#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ALOX5AP	241	hgsc.bcm.edu	37	13	31318290	31318290	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr13:31318290C>T	ENST00000380490.3	+	2	262	c.164C>T	c.(163-165)aCt>aTt	p.T55I	ALOX5AP_ENST00000479597.1_3'UTR	NM_001204406.1|NM_001629.3	NP_001191335.1|NP_001620.2	P20292	AL5AP_HUMAN	arachidonate 5-lipoxygenase-activating protein	55					arachidonic acid metabolic process (GO:0019369)|cellular response to calcium ion (GO:0071277)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|positive regulation of acute inflammatory response (GO:0002675)|protein homotrimerization (GO:0070207)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	arachidonic acid binding (GO:0050544)|enzyme activator activity (GO:0008047)|protein N-terminus binding (GO:0047485)	p.T55I(1)		endometrium(1)|large_intestine(1)|ovary(1)|prostate(1)	4		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0187)|Epithelial(112;0.0803)|OV - Ovarian serous cystadenocarcinoma(117;0.0864)		CGGGTCTACACTGCCAAGTGA	0.537																																																1	Substitution - Missense(1)	ovary(1)	13											78.0	59.0	66.0					13																	31318290		2203	4300	6503	30216290	SO:0001583	missense	241			AH001462	CCDS9337.1, CCDS73558.1	13q12	2008-07-18			ENSG00000132965	ENSG00000132965			436	protein-coding gene	gene with protein product	"""five-lipoxygenase activating protein"", ""MK-886-binding protein"""	603700				1673682, 10036194	Standard	NM_001629		Approved	FLAP	uc010tdr.2	P20292	OTTHUMG00000016677	ENST00000380490.3:c.164C>T	13.37:g.31318290C>T	ENSP00000369858:p.Thr55Ile	Somatic		WXS	SOLID	Phase_III	30216290	Q5VV04	Missense_Mutation	SNP	ENST00000380490.3	37	CCDS9337.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963038	0.74016	.	.	ENSG00000132965	ENST00000380490	T	0.68903	-0.36	5.68	5.68	0.88126	Membrane associated eicosanoid/glutathione metabolism-like domain (1);FLAP/GST2/LTC4S, conserved site (1);	0.093194	0.85682	D	0.000000	T	0.74650	0.3744	L	0.36672	1.1	0.50171	D	0.999853	D	0.76494	0.999	D	0.85130	0.997	T	0.74799	-0.3542	10	0.51188	T	0.08	-17.0092	15.2816	0.73790	0.0:1.0:0.0:0.0	.	55	P20292	AL5AP_HUMAN	I	55	ENSP00000369858:T55I	ENSP00000369858:T55I	T	+	2	0	ALOX5AP	30216290	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	3.099000	0.50267	2.674000	0.91012	0.555000	0.69702	ACT		0.537	ALOX5AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044372.1	NM_001629	
CD99L2	83692	hgsc.bcm.edu	37	X	149938816	149938816	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chrX:149938816C>T	ENST00000370377.3	-	10	799	c.682G>A	c.(682-684)Gga>Aga	p.G228R	CD99L2_ENST00000466436.1_Missense_Mutation_p.G179R|CD99L2_ENST00000355149.3_Missense_Mutation_p.G156R|CD99L2_ENST00000346693.4_5'UTR|CD99L2_ENST00000437787.2_Missense_Mutation_p.G155R	NM_001242614.1|NM_031462.3	NP_001229543.1|NP_113650.2	Q8TCZ2	C99L2_HUMAN	CD99 molecule-like 2	228					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G228R(1)		endometrium(4)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					AGGTTCTCTCCCTTCACGTAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	X											215.0	126.0	156.0					X																	149938816		2203	4300	6503	149689474	SO:0001583	missense	83692			BC030536	CCDS14697.1, CCDS14698.1, CCDS35427.1, CCDS55527.1, CCDS76044.1	Xq28	2007-12-04	2006-03-28	2003-02-14	ENSG00000102181	ENSG00000102181			18237	protein-coding gene	gene with protein product		300846	"""MIC2 like 1"", ""CD99 antigen-like 2"""	MIC2L1			Standard	NM_001184808		Approved	CD99B	uc004fek.3	Q8TCZ2	OTTHUMG00000024247	ENST00000370377.3:c.682G>A	X.37:g.149938816C>T	ENSP00000359403:p.Gly228Arg	Somatic		WXS	SOLID	Phase_III	149689474	A8K2D5|A8K5R0|B3KWG2|B4DDL7|E7EMK5|E9PD27|Q8TAW2|Q8TCZ0|Q8TCZ1|Q9BQG9	Missense_Mutation	SNP	ENST00000370377.3	37	CCDS35427.1	.	.	.	.	.	.	.	.	.	.	c	16.46	3.130621	0.56828	.	.	ENSG00000102181	ENST00000370377;ENST00000438086;ENST00000355149;ENST00000437787;ENST00000466436	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.09	4.23	0.50019	.	0.192524	0.45126	N	0.000395	T	0.51907	0.1702	M	0.80982	2.52	0.80722	D	1	D;D;D;P	0.89917	1.0;0.999;1.0;0.777	D;D;D;B	0.97110	1.0;0.981;1.0;0.396	T	0.55496	-0.8132	9	.	.	.	-9.4079	13.379	0.60757	0.0:0.9215:0.0:0.0785	.	155;156;179;228	E9PD27;Q8TCZ2-3;Q8TCZ2-2;Q8TCZ2	.;.;.;C99L2_HUMAN	R	228;238;156;155;179	ENSP00000359403:G228R;ENSP00000347275:G156R;ENSP00000394858:G155R;ENSP00000417697:G179R	.	G	-	1	0	CD99L2	149689474	1.000000	0.71417	0.987000	0.45799	0.451000	0.32288	3.574000	0.53863	1.078000	0.41014	-0.251000	0.11542	GGA		0.542	CD99L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000061199.1	NM_031462	
KIAA1467	57613	hgsc.bcm.edu	37	12	13221382	13221382	+	Splice_Site	SNP	G	G	C			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr12:13221382G>C	ENST00000197268.8	+	8	1406		c.e8+1			NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467							integral component of membrane (GO:0016021)		p.?(1)		NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		GCCTGCGCAGGTTTGCATTGT	0.458																																																1	Unknown(1)	ovary(1)	12											177.0	136.0	150.0					12																	13221382		2203	4300	6503	13112649	SO:0001630	splice_region_variant	57613			AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67		ENST00000197268.8:c.1286+1G>C	12.37:g.13221382G>C		Somatic		WXS	SOLID	Phase_III	13112649	Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Splice_Site	SNP	ENST00000197268.8	37	CCDS31750.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103442	0.56291	.	.	ENSG00000084444	ENST00000197268;ENST00000537625	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4053	0.87472	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA1467	13112649	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	6.337000	0.72958	2.532000	0.85374	0.655000	0.94253	.		0.458	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401007.1	NM_020853	Intron
MOSPD2	158747	hgsc.bcm.edu	37	X	14929504	14929504	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chrX:14929504C>A	ENST00000380492.3	+	9	936	c.848C>A	c.(847-849)tCt>tAt	p.S283Y	MOSPD2_ENST00000495110.1_3'UTR|MOSPD2_ENST00000482354.1_Missense_Mutation_p.S283Y	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	283						integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)	p.S283Y(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					GAAACAATTTCTAATGAAGAA	0.373																																																1	Substitution - Missense(1)	ovary(1)	X											93.0	84.0	87.0					X																	14929504		2203	4300	6503	14839425	SO:0001583	missense	158747			AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.848C>A	X.37:g.14929504C>A	ENSP00000369860:p.Ser283Tyr	Somatic		WXS	SOLID	Phase_III	14839425	Q8N3H2|Q8NA83	Missense_Mutation	SNP	ENST00000380492.3	37	CCDS14162.1	.	.	.	.	.	.	.	.	.	.	C	4.742	0.137954	0.09083	.	.	ENSG00000130150	ENST00000380492	T	0.66099	-0.19	5.0	2.22	0.28083	.	0.345366	0.31312	N	0.007879	T	0.50309	0.1608	L	0.57536	1.79	0.09310	N	1	B	0.15473	0.013	B	0.20577	0.03	T	0.35001	-0.9806	10	0.17369	T	0.5	-25.8417	5.2448	0.15490	0.0:0.5904:0.1471:0.2625	.	283	Q8NHP6	MSPD2_HUMAN	Y	283	ENSP00000369860:S283Y	ENSP00000369860:S283Y	S	+	2	0	MOSPD2	14839425	0.997000	0.39634	0.113000	0.21522	0.636000	0.38137	1.096000	0.30976	0.102000	0.17638	0.594000	0.82650	TCT		0.373	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055837.1	NM_152581	
PPFIA1	8500	hgsc.bcm.edu	37	11	70221056	70221056	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr11:70221056C>T	ENST00000253925.7	+	24	3387	c.3172C>T	c.(3172-3174)Cgc>Tgc	p.R1058C	PPFIA1_ENST00000389547.3_Missense_Mutation_p.R1058C|PPFIA1_ENST00000530548.1_3'UTR|AP000487.5_ENST00000500185.2_RNA|AP000487.5_ENST00000530690.1_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	1058	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)	p.R1058C(1)		breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TCGAGTGATTCGCTGGATCCT	0.408																																																1	Substitution - Missense(1)	ovary(1)	11											137.0	122.0	127.0					11																	70221056		2200	4294	6494	69898704	SO:0001583	missense	8500			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.3172C>T	11.37:g.70221056C>T	ENSP00000253925:p.Arg1058Cys	Somatic		WXS	SOLID	Phase_III	69898704	A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	C	18.37	3.610013	0.66558	.	.	ENSG00000131626	ENST00000253925;ENST00000389547;ENST00000544950	D;D	0.85088	-1.94;-1.94	5.75	4.83	0.62350	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.683493	0.14346	U	0.325429	D	0.83175	0.5197	L	0.45744	1.44	0.39864	D	0.973411	D;B;B	0.67145	0.996;0.003;0.045	P;B;B	0.45506	0.483;0.004;0.009	T	0.82849	-0.0254	10	0.46703	T	0.11	.	13.9075	0.63845	0.2769:0.7231:0.0:0.0	.	555;1058;1058	F5H1G2;Q13136;Q13136-2	.;LIPA1_HUMAN;.	C	1058;1058;555	ENSP00000253925:R1058C;ENSP00000374198:R1058C	ENSP00000253925:R1058C	R	+	1	0	PPFIA1	69898704	0.052000	0.20516	0.830000	0.32933	0.855000	0.48748	1.264000	0.33015	1.410000	0.46936	0.650000	0.86243	CGC		0.408	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626	
PTGFRN	5738	hgsc.bcm.edu	37	1	117509940	117509940	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr1:117509940T>C	ENST00000393203.2	+	6	2194	c.2047T>C	c.(2047-2049)Ttc>Ctc	p.F683L	PTGFRN_ENST00000496699.1_3'UTR	NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	683					lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.F683L(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		TGAGATAGACTTCCAAACCTC	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											44.0	45.0	45.0					1																	117509940		2203	4299	6502	117311463	SO:0001583	missense	5738			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.2047T>C	1.37:g.117509940T>C	ENSP00000376899:p.Phe683Leu	Somatic		WXS	SOLID	Phase_III	117311463	Q5VVU9|Q8N2K6	Missense_Mutation	SNP	ENST00000393203.2	37	CCDS890.1	.	.	.	.	.	.	.	.	.	.	T	17.35	3.368478	0.61513	.	.	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.02656	4.21	5.56	5.56	0.83823	.	0.048608	0.85682	D	0.000000	T	0.01092	0.0036	N	0.19112	0.55	0.58432	D	0.999998	P	0.39940	0.696	B	0.33750	0.169	T	0.65121	-0.6245	10	0.49607	T	0.09	-34.8724	13.9585	0.64164	0.0:0.0:0.0:1.0	.	683	Q9P2B2	FPRP_HUMAN	L	683;542	ENSP00000376899:F683L	ENSP00000376899:F683L	F	+	1	0	PTGFRN	117311463	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.792000	0.69052	2.249000	0.74217	0.528000	0.53228	TTC		0.512	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033271.1	NM_020440	
PUM2	23369	hgsc.bcm.edu	37	2	20494170	20494170	+	Silent	SNP	T	T	C			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr2:20494170T>C	ENST00000361078.2	-	8	1141	c.1119A>G	c.(1117-1119)caA>caG	p.Q373Q	PUM2_ENST00000536417.1_Silent_p.Q317Q|PUM2_ENST00000403432.1_Silent_p.Q373Q|PUM2_ENST00000338086.5_Silent_p.Q373Q|PUM2_ENST00000319801.5_Silent_p.Q373Q			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	373	Ala-rich.|Gln-rich.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)	p.Q373Q(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGATGCTGCTTGCTGACTGG	0.468																																																1	Substitution - coding silent(1)	ovary(1)	2											123.0	115.0	118.0					2																	20494170		2203	4300	6503	20357651	SO:0001819	synonymous_variant	23369			AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.1119A>G	2.37:g.20494170T>C		Somatic		WXS	SOLID	Phase_III	20357651	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Silent	SNP	ENST00000361078.2	37																																																																																					0.468	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317	
SLC9A4	389015	hgsc.bcm.edu	37	2	103142730	103142730	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr2:103142730A>C	ENST00000295269.4	+	11	2420	c.1963A>C	c.(1963-1965)Aat>Cat	p.N655H		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	655					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.N655H(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TGGCACCAAGAATATCCGCTA	0.517																																																1	Substitution - Missense(1)	ovary(1)	2											136.0	130.0	132.0					2																	103142730		2203	4300	6503	102509162	SO:0001583	missense	389015				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.1963A>C	2.37:g.103142730A>C	ENSP00000295269:p.Asn655His	Somatic		WXS	SOLID	Phase_III	102509162	Q69YK0	Missense_Mutation	SNP	ENST00000295269.4	37	CCDS33264.1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.629224	0.46944	.	.	ENSG00000180251	ENST00000295269	T	0.46819	0.86	5.8	5.8	0.92144	.	0.719472	0.14502	N	0.315686	T	0.58163	0.2103	M	0.63428	1.95	0.31074	N	0.712736	D	0.57571	0.98	P	0.53146	0.719	T	0.61917	-0.6964	10	0.39692	T	0.17	.	13.6782	0.62467	1.0:0.0:0.0:0.0	.	655	Q6AI14	SL9A4_HUMAN	H	655	ENSP00000295269:N655H	ENSP00000295269:N655H	N	+	1	0	SLC9A4	102509162	1.000000	0.71417	1.000000	0.80357	0.348000	0.29142	2.616000	0.46376	2.209000	0.71365	0.533000	0.62120	AAT		0.517	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329498.1	NM_001011552.3	
SLFN13	146857	hgsc.bcm.edu	37	17	33769259	33769260	+	Frame_Shift_Ins	INS	-	-	T			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr17:33769259_33769260insT	ENST00000285013.6	-	5	1519_1520	c.1244_1245insA	c.(1243-1245)gagfs	p.E415fs	SLFN13_ENST00000534689.1_Frame_Shift_Ins_p.E97fs|SLFN13_ENST00000542635.1_Frame_Shift_Ins_p.E415fs|SLFN13_ENST00000360502.2_Frame_Shift_Ins_p.E97fs|SLFN13_ENST00000533791.1_Frame_Shift_Ins_p.E415fs|SLFN13_ENST00000526861.1_Frame_Shift_Ins_p.E415fs	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	415						intracellular (GO:0005622)	ATP binding (GO:0005524)	p.L416fs*6(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GTAAAGACAGCTCCTTCCAGAG	0.436																																																1	Insertion - Frameshift(1)	ovary(1)	17																																								30793373	SO:0001589	frameshift_variant	146857			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1245dupA	17.37:g.33769260_33769260dupT	ENSP00000285013:p.Glu415fs	Somatic		WXS	SOLID	Phase_III	30793372	E1P645|Q658M1|Q6ZS51|Q96A81	Frame_Shift_Ins	INS	ENST00000285013.6	37	CCDS32620.1																																																																																				0.436	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
SLFN13	146857	hgsc.bcm.edu	37	17	33769264	33769264	+	Nonsense_Mutation	SNP	T	T	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr17:33769264T>A	ENST00000285013.6	-	5	1515	c.1240A>T	c.(1240-1242)Aag>Tag	p.K414*	SLFN13_ENST00000534689.1_Nonsense_Mutation_p.K96*|SLFN13_ENST00000542635.1_Nonsense_Mutation_p.K414*|SLFN13_ENST00000360502.2_Nonsense_Mutation_p.K96*|SLFN13_ENST00000533791.1_Nonsense_Mutation_p.K414*|SLFN13_ENST00000526861.1_Nonsense_Mutation_p.K414*	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	414						intracellular (GO:0005622)	ATP binding (GO:0005524)	p.K414*(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GACAGCTCCTTCCAGAGGGAC	0.423																																																1	Substitution - Nonsense(1)	ovary(1)	17											61.0	59.0	60.0					17																	33769264		2203	4300	6503	30793377	SO:0001587	stop_gained	146857			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1240A>T	17.37:g.33769264T>A	ENSP00000285013:p.Lys414*	Somatic		WXS	SOLID	Phase_III	30793377	E1P645|Q658M1|Q6ZS51|Q96A81	Nonsense_Mutation	SNP	ENST00000285013.6	37	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	t	31	5.080444	0.94050	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689;ENST00000532210	.	.	.	3.21	0.678	0.17969	.	1.226110	0.05891	N	0.628291	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.9969	0.06001	0.0:0.147:0.2581:0.5949	.	.	.	.	X	414;96;414;414;96;83	.	ENSP00000285013:K414X	K	-	1	0	SLFN13	30793377	0.000000	0.05858	0.020000	0.16555	0.104000	0.19210	-0.629000	0.05508	0.434000	0.26340	0.334000	0.21626	AAG		0.423	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
ABHD5	51099	hgsc.bcm.edu	37	3	43743852	43743852	+	Silent	SNP	G	G	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr3:43743852G>A	ENST00000458276.2	+	3	402	c.279G>A	c.(277-279)ctG>ctA	p.L93L		NM_016006.4	NP_057090.2	Q8WTS1	ABHD5_HUMAN	abhydrolase domain containing 5	93					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|negative regulation of sequestering of triglyceride (GO:0010891)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|lysophosphatidic acid acyltransferase activity (GO:0042171)	p.L93L(1)		kidney(3)|large_intestine(2)|liver(2)|lung(5)|ovary(1)|skin(1)	14		Renal(3;0.0134)		KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0687)		TCTGGGCACTGAATTTTGGAG	0.423																																																1	Substitution - coding silent(1)	ovary(1)	3											196.0	196.0	196.0					3																	43743852		2203	4300	6503	43718856	SO:0001819	synonymous_variant	51099			AF007132	CCDS2711.1	3p21.33	2012-05-16			ENSG00000011198	ENSG00000011198		"""Abhydrolase domain containing"""	21396	protein-coding gene	gene with protein product		604780				11590543, 18606822	Standard	NM_016006		Approved	CGI-58, NCIE2	uc003cmx.3	Q8WTS1	OTTHUMG00000133039	ENST00000458276.2:c.279G>A	3.37:g.43743852G>A		Somatic		WXS	SOLID	Phase_III	43718856	B2R9K0|Q9Y369	Silent	SNP	ENST00000458276.2	37	CCDS2711.1																																																																																				0.423	ABHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256644.2	NM_016006	
AOX1	316	hgsc.bcm.edu	37	2	201534449	201534449	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr2:201534449A>T	ENST00000374700.2	+	34	4191	c.3950A>T	c.(3949-3951)gAc>gTc	p.D1317V	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	1317					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)	p.D1317V(1)		breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GCCTGTGAAGACAAGTTCACA	0.448																																																1	Substitution - Missense(1)	ovary(1)	2											116.0	113.0	114.0					2																	201534449		2203	4300	6503	201242694	SO:0001583	missense	316			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.3950A>T	2.37:g.201534449A>T	ENSP00000363832:p.Asp1317Val	Somatic		WXS	SOLID	Phase_III	201242694	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	37	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	A	18.30	3.592840	0.66219	.	.	ENSG00000138356	ENST00000374700;ENST00000260930;ENST00000439380	T;T;T	0.75367	-0.93;-0.93;-0.93	5.51	5.51	0.81932	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (2);	0.433911	0.26525	N	0.023900	D	0.85401	0.5688	M	0.84082	2.675	0.80722	D	1	D	0.56968	0.978	P	0.61070	0.883	D	0.87654	0.2530	10	0.87932	D	0	-70.7461	14.7432	0.69472	1.0:0.0:0.0:0.0	.	1317	Q06278	ADO_HUMAN	V	1317;181;157	ENSP00000363832:D1317V;ENSP00000260930:D181V;ENSP00000413326:D157V	ENSP00000260930:D181V	D	+	2	0	AOX1	201242694	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.339000	0.52135	2.313000	0.78055	0.455000	0.32223	GAC		0.448	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159	
CBLC	23624	hgsc.bcm.edu	37	19	45297507	45297507	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr19:45297507C>T	ENST00000270279.3	+	9	1394	c.1331C>T	c.(1330-1332)cCc>cTc	p.P444L	CBLC_ENST00000341505.4_Missense_Mutation_p.P398L	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	444	Interaction with RET.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P444L(1)		breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				GATCTGCCCCCCAGGAAGCCC	0.632			M		AML																																		Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	1	Substitution - Missense(1)	ovary(1)	19											84.0	98.0	94.0					19																	45297507		2203	4300	6503	49989347	SO:0001583	missense	23624			AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	ENST00000270279.3:c.1331C>T	19.37:g.45297507C>T	ENSP00000270279:p.Pro444Leu	Somatic		WXS	SOLID	Phase_III	49989347	Q8N1E5|Q9Y5Z2|Q9Y5Z3	Missense_Mutation	SNP	ENST00000270279.3	37	CCDS12643.1	.	.	.	.	.	.	.	.	.	.	.	14.35	2.509024	0.44660	.	.	ENSG00000142273	ENST00000270279;ENST00000341505	D;D	0.86865	-2.18;-2.17	2.95	1.9	0.25705	.	0.452370	0.17770	N	0.162640	D	0.87297	0.6142	L	0.34521	1.04	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.75983	-0.3125	10	0.87932	D	0	-11.2221	5.8907	0.18911	0.0:0.8536:0.0:0.1464	.	398;444	Q9ULV8-2;Q9ULV8	.;CBLC_HUMAN	L	444;398	ENSP00000270279:P444L;ENSP00000340250:P398L	ENSP00000270279:P444L	P	+	2	0	CBLC	49989347	0.107000	0.21998	0.006000	0.13384	0.160000	0.22226	3.464000	0.53057	0.816000	0.34421	0.555000	0.69702	CCC		0.632	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319732.2	NM_012116	
CCL15	6359	hgsc.bcm.edu	37	17	34325392	34325392	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr17:34325392T>C	ENST00000354059.4	-	3	724	c.172A>G	c.(172-174)Atc>Gtc	p.I58V	CCL14_ENST00000536149.1_5'UTR|CCL15-CCL14_ENST00000481427.2_Missense_Mutation_p.I58V	NM_032965.4	NP_116741.1	Q16663	CCL15_HUMAN	chemokine (C-C motif) ligand 15	58					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|immune response (GO:0006955)|positive chemotaxis (GO:0050918)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.I58V(1)		large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTTTGTGAGATGTAGGAGGTG	0.498																																																1	Substitution - Missense(1)	ovary(1)	17											74.0	63.0	67.0					17																	34325392		2203	4300	6503	31349505	SO:0001583	missense	6359			AF031587	CCDS11304.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000267596	ENSG00000275718		"""Chemokine ligands"", ""Endogenous ligands"""	10613	protein-coding gene	gene with protein product	"""leukotactin 1"", ""CC chemokine 3"", ""macrophage inflammatory protein 5"", ""chemokine CC-2"", ""MIP-1 delta"""	601393	"""small inducible cytokine subfamily A (Cys-Cys), member 15"""	SCYA15		8661057	Standard	NM_032965		Approved	HCC-2, NCC-3, SCYL3, MIP-5, Lkn-1, MIP-1d, HMRP-2B	uc010wcu.2	Q16663	OTTHUMG00000188406	ENST00000354059.4:c.172A>G	17.37:g.34325392T>C	ENSP00000293276:p.Ile58Val	Somatic		WXS	SOLID	Phase_III	31349505	B2RU34|E1P651|Q9UM74	Missense_Mutation	SNP	ENST00000354059.4	37	CCDS11304.1	.	.	.	.	.	.	.	.	.	.	T	0.888	-0.726321	0.03158	.	.	ENSG00000161574	ENST00000354059	T	0.12465	2.68	4.55	-1.57	0.08506	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	1.087510	0.07045	N	0.830955	T	0.06508	0.0167	N	0.13198	0.31	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43147	-0.9409	10	0.17369	T	0.5	.	4.143	0.10203	0.1707:0.3934:0.0:0.4358	.	58	Q16663	CCL15_HUMAN	V	58	ENSP00000293276:I58V	ENSP00000293276:I58V	I	-	1	0	CCL15	31349505	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.362000	0.02595	-0.211000	0.10124	-0.264000	0.10439	ATC		0.498	CCL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256584.2	NM_004167	
CPA5	93979	hgsc.bcm.edu	37	7	130002341	130002341	+	Silent	SNP	G	G	A	rs140378089		TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr7:130002341G>A	ENST00000485477.1	+	7	1726	c.597G>A	c.(595-597)gaG>gaA	p.E199E	CPA5_ENST00000355388.3_Silent_p.E199E|CPA5_ENST00000393213.3_Silent_p.E199E|CPA5_ENST00000466363.2_Silent_p.E199E|CPA5_ENST00000474905.1_Silent_p.E199E|CPA5_ENST00000461828.1_Silent_p.E199E|CPA5_ENST00000431780.2_Silent_p.E199E			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	199	Substrate binding. {ECO:0000250}.					extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.E199E(1)		NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					ACTCCCGGGAGTGGATCACCC	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18011	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	7						G	,,	1,4405	2.1+/-5.4	0,1,2202	51.0	47.0	48.0		597,597,597	5.6	1.0	7	dbSNP_134	48	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	CPA5	NM_001127441.1,NM_001127442.1,NM_080385.4	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	199/437,199/404,199/437	130002341	1,13005	2203	4300	6503	129789577	SO:0001819	synonymous_variant	93979			AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.597G>A	7.37:g.130002341G>A		Somatic		WXS	SOLID	Phase_III	129789577	G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Silent	SNP	ENST00000485477.1	37	CCDS5819.1																																																																																				0.577	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	NM_001127441	
DDX46	9879	hgsc.bcm.edu	37	5	134099771	134099771	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr5:134099771G>T	ENST00000354283.4	+	2	330	c.195G>T	c.(193-195)agG>agT	p.R65S	DDX46_ENST00000452510.2_Missense_Mutation_p.R65S			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	65	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.R65S(1)		NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CAAGGGACAGGAAGCGTCTGA	0.438																																					Colon(13;391 453 4901 21675 24897)											1	Substitution - Missense(1)	ovary(1)	5											86.0	85.0	86.0					5																	134099771		2203	4300	6503	134127670	SO:0001583	missense	9879				CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.195G>T	5.37:g.134099771G>T	ENSP00000346236:p.Arg65Ser	Somatic		WXS	SOLID	Phase_III	134127670	O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	ENST00000354283.4	37	CCDS34240.1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.522365	0.27211	.	.	ENSG00000145833	ENST00000452510;ENST00000537371;ENST00000354283	T;T	0.38887	1.11;1.11	5.22	3.3	0.37823	.	0.000000	0.85682	D	0.000000	T	0.53061	0.1773	M	0.80422	2.495	0.58432	D	0.999999	D	0.54601	0.967	P	0.60789	0.879	T	0.58370	-0.7648	10	0.08837	T	0.75	-18.1305	6.8872	0.24209	0.3587:0.0:0.6413:0.0	.	65	Q7L014	DDX46_HUMAN	S	65	ENSP00000416534:R65S;ENSP00000346236:R65S	ENSP00000346236:R65S	R	+	3	2	DDX46	134127670	0.995000	0.38212	1.000000	0.80357	0.992000	0.81027	0.279000	0.18771	1.431000	0.47355	0.650000	0.86243	AGG		0.438	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829	
EHHADH	1962	hgsc.bcm.edu	37	3	184922213	184922213	+	Missense_Mutation	SNP	C	C	G	rs201955662		TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr3:184922213C>G	ENST00000231887.3	-	6	976	c.901G>C	c.(901-903)Ggt>Cgt	p.G301R	EHHADH_ENST00000456310.1_Missense_Mutation_p.G205R	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	301	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)	p.G301R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			CCAACAACACCAACTGAGGAG	0.488																																																1	Substitution - Missense(1)	ovary(1)	3											91.0	86.0	88.0					3																	184922213		2203	4300	6503	186404907	SO:0001583	missense	1962			L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.901G>C	3.37:g.184922213C>G	ENSP00000231887:p.Gly301Arg	Somatic		WXS	SOLID	Phase_III	186404907	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.240346	0.58995	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.78246	-1.16;-1.16	5.53	5.53	0.82687	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.285625	0.37261	N	0.002168	D	0.89993	0.6876	M	0.88031	2.925	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	D	0.91569	0.5270	10	0.87932	D	0	-16.0472	18.0274	0.89273	0.0:1.0:0.0:0.0	.	301	Q08426	ECHP_HUMAN	R	301;301;205	ENSP00000231887:G301R;ENSP00000387746:G205R	ENSP00000231887:G301R	G	-	1	0	EHHADH	186404907	1.000000	0.71417	1.000000	0.80357	0.281000	0.26958	4.547000	0.60712	2.611000	0.88343	0.650000	0.86243	GGT		0.488	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
ELOVL3	83401	hgsc.bcm.edu	37	10	103988226	103988226	+	Missense_Mutation	SNP	G	G	A	rs150163535	byFrequency	TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr10:103988226G>A	ENST00000370005.3	+	3	507	c.286G>A	c.(286-288)Ggg>Agg	p.G96R		NM_152310.1	NP_689523.1	Q9HB03	ELOV3_HUMAN	ELOVL fatty acid elongase 3	96					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.G96R(1)		breast(2)|lung(10)|ovary(2)|prostate(1)|skin(1)	16		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		GCTACTTACCGGGGGCCTAAA	0.502																																																1	Substitution - Missense(1)	ovary(1)	10						G	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	113.0	107.0	109.0		286	-3.7	0.0	10	dbSNP_134	109	1,8599	1.2+/-3.3	0,1,4299	no	missense	ELOVL3	NM_152310.1	125	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	96/271	103988226	2,13004	2203	4300	6503	103978216	SO:0001583	missense	83401			AF292387	CCDS7531.1	10q24	2011-05-25	2011-05-25		ENSG00000119915	ENSG00000119915			18047	protein-coding gene	gene with protein product		611815	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3"""				Standard	NM_152310		Approved	CIG-30	uc001kut.3	Q9HB03	OTTHUMG00000018951	ENST00000370005.3:c.286G>A	10.37:g.103988226G>A	ENSP00000359022:p.Gly96Arg	Somatic		WXS	SOLID	Phase_III	103978216	Q5VZL3|Q8N180	Missense_Mutation	SNP	ENST00000370005.3	37	CCDS7531.1	.	.	.	.	.	.	.	.	.	.	G	9.123	1.009359	0.19277	2.27E-4	1.16E-4	ENSG00000119915	ENST00000370005	T	0.21361	2.01	4.67	-3.69	0.04450	.	0.959064	0.08632	N	0.916897	T	0.11922	0.0290	N	0.17594	0.5	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.36529	-0.9744	10	0.19590	T	0.45	-20.6228	13.1013	0.59222	0.6747:0.0:0.3253:0.0	.	96	Q9HB03	ELOV3_HUMAN	R	96	ENSP00000359022:G96R	ENSP00000359022:G96R	G	+	1	0	ELOVL3	103978216	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.389000	0.07342	-0.874000	0.04027	-0.291000	0.09656	GGG		0.502	ELOVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050030.1	NM_152310	
ERCC6L	54821	hgsc.bcm.edu	37	X	71425402	71425402	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chrX:71425402C>G	ENST00000334463.3	-	2	3350	c.3215G>C	c.(3214-3216)gGa>gCa	p.G1072A	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000373657.1_Missense_Mutation_p.G949A	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	1072					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.G1072A(1)		breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					AAAGAACCTTCCTGGTGGACT	0.368																																																1	Substitution - Missense(1)	ovary(1)	X											77.0	78.0	78.0					X																	71425402		2203	4300	6503	71342127	SO:0001583	missense	54821			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.3215G>C	X.37:g.71425402C>G	ENSP00000334675:p.Gly1072Ala	Somatic		WXS	SOLID	Phase_III	71342127	Q8NCI1|Q96H93|Q9NXQ8	Missense_Mutation	SNP	ENST00000334463.3	37	CCDS35329.1	.	.	.	.	.	.	.	.	.	.	C	0.021	-1.429254	0.01117	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	D;D	0.90324	-2.62;-2.65	5.58	1.09	0.20402	.	.	.	.	.	T	0.81403	0.4815	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.64567	-0.6377	9	0.28530	T	0.3	-0.8078	0.6015	0.00745	0.1775:0.2603:0.1709:0.3913	.	1072	Q2NKX8	ERC6L_HUMAN	A	949;1072	ENSP00000362761:G949A;ENSP00000334675:G1072A	ENSP00000334675:G1072A	G	-	2	0	ERCC6L	71342127	0.000000	0.05858	0.008000	0.14137	0.050000	0.14768	0.476000	0.22180	0.120000	0.18254	-0.225000	0.12378	GGA		0.368	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669	
FSHR	2492	hgsc.bcm.edu	37	2	49381418	49381418	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr2:49381418T>A	ENST00000406846.2	-	1	258	c.139A>T	c.(139-141)Aat>Tat	p.N47Y	FSHR_ENST00000346173.3_Missense_Mutation_p.N47Y|FSHR_ENST00000304421.4_Missense_Mutation_p.N47Y	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	47					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.N47Y(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	TCAATGGCATTCCTCGGGAGG	0.468									Gonadal Dysgenesis, 46 XX																																							1	Substitution - Missense(1)	ovary(1)	2											69.0	69.0	69.0					2																	49381418		2203	4300	6503	49234922	SO:0001583	missense	2492	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.139A>T	2.37:g.49381418T>A	ENSP00000384708:p.Asn47Tyr	Somatic		WXS	SOLID	Phase_III	49234922	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	T	13.46	2.242973	0.39697	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000454032	D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9	5.46	4.31	0.51392	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.88987	0.6587	M	0.73217	2.22	0.80722	D	1	D;D;D	0.62365	0.983;0.991;0.987	P;P;P	0.62014	0.792;0.897;0.729	D	0.87641	0.2522	9	.	.	.	.	8.0138	0.30368	0.0:0.0895:0.0:0.9105	.	47;47;47	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	Y	47	ENSP00000384708:N47Y;ENSP00000333908:N47Y;ENSP00000306780:N47Y;ENSP00000415504:N47Y	.	N	-	1	0	FSHR	49234922	1.000000	0.71417	0.989000	0.46669	0.288000	0.27193	2.765000	0.47621	1.092000	0.41356	0.533000	0.62120	AAT		0.468	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2		
GNL3L	54552	hgsc.bcm.edu	37	X	54584948	54584948	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chrX:54584948C>G	ENST00000336470.4	+	15	1665	c.1526C>G	c.(1525-1527)cCt>cGt	p.P509R	GNL3L_ENST00000360845.2_Missense_Mutation_p.P509R	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	509					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.P509R(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						GACCACCGCCCTAAGAGCAAC	0.557																																																1	Substitution - Missense(1)	ovary(1)	X											128.0	93.0	105.0					X																	54584948		2203	4300	6503	54601673	SO:0001583	missense	54552			AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.1526C>G	X.37:g.54584948C>G	ENSP00000338573:p.Pro509Arg	Somatic		WXS	SOLID	Phase_III	54601673		Missense_Mutation	SNP	ENST00000336470.4	37	CCDS14360.1	.	.	.	.	.	.	.	.	.	.	C	1.722	-0.496277	0.04291	.	.	ENSG00000130119	ENST00000336470;ENST00000360845	T;T	0.17370	2.28;2.28	3.97	3.97	0.46021	.	1.047260	0.07429	N	0.895387	T	0.11922	0.0290	L	0.27053	0.805	0.21933	N	0.999461	B	0.34015	0.435	B	0.27715	0.082	T	0.10291	-1.0636	10	0.20519	T	0.43	-24.9582	10.4238	0.44365	0.0:1.0:0.0:0.0	.	509	Q9NVN8	GNL3L_HUMAN	R	509	ENSP00000338573:P509R;ENSP00000354091:P509R	ENSP00000338573:P509R	P	+	2	0	GNL3L	54601673	0.626000	0.27120	0.010000	0.14722	0.004000	0.04260	1.375000	0.34295	2.218000	0.71995	0.422000	0.28245	CCT		0.557	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056805.1	NM_019067	
IL10RA	3587	hgsc.bcm.edu	37	11	117870266	117870266	+	Silent	SNP	C	C	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr11:117870266C>A	ENST00000227752.3	+	7	1767	c.1647C>A	c.(1645-1647)ggC>ggA	p.G549G	IL10RA_ENST00000541785.1_Silent_p.G529G|IL10RA_ENST00000545409.1_Silent_p.G400G|IL10RA_ENST00000533700.1_3'UTR	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	549					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.G549G(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		CCCCTCTAGGCTGTGTGGCAG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	11											51.0	48.0	49.0					11																	117870266		2199	4296	6495	117375476	SO:0001819	synonymous_variant	3587			U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.1647C>A	11.37:g.117870266C>A		Somatic		WXS	SOLID	Phase_III	117375476	A8K6I0|B0YJ27	Silent	SNP	ENST00000227752.3	37	CCDS8388.1																																																																																				0.592	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
LEPR	3953	hgsc.bcm.edu	37	1	66102662	66102662	+	Missense_Mutation	SNP	G	G	C	rs377057835		TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr1:66102662G>C	ENST00000349533.6	+	20	3647	c.3462G>C	c.(3460-3462)aaG>aaC	p.K1154N	LEPR_ENST00000406510.3_Missense_Mutation_p.K221N	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)	p.K1154N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AGACTCATAAGATCATGGAAA	0.318																																																1	Substitution - Missense(1)	ovary(1)	1						G	ASN/LYS	0,4406		0,0,2203	61.0	62.0	62.0		3462	3.0	1.0	1		62	1,8599		0,1,4299	no	missense	LEPR	NM_002303.5	94	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	possibly-damaging	1154/1166	66102662	1,13005	2203	4300	6503	65875250	SO:0001583	missense	3953			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.3462G>C	1.37:g.66102662G>C	ENSP00000330393:p.Lys1154Asn	Somatic		WXS	SOLID	Phase_III	65875250	Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	CCDS631.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.367265	0.61513	0.0	1.16E-4	ENSG00000116678	ENST00000349533;ENST00000406510	T	0.58060	0.36	5.93	3.0	0.34707	.	0.331020	0.33895	N	0.004452	T	0.32556	0.0833	M	0.65975	2.015	0.32174	N	0.581311	P	0.46064	0.872	B	0.39660	0.306	T	0.18116	-1.0347	10	0.49607	T	0.09	-11.8094	10.4791	0.44682	0.2203:0.0:0.7797:0.0	.	1154	P48357	LEPR_HUMAN	N	1154;221	ENSP00000330393:K1154N	ENSP00000330393:K1154N	K	+	3	2	LEPR	65875250	0.943000	0.32029	0.999000	0.59377	0.986000	0.74619	0.361000	0.20267	0.814000	0.34374	0.585000	0.79938	AAG		0.318	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
IPO9	55705	hgsc.bcm.edu	37	1	201840382	201840382	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr1:201840382G>A	ENST00000361565.4	+	19	2572	c.2503G>A	c.(2503-2505)Gct>Act	p.A835T		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	835					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)	p.A835T(1)		cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						TGGCAAACCTGCTCTAGAGTT	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											103.0	93.0	96.0					1																	201840382		2203	4300	6503	200107005	SO:0001583	missense	55705			AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.2503G>A	1.37:g.201840382G>A	ENSP00000354742:p.Ala835Thr	Somatic		WXS	SOLID	Phase_III	200107005	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	ENST00000361565.4	37	CCDS1415.1	.	.	.	.	.	.	.	.	.	.	G	35	5.481805	0.96307	.	.	ENSG00000198700	ENST00000361565	T	0.67345	-0.26	5.28	5.28	0.74379	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81692	0.4876	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81495	-0.0907	10	0.40728	T	0.16	-9.261	16.4294	0.83835	0.0:0.0:1.0:0.0	.	835	Q96P70	IPO9_HUMAN	T	835	ENSP00000354742:A835T	ENSP00000354742:A835T	A	+	1	0	IPO9	200107005	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.363000	0.97131	2.467000	0.83353	0.655000	0.94253	GCT		0.512	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1	NM_018085	
MAN1B1	11253	hgsc.bcm.edu	37	9	140002995	140002995	+	Silent	SNP	C	C	T	rs118117962	byFrequency	TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr9:140002995C>T	ENST00000371589.4	+	13	2125	c.2052C>T	c.(2050-2052)taC>taT	p.Y684Y	MAN1B1_ENST00000540391.1_3'UTR|MAN1B1_ENST00000474902.1_Silent_p.Y387Y	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	684					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.Y684Y(1)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		TGGATGCCTACGTGTTCAACA	0.592													C|||	81	0.0161741	0.0015	0.0331	5008	,	,		18114	0.0		0.0368	False		,,,				2504	0.0194															1	Substitution - coding silent(1)	ovary(1)	9						C		39,4367	43.1+/-76.7	0,39,2164	202.0	199.0	200.0		2052	-7.6	0.1	9	dbSNP_132	200	400,8200	127.5+/-185.8	10,380,3910	no	coding-synonymous	MAN1B1	NM_016219.3		10,419,6074	TT,TC,CC		4.6512,0.8852,3.3754		684/700	140002995	439,12567	2203	4300	6503	139122816	SO:0001819	synonymous_variant	11253			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.2052C>T	9.37:g.140002995C>T		Somatic		WXS	SOLID	Phase_III	139122816	Q5VSG3|Q9BRS9|Q9Y5K7	Silent	SNP	ENST00000371589.4	37	CCDS7029.1	46|46	0.021062271062271064|0.021062271062271064	1|1	0.0020325203252032522|0.0020325203252032522	16|16	0.04419889502762431|0.04419889502762431	0|0	0.0|0.0	29|29	0.03825857519788918|0.03825857519788918	C|C	9.288|9.288	1.049890|1.049890	0.19827|0.19827	0.008852|0.008852	0.046512|0.046512	ENSG00000177239|ENSG00000177239	ENST00000550113|ENST00000475449	.|.	.|.	.|.	5.44|5.44	-7.55|-7.55	0.01327|0.01327	.|.	.|.	.|.	.|.	.|.	T|T	0.24928|0.24928	0.0605|0.0605	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.65853|0.65853	-0.6067|-0.6067	4|4	.|.	.|.	.|.	.|.	17.6248|17.6248	0.88091|0.88091	0.0119:0.794:0.0:0.194|0.0119:0.794:0.0:0.194	.|.	.|.	.|.	.|.	C|M	109|110	.|.	.|.	R|T	+|+	1|2	0|0	MAN1B1|MAN1B1	139122816|139122816	0.001000|0.001000	0.12720|0.12720	0.058000|0.058000	0.19502|0.19502	0.156000|0.156000	0.22039|0.22039	-1.774000|-1.774000	0.01784|0.01784	-1.344000|-1.344000	0.02216|0.02216	-1.036000|-1.036000	0.02392|0.02392	CGT|ACG		0.592	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055294.2	NM_016219	
NCR3	259197	hgsc.bcm.edu	37	6	31557641	31557641	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr6:31557641G>C	ENST00000340027.5	-	2	569	c.306C>G	c.(304-306)gaC>gaG	p.D102E	NCR3_ENST00000376073.4_Missense_Mutation_p.D102E|NCR3_ENST00000376071.4_Missense_Mutation_p.D77E|NCR3_ENST00000376072.3_Missense_Mutation_p.D102E|NCR3_ENST00000491161.1_5'UTR	NM_147130.2	NP_667341.1	O14931	NCTR3_HUMAN	natural cytotoxicity triggering receptor 3	102	Ig-like.				cell recognition (GO:0008037)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	integral component of plasma membrane (GO:0005887)		p.D102E(1)		cervix(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)	9						AGATGCTGGCGTCATGGCCTC	0.632																																																1	Substitution - Missense(1)	ovary(1)	6											141.0	126.0	131.0					6																	31557641		1511	2709	4220	31665620	SO:0001583	missense	259197			AB055881	CCDS34397.1, CCDS47401.1, CCDS47402.1	6p21.3	2013-01-11	2002-11-13	2002-11-15	ENSG00000204475	ENSG00000204475		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19077	protein-coding gene	gene with protein product		611550	"""lymphocyte antigen 117"""	LY117		8824804, 11782277	Standard	NM_001145466		Approved	1C7, NKp30, CD337	uc003nuv.2	O14931	OTTHUMG00000031123	ENST00000340027.5:c.306C>G	6.37:g.31557641G>C	ENSP00000342156:p.Asp102Glu	Somatic		WXS	SOLID	Phase_III	31665620	B0S8F2|B0S8F4|B0S8F5|O14930|O14932|O95667|O95668|O95669|Q5ST89|Q5ST90|Q5ST91|Q5ST92|Q5STA3	Missense_Mutation	SNP	ENST00000340027.5	37	CCDS34397.1	.	.	.	.	.	.	.	.	.	.	G	13.92	2.379969	0.42207	.	.	ENSG00000204475	ENST00000340027;ENST00000376073;ENST00000376072;ENST00000376071	D;D;D;T	0.87729	-2.29;-2.29;-2.29;2.69	4.01	-8.02	0.01118	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000053	D	0.88433	0.6435	M	0.85859	2.78	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.987	D;D;D	0.81914	0.992;0.995;0.987	D	0.89234	0.3579	10	0.87932	D	0	-24.6012	14.5939	0.68392	0.2794:0.0:0.7206:0.0	.	102;102;102	O14931-2;Q05D23;O14931	.;.;NCTR3_HUMAN	E	102;102;102;77	ENSP00000342156:D102E;ENSP00000365241:D102E;ENSP00000365240:D102E;ENSP00000365239:D77E	ENSP00000342156:D102E	D	-	3	2	NCR3	31665620	0.000000	0.05858	0.000000	0.03702	0.590000	0.36582	-2.927000	0.00690	-2.191000	0.00756	-0.482000	0.04802	GAC		0.632	NCR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076210.2		
RAB3B	5865	hgsc.bcm.edu	37	1	52442627	52442627	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr1:52442627C>G	ENST00000371655.3	-	2	375	c.163G>C	c.(163-165)Gtg>Ctg	p.V55L		NM_002867.3	NP_002858.2	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family	55					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of vesicle size (GO:0097494)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.V55L(1)		large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9						TCGATGCCCACGGTGCTAACG	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											165.0	123.0	137.0					1																	52442627		2203	4300	6503	52215215	SO:0001583	missense	5865			BC005035	CCDS560.1	1p32-p31	2008-02-05			ENSG00000169213	ENSG00000169213		"""RAB, member RAS oncogene"""	9778	protein-coding gene	gene with protein product		179510					Standard	NM_002867		Approved		uc001cth.3	P20337	OTTHUMG00000008627	ENST00000371655.3:c.163G>C	1.37:g.52442627C>G	ENSP00000360718:p.Val55Leu	Somatic		WXS	SOLID	Phase_III	52215215	Q5VUL2|Q9BSI1	Missense_Mutation	SNP	ENST00000371655.3	37	CCDS560.1	.	.	.	.	.	.	.	.	.	.	C	35	5.434682	0.96150	.	.	ENSG00000169213	ENST00000371655;ENST00000537650	T	0.79033	-1.23	5.49	5.49	0.81192	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.82342	0.5016	N	0.25094	0.71	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.84292	0.0500	10	0.87932	D	0	-17.6145	19.5755	0.95441	0.0:1.0:0.0:0.0	.	55	P20337	RAB3B_HUMAN	L	55	ENSP00000360718:V55L	ENSP00000360718:V55L	V	-	1	0	RAB3B	52215215	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.538000	0.82048	2.865000	0.98341	0.655000	0.94253	GTG		0.522	RAB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023816.1	NM_002867	
RBBP6	5930	hgsc.bcm.edu	37	16	24582325	24582325	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr16:24582325T>C	ENST00000319715.4	+	18	4370	c.3938T>C	c.(3937-3939)aTg>aCg	p.M1313T	RBBP6_ENST00000348022.2_Missense_Mutation_p.M1279T|RBBP6_ENST00000381039.3_Missense_Mutation_p.M473T	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1313					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.M1313T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		GTTATCATTATGATTCAGGTT	0.363																																																1	Substitution - Missense(1)	ovary(1)	16											59.0	56.0	57.0					16																	24582325		2197	4300	6497	24489826	SO:0001583	missense	5930				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3938T>C	16.37:g.24582325T>C	ENSP00000317872:p.Met1313Thr	Somatic		WXS	SOLID	Phase_III	24489826	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	37	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	T	15.41	2.824328	0.50739	.	.	ENSG00000122257	ENST00000381039;ENST00000319715;ENST00000348022	T;T;T	0.22134	1.97;2.4;2.35	5.4	5.4	0.78164	.	0.061049	0.64402	D	0.000003	T	0.32194	0.0821	L	0.32530	0.975	0.45415	D	0.998396	D;D;D	0.57899	0.981;0.981;0.967	D;D;D	0.69142	0.962;0.962;0.916	T	0.03608	-1.1020	10	0.12766	T	0.61	-9.2569	15.7172	0.77677	0.0:0.0:0.0:1.0	.	473;1279;1313	Q7Z6E9-4;Q7Z6E9-2;Q7Z6E9	.;.;RBBP6_HUMAN	T	473;1313;1279	ENSP00000370427:M473T;ENSP00000317872:M1313T;ENSP00000316291:M1279T	ENSP00000317872:M1313T	M	+	2	0	RBBP6	24489826	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.156000	0.71840	2.170000	0.68504	0.460000	0.39030	ATG		0.363	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
TMEM62	80021	hgsc.bcm.edu	37	15	43438750	43438750	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr15:43438750G>A	ENST00000260403.2	+	5	815	c.536G>A	c.(535-537)gGc>gAc	p.G179D		NM_024956.3	NP_079232.3	Q0P6H9	TMM62_HUMAN	transmembrane protein 62	179						integral component of membrane (GO:0016021)		p.G179D(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		ACTCCCTTTGGCAACTATTCG	0.378																																																1	Substitution - Missense(1)	ovary(1)	15											236.0	231.0	233.0					15																	43438750		2203	4299	6502	41226042	SO:0001583	missense	80021			BC009981	CCDS32210.1	15q15.2	2014-09-11			ENSG00000137842	ENSG00000137842			26269	protein-coding gene	gene with protein product							Standard	NM_024956		Approved	FLJ23375	uc001zqr.3	Q0P6H9	OTTHUMG00000176485	ENST00000260403.2:c.536G>A	15.37:g.43438750G>A	ENSP00000260403:p.Gly179Asp	Somatic		WXS	SOLID	Phase_III	41226042	Q6I9Y5|Q9H5J6	Missense_Mutation	SNP	ENST00000260403.2	37	CCDS32210.1	.	.	.	.	.	.	.	.	.	.	G	32	5.136498	0.94517	.	.	ENSG00000137842	ENST00000260403	T	0.51574	0.7	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.69566	0.3125	M	0.76433	2.335	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68002	-0.5524	10	0.39692	T	0.17	-8.3221	18.9054	0.92458	0.0:0.0:1.0:0.0	.	179	Q0P6H9	TMM62_HUMAN	D	179	ENSP00000260403:G179D	ENSP00000260403:G179D	G	+	2	0	TMEM62	41226042	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.326000	0.96389	2.691000	0.91804	0.563000	0.77884	GGC		0.378	TMEM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432227.1	NM_024956	
AGTR2	186	hgsc.bcm.edu	37	X	115304582	115304582	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chrX:115304582G>A	ENST00000371906.4	+	3	1239	c.1049G>A	c.(1048-1050)cGg>cAg	p.R350Q		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	350					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)	p.R350Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	ATGTCTTGCCGGAAAAGCAGT	0.438																																																1	Substitution - Missense(1)	ovary(1)	X											91.0	86.0	88.0					X																	115304582		2203	4300	6503	115218610	SO:0001583	missense	186			AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.1049G>A	X.37:g.115304582G>A	ENSP00000360973:p.Arg350Gln	Somatic		WXS	SOLID	Phase_III	115218610	B2R9V1|Q13016|Q6FGY7	Missense_Mutation	SNP	ENST00000371906.4	37	CCDS14569.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.277047	0.23307	.	.	ENSG00000180772	ENST00000371906	T	0.37584	1.19	4.87	4.87	0.63330	.	0.155918	0.40818	N	0.001015	T	0.15912	0.0383	N	0.08118	0	0.09310	N	0.999992	P	0.42908	0.793	B	0.28465	0.09	T	0.16571	-1.0398	10	0.59425	D	0.04	-4.2867	12.1014	0.53785	0.0:0.0:1.0:0.0	.	350	P50052	AGTR2_HUMAN	Q	350	ENSP00000360973:R350Q	ENSP00000360973:R350Q	R	+	2	0	AGTR2	115218610	0.993000	0.37304	0.777000	0.31699	0.389000	0.30415	4.407000	0.59754	2.243000	0.73865	0.506000	0.49869	CGG		0.438	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057984.1	NM_000686	
BACH2	60468	hgsc.bcm.edu	37	6	90642153	90642153	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr6:90642153C>A	ENST00000257749.4	-	9	3207	c.2500G>T	c.(2500-2502)Gaa>Taa	p.E834*	BACH2_ENST00000537989.1_Nonsense_Mutation_p.E834*|BACH2_ENST00000343122.3_Nonsense_Mutation_p.E834*	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	834						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.E834*(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CTGGGCTGTTCGTCAGTTGTA	0.547																																																1	Substitution - Nonsense(1)	ovary(1)	6											253.0	258.0	256.0					6																	90642153		2203	4300	6503	90698874	SO:0001587	stop_gained	60468			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.2500G>T	6.37:g.90642153C>A	ENSP00000257749:p.Glu834*	Somatic		WXS	SOLID	Phase_III	90698874	E1P518|Q59H70|Q5T793|Q9NTS5	Nonsense_Mutation	SNP	ENST00000257749.4	37	CCDS5026.1	.	.	.	.	.	.	.	.	.	.	C	45	11.318930	0.99546	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.5506	19.4133	0.94685	0.0:1.0:0.0:0.0	.	.	.	.	X	834	.	ENSP00000257749:E834X	E	-	1	0	BACH2	90698874	1.000000	0.71417	0.985000	0.45067	0.981000	0.71138	7.456000	0.80751	2.579000	0.87056	0.561000	0.74099	GAA		0.547	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
BOD1L1	259282	hgsc.bcm.edu	37	4	13601898	13601898	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr4:13601898C>T	ENST00000040738.5	-	10	6761	c.6626G>A	c.(6625-6627)aGc>aAc	p.S2209N		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2209						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S2209N(1)									CTCCTCCTTGCTGGTTGAGGC	0.507																																																1	Substitution - Missense(1)	ovary(1)	4											73.0	59.0	64.0					4																	13601898		2203	4300	6503	13210996	SO:0001583	missense	259282			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6626G>A	4.37:g.13601898C>T	ENSP00000040738:p.Ser2209Asn	Somatic		WXS	SOLID	Phase_III	13210996	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	C	17.78	3.474363	0.63737	.	.	ENSG00000038219	ENST00000040738	T	0.13420	2.59	5.33	4.49	0.54785	.	0.000000	0.64402	D	0.000007	T	0.18299	0.0439	M	0.66939	2.045	0.31124	N	0.70853	D	0.54047	0.964	P	0.45310	0.476	T	0.21211	-1.0252	10	0.72032	D	0.01	-4.3808	8.0752	0.30712	0.1567:0.7629:0.0:0.0803	.	2209	Q8NFC6	BOD1L_HUMAN	N	2209	ENSP00000040738:S2209N	ENSP00000040738:S2209N	S	-	2	0	BOD1L	13210996	1.000000	0.71417	0.999000	0.59377	0.797000	0.45037	2.359000	0.44142	1.257000	0.44085	0.555000	0.69702	AGC		0.507	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
C12orf10	60314	hgsc.bcm.edu	37	12	53700512	53700512	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr12:53700512T>A	ENST00000267103.5	+	6	866	c.814T>A	c.(814-816)Tgg>Agg	p.W272R	C12orf10_ENST00000549488.1_Missense_Mutation_p.W109R|AAAS_ENST00000549983.1_5'Flank|C12orf10_ENST00000548632.1_Missense_Mutation_p.W197R	NM_021640.3	NP_067653	Q9HB07	MYG1_HUMAN	chromosome 12 open reading frame 10	272					locomotory exploration behavior (GO:0035641)|pigmentation (GO:0043473)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.W272R(1)		cervix(1)|endometrium(3)|kidney(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	20						TGCATGTCCCTGGAAGGAGCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											145.0	121.0	129.0					12																	53700512		2203	4300	6503	51986779	SO:0001583	missense	60314			AF289485	CCDS31810.1	12q13.13	2014-05-29			ENSG00000139637	ENSG00000139637			17590	protein-coding gene	gene with protein product	"""melanocyte related gene"", ""melanocyte proliferating gene 1"""	611366					Standard	NM_021640		Approved	MYG, MYG1, Gamm1	uc001scp.4	Q9HB07	OTTHUMG00000170030	ENST00000267103.5:c.814T>A	12.37:g.53700512T>A	ENSP00000267103:p.Trp272Arg	Somatic		WXS	SOLID	Phase_III	51986779		Missense_Mutation	SNP	ENST00000267103.5	37	CCDS31810.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.022307	0.75275	.	.	ENSG00000139637	ENST00000267103;ENST00000548845;ENST00000545214;ENST00000548632;ENST00000549488	T;T;T	0.53423	0.62;0.62;0.62	4.3	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.68155	0.2970	M	0.81179	2.53	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.73007	-0.4118	10	0.87932	D	0	-19.5171	12.0604	0.53559	0.0:0.0:0.0:1.0	.	221;272	F5H641;Q9HB07	.;MYG1_HUMAN	R	272;157;221;197;109	ENSP00000267103:W272R;ENSP00000450270:W197R;ENSP00000448433:W109R	ENSP00000267103:W272R	W	+	1	0	C12orf10	51986779	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.193000	0.77780	2.182000	0.69389	0.533000	0.62120	TGG		0.532	C12orf10-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406906.1	NM_021640	
C5orf42	65250	hgsc.bcm.edu	37	5	37120431	37120431	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr5:37120431T>C	ENST00000508244.1	-	48	9128	c.9035A>G	c.(9034-9036)cAt>cGt	p.H3012R	C5orf42_ENST00000274258.7_Missense_Mutation_p.H1910R|C5orf42_ENST00000512288.1_5'UTR|C5orf42_ENST00000425232.2_Missense_Mutation_p.H3012R			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	3012						integral component of membrane (GO:0016021)		p.H1910R(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ACTGTGACCATGTTGATTCTC	0.353																																																1	Substitution - Missense(1)	ovary(1)	5											81.0	79.0	80.0					5																	37120431		2203	4300	6503	37156188	SO:0001583	missense	65250				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.9035A>G	5.37:g.37120431T>C	ENSP00000421690:p.His3012Arg	Somatic		WXS	SOLID	Phase_III	37156188	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	T	11.83	1.755291	0.31046	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.21	4.05	0.47172	.	0.623087	0.16618	N	0.206614	T	0.33323	0.0859	L	0.48362	1.52	0.09310	N	1	B;P	0.41848	0.007;0.763	B;B	0.33960	0.007;0.173	T	0.10847	-1.0612	10	0.20519	T	0.43	.	7.7843	0.29083	0.0:0.0948:0.0:0.9052	.	3012;1910	E9PH94;Q9H799	.;CE042_HUMAN	R	3012;3012;1910;2078	ENSP00000421690:H3012R;ENSP00000389014:H3012R;ENSP00000274258:H1910R;ENSP00000424223:H2078R	ENSP00000274258:H1910R	H	-	2	0	C5orf42	37156188	0.005000	0.15991	0.002000	0.10522	0.049000	0.14656	1.052000	0.30429	0.838000	0.34948	0.529000	0.55759	CAT		0.353	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
C9orf72	203228	hgsc.bcm.edu	37	9	27556634	27556634	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr9:27556634A>G	ENST00000380003.3	-	8	1079	c.1016T>C	c.(1015-1017)tTc>tCc	p.F339S	C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	339					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)	p.F339S(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		GGCTCTCCAGAAGGCTGTCAG	0.448																																																1	Substitution - Missense(1)	ovary(1)	9											154.0	142.0	146.0					9																	27556634		2203	4300	6503	27546634	SO:0001583	missense	203228			AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.1016T>C	9.37:g.27556634A>G	ENSP00000369339:p.Phe339Ser	Somatic		WXS	SOLID	Phase_III	27546634	A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Missense_Mutation	SNP	ENST00000380003.3	37	CCDS6522.1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.138049	0.56936	.	.	ENSG00000147894	ENST00000380003	T	0.43688	0.94	5.79	5.79	0.91817	.	0.111843	0.64402	D	0.000004	T	0.25269	0.0614	N	0.08118	0	0.80722	D	1	B	0.22146	0.065	B	0.21546	0.035	T	0.11060	-1.0603	9	.	.	.	.	16.1255	0.81392	1.0:0.0:0.0:0.0	.	339	Q96LT7	CI072_HUMAN	S	339	ENSP00000369339:F339S	.	F	-	2	0	C9orf72	27546634	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	7.079000	0.76829	2.205000	0.71048	0.477000	0.44152	TTC		0.448	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	NM_018325	
CHKA	1119	hgsc.bcm.edu	37	11	67837737	67837737	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr11:67837737A>G	ENST00000265689.4	-	6	814	c.788T>C	c.(787-789)aTt>aCt	p.I263T	CHKA_ENST00000356135.5_Missense_Mutation_p.I245T	NM_001277.2	NP_001268.2	P35790	CHKA_HUMAN	choline kinase alpha	263					CDP-choline pathway (GO:0006657)|choline metabolic process (GO:0019695)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline binding (GO:0033265)|choline kinase activity (GO:0004103)|cholinesterase activity (GO:0004104)|drug binding (GO:0008144)|ethanolamine kinase activity (GO:0004305)|signal transducer activity (GO:0004871)	p.I263T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13					Choline(DB00122)	AGTAAATTTAATTCTCAGCAC	0.363																																																1	Substitution - Missense(1)	ovary(1)	11											74.0	80.0	78.0					11																	67837737		2200	4294	6494	67594313	SO:0001583	missense	1119			D10704	CCDS8178.1, CCDS8179.1	11q13.1	2008-02-05	2004-04-19	2004-04-21	ENSG00000110721	ENSG00000110721	2.7.1.32		1937	protein-coding gene	gene with protein product		118491	"""choline kinase"""	CHK		1618328, 15003397	Standard	NM_001277		Approved	CKI	uc001onj.3	P35790	OTTHUMG00000167424	ENST00000265689.4:c.788T>C	11.37:g.67837737A>G	ENSP00000265689:p.Ile263Thr	Somatic		WXS	SOLID	Phase_III	67594313	Q8NE29	Missense_Mutation	SNP	ENST00000265689.4	37	CCDS8178.1	.	.	.	.	.	.	.	.	.	.	A	9.292	1.050969	0.19827	.	.	ENSG00000110721	ENST00000265689;ENST00000356135;ENST00000531341	T;T;T	0.52295	0.67;0.67;0.67	5.22	5.22	0.72569	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);	0.279247	0.34531	N	0.003893	T	0.38188	0.1031	N	0.12831	0.26	0.41159	D	0.986086	B;B	0.29671	0.119;0.254	B;B	0.38842	0.283;0.262	T	0.42378	-0.9455	10	0.54805	T	0.06	-5.9676	15.095	0.72226	1.0:0.0:0.0:0.0	.	245;263	P35790-2;P35790	.;CHKA_HUMAN	T	263;245;141	ENSP00000265689:I263T;ENSP00000348454:I245T;ENSP00000435032:I141T	ENSP00000265689:I263T	I	-	2	0	CHKA	67594313	0.975000	0.34042	0.287000	0.24848	0.292000	0.27327	8.549000	0.90672	1.958000	0.56883	0.459000	0.35465	ATT		0.363	CHKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394570.1	NM_001277	
CLN8	2055	hgsc.bcm.edu	37	8	1719606	1719606	+	Missense_Mutation	SNP	G	G	A	rs571617007		TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr8:1719606G>A	ENST00000331222.4	+	2	633	c.386G>A	c.(385-387)cGg>cAg	p.R129Q		NM_018941.3	NP_061764.2	Q9UBY8	CLN8_HUMAN	ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)	129	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				adult walking behavior (GO:0007628)|age-dependent response to oxidative stress (GO:0001306)|associative learning (GO:0008306)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|ceramide biosynthetic process (GO:0046513)|ceramide metabolic process (GO:0006672)|cholesterol metabolic process (GO:0008203)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|lipid biosynthetic process (GO:0008610)|lipid transport (GO:0006869)|lysosome organization (GO:0007040)|mitochondrial membrane organization (GO:0007006)|musculoskeletal movement (GO:0050881)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteolysis (GO:0045861)|negative regulation of transferase activity (GO:0051348)|nervous system development (GO:0007399)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|phospholipid metabolic process (GO:0006644)|photoreceptor cell maintenance (GO:0045494)|protein catabolic process (GO:0030163)|regulation of cell size (GO:0008361)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic motor neuron differentiation (GO:0021523)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.R129Q(1)		central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24		Ovarian(12;0.0563)|Colorectal(14;0.0815)|Hepatocellular(245;0.0831)		BRCA - Breast invasive adenocarcinoma(11;7.67e-05)|READ - Rectum adenocarcinoma(644;0.0913)		TTGATCTTCCGGACATTTGAC	0.488													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20401	0.0		0.0	False		,,,				2504	0.0				Pancreas(155;338 1942 6138 10888 50612)											1	Substitution - Missense(1)	ovary(1)	8											198.0	195.0	196.0					8																	1719606		2203	4300	6503	1707013	SO:0001583	missense	2055			AF123761	CCDS5956.1	8p23.3	2014-09-17			ENSG00000182372	ENSG00000182372			2079	protein-coding gene	gene with protein product		607837	"""chromosome 8 open reading frame 61"""	EPMR, C8orf61		10508524	Standard	NM_018941		Approved	FLJ39417	uc003wpo.4	Q9UBY8	OTTHUMG00000090343	ENST00000331222.4:c.386G>A	8.37:g.1719606G>A	ENSP00000328182:p.Arg129Gln	Somatic		WXS	SOLID	Phase_III	1707013	Q86U71|Q96I95	Missense_Mutation	SNP	ENST00000331222.4	37	CCDS5956.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302850	0.40795	.	.	ENSG00000182372	ENST00000331222	D	0.84800	-1.9	5.06	-0.156	0.13391	TRAM/LAG1/CLN8 homology domain (3);	0.214791	0.30126	U	0.010360	D	0.82921	0.5142	M	0.67953	2.075	0.25766	N	0.984891	D	0.60575	0.988	P	0.47118	0.538	T	0.76085	-0.3088	9	.	.	.	-10.267	8.9264	0.35643	0.3966:0.0:0.6034:0.0	.	129	Q9UBY8	CLN8_HUMAN	Q	129	ENSP00000328182:R129Q	.	R	+	2	0	CLN8	1707013	0.852000	0.29690	0.011000	0.14972	0.040000	0.13550	2.983000	0.49345	-0.383000	0.07858	0.455000	0.32223	CGG		0.488	CLN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206715.2	NM_018941	
HACE1	57531	hgsc.bcm.edu	37	6	105178187	105178187	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr6:105178187G>A	ENST00000262903.4	-	23	2894	c.2618C>T	c.(2617-2619)tCa>tTa	p.S873L	HACE1_ENST00000517995.1_5'UTR|HACE1_ENST00000369125.2_Missense_Mutation_p.S658L	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	873	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)	p.S873L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		CCATGTGCTTGAAGTTGGTAA	0.378																																																1	Substitution - Missense(1)	ovary(1)	6											104.0	93.0	97.0					6																	105178187		2203	4300	6503	105284880	SO:0001583	missense	57531			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.2618C>T	6.37:g.105178187G>A	ENSP00000262903:p.Ser873Leu	Somatic		WXS	SOLID	Phase_III	105284880	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	37	CCDS5050.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.112610	0.56398	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	T;T	0.51071	0.72;0.72	5.63	5.63	0.86233	HECT (4);	0.059142	0.64402	D	0.000001	T	0.67107	0.2858	M	0.82433	2.59	0.36327	D	0.858618	D;B;B;B	0.60160	0.987;0.101;0.192;0.4	D;B;B;B	0.65573	0.936;0.037;0.089;0.085	T	0.72981	-0.4126	10	0.87932	D	0	.	19.6816	0.95965	0.0:0.0:1.0:0.0	.	658;362;873;526	E9PGP0;B4DFM6;Q8IYU2;Q8IYU2-3	.;.;HACE1_HUMAN;.	L	873;658	ENSP00000262903:S873L;ENSP00000358121:S658L	ENSP00000262903:S873L	S	-	2	0	HACE1	105284880	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	9.328000	0.96403	2.654000	0.90174	0.655000	0.94253	TCA		0.378	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095	
HAO1	54363	hgsc.bcm.edu	37	20	7866210	7866210	+	Missense_Mutation	SNP	C	C	T	rs201216901	byFrequency	TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr20:7866210C>T	ENST00000378789.3	-	7	1051	c.1000G>A	c.(1000-1002)Gag>Aag	p.E334K		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	334	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)	p.E334K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						TTTAGTATCTCGAGGACATCT	0.378													C|||	7	0.00139776	0.0	0.0	5008	,	,		20342	0.0		0.0	False		,,,				2504	0.0072															1	Substitution - Missense(1)	ovary(1)	20											111.0	98.0	102.0					20																	7866210		2203	4300	6503	7814210	SO:0001583	missense	54363			AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.1000G>A	20.37:g.7866210C>T	ENSP00000368066:p.Glu334Lys	Somatic		WXS	SOLID	Phase_III	7814210	Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	ENST00000378789.3	37	CCDS13100.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.194757	0.38806	.	.	ENSG00000101323	ENST00000378789	T	0.31247	1.5	5.98	5.03	0.67393	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.183894	0.64402	D	0.000018	T	0.24392	0.0591	L	0.45698	1.435	0.51233	D	0.999913	B;B	0.13594	0.008;0.008	B;B	0.15052	0.012;0.012	T	0.09015	-1.0694	10	0.39692	T	0.17	-0.0147	6.4418	0.21854	0.0:0.6381:0.2071:0.1548	.	334;334	A8K058;Q9UJM8	.;HAOX1_HUMAN	K	334	ENSP00000368066:E334K	ENSP00000368066:E334K	E	-	1	0	HAO1	7814210	0.690000	0.27699	1.000000	0.80357	0.880000	0.50808	1.149000	0.31626	2.843000	0.97960	0.585000	0.79938	GAG		0.378	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		
HAUS4	54930	hgsc.bcm.edu	37	14	23417107	23417107	+	Silent	SNP	C	C	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr14:23417107C>A	ENST00000206474.7	-	7	930	c.678G>T	c.(676-678)ctG>ctT	p.L226L	HAUS4_ENST00000555986.1_Silent_p.L181L|HAUS4_ENST00000555367.1_Silent_p.L181L|HAUS4_ENST00000554446.1_Intron|HAUS4_ENST00000541587.1_Silent_p.L226L|RP11-298I3.1_ENST00000548819.1_RNA|HAUS4_ENST00000342454.8_Silent_p.L181L|HAUS4_ENST00000347758.2_Intron|RP11-298I3.1_ENST00000548322.1_RNA|HAUS4_ENST00000397409.4_Intron|HAUS4_ENST00000490506.1_Silent_p.L102L|RP11-298I3.5_ENST00000555074.1_Missense_Mutation_p.A56S			Q9H6D7	HAUS4_HUMAN	HAUS augmin-like complex, subunit 4	226					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.L226L(1)		breast(3)|cervix(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)	14						TCTTCTCCAGCAGCAACATCT	0.557																																																1	Substitution - coding silent(1)	ovary(1)	14											112.0	99.0	104.0					14																	23417107		2203	4300	6503	22486947	SO:0001819	synonymous_variant	54930			AK000431	CCDS9580.1, CCDS53886.1	14q11.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000092036	ENSG00000092036		"""HAUS augmin-like complex subunits"""	20163	protein-coding gene	gene with protein product		613431	"""chromosome 14 open reading frame 94"""	C14orf94		19427217	Standard	NM_017815		Approved	FLJ20424	uc001wht.3	Q9H6D7	OTTHUMG00000028710	ENST00000206474.7:c.678G>T	14.37:g.23417107C>A		Somatic		WXS	SOLID	Phase_III	22486947	B7WP17|D3DS34|Q86T15|Q86T16|Q86U43|Q9NX59	Silent	SNP	ENST00000206474.7	37	CCDS9580.1																																																																																				0.557	HAUS4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071680.3		
KLF11	8462	hgsc.bcm.edu	37	2	10188451	10188451	+	Silent	SNP	C	C	T	rs371589306		TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr2:10188451C>T	ENST00000305883.1	+	3	1149	c.987C>T	c.(985-987)ttC>ttT	p.F329F	KLF11_ENST00000535335.1_Silent_p.F312F|KLF11_ENST00000540845.1_Silent_p.F312F	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	329					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.F329F(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		AACCTGTGTTCGTGGGACCTG	0.622											OREG0014425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(56;431 1507 23687 50789)											1	Substitution - coding silent(1)	ovary(1)	2						C	,,	2,4404	4.2+/-10.8	0,2,2201	74.0	69.0	71.0		936,936,987	2.1	0.3	2		71	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	KLF11	NM_001177716.1,NM_001177718.1,NM_003597.4	,,	0,4,6499	TT,TC,CC		0.0233,0.0454,0.0308	,,	312/496,312/496,329/513	10188451	4,13002	2203	4300	6503	10105902	SO:0001819	synonymous_variant	8462			AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.987C>T	2.37:g.10188451C>T		Somatic	662	WXS	SOLID	Phase_III	10105902	B4DZE7|Q9EPF4	Silent	SNP	ENST00000305883.1	37	CCDS1668.1																																																																																				0.622	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000239202.3	NM_003597	
MARK1	4139	hgsc.bcm.edu	37	1	220808727	220808727	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr1:220808727G>A	ENST00000366917.4	+	12	1398	c.1132G>A	c.(1132-1134)Ggt>Agt	p.G378S	MARK1_ENST00000366918.4_Missense_Mutation_p.G356S|MARK1_ENST00000402574.1_Missense_Mutation_p.G243S					MAP/microtubule affinity-regulating kinase 1									p.G378S(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		GTTTGAAGGTGGTGAATCGTT	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											70.0	67.0	68.0					1																	220808727		2203	4300	6503	218875350	SO:0001583	missense	4139			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1132G>A	1.37:g.220808727G>A	ENSP00000355884:p.Gly378Ser	Somatic		WXS	SOLID	Phase_III	218875350		Missense_Mutation	SNP	ENST00000366917.4	37	CCDS31029.2	.	.	.	.	.	.	.	.	.	.	G	11.73	1.726051	0.30593	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.71341	-0.46;-0.24;-0.56	5.71	3.63	0.41609	.	0.151889	0.64402	N	0.000016	T	0.32734	0.0839	N	0.00707	-1.245	0.43130	D	0.99486	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.001	T	0.16928	-1.0386	10	0.12766	T	0.61	.	7.3988	0.26952	0.3405:0.0:0.6595:0.0	.	378;243;378;356	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	S	243;356;378	ENSP00000386017:G243S;ENSP00000355885:G356S;ENSP00000355884:G378S	ENSP00000355884:G378S	G	+	1	0	MARK1	218875350	1.000000	0.71417	0.996000	0.52242	0.863000	0.49368	5.528000	0.67129	1.431000	0.47355	0.561000	0.74099	GGT		0.403	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1		
MSN	4478	hgsc.bcm.edu	37	X	64949370	64949370	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chrX:64949370A>C	ENST00000360270.5	+	4	435	c.263A>C	c.(262-264)gAt>gCt	p.D88A		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	88	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)	p.D88A(1)	MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						TACCCTGAGGATGTGTCCGAG	0.507			T	ALK	ALCL																																		Dom	yes		X	Xq11.2-q12	4478	moesin		L	1	Substitution - Missense(1)	ovary(1)	X											120.0	98.0	105.0					X																	64949370		2203	4300	6503	64866095	SO:0001583	missense	4478			M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.263A>C	X.37:g.64949370A>C	ENSP00000353408:p.Asp88Ala	Somatic		WXS	SOLID	Phase_III	64866095		Missense_Mutation	SNP	ENST00000360270.5	37	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.668386	0.88348	.	.	ENSG00000147065	ENST00000360270	D	0.84730	-1.89	5.99	5.99	0.97316	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	D	0.93132	0.7813	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.94138	0.7394	10	0.72032	D	0.01	.	14.1348	0.65279	1.0:0.0:0.0:0.0	.	88	P26038	MOES_HUMAN	A	88	ENSP00000353408:D88A	ENSP00000353408:D88A	D	+	2	0	MSN	64866095	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.237000	0.95368	2.025000	0.59659	0.486000	0.48141	GAT		0.507	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
NAP1L3	4675	hgsc.bcm.edu	37	X	92927561	92927561	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chrX:92927561A>T	ENST00000373079.3	-	1	1006	c.743T>A	c.(742-744)gTa>gAa	p.V248E	FAM133A_ENST00000332647.4_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.V241E|FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000355813.5_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	248	Glu-rich.				nucleosome assembly (GO:0006334)	nucleus (GO:0005634)		p.V248E(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						ATCTTCTTTTACTTCAGGGGT	0.433																																																1	Substitution - Missense(1)	ovary(1)	X											142.0	137.0	139.0					X																	92927561		2203	4300	6503	92814217	SO:0001583	missense	4675				CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.743T>A	X.37:g.92927561A>T	ENSP00000362171:p.Val248Glu	Somatic		WXS	SOLID	Phase_III	92814217	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	37	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	A	4.844	0.156810	0.09236	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.30448	1.53	3.3	1.96	0.26148	.	0.373375	0.28730	N	0.014332	T	0.11922	0.0290	N	0.04508	-0.205	0.24235	N	0.995385	B	0.17852	0.024	B	0.18263	0.021	T	0.24693	-1.0153	10	0.23891	T	0.37	.	6.2166	0.20658	0.7134:0.0:0.0:0.2866	.	248	Q99457	NP1L3_HUMAN	E	248;241	ENSP00000362171:V248E	ENSP00000362171:V248E	V	-	2	0	NAP1L3	92814217	0.048000	0.20356	0.865000	0.33974	0.416000	0.31233	0.466000	0.22019	0.403000	0.25479	0.430000	0.28490	GTA		0.433	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
SMARCA2	6595	hgsc.bcm.edu	37	9	2039514	2039514	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr9:2039514C>A	ENST00000382203.1	+	4	613	c.404C>A	c.(403-405)tCc>tAc	p.S135Y	SMARCA2_ENST00000491574.1_3'UTR|RP11-264I13.2_ENST00000426860.1_RNA|SMARCA2_ENST00000357248.2_Missense_Mutation_p.S135Y|SMARCA2_ENST00000349721.2_Missense_Mutation_p.S135Y|SMARCA2_ENST00000382194.1_Missense_Mutation_p.S135Y			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	135					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.S135Y(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		GAGCACGTCTCCAGCCCTATG	0.567																																																1	Substitution - Missense(1)	ovary(1)	9											79.0	85.0	83.0					9																	2039514		2203	4300	6503	2029514	SO:0001583	missense	6595			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.404C>A	9.37:g.2039514C>A	ENSP00000371638:p.Ser135Tyr	Somatic		WXS	SOLID	Phase_III	2029514	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.460871	0.84317	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000450198;ENST00000439732;ENST00000382203;ENST00000382194	D;D;T;D;D	0.87887	-2.31;-2.31;0.74;-2.31;-2.31	5.46	5.46	0.80206	.	0.139502	0.50627	D	0.000119	D	0.90769	0.7102	L	0.38175	1.15	0.80722	D	1	D;D	0.64830	0.994;0.982	D;D	0.72075	0.976;0.946	D	0.91363	0.5113	10	0.62326	D	0.03	-17.6776	19.2963	0.94124	0.0:1.0:0.0:0.0	.	135;135	P51531-2;P51531	.;SMCA2_HUMAN	Y	135	ENSP00000265773:S135Y;ENSP00000349788:S135Y;ENSP00000392081:S135Y;ENSP00000371638:S135Y;ENSP00000371629:S135Y	ENSP00000265773:S135Y	S	+	2	0	SMARCA2	2029514	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.050000	0.71063	2.562000	0.86427	0.655000	0.94253	TCC		0.567	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
PHF19	26147	hgsc.bcm.edu	37	9	123623421	123623421	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr9:123623421T>C	ENST00000373896.3	-	13	1502	c.1250A>G	c.(1249-1251)cAc>cGc	p.H417R	PHF19_ENST00000487555.1_5'UTR|PHF19_ENST00000419155.1_Missense_Mutation_p.H208R	NM_015651.1	NP_056466.1	Q5T6S3	PHF19_HUMAN	PHD finger protein 19	417					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.H417R(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGCCAGGTGGTGGTTGGTGCT	0.517																																																1	Substitution - Missense(1)	ovary(1)	9											167.0	148.0	155.0					9																	123623421		2203	4300	6503	122663242	SO:0001583	missense	26147			BX640713	CCDS35116.1, CCDS35117.1, CCDS69648.1, CCDS75889.1	9q34.11	2013-01-28			ENSG00000119403	ENSG00000119403		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24566	protein-coding gene	gene with protein product	"""polycomb-like 3"", ""tudor domain containing 19B"""	609740				15563832	Standard	XM_005251906		Approved	DKFZP727G051, PCL3, MTF2L1, TDRD19B	uc004bks.1	Q5T6S3	OTTHUMG00000020577	ENST00000373896.3:c.1250A>G	9.37:g.123623421T>C	ENSP00000363003:p.His417Arg	Somatic		WXS	SOLID	Phase_III	122663242	Q32NF2|Q5T6S4|Q6N038|Q8TBL6|Q9UFS9	Missense_Mutation	SNP	ENST00000373896.3	37	CCDS35116.1	.	.	.	.	.	.	.	.	.	.	T	14.28	2.487996	0.44249	.	.	ENSG00000119403	ENST00000544082;ENST00000373896;ENST00000419155	T;T	0.41758	1.99;0.99	5.49	5.49	0.81192	.	0.101585	0.64402	D	0.000002	T	0.32285	0.0824	L	0.32530	0.975	0.58432	D	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.09100	-1.0690	10	0.21540	T	0.41	-27.0874	13.8228	0.63333	0.0:0.0:0.0:1.0	.	417	Q5T6S3	PHF19_HUMAN	R	417;417;208	ENSP00000363003:H417R;ENSP00000407433:H208R	ENSP00000363003:H417R	H	-	2	0	PHF19	122663242	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.378000	0.79679	2.208000	0.71279	0.533000	0.62120	CAC		0.517	PHF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053838.3	XM_045308	
SMC3	9126	hgsc.bcm.edu	37	10	112343657	112343657	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr10:112343657A>T	ENST00000361804.4	+	12	1154	c.1028A>T	c.(1027-1029)gAa>gTa	p.E343V		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	343					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)	p.E343V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AAGCAGAAAGAACTGGCAGAA	0.343																																																1	Substitution - Missense(1)	ovary(1)	10											85.0	92.0	90.0					10																	112343657		2203	4300	6503	112333647	SO:0001583	missense	9126			AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.1028A>T	10.37:g.112343657A>T	ENSP00000354720:p.Glu343Val	Somatic		WXS	SOLID	Phase_III	112333647	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.268327	0.80469	.	.	ENSG00000108055	ENST00000361804	T	0.79554	-1.28	5.52	5.52	0.82312	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.88321	0.6405	M	0.89601	3.045	0.80722	D	1	P	0.46578	0.88	P	0.50860	0.652	D	0.90601	0.4544	10	0.72032	D	0.01	.	14.8393	0.70212	1.0:0.0:0.0:0.0	.	343	Q9UQE7	SMC3_HUMAN	V	343	ENSP00000354720:E343V	ENSP00000354720:E343V	E	+	2	0	SMC3	112333647	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.434000	0.90294	2.093000	0.63338	0.528000	0.53228	GAA		0.343	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
TP53	7157	hgsc.bcm.edu	37	17	7578556	7578556	+	Splice_Site	SNP	T	T	C			TCGA-24-1557-01A-01W-0615-10	TCGA-24-1557-10A-01W-0615-10	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	f81ad476-ba03-404c-9b97-41603ea214c6	f3c3aecf-8fa6-4e0b-b31b-ccb258f65273	g.chr17:7578556T>C	ENST00000269305.4	-	5	565		c.e5-2		TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(34)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGGGAGTACTGTAGGAAGAG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Unknown(34)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(19)|breast(7)|central_nervous_system(4)|ovary(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|oesophagus(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)	17											41.0	42.0	41.0					17																	7578556		2203	4300	6503	7519281	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-2A>G	17.37:g.7578556T>C		Somatic		WXS	SOLID	Phase_III	7519281	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.336894	0.60963	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6026	0.45375	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519281	1.000000	0.71417	0.994000	0.49952	0.902000	0.53008	6.214000	0.72200	2.078000	0.62432	0.533000	0.62120	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron
