#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SV2A	9900	genome.wustl.edu	37	1	149880761	149880761	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr1:149880761C>A	ENST00000369146.3	-	8	1852	c.1362G>T	c.(1360-1362)tgG>tgT	p.W454C	SV2A_ENST00000369145.1_Missense_Mutation_p.W454C	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	454					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.W454C(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	ACATGGTGAACCACACACCCA	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											548.0	434.0	473.0					1																	149880761		2203	4300	6503	148147385	SO:0001583	missense	9900			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1362G>T	1.37:g.149880761C>A	ENSP00000358142:p.Trp454Cys	Somatic		Capture	Illumina GAIIx	4	148147385	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	-	p.W454C	ENST00000369146.3	37	c.1362	CCDS940.1	1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735366	0.69189	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.58797	0.31;0.31	4.55	4.55	0.56014	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.276731	0.37577	N	0.002037	T	0.79263	0.4416	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84970	0.0882	10	0.72032	D	0.01	-9.9713	14.8472	0.70270	0.0:1.0:0.0:0.0	.	454	Q7L0J3	SV2A_HUMAN	C	454	ENSP00000358142:W454C;ENSP00000358141:W454C	ENSP00000358141:W454C	W	-	3	0	SV2A	148147385	1.000000	0.71417	0.999000	0.59377	0.932000	0.56968	7.281000	0.78621	2.375000	0.81037	0.491000	0.48974	TGG	-	NULL		0.537	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2A	protein_coding	OTTHUMT00000033754.1	C			148147385	-1	no_errors	NM_014849	genbank	human	validated	54_36p	missense	SNP	1	A
SV2A	9900	genome.wustl.edu	37	1	149881353	149881353	+	Splice_Site	SNP	T	T	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr1:149881353T>G	ENST00000369146.3	-	6	1669	c.1179A>C	c.(1177-1179)tcA>tcC	p.S393S	SV2A_ENST00000369145.1_Splice_Site_p.S393S	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	393					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.S393S(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	TGTGGCTTACTGAGAACACTC	0.587																																																1	Substitution - coding silent(1)	ovary(1)	1											197.0	155.0	169.0					1																	149881353		2203	4300	6503	148147977	SO:0001630	splice_region_variant	9900			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1179+1A>C	1.37:g.149881353T>G		Somatic		Capture	Illumina GAIIx	4	148147977	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	-	p.S393	ENST00000369146.3	37	c.1179	CCDS940.1	1																																																																																			-	NULL		0.587	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2A	protein_coding	OTTHUMT00000033754.1	T		Silent	148147977	-1	no_errors	NM_014849	genbank	human	validated	54_36p	silent	SNP	0.99	G
ITLN1	55600	genome.wustl.edu	37	1	160851956	160851956	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr1:160851956A>T	ENST00000326245.3	-	4	311	c.196T>A	c.(196-198)Tac>Aac	p.Y66N	ITLN1_ENST00000487531.1_5'Flank	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	66	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)	p.Y66N(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			AAGGTCTGGTAGATAACACCA	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											85.0	75.0	79.0					1																	160851956		2203	4300	6503	159118580	SO:0001583	missense	55600			AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.196T>A	1.37:g.160851956A>T	ENSP00000323587:p.Tyr66Asn	Somatic		Capture	Illumina GAIIx	4	159118580	Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Missense_Mutation	SNP	HMMPfam_Fibrinogen_C;superfamily_Fibrinogen C-terminal domain-like	p.Y66N	ENST00000326245.3	37	c.196	CCDS1211.1	1	.	.	.	.	.	.	.	.	.	.	A	19.33	3.807196	0.70797	.	.	ENSG00000179914	ENST00000326245	T	0.17854	2.25	4.17	4.17	0.49024	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (3);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.64402	D	0.000020	T	0.39064	0.1064	M	0.91920	3.255	0.53005	D	0.999963	D	0.89917	1.0	D	0.97110	1.0	T	0.50591	-0.8810	10	0.87932	D	0	-15.499	11.2047	0.48762	1.0:0.0:0.0:0.0	.	66	Q8WWA0	ITLN1_HUMAN	N	66	ENSP00000323587:Y66N	ENSP00000323587:Y66N	Y	-	1	0	ITLN1	159118580	1.000000	0.71417	0.985000	0.45067	0.909000	0.53808	6.406000	0.73276	1.729000	0.51567	0.533000	0.62120	TAC	-	HMMPfam_Fibrinogen_C		0.577	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITLN1	protein_coding	OTTHUMT00000071462.1	A	NM_017625		159118580	-1	no_errors	NM_017625	genbank	human	validated	54_36p	missense	SNP	1	T
QSOX1	5768	genome.wustl.edu	37	1	180165603	180165603	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr1:180165603G>A	ENST00000367602.3	+	12	1749	c.1675G>A	c.(1675-1677)Gca>Aca	p.A559T	QSOX1_ENST00000367600.5_Missense_Mutation_p.A559T			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	559					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)	p.A559T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						GCAGAATGTGGCAGCCGCCCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											83.0	91.0	88.0					1																	180165603		2203	4300	6503	178432226	SO:0001583	missense	5768			U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.1675G>A	1.37:g.180165603G>A	ENSP00000356574:p.Ala559Thr	Somatic		Capture	Illumina GAIIx	4	178432226	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	-	p.A559T	ENST00000367602.3	37	c.1675	CCDS1337.1	1	.	.	.	.	.	.	.	.	.	.	G	10.61	1.398242	0.25205	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	T;T	0.05580	3.56;3.42	5.12	2.23	0.28157	.	1.422770	0.04128	N	0.317384	T	0.06325	0.0163	L	0.29908	0.895	0.09310	N	1	P;P;B;P	0.41848	0.647;0.651;0.319;0.763	B;B;B;B	0.39027	0.131;0.15;0.073;0.288	T	0.43015	-0.9417	10	0.15499	T	0.54	1.1069	9.1484	0.36948	0.2432:0.0:0.7568:0.0	.	559;559;559;559	A8K4C2;A8K477;O00391;O00391-2	.;.;QSOX1_HUMAN;.	T	559	ENSP00000356574:A559T;ENSP00000356572:A559T	ENSP00000356572:A559T	A	+	1	0	QSOX1	178432226	0.395000	0.25254	0.002000	0.10522	0.160000	0.22226	2.988000	0.49386	0.191000	0.20236	-0.350000	0.07774	GCA	-	NULL		0.602	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX1	protein_coding	OTTHUMT00000085289.1	G	NM_002826		178432226	1	no_errors	NM_002826	genbank	human	reviewed	54_36p	missense	SNP	0.01	A
TAS1R1	80835	genome.wustl.edu	37	1	6631275	6631275	+	Splice_Site	SNP	G	G	C			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr1:6631275G>C	ENST00000333172.6	+	2	691	c.498G>C	c.(496-498)atG>atC	p.M166I	TAS1R1_ENST00000328191.4_Splice_Site_p.M166I|TAS1R1_ENST00000351136.3_Splice_Site_p.M166I	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	166					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)	p.M166I(1)		NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TGGTGCCCATGGTAAGCTGGA	0.637																																																1	Substitution - Missense(1)	ovary(1)	1											58.0	56.0	56.0					1																	6631275		2203	4300	6503	6553862	SO:0001630	splice_region_variant	80835				CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.498+1G>C	1.37:g.6631275G>C		Somatic		Capture	Illumina GAIIx	4	6553862	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Missense_Mutation	SNP	HMMPfam_7tm_3;HMMPfam_ANF_receptor;HMMPfam_NCD3G;superfamily_Periplasmic binding protein-like I;superfamily_TNF receptor-like	p.M166I	ENST00000333172.6	37	c.498	CCDS81.1	1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	11.79|11.79|11.79	1.742508|1.742508|1.742508	0.30865|0.30865|0.30865	.|.|.	.|.|.	ENSG00000173662|ENSG00000173662|ENSG00000173662	ENST00000415267|ENST00000333172;ENST00000328191;ENST00000437392;ENST00000351136|ENST00000411823	.|D;D;D|.	.|0.83250|.	.|-1.7;-1.7;-1.7|.	5.01|5.01|5.01	5.01|5.01|5.01	0.66863|0.66863|0.66863	.|Extracellular ligand-binding receptor (1);|.	.|0.293996|.	.|0.32901|.	.|N|.	.|0.005509|.	T|T|.	0.33904|0.33904|.	0.0879|0.0879|.	N|N|N	0.16266|0.16266|0.16266	0.395|0.395|0.395	0.30117|0.30117|0.30117	N|N|N	0.806052|0.806052|0.806052	.|B;B;B;B|.	.|0.15473|.	.|0.013;0.007;0.0;0.002|.	.|B;B;B;B|.	.|0.19666|.	.|0.007;0.026;0.002;0.007|.	T|T|.	0.24548|0.24548|.	-1.0157|-1.0157|.	5|10|.	.|0.28530|.	.|T|.	.|0.3|.	.|.|.	15.0652|15.0652|15.0652	0.71989|0.71989|0.71989	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|166;166;166;166|.	.|Q7RTX1-3;Q7RTX1-4;Q7RTX1-2;Q7RTX1|.	.|.;.;.;TS1R1_HUMAN|.	S|I|S	92|166;166;88;166|92	.|ENSP00000331867:M166I;ENSP00000327705:M166I;ENSP00000312558:M166I|.	.|ENSP00000327705:M166I|.	C|M|X	+|+|+	2|3|2	0|0|2	TAS1R1|TAS1R1|TAS1R1	6553862|6553862|6553862	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.668000|0.668000|0.668000	0.39293|0.39293|0.39293	5.775000|5.775000|5.775000	0.68915|0.68915|0.68915	2.281000|2.281000|2.281000	0.76405|0.76405|0.76405	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	TGC|ATG|TGA	-	HMMPfam_ANF_receptor		0.637	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS1R1	protein_coding	OTTHUMT00000004211.1	G		Missense_Mutation	6553862	1	no_errors	NM_138697	genbank	human	reviewed	54_36p	missense	SNP	1	C
CAMTA1	23261	genome.wustl.edu	37	1	6885168	6885168	+	Silent	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr1:6885168C>T	ENST00000303635.7	+	3	339	c.132C>T	c.(130-132)agC>agT	p.S44S	CAMTA1_ENST00000557126.1_Silent_p.S44S|CAMTA1_ENST00000439411.2_Silent_p.S44S|CAMTA1_ENST00000473578.1_Silent_p.S44S|CAMTA1_ENST00000467404.2_Silent_p.S56S|CAMTA1_ENST00000476163.1_3'UTR	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	44					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S44S(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		ATGGGAACAGCAATAGTAGTC	0.343			T	WWTR1	epitheliod hemangioendothelioma																																		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	1	Substitution - coding silent(1)	ovary(1)	1											64.0	68.0	66.0					1																	6885168		2203	4300	6503	6807755	SO:0001819	synonymous_variant	23261			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.132C>T	1.37:g.6885168C>T		Somatic		Capture	Illumina GAIIx	4	6807755	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	HMMPfam_IQ;HMMPfam_Ank;superfamily_Ankyrin repeat;HMMPfam_TIG;HMMPfam_CG-1;superfamily_E set domains;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.S44	ENST00000303635.7	37	c.132	CCDS30576.1	1																																																																																			-	NULL		0.343	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	protein_coding	OTTHUMT00000003588.3	C	NM_015215		6807755	1	no_errors	NM_015215	genbank	human	validated	54_36p	silent	SNP	1	T
KDF1	126695	genome.wustl.edu	37	1	27278400	27278400	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr1:27278400T>C	ENST00000320567.5	-	2	560	c.472A>G	c.(472-474)Agc>Ggc	p.S158G		NM_152365.2	NP_689578.2	Q8NAX2	KDF1_HUMAN		158					developmental growth (GO:0048589)|establishment of skin barrier (GO:0061436)|keratinocyte development (GO:0003334)|limb epidermis development (GO:0060887)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|positive regulation of epidermal cell differentiation (GO:0045606)|regulation of epidermal cell division (GO:0010482)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)		p.S158G(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		TAGCTGAAGCTGCTGCCCATG	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	44.0	43.0					1																	27278400		2203	4300	6503	27150987	SO:0001583	missense	126695																														ENST00000320567.5:c.472A>G	1.37:g.27278400T>C	ENSP00000319179:p.Ser158Gly	Somatic		Capture	Illumina GAIIx	4	27150987	Q5QP32|Q8N0S7	Missense_Mutation	SNP	-	p.S158G	ENST00000320567.5	37	c.472	CCDS293.1	1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.937959	0.73557	.	.	ENSG00000175707	ENST00000320567	T	0.33216	1.42	5.05	5.05	0.67936	.	0.082235	0.85682	D	0.000000	T	0.42154	0.1190	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.43343	-0.9397	10	0.72032	D	0.01	.	14.9594	0.71144	0.0:0.0:0.0:1.0	.	158	Q8NAX2	CA172_HUMAN	G	158	ENSP00000319179:S158G	ENSP00000319179:S158G	S	-	1	0	C1orf172	27150987	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.187000	0.77730	2.114000	0.64651	0.528000	0.53228	AGC	-	NULL		0.647	C1orf172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf172	protein_coding	OTTHUMT00000012340.1	T			27150987	-1	no_errors	NM_152365	genbank	human	predicted	54_36p	missense	SNP	1	C
C1orf52	148423	genome.wustl.edu	37	1	85725076	85725076	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr1:85725076C>G	ENST00000471115.1	-	1	249	c.241G>C	c.(241-243)Gac>Cac	p.D81H	C1orf52_ENST00000344356.5_Missense_Mutation_p.D81H|C1orf52_ENST00000294661.4_5'UTR	NM_198077.3	NP_932343.1	Q8N6N3	CA052_HUMAN	chromosome 1 open reading frame 52	81							poly(A) RNA binding (GO:0044822)	p.D81H(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)	10				all cancers(265;0.0105)|Epithelial(280;0.0293)		CTCTCCCAGTCTATCTGTTTG	0.642											OREG0013580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											53.0	59.0	57.0					1																	85725076		2203	4300	6503	85497664	SO:0001583	missense	148423			BC029538	CCDS703.1	1p22.3	2008-02-05			ENSG00000162642	ENSG00000162642			24871	protein-coding gene	gene with protein product						11891061	Standard	NM_198077		Approved	gm117, FLJ44982	uc001dkv.3	Q8N6N3	OTTHUMG00000009966	ENST00000471115.1:c.241G>C	1.37:g.85725076C>G	ENSP00000419417:p.Asp81His	Somatic	1239	Capture	Illumina GAIIx	4	85497664	B3KX89|Q8TDK5|Q8TDK6	Missense_Mutation	SNP	-	p.D81H	ENST00000471115.1	37	c.241	CCDS703.1	1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.019527	0.93462	.	.	ENSG00000162642	ENST00000471115;ENST00000344356	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.73776	0.3630	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.68943	0.961;0.919	T	0.75516	-0.3290	9	0.87932	D	0	-4.5507	19.6692	0.95905	0.0:1.0:0.0:0.0	.	81;81	Q8N6N3-2;Q8N6N3	.;CA052_HUMAN	H	81	.	ENSP00000345092:D81H	D	-	1	0	C1orf52	85497664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.851000	0.75425	2.722000	0.93159	0.637000	0.83480	GAC	-	NULL		0.642	C1orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf52	protein_coding	OTTHUMT00000027616.2	C	NM_198077		85497664	-1	no_errors	NM_198077	genbank	human	validated	54_36p	missense	SNP	1	G
KIAA1614	57710	genome.wustl.edu	37	1	180904835	180904835	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr1:180904835C>T	ENST00000367588.4	+	5	1845	c.1790C>T	c.(1789-1791)aCa>aTa	p.T597I	KIAA1614_ENST00000367587.1_Missense_Mutation_p.T218I	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	597								p.T597I(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						ATCCGGGAAACACACATCGGA	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											23.0	27.0	26.0					1																	180904835		2133	4235	6368	179171458	SO:0001583	missense	57710			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.1790C>T	1.37:g.180904835C>T	ENSP00000356560:p.Thr597Ile	Somatic		Capture	Illumina GAIIx	4	179171458	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	-	p.T597I	ENST00000367588.4	37	c.1790	CCDS41442.1	1	.	.	.	.	.	.	.	.	.	.	c	16.82	3.227324	0.58668	.	.	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.55588	1.02;0.51	4.96	4.04	0.47022	.	0.272260	0.34628	N	0.003814	T	0.56124	0.1964	L	0.59436	1.845	0.31950	N	0.609747	P	0.46912	0.886	P	0.48795	0.59	T	0.70648	-0.4814	9	0.87932	D	0	-6.5076	11.2928	0.49261	0.0:0.9133:0.0:0.0867	.	597	Q5VZ46	K1614_HUMAN	I	597;218	ENSP00000356560:T597I;ENSP00000356559:T218I	ENSP00000356559:T218I	T	+	2	0	KIAA1614	179171458	0.982000	0.34865	0.932000	0.37286	0.449000	0.32228	2.634000	0.46528	1.073000	0.40885	-0.265000	0.10407	ACA	-	NULL		0.647	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1614	protein_coding	OTTHUMT00000085151.1	C	XM_046531		179171458	1	no_errors	NM_020950	genbank	human	validated	54_36p	missense	SNP	0.98	T
PITRM1	10531	genome.wustl.edu	37	10	3208518	3208518	+	Silent	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr10:3208518C>T	ENST00000224949.4	-	4	355	c.321G>A	c.(319-321)gaG>gaA	p.E107E	PITRM1-AS1_ENST00000601046.1_RNA|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Silent_p.E107E|PITRM1_ENST00000451104.2_Silent_p.E75E			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	107					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.E107E(1)		breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						GGACGGTATGCTCAAGAATGT	0.493																																																1	Substitution - coding silent(1)	ovary(1)	10											146.0	146.0	146.0					10																	3208518		2018	4172	6190	3198518	SO:0001819	synonymous_variant	10531			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.321G>A	10.37:g.3208518C>T		Somatic		Capture	Illumina GAIIx	4	3198518	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Silent	SNP	HMMPfam_Peptidase_M16_C;superfamily_LuxS/MPP-like metallohydrolase;HMMPfam_M16C_assoc	p.E107	ENST00000224949.4	37	c.321	CCDS59208.1	10																																																																																			-	NULL		0.493	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITRM1	protein_coding	OTTHUMT00000046469.2	C			3198518	-1	no_errors	NM_014889	genbank	human	validated	54_36p	silent	SNP	1	T
ANKRD30A	91074	genome.wustl.edu	37	10	37506757	37506757	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr10:37506757T>G	ENST00000602533.1	+	33	3149	c.3050T>G	c.(3049-3051)cTc>cGc	p.L1017R	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.L1017R|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.L1136R			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1073					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L1017R(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GAACAGGCTCTCAGAATACAA	0.289																																																1	Substitution - Missense(1)	ovary(1)	10											59.0	61.0	61.0					10																	37506757		1812	4057	5869	37546763	SO:0001583	missense	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3050T>G	10.37:g.37506757T>G	ENSP00000473551:p.Leu1017Arg	Somatic		Capture	Illumina GAIIx	4	37546763	Q5W025	Missense_Mutation	SNP	HMMPfam_Ank;superfamily_Ankyrin repeat	p.L1017R	ENST00000602533.1	37	c.3050		10	.	.	.	.	.	.	.	.	.	.	t	10.88	1.475336	0.26511	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.23348	1.91;1.91	2.78	0.21	0.15231	.	.	.	.	.	T	0.31358	0.0794	L	0.58810	1.83	0.09310	N	1	P	0.52842	0.956	P	0.53360	0.724	T	0.17167	-1.0378	9	0.87932	D	0	.	3.3016	0.06985	0.2019:0.1268:0.0:0.6713	.	1073	Q9BXX3	AN30A_HUMAN	R	1017;1136	ENSP00000354432:L1017R;ENSP00000363792:L1136R	ENSP00000354432:L1017R	L	+	2	0	ANKRD30A	37546763	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.903000	0.28475	-0.179000	0.10654	-0.806000	0.03193	CTC	-	NULL		0.289	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	protein_coding	OTTHUMT00000047588.2	T	NM_052997		37546763	1	no_errors	NM_052997	genbank	human	validated	54_36p	missense	SNP	0.02	G
SLC16A9	220963	genome.wustl.edu	37	10	61413887	61413887	+	Silent	SNP	A	A	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr10:61413887A>G	ENST00000395348.3	-	5	1533	c.897T>C	c.(895-897)gcT>gcC	p.A299A	SLC16A9_ENST00000395347.1_Silent_p.A299A	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	299					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.A299A(1)		kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						TTTTAAAAAGAGCCACAGTTT	0.363																																																1	Substitution - coding silent(1)	ovary(1)	10											75.0	77.0	77.0					10																	61413887		2203	4300	6503	61083893	SO:0001819	synonymous_variant	220963			AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.897T>C	10.37:g.61413887A>G		Somatic		Capture	Illumina GAIIx	4	61083893	Q6ZMI2|Q9UFH8	Silent	SNP	-	p.A299	ENST00000395348.3	37	c.897	CCDS7256.1	10																																																																																			-	NULL		0.363	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC16A9	protein_coding	OTTHUMT00000048174.2	A	NM_194298		61083893	-1	no_errors	NM_194298	genbank	human	validated	54_36p	silent	SNP	0.25	G
HKDC1	80201	genome.wustl.edu	37	10	71010331	71010331	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr10:71010331T>G	ENST00000354624.5	+	12	1892	c.1759T>G	c.(1759-1761)Tac>Gac	p.Y587D	HKDC1_ENST00000395086.2_Missense_Mutation_p.Y587D	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	587	Hexokinase type-1 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)	p.Y587D(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CTTCCTGGACTACATGGGCCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	10											121.0	124.0	123.0					10																	71010331		2203	4300	6503	70680337	SO:0001583	missense	80201				CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1759T>G	10.37:g.71010331T>G	ENSP00000346643:p.Tyr587Asp	Somatic		Capture	Illumina GAIIx	4	70680337	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	HMMPfam_Hexokinase_1;HMMPfam_Hexokinase_2;superfamily_Actin-like ATPase domain	p.Y587D	ENST00000354624.5	37	c.1759	CCDS7288.1	10	.	.	.	.	.	.	.	.	.	.	T	13.50	2.257031	0.39896	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.98792	-5.14;-5.14	4.98	4.98	0.66077	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98213	0.9409	L	0.42487	1.325	0.53688	D	0.999975	D	0.60160	0.987	D	0.69824	0.966	D	0.97749	1.0213	10	0.13108	T	0.6	-19.9861	14.8099	0.69985	0.0:0.0:0.0:1.0	.	587	Q2TB90	HKDC1_HUMAN	D	587	ENSP00000346643:Y587D;ENSP00000378521:Y587D	ENSP00000346643:Y587D	Y	+	1	0	HKDC1	70680337	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.988000	0.70579	2.090000	0.63153	0.459000	0.35465	TAC	-	HMMPfam_Hexokinase_1		0.557	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HKDC1	protein_coding	OTTHUMT00000048389.1	T	NM_025130		70680337	1	no_errors	NM_025130	genbank	human	validated	54_36p	missense	SNP	1	G
NRAP	4892	genome.wustl.edu	37	10	115400046	115400046	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr10:115400046G>T	ENST00000359988.3	-	14	1612	c.1368C>A	c.(1366-1368)aaC>aaA	p.N456K	NRAP_ENST00000360478.3_Missense_Mutation_p.N421K|NRAP_ENST00000369358.4_Missense_Mutation_p.N456K|NRAP_ENST00000369360.3_Missense_Mutation_p.N421K	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein									p.N456K(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TGGCTGGGTAGTTGTAGTCGA	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											210.0	189.0	196.0					10																	115400046		2203	4300	6503	115390036	SO:0001583	missense	4892				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.1368C>A	10.37:g.115400046G>T	ENSP00000353078:p.Asn456Lys	Somatic		Capture	Illumina GAIIx	4	115390036		Missense_Mutation	SNP	HMMPfam_Nebulin;HMMPfam_LIM;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.N456K	ENST00000359988.3	37	c.1368	CCDS7579.1	10	.	.	.	.	.	.	.	.	.	.	G	16.23	3.065258	0.55432	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478;ENST00000369350;ENST00000369343	T;T;T;T	0.17054	2.5;2.49;2.39;2.3	6.07	3.22	0.36961	.	0.000000	0.85682	D	0.000000	T	0.33323	0.0859	M	0.70595	2.14	0.39168	D	0.96253	D;D;D	0.65815	0.995;0.99;0.991	D;D;P	0.67103	0.949;0.942;0.877	T	0.09773	-1.0659	10	0.30854	T	0.27	.	8.0306	0.30463	0.3539:0.0:0.6461:0.0	.	456;421;456	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	K	456;421;456;421;185;185	ENSP00000358365:N456K;ENSP00000358367:N421K;ENSP00000353078:N456K;ENSP00000353666:N421K	ENSP00000353078:N456K	N	-	3	2	NRAP	115390036	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.594000	0.46189	0.903000	0.36546	0.655000	0.94253	AAC	-	NULL		0.393	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRAP	protein_coding	OTTHUMT00000050425.2	G	NM_006175		115390036	-1	no_errors	NM_198060	genbank	human	validated	54_36p	missense	SNP	1	T
USH1C	10083	genome.wustl.edu	37	11	17548563	17548563	+	Splice_Site	SNP	C	C	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr11:17548563C>A	ENST00000318024.4	-	6	629	c.521G>T	c.(520-522)aGc>aTc	p.S174I	USH1C_ENST00000005226.7_Splice_Site_p.S174I|USH1C_ENST00000527720.1_Splice_Site_p.S143I|USH1C_ENST00000527020.1_Splice_Site_p.S174I	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	174					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)	p.S174I(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						GGCCTCTCACCTTTTCACGGG	0.657																																																1	Substitution - Missense(1)	ovary(1)	11											29.0	23.0	25.0					11																	17548563		2180	4270	6450	17505139	SO:0001630	splice_region_variant	10083			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.521+1G>T	11.37:g.17548563C>A		Somatic		Capture	Illumina GAIIx	4	17505139	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	HMMPfam_PDZ,superfamily_PDZ domain-like	p.S174I	ENST00000318024.4	37	c.521	CCDS31438.1	11	.	.	.	.	.	.	.	.	.	.	C	12.12	1.843712	0.32606	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226;ENST00000526181	T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33	5.31	4.28	0.50868	PDZ/DHR/GLGF (1);	0.179966	0.64402	D	0.000013	T	0.15349	0.0370	L	0.29908	0.895	0.53005	D	0.999967	P;P;P	0.44946	0.846;0.761;0.801	P;B;B	0.47102	0.537;0.336;0.396	T	0.01352	-1.1377	9	.	.	.	.	8.5461	0.33421	0.0:0.8582:0.0:0.1418	.	174;174;174	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	I	174;143;174;174;185	ENSP00000317018:S174I;ENSP00000432944:S143I;ENSP00000436934:S174I;ENSP00000005226:S174I;ENSP00000437128:S185I	.	S	-	2	0	USH1C	17505139	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	1.790000	0.38734	2.471000	0.83476	0.557000	0.71058	AGC	-	NULL		0.657	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	protein_coding	OTTHUMT00000389146.1	C	NM_005709	Missense_Mutation	17505139	-1	no_errors	NM_153676	genbank	human	reviewed	54_36p	missense	SNP	1	A
FAM111A	63901	genome.wustl.edu	37	11	58920238	58920238	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr11:58920238C>G	ENST00000528737.1	+	5	3915	c.1097C>G	c.(1096-1098)aCt>aGt	p.T366S	FAM111A_ENST00000420244.1_Missense_Mutation_p.T366S|FAM111A_ENST00000533703.1_Missense_Mutation_p.T366S|FAM111A_ENST00000531147.1_Missense_Mutation_p.T366S|FAM111A_ENST00000361723.3_Missense_Mutation_p.T366S			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	366	Interaction with SV40 large T antigen.				defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.T366S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				GACAGTGCAACTACGGGTTAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	11											108.0	108.0	108.0					11																	58920238		2201	4295	6496	58676814	SO:0001583	missense	63901			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.1097C>G	11.37:g.58920238C>G	ENSP00000434435:p.Thr366Ser	Somatic		Capture	Illumina GAIIx	4	58676814	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	superfamily_Trypsin-like serine proteases	p.T366S	ENST00000528737.1	37	c.1097	CCDS7973.1	11	.	.	.	.	.	.	.	.	.	.	C	10.03	1.238061	0.22711	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	5.73	-1.06	0.10002	Peptidase cysteine/serine, trypsin-like (1);	1.020260	0.07794	N	0.955349	T	0.26991	0.0661	L	0.34521	1.04	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.25363	-1.0134	10	0.46703	T	0.11	-18.0317	2.2852	0.04124	0.4385:0.1331:0.0704:0.3579	.	366	Q96PZ2	F111A_HUMAN	S	366	ENSP00000434435:T366S;ENSP00000406683:T366S;ENSP00000355264:T366S;ENSP00000433154:T366S;ENSP00000431631:T366S	ENSP00000355264:T366S	T	+	2	0	FAM111A	58676814	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.611000	0.24268	-0.356000	0.08187	-1.608000	0.00805	ACT	-	NULL		0.398	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM111A	protein_coding	OTTHUMT00000393975.1	C	NM_022074		58676814	1	no_errors	NM_022074	genbank	human	validated	54_36p	missense	SNP	0.03	G
PPP1R32	220004	genome.wustl.edu	37	11	61254627	61254627	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr11:61254627G>C	ENST00000338608.2	+	11	1083	c.958G>C	c.(958-960)Ggg>Cgg	p.G320R	PPP1R32_ENST00000432063.2_Missense_Mutation_p.G300R|PPP1R32_ENST00000538185.1_5'Flank|PPP1R32_ENST00000366212.4_5'Flank	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	320							phosphatase binding (GO:0019902)	p.G320R(1)									GGAGCCCACAGGGTTCAGCCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	11											178.0	176.0	177.0					11																	61254627		2202	4299	6501	61011203	SO:0001583	missense	220004			AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.958G>C	11.37:g.61254627G>C	ENSP00000344140:p.Gly320Arg	Somatic		Capture	Illumina GAIIx	4	61011203	Q4G0P4|Q96M77	Missense_Mutation	SNP	-	p.G320R	ENST00000338608.2	37	c.958	CCDS8008.1	11	.	.	.	.	.	.	.	.	.	.	G	17.28	3.348980	0.61183	.	.	ENSG00000162148	ENST00000432063;ENST00000338608;ENST00000542951;ENST00000535545	T;T;T;T	0.67523	-0.27;0.18;0.57;0.5	4.69	4.69	0.59074	.	0.177207	0.37261	N	0.002169	T	0.81851	0.4910	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;0.989	D;D	0.77004	0.989;0.939	D	0.84824	0.0798	10	0.87932	D	0	-9.5621	14.9191	0.70822	0.0:0.0:1.0:0.0	.	300;320	Q7Z5V6-2;Q7Z5V6	.;PPR32_HUMAN	R	300;320;71;87	ENSP00000391560:G300R;ENSP00000344140:G320R;ENSP00000441053:G71R;ENSP00000437511:G87R	ENSP00000344140:G320R	G	+	1	0	C11orf66	61011203	1.000000	0.71417	0.997000	0.53966	0.591000	0.36615	4.783000	0.62403	2.311000	0.77944	0.609000	0.83330	GGG	-	NULL		0.562	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf66	protein_coding	OTTHUMT00000398621.1	G	NM_145017		61011203	1	no_errors	NM_145017	genbank	human	provisional	54_36p	missense	SNP	1	C
RNF26	79102	genome.wustl.edu	37	11	119206996	119206996	+	Silent	SNP	G	G	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr11:119206996G>A	ENST00000311413.4	+	1	1760	c.1164G>A	c.(1162-1164)aaG>aaA	p.K388K	RP11-334E6.10_ENST00000501918.2_RNA|C1QTNF5_ENST00000525657.1_5'Flank	NM_032015.4	NP_114404.1	Q9BY78	RNF26_HUMAN	ring finger protein 26	388						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.K388K(1)		cervix(1)|endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		ACCAGAGCAAGACAGTGTTGC	0.602																																																1	Substitution - coding silent(1)	ovary(1)	11											101.0	86.0	91.0					11																	119206996		2199	4295	6494	118712206	SO:0001819	synonymous_variant	79102			AB055622	CCDS8419.1	11q23	2008-07-21				ENSG00000173456		"""RING-type (C3HC4) zinc fingers"""	14646	protein-coding gene	gene with protein product	"""ring finger protein with leucine zipper"""	606130				11352657	Standard	NM_032015		Approved	MGC2642	uc001pwh.3	Q9BY78		ENST00000311413.4:c.1164G>A	11.37:g.119206996G>A		Somatic		Capture	Illumina GAIIx	4	118712206	Q542Y8	Silent	SNP	-	p.K388	ENST00000311413.4	37	c.1164	CCDS8419.1	11																																																																																			-	NULL		0.602	RNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF26	protein_coding	OTTHUMT00000388220.1	G	NM_032015		118712206	1	no_errors	NM_032015	genbank	human	reviewed	54_36p	silent	SNP	1	A
ADAMTS20	80070	genome.wustl.edu	37	12	43826111	43826111	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr12:43826111C>T	ENST00000389420.3	-	21	3091	c.3092G>A	c.(3091-3093)aGc>aAc	p.S1031N	ADAMTS20_ENST00000395541.2_Missense_Mutation_p.S185N|ADAMTS20_ENST00000553158.1_Missense_Mutation_p.S1031N	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1031	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C1031Y(1)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ATGTACCTCGCTCCATTCACT	0.378																																																1	Substitution - Missense(1)	ovary(1)	12											100.0	92.0	95.0					12																	43826111		2203	4300	6503	42112378	SO:0001583	missense	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3092G>A	12.37:g.43826111C>T	ENSP00000374071:p.Ser1031Asn	Somatic		Capture	Illumina GAIIx	4	42112378	A6NNC9|J3QT00	Missense_Mutation	SNP	"superfamily_Metalloproteases (""zincins"") catalytic domain;superfamily_TSP-1 type 1 repeat;TSP_1;HMMPfam_TSP_1;Reprolysin;HMMPfam_Reprolysin;Pep_M12B_propep;HMMPfam_Pep_M12B_propep;ADAM_spacer1;HMMPfam_ADAM_spacer1;GON;HMMPfam_GON"	p.S1031N	ENST00000389420.3	37	c.3092	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	C	21.6	4.178243	0.78564	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	4.91	4.91	0.64330	.	0.000000	0.64402	D	0.000010	D	0.82999	0.5159	M	0.88377	2.95	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86194	0.1614	10	0.72032	D	0.01	.	18.9963	0.92813	0.0:1.0:0.0:0.0	.	1031;185	P59510;E9PBD5	ATS20_HUMAN;.	N	1031;197;185;1031;1031	ENSP00000374071:S1031N;ENSP00000447427:S197N;ENSP00000378911:S185N;ENSP00000448341:S1031N	ENSP00000374068:S1031N	S	-	2	0	ADAMTS20	42112378	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	3.497000	0.53295	2.637000	0.89404	0.563000	0.77884	AGC	-	HMMPfam_TSP_1		0.378	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	protein_coding	OTTHUMT00000403643.1	C	NM_025003		42112378	-1	no_errors	NM_025003	genbank	human	validated	54_36p	missense	SNP	1	T
CUX2	23316	genome.wustl.edu	37	12	111746135	111746135	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr12:111746135C>G	ENST00000261726.6	+	13	1310	c.1156C>G	c.(1156-1158)Cag>Gag	p.Q386E		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	386					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.Q386*(1)|p.Q386E(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CAGCCTCCCCCAGGTAAGTGT	0.652																																																2	Substitution - Nonsense(1)|Substitution - Missense(1)	upper_aerodigestive_tract(1)|ovary(1)	12											60.0	64.0	63.0					12																	111746135		2005	4188	6193	110230518	SO:0001583	missense	23316			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.1156C>G	12.37:g.111746135C>G	ENSP00000261726:p.Gln386Glu	Somatic		Capture	Illumina GAIIx	4	110230518	A7E2Y4	Missense_Mutation	SNP	HMMPfam_Homeobox;HMMPfam_CUT;superfamily_Prefoldin;superfamily_Homeodomain-like	p.Q386E	ENST00000261726.6	37	c.1156	CCDS41837.1	12	.	.	.	.	.	.	.	.	.	.	C	17.84	3.488804	0.64074	.	.	ENSG00000111249	ENST00000261726	T	0.51817	0.69	5.04	5.04	0.67666	.	0.127579	0.56097	D	0.000031	T	0.62060	0.2397	L	0.52126	1.63	0.58432	D	0.999999	D	0.58268	0.982	D	0.67548	0.952	T	0.57087	-0.7871	10	0.27785	T	0.31	-28.8216	17.9881	0.89160	0.0:1.0:0.0:0.0	.	386	O14529	CUX2_HUMAN	E	386	ENSP00000261726:Q386E	ENSP00000261726:Q386E	Q	+	1	0	CUX2	110230518	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	6.992000	0.76238	2.344000	0.79699	0.313000	0.20887	CAG	-	NULL		0.652	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	protein_coding	OTTHUMT00000404765.1	C	NM_015267		110230518	1	no_errors	NM_015267	genbank	human	validated	54_36p	missense	SNP	1	G
STARD13	90627	genome.wustl.edu	37	13	33739488	33739488	+	Silent	SNP	T	T	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr13:33739488T>A	ENST00000336934.5	-	3	425	c.309A>T	c.(307-309)gtA>gtT	p.V103V	STARD13-IT1_ENST00000456087.1_RNA|STARD13_ENST00000399365.3_5'UTR|STARD13_ENST00000487412.1_5'UTR|STARD13_ENST00000255486.4_Silent_p.V95V	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	103	SAM.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)	p.V103V(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		AAAGAGGTTCTACAAGGTCCT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	13											120.0	116.0	117.0					13																	33739488		2203	4300	6503	32637488	SO:0001819	synonymous_variant	90627			AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.309A>T	13.37:g.33739488T>A		Somatic		Capture	Illumina GAIIx	4	32637488	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Silent	SNP	HMMPfam_RhoGAP;HMMPfam_START;superfamily_GTPase activation domain GAP;HMMPfam_SAM_2;superfamily_Bet v1-like	p.V103	ENST00000336934.5	37	c.309	CCDS9348.1	13																																																																																			-	HMMPfam_SAM_2		0.398	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD13	protein_coding	OTTHUMT00000276118.2	T	NM_001243466		32637488	-1	no_errors	NM_178006	genbank	human	validated	54_36p	silent	SNP	1	A
COL4A1	1282	genome.wustl.edu	37	13	110827611	110827611	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr13:110827611T>A	ENST00000375820.4	-	37	3273	c.3152A>T	c.(3151-3153)cAg>cTg	p.Q1051L		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1051	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.Q1051L(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			TGGGCCTGCCTGCCCTTTCTC	0.572																																																1	Substitution - Missense(1)	ovary(1)	13											155.0	117.0	130.0					13																	110827611		2203	4300	6503	109625612	SO:0001583	missense	1282			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.3152A>T	13.37:g.110827611T>A	ENSP00000364979:p.Gln1051Leu	Somatic		Capture	Illumina GAIIx	4	109625612	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	HMMPfam_C4;HMMPfam_Collagen;superfamily_C-type lectin-like	p.Q1051L	ENST00000375820.4	37	c.3152	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	T	9.022	0.985026	0.18889	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	D	0.93659	-3.26	5.39	2.71	0.32032	.	0.775970	0.12138	N	0.496131	T	0.80665	0.4666	N	0.03000	-0.44	0.80722	D	1	B	0.20988	0.05	B	0.28385	0.089	T	0.70088	-0.4968	10	0.06891	T	0.86	.	7.1405	0.25554	0.2351:0.0:0.136:0.6289	.	1051	P02462	CO4A1_HUMAN	L	694;1051;700	ENSP00000364979:Q1051L	ENSP00000364973:Q694L	Q	-	2	0	COL4A1	109625612	0.132000	0.22450	0.990000	0.47175	0.346000	0.29079	1.608000	0.36847	0.947000	0.37659	0.528000	0.53228	CAG	-	HMMPfam_Collagen		0.572	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	protein_coding	OTTHUMT00000045759.3	T			109625612	-1	no_errors	NM_001845	genbank	human	reviewed	54_36p	missense	SNP	0.99	A
RPL10L	140801	genome.wustl.edu	37	14	47120738	47120738	+	Missense_Mutation	SNP	C	C	T	rs200453552		TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr14:47120738C>T	ENST00000298283.3	-	1	290	c.202G>A	c.(202-204)Gcc>Acc	p.A68T		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	68					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)	p.A68T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						CAAATACGGGCGGCCTCCAGG	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		17938	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	14											65.0	68.0	67.0					14																	47120738		2203	4300	6503	46190488	SO:0001583	missense	140801			AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.202G>A	14.37:g.47120738C>T	ENSP00000298283:p.Ala68Thr	Somatic		Capture	Illumina GAIIx	4	46190488	Q8IUD1	Missense_Mutation	SNP	-	p.A68T	ENST00000298283.3	37	c.202	CCDS32071.1	14	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	26.9	4.781757	0.90282	.	.	ENSG00000165496	ENST00000298283	T	0.75821	-0.97	4.17	4.17	0.49024	Ribosomal protein L10e/L16 (2);	0.000000	0.85682	D	0.000000	D	0.87977	0.6314	H	0.97516	4.02	0.80722	D	1	P	0.46277	0.875	P	0.52109	0.69	D	0.91913	0.5541	10	0.87932	D	0	-28.8228	14.7976	0.69889	0.0:1.0:0.0:0.0	.	68	Q96L21	RL10L_HUMAN	T	68	ENSP00000298283:A68T	ENSP00000298283:A68T	A	-	1	0	RPL10L	46190488	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.026000	0.76455	2.608000	0.88229	0.655000	0.94253	GCC	-	NULL		0.512	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10L	protein_coding	OTTHUMT00000349819.1	C			46190488	-1	no_errors	NM_080746	genbank	human	reviewed	54_36p	missense	SNP	1	T
ZFYVE26	23503	genome.wustl.edu	37	14	68222743	68222743	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr14:68222743C>A	ENST00000347230.4	-	36	6846	c.6708G>T	c.(6706-6708)aaG>aaT	p.K2236N	ZFYVE26_ENST00000557306.1_Missense_Mutation_p.K82N	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2236					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.K2236N(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CAATCAAGTACTTTCCCCAGC	0.443																																																1	Substitution - Missense(1)	ovary(1)	14											311.0	311.0	311.0					14																	68222743		2203	4300	6503	67292496	SO:0001583	missense	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.6708G>T	14.37:g.68222743C>A	ENSP00000251119:p.Lys2236Asn	Somatic		Capture	Illumina GAIIx	4	67292496	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	HMMPfam_FYVE;superfamily_FYVE/PHD zinc finger	p.K2236N	ENST00000347230.4	37	c.6708	CCDS9788.1	14	.	.	.	.	.	.	.	.	.	.	C	7.402	0.632995	0.14322	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000557306	T;T	0.46063	1.74;0.88	5.25	-0.758	0.11049	.	0.445747	0.23920	N	0.043245	T	0.24699	0.0599	L	0.29908	0.895	0.52501	D	0.999953	B;B	0.21520	0.002;0.057	B;B	0.18871	0.009;0.023	T	0.04386	-1.0955	10	0.27082	T	0.32	-2.0447	7.663	0.28415	0.0:0.3968:0.3221:0.2811	.	82;2236	Q96H43;Q68DK2	.;ZFY26_HUMAN	N	2236;2215;82	ENSP00000251119:K2236N;ENSP00000452142:K82N	ENSP00000251119:K2236N	K	-	3	2	ZFYVE26	67292496	0.997000	0.39634	0.739000	0.30968	0.991000	0.79684	0.416000	0.21198	-0.174000	0.10743	0.462000	0.41574	AAG	-	NULL		0.443	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE26	protein_coding	OTTHUMT00000412736.2	C	NM_015346		67292496	-1	no_errors	NM_015346	genbank	human	reviewed	54_36p	missense	SNP	0.75	A
RASGRP1	10125	genome.wustl.edu	37	15	38803830	38803830	+	Missense_Mutation	SNP	G	G	A	rs369326621		TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr15:38803830G>A	ENST00000310803.5	-	8	1118	c.941C>T	c.(940-942)tCg>tTg	p.S314L	RASGRP1_ENST00000559830.1_Missense_Mutation_p.S314L|RASGRP1_ENST00000539159.1_Missense_Mutation_p.S266L|RASGRP1_ENST00000558164.1_Missense_Mutation_p.S314L|RASGRP1_ENST00000561180.1_Missense_Mutation_p.S365L|RASGRP1_ENST00000450598.2_Missense_Mutation_p.S314L	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	314	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)	p.S314L(2)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		TGGGACATGCGAACTTGTCTC	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		22735	0.0		0.0	False		,,,				2504	0.001															2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	15						G	LEU/SER,LEU/SER	0,4002		0,0,2001	121.0	121.0	121.0		941,941	5.4	1.0	15		121	1,8347		0,1,4173	no	missense,missense	RASGRP1	NM_001128602.1,NM_005739.3	145,145	0,1,6174	AA,AG,GG		0.012,0.0,0.0081	possibly-damaging,possibly-damaging	314/763,314/798	38803830	1,12349	2001	4174	6175	36591122	SO:0001583	missense	10125			AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.941C>T	15.37:g.38803830G>A	ENSP00000310244:p.Ser314Leu	Somatic		Capture	Illumina GAIIx	4	36591122	Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Missense_Mutation	SNP	HMMPfam_RasGEF_N;HMMPfam_RasGEF;HMMPfam_efhand;HMMPfam_C1_1;superfamily_Ras GEF;superfamily_EF-hand;superfamily_Cysteine-rich domain	p.S314L	ENST00000310803.5	37	c.941	CCDS45222.1	15	.	.	.	.	.	.	.	.	.	.	G	34	5.335762	0.95758	0.0	1.2E-4	ENSG00000172575	ENST00000310803;ENST00000450598;ENST00000415523;ENST00000431814;ENST00000539159;ENST00000414708;ENST00000541438	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	5.38	5.38	0.77491	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.220979	0.40640	N	0.001060	T	0.42177	0.1191	M	0.69358	2.11	0.80722	D	1	D;P;P;P	0.53462	0.96;0.782;0.782;0.859	P;P;B;B	0.46110	0.504;0.473;0.393;0.342	T	0.44003	-0.9356	10	0.72032	D	0.01	-9.966	19.3333	0.94303	0.0:0.0:1.0:0.0	.	314;314;314;314	C9JM27;C9JCE5;O95267;O95267-2	.;.;GRP1_HUMAN;.	L	314;314;314;314;266;314;314	ENSP00000310244:S314L;ENSP00000388540:S314L;ENSP00000444762:S266L;ENSP00000413105:S314L	ENSP00000310244:S314L	S	-	2	0	RASGRP1	36591122	1.000000	0.71417	0.967000	0.41034	0.994000	0.84299	9.657000	0.98554	2.793000	0.96121	0.655000	0.94253	TCG	-	HMMPfam_RasGEF		0.493	RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASGRP1	protein_coding	OTTHUMT00000418223.1	G	NM_005739		36591122	-1	no_errors	NM_005739	genbank	human	reviewed	54_36p	missense	SNP	1	A
DMXL2	23312	genome.wustl.edu	37	15	51829847	51829847	+	Silent	SNP	T	T	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr15:51829847T>G	ENST00000251076.5	-	11	1742	c.1455A>C	c.(1453-1455)ccA>ccC	p.P485P	DMXL2_ENST00000449909.3_Silent_p.P485P|DMXL2_ENST00000543779.2_Silent_p.P485P	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	485						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.P485P(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CCGTAGGCAGTGGCATTGGTA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	15											240.0	197.0	212.0					15																	51829847		2195	4293	6488	49617139	SO:0001819	synonymous_variant	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.1455A>C	15.37:g.51829847T>G		Somatic		Capture	Illumina GAIIx	4	49617139	B2RTR3|B7ZMH3|F5GWF1|O94938	Silent	SNP	HMMPfam_WD40;superfamily_WD40 repeat-like	p.P485	ENST00000251076.5	37	c.1455	CCDS10141.1	15																																																																																			-	NULL		0.428	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	protein_coding	OTTHUMT00000254671.2	T	NM_015263		49617139	-1	no_errors	NM_015263	genbank	human	validated	54_36p	silent	SNP	0.95	G
RAB27A	5873	genome.wustl.edu	37	15	55520900	55520900	+	Silent	SNP	A	A	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr15:55520900A>G	ENST00000396307.2	-	4	501	c.250T>C	c.(250-252)Tta>Cta	p.L84L	RAB27A_ENST00000564609.1_Silent_p.L84L|RAB27A_ENST00000336787.1_Silent_p.L84L|RAB27A_ENST00000569493.1_Silent_p.L84L	NM_004580.4	NP_004571.2	P51159	RB27A_HUMAN	RAB27A, member RAS oncogene family	84			L -> F (in dbSNP:rs4340274).		antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cytotoxic T cell degranulation (GO:0043316)|exocytosis (GO:0006887)|exosomal secretion (GO:1990182)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|multivesicular body organization (GO:0036257)|multivesicular body sorting pathway (GO:0071985)|natural killer cell degranulation (GO:0043320)|positive regulation of exocytosis (GO:0045921)|positive regulation of gene expression (GO:0010628)|protein targeting (GO:0006605)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle transport (GO:0048489)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|photoreceptor outer segment (GO:0001750)|secretory granule membrane (GO:0030667)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L84L(1)		endometrium(1)|large_intestine(2)|liver(1)|lung(3)|ovary(1)|skin(1)	9				all cancers(107;0.0273)|GBM - Glioblastoma multiforme(80;0.0993)		GCTGTCGTTAAGCTACGAAAC	0.398																																																1	Substitution - coding silent(1)	ovary(1)	15											97.0	90.0	92.0					15																	55520900		2193	4292	6485	53308192	SO:0001819	synonymous_variant	5873			U38654	CCDS10153.1	15q15-q21.1	2014-09-17			ENSG00000069974	ENSG00000069974		"""RAB, member RAS oncogene"""	9766	protein-coding gene	gene with protein product		603868				7592656	Standard	NM_183235		Approved	RAB27, RAM, GS2, HsT18676	uc002acq.3	P51159	OTTHUMG00000131959	ENST00000396307.2:c.250T>C	15.37:g.55520900A>G		Somatic		Capture	Illumina GAIIx	4	53308192	O00195|Q6FI40|Q9UIR9|Q9Y5U3	Silent	SNP	HMMPfam_Ras;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.L84	ENST00000396307.2	37	c.250	CCDS10153.1	15																																																																																			-	HMMPfam_Ras		0.398	RAB27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB27A	protein_coding	OTTHUMT00000254918.1	A	NM_004580, NM_183236		53308192	-1	no_errors	NM_004580	genbank	human	reviewed	54_36p	silent	SNP	1	G
IGDCC3	9543	genome.wustl.edu	37	15	65622130	65622130	+	Missense_Mutation	SNP	C	C	A	rs146763554		TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr15:65622130C>A	ENST00000327987.4	-	12	2182	c.1931G>T	c.(1930-1932)gGc>gTc	p.G644V	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	644					neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)		p.G644V(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GATGTGGATGCCGATGACGAT	0.637																																																1	Substitution - Missense(1)	ovary(1)	15											127.0	72.0	90.0					15																	65622130		2201	4299	6500	63409183	SO:0001583	missense	9543			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1931G>T	15.37:g.65622130C>A	ENSP00000332773:p.Gly644Val	Somatic		Capture	Illumina GAIIx	4	63409183	O95215	Missense_Mutation	SNP	HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_I-set;HMMPfam_ig;superfamily_Immunoglobulin	p.G644V	ENST00000327987.4	37	c.1931	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740363	0.69304	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	T	0.70399	-0.48	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.79155	0.4398	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.66084	0.941	T	0.79838	-0.1634	10	0.87932	D	0	-29.2905	20.3658	0.98878	0.0:1.0:0.0:0.0	.	644	Q8IVU1	IGDC3_HUMAN	V	644;507	ENSP00000332773:G644V	ENSP00000332773:G644V	G	-	2	0	IGDCC3	63409183	1.000000	0.71417	0.993000	0.49108	0.168000	0.22595	7.792000	0.85828	2.820000	0.97059	0.650000	0.86243	GGC	-	NULL		0.637	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	protein_coding	OTTHUMT00000256826.1	C	NM_004884		63409183	-1	no_errors	NM_004884	genbank	human	validated	54_36p	missense	SNP	1	A
ZKSCAN2	342357	genome.wustl.edu	37	16	25255569	25255569	+	Silent	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr16:25255569C>T	ENST00000328086.7	-	6	2321	c.1518G>A	c.(1516-1518)aaG>aaA	p.K506K		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	506					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.K506K(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		CAAGAAAAGTCTTGGTTTCTT	0.438																																																1	Substitution - coding silent(1)	ovary(1)	16											52.0	53.0	52.0					16																	25255569		2196	4299	6495	25163070	SO:0001819	synonymous_variant	342357			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.1518G>A	16.37:g.25255569C>T		Somatic		Capture	Illumina GAIIx	4	25163070	A1L3B4|Q6ZN77	Silent	SNP	-	p.K506	ENST00000328086.7	37	c.1518	CCDS32410.1	16																																																																																			-	NULL		0.438	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN2	protein_coding	OTTHUMT00000435739.1	C	NM_001012981		25163070	-1	no_errors	NM_001012981	genbank	human	validated	54_36p	silent	SNP	1	T
PRSS36	146547	genome.wustl.edu	37	16	31159926	31159926	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr16:31159926C>G	ENST00000268281.4	-	5	401	c.343G>C	c.(343-345)Gac>Cac	p.D115H	PRSS36_ENST00000418068.2_Missense_Mutation_p.D115H|PRSS36_ENST00000569305.1_Missense_Mutation_p.D115H	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	115	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)	p.D115H(1)		kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						TGCGCGCCGTCCAGGGGCCCG	0.726																																																1	Substitution - Missense(1)	ovary(1)	16											14.0	19.0	17.0					16																	31159926		2053	4086	6139	31067427	SO:0001583	missense	146547			AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.343G>C	16.37:g.31159926C>G	ENSP00000268281:p.Asp115His	Somatic		Capture	Illumina GAIIx	4	31067427	A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	HMMPfam_Trypsin,superfamily_Trypsin-like serine proteases	p.D115H	ENST00000268281.4	37	c.343	CCDS32436.1	16	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745820	0.69418	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	D;D	0.83673	-1.75;-1.75	4.95	3.99	0.46301	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.82481	0.5046	L	0.41415	1.275	0.09310	N	1	P;P;P	0.52061	0.728;0.95;0.897	P;P;P	0.54924	0.674;0.764;0.696	T	0.71919	-0.4447	9	0.49607	T	0.09	.	8.5621	0.33516	0.0:0.8954:0.0:0.1046	.	115;115;115	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	H	115	ENSP00000268281:D115H;ENSP00000407160:D115H	ENSP00000268281:D115H	D	-	1	0	PRSS36	31067427	0.002000	0.14202	0.979000	0.43373	0.949000	0.60115	0.771000	0.26633	2.435000	0.82474	0.555000	0.69702	GAC	-	HMMPfam_Trypsin		0.726	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRSS36	protein_coding	OTTHUMT00000433542.1	C	NM_173502		31067427	-1	no_errors	NM_173502	genbank	human	validated	54_36p	missense	SNP	0.026	G
CES1P2	390732	genome.wustl.edu	37	16	55762082	55762082	+	IGR	SNP	G	G	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr16:55762082G>A								SLC6A2 (21978 upstream) : CES1P1 (32428 downstream)																							TTGACCAACCGAAAGGAGAAC	0.468																																																0			16																																								54319583	SO:0001628	intergenic_variant	390732																															16.37:g.55762082G>A		Somatic		Capture	Illumina GAIIx	4	54319583		RNA	SNP	-	NULL		37	NULL		16																																																																																			-	-	0	0.468					LOC390732			G			54319583	1	pseudogene	XR_016696	genbank	human	model	54_36p	rna	SNP	0.07	A
MYH1	4619	genome.wustl.edu	37	17	10399611	10399611	+	Missense_Mutation	SNP	G	G	A	rs201002878		TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr17:10399611G>A	ENST00000226207.5	-	34	5006	c.4912C>T	c.(4912-4914)Cgc>Tgc	p.R1638C	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1638					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R1638C(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GCAGCCATGCGGTTGGCATGG	0.502																																																1	Substitution - Missense(1)	ovary(1)	17											195.0	171.0	179.0					17																	10399611		2203	4300	6503	10340336	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.4912C>T	17.37:g.10399611G>A	ENSP00000226207:p.Arg1638Cys	Somatic		Capture	Illumina GAIIx	4	10340336	Q14CA4|Q9Y622	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Prefoldin;superfamily_tRNA-binding arm;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R1638C	ENST00000226207.5	37	c.4912	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090151	0.36855	.	.	ENSG00000109061	ENST00000226207	D	0.82167	-1.58	5.53	4.51	0.55191	Myosin tail (1);	0.000000	0.44097	U	0.000485	D	0.88709	0.6510	M	0.93507	3.425	0.58432	D	0.999998	P	0.35011	0.48	B	0.38985	0.287	D	0.91075	0.4895	10	0.87932	D	0	.	16.3189	0.82938	0.0:0.0:0.8676:0.1324	.	1638	P12882	MYH1_HUMAN	C	1638	ENSP00000226207:R1638C	ENSP00000226207:R1638C	R	-	1	0	MYH1	10340336	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.022000	0.41030	2.758000	0.94735	0.655000	0.94253	CGC	-	HMMPfam_Myosin_tail_1		0.502	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	G	NM_005963		10340336	-1	no_errors	NM_005963	genbank	human	reviewed	54_36p	missense	SNP	1	A
TBC1D28	254272	genome.wustl.edu	37	17	18541683	18541683	+	Silent	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr17:18541683C>T	ENST00000345096.4	-	7	1029	c.330G>A	c.(328-330)gcG>gcA	p.A110A	TBC1D28_ENST00000405044.1_Silent_p.A110A			Q2M2D7	TBC28_HUMAN	TBC1 domain family, member 28	110	Rab-GAP TBC.						Rab GTPase activator activity (GO:0005097)	p.A110A(1)		breast(1)|large_intestine(5)|lung(2)|ovary(1)	9						AAAGTGACAACGCCCGGCCCC	0.507																																																1	Substitution - coding silent(1)	ovary(1)	17											122.0	123.0	123.0					17																	18541683		1930	4118	6048	18482408	SO:0001819	synonymous_variant	254272				CCDS42273.1	17p11.2	2008-10-27			ENSG00000189375	ENSG00000189375			26858	protein-coding gene	gene with protein product							Standard	NM_001039397		Approved	FLJ40244	uc002gud.2	Q2M2D7	OTTHUMG00000059054	ENST00000345096.4:c.330G>A	17.37:g.18541683C>T		Somatic		Capture	Illumina GAIIx	4	18482408	Q2M2E1	Silent	SNP	superfamily_Ypt/Rab-GAP domain of gyp1p	p.A110	ENST00000345096.4	37	c.330	CCDS42273.1	17																																																																																			-	NULL		0.507	TBC1D28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D28	protein_coding	OTTHUMT00000130672.2	C	NM_001039397		18482408	-1	no_errors	NM_001039397	genbank	human	validated	54_36p	silent	SNP	0.1	T
TP53	7157	genome.wustl.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr17:7578265A>G	ENST00000269305.4	-	6	773	c.584T>C	c.(583-585)aTc>aCc	p.I195T	TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.I195T|TP53_ENST00000413465.2_Missense_Mutation_p.I195T|TP53_ENST00000445888.2_Missense_Mutation_p.I195T|TP53_ENST00000455263.2_Missense_Mutation_p.I195T|TP53_ENST00000420246.2_Missense_Mutation_p.I195T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)	17											100.0	89.0	93.0					17																	7578265		2203	4300	6503	7518990	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>C	17.37:g.7578265A>G	ENSP00000269305:p.Ile195Thr	Somatic		Capture	Illumina GAIIx	4	7518990	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.I195T	ENST00000269305.4	37	c.584	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324656	0.41197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	N	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.52099	D	0.999943	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.991;0.989;0.998;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.995;0.953;0.979;0.995;0.993;0.996	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195T;ENSP00000352610:I195T;ENSP00000269305:I195T;ENSP00000398846:I195T;ENSP00000391127:I195T;ENSP00000391478:I195T;ENSP00000425104:I63T;ENSP00000423862:I102T	ENSP00000269305:I195T	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC	-	HMMPfam_P53		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546		7518990	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	G
BCAS3	54828	genome.wustl.edu	37	17	58967062	58967062	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr17:58967062A>G	ENST00000390652.5	+	10	699	c.668A>G	c.(667-669)tAt>tGt	p.Y223C	BCAS3_ENST00000588874.1_5'UTR|BCAS3_ENST00000589222.1_Missense_Mutation_p.Y223C|BCAS3_ENST00000408905.3_Missense_Mutation_p.Y223C|BCAS3_ENST00000585744.1_5'UTR|BCAS3_ENST00000588462.1_Missense_Mutation_p.Y223C|BCAS3_ENST00000407086.3_Missense_Mutation_p.Y223C	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3									p.Y223C(1)		NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TCAGGCTGCTATCCATGTCCA	0.393																																																1	Substitution - Missense(1)	ovary(1)	17											103.0	101.0	101.0					17																	58967062		1835	4091	5926	56321844	SO:0001583	missense	54828			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.668A>G	17.37:g.58967062A>G	ENSP00000375067:p.Tyr223Cys	Somatic		Capture	Illumina GAIIx	4	56321844		Missense_Mutation	SNP	-	p.Y223C	ENST00000390652.5	37	c.668	CCDS45749.1	17	.	.	.	.	.	.	.	.	.	.	A	18.44	3.625046	0.66901	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000405070;ENST00000408905;ENST00000405217	T;T;T	0.06933	3.24;3.24;3.24	5.99	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.25005	0.0607	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.66847	0.935;0.947;0.936;0.947	T	0.00534	-1.1684	10	0.72032	D	0.01	.	12.5854	0.56414	0.8754:0.0:0.0:0.1246	.	28;223;223;223	Q70WD9;Q9H6U6-7;Q9H6U6;Q9H6U6-2	.;.;BCAS3_HUMAN;.	C	223;223;223;223;28	ENSP00000375067:Y223C;ENSP00000385323:Y223C;ENSP00000386173:Y223C	ENSP00000375067:Y223C	Y	+	2	0	BCAS3	56321844	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.781000	0.85668	1.058000	0.40530	0.533000	0.62120	TAT	-	NULL		0.393	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS3	protein_coding	OTTHUMT00000449578.1	A	NM_017679		56321844	1	no_errors	NM_001099432	genbank	human	validated	54_36p	missense	SNP	1	G
ZNF429	353088	genome.wustl.edu	37	19	21720471	21720471	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr19:21720471G>A	ENST00000358491.4	+	4	1824	c.1616G>A	c.(1615-1617)tGt>tAt	p.C539Y	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	539					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C539Y(1)		endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						CCTTACAAATGTGAAGAATGT	0.363																																																1	Substitution - Missense(1)	ovary(1)	19											41.0	46.0	44.0					19																	21720471		2136	4268	6404	21512311	SO:0001583	missense	353088			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1616G>A	19.37:g.21720471G>A	ENSP00000351280:p.Cys539Tyr	Somatic		Capture	Illumina GAIIx	4	21512311	A6NLV7|Q9BZE6	Missense_Mutation	SNP	-	p.C539Y	ENST00000358491.4	37	c.1616	CCDS42537.1	19	.	.	.	.	.	.	.	.	.	.	.	10.24	1.295907	0.23564	.	.	ENSG00000197013	ENST00000358491	D	0.85088	-1.94	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94108	0.8111	H	0.97806	4.08	0.30037	N	0.81296	D	0.89917	1.0	D	0.72075	0.976	D	0.88168	0.2862	9	0.62326	D	0.03	.	8.5632	0.33523	0.0:0.0:1.0:0.0	.	539	Q86V71	ZN429_HUMAN	Y	539	ENSP00000351280:C539Y	ENSP00000351280:C539Y	C	+	2	0	ZNF429	21512311	0.994000	0.37717	0.291000	0.24904	0.291000	0.27294	2.810000	0.47979	0.293000	0.22520	0.298000	0.19748	TGT	-	NULL		0.363	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF429	protein_coding	OTTHUMT00000463981.1	G	NM_001001415		21512311	1	no_errors	NM_001001415	genbank	human	provisional	54_36p	missense	SNP	0.03	A
NLRP9	338321	genome.wustl.edu	37	19	56249720	56249720	+	Silent	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr19:56249720C>T	ENST00000332836.2	-	1	48	c.21G>A	c.(19-21)tcG>tcA	p.S7S	RN7SKP109_ENST00000410592.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	7	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.S7S(1)		NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AGCCAAAATCCGAAAAAAAAG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	19											70.0	76.0	74.0					19																	56249720		2199	4300	6499	60941532	SO:0001819	synonymous_variant	338321			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.21G>A	19.37:g.56249720C>T		Somatic		Capture	Illumina GAIIx	4	60941532	B2RN12|Q86W27	Silent	SNP	HMMPfam_PAAD_DAPIN;HMMPfam_NACHT;superfamily_DEATH domain;superfamily_RNI-like;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.S7	ENST00000332836.2	37	c.21	CCDS12934.1	19																																																																																			-	HMMPfam_PAAD_DAPIN		0.398	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	protein_coding	OTTHUMT00000453653.1	C	NM_176820		60941532	-1	no_errors	NM_176820	genbank	human	reviewed	54_36p	silent	SNP	0.03	T
EMR1	2015	genome.wustl.edu	37	19	6919735	6919735	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr19:6919735A>G	ENST00000312053.4	+	13	1634	c.1597A>G	c.(1597-1599)Atc>Gtc	p.I533V	EMR1_ENST00000381407.5_Missense_Mutation_p.I392V|EMR1_ENST00000250572.8_Missense_Mutation_p.I533V|EMR1_ENST00000381404.4_Missense_Mutation_p.I481V|EMR1_ENST00000450315.3_Missense_Mutation_p.I356V	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	533	Ser/Thr-rich.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.I533V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					AGATCCAATCATCTACACTCT	0.473																																																1	Substitution - Missense(1)	ovary(1)	19											85.0	77.0	80.0					19																	6919735		2203	4300	6503	6870735	SO:0001583	missense	2015			X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.1597A>G	19.37:g.6919735A>G	ENSP00000311545:p.Ile533Val	Somatic		Capture	Illumina GAIIx	4	6870735	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	HMMPfam_GPS;HMMPfam_7tm_2;HMMPfam_EGF_CA;superfamily_EGF/Laminin;superfamily_Family A G protein-coupled receptor-like	p.I533V	ENST00000312053.4	37	c.1597	CCDS12175.1	19	.	.	.	.	.	.	.	.	.	.	A	6.416	0.444853	0.12164	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	T;T;T;T;T	0.77489	-1.06;-1.1;-1.1;0.1;0.41	3.99	-1.45	0.08828	.	.	.	.	.	T	0.52338	0.1728	N	0.17082	0.46	0.09310	N	1	B;B;B;B;B	0.15473	0.013;0.006;0.004;0.01;0.001	B;B;B;B;B	0.11329	0.006;0.004;0.005;0.005;0.002	T	0.39165	-0.9627	9	0.06365	T	0.9	.	4.3158	0.10993	0.335:0.3328:0.0:0.3322	.	356;392;533;481;533	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	V	533;533;481;533;392;356	ENSP00000311545:I533V;ENSP00000370811:I481V;ENSP00000250572:I533V;ENSP00000370814:I392V;ENSP00000405974:I356V	ENSP00000250572:I533V	I	+	1	0	EMR1	6870735	0.001000	0.12720	0.001000	0.08648	0.444000	0.32077	-0.138000	0.10374	-0.114000	0.11936	0.402000	0.26972	ATC	-	NULL		0.473	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR1	protein_coding	OTTHUMT00000458485.1	A			6870735	1	no_errors	NM_001974	genbank	human	reviewed	54_36p	missense	SNP		G
ARHGEF18	23370	genome.wustl.edu	37	19	7523469	7523469	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr19:7523469G>T	ENST00000359920.6	+	9	1942	c.1689G>T	c.(1687-1689)atG>atT	p.M563I	CTD-2207O23.3_ENST00000593531.1_Missense_Mutation_p.C521F|ARHGEF18_ENST00000319670.9_Missense_Mutation_p.M405I	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	563	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.M405I(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				AGAAAGCGATGTTTCTGATCA	0.547																																																1	Substitution - Missense(1)	ovary(1)	19											133.0	113.0	120.0					19																	7523469		2203	4300	6503	7429469	SO:0001583	missense	23370			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.1689G>T	19.37:g.7523469G>T	ENSP00000352995:p.Met563Ile	Somatic		Capture	Illumina GAIIx	4	7429469	A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	HMMPfam_RhoGEF;HMMPfam_PH;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like	p.M405I	ENST00000359920.6	37	c.1215	CCDS45946.1	19	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848718	0.91277	.	.	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.62364	0.03;0.03	4.99	4.99	0.66335	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000001	T	0.64271	0.2583	L	0.39566	1.225	0.80722	D	1	B;B	0.32526	0.324;0.374	B;B	0.44224	0.413;0.444	T	0.67906	-0.5549	10	0.72032	D	0.01	-40.4302	15.7945	0.78398	0.0:0.0:1.0:0.0	.	405;563	Q6ZSZ5-2;Q6ZSZ5	.;ARHGI_HUMAN	I	405;563	ENSP00000319200:M405I;ENSP00000352995:M563I	ENSP00000319200:M405I	M	+	3	0	ARHGEF18	7429469	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.467000	0.97671	2.324000	0.78689	0.591000	0.81541	ATG	-	HMMPfam_PH		0.547	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF18	protein_coding	OTTHUMT00000436340.1	G	NM_015318		7429469	1	no_errors	NM_015318	genbank	human	reviewed	54_36p	missense	SNP	1	T
ZNF177	7730	genome.wustl.edu	37	19	9492249	9492249	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr19:9492249C>G	ENST00000589262.1	+	6	1308	c.1242C>G	c.(1240-1242)caC>caG	p.H414Q	ZNF177_ENST00000541595.2_Missense_Mutation_p.H254Q|ZNF177_ENST00000590616.1_Intron|ZNF177_ENST00000343499.4_Missense_Mutation_p.H254Q|ZNF177_ENST00000602738.1_Missense_Mutation_p.H254Q|ZNF177_ENST00000446085.4_3'UTR|ZNF177_ENST00000602856.1_3'UTR|ZNF177_ENST00000434737.2_Missense_Mutation_p.H414Q	NM_001172651.1	NP_001166122.1	Q13360	ZN177_HUMAN	zinc finger protein 177	414					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H254Q(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|stomach(2)	13						TTATTGTGCACAAGAGAACTC	0.468																																																1	Substitution - Missense(1)	ovary(1)	19											139.0	137.0	138.0					19																	9492249		2203	4300	6503	9353249	SO:0001583	missense	7730			U37263, BC012012	CCDS12212.1, CCDS54214.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	12966	protein-coding gene	gene with protein product		601276					Standard	NM_003451		Approved		uc021uon.1	Q13360		ENST00000589262.1:c.1242C>G	19.37:g.9492249C>G	ENSP00000468531:p.His414Gln	Somatic		Capture	Illumina GAIIx	4	9353249	B4DY57|E9PDG0|I3L0I4|Q96ER2	Missense_Mutation	SNP	-	p.H254Q	ENST00000589262.1	37	c.762	CCDS54214.1	19	.	.	.	.	.	.	.	.	.	.	C	12.86	2.065294	0.36470	.	.	ENSG00000188629	ENST00000541595;ENST00000343499;ENST00000434737	D;D;D	0.86865	-2.18;-2.18;-2.18	2.49	-0.861	0.10676	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92557	0.7636	M	0.89658	3.05	0.24211	N	0.995473	D;D	0.89917	1.0;1.0	D;D	0.76575	0.987;0.988	D	0.89711	0.3912	8	0.87932	D	0	.	5.9678	0.19334	0.0:0.4283:0.0:0.5717	.	414;254	B4DY57;Q13360	.;ZN177_HUMAN	Q	254;254;414	ENSP00000445323:H254Q;ENSP00000341497:H254Q;ENSP00000415070:H414Q	ENSP00000341497:H254Q	H	+	3	2	ZNF177	9353249	0.005000	0.15991	0.352000	0.25734	0.964000	0.63967	-0.059000	0.11731	-0.103000	0.12175	-0.251000	0.11542	CAC	-	NULL		0.468	ZNF177-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF177	protein_coding	OTTHUMT00000449028.1	C	NM_003451		9353249	1	no_errors	NM_003451	genbank	human	provisional	54_36p	missense	SNP	0.07	G
NLRP5	126206	genome.wustl.edu	37	19	56539283	56539283	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr19:56539283C>T	ENST00000390649.3	+	7	1684	c.1684C>T	c.(1684-1686)Cgt>Tgt	p.R562C		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	562	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.R562C(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GTCTGAGCTCCGTGCTCTGTT	0.542																																																1	Substitution - Missense(1)	ovary(1)	19											58.0	61.0	60.0					19																	56539283		2114	4234	6348	61231095	SO:0001583	missense	126206			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1684C>T	19.37:g.56539283C>T	ENSP00000375063:p.Arg562Cys	Somatic		Capture	Illumina GAIIx	4	61231095	A8MTY4|Q86W29	Missense_Mutation	SNP	-	p.R543C	ENST00000390649.3	37	c.1627	CCDS12938.1	19	.	.	.	.	.	.	.	.	.	.	C	11.42	1.632529	0.29068	.	.	ENSG00000171487	ENST00000390649	T	0.72282	-0.64	2.97	-0.6	0.11642	.	1.365850	0.05348	N	0.531385	T	0.63450	0.2512	N	0.19112	0.55	0.09310	N	1	D	0.59357	0.985	P	0.53649	0.731	T	0.53394	-0.8445	10	0.51188	T	0.08	.	3.9613	0.09412	0.0:0.1397:0.4439:0.4164	.	562	P59047	NALP5_HUMAN	C	562	ENSP00000375063:R562C	ENSP00000375063:R562C	R	+	1	0	NLRP5	61231095	0.005000	0.15991	0.000000	0.03702	0.000000	0.00434	0.697000	0.25556	-0.206000	0.10203	-1.102000	0.02115	CGT	-	NULL		0.542	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	protein_coding	OTTHUMT00000313735.1	C	NM_153447		61231095	1	no_errors	NM_153447	genbank	human	reviewed	54_36p	missense	SNP	0.02	T
POTEJ	653781	genome.wustl.edu	37	2	131412503	131412503	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr2:131412503A>C	ENST00000409602.1	+	14	1729	c.1677A>C	c.(1675-1677)caA>caC	p.Q559H		NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	559					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						GTGACGAACAAAATGATACTC	0.358																																																0			2																																								131128973	SO:0001583	missense	653781				CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.1677A>C	2.37:g.131412503A>C	ENSP00000387176:p.Gln559His	Somatic		Capture	Illumina GAIIx	4	131128973		Missense_Mutation	SNP	-	p.Q559H	ENST00000409602.1	37	c.1677	CCDS59432.1	2	.	.	.	.	.	.	.	.	.	.	.	6.724	0.502263	0.12822	.	.	ENSG00000222038	ENST00000409602	T	0.78707	-1.2	1.02	1.02	0.19986	.	.	.	.	.	T	0.63462	0.2513	N	0.19112	0.55	0.09310	N	1	.	.	.	.	.	.	T	0.57825	-0.7744	7	0.87932	D	0	.	4.2829	0.10841	1.0:0.0:0.0:0.0	.	.	.	.	H	559	ENSP00000387176:Q559H	ENSP00000387176:Q559H	Q	+	3	2	POTEJ	131128973	0.031000	0.19500	0.042000	0.18584	0.049000	0.14656	-0.208000	0.09371	0.726000	0.32339	0.155000	0.16302	CAA	-	NULL		0.358	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LOC653781	protein_coding	OTTHUMT00000333665.1	A	XM_929706		131128973	1	no_errors	XM_929706	genbank	human	model	54_36p	missense	SNP	0.95	C
COBLL1	22837	genome.wustl.edu	37	2	165559646	165559646	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr2:165559646C>A	ENST00000392717.2	-	10	1428	c.1424G>T	c.(1423-1425)gGg>gTg	p.G475V	COBLL1_ENST00000409184.3_Intron|COBLL1_ENST00000491126.2_Intron|COBLL1_ENST00000375458.2_Intron|COBLL1_ENST00000194871.6_Missense_Mutation_p.G503V|COBLL1_ENST00000342193.4_Missense_Mutation_p.G437V			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	475						extracellular vesicular exosome (GO:0070062)		p.G437V(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						CTCAGGTGTCCCAGGGCACTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	2											164.0	151.0	155.0					2																	165559646		2203	4300	6503	165267892	SO:0001583	missense	22837			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.1424G>T	2.37:g.165559646C>A	ENSP00000376478:p.Gly475Val	Somatic		Capture	Illumina GAIIx	4	165267892	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	-	p.G437V	ENST00000392717.2	37	c.1310		2	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041593	0.55003	.	.	ENSG00000082438	ENST00000342193;ENST00000392717;ENST00000194871	.	.	.	4.71	2.88	0.33553	.	0.330064	0.26863	N	0.022105	T	0.30198	0.0757	L	0.29908	0.895	0.58432	D	0.999997	P	0.50272	0.933	B	0.42386	0.386	T	0.03630	-1.1018	9	0.27785	T	0.31	-12.4063	4.5472	0.12087	0.0:0.6287:0.2149:0.1563	.	503	B7Z2P5	.	V	437;475;503	.	ENSP00000194871:G503V	G	-	2	0	COBLL1	165267892	0.410000	0.25376	0.974000	0.42286	0.393000	0.30537	-0.107000	0.10873	1.318000	0.45170	0.650000	0.86243	GGG	-	NULL		0.507	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	protein_coding		C	NM_014900		165267892	-1	no_errors	NM_014900	genbank	human	validated	54_36p	missense	SNP	0.98	A
COPS7B	64708	genome.wustl.edu	37	2	232660972	232660972	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr2:232660972A>G	ENST00000350033.3	+	5	625	c.484A>G	c.(484-486)Atc>Gtc	p.I162V	COPS7B_ENST00000373608.3_Missense_Mutation_p.I162V|COPS7B_ENST00000410024.1_Missense_Mutation_p.I162V|COPS7B_ENST00000409295.1_Missense_Mutation_p.I128V|COPS7B_ENST00000410017.1_Missense_Mutation_p.I162V|COPS7B_ENST00000409091.1_Missense_Mutation_p.I55V	NM_001282949.1|NM_022730.1	NP_001269878.1|NP_073567.1	Q9H9Q2	CSN7B_HUMAN	COP9 signalosome subunit 7B	162					cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I162V(1)		large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)	8		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		TGGCCGTGACATCCGAAAGAA	0.478																																																1	Substitution - Missense(1)	ovary(1)	2											75.0	65.0	69.0					2																	232660972		2203	4300	6503	232369216	SO:0001583	missense	64708			AK022674	CCDS2488.1, CCDS63152.1, CCDS63153.1, CCDS63154.1, CCDS74668.1	2q37.1	2013-03-14	2013-03-14		ENSG00000144524	ENSG00000144524			16760	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7B"", ""COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)"""			9707402	Standard	NM_001282950		Approved	CSN7B	uc002vsg.1	Q9H9Q2	OTTHUMG00000133228	ENST00000350033.3:c.484A>G	2.37:g.232660972A>G	ENSP00000272995:p.Ile162Val	Somatic		Capture	Illumina GAIIx	4	232369216	Q53S22|Q5BJG3|Q9H7V6	Missense_Mutation	SNP	-	p.I162V	ENST00000350033.3	37	c.484	CCDS2488.1	2	.	.	.	.	.	.	.	.	.	.	A	13.00	2.107510	0.37145	.	.	ENSG00000144524	ENST00000410024;ENST00000409295;ENST00000409091;ENST00000350033;ENST00000412591;ENST00000410017;ENST00000373608;ENST00000537799;ENST00000449174	T;T;T;T	0.39056	1.16;1.16;1.1;1.12	5.36	5.36	0.76844	Proteasome component (PCI) domain (1);	0.133387	0.51477	D	0.000087	T	0.34106	0.0886	L	0.43152	1.355	0.43874	D	0.996488	P;B;B	0.42692	0.787;0.156;0.141	B;B;B	0.40199	0.322;0.147;0.076	T	0.13710	-1.0499	10	0.07030	T	0.85	-11.9181	15.3502	0.74376	1.0:0.0:0.0:0.0	.	162;162;162	Q53GQ2;Q9H9Q2-3;Q9H9Q2	.;.;CSN7B_HUMAN	V	162;128;55;162;107;162;162;55;26	ENSP00000386567:I162V;ENSP00000272995:I162V;ENSP00000386880:I162V;ENSP00000362710:I162V	ENSP00000272995:I162V	I	+	1	0	COPS7B	232369216	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.850000	0.62889	2.022000	0.59522	0.533000	0.62120	ATC	-	NULL		0.478	COPS7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS7B	protein_coding	OTTHUMT00000256964.2	A	NM_022730		232369216	1	no_errors	NM_022730	genbank	human	provisional	54_36p	missense	SNP	1	G
GIGYF2	26058	genome.wustl.edu	37	2	233660906	233660906	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr2:233660906C>A	ENST00000409547.1	+	16	1925	c.1614C>A	c.(1612-1614)taC>taA	p.Y538*	GIGYF2_ENST00000409196.3_Nonsense_Mutation_p.Y532*|GIGYF2_ENST00000409451.3_Nonsense_Mutation_p.Y559*|GIGYF2_ENST00000409480.1_Nonsense_Mutation_p.Y560*|GIGYF2_ENST00000373566.3_Nonsense_Mutation_p.Y560*|GIGYF2_ENST00000452341.2_Nonsense_Mutation_p.Y369*|GIGYF2_ENST00000373563.4_Nonsense_Mutation_p.Y538*	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	538	GYF. {ECO:0000255|PROSITE- ProRule:PRU00101}.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.Y538*(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AGTGGTATTACAAAGATCCTC	0.403																																																1	Substitution - Nonsense(1)	ovary(1)	2											133.0	126.0	129.0					2																	233660906		2203	4300	6503	233369150	SO:0001587	stop_gained	26058			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.1614C>A	2.37:g.233660906C>A	ENSP00000386537:p.Tyr538*	Somatic		Capture	Illumina GAIIx	4	233369150	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Nonsense_Mutation	SNP	-	p.Y559*	ENST00000409547.1	37	c.1677	CCDS33401.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.409317	0.97542	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	.	.	.	5.68	-3.93	0.04143	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.4688	12.7638	0.57380	0.0:0.6083:0.0:0.3917	.	.	.	.	X	560;481;538;560;538;538;481;532;559;532;369	.	ENSP00000362664:Y538X	Y	+	3	2	GIGYF2	233369150	0.998000	0.40836	0.911000	0.35937	0.992000	0.81027	0.665000	0.25083	-1.007000	0.03408	-0.423000	0.05987	TAC	-	NULL		0.403	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	protein_coding	OTTHUMT00000330316.2	C	NM_001103146		233369150	1	no_errors	NM_001103147	genbank	human	validated	54_36p	nonsense	SNP	1	A
ILKAP	80895	genome.wustl.edu	37	2	239090819	239090819	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr2:239090819C>G	ENST00000254654.3	-	9	898	c.723G>C	c.(721-723)ttG>ttC	p.L241F		NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	241	PP2C-like.				protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.L241F(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		TATAACGACACAAGATTGCCT	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											196.0	175.0	182.0					2																	239090819		2203	4300	6503	238755558	SO:0001583	missense	80895			AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.723G>C	2.37:g.239090819C>G	ENSP00000254654:p.Leu241Phe	Somatic		Capture	Illumina GAIIx	4	238755558	B3KM39	Missense_Mutation	SNP	HMMPfam_PP2C;superfamily_Protein serine/threonine phosphatase 2C catalytic domain	p.L241F	ENST00000254654.3	37	c.723	CCDS2526.1	2	.	.	.	.	.	.	.	.	.	.	C	15.92	2.975123	0.53720	.	.	ENSG00000132323	ENST00000254654;ENST00000450411	T;T	0.39056	1.1;1.1	5.37	0.326	0.15908	Protein phosphatase 2C-like (5);	0.072044	0.56097	D	0.000036	T	0.61350	0.2340	M	0.91717	3.235	0.54753	D	0.999987	D	0.89917	1.0	D	0.81914	0.995	T	0.56432	-0.7980	10	0.72032	D	0.01	1.4726	1.2487	0.01978	0.253:0.4092:0.1232:0.2146	.	241	Q9H0C8	ILKAP_HUMAN	F	241;58	ENSP00000254654:L241F;ENSP00000406254:L58F	ENSP00000254654:L241F	L	-	3	2	ILKAP	238755558	0.999000	0.42202	0.988000	0.46212	0.832000	0.47134	0.656000	0.24948	-0.245000	0.09625	-0.793000	0.03317	TTG	-	HMMPfam_PP2C		0.418	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILKAP	protein_coding	OTTHUMT00000257163.2	C	NM_030768		238755558	-1	no_errors	NM_030768	genbank	human	reviewed	54_36p	missense	SNP	1	G
PRR21	643905	genome.wustl.edu	37	2	240982247	240982247	+	Silent	SNP	A	A	G	rs75044548	byFrequency	TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr2:240982247A>G	ENST00000408934.1	-	1	152	c.153T>C	c.(151-153)caT>caC	p.H51H		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	51	Pro-rich.							p.H51H(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						AGAGCCGTGGATGAAGGGCCA	0.577																																																2	Substitution - coding silent(2)	ovary(2)	2											118.0	104.0	109.0					2																	240982247		2203	4299	6502	240630920	SO:0001819	synonymous_variant	643905			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.153T>C	2.37:g.240982247A>G		Somatic		Capture	Illumina GAIIx	4	240630920		Silent	SNP	-	p.H51	ENST00000408934.1	37	c.153	CCDS33417.1	2																																																																																			-	NULL		0.577	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643905	protein_coding		A	NM_001080835		240630920	-1	no_errors	NM_001080835	genbank	human	predicted	54_36p	silent	SNP	0	G
TGM6	343641	genome.wustl.edu	37	20	2380980	2380980	+	Silent	SNP	G	G	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr20:2380980G>T	ENST00000202625.2	+	7	940	c.879G>T	c.(877-879)cgG>cgT	p.R293R	TGM6_ENST00000477505.1_3'UTR|TGM6_ENST00000381423.1_Silent_p.R293R	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	293					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.R293R(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	TAGCCACACGGGTCGTGTCCA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	20											108.0	94.0	99.0					20																	2380980		2203	4300	6503	2328980	SO:0001819	synonymous_variant	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.879G>T	20.37:g.2380980G>T		Somatic		Capture	Illumina GAIIx	4	2328980	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Silent	SNP	-	p.R293	ENST00000202625.2	37	c.879	CCDS13025.1	20																																																																																			-	NULL		0.627	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM6	protein_coding	OTTHUMT00000077581.2	G	NM_198994		2328980	1	no_errors	NM_198994	genbank	human	validated	54_36p	silent	SNP		T
SYCP2	10388	genome.wustl.edu	37	20	58441389	58441389	+	Nonsense_Mutation	SNP	T	T	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr20:58441389T>A	ENST00000357552.3	-	41	4504	c.4279A>T	c.(4279-4281)Aaa>Taa	p.K1427*	SYCP2_ENST00000371001.2_Nonsense_Mutation_p.K1427*			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1427					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)	p.K1427*(1)		NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TGTGAATCTTTTTCAAAATTC	0.239																																																1	Substitution - Nonsense(1)	ovary(1)	20											30.0	35.0	33.0					20																	58441389		2119	4219	6338	57874784	SO:0001587	stop_gained	10388			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.4279A>T	20.37:g.58441389T>A	ENSP00000350162:p.Lys1427*	Somatic		Capture	Illumina GAIIx	4	57874784	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Nonsense_Mutation	SNP	-	p.K1427*	ENST00000357552.3	37	c.4279	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	T	22.6	4.308603	0.81247	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000412613	.	.	.	5.5	5.5	0.81552	.	0.156567	0.45126	D	0.000386	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.3425	11.1279	0.48330	0.0:0.0:0.1543:0.8457	.	.	.	.	X	1427;1427;113	.	ENSP00000350162:K1427X	K	-	1	0	SYCP2	57874784	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	2.547000	0.45786	2.207000	0.71202	0.455000	0.32223	AAA	-	NULL		0.239	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	protein_coding	OTTHUMT00000079930.3	T	NM_014258		57874784	-1	no_errors	NM_014258	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
CABIN1	23523	genome.wustl.edu	37	22	24491950	24491950	+	Silent	SNP	G	G	A	rs552874056		TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr22:24491950G>A	ENST00000398319.2	+	25	4228	c.3843G>A	c.(3841-3843)ggG>ggA	p.G1281G	CABIN1_ENST00000405822.2_Silent_p.G1231G|CABIN1_ENST00000263119.5_Silent_p.G1281G	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1281					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.G1281G(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CCGATTCTGGGGTTGGTGCAG	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		18331	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	22											128.0	133.0	131.0					22																	24491950		2203	4300	6503	22821950	SO:0001819	synonymous_variant	23523			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.3843G>A	22.37:g.24491950G>A		Somatic		Capture	Illumina GAIIx	4	22821950	G5E9F3|Q6PHY0|Q9Y460	Silent	SNP	HMMPfam_TPR_1;HMMPfam_MEF2_binding;superfamily_TPR-like	p.G1281	ENST00000398319.2	37	c.3843	CCDS13823.1	22																																																																																			-	NULL		0.547	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	protein_coding	OTTHUMT00000320161.2	G	NM_012295		22821950	1	no_errors	NM_012295	genbank	human	reviewed	54_36p	silent	SNP	0.98	A
UQCR10	29796	genome.wustl.edu	37	22	30163396	30163396	+	Silent	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr22:30163396C>T	ENST00000330029.6	+	1	39	c.9C>T	c.(7-9)gcC>gcT	p.A3A	ZMAT5_ENST00000397781.3_5'Flank|ZMAT5_ENST00000344318.3_5'Flank|UQCR10_ENST00000401406.3_Silent_p.A3A	NM_001003684.1|NM_013387.3	NP_001003684.1|NP_037519.2	Q9UDW1	QCR9_HUMAN	ubiquinol-cytochrome c reductase, complex III subunit X	3					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)	ubiquinol-cytochrome-c reductase activity (GO:0008121)	p.A3A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)	5						ACATGGCGGCCGCGACGTTGA	0.602																																																1	Substitution - coding silent(1)	ovary(1)	22											46.0	53.0	51.0					22																	30163396		2045	4183	6228	28493396	SO:0001819	synonymous_variant	29796			AB028598	CCDS46680.1, CCDS46681.1	22q12.2	2011-07-04			ENSG00000184076	ENSG00000184076		"""Mitochondrial respiratory chain complex / Complex III"""	30863	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit X, 7.2kDa"", ""complex III subunit 9"""	610843				11042152	Standard	NM_013387		Approved	HSPC051, UCRC, QCR9, UCCR7.2	uc003agq.1	Q9UDW1	OTTHUMG00000151283	ENST00000330029.6:c.9C>T	22.37:g.30163396C>T		Somatic		Capture	Illumina GAIIx	4	28493396	B5MCM5|Q9T2V6	Silent	SNP	HMMPfam_UCR_UQCRX_QCR9	p.A3	ENST00000330029.6	37	c.9	CCDS46680.1	22																																																																																			-	NULL		0.602	UQCR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCRC	protein_coding	OTTHUMT00000322081.1	C	NM_013387		28493396	1	no_errors	NM_013387	genbank	human	validated	54_36p	silent	SNP		T
PHLDB2	90102	genome.wustl.edu	37	3	111604103	111604103	+	Silent	SNP	A	A	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr3:111604103A>T	ENST00000431670.2	+	2	1590	c.1179A>T	c.(1177-1179)gcA>gcT	p.A393A	PHLDB2_ENST00000477695.1_Silent_p.A393A|PHLDB2_ENST00000412622.1_Silent_p.A393A|PHLDB2_ENST00000478922.1_Silent_p.A393A|PHLDB2_ENST00000393925.3_Silent_p.A393A|PHLDB2_ENST00000393923.3_Silent_p.A420A|PHLDB2_ENST00000481953.1_Silent_p.A393A	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	393						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.A393A(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TTGATGAGGCAGATTTGGAAA	0.517																																																1	Substitution - coding silent(1)	ovary(1)	3											76.0	78.0	77.0					3																	111604103		2203	4300	6503	113086793	SO:0001819	synonymous_variant	90102				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1179A>T	3.37:g.111604103A>T		Somatic		Capture	Illumina GAIIx	4	113086793	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Silent	SNP	-	p.A393	ENST00000431670.2	37	c.1179	CCDS46886.1	3																																																																																			-	NULL		0.517	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	protein_coding	OTTHUMT00000354337.1	A	NM_145753		113086793	1	no_errors	NM_145753	genbank	human	validated	54_36p	silent	SNP	0.3	T
SLC9A9	285195	genome.wustl.edu	37	3	143236738	143236738	+	Intron	SNP	C	C	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr3:143236738C>A	ENST00000316549.6	-	10	1298					NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9						ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						TTTGCCTGATCCATCATCTCC	0.413																																																0			3																																								144719428	SO:0001627	intron_variant	645515			AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.1090-22448G>T	3.37:g.143236738C>A		Somatic		Capture	Illumina GAIIx	4	144719428	A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	RNA	SNP	-	NULL	ENST00000316549.6	37	NULL	CCDS33872.1	3																																																																																			-	-		0.413	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC645515	protein_coding	OTTHUMT00000354994.1	C	NM_173653		144719428	-1	pseudogene	XR_017588	genbank	human	model	54_36p	rna	SNP	1	A
GFM1	85476	genome.wustl.edu	37	3	158369907	158369907	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr3:158369907A>G	ENST00000486715.1	+	6	1069	c.712A>G	c.(712-714)Att>Gtt	p.I238V	GFM1_ENST00000264263.5_Missense_Mutation_p.I257V|GFM1_ENST00000478576.1_Missense_Mutation_p.I238V	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1									p.I238V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			ATATGGTGAGATTCCAGCTGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	3											70.0	73.0	72.0					3																	158369907		2203	4300	6503	159852601	SO:0001583	missense	85476			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.712A>G	3.37:g.158369907A>G	ENSP00000419038:p.Ile238Val	Somatic		Capture	Illumina GAIIx	4	159852601		Missense_Mutation	SNP	-	p.I238V	ENST00000486715.1	37	c.712	CCDS33885.1	3	.	.	.	.	.	.	.	.	.	.	A	11.23	1.577680	0.28180	.	.	ENSG00000168827	ENST00000486715;ENST00000478576;ENST00000264263	T;T;T	0.74421	-0.84;-0.84;-0.84	5.63	4.47	0.54385	Protein synthesis factor, GTP-binding (1);	0.108124	0.64402	N	0.000007	T	0.65719	0.2718	L	0.37630	1.12	0.80722	D	1	B;B;B	0.31655	0.286;0.069;0.334	B;B;B	0.34093	0.175;0.173;0.173	T	0.64537	-0.6384	10	0.56958	D	0.05	-20.16	11.1404	0.48400	0.9272:0.0:0.0728:0.0	.	257;238;238	Q96RP9-2;Q96RP9;C9IZ01	.;EFGM_HUMAN;.	V	238;238;257	ENSP00000419038:I238V;ENSP00000418755:I238V;ENSP00000264263:I257V	ENSP00000264263:I257V	I	+	1	0	GFM1	159852601	1.000000	0.71417	0.678000	0.29963	0.552000	0.35366	5.789000	0.69029	0.973000	0.38340	0.533000	0.62120	ATT	-	NULL		0.383	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFM1	protein_coding	OTTHUMT00000352271.1	A	NM_024996		159852601	1	no_errors	NM_024996	genbank	human	reviewed	54_36p	missense	SNP	1	G
TMF1	7110	genome.wustl.edu	37	3	69082855	69082856	+	Splice_Site	DNP	TC	TC	GA			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	TC	TC	TC	GA	TC	TC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr3:69082855_69082856TC>GA	ENST00000398559.2	-	10	2461	c.2245_2245GA>TC	c.(2245-2247)GAag>TCaag	p.E749S	CTD-2013N24.2_ENST00000598783.1_RNA|TMF1_ENST00000543976.1_Splice_Site_p.E752S|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000599467.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000601511.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	749					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		TCCTGGAGTCTCTGAATCATGA	0.366																																																0			3																																								69165546	SO:0001630	splice_region_variant	7110				CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.2245_2245delinsGA	3.37:g.69082855_69082856delinsGA		Somatic		Capture	Illumina GAIIx	4	69165545	B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	DNP	-	p.Q749H	ENST00000398559.2	37	c.2245_2246	CCDS43105.1	3																																																																																			-	NULL		0.366	TMF1-001	KNOWN	basic|CCDS	protein_coding	TMF1	protein_coding	OTTHUMT00000352106.1	TC	NM_007114	Missense_Mutation	69165546	-1	no_errors	NM_007114	genbank	human	validated	54_36p	missense	DNP	1.000:1.000	GA
GBE1	2632	genome.wustl.edu	37	3	81754734	81754734	+	Silent	SNP	G	G	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr3:81754734G>A	ENST00000429644.2	-	2	817	c.174C>T	c.(172-174)aaC>aaT	p.N58N	GBE1_ENST00000489715.1_Silent_p.N17N	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	58					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.N58N(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		TTTCTCCAATGTTCTTCAAAA	0.343									Glycogen Storage Disease, type IV																																							1	Substitution - coding silent(1)	ovary(1)	3											41.0	37.0	38.0					3																	81754734		1824	4079	5903	81837424	SO:0001819	synonymous_variant	2632	Familial Cancer Database	Andersen Disease, Brancher deficiency		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.174C>T	3.37:g.81754734G>A		Somatic		Capture	Illumina GAIIx	4	81837424	B3KWV3|Q96EN0	Silent	SNP	HMMPfam_Isoamylase_N;HMMPfam_Alpha-amylase;HMMPfam_Alpha-amylase_C;superfamily_E set domains;superfamily_Glycosyl hydrolase domain;superfamily_(Trans)glycosidases	p.N58	ENST00000429644.2	37	c.174	CCDS54612.1	3																																																																																			-	NULL		0.343	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBE1	protein_coding	OTTHUMT00000352760.2	G			81837424	-1	no_errors	NM_000158	genbank	human	reviewed	54_36p	silent	SNP	0.76	A
ETV5	2119	genome.wustl.edu	37	3	185823097	185823097	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr3:185823097T>G	ENST00000306376.5	-	5	475	c.229A>C	c.(229-231)Aac>Cac	p.N77H	DGKG_ENST00000447054.1_5'Flank|ETV5_ENST00000434744.1_Missense_Mutation_p.N77H|ETV5_ENST00000537818.1_Missense_Mutation_p.N119H	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	77					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.N77H(1)		breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			TACTTACGGTTATCAGACTGA	0.343			T	"""TMPRSS2, SCL45A3"""	Prostate																																		Dom	yes		3	3q28	2119	ets variant gene 5		E	1	Substitution - Missense(1)	ovary(1)	3											111.0	112.0	111.0					3																	185823097		2203	4300	6503	187305791	SO:0001583	missense	2119			BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.229A>C	3.37:g.185823097T>G	ENSP00000306894:p.Asn77His	Somatic		Capture	Illumina GAIIx	4	187305791	A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	"HMMPfam_Ets;HMMPfam_ETS_PEA3_N;superfamily_""Winged helix"" DNA-binding domain"	p.N77H	ENST00000306376.5	37	c.229	CCDS33906.1	3	.	.	.	.	.	.	.	.	.	.	T	18.24	3.579309	0.65878	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818;ENST00000440773;ENST00000421809;ENST00000413301;ENST00000422039	T;T;T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75;1.75;1.75	5.6	5.6	0.85130	PEA3-type ETS-domain transcription factor, N-terminal (1);	3.669430	0.00698	N	0.000776	T	0.58921	0.2156	M	0.80183	2.485	0.35385	D	0.790236	D;D	0.65815	0.995;0.991	D;P	0.64410	0.925;0.852	T	0.23119	-1.0197	10	0.87932	D	0	.	13.6058	0.62046	0.0:0.0:0.0:1.0	.	77;119	P41161;B7Z7D7	ETV5_HUMAN;.	H	77;77;119;77;77;77;77	ENSP00000306894:N77H;ENSP00000413755:N77H;ENSP00000441737:N119H;ENSP00000389707:N77H;ENSP00000412171:N77H;ENSP00000405157:N77H;ENSP00000388737:N77H	ENSP00000306894:N77H	N	-	1	0	ETV5	187305791	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.324000	0.65863	2.248000	0.74166	0.460000	0.39030	AAC	-	HMMPfam_ETS_PEA3_N		0.343	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV5	protein_coding	OTTHUMT00000344947.1	T	NM_004454		187305791	-1	no_errors	NM_004454	genbank	human	validated	54_36p	missense	SNP	1	G
CXCL8	3576	genome.wustl.edu	37	4	74607289	74607289	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr4:74607289T>A	ENST00000307407.3	+	2	248	c.95T>A	c.(94-96)cTt>cAt	p.L32H	IL8_ENST00000401931.1_Missense_Mutation_p.L32H	NM_000584.3	NP_000575.1	P10145	IL8_HUMAN		32					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|chemotaxis (GO:0006935)|embryonic digestive tract development (GO:0048566)|endoplasmic reticulum unfolded protein response (GO:0030968)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of neutrophil chemotaxis (GO:0090023)|receptor internalization (GO:0031623)|regulation of cell adhesion (GO:0030155)|regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045091)|response to endoplasmic reticulum stress (GO:0034976)|response to molecule of bacterial origin (GO:0002237)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|interleukin-8 receptor binding (GO:0005153)	p.L32H(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	6	Breast(15;0.00102)		all cancers(17;0.00169)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)	LUSC - Lung squamous cell carcinoma(721;0.008)		GCTAAAGAACTTAGATGTCAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	4											95.0	91.0	92.0					4																	74607289		2203	4300	6503	74826153	SO:0001583	missense	3576																														ENST00000307407.3:c.95T>A	4.37:g.74607289T>A	ENSP00000306512:p.Leu32His	Somatic		Capture	Illumina GAIIx	4	74826153	B2R4L8|Q6FGF6|Q6LAE6|Q96RG6|Q9C077|Q9UCE1|Q9UCR8|Q9UCR9|Q9UCS0	Missense_Mutation	SNP	HMMPfam_IL8;superfamily_Interleukin 8-like chemokines	p.L32H	ENST00000307407.3	37	c.95	CCDS34005.1	4	.	.	.	.	.	.	.	.	.	.	T	14.24	2.476185	0.44044	.	.	ENSG00000169429	ENST00000307407;ENST00000401931	T;T	0.06068	3.48;3.35	4.96	4.96	0.65561	Chemokine interleukin-8-like domain (3);	0.181815	0.49916	D	0.000121	T	0.24084	0.0583	.	.	.	0.37634	D	0.921804	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.05419	-1.0886	9	0.87932	D	0	-11.8906	12.8714	0.57966	0.0:0.0:0.0:1.0	.	32;32	C9J4T6;P10145	.;IL8_HUMAN	H	32	ENSP00000306512:L32H;ENSP00000385908:L32H	ENSP00000306512:L32H	L	+	2	0	IL8	74826153	1.000000	0.71417	0.892000	0.35008	0.007000	0.05969	4.670000	0.61583	1.994000	0.58287	0.477000	0.44152	CTT	-	HMMPfam_IL8		0.433	IL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL8	protein_coding	OTTHUMT00000322211.1	T			74826153	1	no_errors	NM_000584	genbank	human	reviewed	54_36p	missense	SNP	0.99	A
GSTA1	2938	genome.wustl.edu	37	6	52657770	52657770	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr6:52657770C>G	ENST00000334575.5	-	6	585	c.430G>C	c.(430-432)Gga>Cga	p.G144R	GSTA1_ENST00000493331.1_5'UTR	NM_145740.3	NP_665683.1	P08263	GSTA1_HUMAN	glutathione S-transferase alpha 1	144	GST C-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|metabolic process (GO:0008152)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)	p.G144R(1)		large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	12	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Glutathione(DB00143)	TAGTCTTGTCCATGGCTCTTT	0.527																																																1	Substitution - Missense(1)	ovary(1)	6											167.0	150.0	156.0					6																	52657770		2203	4300	6503	52765729	SO:0001583	missense	2938				CCDS4945.1	6p12.2	2012-06-21	2008-11-26		ENSG00000243955	ENSG00000243955	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4626	protein-coding gene	gene with protein product		138359	"""glutathione S-transferase A1"""			9503014	Standard	NM_145740		Approved		uc003paz.3	P08263	OTTHUMG00000014861	ENST00000334575.5:c.430G>C	6.37:g.52657770C>G	ENSP00000335620:p.Gly144Arg	Somatic		Capture	Illumina GAIIx	4	52765729	Q14750|Q5GHF8|Q5SZC1	Missense_Mutation	SNP	HMMPfam_GST_N;HMMPfam_GST_C;superfamily_Glutathione S-transferase (GST) C-terminal domain;superfamily_Thioredoxin-like	p.G144R	ENST00000334575.5	37	c.430	CCDS4945.1	6	.	.	.	.	.	.	.	.	.	.	c	7.418	0.636184	0.14386	.	.	ENSG00000243955	ENST00000334575	T	0.14640	2.49	2.43	2.43	0.29744	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.146450	0.44285	D	0.000475	T	0.11623	0.0283	M	0.79343	2.45	0.32660	N	0.518186	B	0.26258	0.145	B	0.36418	0.224	T	0.05305	-1.0893	10	0.56958	D	0.05	.	12.6198	0.56597	0.0:1.0:0.0:0.0	.	144	P08263	GSTA1_HUMAN	R	144	ENSP00000335620:G144R	ENSP00000335620:G144R	G	-	1	0	GSTA1	52765729	0.086000	0.21541	0.872000	0.34217	0.124000	0.20399	2.862000	0.48388	1.043000	0.40175	0.195000	0.17529	GGA	-	HMMPfam_GST_C		0.527	GSTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTA1	protein_coding	OTTHUMT00000040922.1	C			52765729	-1	no_errors	NM_145740	genbank	human	reviewed	54_36p	missense	SNP	1	G
COL21A1	81578	genome.wustl.edu	37	6	56035888	56035888	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr6:56035888C>T	ENST00000244728.5	-	4	1076	c.679G>A	c.(679-681)Gat>Aat	p.D227N	COL21A1_ENST00000535941.1_Missense_Mutation_p.D227N|COL21A1_ENST00000370819.1_Missense_Mutation_p.D227N	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	227					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.D227N(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			CCCCTTTCATCACGAGCTGCC	0.308																																																1	Substitution - Missense(1)	ovary(1)	6											91.0	84.0	86.0					6																	56035888		1832	4081	5913	56143847	SO:0001583	missense	81578			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.679G>A	6.37:g.56035888C>T	ENSP00000244728:p.Asp227Asn	Somatic		Capture	Illumina GAIIx	4	56143847	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	-	p.D227N	ENST00000244728.5	37	c.679	CCDS55025.1	6	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536901	0.65085	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811	D;D;D	0.89875	-2.58;-2.53;-2.58	4.17	4.17	0.49024	.	0.000000	0.52532	U	0.000068	D	0.92140	0.7508	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.989	D	0.91487	0.5209	10	0.39692	T	0.17	.	16.8146	0.85730	0.0:1.0:0.0:0.0	.	227;227	Q96P44-3;Q96P44	.;COLA1_HUMAN	N	227	ENSP00000244728:D227N;ENSP00000359855:D227N;ENSP00000444384:D227N	ENSP00000244728:D227N	D	-	1	0	COL21A1	56143847	1.000000	0.71417	0.996000	0.52242	0.974000	0.67602	7.235000	0.78143	2.024000	0.59613	0.585000	0.79938	GAT	-	NULL		0.308	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	COL21A1	protein_coding	OTTHUMT00000041004.2	C			56143847	-1	no_errors	NM_030820	genbank	human	reviewed	54_36p	missense	SNP	1	T
DST	667	genome.wustl.edu	37	6	56506838	56506838	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr6:56506838A>G	ENST00000361203.3	-	13	1308	c.1301T>C	c.(1300-1302)aTa>aCa	p.I434T	DST_ENST00000370769.4_Missense_Mutation_p.I434T|DST_ENST00000370788.2_Missense_Mutation_p.I434T|DST_ENST00000244364.6_Missense_Mutation_p.I108T|DST_ENST00000446842.2_Missense_Mutation_p.I108T|DST_ENST00000312431.6_Missense_Mutation_p.I434T|DST_ENST00000370765.6_Missense_Mutation_p.I108T|DST_ENST00000421834.2_Missense_Mutation_p.I434T|DST_ENST00000370754.5_Missense_Mutation_p.I612T|DST_ENST00000518935.1_Missense_Mutation_p.I108T			Q03001	DYST_HUMAN	dystonin	434					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.I612T(1)|p.I108T(1)|p.I434T(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACATTCAAGTATATACCCAGC	0.348																																																3	Substitution - Missense(3)	ovary(3)	6											113.0	107.0	109.0					6																	56506838		2203	4299	6502	56614797	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.1301T>C	6.37:g.56506838A>G	ENSP00000354508:p.Ile434Thr	Somatic		Capture	Illumina GAIIx	4	56614797	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	-	p.I434T	ENST00000361203.3	37	c.1301		6	.	.	.	.	.	.	.	.	.	.	A	21.7	4.183012	0.78677	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935;ENST00000449297	D;D;D;D;D;D;D;D;D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24	5.3	5.3	0.74995	.	0.124307	0.35349	N	0.003264	D	0.93559	0.7944	L	0.38175	1.15	0.28672	N	0.905586	B;B;D;B;P;P;D;D;B;B	0.69078	0.361;0.037;0.993;0.089;0.949;0.611;0.995;0.997;0.037;0.372	B;B;D;B;P;B;P;D;B;B	0.72338	0.068;0.016;0.977;0.016;0.496;0.205;0.885;0.945;0.016;0.137	D	0.95023	0.8162	9	0.87932	D	0	.	15.4071	0.74887	1.0:0.0:0.0:0.0	.	463;434;434;612;550;108;108;108;434;108	B4DGY0;Q5TBT1;E7ERU2;E9PEB9;Q03001-13;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;.;.;DYST_HUMAN;.	T	108;612;434;434;108;434;434;434;108;474;108;108;612	ENSP00000244364:I108T;ENSP00000359790:I612T;ENSP00000359805:I434T;ENSP00000400883:I434T;ENSP00000393645:I108T;ENSP00000307959:I434T;ENSP00000359824:I434T;ENSP00000354508:I434T;ENSP00000404924:I108T;ENSP00000431030:I474T;ENSP00000359801:I108T;ENSP00000431003:I108T;ENSP00000393082:I612T	ENSP00000244364:I108T	I	-	2	0	DST	56614797	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	8.761000	0.91691	2.222000	0.72286	0.477000	0.44152	ATA	-	NULL		0.348	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	A	NM_001723		56614797	-1	no_errors	NM_183380	genbank	human	reviewed	54_36p	missense	SNP	1	G
COL12A1	1303	genome.wustl.edu	37	6	75892996	75892996	+	Nonsense_Mutation	SNP	G	G	C			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr6:75892996G>C	ENST00000322507.8	-	10	1970	c.1661C>G	c.(1660-1662)tCa>tGa	p.S554*	COL12A1_ENST00000483888.2_Nonsense_Mutation_p.S554*|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Nonsense_Mutation_p.S554*	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	554	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.S554*(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GAAAGCATCTGATGATTTCCC	0.408																																																1	Substitution - Nonsense(1)	ovary(1)	6											177.0	166.0	170.0					6																	75892996		1909	4133	6042	75949716	SO:0001587	stop_gained	1303			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1661C>G	6.37:g.75892996G>C	ENSP00000325146:p.Ser554*	Somatic		Capture	Illumina GAIIx	4	75949716	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Nonsense_Mutation	SNP	-	p.S554*	ENST00000322507.8	37	c.1661	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.448243	0.97577	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	.	.	.	5.56	5.56	0.83823	.	0.000000	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.8835	0.96906	0.0:0.0:1.0:0.0	.	.	.	.	X	554	.	ENSP00000325146:S554X	S	-	2	0	COL12A1	75949716	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	7.809000	0.86057	2.777000	0.95525	0.655000	0.94253	TCA	-	NULL		0.408	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	protein_coding	OTTHUMT00000041249.3	G	NM_004370		75949716	-1	no_errors	NM_004370	genbank	human	reviewed	54_36p	nonsense	SNP	1	C
KLHL32	114792	genome.wustl.edu	37	6	97587058	97587058	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr6:97587058C>T	ENST00000369261.4	+	11	2126	c.1763C>T	c.(1762-1764)gCt>gTt	p.A588V	KLHL32_ENST00000536676.1_Missense_Mutation_p.A552V|KLHL32_ENST00000544166.1_Missense_Mutation_p.A144V|KLHL32_ENST00000539200.1_Missense_Mutation_p.A519V	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	588								p.A588V(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		CTCCCTTTTGCTTCCAATGGA	0.433																																																1	Substitution - Missense(1)	ovary(1)	6											218.0	182.0	194.0					6																	97587058		2203	4300	6503	97693779	SO:0001583	missense	114792			AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.1763C>T	6.37:g.97587058C>T	ENSP00000358265:p.Ala588Val	Somatic		Capture	Illumina GAIIx	4	97693779	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	-	p.A588V	ENST00000369261.4	37	c.1763	CCDS5038.1	6	.	.	.	.	.	.	.	.	.	.	C	34	5.299724	0.95574	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000544166;ENST00000539200	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.84	5.84	0.93424	Kelch-type beta propeller (1);	0.126462	0.52532	D	0.000069	T	0.80308	0.4599	M	0.77616	2.38	0.80722	D	1	D;D;P;D	0.63880	0.967;0.993;0.558;0.993	P;D;B;D	0.68192	0.637;0.956;0.211;0.935	T	0.80331	-0.1427	10	0.59425	D	0.04	.	20.1346	0.98019	0.0:1.0:0.0:0.0	.	519;552;588;144	B7Z4E2;B7Z346;Q96NJ5;Q8IXH0	.;.;KLH32_HUMAN;.	V	588;552;144;519	ENSP00000358265:A588V;ENSP00000440382:A552V;ENSP00000445453:A144V;ENSP00000441527:A519V	ENSP00000358265:A588V	A	+	2	0	KLHL32	97693779	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.429000	0.80309	2.765000	0.95021	0.655000	0.94253	GCT	-	NULL		0.433	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL32	protein_coding	OTTHUMT00000041570.1	C	NM_052904		97693779	1	no_errors	NM_052904	genbank	human	validated	54_36p	missense	SNP	1	T
DDC	1644	genome.wustl.edu	37	7	50611607	50611607	+	Missense_Mutation	SNP	G	G	T	rs375406710		TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr7:50611607G>T	ENST00000444124.2	-	2	377	c.177C>A	c.(175-177)gaC>gaA	p.D59E	DDC_ENST00000431062.1_Missense_Mutation_p.D59E|DDC_ENST00000380984.4_Missense_Mutation_p.D59E|AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000426377.1_Missense_Mutation_p.D59E|DDC_ENST00000357936.5_Missense_Mutation_p.D59E	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	59	2 X approximate tandem repeats.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)	p.D59E(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	TCTTCTCAACGTCGTTGATGA	0.557																																																1	Substitution - Missense(1)	ovary(1)	7											127.0	119.0	122.0					7																	50611607		2203	4300	6503	50579101	SO:0001583	missense	1644				CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.177C>A	7.37:g.50611607G>T	ENSP00000403644:p.Asp59Glu	Somatic		Capture	Illumina GAIIx	4	50579101	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	HMMPfam_Pyridoxal_deC;superfamily_PLP-dependent transferases	p.D59E	ENST00000444124.2	37	c.177	CCDS5511.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.42|13.42	2.231920|2.231920	0.39399|0.39399	.|.	.|.	ENSG00000132437|ENSG00000132437	ENST00000357936;ENST00000431062;ENST00000426377;ENST00000444124;ENST00000380984|ENST00000430300	T;T;T;T;T|.	0.54071|.	0.59;1.19;0.59;0.59;0.59|.	5.92|5.92	-2.97|-2.97	0.05530|0.05530	Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74801|0.74801	0.3764|0.3764	M|M	0.84683|0.84683	2.71|2.71	0.36975|0.36975	D|D	0.894027|0.894027	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.998|.	T|T	0.79381|0.79381	-0.1827|-0.1827	10|5	0.87932|.	D|.	0|.	-16.2905|-16.2905	15.4951|15.4951	0.75643|0.75643	0.6538:0.0:0.3462:0.0|0.6538:0.0:0.3462:0.0	.|.	59;59|.	Q53Y41;P20711|.	.;DDC_HUMAN|.	E|K	59|25	ENSP00000350616:D59E;ENSP00000399184:D59E;ENSP00000395069:D59E;ENSP00000403644:D59E;ENSP00000370371:D59E|.	ENSP00000350616:D59E|.	D|T	-|-	3|2	2|0	DDC|DDC	50579101|50579101	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.052000|0.052000	0.14988|0.14988	-0.704000|-0.704000	0.05058|0.05058	-0.668000|-0.668000	0.05296|0.05296	-0.713000|-0.713000	0.03633|0.03633	GAC|ACG	-	HMMPfam_Pyridoxal_deC		0.557	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DDC	protein_coding	OTTHUMT00000342593.1	G			50579101	-1	no_errors	NM_000790	genbank	human	reviewed	54_36p	missense	SNP	0.04	T
EPHX2	2053	genome.wustl.edu	37	8	27369405	27369405	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr8:27369405G>C	ENST00000521400.1	+	6	1143	c.713G>C	c.(712-714)aGc>aCc	p.S238T	EPHX2_ENST00000517536.1_Intron|EPHX2_ENST00000518379.1_Missense_Mutation_p.S238T|EPHX2_ENST00000380476.3_Missense_Mutation_p.S185T|EPHX2_ENST00000521780.1_Missense_Mutation_p.S172T	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	238	Epoxide hydrolase.				arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)	p.S238T(1)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		AGTGACATGAGCCATGGGTAC	0.532																																																1	Substitution - Missense(1)	ovary(1)	8											225.0	196.0	206.0					8																	27369405		2203	4300	6503	27425322	SO:0001583	missense	2053			L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.713G>C	8.37:g.27369405G>C	ENSP00000430269:p.Ser238Thr	Somatic		Capture	Illumina GAIIx	4	27425322	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Missense_Mutation	SNP	HMMPfam_Abhydrolase_1;HMMPfam_Hydrolase;superfamily_alpha/beta-Hydrolases;superfamily_HAD-like	p.S238T	ENST00000521400.1	37	c.713	CCDS6060.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.65|10.65	1.411080|1.411080	0.25465|0.25465	.|.	.|.	ENSG00000120915|ENSG00000120915	ENST00000521684|ENST00000521400;ENST00000521780;ENST00000380476;ENST00000415449;ENST00000518379	.|T;T;T;T	.|0.05513	.|3.83;3.83;3.83;3.43	4.76|4.76	1.7|1.7	0.24286|0.24286	.|.	.|0.554181	.|0.21454	.|N	.|0.074298	T|T	0.03178|0.03178	0.0093|0.0093	N|N	0.05158|0.05158	-0.105|-0.105	0.40317|0.40317	D|D	0.978785|0.978785	.|B;B;B	.|0.11235	.|0.004;0.002;0.004	.|B;B;B	.|0.11329	.|0.006;0.002;0.003	T|T	0.46665|0.46665	-0.9175|-0.9175	5|10	.|0.16420	.|T	.|0.52	-0.0011|-0.0011	12.095|12.095	0.53750|0.53750	0.0:0.5637:0.4363:0.0|0.0:0.5637:0.4363:0.0	.|.	.|238;238;238	.|E5RFU2;E7ETW9;P34913	.|.;.;HYES_HUMAN	P|T	197|238;172;185;242;238	.|ENSP00000430269:S238T;ENSP00000430302:S172T;ENSP00000369843:S185T;ENSP00000427956:S238T	.|ENSP00000369843:S185T	A|S	+|+	1|2	0|0	EPHX2|EPHX2	27425322|27425322	1.000000|1.000000	0.71417|0.71417	0.931000|0.931000	0.37212|0.37212	0.259000|0.259000	0.26198|0.26198	0.636000|0.636000	0.24644|0.24644	0.571000|0.571000	0.29365|0.29365	0.561000|0.561000	0.74099|0.74099	GCC|AGC	-	NULL		0.532	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX2	protein_coding	OTTHUMT00000219954.4	G			27425322	1	no_errors	NM_001979	genbank	human	reviewed	54_36p	missense	SNP	0.21	C
TRPA1	8989	genome.wustl.edu	37	8	72981273	72981273	+	Silent	SNP	A	A	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr8:72981273A>G	ENST00000262209.4	-	3	636	c.429T>C	c.(427-429)aaT>aaC	p.N143N		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	143					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.N143N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TCACCTCATTATTCATGCCCT	0.527																																																1	Substitution - coding silent(1)	ovary(1)	8											219.0	230.0	227.0					8																	72981273		2203	4300	6503	73143827	SO:0001819	synonymous_variant	8989			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.429T>C	8.37:g.72981273A>G		Somatic		Capture	Illumina GAIIx	4	73143827	A6NIN6	Silent	SNP	-	p.N143	ENST00000262209.4	37	c.429	CCDS34908.1	8																																																																																			-	NULL		0.527	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	protein_coding	OTTHUMT00000379079.2	A	NM_007332		73143827	-1	no_errors	NM_007332	genbank	human	reviewed	54_36p	silent	SNP	0.08	G
CNGB3	54714	genome.wustl.edu	37	8	87660106	87660106	+	Missense_Mutation	SNP	C	C	T	rs144637286	byFrequency	TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr8:87660106C>T	ENST00000320005.5	-	8	960	c.913G>A	c.(913-915)Gca>Aca	p.A305T		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	305					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.A305T(1)		NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						ATTATTGATGCGACATCCAAC	0.333																																																1	Substitution - Missense(1)	ovary(1)	8						C	THR/ALA	2,4404	4.2+/-10.8	0,2,2201	115.0	108.0	110.0		913	3.1	0.3	8	dbSNP_134	110	10,8588	7.7+/-29.5	0,10,4289	yes	missense	CNGB3	NM_019098.4	58	0,12,6490	TT,TC,CC		0.1163,0.0454,0.0923	possibly-damaging	305/810	87660106	12,12992	2203	4299	6502	87729222	SO:0001583	missense	54714			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.913G>A	8.37:g.87660106C>T	ENSP00000316605:p.Ala305Thr	Somatic		Capture	Illumina GAIIx	4	87729222	C9JA51|Q9NRE9	Missense_Mutation	SNP	HMMPfam_cNMP_binding;superfamily_cAMP-binding domain-like;HMMPfam_Ion_trans;superfamily_Voltage-gated potassium channels	p.A305T	ENST00000320005.5	37	c.913	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	C	14.01	2.408837	0.42715	4.54E-4	0.001163	ENSG00000170289	ENST00000320005	T	0.52983	0.64	5.93	3.07	0.35406	.	0.538057	0.19050	N	0.124067	T	0.48572	0.1507	L	0.58101	1.795	0.09310	N	1	P;P	0.51147	0.928;0.942	P;P	0.51777	0.551;0.679	T	0.42832	-0.9428	10	0.62326	D	0.03	.	3.4677	0.07555	0.2142:0.4616:0.2088:0.1154	.	305;305	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	T	305	ENSP00000316605:A305T	ENSP00000316605:A305T	A	-	1	0	CNGB3	87729222	0.000000	0.05858	0.258000	0.24420	0.360000	0.29518	-0.308000	0.08156	0.792000	0.33850	0.591000	0.81541	GCA	-	HMMPfam_Ion_trans		0.333	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	protein_coding	OTTHUMT00000375107.1	C	NM_019098		87729222	-1	no_errors	NM_019098	genbank	human	validated	54_36p	missense	SNP	0.02	T
HAS2	3037	genome.wustl.edu	37	8	122641138	122641138	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr8:122641138C>T	ENST00000303924.4	-	2	980	c.443G>A	c.(442-444)tGg>tAg	p.W148*		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	148					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)	p.W148*(1)	HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			GTTGTTCTTCCAGATATAAGT	0.433																																																1	Substitution - Nonsense(1)	ovary(1)	8											283.0	253.0	263.0					8																	122641138		2203	4300	6503	122710319	SO:0001587	stop_gained	3037			U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.443G>A	8.37:g.122641138C>T	ENSP00000306991:p.Trp148*	Somatic		Capture	Illumina GAIIx	4	122710319	Q32MM3	Nonsense_Mutation	SNP	HMMPfam_Glycos_transf_2;superfamily_Nucleotide-diphospho-sugar transferases	p.W148*	ENST00000303924.4	37	c.443	CCDS6335.1	8	.	.	.	.	.	.	.	.	.	.	C	42	9.380782	0.99155	.	.	ENSG00000170961	ENST00000303924;ENST00000443194	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7255	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	148	.	ENSP00000306991:W148X	W	-	2	0	HAS2	122710319	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	7.772000	0.85439	2.941000	0.99782	0.655000	0.94253	TGG	-	NULL		0.433	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS2	protein_coding	OTTHUMT00000381150.2	C	NM_005328		122710319	-1	no_errors	NM_005328	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
ADGRF5P2	441416	genome.wustl.edu	37	9	44174373	44174373	+	IGR	SNP	G	G	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr9:44174373G>T								RNU6-599P (66454 upstream) : RP11-175I6.5 (82206 downstream)																							GGAACACAAGGTTGGTCCCTG	0.488																																																0			9																																								44114369	SO:0001628	intergenic_variant	441416																															9.37:g.44174373G>T		Somatic		Capture	Illumina GAIIx	4	44114369		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.488					LOC441416			G			44114369	-1	pseudogene	XR_016304	genbank	human	model	54_36p	rna	SNP		T
TBC1D2	55357	genome.wustl.edu	37	9	100965682	100965682	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chr9:100965682G>T	ENST00000375064.1	-	10	2197	c.2159C>A	c.(2158-2160)gCc>gAc	p.A720D	TBC1D2_ENST00000342112.5_Missense_Mutation_p.A502D|TBC1D2_ENST00000375066.5_Missense_Mutation_p.A720D|TBC1D2_ENST00000375063.1_Missense_Mutation_p.A260D	NM_001267571.1	NP_001254500.1	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	720	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)	p.A720D(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		CAGGGCAATGGCCGCCAGCCT	0.617																																																1	Substitution - Missense(1)	ovary(1)	9											96.0	88.0	91.0					9																	100965682		2203	4300	6503	100005503	SO:0001583	missense	55357			AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375064.1:c.2159C>A	9.37:g.100965682G>T	ENSP00000364205:p.Ala720Asp	Somatic		Capture	Illumina GAIIx	4	100005503	B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Missense_Mutation	SNP	-	p.A720D	ENST00000375064.1	37	c.2159		9	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363406	0.82353	.	.	ENSG00000095383	ENST00000375064;ENST00000375066;ENST00000342112;ENST00000375063	T;T;T;T	0.30182	2.33;2.33;2.33;1.54	5.35	5.35	0.76521	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.73628	0.3611	H	0.98738	4.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.85413	0.1138	10	0.87932	D	0	.	17.8634	0.88789	0.0:0.0:1.0:0.0	.	720;720	Q9BYX2;Q9BYX2-2	TBD2A_HUMAN;.	D	720;720;502;260	ENSP00000364205:A720D;ENSP00000364207:A720D;ENSP00000341567:A502D;ENSP00000364203:A260D	ENSP00000341567:A502D	A	-	2	0	TBC1D2	100005503	1.000000	0.71417	0.995000	0.50966	0.503000	0.33858	9.869000	0.99810	2.503000	0.84419	0.655000	0.94253	GCC	-	NULL		0.617	TBC1D2-001	KNOWN	basic|appris_principal	protein_coding	TBC1D2	protein_coding	OTTHUMT00000053366.1	G	NM_018421		100005503	-1	no_errors	NM_018421	genbank	human	validated	54_36p	missense	SNP	1	T
CSF2RA	1438	genome.wustl.edu	37	X	1419504	1419504	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chrX:1419504G>T	ENST00000381524.3	+	10	1117	c.931G>T	c.(931-933)Gaa>Taa	p.E311*	CSF2RA_ENST00000355432.3_Nonsense_Mutation_p.E311*|CSF2RA_ENST00000381500.1_Nonsense_Mutation_p.E311*|CSF2RA_ENST00000498153.1_3'UTR|CSF2RA_ENST00000417535.2_Nonsense_Mutation_p.E311*|CSF2RA_ENST00000432318.2_Nonsense_Mutation_p.E311*|CSF2RA_ENST00000361536.3_Nonsense_Mutation_p.E311*|CSF2RA_ENST00000381509.3_Nonsense_Mutation_p.E311*|CSF2RA_ENST00000381529.3_Nonsense_Mutation_p.E311*|CSF2RA_ENST00000501036.2_Nonsense_Mutation_p.E178*|RNA5SP498_ENST00000411342.1_RNA|CSF2RA_ENST00000355805.2_Intron|CSF2RA_ENST00000494969.2_Intron			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	311	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.E311*(1)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	CTCCTGGAGTGAAGCCATTGA	0.537																																					Esophageal Squamous(131;723 1707 25334 40494 41806)											1	Substitution - Nonsense(1)	ovary(1)	X											127.0	115.0	119.0					X																	1419504		2203	4296	6499	1379504	SO:0001587	stop_gained	1438			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.931G>T	X.37:g.1419504G>T	ENSP00000370935:p.Glu311*	Somatic		Capture	Illumina GAIIx	4	1379504	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Nonsense_Mutation	SNP	superfamily_Fibronectin type III	p.E311*	ENST00000381524.3	37	c.931	CCDS35191.1	X	.	.	.	.	.	.	.	.	.	.	.	14.41	2.528359	0.44969	.	.	ENSG00000198223	ENST00000381529;ENST00000432318;ENST00000361536;ENST00000501036;ENST00000381524;ENST00000381509;ENST00000355432;ENST00000417535;ENST00000381500	.	.	.	0.798	-0.595	0.11660	.	0.415366	0.17164	U	0.184576	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	4.8924	0.13733	0.0:0.4475:0.5525:0.0	.	.	.	.	X	311;311;311;178;311;311;311;311;311	.	ENSP00000347606:E311X	E	+	1	0	CSF2RA	1379504	0.059000	0.20769	0.004000	0.12327	0.015000	0.08874	-0.266000	0.08631	-0.221000	0.09973	0.100000	0.15512	GAA	-	NULL		0.537	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CSF2RA	protein_coding	OTTHUMT00000035013.2	G			1379504	1	no_errors	NM_006140	genbank	human	reviewed	54_36p	nonsense	SNP		T
STAG2	10735	genome.wustl.edu	37	X	123184055	123184055	+	Silent	SNP	C	C	A			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chrX:123184055C>A	ENST00000371160.1	+	11	1203	c.913C>A	c.(913-915)Cga>Aga	p.R305R	STAG2_ENST00000371145.3_Silent_p.R305R|STAG2_ENST00000354548.5_Silent_p.R236R|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Silent_p.R305R|STAG2_ENST00000371157.3_Silent_p.R305R|STAG2_ENST00000371144.3_Silent_p.R305R	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	305	SCD. {ECO:0000255|PROSITE- ProRule:PRU00750}.				meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.R305R(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						AGCTGAAATTCGAGCTATTTG	0.358																																																1	Substitution - coding silent(1)	ovary(1)	X											232.0	196.0	209.0					X																	123184055		2203	4300	6503	123011736	SO:0001819	synonymous_variant	10735			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.913C>A	X.37:g.123184055C>A		Somatic		Capture	Illumina GAIIx	4	123011736	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Silent	SNP	-	p.R305	ENST00000371160.1	37	c.913	CCDS14607.1	X																																																																																			-	NULL		0.358	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAG2	protein_coding	OTTHUMT00000156159.2	C	NM_006603		123011736	1	no_errors	NM_001042749	genbank	human	validated	54_36p	silent	SNP	0.99	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	G	G	G	T	G	G	Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chrUnknown:0G>T								None (None upstream) : None (None downstream)																								0.0																																																0			X																																								148576685	SO:0001628	intergenic_variant	4110																															Unknown.37:g.0G>T		Somatic		Capture	Illumina GAIIx	4	148576685		Missense_Mutation	SNP	HMMPfam_MAGE	p.L192I		37	c.574		X																																																																																			-	NULL	0	0					MAGEA11			G			148576685	-1	no_errors	NM_005366	genbank	human	reviewed	54_36p	missense	SNP		T
ZFX	7543	genome.wustl.edu	37	X	24226335	24226335	+	Splice_Site	SNP	A	A	G			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chrX:24226335A>G	ENST00000379177.1	+	9	1368	c.941A>G	c.(940-942)aAt>aGt	p.N314S	ZFX_ENST00000304543.5_Splice_Site_p.N314S|ZFX_ENST00000338565.3_Splice_Site_p.N264S|ZFX_ENST00000459724.1_Intron|ZFX_ENST00000539115.1_Splice_Site_p.N85S|ZFX_ENST00000379188.3_Splice_Site_p.N314S|ZFX_ENST00000540034.1_Splice_Site_p.N353S	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	314					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)	p.N314S(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						TTCTACTTAGATGTTGCTGAA	0.443																																					Esophageal Squamous(20;306 562 7346 32868 37983)											1	Substitution - Missense(1)	ovary(1)	X											48.0	47.0	47.0					X																	24226335		2203	4300	6503	24136256	SO:0001630	splice_region_variant	7543				CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.941-1A>G	X.37:g.24226335A>G		Somatic		Capture	Illumina GAIIx	4	24136256	B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	-	p.N314S	ENST00000379177.1	37	c.941	CCDS14211.1	X	.	.	.	.	.	.	.	.	.	.	A	8.029	0.761437	0.15914	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000535562;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565;ENST00000545937	T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82	5.53	4.37	0.52481	Transcriptional activator, Zfx / Zfy domain (1);	0.153170	0.45126	D	0.000388	T	0.28067	0.0692	N	0.14661	0.345	0.39123	D	0.961691	B;B;B;B	0.19445	0.008;0.0;0.0;0.036	B;B;B;B	0.19666	0.011;0.004;0.005;0.026	T	0.13098	-1.0522	9	.	.	.	.	10.1865	0.43000	0.9212:0.0:0.0788:0.0	.	353;83;314;318	B9EG97;F5GYV7;P17010;Q59EB9	.;.;ZFX_HUMAN;.	S	85;314;83;314;314;353;264;109	ENSP00000438233:N85S;ENSP00000368486:N314S;ENSP00000368475:N314S;ENSP00000304985:N314S;ENSP00000441382:N353S;ENSP00000343384:N264S	.	N	+	2	0	ZFX	24136256	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.073000	0.57570	1.959000	0.56917	0.486000	0.48141	AAT	-	NULL		0.443	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFX	protein_coding	OTTHUMT00000056084.1	A	NM_003410	Missense_Mutation	24136256	1	no_errors	NM_003410	genbank	human	validated	54_36p	missense	SNP	1	G
SMC1A	8243	genome.wustl.edu	37	X	53432459	53432459	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1563-01A-01W-0553-09	TCGA-24-1563-10A-01W-0553-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b6c46b53-f94d-4936-9005-518c8f1c1449	45220598-26dc-4163-bb30-1aa5662006e1	g.chrX:53432459C>T	ENST00000322213.4	-	11	2004	c.1877G>A	c.(1876-1878)cGc>cAc	p.R626H	SMC1A_ENST00000375340.6_Missense_Mutation_p.R392H	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	626	Flexible hinge.				DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.R626H(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						GGCAATGCGGCGGGCATCTTC	0.532																																																1	Substitution - Missense(1)	ovary(1)	X											50.0	45.0	47.0					X																	53432459		2203	4300	6503	53449184	SO:0001583	missense	8243			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.1877G>A	X.37:g.53432459C>T	ENSP00000323421:p.Arg626His	Somatic		Capture	Illumina GAIIx	4	53449184	O14995|Q16351|Q2M228	Missense_Mutation	SNP	HMMPfam_SMC_N;HMMPfam_SMC_hinge;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Smc hinge domain	p.R626H	ENST00000322213.4	37	c.1877	CCDS14352.1	X	.	.	.	.	.	.	.	.	.	.	C	29.8	5.038522	0.93630	.	.	ENSG00000072501	ENST00000322213;ENST00000375340	D;D	0.86497	-2.13;-2.13	5.55	5.55	0.83447	SMCs flexible hinge (3);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.94712	0.8294	M	0.90650	3.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.987;0.983	D	0.95461	0.8543	10	0.72032	D	0.01	.	17.4486	0.87586	0.0:1.0:0.0:0.0	.	392;604;626	B7Z709;Q6MZR8;Q14683	.;.;SMC1A_HUMAN	H	626;392	ENSP00000323421:R626H;ENSP00000364489:R392H	ENSP00000323421:R626H	R	-	2	0	SMC1A	53449184	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.791000	0.69045	2.476000	0.83614	0.600000	0.82982	CGC	-	HMMPfam_SMC_N:HMMPfam_SMC_hinge		0.532	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	protein_coding	OTTHUMT00000056756.2	C	NM_006306		53449184	-1	no_errors	NM_006306	genbank	human	reviewed	54_36p	missense	SNP	1	T
