Q	ENSP00000294517:E250Q	E	+	1	0	ADC	33332896	1.000000	0.71417	0.998000	0.56505	0.848000	0.48234	7.662000	0.83803	2.663000	0.90544	0.655000	0.94253	GAA	-	HMMPfam_Orn_Arg_deC_N		0.587	ADC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADC	protein_coding	OTTHUMT00000011867.1	G			33332896	1	no_errors	NM_052998	genbank	human	validated	54_36p	missense	SNP	1	C
HIVEP3	59269	genome.wustl.edu	37	1	42047896	42047896	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:42047896A>G	ENST00000372583.1	-	4	3458	c.2573T>C	c.(2572-2574)aTc>aCc	p.I858T	HIVEP3_ENST00000247584.5_Missense_Mutation_p.I858T|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000429157.2_Missense_Mutation_p.I858T|HIVEP3_ENST00000372584.1_Missense_Mutation_p.I858T	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	858	Glu/Pro-rich.|No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I858T(1)		NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				AGTTACTAGGATCTCAGGAAC	0.627																																																1	Substitution - Missense(1)	ovary(1)	1											71.0	81.0	78.0					1																	42047896		2203	4300	6503	41820483	SO:0001583	missense	59269			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.2573T>C	1.37:g.42047896A>G	ENSP00000361664:p.Ile858Thr	Somatic		Capture	Illumina GAIIx	4	41820483	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.I858T	ENST00000372583.1	37	c.2573	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.098885	0.76870	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	4.95	4.95	0.65309	.	0.000000	0.53938	D	0.000051	T	0.68174	0.2972	M	0.76727	2.345	0.52501	D	0.999951	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	T	0.72868	-0.4162	10	0.87932	D	0	5.4401	14.4275	0.67225	1.0:0.0:0.0:0.0	.	858;858	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	T	858	ENSP00000361665:I858T;ENSP00000361664:I858T;ENSP00000247584:I858T;ENSP00000410828:I858T	ENSP00000247584:I858T	I	-	2	0	HIVEP3	41820483	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.139000	0.94554	2.071000	0.62044	0.379000	0.24179	ATC	-	NULL		0.627	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	protein_coding	OTTHUMT00000016978.1	A	NM_024503		41820483	-1	no_errors	NM_024503	genbank	human	validated	54_36p	missense	SNP	1	G
WLS	79971	genome.wustl.edu	37	1	68628709	68628709	+	Intron	SNP	C	C	T	rs578188830		TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:68628709C>T	ENST00000262348.4	-	3	633				GNG12-AS1_ENST00000413628.1_RNA|WLS_ENST00000370976.3_Intron|WLS_ENST00000354777.2_Intron|WLS_ENST00000540432.1_Intron|GNG12-AS1_ENST00000420587.1_RNA	NM_024911.6	NP_079187.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator						anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						GATCTGGGGGCGGATACCTTC	0.552																																																0			1																																								68401297	SO:0001627	intron_variant	645291			BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000262348.4:c.380-3779G>A	1.37:g.68628709C>T		Somatic		Capture	Illumina GAIIx	4	68401297	B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	RNA	SNP	-	NULL	ENST00000262348.4	37	NULL	CCDS642.1	1																																																																																			-	-		0.552	WLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC645291	protein_coding	OTTHUMT00000025368.1	C	NM_024911		68401297	-1	pseudogene	XR_017617	genbank	human	model	54_36p	rna	SNP	1	T
NLRP3	114548	genome.wustl.edu	37	1	247582273	247582273	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr1:247582273C>G	ENST00000336119.3	+	1	923	c.177C>G	c.(175-177)atC>atG	p.I59M	NLRP3_ENST00000366496.2_Missense_Mutation_p.I59M|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366497.2_Missense_Mutation_p.I59M|NLRP3_ENST00000391828.3_Missense_Mutation_p.I59M|NLRP3_ENST00000348069.2_Missense_Mutation_p.I59M|NLRP3_ENST00000391827.2_Missense_Mutation_p.I59M	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	59	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.I59I(1)|p.I59M(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CGCTAATGATCGACTTCAATG	0.547																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	1											69.0	60.0	63.0					1																	247582273		2203	4300	6503	245648896	SO:0001583	missense	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.177C>G	1.37:g.247582273C>G	ENSP00000337383:p.Ile59Met	Somatic		Capture	Illumina GAIIx	4	245648896	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	-	p.I59M	ENST00000336119.3	37	c.177	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.770397	0.49680	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75	4.49	-8.97	0.00758	Pyrin (2);DEATH-like (2);	0.124322	0.36740	N	0.002437	T	0.54382	0.1855	M	0.67397	2.05	0.23869	N	0.996614	D;D;D;D;D	0.76494	0.998;0.985;0.999;0.999;0.999	D;D;D;D;D	0.81914	0.976;0.913;0.989;0.983;0.995	T	0.62699	-0.6799	10	0.30854	T	0.27	.	11.7747	0.51979	0.1183:0.6355:0.0:0.2462	.	59;59;59;59;59	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	M	59	ENSP00000375704:I59M;ENSP00000355453:I59M;ENSP00000337383:I59M;ENSP00000294752:I59M;ENSP00000355452:I59M;ENSP00000375703:I59M	ENSP00000337383:I59M	I	+	3	3	NLRP3	245648896	0.000000	0.05858	0.269000	0.24586	0.970000	0.65996	-3.326000	0.00511	-2.521000	0.00497	-0.415000	0.06103	ATC	-	NULL		0.547	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	protein_coding	OTTHUMT00000097740.1	C	NM_004895		245648896	1	no_errors	NM_001079821	genbank	human	reviewed	54_36p	missense	SNP	0.93	G
AKR1C1	1645	genome.wustl.edu	37	10	5014864	5014864	+	Silent	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr10:5014864C>T	ENST00000380872.4	+	7	961	c.769C>T	c.(769-771)Ctg>Ttg	p.L257L	AKR1C1_ENST00000477661.1_3'UTR|AKR1C1_ENST00000434459.2_Silent_p.L257L	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	257					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.L257L(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	CCTGATTGCCCTGCGCTACCA	0.607																																					Colon(130;2054 2316 13360 15380)											1	Substitution - coding silent(1)	ovary(1)	10											92.0	89.0	90.0					10																	5014864		2203	4300	6503	5004864	SO:0001819	synonymous_variant	1645			D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.769C>T	10.37:g.5014864C>T		Somatic		Capture	Illumina GAIIx	4	5004864	P52896|Q5SR15|Q7M4N2|Q9UCX2	Silent	SNP	HMMPfam_Aldo_ket_red;superfamily_NAD(P)-linked oxidoreductase	p.L257	ENST00000380872.4	37	c.769	CCDS7061.1	10																																																																																			-	HMMPfam_Aldo_ket_red		0.607	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1C1	protein_coding	OTTHUMT00000046523.2	C	NM_001353		5004864	1	no_errors	NM_001353	genbank	human	reviewed	54_36p	silent	SNP	1	T
PCDH15	65217	genome.wustl.edu	37	10	55955463	55955463	+	Silent	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr10:55955463G>A	ENST00000320301.6	-	11	1679	c.1285C>T	c.(1285-1287)Ctg>Ttg	p.L429L	PCDH15_ENST00000395446.1_Silent_p.L429L|PCDH15_ENST00000361849.3_Silent_p.L429L|PCDH15_ENST00000409834.1_Silent_p.L33L|PCDH15_ENST00000373955.1_Silent_p.L429L|PCDH15_ENST00000395433.1_Silent_p.L407L|PCDH15_ENST00000395438.1_Silent_p.L429L|PCDH15_ENST00000395440.1_Silent_p.L429L|PCDH15_ENST00000373957.3_Silent_p.L407L|PCDH15_ENST00000414778.1_Silent_p.L434L|PCDH15_ENST00000437009.1_Silent_p.L429L|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395445.1_Silent_p.L429L|PCDH15_ENST00000395432.2_Silent_p.L392L|PCDH15_ENST00000373965.2_Silent_p.L429L|PCDH15_ENST00000395430.1_Silent_p.L429L	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	429	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.L429L(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TCCTTGTCCAGAGCTACTATT	0.373										HNSCC(58;0.16)																																						1	Substitution - coding silent(1)	ovary(1)	10											103.0	97.0	99.0					10																	55955463		2203	4300	6503	55625469	SO:0001819	synonymous_variant	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1285C>T	10.37:g.55955463G>A		Somatic		Capture	Illumina GAIIx	4	55625469	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	HMMPfam_Cadherin;superfamily_Cadherin-like	p.L429	ENST00000320301.6	37	c.1285	CCDS7248.1	10																																																																																			-	HMMPfam_Cadherin		0.373	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	protein_coding	OTTHUMT00000048121.2	G	NM_033056		55625469	-1	no_errors	NM_033056	genbank	human	reviewed	54_36p	silent	SNP	1	A
DLG5	9231	genome.wustl.edu	37	10	79601711	79601725	+	In_Frame_Del	DEL	CAGCTCCACTTCGGT	CAGCTCCACTTCGGT	-	rs112570162|rs372158883|rs563925589	byFrequency	TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	CAGCTCCACTTCGGT	CAGCTCCACTTCGGT	CAGCTCCACTTCGGT	-	CAGCTCCACTTCGGT	CAGCTCCACTTCGGT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr10:79601711_79601725delCAGCTCCACTTCGGT	ENST00000372391.2	-	7	1356_1370	c.1351_1365delACCGAAGTGGAGCTG	c.(1351-1365)accgaagtggagctgdel	p.TEVEL451del	DLG5_ENST00000372388.2_In_Frame_Del_p.TEVEL451del	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	451					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)	p.T451_L455del(1)		breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TGGACTCGGCCAGCTCCACTTCGGTCTGCAGCTTG	0.595																																																1	Deletion - In frame(1)	ovary(1)	10																																								79271731	SO:0001651	inframe_deletion	9231			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.1351_1365delACCGAAGTGGAGCTG	10.37:g.79601711_79601725delCAGCTCCACTTCGGT	ENSP00000361467:p.Thr451_Leu455del	Somatic		Capture	Illumina GAIIx	4	79271717	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	In_Frame_Del	DEL	-	p.TEVEL451in_frame_del	ENST00000372391.2	37	c.1365_1351	CCDS7353.2	10																																																																																			(deletion:cds_exon[79271645;79271957])	NULL		0.595	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLG5	protein_coding	OTTHUMT00000048900.2	CAGCTCCACTTCGGT			79271731	-1	no_errors	NM_004747	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.936:1.000:1.000	-
IGSF22	283284	genome.wustl.edu	37	11	18743090	18743090	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr11:18743090C>G	ENST00000513874.1	-	4	509	c.370G>C	c.(370-372)Gtg>Ctg	p.V124L	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	124	Ig-like 1.							p.V124L(1)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						ACCTTCAGCACGTGTTCCTTG	0.607											OREG0020822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	11											126.0	130.0	129.0					11																	18743090		1959	4137	6096	18699666	SO:0001583	missense	283284			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.370G>C	11.37:g.18743090C>G	ENSP00000421191:p.Val124Leu	Somatic	90	Capture	Illumina GAIIx	4	18699666	A6NNA0|D6RGV7	Missense_Mutation	SNP	HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_I-set;superfamily_Immunoglobulin	p.V124L	ENST00000513874.1	37	c.370	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482728	0.63962	.	.	ENSG00000179057	ENST00000513874	T	0.66638	-0.22	5.06	2.12	0.27331	.	0.262077	0.19877	U	0.104076	T	0.50905	0.1643	L	0.38953	1.18	0.22401	N	0.999133	B	0.29988	0.264	B	0.28991	0.097	T	0.35599	-0.9782	10	0.34782	T	0.22	.	6.8068	0.23782	0.0:0.6081:0.0:0.3919	.	124	D6RGV7	.	L	124	ENSP00000421191:V124L	ENSP00000322422:V124L	V	-	1	0	IGSF22	18699666	0.206000	0.23470	0.984000	0.44739	0.988000	0.76386	0.485000	0.22324	0.241000	0.21283	0.655000	0.94253	GTG	-	HMMPfam_I-set		0.607	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	protein_coding	OTTHUMT00000360850.2	C	NM_173588		18699666	-1	no_errors	NM_173588	genbank	human	validated	54_36p	missense	SNP	0.99	G
SYT13	57586	genome.wustl.edu	37	11	45274062	45274062	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr11:45274062G>C	ENST00000020926.3	-	4	867	c.756C>G	c.(754-756)caC>caG	p.H252Q	CTD-2560E9.5_ENST00000531663.1_RNA|CTD-2560E9.5_ENST00000534342.1_RNA	NM_001247987.1|NM_020826.2	NP_001234916.1|NP_065877.1	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	252	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				vesicle-mediated transport (GO:0016192)	integral component of plasma membrane (GO:0005887)|transport vesicle (GO:0030133)		p.H252Q(1)		breast(1)|large_intestine(3)|lung(16)|ovary(1)|skin(2)	23						CGGCCACGCTGTGACGGGAGA	0.687											OREG0020928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	11											46.0	46.0	46.0					11																	45274062		2203	4298	6501	45230638	SO:0001583	missense	57586			AB037848	CCDS31470.1	11p12-p11	2013-01-21			ENSG00000019505	ENSG00000019505		"""Synaptotagmins"""	14962	protein-coding gene	gene with protein product		607716				11171101	Standard	NM_020826		Approved	KIAA1427	uc001myq.2	Q7L8C5	OTTHUMG00000166504	ENST00000020926.3:c.756C>G	11.37:g.45274062G>C	ENSP00000020926:p.His252Gln	Somatic	930	Capture	Illumina GAIIx	4	45230638	A8K4P4|D3DQP1|Q9BQS3|Q9H041|Q9P2C0	Missense_Mutation	SNP	HMMPfam_C2;superfamily_C2 domain (Calcium/lipid-binding domain CaLB)	p.H252Q	ENST00000020926.3	37	c.756	CCDS31470.1	11	.	.	.	.	.	.	.	.	.	.	G	20.1	3.938200	0.73557	.	.	ENSG00000019505	ENST00000020926	T	0.08282	3.11	5.85	3.96	0.45880	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.053328	0.85682	D	0.000000	T	0.18759	0.0450	M	0.63843	1.955	0.49687	D	0.999817	D	0.60160	0.987	P	0.55345	0.774	T	0.00822	-1.1552	10	0.87932	D	0	.	12.054	0.53524	0.1422:0.0:0.8578:0.0	.	252	Q7L8C5	SYT13_HUMAN	Q	252	ENSP00000020926:H252Q	ENSP00000020926:H252Q	H	-	3	2	SYT13	45230638	1.000000	0.71417	1.000000	0.80357	0.457000	0.32468	1.982000	0.40638	1.452000	0.47756	0.561000	0.74099	CAC	-	HMMPfam_C2		0.687	SYT13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT13	protein_coding	OTTHUMT00000390110.1	G	NM_020826		45230638	-1	no_errors	NM_020826	genbank	human	validated	54_36p	missense	SNP	0.99	C
OR8H2	390151	genome.wustl.edu	37	11	55872963	55872963	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr11:55872963T>G	ENST00000313503.1	+	1	445	c.445T>G	c.(445-447)Tat>Gat	p.Y149D		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y149D(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CACTGGGCCTTATGTGATTGG	0.453										HNSCC(53;0.14)																																						1	Substitution - Missense(1)	ovary(1)	11											216.0	194.0	201.0					11																	55872963		2201	4296	6497	55629539	SO:0001583	missense	390151			AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.445T>G	11.37:g.55872963T>G	ENSP00000323982:p.Tyr149Asp	Somatic		Capture	Illumina GAIIx	4	55629539	Q6IFC1	Missense_Mutation	SNP	-	p.Y149D	ENST00000313503.1	37	c.445	CCDS31518.1	11	.	.	.	.	.	.	.	.	.	.	t	15.60	2.881340	0.51801	.	.	ENSG00000181767	ENST00000313503	T	0.38560	1.13	3.58	2.41	0.29592	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000204	T	0.68091	0.2963	M	0.92555	3.32	0.09310	N	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.60875	-0.7176	10	0.87932	D	0	.	9.3203	0.37959	0.0:0.0902:0.0:0.9098	.	149	Q8N162	OR8H2_HUMAN	D	149	ENSP00000323982:Y149D	ENSP00000323982:Y149D	Y	+	1	0	OR8H2	55629539	0.998000	0.40836	0.005000	0.12908	0.006000	0.05464	7.507000	0.81676	0.513000	0.28278	0.362000	0.22060	TAT	-	NULL		0.453	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H2	protein_coding	OTTHUMT00000391540.1	T	NM_001005200		55629539	1	no_errors	NM_001005200	genbank	human	provisional	54_36p	missense	SNP	0.396	G
FGF23	8074	genome.wustl.edu	37	12	4479676	4479676	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr12:4479676C>T	ENST00000237837.1	-	3	734	c.589G>A	c.(589-591)Gcc>Acc	p.A197T		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	197					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.A197T(1)		NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			GTCATCCGGGCCCGGGGCTTC	0.692																																																1	Substitution - Missense(1)	ovary(1)	12											16.0	20.0	19.0					12																	4479676		2191	4291	6482	4349937	SO:0001583	missense	8074			AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.589G>A	12.37:g.4479676C>T	ENSP00000237837:p.Ala197Thr	Somatic		Capture	Illumina GAIIx	4	4349937	Q4V758	Missense_Mutation	SNP	HMMPfam_FGF,superfamily_Cytokine	p.A197T	ENST00000237837.1	37	c.589	CCDS8526.1	12	.	.	.	.	.	.	.	.	.	.	C	2.628	-0.287044	0.05605	.	.	ENSG00000118972	ENST00000237837	D	0.94092	-3.35	4.84	1.96	0.26148	.	0.835496	0.11122	N	0.597373	D	0.84215	0.5423	N	0.19112	0.55	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.68284	-0.5449	10	0.13470	T	0.59	-10.1763	5.3032	0.15790	0.1942:0.3641:0.4418:0.0	.	197	Q9GZV9	FGF23_HUMAN	T	197	ENSP00000237837:A197T	ENSP00000237837:A197T	A	-	1	0	FGF23	4349937	0.991000	0.36638	0.217000	0.23759	0.009000	0.06853	0.744000	0.26245	0.228000	0.21019	-0.333000	0.08304	GCC	-	NULL		0.692	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF23	protein_coding	OTTHUMT00000398936.1	C			4349937	-1	no_errors	NM_020638	genbank	human	reviewed	54_36p	missense	SNP	0.255	T
ABCC9	10060	genome.wustl.edu	37	12	21953991	21953991	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr12:21953991C>T	ENST00000261200.4	-	38	4636	c.4637G>A	c.(4636-4638)cGc>cAc	p.R1546H		NM_020297.2	NP_064693.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	0	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)	p.R1546H(1)		NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CATGTCTGCGCGAACAAAAGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											89.0	83.0	85.0					12																	21953991		2203	4300	6503	21845258	SO:0001583	missense	10060			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261200.4:c.4637G>A	12.37:g.21953991C>T	ENSP00000261200:p.Arg1546His	Somatic		Capture	Illumina GAIIx	4	21845258	O60707	Missense_Mutation	SNP	-	p.R1546H	ENST00000261200.4	37	c.4637	CCDS8693.1	12	.	.	.	.	.	.	.	.	.	.	C	16.42	3.119438	0.56505	.	.	ENSG00000069431	ENST00000261200	D	0.90676	-2.71	4.88	4.88	0.63580	.	0.116707	0.56097	D	0.000021	D	0.88104	0.6347	L	0.31926	0.97	0.80722	D	1	P;B	0.44627	0.839;0.004	B;B	0.43445	0.42;0.008	D	0.89795	0.3971	10	0.72032	D	0.01	-2.9795	18.5784	0.91163	0.0:1.0:0.0:0.0	.	1546;117	O60706-2;Q8N9N1	.;.	H	1546	ENSP00000261200:R1546H	ENSP00000261200:R1546H	R	-	2	0	ABCC9	21845258	0.822000	0.29219	1.000000	0.80357	0.945000	0.59286	1.588000	0.36633	2.695000	0.91970	0.650000	0.86243	CGC	-	NULL		0.383	ABCC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC9	protein_coding	OTTHUMT00000402228.1	C	NM_005691		21845258	-1	no_errors	NM_020297	genbank	human	reviewed	54_36p	missense	SNP	1	T
ARID2	196528	genome.wustl.edu	37	12	46233178	46233178	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr12:46233178A>C	ENST00000334344.6	+	11	1569	c.1397A>C	c.(1396-1398)aAa>aCa	p.K466T	ARID2_ENST00000444670.1_Missense_Mutation_p.K76T|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Missense_Mutation_p.K317T	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	466					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K466T(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GCTGCGGTAAAACTCATTGAA	0.393			"""N, S, F"""		hepatocellular carcinoma																																		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	1	Substitution - Missense(1)	ovary(1)	12											160.0	146.0	150.0					12																	46233178		2203	4300	6503	44519445	SO:0001583	missense	196528				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.1397A>C	12.37:g.46233178A>C	ENSP00000335044:p.Lys466Thr	Somatic		Capture	Illumina GAIIx	4	44519445	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	-	p.K466T	ENST00000334344.6	37	c.1397	CCDS31783.1	12	.	.	.	.	.	.	.	.	.	.	A	21.0	4.085060	0.76642	.	.	ENSG00000189079	ENST00000334344;ENST00000422737;ENST00000444670	T	0.36878	1.23	5.19	5.19	0.71726	.	0.054672	0.64402	D	0.000001	T	0.54431	0.1858	L	0.59436	1.845	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.991	D;D;P	0.65684	0.91;0.937;0.749	T	0.58115	-0.7693	10	0.87932	D	0	-11.9181	14.3223	0.66493	1.0:0.0:0.0:0.0	.	466;317;466	Q68CP9-3;F8WCU9;Q68CP9	.;.;ARID2_HUMAN	T	466;317;76	ENSP00000335044:K466T	ENSP00000335044:K466T	K	+	2	0	ARID2	44519445	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	5.911000	0.69939	2.089000	0.63090	0.533000	0.62120	AAA	-	NULL		0.393	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	protein_coding	OTTHUMT00000318380.2	A	XM_350875		44519445	1	no_errors	NM_152641	genbank	human	validated	54_36p	missense	SNP	1	C
PCDH20	64881	genome.wustl.edu	37	13	61986437	61986437	+	Silent	SNP	G	G	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr13:61986437G>T	ENST00000409186.1	-	5	3900	c.1795C>A	c.(1795-1797)Cga>Aga	p.R599R	PCDH20_ENST00000409204.4_Silent_p.R599R			Q8N6Y1	PCD20_HUMAN	protocadherin 20	599	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.R572R(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TTCTCTTCTCGGTCCAGCTGA	0.463																																																1	Substitution - coding silent(1)	ovary(1)	13											112.0	110.0	110.0					13																	61986437		2203	4300	6503	60884438	SO:0001819	synonymous_variant	64881			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.1795C>A	13.37:g.61986437G>T		Somatic		Capture	Illumina GAIIx	4	60884438	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Silent	SNP	HMMPfam_Cadherin;HMMPfam_Cadherin_2;superfamily_Cadherin-like	p.R572	ENST00000409186.1	37	c.1714	CCDS9442.2	13																																																																																			-	HMMPfam_Cadherin		0.463	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	protein_coding	OTTHUMT00000333054.2	G	NM_022843		60884438	-1	no_errors	NM_022843	genbank	human	validated	54_36p	silent	SNP	1	T
MYCBP2	23077	genome.wustl.edu	37	13	77754358	77754358	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr13:77754358T>G	ENST00000544440.2	-	34	4940	c.4923A>C	c.(4921-4923)agA>agC	p.R1641S	MYCBP2_ENST00000357337.6_Missense_Mutation_p.R1641S|MYCBP2_ENST00000407578.2_Missense_Mutation_p.R1679S|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase									p.R1641S(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GTTCATTTTCTCTCCTCAGGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	13											180.0	172.0	175.0					13																	77754358		2203	4300	6503	76652359	SO:0001583	missense	23077			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.4923A>C	13.37:g.77754358T>G	ENSP00000444596:p.Arg1641Ser	Somatic		Capture	Illumina GAIIx	4	76652359		Missense_Mutation	SNP	HMMPfam_RCC1;superfamily_Galactose-binding domain-like;superfamily_RCC1/BLIP-II;HMMPfam_PHR;superfamily_E set domains;superfamily_ARM repeat;superfamily_RING/U-box	p.R1641S	ENST00000544440.2	37	c.4923		13	.	.	.	.	.	.	.	.	.	.	T	14.31	2.496738	0.44352	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.29142	1.58;1.58;1.58	5.67	-2.45	0.06481	.	0.061053	0.64402	D	0.000006	T	0.11750	0.0286	N	0.08118	0	0.35733	D	0.818116	B	0.27498	0.18	B	0.22601	0.04	T	0.09164	-1.0687	10	0.36615	T	0.2	.	7.8362	0.29371	0.107:0.4273:0.0:0.4657	.	1641	O75592	MYCB2_HUMAN	S	1641;1679;1641	ENSP00000349892:R1641S;ENSP00000384288:R1679S;ENSP00000444596:R1641S	ENSP00000349892:R1641S	R	-	3	2	MYCBP2	76652359	1.000000	0.71417	0.992000	0.48379	0.955000	0.61496	1.057000	0.30492	-0.303000	0.08856	-0.250000	0.11733	AGA	-	NULL		0.498	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	protein_coding	OTTHUMT00000045326.1	T	NM_015057		76652359	-1	no_errors	NM_015057	genbank	human	validated	54_36p	missense	SNP	1	G
RALGAPA1	253959	genome.wustl.edu	37	14	36096537	36096537	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr14:36096537C>T	ENST00000389698.3	-	33	5488	c.5098G>A	c.(5098-5100)Gga>Aga	p.G1700R	RALGAPA1_ENST00000307138.6_Missense_Mutation_p.G1700R|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.G1747R|RALGAPA1_ENST00000382366.3_Missense_Mutation_p.G1713R	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1700	Minimal domain that binds to TCF3/E12. {ECO:0000250}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.G1700R(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AGTGAGATTCCAGTTCTCTGT	0.363																																																1	Substitution - Missense(1)	ovary(1)	14											62.0	66.0	65.0					14																	36096537		2202	4295	6497	35166288	SO:0001583	missense	253959			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.5098G>A	14.37:g.36096537C>T	ENSP00000374348:p.Gly1700Arg	Somatic		Capture	Illumina GAIIx	4	35166288	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	-	p.G1700R	ENST00000389698.3	37	c.5098	CCDS32065.1	14	.	.	.	.	.	.	.	.	.	.	C	15.42	2.826845	0.50739	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000554259;ENST00000382366;ENST00000553892	D;D;D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25;-3.25;-3.25	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.96374	0.8817	M	0.69823	2.125	0.53005	D	0.999965	D;P;D;P	0.89917	1.0;0.768;1.0;0.551	D;B;D;B	0.97110	1.0;0.387;0.984;0.152	D	0.95200	0.8316	10	0.36615	T	0.2	-19.0745	19.5444	0.95285	0.0:1.0:0.0:0.0	.	1747;1713;1700;1700	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	R	1700;1700;1700;1747;338;1713;1747	ENSP00000374348:G1700R;ENSP00000302647:G1700R;ENSP00000258840:G1747R;ENSP00000451133:G338R;ENSP00000371803:G1713R;ENSP00000451877:G1747R	ENSP00000258840:G1747R	G	-	1	0	RALGAPA1	35166288	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.770000	0.62309	2.683000	0.91414	0.655000	0.94253	GGA	-	NULL		0.363	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	GARNL1	protein_coding	OTTHUMT00000409829.1	C	XM_210022		35166288	-1	no_errors	NM_194301	genbank	human	provisional	54_36p	missense	SNP	1	T
TRIP11	9321	genome.wustl.edu	37	14	92472684	92472684	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr14:92472684G>A	ENST00000267622.4	-	11	2009	c.1636C>T	c.(1636-1638)Ctt>Ttt	p.L546F		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	546					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.L546F(1)		breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TCATCTTCAAGTTGATGAACT	0.303			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	1	Substitution - Missense(1)	ovary(1)	14											82.0	78.0	79.0					14																	92472684		2202	4295	6497	91542437	SO:0001583	missense	9321			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.1636C>T	14.37:g.92472684G>A	ENSP00000267622:p.Leu546Phe	Somatic		Capture	Illumina GAIIx	4	91542437	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	"superfamily_Ribosomal protein L29 (L29p);superfamily_""Winged helix"" DNA-binding domain;superfamily_Spectrin repeat"	p.L546F	ENST00000267622.4	37	c.1636	CCDS9899.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.58|13.58	2.278759|2.278759	0.40294|0.40294	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	T|.	0.08807|.	3.05|.	6.16|6.16	5.28|5.28	0.74379|0.74379	.|.	0.219434|.	0.37437|.	N|.	0.002088|.	T|T	0.65396|0.65396	0.2687|0.2687	M|M	0.74881|0.74881	2.28|2.28	0.35563|0.35563	D|D	0.804839|0.804839	P;D|.	0.89917|.	0.873;1.0|.	B;D|.	0.85130|.	0.403;0.997|.	T|T	0.73953|0.73953	-0.3820|-0.3820	10|5	0.66056|.	D|.	0.02|.	.|.	7.8207|7.8207	0.29286|0.29286	0.1484:0.135:0.7166:0.0|0.1484:0.135:0.7166:0.0	.|.	282;546|.	F5H1Z0;Q15643|.	.;TRIPB_HUMAN|.	F|I	546;282|261	ENSP00000267622:L546F|.	ENSP00000267622:L546F|.	L|T	-|-	1|2	0|0	TRIP11|TRIP11	91542437|91542437	0.741000|0.741000	0.28217|0.28217	0.583000|0.583000	0.28640|0.28640	0.207000|0.207000	0.24258|0.24258	1.149000|1.149000	0.31626|0.31626	1.628000|1.628000	0.50416|0.50416	-0.145000|-0.145000	0.13849|0.13849	CTT|ACT	-	NULL		0.303	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP11	protein_coding	OTTHUMT00000411823.1	G			91542437	-1	no_errors	NM_004239	genbank	human	validated	54_36p	missense	SNP	0.32	A
ARFIP1	27236	genome.wustl.edu	37	4	153717643	153717643	+	Intron	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr4:153717643C>T	ENST00000451320.2	+	1	155				ARFIP1_ENST00000405727.2_Intron|ARFIP1_ENST00000353617.2_Intron|ARFIP1_ENST00000356064.3_Intron|ARFIP1_ENST00000429148.2_Intron			P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1						intracellular protein transport (GO:0006886)|regulation of protein secretion (GO:0050708)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)			ARFIP1/FHDC1(2)	cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(180;0.093)					AGGGACTTCCCATTTTCCCTC	0.428																																																0			4																																								153937093	SO:0001627	intron_variant	100130960			U52521	CCDS3780.1, CCDS34080.1	4q31.3	2008-08-01	2008-08-01			ENSG00000164144			21496	protein-coding gene	gene with protein product	"""arfaptin 1"""	605928				9038142, 10413101	Standard	NM_001025595		Approved	HSU52521	uc003imz.3	P53367		ENST00000451320.2:c.-10+16400C>T	4.37:g.153717643C>T		Somatic		Capture	Illumina GAIIx	4	153937093	Q2M2X4|Q3SYL4|Q9Y2X6	RNA	SNP	-	NULL	ENST00000451320.2	37	NULL	CCDS34080.1	4																																																																																			-	-		0.428	ARFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100130960	protein_coding	OTTHUMT00000365032.1	C	NM_014447		153937093	-1	pseudogene	XR_038000	genbank	human	model	54_36p	rna	SNP	1	T
SLX4	84464	genome.wustl.edu	37	16	3639355	3639355	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr16:3639355C>A	ENST00000294008.3	-	12	4924	c.4284G>T	c.(4282-4284)tgG>tgT	p.W1428C		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1428	Interaction with MUS81.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)	p.W1428C(1)		breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GCTCCATGTGCCAGCAGCAGT	0.637								Direct reversal of damage																																								1	Substitution - Missense(1)	ovary(1)	16											60.0	70.0	66.0					16																	3639355		2178	4278	6456	3579356	SO:0001583	missense	84464			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.4284G>T	16.37:g.3639355C>A	ENSP00000294008:p.Trp1428Cys	Somatic		Capture	Illumina GAIIx	4	3579356	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	-	p.W1428C	ENST00000294008.3	37	c.4284	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084344	0.76642	.	.	ENSG00000188827	ENST00000294008	T	0.02140	4.43	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000004	T	0.12646	0.0307	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00013	-1.2415	10	0.62326	D	0.03	.	17.502	0.87734	0.0:1.0:0.0:0.0	.	1428	Q8IY92	SLX4_HUMAN	C	1428	ENSP00000294008:W1428C	ENSP00000294008:W1428C	W	-	3	0	SLX4	3579356	0.947000	0.32204	0.768000	0.31515	0.020000	0.10135	2.839000	0.48207	2.884000	0.98904	0.655000	0.94253	TGG	-	NULL		0.637	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD12	protein_coding	OTTHUMT00000157301.3	C	NM_032444		3579356	-1	no_errors	NM_032444	genbank	human	provisional	54_36p	missense	SNP	0.08	A
KAT8	84148	genome.wustl.edu	37	16	31131551	31131551	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr16:31131551C>G	ENST00000543774.2	+	3	591	c.256C>G	c.(256-258)Cga>Gga	p.R86G	RP11-196G11.4_ENST00000576336.1_RNA|KAT8_ENST00000448516.2_Missense_Mutation_p.R86G|KAT8_ENST00000219797.4_Missense_Mutation_p.R86G			Q9H7Z6	KAT8_HUMAN	K(lysine) acetyltransferase 8	86	Chromo.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|myeloid cell differentiation (GO:0030099)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	histone acetyltransferase complex (GO:0000123)|kinetochore (GO:0000776)|MLL1 complex (GO:0071339)|MSL complex (GO:0072487)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|transcription factor binding (GO:0008134)	p.R86G(1)									CCAGGAGGGCCGAGAGGAATT	0.542																																																1	Substitution - Missense(1)	ovary(1)	16											154.0	140.0	145.0					16																	31131551		2197	4300	6497	31039052	SO:0001583	missense	84148			AF217501	CCDS10706.1, CCDS45468.1	16p11.1	2013-01-10	2011-07-21	2011-07-21	ENSG00000103510	ENSG00000103510	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17933	protein-coding gene	gene with protein product		609912	"""MYST histone acetyltransferase 1"""	MYST1		10786633	Standard	NM_032188		Approved	MOF, FLJ14040, hMOF, ZC2HC8	uc002eax.3	Q9H7Z6	OTTHUMG00000132410	ENST00000543774.2:c.256C>G	16.37:g.31131551C>G	ENSP00000456933:p.Arg86Gly	Somatic		Capture	Illumina GAIIx	4	31039052	A8K4Z1|G5E9P2|Q659G0|Q7LC17|Q8IY59|Q8WYB4|Q8WZ14|Q9HAC5|Q9NR35	Missense_Mutation	SNP	-	p.R86G	ENST00000543774.2	37	c.256	CCDS10706.1	16	.	.	.	.	.	.	.	.	.	.	C	12.36	1.915691	0.33815	.	.	ENSG00000103510	ENST00000219797;ENST00000448516	T;T	0.39406	1.08;1.08	5.83	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.26340	0.0643	N	0.13272	0.32	0.58432	D	0.99999	B;B	0.06786	0.0;0.001	B;B	0.13407	0.009;0.009	T	0.05354	-1.0890	10	0.22706	T	0.39	-6.9305	13.7408	0.62847	0.2612:0.7388:0.0:0.0	.	86;86	Q9H7Z6;G5E9P2	KAT8_HUMAN;.	G	86	ENSP00000219797:R86G;ENSP00000406037:R86G	ENSP00000219797:R86G	R	+	1	2	KAT8	31039052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.361000	0.44160	2.769000	0.95229	0.655000	0.94253	CGA	-	NULL		0.542	KAT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYST1	protein_coding	OTTHUMT00000255546.3	C	NM_032188		31039052	1	no_errors	NM_182958	genbank	human	provisional	54_36p	missense	SNP	1	G
USP7	7874	genome.wustl.edu	37	16	8990874	8990874	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr16:8990874T>A	ENST00000344836.4	-	26	2999	c.2801A>T	c.(2800-2802)aAa>aTa	p.K934I	USP7_ENST00000381886.4_Missense_Mutation_p.K918I|USP7_ENST00000535863.1_Missense_Mutation_p.K835I	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	934					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.K934I(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						CCCTGATGCTTTCTCCCCAAG	0.458																																																1	Substitution - Missense(1)	ovary(1)	16											290.0	255.0	267.0					16																	8990874		2197	4300	6497	8898375	SO:0001583	missense	7874			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.2801A>T	16.37:g.8990874T>A	ENSP00000343535:p.Lys934Ile	Somatic		Capture	Illumina GAIIx	4	8898375	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	HMMPfam_UCH;HMMPfam_MATH;superfamily_TRAF domain-like;superfamily_Cysteine proteinases	p.K934I	ENST00000344836.4	37	c.2801	CCDS32385.1	16	.	.	.	.	.	.	.	.	.	.	T	15.58	2.877051	0.51801	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863	T;T	0.08193	3.12;3.12	5.68	5.68	0.88126	.	0.044914	0.85682	D	0.000000	T	0.05090	0.0136	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40869	-0.9540	10	0.44086	T	0.13	.	11.3096	0.49356	0.0:0.0707:0.0:0.9293	.	934;918	Q93009;B7Z815	UBP7_HUMAN;.	I	934;942;835	ENSP00000343535:K934I;ENSP00000443646:K835I	ENSP00000343535:K934I	K	-	2	0	USP7	8898375	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.730000	0.47335	2.288000	0.76882	0.528000	0.53228	AAA	-	NULL		0.458	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP7	protein_coding	OTTHUMT00000434268.2	T			8898375	-1	no_errors	NM_003470	genbank	human	validated	54_36p	missense	SNP	1	A
HEATR3	55027	genome.wustl.edu	37	16	50109495	50109495	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr16:50109495G>T	ENST00000299192.7	+	6	827	c.636G>T	c.(634-636)caG>caT	p.Q212H	HEATR3_ENST00000285767.4_Missense_Mutation_p.Q126H	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	212								p.Q212H(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						ATTGTTTGCAGACAGTGACTG	0.378																																																1	Substitution - Missense(1)	ovary(1)	16											108.0	95.0	99.0					16																	50109495		2198	4300	6498	48666996	SO:0001583	missense	55027			BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.636G>T	16.37:g.50109495G>T	ENSP00000299192:p.Gln212His	Somatic		Capture	Illumina GAIIx	4	48666996	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Missense_Mutation	SNP	-	p.Q212H	ENST00000299192.7	37	c.636	CCDS10739.1	16	.	.	.	.	.	.	.	.	.	.	G	7.705	0.693834	0.15039	.	.	ENSG00000155393	ENST00000285767;ENST00000299192	T;T	0.35048	1.33;1.33	4.94	3.97	0.46021	Armadillo-like helical (1);Armadillo-type fold (1);	0.104699	0.64402	D	0.000003	T	0.24314	0.0589	L	0.31926	0.97	0.33364	D	0.572655	B;B	0.26775	0.119;0.159	B;B	0.22753	0.041;0.024	T	0.21381	-1.0247	10	0.14656	T	0.56	.	11.7767	0.51989	0.1416:0.0:0.8584:0.0	.	126;212	B7WNW7;Q7Z4Q2	.;HEAT3_HUMAN	H	126;212	ENSP00000285767:Q126H;ENSP00000299192:Q212H	ENSP00000285767:Q126H	Q	+	3	2	HEATR3	48666996	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	1.214000	0.32419	2.441000	0.82636	0.650000	0.86243	CAG	-	NULL		0.378	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR3	protein_coding	OTTHUMT00000256880.2	G	NM_182922		48666996	1	no_errors	NM_182922	genbank	human	provisional	54_36p	missense	SNP	1	T
NF1	4763	genome.wustl.edu	37	17	29661888	29661906	+	Frame_Shift_Del	DEL	ATGACTCCATGGCTGTCAA	ATGACTCCATGGCTGTCAA	-	rs199474791|rs199474792		TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	ATGACTCCATGGCTGTCAA	ATGACTCCATGGCTGTCAA	ATGACTCCATGGCTGTCAA	-	ATGACTCCATGGCTGTCAA	ATGACTCCATGGCTGTCAA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr17:29661888_29661906delATGACTCCATGGCTGTCAA	ENST00000358273.4	+	40	6228_6246	c.5845_5863delATGACTCCATGGCTGTCAA	c.(5845-5865)atgactccatggctgtcaaatfs	p.MTPWLSN1949fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.MTPWLSN1928fs|NF1_ENST00000444181.2_5'Flank|NF1_ENST00000417592.2_5'Flank|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1949					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.M1949fs*2(1)|p.P1951fs*6(1)|p.P1951L(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTTGGAATACATGACTCCATGGCTGTCAAATCTAGTTCG	0.329			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	14	Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(2)|Substitution - Missense(1)	soft_tissue(8)|autonomic_ganglia(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|ovary(1)	17	GRCh37	CD001524|CD030340|CD031066|CM062912|CM071891|CM076347|CM900172|CM971052	NF1	D|M																																				26686032	SO:0001589	frameshift_variant	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5845_5863delATGACTCCATGGCTGTCAA	17.37:g.29661888_29661906delATGACTCCATGGCTGTCAA	ENSP00000351015:p.Met1949fs	Somatic		Capture	Illumina GAIIx	4	26686014	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	-	p.M1949fs	ENST00000358273.4	37	c.5845_5863	CCDS42292.1	17																																																																																			(deletion:cds_exon[26685982;26686175])	NULL		0.329	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	ATGACTCCATGGCTGTCAA	NM_000267		26686032	1	no_errors	NM_001042492	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.993:0.953:1.000	-
ACADVL	37	genome.wustl.edu	37	17	7125517	7125517	+	Silent	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr17:7125517C>T	ENST00000356839.5	+	9	953	c.774C>T	c.(772-774)atC>atT	p.I258I	DLG4_ENST00000399510.2_5'Flank|MIR324_ENST00000362183.1_RNA|ACADVL_ENST00000543245.2_Silent_p.I281I|ACADVL_ENST00000350303.5_Silent_p.I236I	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	258	Catalytic.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)	p.I258I(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						TAGCAGACATCTTCACGGTCT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	17											74.0	73.0	73.0					17																	7125517		2203	4300	6503	7066241	SO:0001819	synonymous_variant	37			BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.774C>T	17.37:g.7125517C>T		Somatic		Capture	Illumina GAIIx	4	7066241	B4DEB6|F5H2A9|O76056|Q8WUL0	Silent	SNP	HMMPfam_Acyl-CoA_dh_1;HMMPfam_Acyl-CoA_dh_M;HMMPfam_Acyl-CoA_dh_N;superfamily_Acyl-CoA dehydrogenase C-terminal domain-like;superfamily_Acyl-CoA dehydrogenase NM domain-like	p.I258	ENST00000356839.5	37	c.774	CCDS11090.1	17																																																																																			-	HMMPfam_Acyl-CoA_dh_M		0.567	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ACADVL	protein_coding	OTTHUMT00000220001.5	C	NM_000018		7066241	1	no_errors	NM_000018	genbank	human	reviewed	54_36p	silent	SNP	1	T
TP53	7157	genome.wustl.edu	37	17	7577501	7577501	+	Frame_Shift_Del	DEL	G	G	-			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr17:7577501delG	ENST00000269305.4	-	7	969	c.780delC	c.(778-780)tccfs	p.S261fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.S260fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Del_p.S261fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.S261fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.S261fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.S261fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	261	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		S -> C (in a sporadic cancer; somatic mutation).|S -> G (in sporadic cancers; somatic mutation).|S -> I (in sporadic cancers; somatic mutation).|S -> N (in a sporadic cancer; somatic mutation).|S -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.S260S(4)|p.S260_S261insX(3)|p.S261fs*84(2)|p.?(1)|p.E258fs*71(1)|p.S260_S261delSS(1)|p.S261fs*151(1)|p.E258fs*2(1)|p.E258_S260delEDS(1)|p.S260del(1)|p.S261fs*4(1)|p.S261fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCCTGACCTGGAGTCTTCCA	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	26	Whole gene deletion(8)|Deletion - Frameshift(4)|Substitution - coding silent(4)|Deletion - In frame(3)|Insertion - Frameshift(3)|Insertion - In frame(3)|Unknown(1)	ovary(6)|bone(4)|upper_aerodigestive_tract(3)|haematopoietic_and_lymphoid_tissue(3)|stomach(2)|central_nervous_system(2)|oesophagus(2)|lung(2)|breast(1)|pancreas(1)	17											127.0	89.0	102.0					17																	7577501		2203	4300	6503	7518226	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.780delC	17.37:g.7577501delG	ENSP00000269305:p.Ser261fs	Somatic		Capture	Illumina GAIIx	4	7518226	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.S261fs	ENST00000269305.4	37	c.780	CCDS11118.1	17																																																																																			(deletion:cds_exon[7518224;7518333])	HMMPfam_P53		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7518226	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1	-
TUBG1	7283	genome.wustl.edu	37	17	40764133	40764133	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr17:40764133G>T	ENST00000251413.3	+	4	433	c.371G>T	c.(370-372)cGg>cTg	p.R124L	FAM134C_ENST00000309428.5_5'Flank|FAM134C_ENST00000543197.1_5'Flank|FAM134C_ENST00000585894.1_5'Flank	NM_001070.4	NP_001061.2	P23258	TBG1_HUMAN	tubulin, gamma 1	124					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic spindle organization (GO:0000212)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	apical part of cell (GO:0045177)|cell leading edge (GO:0031252)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)|polar microtubule (GO:0005827)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R124L(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Vinblastine(DB00570)	ATCATAGACCGGGAGGCAGAT	0.537																																					Colon(20;114 698 11420 22864)											1	Substitution - Missense(1)	ovary(1)	17											111.0	97.0	102.0					17																	40764133		2203	4300	6503	38017659	SO:0001583	missense	7283			BC000619	CCDS11433.1	17q21.31	2010-03-15	2000-01-20		ENSG00000131462	ENSG00000131462		"""Tubulins"""	12417	protein-coding gene	gene with protein product		191135	"""tubulin, gamma polypeptide"""	TUBG		1904010	Standard	NM_001070		Approved	TUBGCP1	uc002ian.3	P23258		ENST00000251413.3:c.371G>T	17.37:g.40764133G>T	ENSP00000251413:p.Arg124Leu	Somatic		Capture	Illumina GAIIx	4	38017659	Q53X79|Q9BW59	Missense_Mutation	SNP	-	p.R124L	ENST00000251413.3	37	c.371	CCDS11433.1	17	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951871	0.73787	.	.	ENSG00000131462	ENST00000251413	T	0.72394	-0.65	5.37	5.37	0.77165	Tubulin/FtsZ, GTPase domain (4);	0.196859	0.32343	U	0.006238	D	0.89269	0.6667	H	0.95611	3.695	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.92324	0.5868	10	0.87932	D	0	-11.3346	18.7557	0.91832	0.0:0.0:1.0:0.0	.	124	P23258	TBG1_HUMAN	L	124	ENSP00000251413:R124L	ENSP00000251413:R124L	R	+	2	0	TUBG1	38017659	1.000000	0.71417	1.000000	0.80357	0.054000	0.15201	9.729000	0.98795	2.519000	0.84933	0.467000	0.42956	CGG	-	NULL		0.537	TUBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBG1	protein_coding	OTTHUMT00000450548.1	G	NM_001070		38017659	1	no_errors	NM_001070	genbank	human	reviewed	54_36p	missense	SNP	1	T
CFAP53	220136	genome.wustl.edu	37	18	47788430	47788430	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr18:47788430T>A	ENST00000398545.4	-	2	346	c.229A>T	c.(229-231)Agc>Tgc	p.S77C		NM_145020.3	NP_659457.2												p.S77C(1)		endometrium(1)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|pancreas(1)|skin(1)	20				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)		CGCACAAGGCTGTCCAAAATC	0.438																																																1	Substitution - Missense(1)	ovary(1)	18											176.0	162.0	166.0					18																	47788430		1930	4148	6078	46042428	SO:0001583	missense	220136																														ENST00000398545.4:c.229A>T	18.37:g.47788430T>A	ENSP00000381553:p.Ser77Cys	Somatic		Capture	Illumina GAIIx	4	46042428		Missense_Mutation	SNP	-	p.S77C	ENST00000398545.4	37	c.229	CCDS11940.2	18	.	.	.	.	.	.	.	.	.	.	T	8.076	0.771223	0.16051	.	.	ENSG00000172361	ENST00000398545	T	0.32753	1.44	5.12	2.65	0.31530	.	0.836117	0.09770	U	0.758070	T	0.23727	0.0574	L	0.51422	1.61	0.09310	N	1	P	0.46327	0.876	B	0.36186	0.219	T	0.18587	-1.0332	10	0.59425	D	0.04	-0.9526	5.1665	0.15088	0.0:0.0928:0.1817:0.7255	.	77	Q96M91	CCD11_HUMAN	C	77	ENSP00000381553:S77C	ENSP00000381553:S77C	S	-	1	0	CCDC11	46042428	0.901000	0.30685	0.003000	0.11579	0.061000	0.15899	2.367000	0.44213	0.469000	0.27268	-0.371000	0.07208	AGC	-	NULL		0.438	CCDC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC11	protein_coding	OTTHUMT00000255922.3	T			46042428	-1	no_errors	NM_145020	genbank	human	validated	54_36p	missense	SNP	0.01	A
MTCL1	23255	genome.wustl.edu	37	18	8819131	8819131	+	Silent	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr18:8819131G>A	ENST00000306329.11	+	11	3987	c.3987G>A	c.(3985-3987)aaG>aaA	p.K1329K	SOGA2_ENST00000518815.1_Silent_p.K335K|SOGA2_ENST00000517570.1_Silent_p.K969K|SOGA2_ENST00000359865.3_Silent_p.K1010K|SOGA2_ENST00000306285.7_Silent_p.K335K|SOGA2_ENST00000400050.3_Silent_p.K969K														p.K1010K(1)									CGCTGTCCAAGCTGAAGGAGT	0.622																																																1	Substitution - coding silent(1)	ovary(1)	18											49.0	46.0	47.0					18																	8819131		2203	4300	6503	8809131	SO:0001819	synonymous_variant	23255																														ENST00000306329.11:c.3987G>A	18.37:g.8819131G>A		Somatic		Capture	Illumina GAIIx	4	8809131		Silent	SNP	-	p.K1010	ENST00000306329.11	37	c.3030		18	.	.	.	.	.	.	.	.	.	.	G	7.780	0.709365	0.15239	.	.	ENSG00000168502	ENST00000519823	.	.	.	6.07	2.26	0.28386	.	.	.	.	.	T	0.59238	0.2179	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55496	-0.8132	4	.	.	.	-57.9712	10.1874	0.43006	0.3232:0.0:0.6768:0.0	.	.	.	.	T	116	.	.	A	+	1	0	CCDC165	8809131	1.000000	0.71417	0.990000	0.47175	0.557000	0.35523	1.038000	0.30254	0.878000	0.35920	0.655000	0.94253	GCT	-	NULL		0.622	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	KIAA0802	protein_coding	OTTHUMT00000444141.1	G			8809131	1	no_errors	NM_015210	genbank	human	predicted	54_36p	silent	SNP	1	A
C18orf54	162681	genome.wustl.edu	37	18	51889233	51889233	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr18:51889233C>G	ENST00000300091.5	+	4	1014	c.682C>G	c.(682-684)Cct>Gct	p.P228A	C18orf54_ENST00000578138.1_Missense_Mutation_p.P7A|C18orf54_ENST00000382911.4_Missense_Mutation_p.P389A	NM_173529.4	NP_775800.3	Q8IYD9	LAS2_HUMAN	chromosome 18 open reading frame 54	228						extracellular region (GO:0005576)		p.P228A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		GGATGACAGTCCTTGCTCATT	0.353																																																1	Substitution - Missense(1)	ovary(1)	18											90.0	89.0	89.0					18																	51889233		2203	4300	6503	50143231	SO:0001583	missense	162681			AK126503	CCDS11956.1, CCDS74223.1	18q21	2012-10-24			ENSG00000166845	ENSG00000166845			13796	protein-coding gene	gene with protein product	"""lung adenoma susceptibility protein 2"""	613258					Standard	XM_005258201		Approved	MGC33382, LAS2	uc031rij.1	Q8IYD9	OTTHUMG00000132703	ENST00000300091.5:c.682C>G	18.37:g.51889233C>G	ENSP00000300091:p.Pro228Ala	Somatic		Capture	Illumina GAIIx	4	50143231	I7HFJ6|Q6MZU3|Q6ZTL6	Missense_Mutation	SNP	-	p.P228A	ENST00000300091.5	37	c.682	CCDS11956.1	18	.	.	.	.	.	.	.	.	.	.	C	11.36	1.617117	0.28801	.	.	ENSG00000166845	ENST00000300091;ENST00000382911	T;T	0.38560	1.13;1.13	5.12	5.12	0.69794	.	0.064020	0.64402	D	0.000006	T	0.60483	0.2272	L	0.55481	1.735	0.31349	N	0.682763	D;D	0.89917	0.999;1.0	D;D	0.91635	0.983;0.999	T	0.63093	-0.6714	10	0.41790	T	0.15	0.749	17.3157	0.87224	0.0:1.0:0.0:0.0	.	389;228	Q8IYD9-2;Q8IYD9	.;CR054_HUMAN	A	228;389	ENSP00000300091:P228A;ENSP00000372368:P389A	ENSP00000300091:P228A	P	+	1	0	C18orf54	50143231	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.216000	0.65246	2.386000	0.81285	0.491000	0.48974	CCT	-	NULL		0.353	C18orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C18orf54	protein_coding	OTTHUMT00000256001.1	C	NM_173529		50143231	1	no_errors	NM_173529	genbank	human	validated	54_36p	missense	SNP	1	G
ZNF98	148198	genome.wustl.edu	37	19	22574616	22574616	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr19:22574616G>A	ENST00000357774.5	-	4	1542	c.1421C>T	c.(1420-1422)tCc>tTc	p.S474F		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	474					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S474F(1)		central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				AAGAGTTGAGGACTGGTTAAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	19											39.0	34.0	36.0					19																	22574616		1804	3691	5495	22366456	SO:0001583	missense	148198				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.1421C>T	19.37:g.22574616G>A	ENSP00000350418:p.Ser474Phe	Somatic		Capture	Illumina GAIIx	4	22366456		Missense_Mutation	SNP	-	p.S474F	ENST00000357774.5	37	c.1421	CCDS46031.1	19	.	.	.	.	.	.	.	.	.	.	.	0.696	-0.792547	0.02884	.	.	ENSG00000197360	ENST00000357774	T	0.35421	1.31	1.26	-2.53	0.06326	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29061	0.0722	M	0.67953	2.075	0.09310	N	1	B	0.13594	0.008	B	0.15052	0.012	T	0.32719	-0.9896	9	0.30854	T	0.27	.	3.5479	0.07835	0.0:0.3649:0.2532:0.3819	.	474	A6NK75	ZNF98_HUMAN	F	474	ENSP00000350418:S474F	ENSP00000350418:S474F	S	-	2	0	ZNF98	22366456	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.358000	0.02604	-0.240000	0.09696	0.289000	0.19496	TCC	-	NULL		0.368	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF98	protein_coding	OTTHUMT00000464398.1	G	NM_001098626		22366456	-1	no_errors	NM_001098626	genbank	human	validated	54_36p	missense	SNP		A
ZNF91	7644	genome.wustl.edu	37	19	23545269	23545269	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr19:23545269C>G	ENST00000300619.7	-	4	717	c.512G>C	c.(511-513)aGa>aCa	p.R171T	ZNF91_ENST00000397082.2_Missense_Mutation_p.R139T|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	171					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R171T(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TATCGTATGTCTGTTTGAATT	0.313																																																1	Substitution - Missense(1)	ovary(1)	19											60.0	60.0	60.0					19																	23545269		2039	4238	6277	23337109	SO:0001583	missense	7644			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.512G>C	19.37:g.23545269C>G	ENSP00000300619:p.Arg171Thr	Somatic		Capture	Illumina GAIIx	4	23337109	A8K5E1|B7Z6G6	Missense_Mutation	SNP	HMMPfam_KRAB,HMMPfam_zf-C2H2,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),superfamily_C2H2 and C2HC zinc fingers	p.R171T	ENST00000300619.7	37	c.512	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	C	0.303	-0.972842	0.02215	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.15718	2.4;2.4	0.898	0.898	0.19264	.	.	.	.	.	T	0.12008	0.0292	L	0.56769	1.78	0.09310	N	1	B;P	0.43392	0.19;0.805	B;B	0.34180	0.026;0.177	T	0.22103	-1.0226	9	0.19590	T	0.45	.	4.929	0.13907	0.0:1.0:0.0:0.0	.	139;171	Q05481-2;Q05481	.;ZNF91_HUMAN	T	171;139	ENSP00000300619:R171T;ENSP00000380272:R139T	ENSP00000300619:R171T	R	-	2	0	ZNF91	23337109	0.013000	0.17824	0.024000	0.17045	0.034000	0.12701	0.497000	0.22514	0.284000	0.22305	0.289000	0.19496	AGA	-	NULL		0.313	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	protein_coding	OTTHUMT00000465891.1	C	NM_003430		23337109	-1	no_errors	NM_003430	genbank	human	validated	54_36p	missense	SNP	0.083	G
MED29	55588	genome.wustl.edu	37	19	39882225	39882225	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr19:39882225G>C	ENST00000599213.2	+	1	190	c.163G>C	c.(163-165)Gat>Cat	p.D55H	PAF1_ENST00000595564.1_5'Flank|PAF1_ENST00000221265.3_5'Flank|MED29_ENST00000594368.1_Missense_Mutation_p.D55H|PAF1_ENST00000221266.7_5'Flank|MED29_ENST00000315588.5_Missense_Mutation_p.D76H			Q9NX70	MED29_HUMAN	mediator complex subunit 29	55	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)|nucleus (GO:0005634)		p.D76H(1)		lung(2)|ovary(1)|pancreas(1)	4	all_cancers(60;7.82e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;1.04e-26)|all cancers(26;7.68e-24)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			ACAGGACTTCGATCCTGTGCA	0.597																																																1	Substitution - Missense(1)	ovary(1)	19											42.0	43.0	43.0					19																	39882225		2203	4299	6502	44574065	SO:0001583	missense	55588			AL137304, AY729650	CCDS33021.1	19q13.2	2007-07-30	2007-07-30	2007-07-30		ENSG00000063322			23074	protein-coding gene	gene with protein product		612914	"""intersex-like (Drosophila)"""	IXL		15555573	Standard	NM_017592		Approved	DKFZp434H247	uc010xux.3	Q9NX70		ENST00000599213.2:c.163G>C	19.37:g.39882225G>C	ENSP00000471802:p.Asp55His	Somatic		Capture	Illumina GAIIx	4	44574065	B4DNQ6|M0R2E4|Q5XX09|Q9NTF4	Missense_Mutation	SNP	-	p.D76H	ENST00000599213.2	37	c.226		19	.	.	.	.	.	.	.	.	.	.	G	34	5.301232	0.95601	.	.	ENSG00000063322	ENST00000315588	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.79034	0.4378	M	0.76170	2.325	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80692	-0.1269	9	0.87932	D	0	-33.4419	15.5372	0.76013	0.0:0.0:1.0:0.0	.	55;76	Q9NX70;B4DUA7	MED29_HUMAN;.	H	76	.	ENSP00000314343:D76H	D	+	1	0	MED29	44574065	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.920000	0.92779	2.734000	0.93682	0.655000	0.94253	GAT	-	NULL		0.597	MED29-011	KNOWN	basic|appris_candidate	protein_coding	MED29	protein_coding	OTTHUMT00000470870.1	G	XM_290829		44574065	1	no_errors	NM_017592	genbank	human	provisional	54_36p	missense	SNP	1	C
SH3RF3	344558	genome.wustl.edu	37	2	109964171	109964171	+	Silent	SNP	C	C	T	rs377230878	byFrequency	TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr2:109964171C>T	ENST00000309415.6	+	2	615	c.615C>T	c.(613-615)taC>taT	p.Y205Y		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	205	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.						zinc ion binding (GO:0008270)	p.Y205Y(1)		endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						TCTACAGCTACGAGGGGAAGG	0.597													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		16363	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	2						C		7,4241		0,7,2117	52.0	54.0	53.0		615	-9.2	0.0	2		53	0,8452		0,0,4226	no	coding-synonymous	SH3RF3	NM_001099289.1		0,7,6343	TT,TC,CC		0.0,0.1648,0.0551		205/883	109964171	7,12693	2124	4226	6350	109330603	SO:0001819	synonymous_variant	344558			AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.615C>T	2.37:g.109964171C>T		Somatic		Capture	Illumina GAIIx	4	109330603	A0SDZ7|A8MPR1|Q8NDU1	Silent	SNP	-	p.Y205	ENST00000309415.6	37	c.615		2																																																																																			-	NULL		0.597	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	SH3RF3	protein_coding		C	NM_001099289		109330603	1	no_stop_codon	NM_001099289	genbank	human	provisional	54_36p	silent	SNP	0.54	T
FAM171B	165215	genome.wustl.edu	37	2	187627428	187627428	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr2:187627428G>A	ENST00000304698.5	+	8	2562	c.2359G>A	c.(2359-2361)Gaa>Aaa	p.E787K		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	787						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.E787K(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						AAGCACTGTTGAAGATTTTGA	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											59.0	57.0	58.0					2																	187627428		2203	4300	6503	187335673	SO:0001583	missense	165215			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.2359G>A	2.37:g.187627428G>A	ENSP00000304108:p.Glu787Lys	Somatic		Capture	Illumina GAIIx	4	187335673	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	-	p.E787K	ENST00000304698.5	37	c.2359	CCDS33347.1	2	.	.	.	.	.	.	.	.	.	.	G	11.10	1.539053	0.27475	.	.	ENSG00000144369	ENST00000304698	T	0.30714	1.52	6.02	5.14	0.70334	.	0.317042	0.33834	N	0.004520	T	0.24812	0.0602	L	0.43923	1.385	0.40296	D	0.978551	B;B	0.16166	0.016;0.016	B;B	0.18871	0.023;0.012	T	0.05084	-1.0907	10	0.07325	T	0.83	-12.3263	14.7197	0.69297	0.0687:0.0:0.9313:0.0	.	787;788	Q6P995;A8K122	F171B_HUMAN;.	K	787	ENSP00000304108:E787K	ENSP00000304108:E787K	E	+	1	0	FAM171B	187335673	1.000000	0.71417	0.974000	0.42286	0.970000	0.65996	4.053000	0.57427	2.850000	0.98022	0.650000	0.86243	GAA	-	NULL		0.498	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	protein_coding	OTTHUMT00000334679.1	G	NM_177454		187335673	1	no_errors	NM_177454	genbank	human	validated	54_36p	missense	SNP	0.92	A
RNASEH1	246243	genome.wustl.edu	37	2	3597983	3597983	+	Silent	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr2:3597983G>A	ENST00000315212.3	-	4	844	c.489C>T	c.(487-489)taC>taT	p.Y163Y	RP13-512J5.1_ENST00000438485.1_5'Flank	NM_002936.3	NP_002927.2	O60930	RNH1_HUMAN	ribonuclease H1	163	RNase H. {ECO:0000255|PROSITE- ProRule:PRU00408}.				mitochondrial DNA replication (GO:0006264)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)	p.Y163Y(1)		endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	13	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)		CTGGCCCCCAGTAAACGCCGA	0.498																																																1	Substitution - coding silent(1)	ovary(1)	2											113.0	126.0	122.0					2																	3597983		2203	4300	6503	3575858	SO:0001819	synonymous_variant	246243			AF039652	CCDS1647.1	2p25	2008-03-11			ENSG00000171865	ENSG00000171865	3.1.26.-		18466	protein-coding gene	gene with protein product	"""RNase H1"""	604123				12036296, 17964265	Standard	XR_244873		Approved		uc002qxt.3	O60930	OTTHUMG00000090279	ENST00000315212.3:c.489C>T	2.37:g.3597983G>A		Somatic		Capture	Illumina GAIIx	4	3575858	B3KQU4|O60523|O60857|Q57Z93|Q5U0C1|Q6FHD4	Silent	SNP	HMMPfam_RnaseH;superfamily_L9 N-domain-like;superfamily_Ribonuclease H-like	p.Y163	ENST00000315212.3	37	c.489	CCDS1647.1	2																																																																																			-	HMMPfam_RnaseH		0.498	RNASEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEH1	protein_coding	OTTHUMT00000206605.2	G			3575858	-1	no_errors	NM_002936	genbank	human	validated	54_36p	silent	SNP	1	A
Unknown	0	genome.wustl.edu	37	2	20439853	20439853	+	IGR	SNP	C	C	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr2:20439853C>A								SDC1 (14659 upstream) : RNU7-113P (6233 downstream)																							CTGGTAATTGCCTTTGGGTTT	0.413																																																0			2																																								20303334	SO:0001628	intergenic_variant	151457																															2.37:g.20439853C>A		Somatic		Capture	Illumina GAIIx	4	20303334		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.413					LOC151457			C			20303334	-1	pseudogene	XR_016242	genbank	human	model	54_36p	rna	SNP	1	A
KIF3C	3797	genome.wustl.edu	37	2	26204159	26204159	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr2:26204159T>G	ENST00000264712.3	-	1	1207	c.628A>C	c.(628-630)Aat>Cat	p.N210H	KIF3C_ENST00000405914.1_Missense_Mutation_p.N210H	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	210	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.N210H(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGACCTCATTCATGTGGGTG	0.567																																																1	Substitution - Missense(1)	ovary(1)	2											76.0	78.0	77.0					2																	26204159		2203	4300	6503	26057663	SO:0001583	missense	3797				CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.628A>C	2.37:g.26204159T>G	ENSP00000264712:p.Asn210His	Somatic		Capture	Illumina GAIIx	4	26057663	O43544|Q4ZG18|Q53SX5|Q562F7	Missense_Mutation	SNP	-	p.N210H	ENST00000264712.3	37	c.628	CCDS1719.1	2	.	.	.	.	.	.	.	.	.	.	T	17.35	3.368574	0.61624	.	.	ENSG00000084731	ENST00000264712;ENST00000542511;ENST00000405914	D;D	0.82433	-1.61;-1.61	5.67	5.67	0.87782	Kinesin, motor domain (5);	0.000000	0.85682	D	0.000000	D	0.93530	0.7935	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95125	0.8250	10	0.87932	D	0	.	13.8585	0.63545	0.0:0.0:0.0:1.0	.	210;210	B7ZM25;O14782	.;KIF3C_HUMAN	H	210;16;210	ENSP00000264712:N210H;ENSP00000385030:N210H	ENSP00000264712:N210H	N	-	1	0	KIF3C	26057663	1.000000	0.71417	0.998000	0.56505	0.903000	0.53119	8.004000	0.88535	2.152000	0.67230	0.533000	0.62120	AAT	-	NULL		0.567	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3C	protein_coding	OTTHUMT00000211611.1	T			26057663	-1	no_errors	NM_002254	genbank	human	validated	54_36p	missense	SNP	1	G
CLHC1	130162	genome.wustl.edu	37	2	55435838	55435838	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr2:55435838C>G	ENST00000401408.1	-	8	1168	c.823G>C	c.(823-825)Ggc>Cgc	p.G275R	CLHC1_ENST00000406437.2_Intron|CLHC1_ENST00000406076.1_Missense_Mutation_p.G153R|CLHC1_ENST00000407122.1_Missense_Mutation_p.G275R|CLHC1_ENST00000494539.1_Intron	NM_152385.2	NP_689598.2	Q8NHS4	CLHC1_HUMAN	clathrin heavy chain linker domain containing 1	275								p.G275R(2)									TCAACAATGCCTTGGTCACCT	0.318																																																2	Substitution - Missense(2)	ovary(2)	2											126.0	124.0	125.0					2																	55435838		2203	4300	6503	55289342	SO:0001583	missense	130162				CCDS33201.1, CCDS46287.1	2p16.1	2012-08-03	2012-08-03	2012-08-03	ENSG00000162994	ENSG00000162994			26453	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 63"""	C2orf63			Standard	NM_152385		Approved	FLJ31438	uc002ryi.2	Q8NHS4	OTTHUMG00000151918	ENST00000401408.1:c.823G>C	2.37:g.55435838C>G	ENSP00000384869:p.Gly275Arg	Somatic		Capture	Illumina GAIIx	4	55289342	B2RDV1|Q53R93|Q8N403	Missense_Mutation	SNP	-	p.G275R	ENST00000401408.1	37	c.823	CCDS33201.1	2	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297274	0.23650	.	.	ENSG00000162994	ENST00000407122;ENST00000401408;ENST00000406076	T;T;T	0.16743	2.32;2.32;2.32	5.51	-0.919	0.10478	.	1.527330	0.03789	N	0.262597	T	0.15176	0.0366	L	0.51422	1.61	0.09310	N	1	B	0.24823	0.112	B	0.21360	0.034	T	0.27606	-1.0069	10	0.18710	T	0.47	3.1728	5.8576	0.18728	0.1304:0.3714:0.0:0.4981	.	275	Q8NHS4	CB063_HUMAN	R	275;275;153	ENSP00000385778:G275R;ENSP00000384869:G275R;ENSP00000385512:G153R	ENSP00000384869:G275R	G	-	1	0	C2orf63	55289342	0.000000	0.05858	0.001000	0.08648	0.755000	0.42902	-0.392000	0.07314	-0.092000	0.12417	0.563000	0.77884	GGC	-	NULL		0.318	CLHC1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf63	protein_coding	OTTHUMT00000324412.4	C	NM_152385		55289342	-1	no_errors	NM_152385	genbank	human	validated	54_36p	missense	SNP		G
C2orf78	388960	genome.wustl.edu	37	2	74043138	74043138	+	Silent	SNP	A	A	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr2:74043138A>G	ENST00000409561.1	+	3	1909	c.1788A>G	c.(1786-1788)gtA>gtG	p.V596V		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	596	Lys-rich.							p.V566V(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						AAGTCAAGGTAGAAGAGAAGC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	2											82.0	79.0	80.0					2																	74043138		1869	4115	5984	73896646	SO:0001819	synonymous_variant	388960			AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.1788A>G	2.37:g.74043138A>G		Somatic		Capture	Illumina GAIIx	4	73896646		Silent	SNP	-	p.V596	ENST00000409561.1	37	c.1788	CCDS46338.1	2																																																																																			-	NULL		0.443	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf78	protein_coding	OTTHUMT00000328083.1	A	NM_001080474		73896646	1	no_errors	NM_001080474	genbank	human	predicted	54_36p	silent	SNP	0.13	G
SMYD1	150572	genome.wustl.edu	37	2	88383883	88383883	+	Silent	SNP	C	C	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr2:88383883C>G	ENST00000419482.2	+	2	271	c.186C>G	c.(184-186)ctC>ctG	p.L62L	MIR4780_ENST00000584268.1_RNA|SMYD1_ENST00000444564.2_Silent_p.L62L|SMYD1_ENST00000468008.1_3'UTR|SMYD1_ENST00000438570.1_Silent_p.L62L	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	62	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.L62L(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						AGGAGAAGCTCCATCGCTGTG	0.512																																																1	Substitution - coding silent(1)	ovary(1)	2											107.0	91.0	97.0					2																	88383883		2203	4300	6503	88164998	SO:0001819	synonymous_variant	150572			AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.186C>G	2.37:g.88383883C>G		Somatic		Capture	Illumina GAIIx	4	88164998	A0AV30|A6NE13	Silent	SNP	-	p.L62	ENST00000419482.2	37	c.186	CCDS33240.1	2																																																																																			-	NULL		0.512	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD1	protein_coding	OTTHUMT00000338229.2	C	XM_097915		88164998	1	no_errors	NM_198274	genbank	human	provisional	54_36p	silent	SNP	1	G
TMEM131	23505	genome.wustl.edu	37	2	98392471	98392471	+	Silent	SNP	T	T	C			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr2:98392471T>C	ENST00000186436.5	-	32	4383	c.4155A>G	c.(4153-4155)aaA>aaG	p.K1385K		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1385	Lys-rich.					integral component of membrane (GO:0016021)		p.K1272K(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GCTGAAGAGGTTTTCCTTTCC	0.433																																																1	Substitution - coding silent(1)	ovary(1)	2											155.0	150.0	151.0					2																	98392471		1879	4104	5983	97758903	SO:0001819	synonymous_variant	23505			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.4155A>G	2.37:g.98392471T>C		Somatic		Capture	Illumina GAIIx	4	97758903		Silent	SNP	-	p.K1385	ENST00000186436.5	37	c.4155	CCDS46368.1	2																																																																																			-	NULL		0.433	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	protein_coding	OTTHUMT00000329285.2	T	XM_371542		97758903	-1	no_errors	NM_015348	genbank	human	validated	54_36p	silent	SNP	0.96	C
INPP1	3628	genome.wustl.edu	37	2	191233921	191233921	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr2:191233921G>T	ENST00000322522.4	+	5	1015	c.559G>T	c.(559-561)Ggt>Tgt	p.G187C	INPP1_ENST00000541441.1_Missense_Mutation_p.G187C|INPP1_ENST00000392329.2_Missense_Mutation_p.G187C	NM_002194.3	NP_002185.1	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase	187					dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-1,3,4-trisphosphate 1-phosphatase activity (GO:0052829)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|metal ion binding (GO:0046872)	p.G187C(1)		cervix(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)			CATTTTAATTGGTGTCTATGA	0.403																																					Melanoma(130;184 1743 2185 19805 38428)											1	Substitution - Missense(1)	ovary(1)	2											120.0	119.0	119.0					2																	191233921		2203	4300	6503	190942166	SO:0001583	missense	3628				CCDS2305.1	2q32	2008-02-07			ENSG00000151689	ENSG00000151689	3.1.3.57		6071	protein-coding gene	gene with protein product		147263				8390685	Standard	NM_002194		Approved		uc010fsb.3	P49441	OTTHUMG00000132672	ENST00000322522.4:c.559G>T	2.37:g.191233921G>T	ENSP00000325423:p.Gly187Cys	Somatic		Capture	Illumina GAIIx	4	190942166		Missense_Mutation	SNP	HMMPfam_Inositol_P;superfamily_Carbohydrate phosphatase	p.G187C	ENST00000322522.4	37	c.559	CCDS2305.1	2	.	.	.	.	.	.	.	.	.	.	G	25.8	4.679846	0.88542	.	.	ENSG00000151689	ENST00000392329;ENST00000322522;ENST00000541441;ENST00000431594;ENST00000444194;ENST00000423767	T;T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26;1.26	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.59183	0.2175	M	0.67397	2.05	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	T	0.55768	-0.8089	10	0.45353	T	0.12	-20.8504	17.5378	0.87837	0.0:0.0:1.0:0.0	.	187	P49441	INPP_HUMAN	C	187	ENSP00000376142:G187C;ENSP00000325423:G187C;ENSP00000440650:G187C;ENSP00000409786:G187C;ENSP00000404732:G187C;ENSP00000395424:G187C	ENSP00000325423:G187C	G	+	1	0	INPP1	190942166	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.353000	0.73032	2.747000	0.94245	0.644000	0.83932	GGT	-	HMMPfam_Inositol_P		0.403	INPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP1	protein_coding	OTTHUMT00000255932.2	G			190942166	1	no_errors	NM_002194	genbank	human	reviewed	54_36p	missense	SNP	1	T
NAPB	63908	genome.wustl.edu	37	20	23360089	23360089	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr20:23360089G>T	ENST00000377026.4	-	10	864	c.779C>A	c.(778-780)aCt>aAt	p.T260N	NAPB_ENST00000398425.3_Missense_Mutation_p.T166N|RNA5SP479_ENST00000364858.1_RNA|NAPB_ENST00000432543.2_Missense_Mutation_p.T221N|NAPB_ENST00000472855.1_5'UTR	NM_001283018.1|NM_001283020.1|NM_022080.2	NP_001269947.1|NP_001269949.1|NP_071363.1	Q9H115	SNAB_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, beta	260					intracellular protein transport (GO:0006886)|regulation of synaptic vesicle priming (GO:0010807)|SNARE complex disassembly (GO:0035494)|synaptic transmission, glutamatergic (GO:0035249)	extracellular vesicular exosome (GO:0070062)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)		p.T260N(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12	Lung NSC(19;0.0646)|Colorectal(13;0.0993)|all_lung(19;0.143)					TACTGCTTCAGTGTAAGCTTC	0.303																																																1	Substitution - Missense(1)	ovary(1)	20											128.0	124.0	125.0					20																	23360089		2202	4300	6502	23308089	SO:0001583	missense	10801			AK022817	CCDS13152.1, CCDS63241.1, CCDS63242.1, CCDS74710.1	20p12.3-p11.21	2008-08-01			ENSG00000125814	ENSG00000125814			15751	protein-coding gene	gene with protein product		611270				8455721	Standard	NM_022080		Approved	SNAP-BETA, SNAPB	uc002wta.3	Q9H115	OTTHUMG00000032062	ENST00000377026.4:c.779C>A	20.37:g.23360089G>T	ENSP00000366225:p.Thr260Asn	Somatic		Capture	Illumina GAIIx	4	23308089	B4DK44|Q4G0M0|Q4G187|Q5JXF9|Q8N3C4	Missense_Mutation	SNP	HMMPfam_NSF;superfamily_TPR-like	p.T260N	ENST00000377026.4	37	c.779	CCDS13152.1	20	.	.	.	.	.	.	.	.	.	.	G	33	5.283398	0.95489	.	.	ENSG00000125814	ENST00000377026;ENST00000398425;ENST00000432543;ENST00000431864	T;T;T	0.76709	-1.04;-1.04;-1.04	5.55	5.55	0.83447	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.89178	0.6641	M	0.90369	3.11	0.80722	D	1	P;P;P;P	0.47962	0.903;0.903;0.903;0.903	P;P;P;P	0.57009	0.692;0.692;0.811;0.811	D	0.90778	0.4677	10	0.87932	D	0	-18.1847	18.8442	0.92198	0.0:0.0:1.0:0.0	.	221;166;264;260	B4DK44;Q4G0M0;B4DIV0;Q9H115	.;.;.;SNAB_HUMAN	N	260;166;221;217	ENSP00000366225:T260N;ENSP00000381459:T166N;ENSP00000413600:T221N	ENSP00000366225:T260N	T	-	2	0	NAPB	23308089	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.711000	0.98735	2.752000	0.94435	0.650000	0.86243	ACT	-	NULL		0.303	NAPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAPB	protein_coding	OTTHUMT00000078317.2	G	NM_022080		23308089	-1	no_errors	NM_022080	genbank	human	validated	54_36p	missense	SNP	1	T
ABCG1	9619	genome.wustl.edu	37	21	43710219	43710219	+	Silent	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr21:43710219G>A	ENST00000361802.2	+	11	1465	c.1320G>A	c.(1318-1320)ctG>ctA	p.L440L	ABCG1_ENST00000343687.3_Silent_p.L439L|ABCG1_ENST00000340588.4_Silent_p.L548L|ABCG1_ENST00000347800.2_Silent_p.L425L|ABCG1_ENST00000398437.1_Silent_p.L586L|ABCG1_ENST00000462050.1_3'UTR|ABCG1_ENST00000398457.2_Silent_p.L430L|ABCG1_ENST00000398449.3_Silent_p.L428L	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	440	ABC transmembrane type-2.				amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)	p.L440L(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	TTGGCCTGCTGTACTTGGGGA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	21											192.0	143.0	159.0					21																	43710219		2203	4300	6503	42583288	SO:0001819	synonymous_variant	9619			U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.1320G>A	21.37:g.43710219G>A		Somatic		Capture	Illumina GAIIx	4	42583288	Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Silent	SNP	-	p.L440	ENST00000361802.2	37	c.1320	CCDS13682.1	21	.	.	.	.	.	.	.	.	.	.	G	9.739	1.164465	0.21538	.	.	ENSG00000160179	ENST00000489035;ENST00000469119;ENST00000482161	.	.	.	4.49	-2.6	0.06190	.	.	.	.	.	T	0.55986	0.1955	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55457	-0.8138	4	.	.	.	-32.6727	11.1469	0.48436	0.2033:0.3057:0.491:0.0	.	.	.	.	I	176;164;164	.	.	V	+	1	0	ABCG1	42583288	0.113000	0.22115	0.996000	0.52242	0.971000	0.66376	-0.668000	0.05268	-0.170000	0.10816	-0.344000	0.07964	GTA	-	NULL		0.582	ABCG1-006	KNOWN	basic|CCDS	protein_coding	ABCG1	protein_coding	OTTHUMT00000195318.2	G	NM_207174		42583288	1	no_errors	NM_004915	genbank	human	reviewed	54_36p	silent	SNP	0.85	A
UBASH3A	53347	genome.wustl.edu	37	21	43838668	43838668	+	Silent	SNP	G	G	A	rs138698980		TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr21:43838668G>A	ENST00000319294.6	+	7	1027	c.996G>A	c.(994-996)ccG>ccA	p.P332P	UBASH3A_ENST00000398367.1_Silent_p.P294P|RNU6-1149P_ENST00000516810.1_RNA|UBASH3A_ENST00000291535.6_Silent_p.P294P	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	332	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.P332P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						GCTTCCTGCCGGAAAACTACA	0.607																																																1	Substitution - coding silent(1)	ovary(1)	21						G	,	1,4405	2.1+/-5.4	0,1,2202	42.0	45.0	44.0		882,996	-10.6	0.0	21	dbSNP_134	44	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	UBASH3A	NM_001001895.2,NM_018961.3	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	294/624,332/662	43838668	2,13004	2203	4300	6503	42711737	SO:0001819	synonymous_variant	53347			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.996G>A	21.37:g.43838668G>A		Somatic		Capture	Illumina GAIIx	4	42711737	G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Silent	SNP	HMMPfam_UBA;HMMPfam_SH3_1;superfamily_SH3-domain;superfamily_UBA-like;HMMPfam_PGAM;superfamily_Phosphoglycerate mutase-like	p.P332	ENST00000319294.6	37	c.996	CCDS13687.1	21																																																																																			-	HMMPfam_SH3_1		0.607	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	UBASH3A	protein_coding	OTTHUMT00000195382.1	G	NM_001001895		42711737	1	no_errors	NM_018961	genbank	human	validated	54_36p	silent	SNP	0.75	A
PCNT	5116	genome.wustl.edu	37	21	47851839	47851839	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr21:47851839C>T	ENST00000359568.5	+	38	8568	c.8461C>T	c.(8461-8463)Cag>Tag	p.Q2821*	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2821					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.Q2821*(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TTCTCAGCAGCAGCTTGAGGC	0.572																																																1	Substitution - Nonsense(1)	ovary(1)	21											60.0	56.0	58.0					21																	47851839		2203	4300	6503	46676267	SO:0001587	stop_gained	5116			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.8461C>T	21.37:g.47851839C>T	ENSP00000352572:p.Gln2821*	Somatic		Capture	Illumina GAIIx	4	46676267	O43152|Q7Z7C9	Nonsense_Mutation	SNP	-	p.Q2821*	ENST00000359568.5	37	c.8461	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	C	47	13.028092	0.99714	.	.	ENSG00000160299	ENST00000359568	.	.	.	5.32	1.15	0.20763	.	0.000000	0.32273	N	0.006333	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	9.852	0.41061	0.2464:0.49:0.2636:0.0	.	.	.	.	X	2821	.	ENSP00000352572:Q2821X	Q	+	1	0	PCNT	46676267	0.997000	0.39634	0.010000	0.14722	0.081000	0.17604	0.775000	0.26689	0.317000	0.23160	0.655000	0.94253	CAG	-	NULL		0.572	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	protein_coding	OTTHUMT00000207336.1	C	NM_006031		46676267	1	no_errors	NM_006031	genbank	human	reviewed	54_36p	nonsense	SNP		T
SEZ6L	23544	genome.wustl.edu	37	22	26747080	26747080	+	Silent	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr22:26747080C>T	ENST00000248933.6	+	12	2565	c.2470C>T	c.(2470-2472)Ctg>Ttg	p.L824L	SEZ6L_ENST00000529632.2_Silent_p.L824L|SEZ6L_ENST00000343706.4_Silent_p.L824L|SEZ6L_ENST00000402979.1_Silent_p.L597L|SEZ6L_ENST00000403121.1_Silent_p.L597L|SEZ6L_ENST00000360929.3_Intron|SEZ6L_ENST00000404234.3_Silent_p.L824L|SEZ6L_ENST00000411842.2_Silent_p.L21L			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	824	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.L824L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						GGATCCTGTGCTGCTGGTGGG	0.552																																																1	Substitution - coding silent(1)	ovary(1)	22											123.0	106.0	112.0					22																	26747080		2203	4300	6503	25077080	SO:0001819	synonymous_variant	23544			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2470C>T	22.37:g.26747080C>T		Somatic		Capture	Illumina GAIIx	4	25077080	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	HMMPfam_Sushi;HMMPfam_CUB;superfamily_Spermadhesin CUB domain;superfamily_Complement control module/SCR domain	p.L824	ENST00000248933.6	37	c.2470	CCDS13833.1	22																																																																																			-	HMMPfam_Sushi		0.552	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	protein_coding	OTTHUMT00000320359.3	C			25077080	1	no_errors	NM_021115	genbank	human	validated	54_36p	silent	SNP	1	T
APOBEC3D	140564	genome.wustl.edu	37	22	39427839	39427839	+	Silent	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr22:39427839C>T	ENST00000216099.8	+	6	1310	c.903C>T	c.(901-903)gcC>gcT	p.A301A	APOBEC3D_ENST00000427494.2_Silent_p.A117A|APOBEC3D_ENST00000381568.4_Silent_p.A301A	NM_152426.3	NP_689639.2	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D	301					defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)	p.A301A(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)	11	Melanoma(58;0.04)					GGGAGGTGGCCGAGTTCCTGG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	22											65.0	66.0	65.0					22																	39427839		1568	3578	5146	37757785	SO:0001819	synonymous_variant	140564			BF832090	CCDS46709.1	22q13.1	2012-10-19	2008-05-01		ENSG00000243811	ENSG00000243811		"""Apolipoprotein B mRNA editing enzymes"""	17354	protein-coding gene	gene with protein product		609900	"""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (putative)"", ""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3E pseudogene"""	APOBEC3E		11863358	Standard	NM_152426		Approved	ARP6, APOBEC3DE	uc003awt.4	Q96AK3	OTTHUMG00000151084	ENST00000216099.8:c.903C>T	22.37:g.39427839C>T		Somatic		Capture	Illumina GAIIx	4	37757785	Q5JZ91|Q7Z2N2|Q7Z2N5|Q7Z2N6	Silent	SNP	-	p.A301	ENST00000216099.8	37	c.903	CCDS46709.1	22																																																																																			-	NULL		0.562	APOBEC3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3D	protein_coding	OTTHUMT00000321232.2	C	NM_152426		37757785	1	no_errors	ENST00000216099	ensembl	human	known	54_36p	silent	SNP	0.03	T
CPT1B	1375	genome.wustl.edu	37	22	51011371	51011371	+	Missense_Mutation	SNP	C	C	T	rs546046921		TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr22:51011371C>T	ENST00000360719.2	-	11	1422	c.1285G>A	c.(1285-1287)Gac>Aac	p.D429N	CPT1B_ENST00000395650.2_Missense_Mutation_p.D429N|CPT1B_ENST00000405237.3_Missense_Mutation_p.D429N|CPT1B_ENST00000312108.7_Missense_Mutation_p.D429N|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000440709.1_Intron|CPT1B_ENST00000434492.2_Missense_Mutation_p.D226N|CPT1B_ENST00000457250.1_Missense_Mutation_p.D395N	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	429					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)	p.D429N(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		TCTTCGGGGTCATAGGAGTAG	0.577																																					Esophageal Squamous(170;988 1933 25577 30295 48163)											1	Substitution - Missense(1)	ovary(1)	22											125.0	119.0	121.0					22																	51011371		2203	4300	6503	49358237	SO:0001583	missense	1375			U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.1285G>A	22.37:g.51011371C>T	ENSP00000353945:p.Asp429Asn	Somatic		Capture	Illumina GAIIx	4	49358237	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Missense_Mutation	SNP	-	p.D429N	ENST00000360719.2	37	c.1285	CCDS14098.1	22	.	.	.	.	.	.	.	.	.	.	C	5.896	0.349399	0.11182	.	.	ENSG00000205560	ENST00000405237;ENST00000312108;ENST00000360719;ENST00000457250;ENST00000434492;ENST00000395650	D;D;D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49;-2.49;-2.49	4.98	1.57	0.23409	.	0.264809	0.41294	N	0.000914	T	0.77942	0.4206	N	0.21617	0.685	0.35168	D	0.771277	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.10450	0.005;0.003;0.005	T	0.68221	-0.5466	10	0.33141	T	0.24	-16.1375	6.5162	0.22248	0.0:0.3931:0.0:0.6069	.	395;226;429	B7Z4U4;A2RRE8;Q92523	.;.;CPT1B_HUMAN	N	429;429;429;395;226;429	ENSP00000385486:D429N;ENSP00000312189:D429N;ENSP00000353945:D429N;ENSP00000409342:D395N;ENSP00000410966:D226N;ENSP00000379011:D429N	ENSP00000312189:D429N	D	-	1	0	CPT1B	49358237	0.997000	0.39634	0.172000	0.22920	0.075000	0.17131	2.203000	0.42752	0.144000	0.18951	-0.258000	0.10820	GAC	-	NULL		0.577	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT1B	protein_coding	OTTHUMT00000317264.5	C	NM_152246		49358237	-1	no_errors	NM_004377	genbank	human	reviewed	54_36p	missense	SNP	0.81	T
GPR128	84873	genome.wustl.edu	37	3	100368630	100368630	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr3:100368630T>A	ENST00000273352.3	+	11	1626	c.1358T>A	c.(1357-1359)gTt>gAt	p.V453D	GPR128_ENST00000475887.1_Missense_Mutation_p.V158D	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	453					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V453D(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						GCTCTCACAGTTATATTTCAG	0.368																																					Pancreas(87;185 1975 7223 18722)											1	Substitution - Missense(1)	ovary(1)	3											121.0	116.0	117.0					3																	100368630		2203	4300	6503	101851320	SO:0001583	missense	84873			AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.1358T>A	3.37:g.100368630T>A	ENSP00000273352:p.Val453Asp	Somatic		Capture	Illumina GAIIx	4	101851320	Q14D94|Q86SQ2	Missense_Mutation	SNP	-	p.V453D	ENST00000273352.3	37	c.1358	CCDS2938.1	3	.	.	.	.	.	.	.	.	.	.	T	14.76	2.631999	0.46944	.	.	ENSG00000144820	ENST00000273352;ENST00000475887	T;T	0.51071	0.72;0.72	5.64	4.47	0.54385	GPCR, family 2-like (1);	0.085531	0.49916	D	0.000124	T	0.44850	0.1313	L	0.45352	1.415	0.09310	N	0.999999	P;B	0.51933	0.949;0.355	P;B	0.46419	0.516;0.338	T	0.39396	-0.9616	10	0.87932	D	0	.	10.5657	0.45171	0.0:0.0:0.162:0.838	.	158;453	E9PHI0;Q96K78	.;GP128_HUMAN	D	453;158	ENSP00000273352:V453D;ENSP00000419788:V158D	ENSP00000273352:V453D	V	+	2	0	GPR128	101851320	0.935000	0.31712	0.008000	0.14137	0.704000	0.40688	3.283000	0.51701	0.946000	0.37632	0.533000	0.62120	GTT	-	NULL		0.368	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR128	protein_coding	OTTHUMT00000353236.1	T			101851320	1	no_errors	NM_032787	genbank	human	provisional	54_36p	missense	SNP	0.3	A
HEG1	57493	genome.wustl.edu	37	3	124732833	124732833	+	Splice_Site	SNP	G	G	T	rs202024429		TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr3:124732833G>T	ENST00000311127.4	-	6	1657	c.1590C>A	c.(1588-1590)atC>atA	p.I530I	HEG1_ENST00000477536.1_5'UTR	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	530	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.I530I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TAATCCCAGCGACTGTAAACG	0.423																																																1	Substitution - coding silent(1)	ovary(1)	3											64.0	58.0	60.0					3																	124732833		1899	4124	6023	126215523	SO:0001630	splice_region_variant	57493			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.1589-1C>A	3.37:g.124732833G>T		Somatic		Capture	Illumina GAIIx	4	126215523	Q6NX66|Q8NC40|Q9BSV0	Silent	SNP	-	p.I530	ENST00000311127.4	37	c.1590	CCDS46898.1	3																																																																																			-	NULL		0.423	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	protein_coding	OTTHUMT00000355732.2	G	XM_087386	Silent	126215523	-1	no_errors	NM_020733	genbank	human	validated	54_36p	silent	SNP	0.12	T
SATB1-AS1	101927777	genome.wustl.edu	37	3	18580911	18580911	+	RNA	SNP	G	G	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr3:18580911G>T	ENST00000595865.1	+	0	364				AC144521.1_ENST00000598390.1_RNA|AC144521.1_ENST00000456253.2_RNA|AC144521.1_ENST00000596307.1_RNA|AC144521.1_ENST00000596139.1_RNA|AC144521.1_ENST00000595388.1_RNA|AC144521.1_ENST00000600177.1_RNA|AC144521.1_ENST00000595250.1_RNA|AC144521.1_ENST00000599762.1_RNA|AC144521.1_ENST00000596152.1_RNA																							TAGTACTGGGGCTCCTCAGTC	0.502																																																0			3																																								18555915			131185																															3.37:g.18580911G>T		Somatic		Capture	Illumina GAIIx	4	18555915		RNA	SNP	-	NULL	ENST00000595865.1	37	NULL		3																																																																																			-	-		0.502	AC144521.1-009	KNOWN	basic	antisense	LOC131185	processed_transcript	OTTHUMT00000461234.2	G			18555915	1	pseudogene	XR_016694	genbank	human	model	54_36p	rna	SNP	0.01	T
TRANK1	9881	genome.wustl.edu	37	3	36897212	36897212	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr3:36897212A>G	ENST00000429976.2	-	12	4116	c.3869T>C	c.(3868-3870)aTg>aCg	p.M1290T	TRANK1_ENST00000301807.6_Missense_Mutation_p.M740T|TRANK1_ENST00000428977.2_Missense_Mutation_p.M740T	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	1290							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)	p.M740T(2)		NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CCCTTTGGTCATTTTGGGCCA	0.468																																																2	Substitution - Missense(2)	ovary(2)	3											205.0	201.0	203.0					3																	36897212		1941	4151	6092	36872216	SO:0001583	missense	9881			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.3869T>C	3.37:g.36897212A>G	ENSP00000416168:p.Met1290Thr	Somatic		Capture	Illumina GAIIx	4	36872216	Q8N8K0	Missense_Mutation	SNP	-	p.M740T	ENST00000429976.2	37	c.2219	CCDS46789.2	3	.	.	.	.	.	.	.	.	.	.	A	12.33	1.906765	0.33628	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.31769	1.48;1.89;1.48	5.46	5.46	0.80206	.	0.073999	0.56097	D	0.000022	T	0.30103	0.0754	L	0.44542	1.39	0.49051	D	0.999746	P	0.39717	0.684	B	0.37780	0.258	T	0.09796	-1.0658	10	0.66056	D	0.02	.	15.8445	0.78876	1.0:0.0:0.0:0.0	.	1290	O15050	TRNK1_HUMAN	T	740;1290;740	ENSP00000416826:M740T;ENSP00000416168:M1290T;ENSP00000301807:M740T	ENSP00000301807:M740T	M	-	2	0	TRANK1	36872216	1.000000	0.71417	0.990000	0.47175	0.702000	0.40608	7.176000	0.77643	2.208000	0.71279	0.459000	0.35465	ATG	-	NULL		0.468	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LBA1	protein_coding		A	NM_014831		36872216	-1	no_errors	NM_014831	genbank	human	validated	54_36p	missense	SNP	1	G
NBEAL2	23218	genome.wustl.edu	37	3	47050489	47050489	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr3:47050489G>A	ENST00000450053.3	+	53	8217	c.8038G>A	c.(8038-8040)Gcc>Acc	p.A2680T	NBEAL2_ENST00000383740.2_Missense_Mutation_p.A929T|NBEAL2_ENST00000292309.5_Missense_Mutation_p.A2496T	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2680					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.A2057T(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		ACTGCTCCCGGCCGCGCCTCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	3											26.0	29.0	28.0					3																	47050489		1962	4123	6085	47025493	SO:0001583	missense	23218			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.8038G>A	3.37:g.47050489G>A	ENSP00000415034:p.Ala2680Thr	Somatic		Capture	Illumina GAIIx	4	47025493	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	-	p.A2680T	ENST00000450053.3	37	c.8038	CCDS46817.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.092305|5.092305	0.94149|0.94149	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000383740;ENST00000450053;ENST00000445550|ENST00000443829	T;T;T|.	0.16457|.	2.34;2.34;2.34|.	4.85|4.85	4.85|4.85	0.62838|0.62838	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.379178|.	0.28754|.	N|.	0.014250|.	T|T	0.52008|0.52008	0.1708|0.1708	L|L	0.46157|0.46157	1.445|1.445	0.27869|0.27869	N|N	0.940107|0.940107	D;P|.	0.56521|.	0.976;0.885|.	P;P|.	0.51615|.	0.675;0.621|.	T|T	0.46843|0.46843	-0.9162|-0.9162	10|5	0.29301|.	T|.	0.29|.	.|.	15.4919|15.4919	0.75611|0.75611	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2496;2680|.	Q6ZNJ1-2;Q6ZNJ1|.	.;NBEL2_HUMAN|.	T|D	2496;929;2680;623|1018	ENSP00000292309:A2496T;ENSP00000373246:A929T;ENSP00000415034:A2680T|.	ENSP00000292309:A2496T|.	A|G	+|+	1|2	0|0	NBEAL2|NBEAL2	47025493|47025493	0.012000|0.012000	0.17670|0.17670	0.259000|0.259000	0.24435|0.24435	0.855000|0.855000	0.48748|0.48748	1.566000|1.566000	0.36396|0.36396	2.510000|2.510000	0.84645|0.84645	0.462000|0.462000	0.41574|0.41574	GCC|GGC	-	NULL		0.617	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	protein_coding	OTTHUMT00000344363.3	G	XM_291064		47025493	1	no_errors	NM_015175	genbank	human	validated	54_36p	missense	SNP	0.011	A
WWP1P1	339843	genome.wustl.edu	37	3	98379044	98379044	+	IGR	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr3:98379044C>T								AC021660.1 (36156 upstream) : ST3GAL6-AS1 (54129 downstream)														p.T135M(1)									TTAGAGGTTACGTTGTGTGGC	0.413																																																1	Substitution - Missense(1)	ovary(1)	3																																								99861734	SO:0001628	intergenic_variant	339843																															3.37:g.98379044C>T		Somatic		Capture	Illumina GAIIx	4	99861734		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.413					LOC339843			C			99861734	1	pseudogene	XR_016598	genbank	human	model	54_36p	rna	SNP	1	T
BCHE	590	genome.wustl.edu	37	3	165547408	165547408	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr3:165547408A>G	ENST00000264381.3	-	2	1580	c.1414T>C	c.(1414-1416)Ttt>Ctt	p.F472L	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	472					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)	p.F472L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	CCAAAGACAAATTCAATTTCA	0.388																																																1	Substitution - Missense(1)	ovary(1)	3											88.0	92.0	90.0					3																	165547408		2203	4300	6503	167030102	SO:0001583	missense	590			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1414T>C	3.37:g.165547408A>G	ENSP00000264381:p.Phe472Leu	Somatic		Capture	Illumina GAIIx	4	167030102	A8K7P8	Missense_Mutation	SNP	HMMPfam_COesterase;HMMPfam_AChE_tetra;superfamily_alpha/beta-Hydrolases	p.F472L	ENST00000264381.3	37	c.1414	CCDS3198.1	3	.	.	.	.	.	.	.	.	.	.	A	22.7	4.325983	0.81580	.	.	ENSG00000114200	ENST00000264381	T	0.66995	-0.24	5.52	5.52	0.82312	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	T	0.78078	0.4227	M	0.73217	2.22	0.80722	D	1	D	0.55172	0.97	P	0.58780	0.845	T	0.81070	-0.1099	10	0.87932	D	0	.	14.8209	0.70070	1.0:0.0:0.0:0.0	.	472	P06276	CHLE_HUMAN	L	472	ENSP00000264381:F472L	ENSP00000264381:F472L	F	-	1	0	BCHE	167030102	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.832000	0.92079	2.105000	0.64084	0.482000	0.46254	TTT	-	HMMPfam_COesterase		0.388	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	protein_coding	OTTHUMT00000350254.1	A			167030102	-1	no_errors	NM_000055	genbank	human	reviewed	54_36p	missense	SNP	1	G
RPL7AP30	441034	genome.wustl.edu	37	4	113709507	113709507	+	IGR	SNP	A	A	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr4:113709507A>G								Y_RNA (32434 upstream) : ANK2 (29757 downstream)																							CTAAGGGACCACCATTTTACG	0.542																																																0			4																																								113928956	SO:0001628	intergenic_variant	441034																															4.37:g.113709507A>G		Somatic		Capture	Illumina GAIIx	4	113928956		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.542					LOC441034			A			113928956	-1	pseudogene	XR_016809	genbank	human	model	54_36p	rna	SNP	1	G
SETD7	80854	genome.wustl.edu	37	4	140432890	140432890	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr4:140432890C>A	ENST00000274031.3	-	8	1664	c.1028G>T	c.(1027-1029)gGg>gTg	p.G343V	SETD7_ENST00000506866.2_Intron	NM_030648.2	NP_085151.1	Q8WTS6	SETD7_HUMAN	SET domain containing (lysine methyltransferase) 7	343					chromatin modification (GO:0016568)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)	p.G343V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8	all_hematologic(180;0.156)					CCCACTCTTCCCGGGGGGGCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	4											61.0	64.0	63.0					4																	140432890		2203	4300	6503	140652340	SO:0001583	missense	80854			AB051504	CCDS3748.1	4q31.1	2011-07-01			ENSG00000145391	ENSG00000145391		"""Chromatin-modifying enzymes / K-methyltransferases"""	30412	protein-coding gene	gene with protein product		606594				11850410, 11779497	Standard	NM_030648		Approved	KIAA1717, SET7, SET7/9, Set9, KMT7	uc003ihw.3	Q8WTS6	OTTHUMG00000133385	ENST00000274031.3:c.1028G>T	4.37:g.140432890C>A	ENSP00000274031:p.Gly343Val	Somatic		Capture	Illumina GAIIx	4	140652340	B5WWL3|Q0VAH3|Q4W5A9|Q9C0E6	Missense_Mutation	SNP	HMMPfam_SET;HMMPfam_MORN;superfamily_Histone H3 K4-specific methyltransferase SET7/9 N-terminal domain;superfamily_SET domain	p.G343V	ENST00000274031.3	37	c.1028	CCDS3748.1	4	.	.	.	.	.	.	.	.	.	.	C	21.7	4.190459	0.78789	.	.	ENSG00000145391	ENST00000274031	D	0.85556	-2.0	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.84875	0.5569	L	0.32530	0.975	0.80722	D	1	D	0.65815	0.995	P	0.53593	0.73	D	0.86264	0.1657	10	0.87932	D	0	-24.5564	14.2292	0.65879	0.0:0.9292:0.0:0.0708	.	343	Q8WTS6	SETD7_HUMAN	V	343	ENSP00000274031:G343V	ENSP00000274031:G343V	G	-	2	0	SETD7	140652340	1.000000	0.71417	0.783000	0.31826	0.985000	0.73830	5.884000	0.69729	2.758000	0.94735	0.561000	0.74099	GGG	-	HMMPfam_SET		0.612	SETD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD7	protein_coding	OTTHUMT00000257236.1	C	NM_030648		140652340	-1	no_errors	NM_030648	genbank	human	validated	54_36p	missense	SNP	0.88	A
CRMP1	1400	genome.wustl.edu	37	4	5843063	5843063	+	Silent	SNP	G	G	A	rs138373028		TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr4:5843063G>A	ENST00000397890.2	-	8	997	c.783C>T	c.(781-783)gcC>gcT	p.A261A	CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000512574.1_Silent_p.A259A|CRMP1_ENST00000324989.7_Silent_p.A375A	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	261					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.A375A(1)		NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CGATGATGTCGGCTGCACTCT	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16169	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	4						G	,	2,4404	4.2+/-10.8	0,2,2201	180.0	174.0	176.0		1125,783	-8.9	0.0	4	dbSNP_134	176	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CRMP1	NM_001014809.1,NM_001313.3	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	375/687,261/573	5843063	2,13004	2203	4300	6503	5893964	SO:0001819	synonymous_variant	1400			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.783C>T	4.37:g.5843063G>A		Somatic		Capture	Illumina GAIIx	4	5893964	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	HMMPfam_Amidohydro_1;superfamily_Composite domain of metallo-dependent hydrolases;superfamily_Metallo-dependent hydrolases	p.A375	ENST00000397890.2	37	c.1125	CCDS43207.1	4																																																																																			-	HMMPfam_Amidohydro_1		0.622	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	protein_coding	OTTHUMT00000358871.1	G	NM_001313		5893964	-1	no_errors	NM_001014809	genbank	human	reviewed	54_36p	silent	SNP	0.25	A
FAT1	2195	genome.wustl.edu	37	4	187630466	187630466	+	Silent	SNP	G	G	A	rs548372738		TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr4:187630466G>A	ENST00000441802.2	-	2	725	c.516C>T	c.(514-516)agC>agT	p.S172S		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	172	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S172S(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CATCCGTGGCGCTGACTCTTG	0.438										HNSCC(5;0.00058)			G|||	1	0.000199681	0.0	0.0	5008	,	,		21298	0.0		0.001	False		,,,				2504	0.0				Colon(197;1040 2055 4143 4984 49344)											1	Substitution - coding silent(1)	ovary(1)	4											175.0	182.0	180.0					4																	187630466		2177	4279	6456	187867460	SO:0001819	synonymous_variant	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.516C>T	4.37:g.187630466G>A		Somatic		Capture	Illumina GAIIx	4	187867460		Silent	SNP	-	p.S172	ENST00000441802.2	37	c.516	CCDS47177.1	4																																																																																			-	NULL		0.438	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	protein_coding	OTTHUMT00000360209.3	G	NM_005245		187867460	-1	no_errors	NM_005245	genbank	human	reviewed	54_36p	silent	SNP	1	A
DNAH5	1767	genome.wustl.edu	37	5	13807741	13807741	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr5:13807741T>C	ENST00000265104.4	-	47	7950	c.7846A>G	c.(7846-7848)Agt>Ggt	p.S2616G		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2616	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S2616G(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AAATTCAGACTCTTGATCATG	0.383									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	5											146.0	136.0	139.0					5																	13807741		2203	4300	6503	13860741	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.7846A>G	5.37:g.13807741T>C	ENSP00000265104:p.Ser2616Gly	Somatic		Capture	Illumina GAIIx	4	13860741	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	-	p.S2616G	ENST00000265104.4	37	c.7846	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	T	16.65	3.182625	0.57800	.	.	ENSG00000039139	ENST00000265104	T	0.36157	1.27	5.87	5.87	0.94306	ATPase, AAA+ type, core (1);	0.172931	0.64402	D	0.000008	T	0.46521	0.1397	M	0.87900	2.915	0.42919	D	0.994282	B	0.10296	0.003	B	0.23852	0.049	T	0.50398	-0.8833	10	0.59425	D	0.04	.	11.3785	0.49743	0.1351:0.0:0.0:0.8649	.	2616	Q8TE73	DYH5_HUMAN	G	2616	ENSP00000265104:S2616G	ENSP00000265104:S2616G	S	-	1	0	DNAH5	13860741	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.238000	0.51352	2.236000	0.73375	0.528000	0.53228	AGT	-	NULL		0.383	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	protein_coding	OTTHUMT00000207057.2	T	NM_001369		13860741	-1	no_errors	NM_001369	genbank	human	validated	54_36p	missense	SNP	1	C
CDH10	1008	genome.wustl.edu	37	5	24511468	24511468	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr5:24511468C>A	ENST00000264463.4	-	6	1477	c.970G>T	c.(970-972)Gac>Tac	p.D324Y		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	324	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D324Y(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TCCTGTGTGTCCTTCTCAGTC	0.413										HNSCC(23;0.051)																																						1	Substitution - Missense(1)	ovary(1)	5											274.0	217.0	236.0					5																	24511468		2203	4300	6503	24547225	SO:0001583	missense	1008			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.970G>T	5.37:g.24511468C>A	ENSP00000264463:p.Asp324Tyr	Somatic		Capture	Illumina GAIIx	4	24547225	Q9ULB3	Missense_Mutation	SNP	HMMPfam_Cadherin_C;HMMPfam_Cadherin;superfamily_Cadherin-like	p.D324Y	ENST00000264463.4	37	c.970	CCDS3892.1	5	.	.	.	.	.	.	.	.	.	.	C	15.60	2.881320	0.51801	.	.	ENSG00000040731	ENST00000264463	T	0.48522	0.81	5.22	5.22	0.72569	Cadherin (4);Cadherin-like (1);	0.365437	0.31188	N	0.008089	T	0.61874	0.2382	H	0.95780	3.72	0.45205	D	0.998213	B	0.20164	0.042	B	0.25987	0.065	T	0.67803	-0.5576	10	0.66056	D	0.02	.	11.2628	0.49093	0.0:0.9164:0.0:0.0836	.	324	Q9Y6N8	CAD10_HUMAN	Y	324	ENSP00000264463:D324Y	ENSP00000264463:D324Y	D	-	1	0	CDH10	24547225	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.449000	0.44935	2.410000	0.81850	0.650000	0.86243	GAC	-	HMMPfam_Cadherin		0.413	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	protein_coding	OTTHUMT00000207345.2	C	NM_006727		24547225	-1	no_errors	NM_006727	genbank	human	reviewed	54_36p	missense	SNP	1	A
LOC102724392	102724392	genome.wustl.edu	37	5	70672200	70672200	+	lincRNA	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr5:70672200C>T	ENST00000502659.2	-	0	698				PMCHL2_ENST00000450213.2_RNA|RP11-136K7.3_ENST00000518473.1_lincRNA																							TCCATATCATCTTTTCAGAAG	0.388																																																0			5																																								70707956			5370																															5.37:g.70672200C>T		Somatic		Capture	Illumina GAIIx	4	70707956		RNA	SNP	-	NULL	ENST00000502659.2	37	NULL		5																																																																																			-	-		0.388	RP11-136K7.2-001	KNOWN	basic	lincRNA	PMCHL2	lincRNA	OTTHUMT00000374679.1	C			70707956	1	pseudogene	NR_003922	genbank	human	validated	54_36p	rna	SNP	0.96	T
ARHGEF28	64283	genome.wustl.edu	37	5	73142291	73142291	+	Silent	SNP	A	A	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr5:73142291A>G	ENST00000426542.2	+	11	1646	c.1626A>G	c.(1624-1626)ctA>ctG	p.L542L	ARHGEF28_ENST00000287898.5_Silent_p.L542L|ARHGEF28_ENST00000513042.2_Silent_p.L542L|ARHGEF28_ENST00000296799.4_Silent_p.L229L|ARHGEF28_ENST00000513841.1_3'UTR|ARHGEF28_ENST00000296794.6_Silent_p.L542L|ARHGEF28_ENST00000437974.1_Silent_p.L542L|ARHGEF28_ENST00000545377.1_Silent_p.L542L			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	542					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)	p.L542L(1)									CAAGTAATCTACAGTCGAAGG	0.373																																																1	Substitution - coding silent(1)	ovary(1)	5											82.0	75.0	77.0					5																	73142291		1826	4084	5910	73178047	SO:0001819	synonymous_variant	64283				CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.1626A>G	5.37:g.73142291A>G		Somatic		Capture	Illumina GAIIx	4	73178047	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Silent	SNP	-	p.L542	ENST00000426542.2	37	c.1626	CCDS54870.1	5																																																																																			-	NULL		0.373	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGNEF	protein_coding	OTTHUMT00000368975.1	A			73178047	1	no_errors	NM_001080479	genbank	human	provisional	54_36p	silent	SNP	0.98	G
PCDHB10	56126	genome.wustl.edu	37	5	140574499	140574499	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr5:140574499C>T	ENST00000239446.4	+	1	2558	c.2374C>T	c.(2374-2376)Cga>Tga	p.R792*		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	792					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R792*(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCCACCTTCCGAAATAGCTT	0.398																																																1	Substitution - Nonsense(1)	ovary(1)	5											42.0	46.0	45.0					5																	140574499		2203	4300	6503	140554683	SO:0001587	stop_gained	56126			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2374C>T	5.37:g.140574499C>T	ENSP00000239446:p.Arg792*	Somatic		Capture	Illumina GAIIx	4	140554683	Q96T99	Nonsense_Mutation	SNP	-	p.R792*	ENST00000239446.4	37	c.2374	CCDS4252.1	5	.	.	.	.	.	.	.	.	.	.	C	28.7	4.941820	0.92526	.	.	ENSG00000120324	ENST00000239446	.	.	.	3.47	-6.93	0.01638	.	.	.	.	.	.	.	.	.	.	.	0.22911	N	0.998571	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.9093	0.01291	0.2331:0.2542:0.1154:0.3972	.	.	.	.	X	792	.	ENSP00000239446:R792X	R	+	1	2	PCDHB10	140554683	0.000000	0.05858	0.000000	0.03702	0.288000	0.27193	-3.209000	0.00557	-1.950000	0.01030	0.461000	0.40582	CGA	-	NULL		0.398	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB10	protein_coding	OTTHUMT00000251821.1	C	NM_018930		140554683	1	no_errors	NM_018930	genbank	human	reviewed	54_36p	nonsense	SNP		T
HIVEP1	3096	genome.wustl.edu	37	6	12122774	12122774	+	Missense_Mutation	SNP	G	G	A	rs574039329		TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr6:12122774G>A	ENST00000379388.2	+	4	3078	c.2746G>A	c.(2746-2748)Gga>Aga	p.G916R		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	916					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G916R(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TCTTGGTACTGGACAGTCCCT	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		19296	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	6											54.0	56.0	55.0					6																	12122774		2049	4191	6240	12230760	SO:0001583	missense	3096			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.2746G>A	6.37:g.12122774G>A	ENSP00000368698:p.Gly916Arg	Somatic		Capture	Illumina GAIIx	4	12230760	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	-	p.G916R	ENST00000379388.2	37	c.2746	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	G	6.944	0.544002	0.13312	.	.	ENSG00000095951	ENST00000379388	T	0.25749	1.78	6.02	3.95	0.45737	.	0.314395	0.18109	N	0.151439	T	0.10551	0.0258	L	0.57536	1.79	0.24048	N	0.996057	B	0.13594	0.008	B	0.13407	0.009	T	0.13522	-1.0506	9	.	.	.	-14.0355	9.4475	0.38706	0.1426:0.0:0.7358:0.1216	.	916	P15822	ZEP1_HUMAN	R	916	ENSP00000368698:G916R	.	G	+	1	0	HIVEP1	12230760	0.209000	0.23505	0.630000	0.29268	0.383000	0.30230	1.616000	0.36933	1.569000	0.49696	0.655000	0.94253	GGA	-	NULL		0.517	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	protein_coding	OTTHUMT00000039870.2	G	NM_002114		12230760	1	no_errors	NM_002114	genbank	human	validated	54_36p	missense	SNP	0.074	A
RNF182	221687	genome.wustl.edu	37	6	13978055	13978055	+	Silent	SNP	T	T	C			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr6:13978055T>C	ENST00000488300.1	+	3	1228	c.705T>C	c.(703-705)gtT>gtC	p.V235V	RNF182_ENST00000537663.1_Silent_p.V235V|RNF182_ENST00000537388.1_Silent_p.V235V|RNF182_ENST00000544682.1_Silent_p.V235V	NM_152737.3	NP_689950.1	Q8N6D2	RN182_HUMAN	ring finger protein 182	235					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V235V(1)		cervix(1)|large_intestine(7)|liver(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			GCCAGTGTGTTTGTCATGAAT	0.418																																																1	Substitution - coding silent(1)	ovary(1)	6											168.0	157.0	161.0					6																	13978055		2203	4300	6503	14086034	SO:0001819	synonymous_variant	221687			AK090576	CCDS4531.1	6p23	2013-01-09			ENSG00000180537	ENSG00000180537		"""RING-type (C3HC4) zinc fingers"""	28522	protein-coding gene	gene with protein product						12477932	Standard	NM_152737		Approved	MGC33993	uc003nbg.3	Q8N6D2	OTTHUMG00000014280	ENST00000488300.1:c.705T>C	6.37:g.13978055T>C		Somatic		Capture	Illumina GAIIx	4	14086034	B2RDG2|Q8NBG3	Silent	SNP	-	p.V235	ENST00000488300.1	37	c.705	CCDS4531.1	6																																																																																			-	NULL		0.418	RNF182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF182	protein_coding	OTTHUMT00000039911.2	T	NM_152737		14086034	1	no_errors	NM_152737	genbank	human	provisional	54_36p	silent	SNP	0.9	C
GABBR1	2550	genome.wustl.edu	37	6	29588909	29588909	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr6:29588909T>C	ENST00000377034.4	-	11	1627	c.1292A>G	c.(1291-1293)aAt>aGt	p.N431S	GABBR1_ENST00000376977.3_Missense_Mutation_p.N431S|GABBR1_ENST00000377016.4_Missense_Mutation_p.N369S|GABBR1_ENST00000355973.3_Missense_Mutation_p.N314S|GABBR1_ENST00000377012.4_Missense_Mutation_p.N314S	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	431					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.N431S(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	ATTGGCAGGATTCAGCATGAC	0.547																																																1	Substitution - Missense(1)	ovary(1)	6											133.0	103.0	114.0					6																	29588909		1511	2709	4220	29696888	SO:0001583	missense	2550			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1292A>G	6.37:g.29588909T>C	ENSP00000366233:p.Asn431Ser	Somatic		Capture	Illumina GAIIx	4	29696888	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	HMMPfam_7tm_3;HMMPfam_Sushi;HMMPfam_ANF_receptor;superfamily_Periplasmic binding protein-like I;superfamily_Complement control module/SCR domain	p.N431S	ENST00000377034.4	37	c.1292	CCDS4663.1	6	.	.	.	.	.	.	.	.	.	.	t	14.78	2.636148	0.47049	.	.	ENSG00000204681	ENST00000355973;ENST00000376977;ENST00000377016;ENST00000377012;ENST00000377034	D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67	5.64	5.64	0.86602	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.71542	0.3352	N	0.11255	0.115	0.58432	D	0.999999	B;P;B;D	0.76494	0.067;0.95;0.428;0.999	B;B;B;D	0.80764	0.084;0.429;0.248;0.994	T	0.72364	-0.4316	10	0.07325	T	0.83	-15.3933	13.8215	0.63322	0.0:0.0:0.0:1.0	.	431;369;431;314	Q9UBS5-5;Q9UBS5-3;Q9UBS5;Q5SUJ9	.;.;GABR1_HUMAN;.	S	314;431;369;314;431	ENSP00000348248:N314S;ENSP00000366176:N431S;ENSP00000366215:N369S;ENSP00000366211:N314S;ENSP00000366233:N431S	ENSP00000348248:N314S	N	-	2	0	GABBR1	29696888	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.591000	0.82666	2.168000	0.68352	0.520000	0.50463	AAT	-	HMMPfam_ANF_receptor		0.547	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	protein_coding	OTTHUMT00000076141.3	T			29696888	-1	no_errors	NM_001470	genbank	human	reviewed	54_36p	missense	SNP	1	C
B3GALT4	8705	genome.wustl.edu	37	6	33245282	33245282	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr6:33245282G>T	ENST00000451237.1	+	1	366	c.86G>T	c.(85-87)gGg>gTg	p.G29V		NM_003782.3	NP_003773.1	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4	29					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ganglioside galactosyltransferase activity (GO:0047915)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)	p.G29V(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	13						TCGGGGTTGGGGGAGGAGCTG	0.692																																																1	Substitution - Missense(1)	ovary(1)	6											25.0	29.0	27.0					6																	33245282		2200	4291	6491	33353260	SO:0001583	missense	8705			Y15061	CCDS34425.1	6p21.3	2013-02-19			ENSG00000235863	ENSG00000235863		"""Beta 3-glycosyltransferases"""	919	protein-coding gene	gene with protein product		603095				9582303	Standard	NM_003782		Approved	beta3Gal-T4, GalT4	uc003odr.3	O96024	OTTHUMG00000031100	ENST00000451237.1:c.86G>T	6.37:g.33245282G>T	ENSP00000390784:p.Gly29Val	Somatic		Capture	Illumina GAIIx	4	33353260		Missense_Mutation	SNP	HMMPfam_Galactosyl_T	p.G29V	ENST00000451237.1	37	c.86	CCDS34425.1	6	.	.	.	.	.	.	.	.	.	.	G	17.35	3.366595	0.61513	.	.	ENSG00000235863	ENST00000451237	D	0.88046	-2.33	4.5	4.5	0.54988	.	.	.	.	.	T	0.76033	0.3931	N	0.19112	0.55	0.38810	D	0.955406	D	0.54772	0.968	P	0.50970	0.655	T	0.74627	-0.3602	9	0.22109	T	0.4	.	12.6434	0.56721	0.0:0.0:1.0:0.0	.	29	O96024	B3GT4_HUMAN	V	29	ENSP00000390784:G29V	ENSP00000390784:G29V	G	+	2	0	B3GALT4	33353260	1.000000	0.71417	0.991000	0.47740	0.947000	0.59692	1.395000	0.34520	2.352000	0.79861	0.543000	0.68304	GGG	-	NULL		0.692	B3GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALT4	protein_coding	OTTHUMT00000076162.2	G			33353260	1	no_errors	NM_003782	genbank	human	reviewed	54_36p	missense	SNP	0.05	T
BAK1	578	genome.wustl.edu	37	6	33543662	33543662	+	Silent	SNP	G	G	A	rs372257626		TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr6:33543662G>A	ENST00000374467.3	-	3	362	c.114C>T	c.(112-114)taC>taT	p.Y38Y	BAK1_ENST00000360661.5_Silent_p.Y38Y|BAK1_ENST00000442998.2_Silent_p.Y38Y	NM_001188.3	NP_001179.1	Q16611	BAK_HUMAN	BCL2-antagonist/killer 1	38					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic process involved in patterning of blood vessels (GO:1902262)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|B cell negative selection (GO:0002352)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast apoptotic process (GO:0044346)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|limb morphogenesis (GO:0035108)|mitochondrial fusion (GO:0008053)|myeloid cell homeostasis (GO:0002262)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of gene expression (GO:0010629)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic camera-type eye morphogenesis (GO:0048597)|regulation of cell cycle (GO:0051726)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|release of cytochrome c from mitochondria (GO:0001836)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to fungus (GO:0009620)|response to gamma radiation (GO:0010332)|response to hydrogen peroxide (GO:0042542)|response to mycotoxin (GO:0010046)|response to organic cyclic compound (GO:0014070)|response to UV-C (GO:0010225)|thymocyte apoptotic process (GO:0070242)|vagina development (GO:0060068)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|pore complex (GO:0046930)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.Y38Y(1)		large_intestine(1)|lung(1)|ovary(1)|skin(1)	4						GGTAAAAAACGTAGCTGCGGA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	6						G		0,4406		0,0,2203	88.0	80.0	83.0		114	-0.2	1.0	6		83	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BAK1	NM_001188.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		38/212	33543662	1,13005	2203	4300	6503	33651640	SO:0001819	synonymous_variant	578			U23765	CCDS4781.1	6p21.31	2014-03-07			ENSG00000030110	ENSG00000030110			949	protein-coding gene	gene with protein product		600516		CDN1		7715730, 7715731	Standard	NM_001188		Approved	BCL2L7, BAK	uc003oes.3	Q16611	OTTHUMG00000014530	ENST00000374467.3:c.114C>T	6.37:g.33543662G>A		Somatic		Capture	Illumina GAIIx	4	33651640	C0H5Y7|Q6I9T6|Q92533	Silent	SNP	-	p.Y38	ENST00000374467.3	37	c.114	CCDS4781.1	6																																																																																			-	NULL		0.602	BAK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BAK1	protein_coding	OTTHUMT00000040202.1	G	NM_001188		33651640	-1	no_errors	NM_001188	genbank	human	reviewed	54_36p	silent	SNP	1	A
GPR22	2845	genome.wustl.edu	37	7	107114562	107114562	+	Silent	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr7:107114562G>A	ENST00000304402.4	+	3	1400	c.57G>A	c.(55-57)gtG>gtA	p.V19V	COG5_ENST00000393603.2_Intron|COG5_ENST00000297135.3_Intron|COG5_ENST00000347053.3_Intron|COG5_ENST00000475638.2_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	19					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.V19V(1)		large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						ACATTACAGTGCGAGATGACA	0.368																																																1	Substitution - coding silent(1)	ovary(1)	7											141.0	113.0	122.0					7																	107114562		2203	4300	6503	106901798	SO:0001819	synonymous_variant	2845			U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.57G>A	7.37:g.107114562G>A		Somatic		Capture	Illumina GAIIx	4	106901798	O14554	Silent	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.V19	ENST00000304402.4	37	c.57	CCDS5744.1	7																																																																																			-	NULL		0.368	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR22	protein_coding	OTTHUMT00000337598.1	G			106901798	1	no_errors	NM_005295	genbank	human	reviewed	54_36p	silent	SNP	1	A
CPED1	79974	genome.wustl.edu	37	7	120768471	120768471	+	Silent	SNP	G	G	C			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr7:120768471G>C	ENST00000310396.5	+	11	1805	c.1338G>C	c.(1336-1338)ctG>ctC	p.L446L	CPED1_ENST00000450913.2_Silent_p.L446L|CPED1_ENST00000423795.1_Silent_p.L226L	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	446						endoplasmic reticulum (GO:0005783)		p.L446L(1)									ATCAGTGTCTGTCCTTAGAAG	0.343																																																1	Substitution - coding silent(1)	ovary(1)	7											90.0	91.0	91.0					7																	120768471		2203	4300	6503	120555707	SO:0001819	synonymous_variant	79974				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.1338G>C	7.37:g.120768471G>C		Somatic		Capture	Illumina GAIIx	4	120555707	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Silent	SNP	-	p.L446	ENST00000310396.5	37	c.1338	CCDS34739.1	7																																																																																			-	NULL		0.343	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf58	protein_coding	OTTHUMT00000346959.1	G	NM_024913		120555707	1	no_errors	NM_024913	genbank	human	validated	54_36p	silent	SNP	0.9	C
NPVF	64111	genome.wustl.edu	37	7	25268013	25268013	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr7:25268013T>A	ENST00000222674.2	-	1	92	c.46A>T	c.(46-48)Act>Tct	p.T16S		NM_022150.3	NP_071433	Q9HCQ7	NPVF_HUMAN	neuropeptide VF precursor	16					negative regulation of gonadotropin secretion (GO:0032277)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.T16S(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|urinary_tract(1)	15						AAGCTTGAAGTGGCTAAAGTC	0.303																																																1	Substitution - Missense(1)	ovary(1)	7											64.0	69.0	67.0					7																	25268013		2200	4293	6493	25234538	SO:0001583	missense	64111			AB040290	CCDS5395.1	7p21-p15	2013-02-28	2006-10-06	2006-10-06	ENSG00000105954	ENSG00000105954		"""Endogenous ligands"""	13782	protein-coding gene	gene with protein product	"""RFamide-related peptide precursor"", ""FMRFamide-related peptide precursor"""		"""chromosome 7 open reading frame 9"""	C7orf9		11951088, 11173868	Standard	NM_022150		Approved	RFRP	uc003sxo.3	Q9HCQ7	OTTHUMG00000128509	ENST00000222674.2:c.46A>T	7.37:g.25268013T>A	ENSP00000222674:p.Thr16Ser	Somatic		Capture	Illumina GAIIx	4	25234538	A4D164|Q7LE27|Q96PI9	Missense_Mutation	SNP	-	p.T16S	ENST00000222674.2	37	c.46	CCDS5395.1	7	.	.	.	.	.	.	.	.	.	.	T	10.21	1.287634	0.23478	.	.	ENSG00000105954	ENST00000222674	T	0.46063	0.88	5.37	4.22	0.49857	.	0.222293	0.31989	N	0.006750	T	0.55847	0.1946	M	0.73962	2.25	0.30230	N	0.796003	D	0.61080	0.989	P	0.57502	0.822	T	0.60475	-0.7256	10	0.66056	D	0.02	-0.7709	9.3383	0.38065	0.0:0.0816:0.0:0.9184	.	16	Q9HCQ7	RFRP_HUMAN	S	16	ENSP00000222674:T16S	ENSP00000222674:T16S	T	-	1	0	NPVF	25234538	1.000000	0.71417	0.998000	0.56505	0.133000	0.20885	1.841000	0.39240	0.870000	0.35726	-0.274000	0.10170	ACT	-	NULL		0.303	NPVF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPVF	protein_coding	OTTHUMT00000250315.1	T	NM_022150		25234538	-1	no_errors	NM_022150	genbank	human	validated	54_36p	missense	SNP	1	A
PCLO	27445	genome.wustl.edu	37	7	82546091	82546091	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr7:82546091T>A	ENST00000333891.9	-	7	11548	c.11211A>T	c.(11209-11211)caA>caT	p.Q3737H	PCLO_ENST00000423517.2_Missense_Mutation_p.Q3737H|PCLO_ENST00000437081.1_Missense_Mutation_p.Q457H	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.Q3737H(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGAATGTGGATTGAGTTCCTG	0.468																																																1	Substitution - Missense(1)	ovary(1)	7											139.0	122.0	128.0					7																	82546091		1869	4125	5994	82384027	SO:0001583	missense	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11211A>T	7.37:g.82546091T>A	ENSP00000334319:p.Gln3737His	Somatic		Capture	Illumina GAIIx	4	82384027		Missense_Mutation	SNP	-	p.Q3737H	ENST00000333891.9	37	c.11211	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	T	13.52	2.261794	0.39995	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.16743	2.33;2.32	5.71	2.48	0.30137	.	.	.	.	.	T	0.25754	0.0627	L	0.51422	1.61	0.42471	D	0.992822	P;D;D	0.59767	0.845;0.986;0.986	B;P;P	0.54100	0.34;0.742;0.742	T	0.03231	-1.1058	9	0.87932	D	0	.	11.0466	0.47863	0.0:0.7039:0.0:0.2961	.	3668;3737;3737	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	H	3737;3737;457	ENSP00000334319:Q3737H;ENSP00000388393:Q3737H	ENSP00000334319:Q3737H	Q	-	3	2	PCLO	82384027	0.992000	0.36948	0.978000	0.43139	0.883000	0.51084	0.697000	0.25556	0.754000	0.32968	-0.468000	0.05107	CAA	-	NULL		0.468	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	T	NM_014510		82384027	-1	no_errors	NM_033026	genbank	human	validated	54_36p	missense	SNP	1	A
EPHA1	2041	genome.wustl.edu	37	7	143092230	143092230	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr7:143092230A>G	ENST00000275815.3	-	13	2215	c.2129T>C	c.(2128-2130)cTg>cCg	p.L710P		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	710	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)	p.L710P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GAAGGCATCCAGGGCTCCATT	0.582																																																1	Substitution - Missense(1)	ovary(1)	7											139.0	117.0	124.0					7																	143092230		2203	4300	6503	142802352	SO:0001583	missense	2041			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.2129T>C	7.37:g.143092230A>G	ENSP00000275815:p.Leu710Pro	Somatic		Capture	Illumina GAIIx	4	142802352	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	Ephrin_lbd;HMMPfam_Ephrin_lbd;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;SAM_1;HMMPfam_SAM_1;fn3;HMMPfam_fn3	p.L710P	ENST00000275815.3	37	c.2129	CCDS5884.1	7	.	.	.	.	.	.	.	.	.	.	A	18.83	3.707582	0.68615	.	.	ENSG00000146904	ENST00000275815	D	0.84873	-1.91	4.83	4.83	0.62350	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47455	D	0.000224	D	0.94837	0.8332	H	0.97940	4.11	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95768	0.8806	10	0.87932	D	0	.	11.2973	0.49286	0.864:0.0:0.0:0.136	.	710	P21709	EPHA1_HUMAN	P	710	ENSP00000275815:L710P	ENSP00000275815:L710P	L	-	2	0	EPHA1	142802352	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.247000	0.78257	2.157000	0.67596	0.533000	0.62120	CTG	-	HMMPfam_Pkinase_Tyr		0.582	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA1	protein_coding	OTTHUMT00000342154.1	A			142802352	-1	no_errors	NM_005232	genbank	human	reviewed	54_36p	missense	SNP	1	G
PENK	5179	genome.wustl.edu	37	8	57353863	57353863	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr8:57353863C>G	ENST00000314922.3	-	2	848	c.772G>C	c.(772-774)Gaa>Caa	p.E258Q	PENK_ENST00000523274.1_5'Flank|PENK_ENST00000451791.2_Missense_Mutation_p.E258Q	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	258					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)	p.E258Q(1)		central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			TATCTTTTTTCCATTTCAGGA	0.498																																																1	Substitution - Missense(1)	ovary(1)	8											77.0	87.0	83.0					8																	57353863		2203	4300	6503	57516417	SO:0001583	missense	5179				CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.772G>C	8.37:g.57353863C>G	ENSP00000324248:p.Glu258Gln	Somatic		Capture	Illumina GAIIx	4	57516417	B2RC23|Q6FHC6|Q6FHE6	Missense_Mutation	SNP	HMMPfam_Opiods_neuropep	p.E258Q	ENST00000314922.3	37	c.772	CCDS6168.1	8	.	.	.	.	.	.	.	.	.	.	C	16.38	3.107101	0.56291	.	.	ENSG00000181195	ENST00000314922;ENST00000451791	T;T	0.74209	-0.82;-0.82	5.91	5.91	0.95273	.	0.095596	0.64402	D	0.000001	T	0.70465	0.3227	L	0.42529	1.33	0.80722	D	1	B	0.34015	0.435	B	0.33960	0.173	T	0.68580	-0.5371	10	0.42905	T	0.14	-17.822	19.2867	0.94077	0.0:1.0:0.0:0.0	.	258	P01210	PENK_HUMAN	Q	258	ENSP00000324248:E258Q;ENSP00000400894:E258Q	ENSP00000324248:E258Q	E	-	1	0	PENK	57516417	1.000000	0.71417	0.978000	0.43139	0.983000	0.72400	3.963000	0.56773	2.793000	0.96121	0.655000	0.94253	GAA	-	NULL		0.498	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PENK	protein_coding	OTTHUMT00000378645.1	C			57516417	-1	no_errors	NM_006211	genbank	human	validated	54_36p	missense	SNP	1	G
SETX	23064	genome.wustl.edu	37	9	135221654	135221654	+	Missense_Mutation	SNP	G	G	T	rs552476047		TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chr9:135221654G>T	ENST00000224140.5	-	4	564	c.382C>A	c.(382-384)Cgt>Agt	p.R128S	SETX_ENST00000393220.1_Missense_Mutation_p.R128S|SETX_ENST00000372169.2_Missense_Mutation_p.R128S	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	128					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.R128S(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TCACTAACACGTTCATGTAGA	0.333																																																1	Substitution - Missense(1)	ovary(1)	9											113.0	107.0	109.0					9																	135221654		2203	4300	6503	134211475	SO:0001583	missense	23064			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.382C>A	9.37:g.135221654G>T	ENSP00000224140:p.Arg128Ser	Somatic		Capture	Illumina GAIIx	4	134211475	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R128S	ENST00000224140.5	37	c.382	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067842	0.55539	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.82893	-1.66;-1.66;-1.66	5.49	5.49	0.81192	.	0.606289	0.16665	N	0.204623	T	0.75258	0.3825	N	0.14661	0.345	0.30563	N	0.764255	P	0.48407	0.91	P	0.45753	0.492	T	0.76572	-0.2910	10	0.56958	D	0.05	.	13.9313	0.63998	0.0:0.0:0.8383:0.1617	.	128	Q7Z333	SETX_HUMAN	S	128	ENSP00000224140:R128S;ENSP00000361242:R128S;ENSP00000376913:R128S	ENSP00000224140:R128S	R	-	1	0	SETX	134211475	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	3.502000	0.53332	2.596000	0.87737	0.557000	0.71058	CGT	-	NULL		0.333	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	protein_coding	OTTHUMT00000054774.3	G	NM_015046		134211475	-1	no_errors	NM_015046	genbank	human	reviewed	54_36p	missense	SNP	1	T
DHRSX	207063	genome.wustl.edu	37	X	2326807	2326807	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chrX:2326807C>T	ENST00000334651.5	-	3	317	c.265G>A	c.(265-267)Gaa>Aaa	p.E89K		NM_145177.2	NP_660160.2	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked	89							oxidoreductase activity (GO:0016491)	p.E89K(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)	16		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AAGGTTTCTTCTTTTATTTTG	0.373																																																1	Substitution - Missense(1)	ovary(1)	X											346.0	321.0	329.0					X																	2326807		2201	4296	6497	2336807	SO:0001583	missense	207063			AJ293620	CCDS35195.1	Xp22.33 and Yp11.2	2014-05-07	2003-09-12		ENSG00000169084	ENSG00000169084		"""Pseudoautosomal regions / PAR1"""	18399	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 6"", ""short chain dehydrogenase/reductase family 46C, member 1"", ""dehydrogenase/reductase (SDR family) Y-linked"""		"""dehydrogenase/reductase (SDR family) X chromosome"""			11731500, 19027726	Standard	NM_145177		Approved	DHRS5X, DHRSXY, DHRSY, DHRS5Y, SDR46C1, SDR7C6	uc004cqf.4	Q8N5I4	OTTHUMG00000021068	ENST00000334651.5:c.265G>A	X.37:g.2326807C>T	ENSP00000334113:p.Glu89Lys	Somatic		Capture	Illumina GAIIx	4	2336807	Q6UWC7|Q8WUS4|Q96GR8|Q9NTF6	Missense_Mutation	SNP	HMMPfam_adh_short;superfamily_NAD(P)-binding Rossmann-fold domains	p.E89K	ENST00000334651.5	37	c.265	CCDS35195.1	X	.	.	.	.	.	.	.	.	.	.	c	11.70	1.717250	0.30413	.	.	ENSG00000169084	ENST00000334651;ENST00000444280	T;D	0.84730	-1.04;-1.89	1.14	0.21	0.15231	NAD(P)-binding domain (1);	0.427376	0.19544	U	0.111722	T	0.62720	0.2451	N	0.17082	0.46	0.09310	N	1	B	0.32409	0.37	B	0.28011	0.085	T	0.55309	-0.8161	10	0.06625	T	0.88	.	3.5453	0.07826	0.0:0.717:0.0:0.283	.	89	Q8N5I4	DHRSX_HUMAN	K	89;22	ENSP00000334113:E89K;ENSP00000402741:E22K	ENSP00000334113:E89K	E	-	1	0	DHRSX	2336807	0.772000	0.28567	0.001000	0.08648	0.087000	0.18053	1.604000	0.36804	0.045000	0.15804	0.280000	0.19369	GAA	-	HMMPfam_adh_short		0.373	DHRSX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRSX	protein_coding	OTTHUMT00000055617.3	C	NM_145177		2336807	-1	no_errors	NM_145177	genbank	human	validated	54_36p	missense	SNP	0.03	T
MXRA5	25878	genome.wustl.edu	37	X	3241268	3241268	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chrX:3241268G>A	ENST00000217939.6	-	5	2612	c.2458C>T	c.(2458-2460)Cct>Tct	p.P820S		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	820						extracellular vesicular exosome (GO:0070062)		p.P820S(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCAGGAAAAGGTGGTGTGACT	0.478																																																1	Substitution - Missense(1)	ovary(1)	X											145.0	141.0	143.0					X																	3241268		2203	4300	6503	3251268	SO:0001583	missense	25878			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.2458C>T	X.37:g.3241268G>A	ENSP00000217939:p.Pro820Ser	Somatic		Capture	Illumina GAIIx	4	3251268	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	HMMPfam_LRR_1,HMMPfam_I-set,HMMPfam_ig,superfamily_Immunoglobulin,superfamily_L domain-like	p.P820S	ENST00000217939.6	37	c.2458	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	g	6.428	0.447128	0.12223	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.64438	-0.1	3.63	2.75	0.32379	.	1.000890	0.08064	U	0.998801	T	0.42743	0.1216	N	0.08118	0	0.09310	N	1	P	0.44578	0.838	B	0.41135	0.348	T	0.26780	-1.0093	10	0.56958	D	0.05	.	7.292	0.26372	0.0:0.2058:0.613:0.1812	.	820	Q9NR99	MXRA5_HUMAN	S	820	ENSP00000217939:P820S	ENSP00000217939:P820S	P	-	1	0	MXRA5	3251268	0.622000	0.27085	0.000000	0.03702	0.007000	0.05969	1.128000	0.31369	0.387000	0.25024	0.529000	0.55759	CCT	-	NULL		0.478	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	protein_coding	OTTHUMT00000055655.2	G	NM_015419		3251268	-1	no_errors	NM_015419	genbank	human	validated	54_36p	missense	SNP	0	A
UBQLN2	29978	genome.wustl.edu	37	X	56591172	56591172	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chrX:56591172G>T	ENST00000338222.5	+	1	1147	c.866G>T	c.(865-867)gGt>gTt	p.G289V		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	289					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G289V(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						CAGTTTGGGGGTAATCCATTT	0.532																																					Esophageal Squamous(104;218 1492 6022 10838 28884)											1	Substitution - Missense(1)	ovary(1)	X											52.0	49.0	50.0					X																	56591172		2203	4300	6503	56607897	SO:0001583	missense	29978			AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.866G>T	X.37:g.56591172G>T	ENSP00000345195:p.Gly289Val	Somatic		Capture	Illumina GAIIx	4	56607897	O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	HMMPfam_UBA,HMMPfam_ubiquitin,superfamily_UBA-like,superfamily_XPC-binding domain,superfamily_ARM repeat,superfamily_Ubiquitin-like	p.G289V	ENST00000338222.5	37	c.866	CCDS14374.1	X	.	.	.	.	.	.	.	.	.	.	G	15.06	2.720218	0.48728	.	.	ENSG00000188021	ENST00000338222;ENST00000535171	T	0.79454	-1.27	4.93	4.93	0.64822	.	0.000000	0.64402	D	0.000002	D	0.87617	0.6222	M	0.82193	2.58	0.80722	D	1	D;D	0.65815	0.995;0.992	D;D	0.66196	0.942;0.917	D	0.88810	0.3291	10	0.56958	D	0.05	-6.7153	14.6902	0.69080	0.0:0.0:1.0:0.0	.	289;289	B4DZF1;Q9UHD9	.;UBQL2_HUMAN	V	289	ENSP00000345195:G289V	ENSP00000345195:G289V	G	+	2	0	UBQLN2	56607897	0.965000	0.33210	1.000000	0.80357	0.896000	0.52359	2.033000	0.41136	2.440000	0.82611	0.600000	0.82982	GGT	-	NULL		0.532	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN2	protein_coding	OTTHUMT00000056891.1	G	NM_013444		56607897	1	no_errors	NM_013444	genbank	human	reviewed	54_36p	missense	SNP	0.997	T
LPAR4	2846	genome.wustl.edu	37	X	78011285	78011285	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1470-01A-01W-0553-09	TCGA-24-1470-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	1d2bf111-910b-4ce9-8638-ab992b414e65	60102268-7f80-4d74-aab6-a2cdd0f221d6	g.chrX:78011285G>T	ENST00000435339.3	+	2	1305	c.919G>T	c.(919-921)Gac>Tac	p.D307Y		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	307					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)	p.D307N(1)|p.D307Y(1)|p.D307H(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						CTGTTGTTTTGACCCTTTCAT	0.418																																																3	Substitution - Missense(3)	ovary(2)|breast(1)	X											197.0	159.0	172.0					X																	78011285		2203	4300	6503	77897941	SO:0001583	missense	2846			U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.919G>T	X.37:g.78011285G>T	ENSP00000408205:p.Asp307Tyr	Somatic		Capture	Illumina GAIIx	4	77897941	B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	-	p.D307Y	ENST00000435339.3	37	c.919	CCDS14441.1	X	.	.	.	.	.	.	.	.	.	.	G	16.41	3.116900	0.56505	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.74209	-0.82;-0.82	3.99	3.99	0.46301	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	U	0.000000	D	0.89908	0.6851	H	0.95982	3.75	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.92988	0.6412	10	0.87932	D	0	.	13.9688	0.64225	0.0:0.0:1.0:0.0	.	307	Q99677	LPAR4_HUMAN	Y	307	ENSP00000408205:D307Y;ENSP00000362398:D307Y	ENSP00000362398:D307Y	D	+	1	0	LPAR4	77897941	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.112000	0.94314	1.832000	0.53329	0.422000	0.28245	GAC	-	NULL		0.418	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR4	protein_coding	OTTHUMT00000057322.2	G	NM_005296		77897941	1	no_errors	NM_005296	genbank	human	reviewed	54_36p	missense	SNP	1	T
